WO2006044842A2

WO2006044842A2 - Pancreatic islet beta-cell-like macrophages and methods to produce them

Info

Publication number: WO2006044842A2
Application number: PCT/US2005/037341
Authority: WO
Inventors: Eliezer Huberman; Yong Zhao
Original assignee: The University Of Chicago
Priority date: 2004-10-18
Filing date: 2005-10-13
Publication date: 2006-04-27
Also published as: US20050260158A1; WO2006044842A3

Abstract

Monocyte derived adult stem cells (MDSCs) isolated from peripheral blood of mammals are provided, along with pharmaceutical compositions containing an MDSC, kits containing a pharmaceutical composition, and methods of preparing, propagating and using MDSCs or differentiated derivatives thereof. The uses of these biological materials include methods of treating disorders or diseases, as well as methods of ameliorating a symptom associated with any such disorder or disease, including disorders or diseases associated with aberrant function or presence (i.e., level) of pancreatic islet β-cell-like macrophages.

Description

HUMAN STEM CELL MATERIALS AND METHODS

GOVERNMENT INTEREST

[0001] The U.S. government owns rights in the invention pursuant to National Cancer Institute grant number 1 ROl CA 80826-01.

TECHNICAL FIELD

[0002] The invention generally relates to materials and methods of isolating, preparing, and using adult stem cells derived from a subset of cultured peripheral blood monocytes.

BACKGROUND

[0003] Pluripotent stem cells are a valuable resource for research, drug discovery and therapeutic treatments, including transplantation (Lovell-Badge, Nature, 414:88-91 (2001); Donovan et al., Nature, 414, 92-97 (2001); Griffith et al., Science, 295:1009-1014 (2002); Weissman, N. Engl. J. Med., 346:1576-1579 (2002)). These cells, or their mature progeny, can be used to study signaling events that regulate differentiation processes, identify and test drugs for lineage-specific beneficial or cytotoxic effects, or replace tissues damaged by disease or an environmental impact. The current state of pluripotent stem cell biology and the medicinal outlook, however, are not without drawbacks or free from controversy.

[0004] The use of pluripotent stem cells from fetuses, umbilical cords or embryonic tissues derived from in vitro fertilized eggs raises ethical and legal questions in the case of human materials, poses a risk of transmitting infections and/or may be ineffective because of immune rejection. In particular, embryonic stem cells have a number of disadvantages. For example, embryonic stem cells may pass through several intermediate stages before becoming the cell type needed to treat a particular disease. In addition, embryonic stem cells may be rejected by the recipient's immune system since it is possible that the immune profile of the specialized cells would differ from that of the recipient. [0005] One way to circumvent these problems is by exploiting autologous stem cells, preferably from an easily accessible tissue such as peripheral blood. In this context, it has been reported that bone marrow contains cells that appear to have the ability to trans-differentiate into mature cells belonging to cell lineages other than those of the blood (Laggase et al., Nature Med., 6:1229-1234 (2000); Orlic et al., Nature, 410:640-641 (2001); Korbling, et al. N. Engl. J. Med., 346:738-746 (2002)). However, recent studies have questioned the existence of such a trans-differentiation and raised the possibility that the emerging mature cells result from fusion of stem cells with resident tissue cells (Terada, et al., Nature, 416,:542-545 (2002); Ying et al., Nature, 416:545-548 (2002)). A further consideration is that obtaining samples from bone marrow is often a painful and cumbersome procedure.

[0006] In a separate study, Jiang et al. observed that a cell within mesenchymal cell cultures derived from the bone marrow of rats, mice and humans had the ability to differentiate into various cell lineages (Jiang et al., Nature 418:41-49 (2002)). Again, however, these cells are located in the relatively inaccessible bone marrow of these rodents, making their isolation and use a more difficult and costly process.

[0007] The pancreas is composed of at least three types of differentiated tissue: the hormone-producing cells in islets (4 different cell types), the exocrine zymogen-containing acini, and the centroacinar cells, ductules and ducts (ductal tree). All of these cells appear to have a common origin during embryogenesis in the form of duct-like protodifferentiated cells. Later in life, the acinar and ductal cells retain a significant proliferative capacity that can ensure cell renewal and growth, whereas the islet cells become mitotically inactive.

[0008] During embryonic development, and probably later in life, pancreatic islets of Langerhans originate from differentiating epithelial stem cells. These stem cells are situated in the pancreatic ducts but are otherwise poorly characterized. Pancreatic islets contain four islet cell types: alpha, beta, delta and pancreatic polypeptide cells that synthesize glucagon, insulin, somatostatin and pancreatic polypeptide, respectively. The early progenitor cells to the pancreatic islets are multipotential and coactivate all the islet-specific genes from the time these cells first appear. As development proceeds, expression of islet-specific hormones becomes restricted to the pattern of expression characteristic of mature islet cells.

[0009] The characterization of pre-islet cells is of great interest for the development of therapeutics to treat diseases of the pancreas, particularly insulin- dependent diabetes mellitus (IDDM). Model systems have been described that permit the study of these cells. For example, Gu and Sarvetnick (1993) Development 118:33-46 identify a model system for the study of pancreatic islet development and regeneration. Transgenic mice carrying the mouse γ-interferon gene linked to the human insulin promoter exhibit inflammatory-induced islet loss. Significant duct cell proliferation occurs in these mice, leading to a striking expansion of pancreatic ducts. Endocrine progenitor cells are localized in these ducts.

[0010] Type I autoimmune diabetes results from the destruction of insulin- producing β-cells in the pancreatic islets of Langerhans. The adult pancreas has very limited regenerative potential, and so these islets are not replaced if destroyed. The patient's survival then depends on exogenous administration of insulin. There are an estimated 500,000 to 1 million people with type 1 diabetes in the United States today. The risk of developing type 1 diabetes is higher than virtually all other severe chronic diseases of childhood.

[0011] The optimal treatment of IDDM, is the regulated delivery of insulin by functional β-cells. Pancreas transplantation, however, is a major surgical procedure with a high rate of complication. Transplantation of the isolated insulin- secreting islets of Langerhans is an alternative approach, which is easier and safer than whole-organ transplantation. Clinical trials of islet transplantation have begun in a few specialized centers worldwide.

[0012] β-cell transplantation has so far been restricted by the scarcity of human islet donors. This shortage could be alleviated by methods for the isolation and/or culture of β-cell progenitors. Such cells might also be protected from immunological rejection and recurring autoimmunity by genetic manipulation, ^■particularly if an autologous source is available. The combination of these approaches with immunoisolation devices holds the promise of a widely available cell therapy for treatment of IDDM in the near future. [0013] Needs also exist in the art to isolate, culture, sustain, propagate, and differentiate adult stem cells, particularly human adult stem cells that are relatively accessible, in order to develop cell types, including platelets, suitable for a variety of uses. Such uses may include the use of autologous stem cells for the treatment of diseases and amelioration of symptoms of diseases.

SUMMARY OF THE INVENTION

[0014] The invention solves at least one of the aforementioned needs in the art by generally providing a monocyte-derived stem cell (MDSC) that is pluripotent, along with pharmaceutical compositions including such a cell, methods of preparing and sustaining such a cell, methods of propagating such a cell, methods of differentiating such a cell, methods of propagating a non-terminally differentiated cell, and methods of using a cell or cells from the group comprising a MDSC and differentiated cells thereof to treat diseases or disorders or to ameliorate symptoms associated with a disease or disorder. The MDSCs of the invention are found in peripheral blood, providing a cost-effective source of pluripotent stem cells that can be obtained from most organisms. Significantly, these MDSCs can be readily propagated. Because such cells are typically available from most organisms, autologous MDSCs are also available where necessary or desired. Moreover, as pluripotent stem cells, the MDSCs of the invention are suitable for use in treating a wide variety of disorders and diseases, and in ameliorating a symptom associated with one or more of those diseases or disorders.

[0015] In one aspect, the invention provides a method of preparing an isolated monocyte-derived stem cell (MDSC) comprising the steps of isolating a peripheral-blood monocyte (PBM); contacting the PBM with an effective amount of a mitogenic compound selected from the group consisting of macrophage colony- stimulating factor (M-CSF), interleukin-6 (IL-6) and leukemia inhibitory factor (LIF); and culturing the PBM under conditions suitable for propagation of the cell and thereby obtaining a preparation of an isolated MDSC. The PBM is preferably a mammalian, human, or adult human PBM. In one embodiment, the PBM is cryopreserved prior to contact with a mitogenic compound, hi a related aspect of the invention, the isolated MDSC is cryopreserved. [0016] In another related aspect, the invention comprehends an isolated MDSC obtained by the above-described method. As the MDSC of the invention has a distinct phenotype, it is contemplated by the invention that the MDSC will have at least one specific and characteristic activity. For example, an MDSC of the invention exhibits at least one distinct cell surface marker (MAC-I, CD14, CD34, CD40 and CD45), and/or produces at least one cytokine selected from the group consisting of IL- IB, IL-6 and IL- 12 p70, or exhibits phagocytic activity, or exhibits lymphocyte activation activity, or exhibits resistance to dispersion by any one of trypsin, EDTA and dispase, or exhibits susceptibility to dispersion by lidocaine. Preferably an isolated MDSC according to the invention exhibits phagocytic activity. Also preferred is an isolated MDSC exhibiting at least one of the above-identified cell surface markers, production of one of the above-identified cytokines, phagocytic activity, lymphocyte activation activity, resistance to dispersion by trypsin, EDTA, or dispase, and susceptibility to dispersion by lidocaine.

[0017] Isolated MDSCs exhibiting a variety of cell-surface antigens are contemplated in the invention. In one aspect of the invention, an isolated MDSC is provided wherein the cell exhibits a surface antigen selected from the group consisting of MAC-I, CD 14, CD34, CD40 and CD45. Preferably, the invention provides an isolated MDSC wherein the MDSC does not exhibit a surface antigen selected from the group consisting of CDIa and CD83.

[0018] In one embodiment of this aspect of the invention, an isolated MDSC is provided wherein the cell produces a cytokine selected from the group consisting of IL-I β, IL-6 and IL-12 p70. In another embodiment, the invention provides an isolated MDSC that exhibits phagocytic activity.

[0019] In another embodiment, the MDSC of the invention is resistant to dispersion by an agent selected from the group consisting of trypsin, EDTA and dispase. In yet another embodiment, the MDSC of the invention is susceptible to dispersion following treatment with lidocaine. Of course, an MDSC according to the invention may be resistant to dispersion by trypsin, EDTA and dispase, while being susceptible to dispersion with lidocaine. [0020] The invention also comprehends an isolated MDSC wherein the cell is an adult human cell; exhibits a surface antigen selected from the group consisting of MAC-I, CD 14, CD34, CD40 and C45; produces a cytokine selected from the group consisting of IL-IB, IL-6 and IL-12 p70; is resistant to dispersion by an agent selected from the group consisting of trypsin, EDTA, and dispase; and exhibits phagocytic activity.

[0021] In another aspect of the invention, a method of generating a differentiated cell is provided comprising the steps of isolating an MDSC and contacting the cell with an amount of an inducing agent effective to induce differentiation of the cell. Preferably, the differentiated cell is cultured under conditions for sustaining and/or propagating the cell. The MDSC of the invention is preferably a human MDSC or an adult human MDSC. In a related aspect, the invention contemplates cryopreservation of the MDSC and/or the differentiated cell.

[0022] A related aspect of the invention provides a method for identifying a cell type-specific therapeutic agent comprising contacting a candidate therapeutic agent and a first differentiated cell obtained according to the above-described method of generating a differentiated cell, further contacting the candidate therapeutic agent and a second differentiated cell obtained according to that method of generating a differentiated cell, wherein the first and second differentiated cells are different cell types, and measuring the viability of the first differentiated cell relative to the viability of the second differentiated cell, wherein a difference in viabilities identifies the candidate therapeutic agent as a cell type-specific therapeutic agent.

[0023] Given the scope of the invention, one skilled in the art will appreciate that a variety of growth and differentiation factors and methods, which are employed in the generation, sustaining and/or propagation of a range of specific cell and tissue types, can be used in sustaining, propagation and/or differentiation of the MDSC described herein. In particular, the invention contemplates a method of generating, sustaining and/or propagating a neuronal cell comprising the steps of isolating an MDSC; contacting the MDSC with an amount of a nerve cell inducing agent such as nerve growth factor (bNGF) effective to induce MDSC differentiation into a neuronal cell; and culturing the neuronal cell under conditions suitable for sustaining and/or propagating the neuronal cell. [0024] In another aspect of the invention, a method of generating, sustaining and/or propagating an endothelial cell is provided comprising the steps of isolating an MDSC; contacting the MDSC with an amount of an endothelial cell inducing agent such as vascular endothelial growth factor (VEGF) effective to induce MDSC differentiation into an endothelial cell; and culturing the endothelial cell under conditions suitable for sustaining and/or propagating the endothelial cell.

[0025] In another aspect of the invention, a method of generating, sustaining and/or propagating an epithelial cell is provided comprising the steps of isolating an MDSC; contacting the MDSC with an amount of an epidermal cell inducing agent such as epidermal growth factor (EGF) effective to induce MDSC differentiation into an epithelial cell; and culturing the epithelial cell under conditions suitable for sustaining and/or propagating the epithelial cell.

[0026] In yet another aspect of the invention, a method of generating, sustaining and/or propagating a T-lymphocyte is provided comprising the steps of isolating an MDSC; contacting the MDSC with an amount of a T-cell inducing agent such as interleukin-2 (IL-2) effective to induce MDSC differentiation into a T- lymphocyte; and culturing the T-lymphocyte under conditions suitable for sustaining and/or propagating the T-lymphocyte.

[0027] In still another aspect of the invention, a method of generating, sustaining and/or propagating a macrophage is provided comprising the steps of isolating an MDSC; contacting the MDSC with an amount of a macrophage inducing agent such as lipopolysaccharide (LPS) effective to induce MDSC differentiation into a macrophage; and culturing the macrophage under conditions suitable for sustaining and/or propagating the macrophage.

[0028] In an additional aspect of the invention, a method of generating, sustaining and/or propagating a hepatocyte is provided comprising the steps of isolating an MDSC; contacting the MDSC with an amount of a hepatocyte inducing agent such as hepatocyte growth factor (HGF) effective to induce MDSC differentiation into a hepatocyte; and culturing the hepatocyte under conditions suitable for sustaining and/or propagating the hepatocyte. [0029] In still another aspect of the invention, a method of generating, sustaining and/or propagating a platelet is provided comprising the steps of isolating an MDSC; contacting the MDSC with at least one platelet-inducing agent, wherein said agent or agents are collectively present in an amount effective to induce MDSC differentiation into a platelet; and culturing the platelet under conditions suitable for sustaining and/or propagating the platelet. Typically, the MDSCs differentiate through proliferating megakaryocyte progenitors into megakaryocytes, and ultimately into platelets. Suitable platelet-inducing agents include, but are not limited to: IL-3, IL-6, IL-11, granulocyte-macrophage colony stimulating factor (GM-CSF), thrombopoietin (TPO), stem cell factor (SCF), leukemia inhibitory factor (LIF), basic fibroblast growth factor (bFGF), macrophage inflammatory protein- lα (MIP- lα), prolactin-like protein E (PLP-E), forskolin, and PMA. The aforementioned platelet- inducing agents may be provided individually or in combination.

[0030] In another aspect of the invention, a method of generating a pancreatic islet β-cell-like macrophage is provided comprising the step of contacting a MDSC with at least one pancreatic islet β-cell-like macrophage-inducing agent, wherein said agent or agents are collectively present in an amount effective to induce differentiation of the MDSC into a pancreatic islet β-cell-like macrophage. In a related embodiment, the method is provided further comprising cryopreserving said pancreatic islet β-cell-like macrophage. In yet another related embodiment, the method is provided further comprising culturing the pancreatic islet β-cell-like macrophage.

[0031] In still another embodiment of the invention, the aforementioned method is provided wherein the pancreatic islet β-cell-like macrophage-inducing agent is selected from the group consisting of lipopolysaccharide (LPS), CD40 antibody (CD40Ab), and glucose. In a related embodiment, the method is provided wherein the MDSC is a human MDSC or an adult human MDSC.

[0032] In another embodiment of the invention, a method of generating a pancreatic islet β-cell-like macrophage is provided comprising the steps of a) isolating a MDSC comprising the steps of i) isolating a peripheral-blood monocyte (PBM); ii) contacting said PBM with an effective amount of a mitogenic compound selected from the group consisting of macrophage colony-stimulating factor (M-CSF), interleukin-6 (IL-6), and leukemia inhibitory factor (LIF); and iii) culturing said PBM under conditions suitable for propagation of said cell, thereby obtaining a preparation of an isolated MDSC; and b) contacting the MDSC with at least one pancreatic islet β-cell-like macrophage-inducing agent, wherein the agent or agents are collectively present in an amount effective to induce differentiation of the cell into a pancreatic islet β-cell-like macrophage.

[0033] In a related embodiment, the aforementioned method is provided further comprising cryopreserving the pancreatic islet β-cell-like macrophage. In yet another related embodiment, the method according is provided comprising culturing the pancreatic islet β-cell-like macrophage. In still another embodiment of the invention, the aforementioned method is provided wherein the pancreatic islet β-cell- like macrophage-inducing agent is selected from the group consisting of lipopolysaccharide (LPS), CD40 monoclonal antibody (CD40Ab), and glucose. In a related embodiment, the MDSC is a human MDSC or an adult human MDSC.

[0034] In still another aspect of the invention, a method for identifying a pancreatic islet β-cell-like macrophage-specific therapeutic agent is provided comprising: (a) contacting a pancreatic islet β-cell-like macrophage obtained according to the aforementioned methods and a candidate therapeutic agent; (b) further contacting a cell terminally differentiated from an MDSC selected from the group consisting of an epithelial cell, an endothelial cell, a macrophage, a T- lymphocyte, a hepatocyte, a neuronal cell, and a platelet, and the candidate therapeutic agent; (c) measuring the viability of the pancreatic islet β-cell-like macrophage relative to the viability of the differentiated cell, wherein a difference in viabilities identifies the candidate therapeutic agent as a pancreatic islet β-cell-like macrophage-specific therapeutic agent.

[0035] In another aspect, a method of treating a pancreatic islet β-cell-like macrophage disorder is provided comprising administering a therapeutically effective number of a pancreatic islet β-cell-like macrophage obtained by the aforementioned methods. In a related embodiment, the method is provided wherein the pancreatic islet β-cell-like macrophage disorder is selected from the group consisting of insulin- dependent diabetes mellitus (IDDM), type 2 diabetes mellitus, hyperglycemia, hyperlipidemia, obesity, Metabolic Syndrome, and hypertension. In still another related embodiment, the use of a pancreatic islet β-cell-like macrophage according to the aforementioned methods in the preparation of a medicament for the treatment of a pancreatic islet β-cell-like macrophage disorder is provided.

[0036] In another aspect of the invention, an isolated pancreatic islet β-cell- like macrophage is provided. In a related embodiment, an isolated collection of cells comprising pancreatic islet β-cell-like macrophage is provided wherein the collection of cells is composed of at least 80% pancreatic islet β-cell-like macrophages. In yet another related embodiment, a kit comprising a pancreatic islet β-cell-like macrophage and a set of instructions for administration of the pancreatic islet β-cell- like macrophage to an organism in need thereof is provided.

[0037] Another aspect of the invention is drawn to an isolated pancreatic islet β-cell-like macrophage produced according to the aforementioned methods is provided. In yet another embodiment, a method of transplanting an isolated pancreatic islet β-cell-like macrophage into an organism in need thereof is provided comprising the steps of (a) obtaining an isolated pancreatic islet β cell-like macrophage; and (b) administering the pancreatic islet β cell-like macrophage to an organism in need, thereby transplanting the macrophage into the organism in need. In some embodiments, the method of transplanting further comprises generating the pancreatic islet β cell-like macrophage from a monocyte derived stem cell (MDSC). Related embodiments of the method further comprise generating the MDSC from a peripheral blood monocyte (PBM). In still another related embodiment, the method of transplanting provides an isolated pancreatic islet β-cell-like macrophage that is autologous to the organism in need thereof.

[0038] A cell, such as any of the cell types differentiable from a MDSC (e.g., neuron, epithelial cell, endothelial cell, a T-lymphocyte, a macrophage, a hepatocyte, a platelet or a pancreatic islet β-cell-like macrophage), is also contemplated as a useful source of any product characteristic of that cell type, e.g., insulin produced by a pancreatic islet β-cell-like macrophage. Accordingly, the invention comprehends methods for maintaining, propagating and/or culturing at least one such cell type, ultimately derived from a PBM, under conditions suitable for production of the characteristic product in an ex vivo, e.g., in vitro, environment. The methods according to this aspect of the invention comprise the steps of incubating a differentiated cell derived from a PBM and maintaining, propagating and/or culturing the cell under conditions suitable for production of at least one product. Such conditions may include, but need not require, contacting the cell with at least one agent to induce production of the product. The methods according to this aspect of the invention are expected to provide the benefit of a cell-based production system capable of providing any desired modification of a nascently produced product, such as the post-translational modification of a protein product as exemplified by post- translational glycosylation.

[0039] The invention also comprehends a method of treating a disorder comprising administering, to an organism in need, effective amounts of each of at least two cell differentiation-inducing agents: a first agent that induces the generation of an MDSC from a PBM and a second agent that induces terminal differentiation (e.g., differentiation of an MDSC into a neuronal cell, an endothelial cell, an epithelial cell, a macrophage, a T-lymphocyte, a hepatocyte, a platelet, a pancreatic islet beta cell-like macrophage, or a mixture thereof). Suitable agents include any inducing agent or factor known in the art, as exemplified by the inducing agents disclosed herein. Preferably, the agents are delivered at separate times (e.g., 3-7 days apart). In one embodiment, the inducing agent(s) is reversibly immobilized to a carrier and implanted into an organism in need, using conventional techniques and chemistries. The agent is then released over time in the form of a localized dose, as would be understood in the art. Suitable carriers include without limitation stents, gel matrices, and beads. Preferably, an MDSC of the invention is isolated from a mammalian source. Also preferred are human and adult human sources for the MDSC according to the invention.

[0040] The use of isolated MDSC for the treatment of various diseases and disorders is further contemplated by the invention. A disorder amenable to cell-based treatment includes, but is not limited to, Alzheimer's disease, Parkinson's disease, senile dementia, multiple sclerosis, age-related central nervous system (CNS) conditions, including changes manifested, e.g., as current time, date, location, or identity confusion, and/or recent memory loss, Acquired Immune Deficiency Syndrome (AIDS)-associated dementia, brain damage due to a blood clot, interruption of blood supply, formation or presence of a cyst, an autoimmune disorder, bacterial infection, e.g., of the brain, which may include an abscess, viral infection, e.g., of the brain, brain tumor, seizure disorders, neural trauma, surgical incision, diabetic ulcer, hemophiliac ulcer, varicose ulcer, solid angiogenic tumor, leukemia, hemangioma, acoustic neuroma, neurofibroma, trachoma, pyogenic granuloma, rheumatoid arthritis, psoriasis, diabetic retinopathy, retinopathy of premature macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, Osier- Webber Syndrome, myocardial angiogenesis blindness, plaque neovascularization, telangiectasia, hemophiliac joint damage, angiofibroma, wound granulation, epithelial cell neoplasia, Crohn's disease, chemical-, heat-, infection- or autoimmune-induced intestinal tract damage, chemical-, heat-, infection- or autoimmune-induced skin damage, systemic lupus erythematosus, reactive arthritis, Lyme disease, insulin- dependent diabetes, an organ-specific autoimmune disorder, rheumatoid arthritis, inflammatory bowel disease, Hashimoto's thyroiditis, Grave's disease, contact dermatitis, psoriasis, graft rejection, graft-versus-host disease, sarcoidosis, a gastrointestinal allergy, eosinophilia, conjunctivitis, glomerular nephritis, a helminthic infection, lepromatous leprosy, diabetes, Gaucher's disease, Niemann-Pick disease, a parasitic infection, cancer, a disorder of the immune system, chemical (including drugs and alcohol)-, physical-, infection-, or autoimmune-induced hep ato toxicity, liver cancer, liver damage induced by metastatic cancer, a liver blood clot, acute infections, anaphylactic shock, haemorrhagic diseases, and anemias, such as anemias arising from chemo- or radiotherapy, platelet- function deficient disease, chronic hepatic disorders and renal disorders, as well as diseases which directly damage bone marrow, such as osteomyelodysplasia, leukemia, cancer metastasis into bone marrow, myelomatosis, Hodgkin's disease, lymphosarcoma, myelofibrosis, myelosclerosis, hypertrophic osteoarthropathy, osteopetrosis, diseases which damage the spleen, such as Banti's syndrome, reticulum cell sarcoma, syphilis, and malignant tumors that induce splenomegaly, disorders related to reactions to drugs such as heparin, quinidine, quinine, sulfa-containing antibiotics, oral diabetes drugs, gold salts, and rifampin, idiopathic thrombocytopenic purpura, hemolytic-uremic syndrome, Von Willebrand's disease, hemophilia, disseminated intravascular coagulation, hereditary platelet disorders, leukemia, aplastic anemia, paroxysmal nocturnal hemoglobinuria, megaloblastic anemia, HIV infection, systemic lupus erythematosus, bacterial septicemia, skin petechial hemorrhage, rhinorrhagia, tunica mucosa oris hemorrhage, urinary tract hemorrhage, genitalia hemorrhage, alimentary canal bleeding, intracranial hemorrhage type 2 diabetes mellitus, hyperglycemia, hyperlipidemia, obesity, Metabolic Syndrome, and hypertension. [0041] According to the invention, the MDSC is preferably isolated from the organism to receive treatment (i.e., is an autologous MDSC). Preferably, the MDSC used to treat a disorder is derived from a mammalian, human, or adult human source.

[0042] The invention is further useful in treating a variety of diseases according to the methods described herein. One aspect of the invention provides a method for treating a neuronal disorder amenable to cell-based treatment comprising administering a therapeutically effective number of an neuronal cell obtained by the methods described herein. A neuronal cell disorder amenable to cell-based treatment includes, but is not limited to, Alzheimer's disease, Parkinson's disease, senile dementia, multiple sclerosis, age-related CNS conditions, including changes manifested, e.g., as current time, date, location, or identity confusion, and/or recent memory loss, AIDS-associated dementia, brain damage due to a blood clot, an interruption of blood supply, formation or presence of a cyst, an autoimmune disorder, a bacterial infection including an abscess, a viral infection, e.g., of the brain, a brain tumor, a seizure disorder, and a neural trauma. It is further contemplated that a neuronal cell derived from an MDSC according to the invention may be used to ameliorate a symptom associated with an disorder amenable to cell-based treatment, as mentioned above, comprising administering a therapeutically effective number of a neuronal cell obtained by the methods described herein. Symptoms associated with such disorders are well known in the art.

[0043] Another aspect of the invention is drawn to a method of treating an endothelial cell disorder amenable to cell-based treatment comprising administering a therapeutically effective number of an endothelial cell obtained by the methods described herein. An endothelial cell disorder amenable to cell-based treatment includes, but is not limited to, a surgical incision, a diabetic ulcer, a hemophiliac ulcer, a varicose ulcer, a solid angiogenic tumor, a leukemia, a hemangioma, an acoustic neuroma, a neurofibroma, a trachoma, a pyogenic granuloma, rheumatoid arthritis, psoriasis, diabetic retinopathy, retinopathy of premature macular degeneration, a corneal graft rejection, a neovascular glaucoma, a retrolental fibroplasia, rubeosis, Osier-Webber Syndrome, myocardial angiogenesis blindness, plaque neovascularization, telangiectasia, a hemophiliac joint damage, an angiofibroma, and wound granulation. It is further contemplated that an endothelial cell derived from an MDSC according to the invention may be used to ameliorate a symptom associated with a disorder amenable to cell-based treatment, as mentioned above, comprising administering a therapeutically effective number of an endothelial cell obtained by the methods described herein. Symptoms associated with such disorders are well known in the art.

[0044] Yet another aspect of the invention provides a method of treating an epithelial cell disorder amenable to cell-based treatment comprising administering a therapeutically effective number of an epithelial cell obtained by the methods described herein. An epithelial cell disorder amenable to cell-based treatment includes, but is not limited to, an epithelial cell neoplasia, Crohn's disease, chemical-, heat-, infection- or autoimmune-induced intestinal tract damage, or chemical-, heat- infection and autoimmune-induced skin damage. It is further contemplated that an epithelial cell derived from an MDSC according to the invention may be used to ameliorate a symptom associated with a disorder amenable to cell-based treatment comprising administering a therapeutically effective number of an epithelial cell obtained by the methods described herein. Symptoms associated with such disorders are well known in the art.

[0045] The invention further comprehends a method of treating a T-lymphocyte disorder amenable to cell-based treatment comprising administering a therapeutically effective number of a T-lymphocyte obtained by the methods described herein. A T-lymphocyte disorder amenable to cell-based treatment includes, but is not limited to, leukemia, systemic lupus erythematosus, AIDS, Crohn's disease, reactive arthritis, Lyme disease, insulin-dependent diabetes, an organ-specific autoimmune disorder, rheumatoid arthritis, inflammatory bowel disease, Hashimoto's thyroiditis, Grave's disease, contact dermatitis, psoriasis, graft rejection, graft-versus-host disease, sarcoidosis, a gastrointestinal allergy, eosinophilia, conjunctivitis, glomerular nephritis, a helminthic infection, a viral infection, a bacterial infection and lepromatous leprosy. It is further contemplated that a T lymphocyte derived from an MDSC according to the invention may be used to ameliorate a symptom associated with a disorder amenable to cell-based treatment comprising administering a therapeutically effective number of a T-lymphocyte obtained by the methods described herein. Symptoms associated with such disorders are well known in the art. [0046] In yet another aspect of the invention, a method of treating a macrophage cell disorder amenable to cell-based treatment comprising administering a therapeutically effective number of a macrophage obtained by the methods described herein. A macrophage cell disorder amenable to cell-based treatment includes, but is not limited to, diabetes, Gaucher's disease, Niemann-Pick disease, a bacterial infection, a parasitic infection, cancer, leukemia and a disorder of the immune system is provided. It is further contemplated that a macrophage derived from an MDSC according to the invention may be used to ameliorate a symptom associated with a disorder amenable to cell-based treatment comprising administering a therapeutically effective number of a macrophage obtained by the methods described herein. Symptoms associated with such disorders are well known in the art.

[0047] In an additional aspect, the invention provides a method of treating a hepatocyte disorder amenable to cell-based treatment comprising administering a therapeutically effective number of a hepatocyte obtained by the methods described herein. A hepatocyte disorder amenable to cell-based treatment includes, but is not limited to, chemical (including drugs and alcohol)-, physical-, infection-, or autoimmune-induced hepatotoxicity, liver cancer, liver damage induced by metastatic cancer, systemic lupus erythematosus, AIDS, Niemann-Pick disease, cancer, and a liver blood clot. It is further contemplated that a hepatocyte derived from an MDSC according to the invention may be used to ameliorate a symptom associated with a disorder amenable to cell-based treatment comprising administering a therapeutically effective number of a hepatocyte obtained by the methods described herein. Symptoms associated with such disorders are well known in the art.

[0048] In an additional aspect, the invention provides a method of treating a platelet disorder amenable to cell-based treatment comprising administering a therapeutically effective number of a platelet obtained by the methods described herein. Disorders amenable to treatment by MDSC-derived platelets include thrombocytopenia, as occurs in some acute infections, anaphylactic shock, haemorrhagic diseases, and anemias, such as anemias arising from chemo- or radiotherapy. Other diseases or disorders include platelet- function deficient disease, chronic hepatic disorders and renal disorders, as well as diseases which directly damage bone marrow, such as osteomyelodysplasia, leukemia, cancer metastasis into bone marrow, myelomatosis, Hodgkin's disease, lymphosarcoma, myelofibrosis, myelosclerosis, hypertrophic osteoarthropathy, and osteopetrosis. Still other diseases include diseases which damage the spleen, such as Banti's syndrome, reticulum cell sarcoma, syphilis, and malignant tumors that induce splenomegaly.

[0049] Further, the invention comprehends the use of MDSC-derived platelets to treat skin petechial hemorrhage, rhinorrhagia, tunica mucosa oris hemorrhage, urinary tract hemorrhage, and genitalia hemorrhage, alimentary canal bleeding and intracranial hemorrhage.

[0050] In an additional aspect, the invention provides a method of treating a pancreatic islet β-cell-like macrophage disorder amenable to cell-based treatment comprising administering a therapeutically effective number of a pancreatic islet β- cell-like macrophage obtained by the methods described herein. Disorders amenable to treatment by MDSC-derived pancreatic islet β-cell-like macrophages include insulin-dependent diabetes mellitus (IDDM), type 2 diabetes mellitus, hyperglycemia, hyperlipidemia, obesity, Metabolic Syndrome, and hypertension.

[0051] The invention is further useful in the treatment of disorders related to reactions to drugs such as heparin, quinidine, quinine, sulfa-containing antibiotics, oral diabetes drugs, gold salts, and rifampin. Other diseases or disorders include idiopathic thrombocytopenic purpura, hemolytic-uremic syndrome, Von Willebrand's disease, hemophilia, disseminated intravascular coagulation, hereditary platelet disorders, leukemia, aplastic anemia, paroxysmal nocturnal hemoglobinuria, megaloblastic anemia, HIV infection, systemic lupus erythematosus and bacterial septicemia.

[0052] It is further contemplated that administration of one or more cell types according to the invention (e.g., MDSC and both non-terminal Iy and terminally differentiated cells thereof) may be used to treat a disease or disorder or to ameliorate a symptom associated with such a disease or disorder.

[0053] Pharmaceutical compositions are also contemplated. Preferably, a pharmaceutical composition of the invention comprises a MDSC and a pharmaceutically acceptable diluent, carrier or medium. The invention further contemplates a kit comprising a pharmaceutical composition according to the invention. [0054] Other features and advantages of the invention will be better understood upon review of the brief description of the drawing and the detailed description, which follow.

BRIEF DESCRIPTION OF THE DRAWING

[0055] Figure 1. Macrophage differentiation of peripheral blood monocytes and MDSC growth; a) freshly isolated monocytes, b) untreated 5-day-old monocyte culture, c) 5-day PMA-treated monocyte culture, d) 5-day M-CSF-treated monocyte culture, e) 14-day M-CSF-treated monocyte culture; the arrow points to a dividing cell, f) 14-day M-CSF-treated monocyte culture incubated for 1 day with LPS, g) MAC-I immunostaining of 5 day M-CSF-treated monocyte culture, and h) fluorescence of phagocytized beads in 5-day M-CSF-treated monocyte culture. For Fig. la-f, cells were visualized by phase-contrast microscopy merged with fluorescence images of lipids stained with Nile red (red) and nuclei stained with 4',6- diamidino-2-phenylindole (DAPI, blue). Scale bar, 40 μm.

[0056] Figure 2. Replication of MDSCs. MDSCs in untreated (x-x) and M-CSF-treated (•-•) monocyte cultures, and s-MΦ (S-macrophage or standard macrophage) in untreated (A-A), and M-CSF-treated (■-■) monocyte cultures. The results are the mean ± s. d. of cell counts from 4 different individuals.

[0057] Figure 3. LPS-induced macrophage differentiation of MDSCs. Fluorescence intensity (mean ± s.d. of 4 experiments) is based on 30-50 cells/determination/individual.

[0058] Figure 4. Epithelial and neuronal cell differentiation of MDSCs. A, EGF-induced epithelial cell differentiation was assessed by double immunostaining for keratins and E-cadherin, distinguishably stained. Each field contains 4-5 cells. The double immunostaining revealed staining for keratins and E-cadherin in the same cells. The control panel was selected to include a positive cell. B, bNGF-induced neuronal cell differentiation was assessed by length of the main processes (mean ± s.d.) of 50 randomly selected cells using Slidebook software (upper panel) and by immunostaining for neuron-specific antigens (lower panel). Each immunostained field contains 10-15 cells with the control panel selected to contain positive cells. Scale bar, 50 μm. MAP-IB, microtubule-associated protein-IB; NF, neurofilament; NSE, neuron-specific enolase.

[0059] Figure 5. Relative cell number in MDSC cultures treated with or without differentiation inducers. The results are the mean ± s.d. of 5 randomly selected microscopic fields, each from 4 different experiments for each treatment.

[0060] Figure 6. Expression of β-cell markers in MDSC treated with 1 μg/ml LPS or 20 μg/ml CD40 MAb. 6A, immunostaining of untreated or 3 -day- treated MDSC incubated in the presence of 25 mM glucose. 6B, electron micrographs of untreated or 4-day-treated MDSC. 6C, immunostaining of untreated or 1.5-day- treated MDSC incubated in the presence of low or high glucose. 6D, nested RT-PCR for insulin using RNA from untreated or 3-day-treated MDSC cultures in the absence (-) or presence (+) of 25 mM glucose. 6F, Effect of 30 minutes treatment with 10 μM tolbudamide and 100 μM IBMX on insulin secretion in the presence of low glucose.

[0061] Figure 7. Display of cell-surface macrophage markers (7A) and phagocytosis (7B) of dextran in MDSC treated with 1 μg/ml LPS or 20 μg/ml CD40 MAb.

[0062] Figure 8. Display of β-cell and macrophage markers in fixed pancreatic slides from healthy human donors. 8 A, display of lymphocyte markers CD3 or CD20. 8B, display of dendritic cell markers CDIa and CD83. 8C, serial sections stained for insulin and CD45. 8D, display of macrophage functional markers Il-12p70 and NSE. 8E, co-localization of macrophage and β-cell markers.

[0063] Figure 9. Display of macrophage and β-cell markers in dissociated viable human pancreatic islet cells. 9A, dissociated pancreatic islet cells stained for R-PE-conjugated CD14 and insulin were sorted and the double-negative cells re- stained for Cy-Chrome-conjugated CD45 and flow analyzed. 9B, Sorted β-cells were re-stained for CD45 and flow-analyzed. 9C, triple staining of freshly cultured islet cells with β-cell markers, phagocytozed Dextran- Alexa Fluor 647, and blood and macrophage determinants. 9D, double immunostaining of freshly cultured islet cells for β-cell markers and cytokines. DETAILED DESCRIPTION OF THE INVENTION

[0064] The invention provides pluripotent adult stem cells derivable from peripheral blood sources, as well as methods for culturing, propagating and/or differentiating such cells. The invention also provides methods of using such cells to treat any of a variety of disorders or diseases, or to ameliorate at least one symptom of one or more such disorders or diseases. The pluripotent adult stem cells of the invention are a subset of monocytes and are preferably obtained from humans, domesticated livestock, or pets. The cells of this subset are herein identified as monocyte-derived stem cells (MDSCs). The examples provided herein demonstrate that an MDSC can be induced to differentiate into a variety of non-terminally or terminally differentiated cells, including macrophage, T-lymphocyte, epithelial cell, endothelial cell, neuronal cell, hepatocyte, platelet and pancreatic islet β-cell-like macrophage (i.e., to acquire a phenotype characteristic of such a cell).

[0065] One advantage of the invention is the capability to administer autologous MDSCs, and/or cells differentiated therefrom, to patients in need of such cells. The use of autologous MDSCs or their progeny reduces the risk of immune rejection and the transmission of disease. Further, the ability to propagate autologous MDSCs, thereby producing useful quantities of those cells, is expected to expand the number and variety of disorders and diseases amenable to therapies (and the number and variety of symptoms thereof amenable to amelioration) based on MDSC administration. Thus, methods of the invention show promise in being more effective and versatile than current procedures, which do not include such an expansion of cells. The dosage and manner of administration are readily determinable by one of skill in the art using nothing more than routine optimization, with such efforts being guided by the type of cells being administered (MDSCs and/or derivatives thereof). Thus, the ability to store, propagate and differentiate the MDSCs make them invaluable for autologous administration.

[0066] Advantages of the invention include the use of peripheral blood as a convenient source for MDSCs, including autologous MDSCs, which can be safely and economically obtained. Further, it is generally appreciated in the art that peripheral blood is readily renewable and can provide a continuing source of autologous, or heterologous, pluripotent stem cells. A further advantage of the invention is that the blood source for MDSC preparation may be an adult source. As such, the controversial sampling of embryonic stem cells is avoided. Moreover, the adult blood source may be the very patient requiring administration of MDSCs or cells derived therefrom. To better understand the invention, the following definitions are provided.

[0067] "Adult" or "adult human" means a mature organism or a mature cell such as a mature human or a mature human cell, regardless of age, as would be understood in the art.

[0068] The term "stem cell" refers to any cell that has the ability to differentiate into a variety of cell types, including terminally differentiated cell types. Such cells are, therefore, properly regarded as progenitor cells. Stem cells can be pluripotent, i.e., capable of differentiating into a plurality of cell types.

[0069] As defined herein, the term "isolated" refers to cells that have been removed from their natural environment, typically the body of a mammal. Preferably, isolated cells are separated from other cell types such that the sample is homogeneous or substantially homogeneous. As a specific example, a blood cell monocyte is isolated if it is contained in a sample of blood that has been removed from an organism.

[0070] "Monocyte-derived stem cell" or "MDSC" means stem cell derived from the monocyte fraction of the blood. "Peripheral blood monocyte" or "PBM" means a monocyte cell typically found in the peripheral blood of a vertebrate such as a mammal. These definitions comport with the ordinary and accustomed meanings of these cell-based terms in the art.

[0071] "Surface antigen" means a compound, typically proteinaceous, that is capable of binding to an antibody and is typically localized to a cell surface, such as by association with a cell membrane. A cell "marker," such as an "adipocyte marker," is a detectable element characteristic of that cell or cell type (e.g., an adipocyte). One class of useful markers is cell-surface markers, which can be detected with minimal disruption of cellular activity.

[0072] Cell-based "activity" refers to a function(s) of a given cell or cell type. One category of useful activities is the activities useful in distinguishing a given cell or cell type from other cells or cell types. For example, an activity of a macrophage is phagocytosis, which is a distinguishing characteristic of macrophages. [0073] "Cytokine" is given its ordinary and accustomed meaning of a regulatory protein released by a cell usually of the immune system that acts as an intercellular mediator in the generation of a cellular response such as an immune response. Examples of cytokines are the interleukins and lymphokines.

[0074] "Dispersion" means to loosen or dissociate. As used herein, dispersion is not limited to dissolving or forming a solution thereof. In the context of the invention, the dissociation of cells, or a cell and a solid surface, typically a solid surface available to the cell during cell culture or propagation.

[0075] "Vertebrate" is given its ordinary and accustomed meaning of any organism properly characterized as having a bony or cartilaginous backbone made of vertebra. Similarly, the term "mammalian," as defined herein, refers to any vertebrate animal, including monotremes, both marsupial and placental, that suckle their young and either give birth to living young (eutharian or placental mammals) or are egg- laying (metatharian or nonplacental mammals). Examples of mammalian species include primates (e.g., humans, monkeys, chimpanzees, baboons), rodents (e.g., rats, mice, guinea pigs, hamsters), lagomorphs (e.g., rabbits, hares, pikas), ruminants (e.g., cows, horses, sheep), canines (e.g., dogs, wolves) and felines (e.g., lions, tigers, cats).

[0076] By "suitable conditions" for growth, propagation or culture, it is meant that the temperature, humidity, oxygen tension, medium component concentrations, time of incubation and relative concentrations of cells and growth factors are at values compatible with the generation of progeny or sustaining cell viability. Each of the variables involved in cell growth or culture is well known in the art and, generally, a range of suitable values can be obtained using routine experimentation to optimize each result-effective variable.

[0077] The term "growth" is given its ordinary and accustomed meaning of the expansion of a cell population and/or cell size. Thus, the term "growth factor" as defined herein refers to a compound that is capable of inducing, or modifying the rate of, cell growth. [0078] A cell "culture" is one or more cells within a defined boundary such that the cell(s) are allotted space and growth conditions typically compatible with cell growth or sustaining its viability. Likewise, the term "culture," used as a verb, refers to the process of providing said space and growth conditions suitable for growth of a cell or sustaining its viability.

[0079] The term "propagate" or "propagation" refers to the process of cell growth. A "mitogenic compound" is a compound capable of affecting the rate of cell division for at least one cell type under at least one set of conditions suitable for growth or culture.

[0080] The phrase "disorder amenable to cell-based treatment" refers to a disorder that can be treated in whole or in part by administration of cells, whether autologous or heterologous to the recipient. The definition further embraces those disorders characterized by an effective cell deficiency (e.g., deficiency in number of cells or deficiency in number of healthy cells) as well as those disorders resulting from an abnormal extracellular signal wherein the administered cells can modulate/affect the level of that signal. As such, the definition embraces the physical re-supplying of cells and/or taking advantage of the physiology of the administered cells to restore an extracellular signal to levels characteristic of, or approaching that of, healthy individuals.

[0081] The term "differentiation" is given its ordinary and accustomed meaning of the process by which a cell or cells change to a different and phenotypically distinct cell type. A "differentiation inducer" is a compound that is a direct, or indirect, causative agent of the process of cell differentiation. Using this definition, a "differentiation inducer" is not be essential to differentiation.

[0082] An "inducing agent" or inducer is a differentiation inducer, i.e., a substance capable of directing, facilitating or promoting at least one type of cellular differentiation.

[0083] An "age-related CNS change" means a central nervous system alteration or change as manifested by confusion regarding the current time, the current date, the current location, self-identity, recent memory loss, or one or more other common facts that are well known and provide a basis for assessing the mental state of humans. [0084] An "effective" or "pharmaceutically effective" amount is that amount that is associated with a desired effect, for example a pharmaceutical effect. Typically in the context of the invention, it is that amount or number of MDSCs (and/or differentiated MDSC derivatives) which, when administered using conventional techniques, will result in a beneficial effect on a disorder or disease, or a symptom associated therewith, without unacceptably deleterious effects on the health or well being of the animal or human patient. By way of example, an effective amount is that amount of M-CSF that causes PBM propagation, and particularly MDSC propagation, preferably increasing the relative contribution of MDSCs to such cultures. A therapeutically effective number, by way of example, is that amount of neuronal cells derived from MDSCs that will ameliorate a symptom of Alzheimer's disease.

[0085] "Viability" is given its ordinary and accustomed meaning of a state characterized by the capacity for living, developing or germinating. In context, "viability" refers to the state of a cell. Measures of viability include, but are not limited to, a determination of the absolute, or relative, number(s) of cells, or an assessment of the absolute or relative health of one or more cells, using any one or more characteristic or property of a cell recognized in the art as informative on the health of a cell.

[0086] The term "pancreatic islet β-cell-like macrophage" refers to a cell with at least one β-cell marker, such as insulin, C-peptide, glucose transporter 2 (GLUT2), glucokinase regulatory protein (GCKR), transcription factor PDX-I, transcription factor NKX6.1, or K_ATP channel protein Surl/Kir6.2, and macrophage morphology. In addition, a culture comprising at least 80%, and preferably at least 85% or at least 90%, pancreatic islet β-cell-like macrophages is a pancreatic islet β- cell-like macrophage culture according to the invention. A pancreatic islet β-cell disorder includes, but is not limited to, any form of insulin-dependent diabetes or disorder arising, at least in part, from improper production, distribution or activity of insulin. It is contemplated that a pancreatic islet β-cell-like macrophage according to the invention will be useful in treating, or ameliorating at least one symptom of, any of such disorders. [0087] The term "therapeutically effective amount" means the amount that results in a stable, detectable increase in insulin production under appropriate circumstances (e.g., hyperglycemia), as would be understood in the art. The term "set of instructions" means a set of written guidelines appropriate for the administration of a cell or cells according to the invention in the treatment of a disease or disorder. The term "organism in need thereof means an organism afflicted with a disease or disorder associated with aberrant function or presence (i.e., level) of pancreatic islet β-cell-like macrophages.

[0088] In view of the preceding definitions, one of ordinary skill in the art will understand that the invention provides methods for preparing an isolated MDSC that comprise the steps of (a) isolating a peripheral-blood monocyte (PBM), (b) contacting the PBM with an effective amount of a mitogenic compound selected from the group consisting of macrophage colony-stimulating factor (M-CSF), interleukin-6 (IL-6) and leukemia inhibitory factor (LIF), and (c) culturing the PBM under conditions suitable for propagation of said cell, thereby obtaining a preparation of an isolated MDSC.

[0089] An isolated PBM is incubated with an effective amount of M-CSF (25-200 ng/ml), IL-6 (10-50 ng/ml) or LIF (100-2000 units/ml) according to one aspect of the invention. Preferably, 50 ng/ml M-CSF, 20 ng/ml IL-6 or 1000 units/ml LIF is used to treat preparations of cultured human PBM.

[0090] The M-CSF, IL-6 or LIF used in the invention may be from any suitable source, such as a natural or synthetic source, and may be used in a purified or unpurified state. Further, it is contemplated that the M-CSF, IL-6 or LIF may be a holoprotein or may be active subunits or fragments that exhibit a mitogenic effect on PBMs. Similarly, the M-CSF, IL-6 or LIF may be used alone or in combination (e.g., with other mitogens), with suitable buffers and the like. The use of conventional assays may be used to determine the quantity and dosage of M-CSF, IL-6 or LIF associated with a sufficient mitogenic effect.

[0091] According to methods of the invention, PBMs are incubated with one or more growth factors (i.e., mitogenic compounds) under suitable growth conditions to propagate MDSCs. Likewise, the MDSC of the invention is incubated with one or more of various differentiation inducers (i.e., inducers or inducing agents), and optionally one or more growth factors, under suitable conditions to allow for differentiation, and optionally propagation, of a variety of cell types. As one of skill would recognize, there are known compounds that function as both growth factors and differentiation inducers. Growth factors of the invention include, but are not limited to, macrophage-colony stimulating growth factor (M-CSF), interleukin-6 (IL-6) and leukemia inhibitory factor (LIF). Examples of compounds functioning as growth factors and/or differentiation inducers include, but are not limited to, lipopolysaccharide (LPS), phorbol 12-myristate 13-acetate (PMA), stem cell growth factor, human recombinant interleukin-2 (IL-2), IL-3, epidermal growth factor (EGF), b-nerve growth factor (NGF), recombinant human vascular endothelial growth factor _I65 isoform (VEGF), hepatocyte growth factor (HGF), IL-6, IL-I l, granulocyte- macrophage colony stimulating factor (GM-CSF), thrombopoietin (TPO), stem cell factor (SCF), basic fibroblast growth factor (bFGF), macrophage inflammatory protein- lα (MIP- lα), prolactin-like protein E (PLP-E), forskolin, CD40 antibody (CD40Ab), glucose, IL-4 and interferon (IFN)γ. Useful doses for inducing MDSC differentiation by growth and/or differentiation factors are: 0.5-1.0 μg/ml (preferably 1.0 μg/ml) for LPS, 1-160 nM (preferably 3 nM) for PMA, 500-2400 units/ml (preferably 1200 units/ml) for IL-2 , 50-1,600 ng/ml (preferably 200 ng/ml) for bNGF, 12.5-100 ng/ml (preferably 50 ng/ml) for VEGF, 10-200 ng/ml (preferably 100 ng/ml) for EGF, 25-200 ng/ml (preferably 50 ng/ml) for HGF, 1-25 ng/ml for IL- 3, 5-50 ng/ml for IL-6, 5-50ng/ml for IL-11, 25-250 ng/ml for GM-CSF, 10-500 ng/ml for TPO, 1-50 ng/ml for SCF, 1-50 ng/ml for LIF, 1-50 ng/ml for bFGF, 1-25 μg/ml for PLP-E, 1-25 μmol/L for forskolin, 10-100 ng/ml for MIP- lα, 1-50 μg/ml (preferably 20 μg/ml) for CD40Ab (R&D System, Minneapolis, MN), and 0.5-50 mM (preferably 25 mM) for glucose. (See, e.g., Nagahisa, H. et al. Blood, 87(4): 1309- 1316 (1996); Bertolini, F. et al. Blood, 89: 2679-2688 (1997); Weich, N., S. et al. Blood, 90:3893-902 (1997); Concalves, F. Leukemia, 12: 1355-1366 (1998); Zauli, G. Blood, 92: 472-478 (1998); Fugman, D., A. Blood, 75: 1252-1261 (1990); Lin, J., Linzer D., L, H. J. Biol. Chem. 30, 21485-21489 (1999); Guerriero, A. et al. Blood, 90(9):3444-3455 (1997); and Miazaki, R. et al. Br. J. Haematol. 108: 602-609 (2000), each of which is incorporated by reference in its entirety) . [0092] Cell surface antigens and cell markers may be identified using any technique known in the art, including immunostaining. Surface antigens and markers which, alone or in combination, are characteristic of cells according to the invention include MAC-I, CD14, CD34, CD40 and C45, whereas CDIa and CD83 are characteristically not associated with cells according to the invention. By way of example, cell surface antigens or markers have been identified using cells on glass slides, the cells having been immunostained by washing with phosphate-buffered saline (PBS) and fixed with 4% formaldehyde in PBS for 20 minutes at 20°C. For intracellular proteins, the cells were permeabilized with 0.5% Triton X-100 for 5 minutes at 20°C and incubated for one. hour with the primary antibodies. The primary antibodies were diluted with PBS containing 1% BSA to block non-specific reactivity. The cells were then washed 3 times with PBS containing 1% BSA and incubated for 45 minutes with FITC-, TRITC-, or Cy5 -conjugated cross-adsorbed donkey secondary antibodies (Jackson ImmunoResearch, West Grove, PA). Both of these reactions were performed at saturating concentrations and at 4°C. The slides were then washed and mounted with phosphate-buffered gelvatol.

[0093] Fluorescence imaging may be used to monitor or detect cells and is performed using techniques known in the art. For example, automated excitation and emission filter wheels, a quad-pass cube, and SlideBook software may be used for fluorescence imaging. Quantitative fluorescence ratio imaging can be performed using glyceraldehyde 3-phosphate dehydrogenase immunofluorescence (sheep polyclonal antibody, Cortex Biochem., San Leonardo, CA) as an internal standard. The fluorescence intensity level detected after reacting a sample with an isotype- matched IgG antibody provides a background fluorescence level, which is primarily attributable to non-specific binding. This fluorescence intensity was arbitrarily assigned an intensity level of one.

[0094] Among the antibodies contemplated for use in the invention are mouse monoclonal antibodies to IL- lβ, IL-6, IL-10, CD 14, CD34, CD40, CD45, HLA-DR, HLA-DQ, CDIa, CD83, von Willebrand's factor (vWF), keratins (Pan Ab- 1), cytokeratin 7, α-fetoprotein (AFP), microtubule-associated protein-IB (MAP-IB), neurofilament Ab-I (NF), 1L-I2p7θ, tumor necrosis factor-α (TNF-α), TNF-α receptor I (TNF-RI) and TNF-RII. Further, mouse IgG,, IgG_2A, IgG_2B, and goat IgG antibody to CD3, CD4, CD8 and human albumin; rat monoclonal antibody to E- cadherin; rabbit polyclonal antibodies to neuron-specific enolase (NSE), peroxisome proliferator-activated receptor (PPAR)γ2, IL-6, leptin and VEGF-R3 (FLT-4), and mouse monoclonal antibody to VEGF-R2 (FLK-I) are also contemplated for use in the invention. Even further, antibodies to IL-11, granulocyte-macrophage colony stimulating factor (GM-CSF), thrombopoietin (TPO), stem cell factor (SCF), basic fibroblast growth factor (bFGF), macrophage inflammatory protein- lα (MIP- lα), and prolactin-like protein E (PLP-E), are contemplated for use in the present invention.

[0095] Upon incubation with the appropriate differentiation inducer, an MDSC of the invention has the ability to differentiate into a variety of cell types. For example, according to methods of the invention, following contact by an effective amount of bNGF, an MDSC differentiates into a neuronal cell when under suitable growth conditions. In one embodiment, 200 ng/ml bNGF was used to treat MDSC cultures. It is contemplated by the invention that inducers of neuronal cell differentiation known in the art may be used under growth conditions and inducer concentrations that allow for optimal differentiation. These may include, but are not limited to, NGF, brain-derived neurotrophic factor, neurotrophin-3, basic fibroblast growth factor, pigment epithelium-derived factor, or retinoic acid.

[0096] According to other methods of the invention, endothelial cells are prepared by contacting MDSCs with VEGF under suitable growth conditions. In one embodiment, 50 ng/ml of VEGF was used to treat cultures of MDSC for 5-7 days. However, it is contemplated by the invention that other known inducers of endothelial cell differentiation may be substituted for VEGF. These may include, but are not limited to, insulin-like growth factor- 1 (IGF-I) and basic fibroblast growth factor.

[0097] Analogously, the invention provides methods to prepare epithelial cells by contacting MDSCs with EGF under suitable culture conditions. By way of example, 100 ng/ml EGF was incubated with an MDSC sample for 4 days. However, it is contemplated by the invention that other known inducers of epithelial cell differentiation may be substituted for EGF. These include, but are not limited to, bone morphogenesis protein-4, elevated calcium concentrations, retinoic acid, sodium butyrate, vitamin C, hexamethylene bis acetate, phorbol 12-myristate 13-acetate (PMA), teleocidin, interferon gamma, staurosporin, or activin. [0098] According to still other methods of the invention, a macrophage and/or a T-lymphocyte is prepared by contacting an MDSC with an appropriate inducer, such as LPS, for macrophage development and IL-2 for T-lymphocyte development. For example, 1 μg/ml LPS and 1200 units/ml IL-2 are incubated with MDSCs to achieve macrophage and T-lymphocyte cell differentiation, respectively. It is contemplated by the invention that other known inducers of macrophage and T- lymphocyte cell differentiation may be substituted for LPS and IL-2. These may include, but are not limited to, IL-4, IL-12, IL-18, CD3 antibody, PMA, teleocidin, or interferon gamma.

[0099] In a similar way, the invention provides methods to prepare a hepatocyte by contacting MDSCs with human recombinant hepatocyte growth factor (HGF) under suitable culture conditions. By way of example, 50 ng/ml of HGF is incubated with an MDSC sample for 5-7 days. However, it is contemplated by the invention that other known inducers of hepatocyte differentiation may be substituted for HGF. These include, but are not limited to, retinoic acid, oncostatin M, phenobarbital, dimethyl sulfoxide, dexamethasone, or dexamethasone and dibutyryl cyclic AMP.

[00100] In yet another method of the invention, a platelet is prepared by contacting MDSCs with IL-3, IL-6, IL-11, GM-CSF, TPO, SCF, LIF, bFGF, PLP-E, forskolin, MIP-Ia and PMA individually or in various combinations. IL-3, IL-6, IL- 11, GM-CSF, TPO, SCF, LIF, bFGF, PLP-E, forskolin or MP- lα may be a holoprotein or may be active subunits or fragments that exhibit the mitogenic and/or differentiating effect on MDSCs. Treatment with these agents may be for up to about 3 weeks at 37°C in a humidified 5-8% CO₂ atmosphere in an appropriate culture medium. Examples of such a media are; the STEMA medium (TEBU, Le Parray .en Yvelines, France), X-vivo 10 medium (Bio Whitaker, Walkersville, MD), Iscove's modified Dulbecco's medium or RPMI 1640 medium (GIBCO BRL, Gaithersburg, MD) optionally supplemented with or without antibiotics and with or without 1-20% bovine calf serum. Differentiation of MDSCs into megakaryocytes may be determined by a combination of one or more megakaryocyte maturation markers that may include, but are not limited to, an increase in cell size, polyploidization, assaying for acetylcholinesterase and immunostaining for any one or more of TPO receptor, CD32, CD41, CD42 and/or CD62. The presence of platelets will be defined visually or by flow cytometry after immϋnostaining with or without one or more of the megakaryocyte markers, such as a TPO receptor, CD32, CD41, CD42, CD62 and acetylcholinesterase.

[00101] Similarly, a pancreatic islet β-cell-like macrophage is prepared by contacting MDSCs with LPS, CD40Ab and glucose under suitable culture conditions. By way of example, 1 μg/ml LPS and 25 mM glucose, or 20 μg/ml CD40Ab and 25 mM glucose, was incubated with an MDSC sample for 1-5 days. However, it is contemplated by the invention that other known inducers of pancreatic islet β-cell-like macrophage differentiation may be substituted for LPS, CD40 MAb and glucose.

[00102] The currently described MDSC and/or cell derived therefrom is, among other uses, employed to replenish a cell population that has been reduced or eradicated by a disease or disorder (e.g., cancer), by a treatment for such a disease or disorder (e.g., a cancer therapy), or to replace damaged or missing cells or tissue(s). By way of example, neuronal tissue damaged during the progression of Parkinson's disease, endothelial cells damaged by surgical incisions, macrophage cells affected by Gaucher's disease, epithelial cells damaged from skin burns, T-lymphocytes affected by Lyme disease, hepatocytes damaged as a result of cirrhosis, platelet cells damaged as a result of or pancreatic islet β-cell-like macrophage cells damaged as a result of diabetes, are replenished by cells according to the invention. In addition, individuals with congenital diseases can be engrafted with autologous MDSCs or their progeny, after repairing the genetic alteration or further modifying the genome (e.g., introduction, deletion or modification of an expression control sequence, introduction of a modification in the genome that functions as a second-site reversion, replacing a defective gene with a normal copy of the gene, and the like) by recombinant technology. Moreover, the ability to propagate autologous MDSCs in vitro before administration of such cells should yield a sufficient number of stem cells for this procedure, which is expected to be more effective and versatile than the current transplantation procedures that do not include such an expansion.

[00103] Insertion of a missing cell type into the body can be accomplished by implantation, transplantation or injection of cells. The cells can be in the form of tissue fragments, clumps of cells or single cells derived from the fragmentation of organs or tissues. Alternatively, the cells can be clumps of cells or single cells derived from cell culture, tissue culture or organ culture. To maximize the chance for successful therapy, the inserted cells preferably have the physiological environment required for the reorganization, growth or differentiation necessary to permit normal functioning in the body. The cells inserted into the body must be maintained in a physical relationship that permits adaptation to the new environment and promotes the changes that will facilitate normal cell functioning, as would be known in the art.

[00104] Diabetes mellitis is an example of a disease state associated with an insufficiency or effective absence of certain types of cells in the body. In this disease, pancreatic B-cells are missing or deficient or defective. The condition can be treated, or at least one of its symptoms ameliorated, by insertion of pancreatic islet β cell-like macrophages described herein.

[00105] Methods of transplanting pancreatic cells are well-known in the art. See, for example, U.S. Pat. Nos. 4,997,443 and 4,902,295, which describe a transplantable artificial tissue matrix structure containing viable cells, preferably pancreatic islet cells, suitable for insertion into a human. Cell-encapsulated transplantation methods that protect the transplanted cell or cells against the host immune response are well-known in the art (see, e.g., U.S. Pat. Nos. 4,353,888 and 4,696,286). Autologous cell transplantation is also contemplated by the present invention to reduce or eliminate problems associated with the host immune response. The invention is illustrated by the following examples, which are not intended to be limiting in any way.

[00106] The examples show that an MDSC, derived from a peripheral blood source, can be induced to differentiate into, or acquire a characteristic phenotype of, a macrophage, lymphocyte, epithelial cell, endothelial cell, neuronal cell or hepatocyte phenotype. Briefly, Example 1 describes the isolation and storage at -70°C of adult human monocytes from peripheral blood and the culturing of MDSCs. Examples 2-9 describe the verification of differences between s-MΦ and MDSCs (Example 2), and the differentiation of MDSCs to macrophages and T- lymphocytes (Example 3), epithelial cells (Example 4), neuronal cells (Example 5), endothelial cells (Example 6), hepatocytes (Example 7), platelets (Example 8), and pancreatic islet β-cell-like macrophage (Example 9). Example 10 describes a clonal analysis to determine whether single monocytes generate colonies of MDSCs whose progeny are capable of, at least, T-lymphocyte, epithelial, neuronal, endothelial, macrophage, hepatocyte, platelet, or pancreatic islet β-cell-like macrophage differentiation.

Example 1

Isolation and culturing of adult human MDSC from peripheral blood

[00107] Peripheral blood monocyte (PBM) preparations from about 50 ml buffy coats samples (each from 500 ml peripheral blood) of healthy individuals (LifeSource Blood Services, Glenview, IL) were obtained by a selective attachment method as previously described (Hoklland, M. et al., Cell Biology, a laboratory handbook, Celis J. E. ed., Academic Press, 1 : 179-181(1994)). Buffy coat cell samples of 20-25 ml, which were diluted earlier with an equal volume of RPMI 1640 medium (Life Technologies, Inc.), were carefully layered over 20 ml Ficoll-Hypaque (γ= 1.077) in 50 ml centrifuge tubes and then centrifuged using a Beckman CPKR centrifuge and a GH-3.7 horizontal rotor at 3,500 rpm (270Og) for 25 minutes at 4°C. After carefully harvesting the mononuclear cells at the interface, cells were washed 2- 3 times with RPMI 1640 medium by centrifugation using a Beckman CPKR centrifuge and a GH-3.7 horizontal rotor at 1,000 rpm (250g) for 10 minutes. The cells were then used for culture and/or stored in liquid nitrogen in a 90% bovine calf serum and 10% dimethyl sulfoxide solution. The cells, including those obtained from storage in liquid nitrogen, were incubated at 2-3 x 10⁷ cells/15 cm dish. After 8-12 hours incubation at 37°C (8% CO₂), the floating cells were removed and the dishes were rinsed 5 times with RPMI 1640 medium. The attached cells were then detached from the surface of the dishes by forceful pipetting with 5-10 ml of RPMI 1640 medium supplemented with 10% bovine calf serum.

[00108] The percentage of PBM was verified by immunostaining with an R-phycoerythin-conjugated mouse anti -human CD 14 monoclonal antibody using a Becton Dickinson FACScan. The fraction of CD 14 cells in these cell preparations, which were usually used in the experiments, was 90-95%. In a number of experiments, the CD14-immunostained cells were further isolated to a purity of 99.97% by using a droplet cell-sorting method by means of a 5 detector Becton Dickinson FACStarPlus Cell Sorter. The isolated PBMs were inoculated at 1 x 10⁵ cells/ml in 8-well LabTek chamber slides (Nunc, Inc., Naperville, IL) at 0.4 ml/well in a 37°C humidified atmosphere containing 8% CO₂. Every five to seven days, one- half of the culture medium was replaced with fresh growth medium. This medium consisted of RPMI- 1640 supplemented with 10% heat-inactivated bovine calf serum (Harlan, Indianapolis, IN), 100 units/ml penicillin, 100 μg/ml streptomycin, and 2 mM L-glutamine (Life Technologies).

[00109] Five preparations of cultured human peripheral blood monocytes, each from a different individual, were treated with 50 ng/ml M-CSF (Zhoa et al., Proc. Natl. Acad. Sci., 100:2426-2431 (2003); incorporated herein by reference in its entirety). After five days of incubation, the cultures contained two major morphologically distinct subsets of cells. The less abundant of the two subsets, containing about 25-35% of the total cells, was composed of elongated cells that morphologically resembled fibroblasts and were termed monocyte-derived stem cells (MDSCs). The other subset, containing about 65-75% of the total, was composed of standard macrophages, which were termed s-macrophages or standard macrophages (s-MΦ) (Fig.l). Liquid nitrogen-stored PBMs from two of the five individuals yielded similar results. Two other PBM preparations, including one obtained from liquid nitrogen, each from a different individual, were incubated with any one of 50 ng/ml M-CSF, 1000 units/ml LIF, 20 ng/ml IL-6, or a combination of M-CSF with either LIF or IL-6 (Table 1). After five days, the cultures treated with M-CSF or LIF yielded about 30% MDSCs, while the cells treated with IL-6 contained about 20% of these cells. Treatment with both M-CSF and LIF displayed an approximately additive effect, namely, the cultures were composed of about 50% MDSCs. Incubation with both M-CSF and IL-6 failed to yield such an effect (Table 1). Significantly, control cultures had only about 5% of these cells (Table 1). Both the MDSCs and s-MΦ displayed an ability to attach and spread on culture matrices, engulf fluorescent beads and express MAC-I (Fig. 1), each of which are characteristic markers of macrophages (Laouar et al., Cell Biology: A Laboratory Hand book, J. E. Celis Ed., Academic Press, vol. 1, 233 (1997); Schlossman, S. et al. Eds., Leukocyte Typing V: White Cell Differentiation Antigens, Oxford Univ. Press, New York (1995)).

[00110] Macrophages are known to function as antigen-presenting cells and as such they produce cytokines and display characteristic cell-surface molecules (Gordon et al., Curr. Opin. Immunol., 7: 24-33 (1995); Martinez-Pomares et al., Immunobiology, 195: 407-416 (1996); Grage-Griebenow et al., J. Leukoc. Biol. 69:11-20 (2001)). Immunostaining for these proteins indicated that both cell types share some of the characteristics of antigen-presenting cells. However, the MDSCs differed from s-MΦ in that they exhibited reduced levels of IL-IO, TNF-α, TNFRII, CDIa, HLA-DR and HLA-DQ (Table 2). In Table 2, fluorescence intensities of cell- surface antigens, cytokines, leptin and PPARγ2 were determined after immunostaining, and lipid droplets were assessed after Nile red staining. Relative fluorescence intensity was examined by quantitative ratio imaging microscopy. Stimulation of lymphocyte proliferation was performed using a 10:1 macrophage to lymphocyte ratio and cytotoxicity was assessed using a 5:1 macrophage to target cell ratio, as previously described (Nakabo et al., J. Leukoc. Biol., 60:328-336 (1996), Zhou et al., Proc. Natl. Acad. Sci. USA, 93:2588-2592 (1996)). The MDSCs were found to be less cytotoxic to human leukemia cells and were more effective than s- MΦ cells in stimulating lymphocyte proliferation (Table 2). Another property that distinguished MDSCs from s-MΦ was their reduced ability to express leptin and PPARγ2 (Tontonoz et al., Cell, 93:241-252 (1998)) and their increased susceptibility to staining for lipid droplets (Fig. Id, Table 2).

Table 1

Table 2

MDSC s-MΦ

Surface antigens Relative fluorescence intensity

MAC-I 69 ± 1 1 67 ± 7

HLA-DR 18 ± 4 106 ± 41

HLA-DQ 17 ± . 5 83 + 28

CDIa 1 15 + 3

CD14 129 ± 27 155 ± 22

CD34 72 ± 19 21 ± 7

CD40 49 ± 23 37 ± 18 MDSC S-MΦ

CD45 132 ± 27 144 ± 36

CD83 1 1

Cytokine production

IL- l β 81 ± 29 78 ± 17

IL-6 44 ± 18 59 ± 17

IL-IO 11 ± 6 53 ± 10

IL-12 p70 54 ± 32 53 ± 8

TNFα 25 ± 11 66 ± 17

TNF-RI 28 ± 6 30 ± 18

TNF-RII 8 ± 5 52 ± 19

Adipocyte markers

Lipids 17 ± 10 147 ± 10

Leptin production 25 ± 6 82 ± 18

PPARγ2 21 ± 5 105 ± 31

Functional indicators

Phagocytosis 184 + 18 191 ± 20

Lymphocyte stimulation (A₅₄₀)* 0.74 ± 0.05 0.17 ± 0.02

Cytotoxicity (%) 11 ± 3 68 ± 6

*A₅₄₀: optical absorbance at 540 nm.

[00111] Thus, the MDSC of the invention can be isolated from peripheral blood samples of adults and can be distinguished from a variety of other cell types, whether native to the source organism or not. Further, the results demonstrated that storage of the PBM preparations in liquid nitrogen does not compromise the ability of the PBMs to differentiate to MDSCs, indicating that long-term freezing of the PBM preparations for the generation of a cell bank is possible. It is contemplated that cryopreservation of the MDSCs themselves, as well as cells terminally differentiated therefrom, will allow re-population of cells depleted from treatment of various diseases (e.g., following anti-cancer chemotherapy or radiation treatment).

[00112] One of ordinary skill in the art will appreciate that cells exhibiting one or more of the characteristics disclosed in Table 2 can be isolated from different sources of peripheral blood using routine techniques well known in the art. Example 2

Verification of s-MΦ and MDSCs as two distinct cell types

[00113] Unlike s-MΦ, MDSCs contained dividing cells (Fig. Ie) and displayed elevated levels of the hematopoietic stem cell marker CD34 (Randall et al., Stem Cells, 16:38-48 (1998))) (Table 1). In order to determine whether the MDSCs were simply replicating progenitors of s-MΦ, five preparations of cultured peripheral blood monocytes, each from a different human, were treated with 50 ng/ml M-CSF and the number of MDSCs and s-MΦ were determined over a period of 14 days by morphological examination. The results indicated that after 6 days, the number of MDSC increased while the number of s-MΦ decreased (Fig. 2). Based on the growth curve during this time, it was estimated that the MDSC population replicated about every three days. After day 10, the confluent cultures were composed of 80-90% MDSCs (Fig. 2). No such increase was observed in cultures untreated with M-CSF (Fig. 2). Replenishing the cultures with fresh M-CSF on days 5 or 12 had little impact on the appearance or number of MDSCs.

[00114] hi this example, a feature of the MDSCs is resistance to dispersion by trypsin and/or EDTA, or dispase. Standard digestion with trypsin, trypsin-EDTA or dispase for up to 60 minutes failed to remove the MDSCs, which were tightly bound to the surface of the culture dish. Therefore, to obtain cell suspensions for subculture, the MDSCs were dispersed by forceful pipetting after incubation with 2% lidocaine in a PBS solution for 5-8 minutes, with the exception of the work described in Example 8.

[00115] Thus, the MDSCs of the invention are distinguishable from other cells (e.g., s-MΦ) found in peripheral blood. It will be appreciated by one of ordinary skill in the art that mitogenic compounds other than M-CSF, LIF or IL-6 may be used to propagate MDSCs. Further, a skilled artisan will recognize that various growth conditions may be used to the propagate stem cells. Moreover, it is within the skill in the art to optimize result-effective variables of culturing or propagation to optimize or maximize the propagation of MDSCs and its derivatives. Additionally, while the characteristics of MDSCs disclosed herein are sufficient to distinguish these cells from other cell types, it is expected that additional identifying characteristics of MDSCs will be found by those of skill in the art using routine procedures. Example 3

Macrophage and T-lvmphocyte cell differentiation

[00116] To confirm their progenitor nature (i.e., their pluripotency), preparations of 12-14-day-old, M-CSF-treated, monocyte cultures containing 80-90% MDSCs, from each of four different humans (MDSC cultures), were incubated with 1 μg/ml LPS, a macrophage activator (Vadiveloo et al., J. Leukoc. Biol., 66:579-582 (1999)). This treatment transformed the MDSCs into standard macrophages. This transformation was verified by characterization of morphology, lipid staining, increased HLA-DR, HLA-DQ, IL-10 and TNF-α immunostaining (Fig. 3), and cytotoxicity (Table 1).

[00117] To determine whether the MDSCs could also be induced to mature along another blood lineage, the ability of IL-2 to induce T-lymphocyte differentiation was tested. Treatment of four MDSC cultures with 1200 units/ml IL-2 for 4 days induced the cells to acquire a round morphology. This treatment also caused about 90% of the treated cells to express CD3, which is a defining characteristic of mature T-lymphocytes (Schlossman et al., Eds., Leukocyte Typing V: White Cell Differentiation Antigens (Oxford Univ. Press, New York 1995). Roughly 75% of the CD3-positive cells also displayed CD8, which characterizes cytotoxic/suppressor T lymphocytes (Ryffel et al., Proc. Natl. Acad. Sci. USA, 79:7336-7340 (1982); Lederman et al., Hum. Immunol., 60:533-561 (1999)). Control cultures contained 3- 4% of cells that stained for CD3 and CD8. Less than 3% of control or IL-2-treated cells exhibited CD4, a helper T-lymphocyte marker (Schlossman et al., Eds., Leukocyte Typing V: White Cell Differentiation Antigens (Oxford Univ. Press, New York 1995). The IL-2-induced cells also acquired an increased ability to kill target cells, a functional marker for cytotoxic/suppressor T-lymphocytes. Using a 5:1 effector to target cell ratio, the IL-2-induced lymphocytes lysed 35 ± 7% of the target cells compared to 12 ± 3% by control cells.

[00118] Thus, MDSCs of the invention can be induced to differentiate into macrophages or various T-cell lymphocytes by exposure to effective quantities of LPS or IL-2, respectively. One of skill in the art will recognize that other known inducers of macrophage or T-cell differentiation may be substituted for the exemplified inducing compounds, LPS and IL-2. Moreover, skilled artisans will appreciate that suitable dosages of the inducing compounds can be determined using routine techniques well known in the art. It is further expected that known differentiation inducers of any of a wide variety of cell types will result in differentiation of MDSCs into such cell types, and the range of these differentiation inductions is illustrated by this example and the examples that follow.

Example 4

Epithelial cell differentiation

[00119] To determine whether MDSCs differentiate into lineages other than those of blood cells, the ability to differentiate into epithelial cells was initially tested. Four MDSC cultures prepared as described above were treated for 4 days with 100 ng/ml epithelial growth factor (EGF), a promoter of epithelial cell growth and differentiation (Carpenter et al., Curr. Opin. Cell Biol., 5:261-264 (1993)). This treatment induced about 70% of the MDSCs to display an epithelial cell morphology. This treatment also caused 71 ± 4% of the cells to immunostain for pan-keratins and 68 ± 5% to immunostain for E-cadherin, both of which are markers characteristic of epithelial cells (Tseng et al., Cell, 30:361-372 (1982)). Only 4 ± 1% of control cells stained for keratins and 3 ± 2% for E-cadherin. Cells that stained positive for E- cadherin consistently stained for keratins.

[00120] Thus, MDSCs of the invention can be induced to differentiate into non-blood cell types, such as epithelial cells, by exposure to effective quantities of a differentiation inducer, such as EGF. One of skill in the art will recognize that other known inducers of epithelial cell differentiation may be substituted for the exemplified inducing compound, EGF. Moreover, skilled artisans will appreciate that suitable dosages of the inducing compounds can be determined using routine techniques well known in the art. Example 5

Neuronal cell differentiation

[00121] To examine the ability of MDSCs to mature along yet another cell lineage, the effect of nerve growth factor (bNGF), an inducer of neuronal differentiation (McAllister et al., Cell. MoI. Life Sci., 58:1054-1060 (2001)), was tested. Four MDSC cultures prepared as described above were treated with 200 ng/ml bNGF, which caused about 90% of the MDSCs to display a neuronal morphology. These cells had a smaller cell body and displayed neurite- and axon-like processes (Jacovina et al., J. Biol. Chem., 276:49350-49358 (2001)). After 5-8 days these processes, some of which were exceedingly long, formed cell-cell contacts and created the appearance of a neural network. These mature cells were further characterized by immunostaining for neuron-specific enolase (NSE), neurofilament (NF) and microtubule- associated protein -IB (MAP- IB), which are well-known markers of neuronal cells (Encinas et al., J. Neurochem., 75:991-1003 (2000)). After three days of treatment, 25% of the cells displayed robust immunostaining for these three proteins and after 5-8 days, this staining was detected in about 90% of the cells, which at this time was also observed in their processes, especially with regards to MAP-IB. After 5-8 days of incubation, less than 9% of control cells displayed elongated processes and these cells stained only weakly for the neuron-specific antigens. Little to no neuronal differentiation was observed when freshly cultured peripheral blood monocytes were treated with bNGF for 7 or 20 days.

[00122] Thus, MDSCs of the invention can be induced to differentiate into neuronal cells by exposure to effective quantities of bNGF. One of skill in the art will recognize that other known inducers of neuronal cell differentiation may be substituted for the exemplified inducing compound, bNGF and, again, skilled artisans will appreciate that suitable dosages of the inducing compounds can be determined using routine techniques well known in the art. Example 6

Endothelial cell differentiation

[00123] MDSC cultures prepared as described above were treated with 50 ng/ml of recombinant human vascular endothelial growth factor^ isoform (VEGF) for 5-7 days. This treatment induced about 70% of the cells to display endothelial cell morphology. A fraction of these cells formed chains of cobblestone-like formations, some of which were parallel or crossed each other. VEGF -treatment also caused 74 ± 3% of the cells to immunostain for three well-known endothelial cell maturation markers (Karkkainen et al., Nature Cell Biol., 4:E2-5 (2002)), namely VEGF-R2, VEGF-R3 and von Willebrand's Factor (vWF). In the absence of VEGF, only 5 + 1% of the cells stained for these markers. VEGF treatment also induced 31 ± 4% of the cells to immunostain for the neuronal markers NSE, NF and MAP- IB, compared to 7 ± 4% in the absence of VEGF. Nearly all of the NSE-, NF- and MAP- IB-stained cells exhibited a neuronal morphology. A small percentage of cells, which displayed an intermediate morphology between endothelial and neuronal cells, stained for both the endothelial and neuronal markers.

[00124] Thus, MDSCs of the invention can be induced to differentiate into endothelial cells by exposure to effective quantities of VEGF. One of skill in the art will recognize that other known inducers of endothelial cell differentiation may be substituted for the exemplified inducing compound, VEGF. Moreover, skilled artisans will appreciate that suitable dosages of the inducing compounds can be determined using routine techniques well known in the art.

Example 7

Hepatocyte differentiation

[00125] To determine whether MDSCs can also differentiate into liver cells, MDSC cultures prepared as described above were treated for 5-7 days with 100 ng/ml recombinant human hepatocyte growth factor (HGF), a promoter of liver cell growth and differentiation (Michalopoulus and DeFrances, Science 276: 60-66 (1997); Schmidt et al., Nature , 373: 699-702 (1995)). After this treatment, 75-80% of the cells displayed a round or oval-like flattened morphology. It also caused 75± 7% of the treated cells to display immunostaining for albumin and 81 ± 7% to exhibit immunostaining for α fetal protein (AFP) (Table 3), which are specific for differentiated hepatocytes (Hamazaki et al., FEBS Lett. , 497: 15-19 (2001)). A smaller fraction of 33± 4% also immunostained for cytokeratin 7, which is a marker of bile duct epithelium (Ruck et al., Histopathology 31: 324-329 (1997)). Only 8 ± 5% of control cells immunostained for albumin, 6 ± 5% for AFP, and 7 ± 3% for cytokeratin 7.

[00126] Thus, MDSCs of the invention can be induced to differentiate into hepatocytes by exposure to effective quantities of HGF. One of skill in the art will recognize that other known inducers of hepatocyte differentiation may be substituted for the exemplified inducing compound, HGF and, again, skilled artisans will appreciate that suitable dosages of the inducing compounds can be determined using routine techniques well known in the art.

[00127] Further, the separate inductions of lymphocytic, epithelial, neuronal, endothelial and hepatocyte cell differentiation from MDSCs, which were associated with a somewhat lower cell number than the control (Fig. 5), were characterized by a marked decrease or disappearance of MAC-I expression.

Table 3

Example 8

Platelet differentiation

[00128] Human MDSCs were isolated and cultured either as described above or as described herein. Briefly, 25-50 ml of heparinized peripheral blood aspirate is mixed with an equal volume of phosphate-buffered saline (PBS) and is centrifuged at 900 x g for 10 minutes at room temperature. Washed cells are resuspended in PBS to a final density of 2 x 10⁷ cells/ml and a 10 ml aliquot is layered over a 1.073 g/ml solution of Percoll (Pfizer, Piscataway, NJ.) and centrifuged at 900 x g for 30 minutes at 25°C. MDSCs collecting at the interface are recovered, washed once in PBS, resuspended in human MDSC medium and expanded in the presence, or absence, of a platelet-inducing agent as defined herein. The cells are plated at a density of 3x10⁷ cells/185 cm² flask.

[00129] CD34⁺ cells are the precursors to megakaryocyte precursor cells arising in these cultures are identified using the CD34 Progenitor Cell Selection System (DYNAL) according to the procedure recommended by the manufacturer. In particular, the MDSC cultures are diluted 1 :2 with Hank's buffered saline (HBS) (Life Technologies). Suspended cells are recovered by centrifugation and suspended at a density of 2x10⁷ cells/ml. Ten ml aliquots of the cell suspensions are each layered over a 1.077 gm/ml Ficoll (Pfizer) solution. The mononuclear cells in the buffy coat are recovered from the interface and processed for CD34 cell selection using the DYNAL cell selection system.

[00130] To determine if the megakaryocyte progenitor CD34⁺ cells derived from the isolated MDSCs continue to differentiate, ultimately leading to the production of megakaryocytes and platelets, cultures of the CD34⁺ cells, with and without platelet-inducing agent(s), are established in duplicate for immuno- histochemistry analysis. The cells are seeded in four-welled chamber slides with 1000 or 2000 CD34⁺ cells in each well. The identity and amount of any platelet- inducing agent(s), added to a given well is kept constant at physiologically active levels known in the art. Samples are incubated in Iscove's medium supplemented with 10 mg/ml bovine serum albumin (BSA), 10 μg/ml human insulin, 200 μg/ml human transferrin, (BIT medium, Stem Cell Technologies, British Columbia, Canada), 10^"4 M 2-mercaptoethanol (Sigma Chem. Co., St. Louis), plus 40 μg/ml low density lipoproteins (LDL) (Sigma Chem. Co.). The suspension cultures are incubated unperturbed, for a period ranging from 5 to 12 days at 37°C. At the end of days 5 and 11 , all adherent cells in each chamber are fixed and stained, as described below.

[00131] Cultures for the megakaryocytopoiesis assays are set up with 1- 2x10⁵ cells of the purified CD34⁺ cells in Megacult medium with no platelet-inducing agent(s), or in BIT medium (basal media supplied by Stem Cell Technology). The latter medium is supplemented with 40 μg/ml LDL and 10^~4 M 2-mercaptoethanol. The cultures are set up with 5 ml media in six -well tissue culture plates and the cells are incubated at 37°C for the length of the experiment (5-12 days) in an atmosphere of 5% CO₂ in air in a humidified incubator. Measurements at each time point are preferably performed in duplicate. To characterize the phenotype of the cultured cells (day 5 and day 12), the non-adherent cells from each well are removed and pooled with the respective washes. The adherent cells from each well are dislodged with 0.5 mM EDTA in PBS and the FACS analysis of each of these samples is done separately. Cells are resuspended and washed twice in FACS buffer (PBS/2% bovine serum albumin/0.1 % sodium azide) before staining with anti-CD34- APC and anti- CD41/61 conjugated to PE, respectively. Cells are fixed with 2% paraformaldehyde in the FACS buffer before the FACS analysis. (See, e.g., U.S. Patent No. 4520,110, incorporated by reference in its entirety)

[00132] The cells in suspension are removed along with the medium and the adherent cell layer is washed twice with PBS. The washes are pooled with the cells in suspension and centrifuged at 500x g for 20 minutes. The adherent cells from the cultures are trypsinized at room temperature and recovered by centrifugation at 90Ox g for 20 minutes. Cells are finally washed, collected in FACS buffer, and incubated at room temperature for 20 minutes with 2 μg/ml of the primary antibodies - CD34-APC (Becton Dickinson, Mountain View, Calif.), CD41-PE and CD-61-FITC (PharMingen, San Diego). Cells are washed twice in FACS buffer and finally resuspended in 0.25 ml of stop buffer. Cells are analyzed by collecting 10,000 events on a Becton Dickinson FACS instrument using Cell-Quant software. [00133] Immunostaining is performed on the cells cultured in chamber slides. Cells are gently washed with PBS to wash the cells without dislodging the adherent cells/cell complexes. Cells are fixed in acetone on ice for 5 minutes, followed by two ten-minute washes with PBS. Non-specific antibody binding sites on the cells are blocked with 5% normal goat serum, followed by the addition of appropriate antibody. Cultured cells are stained with three different antibodies. SH-3 antibody (conjugated to biotin), which recognizes a surface marker on human mesenchymal stem cells, is used as the primary antibody, followed by the addition of streptavidin conjugated to cascade blue as the secondary reagent. This procedure is followed by two washes with PBS and addition of anti-CD41-PE and anti-CD34- FITC monoclonal antibodies. Staining of the cells is done with SH-3-FITC and anti- CD41-PE using techniques known in the art. All samples are incubated in the dark for 20 minutes at room temperature. The slides are washed in PBS for an additional 20 minutes before mounting in Aquamount and visualizing under the microscope.

[00134] Incubation of an MDSC with a platelet- inducing agent(s), is expected to produce CD34⁺ cells. After approximately 48 hours in culture, it is expected that a detectable fraction of the cultured MDSCs will have differentiated into CD34⁺ and CD34/41⁺ cells; within 5 days, large lobulated cells are expected to be visible. By day 12 of culture, relatively dense clusters of CD41⁺/61⁺ cells are expected to release platelets into the culture medium. In contrast, MDSCs alone, or CD34⁺ derivatives thereof alone, are not expected to produce significant numbers of platelets under these culture conditions.

[00135] To determine whether platelet-inducing agent(s) exposure to MDSCs could support CD34⁺ and megakaryocyte differentiation in a defined medium, the cultures are analyzed by immunostaining, e.g., triple immuno¬ fluorescence is performed. Staining on day 5 or day 12 with SH-3 cascade-blue, anti- CD41-PE and anti CD34-FITC monoclonal antibodies is performed on cultures to monitor differentiation of the megakaryocyte precursor CD34⁺ cells. It is expected that FITC-stained CD34⁺ cells will be observed, most likely at about 1% of the total cell number. [00136] Immunostaining the cells is expected to reveal expression of CD41 or CD61 surface markers in approximately 20% of the input CD34 cell population by day five. The number of differentiating cells (CD41⁺ or CD61⁺) is not expected to substantially increase by day 12. The earliest production of platelets from the differentiated and maturing megakaryocytes is expected to be seen around day 4, with a steady increase in platelet population up to days 10 and 11. The frequency of double-labeled cells positive for both CD34⁺ markers and megakaryocyte markers is expected to be about 3-5% as seen by staining at day 5 and throughout the culture period. Only a small number (<1%) of the anchored MDSCs are expected to retain their CD34 marker.

[00137] The triple immune-fluorescence observations may be further substantiated by FACS analysis to demonstrate that MDSCs have a role in the regulation of megakaryocyte differentiation and platelet production.

[00138] Highly purified CD34⁺ cells (purity>96%) may be analyzed for the presence of surface markers for megakaryocyte progenitors (CD34), megakaryocyte marker (CD41) and platelet markers (CD41/CD61). Both the size and positivity of the cells for the respective markers are amenable to analyses. FACS analysis at days 0, 5 and 12 is expected to show progression of the cell phenotype from 2-6% CD41⁺ to more than 50% CD41⁺ on day 5-12. A more dramatic increase is expected for the number of platelets (CD41/CD61 double positive) present at days 5 and 12 of culture. Although a large number of cells may appear to retain their CD34 phenotype, >10% are expected to also be CD41 or CD61 double positive.

[00139] FACS analysis of the cultures is expected to confirm the appearance of platelets between days 5-12 by their dual reactivity to CD41 and CD61 markers. A majority of the platelets produced during the culture period will tend to adhere to the MDSC cell layer. FACS data should show >50% of the CD41/CD61 signal being associated with the MDSC stromal cell layer, therefore making the quantitation of the platelet production difficult. Both staining and FACS data, howver, are expected to yield unambiguous evidence of the differentiation of the starting MDSCs, or CD34⁺ cells, towards the megakaryocyte lineage. Example 9

Pancreatic islet β-cell-like macrophage differentiation

[00140] Human MDSCs were isolated and cultured either as described above or as described herein.

Material and Methods

[00141] Cells. MDSCs cultured in 8-well Lab-Tek chamber slides (Nunc, Naperville, IL)) were treated for 3-5 days with 1 mg/ml LPS (Sigma) or 20 mg/ml CD40Ab (R&D System, Minneapolis, MN)) in the presence of low (5 mM) or high (25 mM) glucose (Sigma). Human pancreatic islets were digested as described in Ricordi, C, et al., Diabetes 38 Suppl 1, 140-142(1989) and purified on COBE 2991 (Mediatech, Herndon, VA) using a continuous Ficoll gradient.

[00142] Immunostaining. Tissue slides (Biochain, Hayward, CA) were immunostained after deparaffinization with AutoDewaxer (Phoenix Biotechnologies, Huntsville, AL). The secondary antibodies were peroxidase-, FITC-, or Texas Red® dye-conjugated affiniPure anti-mouse, donkey, goat or Guinea pig antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA). Peroxide immunoreactivity was demonstrated with a DAB substrate kit (BD PharmingenTM, San Diego, CA) after blocking non-specific sites with ImmunoPure® Peroxidase Suppressor (Pierce, Rockford, IL). Isotype-matched antibodies served as controls. Human macrophages served as positive controls. Mouse monoclonal antibodies (mAbs) to CD 14-PE, CD20, CD45-Cy-Chrome, CD64, and CD83 were from BD PharMingen (San Diego, CA), IL-12p70, CD3 from BioSource International (Camarillo, CA), Mac-1 and insulin from Sigma, and IgGl was from R&D Systems. Guinea pig anti-human C-peptide antibody was from Linco Research (St. Charles, MO) and goat anti-human polyclonal antibodies to GLUT-2, GCKR, PDX-I, NKX6.1, Surl , and Kir6.2 were from Santa Cruz Biotechnology (Santa Cruz, CA). In double CD 14 and CD45 staining, after reacting with the primary and secondary antibodies, the cells were re-stained with CD 14-PE or CD45-Cy-Chrome. Immunostaining for the different antigens and insulin immuno-quantification was done as previously described (Zhao, Y., et al., Proc. Natl. Acad. Sci. USA, 100: 2426-2431(2003). Non-specific esterase staining was performed using a-Naphthyl Acetate Esterase kit (Sigma). [00143] Transmission electron microscopy. Untreated or treated MDSC cultures were incubated in high glucose in 8-well Permanox® Slides (Nunc, Naperville, IL). Freshly human isolated islets were fixed for 2h with 2% glutaraldehyde in cacodylate buffer at room temperature and the further sample preparation was done as described in Zhu, X., et al., Proc. Natl. Acad. ScL (U S A), 99:10299-10304 (2002). Fifty randomly selected cells were photographed using the Philips CM- 120 transmission electron microscope.

[00144] Nested RT-PCR. Nested RT-PCR was performed using the QIAGEN® OneStep RT-PCR kit (Qiagen, Valencia, CA), with the following: insulin forward-ATGGCCCTGTGGATGCGCCTCCT (SEQ ID NO: 1) (PCR product size 324 bp), insulin forward nested-ACCCAGCCGCAGCCTTTGTGAA (SEQ ID NO: 2) (PCR product size 266 bp), insulin reverse- GT AGTTCTCCAGCTGGT AGAGGG (SEQ ID NO: 3), glyceraldehyde phosphate dehydrogenase (GAPDH) forward- TTAGCACCCCTGGCCAAGG (SEQ ID NO: 4) (PCR product size 54 lbp), GAPDH forward nested- TGGACCTGACCTGCCGTCTAGAA (SEQ ID NO: 5) (PCR poduct size 282 bp), GAPDH reverse- CTTACTCCTTGGAGGCCATG (SEQ ID NO: 6). Both PCR rounds were done using 40 cycles consisting of 30 seconds at 94⁰C, 1 minute at 58⁰C, and 1 minute at 72⁰C. First round PCR products were diluted 1 :100 prior to the nested PCR. Final PCR products were electrophoresed through 1.7% agarose with ethidiumbromide and visualized by UV.

[00145] Insulin release. MDSC cultures incubated in 24-well tissue culture plates (Costar, Cambridge, MA) at 70-80% confluence were treated for 4-5 days with LPS or CD40Ab. Insulin secretion was assessed as previously described in Schuit, F., et al.,. J Biol. Chem. 272:18572-18579 (1997), using an insulin ELISA kit (Linco Research, MO). When required, the untreated or treated cultures were also pre- incubated for 30 min with 50OmM diazoxide, 1OmM tolbudamide, or 10OmM IBMX.

[00146] Phagocytosis. Phagocytosis was demonstrated as described in Swanson, J. A., et al., J. Cell Biol. 115:941-948 (1991). Untreated or treated MDSC cultures and overnight cultured isolated islet cells in 8-well Lab-Tek were incubated with 3.5 mg/ml of 1OkD Dextran Alexa Fluor 647 (Molecular Probes Inc., Eugene, OR) and 3-5 hours later were rinsed 3 times with PBS to remove loosely bound beads. The slides were then mounted with phosphate-buffered gelvatol, and viewed or photographed using a Leitz Orthoplan microscope and Hamamatsu C2400 C-SIT camera.

[00147] Islet cell sorting and flow cytometry. After dissociation with 2% lidocaine for 3-5 minutes at room temperature and forceful pipetting, the single islet cells were washed with PBS, fixed in 4% formaldehyde in PBS, washed again with PBS and immunostained. Cell sorting and flow analysis were carried out using a 10- detector Cytomation MoFIo high-speed cell sorter (Becton Dickinson).

[00148] Results

[00149] Blood monocytes were incubated with 50 ng/ml macrophage- colony stimulating factor for 7-9 days. The treatment resulted in cultures containing 70-80% cells with MDSC morphology with the remaining displaying standard round macrophage morphology; these MDSC-enriched cultures were termed MDSC cultures. Immunostaining with an anti-insulin monoclonal antibody (MAb) (mouse anti-human monoclonal antibody (Sigma, Catalogue No: 1 2018)) revealed that about 5% of the cells in the MDSC cultures, which exhibited standard macrophage appearance, stained faintly for insulin.

[0015.0] To determine whether cells in the MDSC cultures were capable of producing insulin, we incubated MDSC cultures with two known macrophage activators, namely lipopolysaccharide (LPS) and CD40Ab in the presence of high (25 mM) glucose concentration known to stimulate insulin production in beta-cells. Treatment with these activators caused more than 95% of the cells to exhibit standard macrophage appearance and more than 80% of these cells displayed insulin staining and were designated pancreatic islet β-cell-like macrophages (Fig. 6A), while the control had about 5% of faintly stained cells.

[00151] To further characterize the nature of these insulin positive cells, immunostaining for seven other beta-cell markers was performed: C-peptide (a byproduct of insulin biosynthesis), glucose transporter 2 (GLUT2), glucokinase regulatory protein (GCKR), PDX-I and NKX6.1 (transcription factors involved in islet cell development), and ATP-dependent K⁺ channel (KATP) (a Surl/Kir6.2 component). LPS or CD40 MAb treatment in the presence of the high glucose caused more than 80% of the cells in the MDSC cultures to display staining for these markers (Fig. 6A), while controls had less than 10% faintly stained cells. [00152] Transmission electron microscopy of LPS- and CD40Ab-treated cells revealed many halo granules of different sizes, which resemble granules of developing beta-cells (Fig. 6B). The control cells in regular 5mM glucose RPMI 1640 culture medium showed no or a few granules. These granules were observed only infrequently in control cells.

[00153] To further substantiate the induction of insulin production, quantitative immunostaining was performed to determine the level of insulin production in MDSC cultures treated with LPS or CD40Ab in the absence of serum. The results indicated that in the presence of high glucose this treatment caused a marked increase in insulin level, which was noticeably lower than that of islet beta- cells (Fig. 6C).

[00154] To ensure that insulin staining was due to gene expression and not merely to uptake from serum present in culture medium, nested RT-PCR was performed. The results indicated that LPS- or CD40Ab-treated MDSC cultures express the insulin gene, which was markedly increased in the presence of high glucose (Fig. 6D). Control cultures exhibited low background levels. DNA bands from 3 different nested RT-PCR experiments were sequenced and confirmed that they code for human insulin. By means of ELISA, LPS- or CD40Ab-treatment was shown to cause a glucose-dependent insulin release (Fig. 6E, left panel). Moreover, in the presence of high glucose, diazoxide, a KATP channel activator, effectively inhibited LPS- or CD40Ab-induced insulin release (Fig. 6E, middle panel). Mannite, which at 25 mM yields an osmolarity similar to that of 25 mM glucose, caused little to no insulin release (Fig. 6E, right panel). In contrast, in the presence of low glucose (5 mM), LPS- or CD40Ab- induced insulin release was markedly stimulated by tolbutamide, a sulfonylurea inhibitor of a KATP channel, and by isobutyl-1- methylxanthine (IBMX), an inhibitor of cyclic- AMP phosphodiesterase (Fig. 6F). The inhibitors or stimulators had little to no effect on insulin release in control cultures.

[00155] To confirm the macrophage character of the insulin-producing cells, the phenotype of cells treated with or without LPS or CD40Ab in the presence of high glucose was examined. The results indicated that treated cells acquired standard macrophage morphology while most control cells maintained the typical MDSC appearance (Fig. 7A). Additionally, more than 95% of untreated or treated cells expressed the macrophage antigens Mac-1, CD14, CD64, and the general blood antigen CD45, and exhibited phagocytosis (Fig. 7B), a functional macrophage marker. These studies demonstrate that LPS or CD40Ab treatment in the presence of high glucose causes a MDSC to differentiate into a macrophage with beta-cell-like characteristics (i.e., pancreatic islet β-cell-like macrophage) including its hallmark trait, glucose-dependent insulin production and release.

[00156] Macrophage-like features of pancreatic β-cells. The observed association between β-cell and macrophage features in LPS- and CD40Ab-treated MDSC cultures indicated that such a relationship could be expected for pancreatic islet beta-cells. To test for this likelihood, fixed pancreatic tissue slides were obtained from 5 healthy humans aged 26-77. Light microscopy examination of serial sections of these slides stained with hematoxylin revealed normal islet architecture with most islet cells having single intact nuclei, thus lessening the possibility of latent in situ phagocytosis. Moreover, islet cells failed to exhibit noticeable staining for CD3, a T- lymphocyte marker, or CD20, a B-lymphocyte marker (Fig. 8A). The occasional CD3- or CD20-positive cells were usually found within the perimeter of blood vessels (Fig 8A, insets). Similar to standard macrophages, islet cells also displayed a faint staining for the dendritic cell markers CDIa and CD83 (Fig. 8B). The presence of CD3-, CD20-, CDIa- and/or CD83-positive cells could have signified an underlying inflammatory process. The absence of the aforementioned markers indicated that dormant insulitis was not present.

[00157] To examine β-cells for macrophage characteristics, serial sections of pancreatic tissue were initially stained for insulin and CD45. The results indicated that islets were positive for insulin and CD45 (Fig. 8C). In contrast, serial sections of adult brain, liver and colon tissues failed to display this blood antigen (the rarely observed positive stained cells were consistent with the trace presence of blood cells). In addition, pancreatic tissue slides were stained for functional macrophage markers, such as interleukin (IL)-12p70, and nonspecific esterase (NSE) activity. The results indicated that the islets displayed a robust staining for these markers (Fig. 8D). Double immunostaining revealed that these islets concomitantly displayed both β-cell and macrophage indicators, namely insulin and CD45, insulin and CD 14, and C- peptide and Mac-1 (Fig. 8E). The exceptions were GLUT2-positive islets, which were either positive or negative for CD64 (Fig. 8E). Freshly isolated islets also immunostained positive for CD45 and CD 14 (Fig. 9A).

[00158] To substantiate the association between β-cell and macrophage characteristics at the single cell level, dissociated human pancreatic islet cells stained for insulin and CD 14 or CD45 were examined by flow cytometry. In one experiment, the dissociated cells were co-stained with antibodies to both insulin and CD 14. The results showed that 64% of the cells stained for both insulin and CD 14, while most other cells failed to exhibit the double stain pattern (Fig. 9B, left lower panel). Re- staining of the sorted double-negative cells for CD45 yielded negative results (Fig. 9B, right lower panel), implying that these non-β-cells are most likely not of blood origin. In another experiment, a population of insulin-positive cells were initially selected by cell sorting (Fig. 9C, left). These sorted cells were then re-stained for CD45. The results indicated that nearly all of the insulin-positive cells stained for CD45 (Fig. 9C, right). These studies further support the position that β-cells represent a special type of macrophage.

[00159] To further support this concept, dissociated cells of freshly cultured human islet from 3 healthy donors were examined for the presence of insulin, C- peptide, GLUT2 and PDX-I (beta-cells indicators); CD45, CD- 14, Mac-1 and CD64 (macrophage indicators); and dextran phagocytosis, a functional macrophage trait. Triple staining for these markers indicated a widespread overlap in positively stained cells (Fig. 9D). In addition, double immunostaining of such cells for β-cell markers and cytokines, typically produced by standard macrophages, indicated that islet beta- cells expressed high levels of IL-6, IL-10, and, especially, IL-12 p70 (Fig. 9E). However, immunostaining for IL-I or TNFα (inflammatory cytokines that participate in pathophysiological responses) was weak (Fig.9E). Thus, the experiments described herein indicate that islet β-cells display typical macrophage markers, including functional indicators such as phagocytosis and cytokine production. Example 10

Clonal analysis

[00160] To determine whether progeny of colonies derived from single MDSCs can be induced to differentiate into distinct cell lineages, cells from a five- day, 50 ng/ml, M-CSF-treated culture enriched to contain 99.97% peripheral blood monocytes were inoculated into 12 U-bottom tissue culture plates, 96 wells each, at 0.8 cells/well in 0.1-0.2 ml growth medium. The cells were then incubated in the presence of 50 ng/ml M-CSF and 1,000 units/ml LIF for 15-20 days. Additionally, one plate was incubated with 25% conditioned medium from a five-day, 50 ng/ml, M- CSF treated culture. Microscopic inspection revealed that about 70% of the wells contained single cells, when examined after 1 day. The few wells that contained more than one cell were excluded from further experimentation. Medium was replaced every 5-7 days. At 20 days, there were about 5 colonies/plate (about 30 cells/colony). Further incubation caused the cells in most of these colonies to acquire distinct morphologies characteristic of different cell lineages and thereafter to die.

[00161] A number of colonies in the plate treated with the conditioned medium continued to grow. At 45-52 days, these cells were dispersed by forceful pipetting, without lidocaine, into flat-bottom, 96-well, tissue culture plates. The untreated cells displayed CD 14, CD34 and CD45 cell surface antigens, and most (-85%) displayed a morphology characteristic of MDSCs. Two colonies of MDSCs, each of which had arisen from a single cell, were chosen for further differentiation experiments and were termed Clone 1 and Clone 2. Seven days after treatment with 1200 units/ml IL-2, 100 ng/ml EGF, 200 ng/ml NGF, 50 ng/ml VEGF or 50 ng/ml HGF, the cells were stained with lineage-specific antibodies. These antibodies separately recognized cell-surface markers that included the T lymphocyte marker CD3, the epithelial marker keratin, the endothelial marker vWF, the neuronal marker MAPl-B, and the hepatocyte marker AFP. The results indicated that the differentiation inducers evoked morphologies consistent with the expected lineages in a majority of the treated cells and were similar to those previously observed for inducer-treated MDSC cultures. As shown in Table 4, 70-90% of the treated cells displayed maturation markers that characterize the specific mature state (Table 4). These observations indicate that progeny of single MDSC have the ability to be induced to differentiate into distinct cell lineages, and as a consequence further confirmed the pluripotent nature of the MDSCs.

[00162] Thus, according to methods of the invention, single monocytes can generate an MDSC colony, and the progeny of these cells can be induced to differentiate into a variety of non-terminally and terminally differentiated cell types. Further, a differentiated cell generated using the methodology disclosed herein can be used in a method for identifying a therapeutic compound, such as a cell type-specific therapeutic compound.

[00163] In methods for identifying therapeutic compounds, techniques known in the art are practiced to bring candidate therapeutic compounds into contact with a differentiated cell. In one embodiment, a candidate therapeutic compound is separately brought into contact with a differentiated cell of a first type (e.g., a neuronal cell) and a differentiated cell of a second type (e.g., a macrophage) with the subsequent measurement of the absolute or relative viabilities of the cells. Viability is assessed in terms of any measure acceptable in the art, including a determination of absolute or relative cell number(s), as well as any acceptable measure of the absolute or relative health of a cell (e.g., energy store). Candidate therapeutic compound concentrations are optimized by routine screening using conventional techniques.

Table 4

Inducer Lineage Marker Treatment Clone 1 Clone 2

Immunostamed cells (%)

IL-2 Lymphocyte CD3 6 3

+ 75 81

EGF Epithelial Keratins 7 5

+ 89 76

NGF Neuronal MAPl-B 3 4

+ 83 80

VEGF Endothelial vWF 8 5

+ 80 87

HGF Hepatocyte AFP 7 2

+ 88 75 [00164] The examples herein demonstrate that MDSCs can be induced to differentiate into a variety of cell types from all three germ layers and it is expected that inducers of any of a wide variety of cell type differentiations will be effective with MDSCs.

[00165] Numerous modifications and variations of the invention as set forth in the above illustrative examples are expected to occur to those skilled in the art and are contemplated by the invention. Consequently, only such limitations as appear in the appended claims should be placed on the invention.

Claims

CLAIMS What is claimed is:

1. A method of generating a pancreatic islet β-cell-like macrophage comprising the step of contacting a MDSC with at least one pancreatic islet β-cell-like macrophage-inducing agent, wherein said agent or agents are collectively present in an amount effective to induce differentiation of the MDSC into a pancreatic islet β- cell-like macrophage.

2. The method according to claim 1 further comprising cryopreserving said pancreatic islet β-cell-like macrophage.

3. The method according to claim 1 wherein the pancreatic islet β-cell-like macrophage-inducing agent is selected from the group consisting of lipopolysaccharide (LPS), CD40 monoclonal antibody (CD40Ab), and glucose.

4. The method according to claim 1 wherein the MDSC is a human MDSC.

5. The method according to claim 4 wherein the MDSC is an adult human MDSC.

6. A method of generating a pancreatic islet β-cell-like macrophage comprising the steps of:

a) isolating a MDSC comprising the steps of: i) isolating a peripheral-blood monocyte (PBM); ii) contacting said PBM with an effective amount of a mitogenic compound selected from the group consisting of macrophage colony- stimulating factor (M-CSF), interleukin-6 (IL-6), and leukemia inhibitory factor (LIF); and iii) culturing said PBM under conditions suitable for propagation of said cell, thereby obtaining a preparation of an isolated MDSC; and b) contacting the MDSC with at least one pancreatic islet β-cell-like macrophage-inducing agent, wherein said agent or agents are collectively present in an amount effective to induce differentiation of the cell into a pancreatic islet β-cell- like macrophage.

7. The method according to claim 6 further comprising cryopreserving said pancreatic islet β-cell-like macrophage.

8. The method according to claim 6 further comprising culturing said pancreatic islet β-cell-like macrophage.

9. The method according to claim 8 wherein the pancreatic islet β-cell-like macrophage-inducing agent is selected from the group consisting of lipopolysaccharide (LPS), CD40 monoclonal antibody (CD40Ab), and glucose.

10. The method according to claim 6 wherein the MDSC is an adult human MDSC.

11. A method for identifying a pancreatic islet β-cell-like macrophage- specific therapeutic agent comprising:

(a) contacting a pancreatic islet β-cell-like macrophage obtained according to the method of claim 1 and a candidate therapeutic agent;

(b) further contacting a cell terminally differentiated from an MDSC selected from the group consisting of an epithelial cell, an endothelial cell, a macrophage, a T-lymphocyte, a hepatocyte, a neuronal cell, and a platelet, and the candidate therapeutic agent;

(c) measuring the viability of the pancreatic islet β-cell-like macrophage relative to the viability of the differentiated cell, wherein a difference in viabilities identifies the candidate therapeutic agent as a pancreatic islet β-cell-like macrophage- specific therapeutic agent.

12. A method of treating a pancreatic islet β-cell-like macrophage disorder comprising administering a therapeutically effective number of a pancreatic islet β- cell-like macrophage obtained by the method according to claim 1.

13. The method according to claim 12 wherein the pancreatic islet β-cell-like macrophage disorder is selected from the group consisting of insulin-dependent diabetes mellitus (EDDM), type 2 diabetes mellitus, hyperglycemia, hyperlipidemia, obesity, Metabolic Syndrome, and hypertension.

14. Use of a pancreatic islet β-cell-like macrophage according to claim 1 in the preparation of a medicament for the treatment of a pancreatic islet β-cell-like macrophage disorder.

15. A method of treating a disorder comprising administering a therapeutically effective number of a pancreatic islet β-cell-like macrophage obtained by the method according to claim 6.

16. The method according to claim 15 wherein the pancreatic islet β-cell-like macrophage disorder is selected from the group consisting of insulin-dependent diabetes mellitus (IDDM), type 2 diabetes mellitus, hyperglycemia, hyperlipidemia, obesity, Metabolic Syndrome, and hypertension.

17. Use of a pancreatic islet β-cell-like macrophage according to claim 6 in the preparation of a medicament for the treatment of a pancreatic islet β-cell-like macrophage disorder.

18. An isolated pancreatic islet β-cell-like macrophage.

19. An isolated collection of cells comprising pancreatic islet β-cell-like macrophage of claim 18, wherein said collection of cells is composed of at least 80% pancreatic islet β-cell-like macrophages.

20. An isolated pancreatic islet β-cell-like macrophage produced according to the method of claim 1.

21. An isolated pancreatic islet β-cell-like macrophage produced according to the method of claim 6.

22. A method of transplanting an isolated pancreatic islet β-cell-like macrophage into an organism in need thereof comprising the steps of:

(a) obtaining an isolated pancreatic islet β cell-like macrophage; and

(b) administering the pancreatic islet β cell-like macrophage to an organism in need, thereby transplanting the macrophage into the organism in need.

23. The method according to claim 22 further comprising generating the pancreatic islet β cell-like macrophage from a monocyte derived stem cell (MDSC).

24. The method according to claim 23 further comprising generating the MDSC from a peripheral blood monocyte (PBM).

25. The method according to claim 22 wherein said isolated pancreatic islet β- cell-like macrophage is autologous to the organism in need thereof.

26. A kit comprising a pancreatic islet β-cell-like macrophage according to claim 18, and a set of instructions for administration of said pancreatic islet β-cell-like macrophage to an organism in need thereof.