WO2006042418A1 - Antiviral oligonucleotides - Google Patents

Abstract

Random sequence oligonucleotides that have antiviral activity are described, along with their use as antiviral agents. In many cases, the oligonucleotides are greater than 40 nucleotides in length and include chemical modifications, such as modified internucleotidic linkages and modifications at the 2'-position of the ribose moieties. Also described are uses for the prophylaxis or treatment of a viral infection in a human or animal, and use for the prophylaxis or treatment of cancer caused by oncoviruses in a human or animal. The uses typically involve administering to a human or animal in need of such treatment, a pharmacologically acceptable, therapeutically effective amount of at least one oligonucleotide that act by a sequence independent mode of action.

Description

ANTIVIRAL OLIGONUCLEOTIDES

FIELD OF THE INVENTION

The present invention relates to oligonucleotides having antiviral activities and their use as therapeutic agents in viral infections caused by human and animal viruses and in cancers caused by oncogene viruses and in other diseases whose etiology is viral- based.

BACKGROUND OF THE INVENTION

The following discussion is provided solely to assist the understanding of the reader, and does not constitute an admission that any of the information discussed or references cited constitute prior art to the present invention.

Many important infectious diseases afflicting mankind are caused by viruses. Many of these diseases, including rabies, smallpox, poliomyelitis, viral hemaoragghic fevers, hepatitis, yellow fever, immune deficiencies and various encephalitic diseases, are frequently fatal. Others are significant in that they are highly contagious and create acute discomfort such as influenza, measles, mumps and chickenpox, as well as respiratory or gastrointestinal disorders. Others such as rubella and cytomegalovirus can cause congenital abnormalities. Finally there are viruses, known as oncoviruses, which can cause cancer in humans and animals.

Among viruses, the family of Herpesviridae is of great interest. The Herpesviridae are a ubiquitous class of icoshedral, double stranded DNA viruses. Of over 100 characterized members of Herpesviridae (HHV), only eight infect humans. The best known among these are Herpes simplex type 1 (HSV-1), Herpes simplex type 2 (HSV-2), Varicella zoster (chicken pox or shingles), cytomegalovirus (CMV) and Epstein-Barr virus (EBV).

The prevalence of Herpes viruses in humans is high, affecting at least one third of the worldwide population; and in the United States, 70-80% of the population have some kind of Herpes infection. While the pathology of Herpes infections are usually not dangerous, as in the case of HSV-1 which usually only causes short lived lesions around the mouth and face, these viruses are also known to be the cause of more dangerous symptoms, which vary from genital ulcers and discharge to fetal infections which can lead to encephalitis (15% mortality) or disseminated infection (40% mortality).

Herpes viruses are highly disseminated in nature and highly pathogenic for man. For example, Epstein-Barr virus (EBV) is known to cause infectious mononucleosis in late childhood or adolescence or in young adults. The hallmarks of acute infectious mononucleosis are sore throat, fever, headache, lymphadenopathy, enlarged tonsils and atypical, dividing lymphocytes in the peripheral blood. Other manifestations frequently include mild hepatitis, splenomegaly and encephalitis. EBV is also associated with two forms of cancer: Burkitt's lymphoma (BL) and the nasopharyngeal carcinoma (NPC). In endemic areas of equatorial Africa, BL is the most common childhood malignancy, accounting for approximately 80% of cancers in children. While moderately observed in North American Caucasians, NPC is one of the most common cancers in Southern China with age incidence of 25 to 55 years. EBV, like the cytomegalovirus, is also associated with post-transplant lymphoproliferative disease, which is a potentially fatal complication of chronic immunosuppression following solid organ or bone marrow transplantation.

Other diseases are also associated with HSV, including skin and eye infections, for example, chorioretinitis or keratoconjunctivitis. Approximately 300,000 cases of HSV infections of the eye are diagnosed yearly in the United States.

AIDS (acquired immunodeficiency syndrome) is caused by the human immunodeficiency virus (HIV). By killing or damaging cells of the body's immune system, HIV progressively destroys the body's ability to fight infections and certain cancers.^" There are currently approximately 42 million people living with HIV/AIDS worldwide. A total of 3.1 million people died of HIV/AIDS related causes in 2002. The ultimate goal of anti-HIV drug therapy is to prevent the virus from reproducing and damaging the immune system. Although substantial progress has been made over the past fifteen years in the fight against HIV, a cure still eludes medical science. Today, physicians have more than a dozen antiretroviral agents in three different drug classes to manage the disease. Typically, drugs from two or three classes are prescribed in a variety of combinations known as HAART (Highly Active AntiRetroviral Treatment). HAART therapies typically comprise two nucleoside reverse transcriptase inhibitors drugs with a third drug, either a protease inhibitor or a non-nucleoside reverse transcriptase inhibitor. Clinical studies have shown that HAART is the most effective means of reducing viral loads and minimizing the likelihood of drug resistance.

While HAART has been shown to reduce the amount of HIV in the body, commonly known as viral load, tens of thousands of patients encounter significant problems with this therapy. Some side effects are serious and include abnormal fat metabolism, kidney stones, and heart disease. Other side effects such as nausea, vomiting, and insomnia are less serious, but still problematic for HIV patients that need chronic drug therapy for a lifetime.

Currently approved anti-HIV drugs work by entering an HIV infected CD4+ T cell and blocking the function of a viral enzyme, either the reverse transcriptase or a protease. HIV needs both of these enzymes in order to reproduce. However, HIV frequently mutates, rendering reverse transcriptase or protease inhibitor drugs ineffective against these resistant strains. Once resistance occurs, viral loads increase and dictate the need to switch the ineffective agent for another antiretroviral agent. Unfortunately, when a virus becomes resistant to one drug in a class, other drugs in that class may also become less effective. This phenomenon, known as cross-resistance, occurs because many anti-HIV drugs work in a similar fashion. The occurrence of drug cross-resistance is highly undesirable because it reduces the available number of treatment options for patients.

There is therefore a great need for the development of other antiviral agents effective against HIV that work through other mechanisms of action against which the virus has not developed resistance. This is becoming especially important in view of recent data showing that 1 out of 10 patients newly diagnosed with HIV in Europe, is infected with a strain of HIV already resistant to at least one of the approved drugs on the market.

Respiratory syncytial virus (RSV) causes upper and lower respiratory tract infections. It is a negative-sense, enveloped RNA virus and is highly infectious. It commonly affects young children and is the most common cause of lower respiratory tract illness in infants. RSV infections are usually associated with moderate-to-severe cold-like symptoms. However, severe lower respiratory tract disease may occur at any age, especially in elderly or immunocompromised patients. Children with severe infections may require oxygen therapy and, in certain cases, mechanical ventilation. According to the American Medical Association, an increasing number of children are being hospitalized for bronchiolitis, often caused by RSV infection. RSV infections also account for approximately one-third of community-associated respiratory virus infections in patients in bone marrow transplant centers. In the elderly population, RSV infection has been recently recognized to be very similar in severity to influenza virus infection.

Influenza (INF), also known as the flu, is a contagious disease that is caused by the influenza virus. It attacks the respiratory tract in humans (nose, throat, and lungs). An average of about 36,000 people per year in the United States die from influenza, and 114,000 per year require hospitalization as a result of influenza. Influenza has recently become a more serious concern with the emergence of highly pathogenic strains previously only found in animals (e.g. avian flu).

In all infectious diseases, the efficacy of a given therapy often depends on the host immune response. This is particularly true for herpes viruses, where the ability of all herpes viruses to establish latent infections results in an extremely high incidence of reactivated infections in immunocompromised patients. In renal transplant recipients, 40% to 70% reactivate latent HSV infections, and 80% to 100% reactivate CMV infections. Such viral reactivations have also been observed with AIDS patients.

The hepatitis B virus (HBV) is a DNA virus that belongs to the Hepadnaviridae family of viruses. HBV causes hepatitis B in humans. It is estimated that 2 billion people have been infected (1 out of 3 people) in the world. About 350 million people remain chronically infected and an estimated 1 million people die each year from hepatitis B and its complications. HBV can cause lifelong infection, cirrhosis of the liver, liver cancer, liver failure, and death. The virus is transmitted through blood and bodily fluids. This can occur through direct blood-to-blood contact, unprotected sex, use of unsterile needles, and from an infected woman to her newborn during the delivery process. Most healthy adults (90%) who are infected will recover and develop protective antibodies against future hepatitis B infections. A small number (5-10%) will be unable to get rid of the virus and will develop chronic infections while 90% of infants and up to 50% of young children develop chronic infections when infected with the virus. Alpha-interferon is the most frequent type of treatment used. Significant side effects are related to this treatment including flu-like symptoms, depression, rashes, other reactions and abnormal blood counts. Another treatment option includes 3TC which also has many side effects associated with its use. In the last few years, there have been an increasing number of reports showing that patients treated with 3TC are developing resistant strains of HBV.

This is especially problematic in the population of patients who are co-infected with HBV and HIV. There is clearly an urgent need to develop new antiviral therapies against this virus.

Hepatitis C virus (HCV) infection is the most common chronic bloodborne infection in the United States where the number of infected patients likely exceeds 4 million. This common viral infection is a leading cause of cirrhosis and liver cancer, and is now the leading reason for liver transplantation in the United States. Recovery from infection is uncommon, and about 85 percent of infected patients become chronic carriers of the virus and 10 to 20 percent develop cirrhosis. It is estimated that there are currently 170 million people worldwide who are chronic carriers. According to the Centers for Disease Control and Prevention, chronic hepatitis C causes between 8,000 and 10,000 deaths and leads to about 1 ,000 liver transplants in the United States alone each year. There is no vaccine available for hepatitis C. Prolonged therapy with interferon alpha, or the combination of interferon with Ribavirin, is effective in only about 40 percent of patients and causes significant side effects.

Today, the therapeutic outlook for viral infections in general is not favourable. In general, therapies for viruses have mediocre efficacies and are associated with strong side effects which either prevent the administration of an effective dosage or prevent long term treatment. Three clinical situations which exemplify these problems are herpesviridae, HIV and RSV infections.

In the case of herpesviridae, there are five major treatments currently approved for use in the clinic: idoxuridine, vidarabine, acyclovir, foscarnet and ganciclovir. While having limited efficacy, these treatments are also fraught with side effects. Allergic reactions have been reported in 35% of patients treated with idoxuridine, vidarabine can result in gastrointestional disturbances in 15% of patients and acyclovir, foscarnet and ganciclovir, being nucleoside analogs, affect DNA replication in host cells. In the case of ganciclovir, neutropenia and thrombocytopenia are reported in 40% of AIDS patients treated with this drug.

While there are many different drugs currently available for the treatment of HIV infections, all of these are associated with side effects potent enough to require extensive supplemental medication to give patients a reasonable quality of life. The additional problem of drug resistant strains of HIV (a problem also found in herpesviridae infections) usually requires periodic changing of the treatment cocktail and in some cases, makes the infection extremely difficult to treat.

The treatment of RSV infections in young infants is another example of the urgent need for new drug development. In this case, the usual line of treatment is to deliver Ribavirin by inhalation using a small-particule aerosol in an isolation tent. Not only is Ribavirin only mildly effective, but its use is associated with significant side effects. In addition, the potential release of the drug has caused great concern in hospital personnel because of the known teratogenicity of Ribavirin.

It is clear that for any new emerging antiviral drug being developed, it would be highly desirable to incorporate the three following features: 1- improved efficacy; 2- reduced risks of side effects and 3- a mechanism of action which is difficult for the virus to overcome by mutation.

Severat attempts to inhibit particular viruses by various antisense approaches have been made.

Zamecnik et al. have used ONs specifically targeted to the reverse transcriptase primer site and to splice donor/acceptor sites (Zamecnik, et al (1986) Proc. Natl. Acad. Sci. USA 83:4143-) (Goodchild & Zamecnik (1989) US Pat 4,806,463).

Crooke and coworkers. (Crooke et al. (1992) Antimicrob. Agents Chemother. 36:527- 532) described an antisense against HSV-1.

Draper et al. (1993) (US Pat 5,248,670) reported antisense oligonucleotides having anti- HSV activity containing the Cat sequence and hybridizing to the HSV-1 genes UL13, UL39 and UL40.

Kean et al. (Biochemistry (1995) 34:14617-14620) reported testing of antisense methylphosphonate oligomers as anti-HSV agents.

Peyman ef al. (Biol Chem Hoppe Seyler (1995) Mar; 376:195-198) have reported testing specific antisense oligonucleotides directed against the IE110 and the UL30 mRNA of HSV-1 for their antiviral properties.

Oligonucleotides or oligonucleotide analogs targeting CMV mRNAs coding for IE1, IE2 or DNA polymerase were reported by_Anderson et al (1997) (US Pat 5,591 ,720)

Hanecak et al (1999) (US Pat 5,952,490) have described modified oligonucleotides having a conserved G quartet sequence and a sufficient number of flanking nucleotides to significantly inhibit the activity of a virus such as HSV-1.

Jajrath et al (Antiviral Res. (1997) 33:201-213) have reported antisense oligonucleotides against RSV.

Torrence et al (1999) (US Pat 5,998,602) have reported compounds comprising an antisense component complementary to a single stranded portion of the RSV antigenomic strand (the mRNA strand), a linker and a oligonucleotide activator of RNase L.

Qi ef al. (Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi (2000) 14:253-256) have reported testing antisense PS-oligonucleotides (PS-ONs) in Coxsackie virus B3. International publication WO9203051 (Roizman and Maxwell) describes methylphosphonate antisense oligomers which are complementary to vital regions of HSV viral genome or mRNA transcripts thereof which exhibit antiviral activity.

Guanosine/thymidine or guanosine-rich phosphorothioate oligodeoxynucleotides (GT- PS-ONs) have been reported to have antiviral activity. The article stated that "several different PS-containing GT-rich ONs (B106-140, 1100-12, and G106-57) all 26 or 27 nt in length, were just as effective at reducing HIV-2 titers as GT-rich ONs consisting of 36 (B106-96, B106-97) or 45 nt (Table 4)." (Fennewald et al., Antiviral Res. (1995) 26:37- 54).

In US Pat 6,184,369, anti-HIV, anti-HSV, and anti-CMV oligonucleotides containing a

> high percentage of guanosine bases are described. In preferred embodiments, the oligonucleotide has a three dimensional structure and this structure is stabilized by guanosine tetrads. In a further embodiment, the oligonucleotide compositions of the invention have two or more runs of two contiguous deoxyguanosines. The patent 5 claims a G-rich oligodeoxynucleotide (ODN) that includes at least two G residues in at least two positions.

Cohen et al. (US Pats. 5,264,423 and 5,276,019) described the inhibition of replication of HIV, and more particularly to PS-ODN analogs that can be used to prevent replication of foreign nucleic acids in the presence of normal living cells. Cohen et al describe O antiviral activity of antisense PS-ODNs specific to a viral sequence. They also describe testing polyA, polyT and polyC PS-ODN sequences of 14, 18, 21 and 28-mers and indicate an antiviral effect of those PS-ODNs.

Matsukura et al. (Matsukura et al (1987) Proc Natl Acad Sci USA 84:7706-7710) later published the result described in Cohen et al, US patents above.

5 Gao et al (Gao et al (1989) J Biol Chem 264 :11521-11526), describe the inhibition of replication of HSV-2, by PS-ODNs by testing ^"of polyA, polyT and polyC PS-ODN sequences in sizes of 7, 15, 21 and 28 nucleotides.

Archambault, Stein and Cohen (Archambault et al (1994) Arch Virol 139:97109) report that a PS-ODN polyC of 28 nucleotides is not effective against HSV-1.

0 Stein et al (Stein et al. (1989) AIDS Res Hum Retrovir 5:639-646), published results concerning additional data on anti-HIV ODNs, generally of 21-28 nucleotides in length. Marshal et at. (Marshall et al. (1992) Proc. Natl. Acad. Sci. USA 89:6265-6269) describe anti-HIV-1 effect of phosphorothioate and phosphorothioate poly-C oligos of 4-28 nucleotides in length.

Stein & Cheng (Stein et al. (1993) Science 261 :1004-1012), in a review article, mention the antiviral activity of non specific ODNs of 28 nucleotides, stating that "the anti-HIV properties of PS oligos are significantly influenced by non-sequence-specific effects, that is, the inhibitory effect is independent of the base sequence."

In a review article Lebedeva & Stein (Lebedeva et al (2001) Annul Rev Pharmacol 41:403-419) report a variety of non-specific protein binding activity of PS-ODNs, including viral proteins. They state that "these molecules are highly biologically active, and it is often relatively easy to mistake artifact for antisense".

Rein et al. (US Pat. 6,316,190) reported a GT rich ON decoy linked to a fusion partner and binding to the HIV nucleocapsid, which can be used as an antiviral compound. Similarly, Campbell et al. (Campbell et al (1999) J. Virol. 73 :2270-2279) reported PO- ODN with a TGTGT motif binding specifically to the nucleocapsid of HIV but with no references to an antiviral activity.

Feng at al. (Feng et al. (2002) J. Virol. 76 :11757-11762) described A(n) and TG(n) PO- ODNs binding to the recombinant HIV nucleocapsid but with no data nor references to an anti-HIV activity.

Antisense ODNs developed as anticancer agents, antiviral agents, or to treat others diseases are typically approximately 20 nucleotides in length. In a review article (Stein, CA, (2001) J. CHn. Invest. 108:641-644), it is affirmed that "the length of an antisense oligonucleotide must be optimized: If the antisense oligonucleotide is either too long or too short, an element of specificity is lost. At the present time, the optimal length for an antisense oligonucleotide seems to be roughly 16-20 nucleotides". Similarly, in another review article (Crooke, ST (2000) Methods Enzymol. 313:3-45) it is stated that "Compared to RNA and RNA duplex formation, a phosphorothioate oligodeoxynucleotide has a T_m approximately -2.2° lower per unit. This means that to be effective in vitro, phosphorothioate oligodeoxynucleotides must typically be 17- to -20- mer in length...".

Caruthers and co-workers (Marshall et al. (1992) Proc. Natl. Acad. Sci. USA 89:6265- 6269) reported anti-HIV activity of phosphorodithioate ODNs (PS2-ODNs) for a 12mer polycytidine-PS2-ODN and for a 14mer PS2-ODN. No other sizes were tested for anti- HIV activity. They also reported the inhibition of HIV reverse transcriptase (RT) for 12, 14, 20 and 28mer polycytidine-PS2-ODNs. Later,' this group (Marshal et al (1993) Science 259:1564-1570) reported results showing sequence specific inhibition of the HIV RT. The same group published data for PS2-ODNs in several patents. In US Pat Nos. 5,218,103 and 5,684.148, PS2-ODN structure and synthesis is described. In U.S. Pat. Nos. 5,452,496, 5,278,302, and 5,695,979 inhibition of HIV RT is described for PS2-ODNs not longer than 15 bases. In U.S. Pat. Nos. 5,750,666 and 5,602,244, antisense activity of PS2-ODNs is described.

Oligonucleotides modified at the 2' position of the ribose and their uses in antisense strategies have been evaluated, e.g., as described in the references cited below.

lnoue and coworkers (Inoue et al. (1985) Nucleic Acids Res. 16:165168) describe the synthesis and properties of oligos (2'-0-methylribonucleotides). The same group (Inoue et al. (1987) FEBS Letter 215:327-330) reported that no RNAse H mediated mRNA cleavage occurs when the oligonucleotide contains all 2'-O-methylribonucleotides. With mixed oligonucleotides i.e. oligonucleotides having unmodified and 2'-O- methylribonucleotides, they report sequence specific RNAse H hydrolysis of the nucleic acid complex formed by RNA and 2'-O-methylribonucleotides.

Fully 2'-O-methylated and phosphorothioated oligonucleotides which do not support RNase H-mediated cleavage of target mRNA, were used to determine if active antisense oligonucleotides inhibited ICAM-1 expression by an RNase H-dependent mechanism (Chiang et al., (1991) J. Biol. Chem. 266:18162-18171). They stated that these antisense oligonucleotides may be useful as therapeutic agents.

Oligonucleotides with 2'-sugar modifications including 2'-O-methyl, 2'-O-propyl, 2'-O- pentyl, and 2'-fluoro were analyzed for antisense activity. Evaluation of antisense activities of uniformly 2'-modified oligonucleotides revealed that these compounds were completely ineffective in inhibiting gene expression. Activity was restored if the compound contained a stretch of at least five 2'-deoxyribonucleotide residues. This minimum deoxyribonucleotide length correlated perfectly with the minimum length required for efficient RNase H activation in vitro. (Monia et al., 1993, J. Biol. Chem. 268:14514.)

Yu et al. ((1996) Bioorganic. Med. Chem. 4:1685-1692) reported that hybrid antisense oligonucleotides having phosphorothioate, phosphodiester, or mixed backbones with a portion of 2'-O-methyl modified sugars have a specific anti-HIV activity measured by p24 ELISA quantification.

It is reported that correct splicing was efficiently restored when phosphorothioated 2'-O- methyl-oligoribonucleotides were targeted to the aberrant splice sites of IVS2-654 pre- mRNA expressed in mammalian cells stably transformed with this mutated human beta- globin gene. (Sierakowska, et al (1996) Proc. Natl. Acad. Sci. USA 93:12840-12844.)

A review article, Agrawal ((1999) Biochim. Biophys. Acta 1489:53-68) suggests that for optimum activity, antisense oligonucleotides should have a combination of various properties, instead of only increased stability toward nucleases or high affnity to target RNA. Such properties include RNAse H activation. In a later review, Agrawal and Kandimalla ((2000) MoI. Med. Today -6:72-81) say that mixed backbone oligonucleotides, including 2'-O-methyl modifications, have become the choice for second-generation antisense oligonucleotides for their improved characteristics including RNAse H activation. An antisense oligo should posses certain important characteristics such as the ability to activate RNAse H upon binding to the target RNA. (Agrawal and Kandimalla, 2001, Current Cancer Drug Target 1:197-209.) For most antisense approaches target RNA cleavage by RNAse H is desired in order to increase antisense potency. (Kurreck, 2003, Eur. J. Biochem. 270:1628-1644.)

Many studies describe the use of the 2'-O-methoxyethyl modification in antisense oligonucleotides. An example is a study using a gapped 2' modified oligonucleotide antisense described in Zellweger et al. ((2001) J. Pharmacol. Experimental Therapeutics 298:934-940). Another example shows inhibition of the formation of the translation initiation complex using RNase H independent 2'-O-methoxyethyl antisense. (Baker et al. 1997) J. Biol. Chem. 272 :1994-12000.)

Kuwasaki et al. (2003) J. Antimicrob. Chemother. 51 :813-819, describes the design of a highly nuclease-resistant, dimeric hairpin guanosine-quadruplex containing 2'-O-methyl groups on the nucleosides and sulphur groups on the internucleotidic bonds, and its anti-HIV-1 activity in cultured cells.

Mou and Gray (2002) (Nucleic Acids Res. 30:749-758), indicates that, compared with typical phosphorothioate-DNA oligomers, the addition of the 2'-O-methyl modification lowers the non-specific protein binding property. The protein binding affinities of g5p for a 36mers oligonucleotide increased in the order of dA₃₆ < rA₃₆ < 2'-0-MeA₃₆ < S-rA₃₆ « S-2'-O-MeA_3β < S-dA₃₆ (where d = deoxy, r = ribo, 2'-0-Me = 2'-O-methyl, S = phosphorothioate). This order was in agreement with the order of S-RNA « S-2-O- MeRNA < S-DNA reported in Kandimalla et al. ((1998) Bioorganic Med Chem Lett. 8:2103-2108) for the non-specific binding of plasma proteins, such as human serum albumin, γ-globulin and fibrinogen for these oligomer modifications.

US Patents 5,591,623 and 5,514,788 describe compositions and methods for the treatment and diagnosis of diseases amenable to treatment through modulation of the synthesis or metabolism of intercellular adhesion molecules. In accordance with preferred embodiments, oligonucleotides are described which are specifically hybridizable with nucleic acids encoding intercellular adhesion genes. The invention describes the synthesis of 2'-O-methyl phosphorothioate oligonucleotides and their use as antisense.

US Patents 5,652,355, 6,143,881 and 6,346,614 describe hybrid oligonucleotides (containing segments of deoxy- and ribo nucleotides) that resist nucleolytic degradation, form stable duplexes with RNA or DNA, and activate RNase H when hybridized with RNA. It is indicated that one property of phosphorothioate 2'-O-methyl-oligonucleotide is the non-activation of RNAse H. In one aspect, the invention provides hybrid oligonucleotides that are effective in inhibiting viruses, pathogenic organisms, or the expression of cellular genes. A feature of oligonucleotides according to this aspect of the invention is the presence of deoxyribonucleotides. Oligonucleotides according to the invention contain at least one deoxyribonucleotide. The nucleotide sequence of oligonucleotides according to this aspect of the invention is complementary to a nucleic acid sequence that is from a virus, a pathogenic organism or a cellular gene.

U.S. Patents 5,591 ,721 and 6,608,035 describe a method of down-regulating the expression of a gene in an animal by the oral administration of an oligonucleotide whose nucleotide sequence is complementary to the targeted gene. Thus, because of the properties described in the patent, such oligonucleotides are said to be useful therapeutically by their ability to control or down-regulate the expression of a particular gene in an animal. The hybrid DNA/RNA oligonucleotides useful in the method of the invention resist nucleolytic degradation, form stable duplexes with RNA or DNA, and preferably activate RNase H when hybridized with RNA. The oligonucleotides according to the invention are reported to be effective in inhibiting the expression of various genes in viruses, pathogenic organisms, or in inhibiting the expression of cellular genes. Thus, oligonucleotides according to the method of the invention have a nucleotide sequence which is complementary to a nucleic acid sequence that is from a virus, a pathogenic organism or a cellular gene. US Patent 6,608,035 presents data indicating that a phosphorothioate oligonucleotide is not stable in the stomach after 6 hours but a hybrid phosphorothioate oligonucleotide containing 2'-O-methyl ribonucleotide at the 3' and 5'ends and a deoxyribonucleotide interior is more stable in the stomach but partially degraded.

SUMMARY OF THE INVENTION

The present invention involves the discovery that oligonucleotides (ONs), e.g., oligodeoxynucleotides (ODNs)₁ including highly modified oligonucleotides, can have a broadly applicable, sequence independent antiviral activity. Advantageous modifications include modified intemucleotidic linkages and 2'-modifications. It is not necessary for the oligonucleotide to be complementary to any viral sequence or to have a particular distribution of nucleotides in order to have antiviral activity. Such an oligonucleotide can even be prepared as a randomer, such that there will be at most a few copies of any particular sequence in a preparation, e.g., in a 15 micromol randomer preparation 32 or more nucleotides in length.

In addition, the inventors have discovered that different length oligonucleotides have varying antiviral effect. For example, present results indicate that the length of antiviral oligonucleotide that produces maximal antiviral effect when modified with phosphorothioate intemucleotidic linkages is typically in the range of 40-120 nucleotides. In view of the present discoveries concerning antiviral properties of oligonucleotides, this invention provides oligonucleotide antiviral agents that can have activity against numerous different viruses, and can even be selected as broad- spectrum antiviral agents. Such antiviral agents are particularly advantageous in view of the limited antiviral therapeutic options currently available.

Therefore, the ONs₁ e.g., ODNs, of the present invention are useful in therapy for treating or preventing viral infections or for treating or preventing tumors or cancers induced by viruses, such as oncoviruses (e.g., retroviruses, papillomaviruses, and herpesviruses), and in treating or preventing other diseases whose etiology is viral- based. Such treatments are applicable to many types of patients and treatments, including, for example, the prophylaxis or treatment of viral infections in immunosuppressed human and animal patients.

A first aspect of the invention concerns antiviral oligonucleotides, e.g., purified oligonucleotides, where the antiviral occurs principally by a sequence independent, e.g., non-sequence complementary, mode of action, and formulations containing such oligonucleotides.

Oligonucleotides useful in the present invention can be of various lengths, e.g., at least

6, 10, 14, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 38, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 140, 160, or more nucleotides in length. Likewise, the oligonucleotide can be in a range, e.g., a range defined by taking any two of the preceding listed values as inclusive end points of the range, for example 10-20, 20-30,

20-40, 30-40, 30-50, 40-50, 40-60, 40-80, 50-60, 50-70, 60-70, 70-80, 60-120, and 80-

120 nucleotides. In particular embodiments, a minimum length or length range is combined with any other of the oligonucleotide specifications listed herein for the present antiviral oligonucleotides.

The antiviral nucleotide can include various modifications, e.g., stabilizing modifications, and thus can include at least one modification in the phosphodiester linkage and/or on the sugar, and/or on the base. For example, the oligonucleotide can include one or more phosphorothioate linkages, phosphorodithioate linkages, and/or methylphosphonate linkages. Different chemically compatible modified linkages can be combined, e.g., modifications where the synthesis conditions are chemically compatible. While modified linkages are useful, the oligonucleotides can include phosphodiester linkages, e.g., include at least one phosphodiester linkage, or at least 5, 10, 20, 30% or more phosphodiester linkages. Additional useful modifications include, without restriction, modifications at the 2'-position of the sugar, such as 2'-O-alkyl modifications such as 2'-O-methyl modifications, 2'-amino modifications, 2'-halo modifications such as

2'-fluoro; acyclic nucleotide analogs. Other modifications are also known in the art and

. can be used. In particular embodiments, the oligonucleotide has modified linkages throughout, e.g., phosphorothioate; has a 3'- and/or 5'-cap; includes a terminal 3'-5' linkage; the oligonucleotide is or includes a concatemer consisting of two or more oligonucleotide sequences joined by a linker(s).

The present invention further provides an oligonucleotide, wherein said oligonucleotide is linked or conjugated at one or more nucleotide residues, to a molecule modifying the characteristics of the oligonucleotide to obtain one or more characteristics selected from the group consisting of higher stability, lower serum interaction, higher cellular uptake, higher viral protein interaction, an improved ability to be formulated for delivery, a detectable signal, higher antiviral activity, better pharmacokinetic properties, specific tissue distribution, lower toxicity. In certain embodiments, the oligonucleotide includes at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or 100% modified linkages, e.g., phosphorothioate, phosphorodithioate, and/or methylphosphonate.

In certain embodiments, at least 10, 20, 30, 40, 50, 60, 70, 80, 90, or 95%, or all of the nucleotides are modified at the 2'-position of the ribose, e.g., 2'-OMe, 2'-F, 2'-amino.

In certain embodiments modified linkages are combined with 2-modifications in oligonucleotides, for example, at least 30% modified linkages and at least 30% 2'- modifications; or respectively at least 40% and 40%, at least 50% and 50%, at least 60% and 60%, at least 70% and 70%, at least 80% and 80%, at least 90% and 90%, 100% and 100%. In certain embodiments, the oligonucleotide includes at least 30, 40, 50, 60, 70, 80, 90, or 100% modified linkages and at least 30, 40, 50, 60, 70, 80, 90, or 100% 2'-modifications where embodiments include each combination of listed modified linkage percentage and 2'-modification percentage (e.g., at least 50% modified linkage and at least 80% 2'-modifications, and at least 80% modified linkages and 100% 2'- modifications). In particular embodiments of each of the combinations percentages described, the modified linkages are phosphorothioate linkages; the modified linkages are phosphorodithioate linkages; the 2'-modifications are 2'-OMe; the 2'-modifications

^■ are 2'-fluoro; the 2'-modifications are a combination of 2'-OMe and 2'-fluoro; the modified linkages are phosphorothioate linkages and the 2'-modifications are 2'-OMe; the modified linkages are phosphorothioate linkages and the 2'-modifications are 2'- fluoro; the modified linkages are phosphorodithioate linkages and the 2'-modifιcations are 2'-OMe; the modified linkages are phosphorodithioate linkages and the 2'- modifications are 2'-fluoro; the modified linkages are phosphorodithioate linkages and the 2'-modifications are a combination of 2'-OMe and 2'-fluoro. In certain embodiments .of oligonucleotides as described herein that combine a particular percentage of modified linkages and a particular percentage of 2'-modifιcations, the oligonucleotide is at least 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, or 120 nucleotides in length, or is in a length range defined by taking any two of the specified lengths as inclusive endpoints of the range.

In certain embodiments, all but 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the internucleotidic linkages and/or 2'-positions of the ribose moiety are modified, e.g., with linkages modified with phosphorothioate, phosphorodithioate, or methylphosphonate linkages and/or 2'-OMe, 2'-F, and/or 2'-amino modifications of the ribose moiety. In some embodiments, the oligonucleotide includes at least 1 , 2, 3, or 4 ribonucleotides, or at least 10, 20, 30, 40, 50, 60, 70, 80, 90%, or even 100% ribonucleotides.

In particular embodiments, the oligonucleotide includes non-nucleotide groups in the chain (i.e., form part of the chain backbone) and/or as side chain moieties, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or even more, or up to 5, 10, 20% or more of the chain moieties and/or side chain moieties.

In certain embodiments, the oligonucleotide is free of self-complementary sequences longer than 5, 8, 10, 15, 20, 25, 30 nucleotides; the oligonucleotide is free of catalytic activity, e.g., cleavage activity against RNA; the oligonucleotide does not induce an RNAi mechanism.

In particular embodiments, the oligonucleotide binds to one or more viral proteins; the sequence of the oligonucleotide (or a portion thereof, e.g., at least 20, 30, 40, 50, 60, 70% or more) is derived from a viral genome; the activity of an oligonucleotide with a sequence derived from a viral genome is not superior to a randomer oligonucleotide or a random oligonucleotide of the same length; the oligonucleotide includes a portion complementary to a viral sequence and a portion not complementary to a viral sequence; the sequence of the oligonucleotide is derived from a viral packaging sequence or other viral sequence involved in an aptameric interaction; unless otherwise indicated, the sequence of the oligonucleotide includes A(x), C(x), G(x), T(x), U(x), l(x), AC(X), AG(X), AT(X), AU(x), CG(x), CT(x), CU(x), GT(x), GU(x), TU(x), Al(x), IC(x),

^■ IG(X), IT(x) lU(x) where x is 2, 3, 4, 5, 6, ... 60 ... 120 (in particular embodiments the oligonucleotide is at least 15, 20, 25, 29, 30, 32, 34, 35, 36, 38, 40, 45, 46, 50, 60, 70,

80, 90, 100, 110, 120, 140, or 160 nucleotides in length or is in a range defined by taking any two of the listed values as inclusive endpoints, or the length of the specified repeat sequence is at least a length or in a length range just specified); the oligonucleotide includes a combination of repeat sequences (e.g., repeat sequences as specified above), including, for example, each combination of the above monomer and/or dimer repeats taken 2, 3, or 4 at a time; the oligonucleotide is single stranded (RNA or DNA); the oligonucleotide is double stranded (RNA or DNA); the oligonucleotide includes at least one Gquartet or CpG portion; the oligonucleotide includes a portion complementary to a viral mRNA and is at least 29, 37, or 38 nucleotides in length (or other length as specified above); the oligonucleotide includes at least one non-Watson-Crick oligonucleotide and/or at least one nucleotide that participates in non-Watson-Crick binding with another nucleotide and/or at least one nucleotide that cannot form base pairs with other nucleotides; the oligonucleotide is a random oligonucleotide, the oligonucleotide is a randomer or includes a randomer portion, e.g., a randomer portion that has a length of at least 5, 10, 15, 20, 25, 30, 35, 40 or more contiguous oligonucleotides or a length as specified above for oligonucleotide length or at least 10, 20, 30, 40, 50, 60, 70, 80, 90% or all the nucleotides are randomer; the oligonucleotide is linked or conjugated at one or more nucleotide residues to a molecule that modifies the characteristics of the oligonucleotide, e.g. to provide higher stability (such as stability in serum or stability in a particular solution), lower serum interaction, higher cellular uptake, higher viral protein interaction, improved ability to be formulated for delivery, a detectable signal, improved pharmacokinetic properties, specific tissue distribution, and/or lower toxicity.

It was also discovered that phosphorothioated ONs containing only (or at least primarily) pyrimidine nucleotides, including cytosine and/or thymidine and/or other pyrimidines are resistant to low pH and polycytosine oligonucleotides showed increased resistance to a number of nucleases, thereby providing two important characteristics for oral administration of an antiviral ON. Thus, in certain embodiments, the oligonucleotide has at least 80, 90, or 95, or 100% modified internucleotidic linkages (e.g., phosphorothioate or phosphorodithoiate) and the pyrimidine content is more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, or 100%, I.e.; is a pyrimidine oligonucleotide or the cytosine content is more than 50%, more than 60%, more than 70%, more than 80%, morethan 90% or 100% i.e. is a polycytosine oligonucleotide. In certain embodiments, the length is at least 29, 30, 32, 34, 36, 38, 40, 45, 50, 60, 70, or 80 nucleotides, or is in a range of 20-28, 25-35, 29-40, 30-40, 35-45, 40-50, 45-55, 50- 60, 55-65, 60-70, 65-75, or 70-80, or is in a range defined by taking any two of the listed values as inclusive endpoints of the range. In particular embodiment, the oligonucleotide is at least 50, 60, 70, 80, or 90% cytosine; at least 50, 60, 70, 80, or 90% thymidine (and may have a total pyrimidine content as listed above). In particular embodiments, the oligonucleotide contains a listed percentage of either cytosine or thymidine, and the remainder of the pyrimidine nucleotides are the other of cytosine and thymidine. Also in certain embodiments, the oligonucleotide includes at least 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, or more contiguous pyrimidine nucleotides, e.g., as C nucleotides, T nucleotides, or CT dinucleotide pairs. In certain embodiments, the pyrimidine oligonucleotide consists only of pyrimidine nucleotides; includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-pyrimidine moieities; includes 1-5, 6-10, 11-15, or at least 16 non-pyrimidine backbone moieties; includes at least one, 1-20, 1-5, 6-10, 11-15, or 16- 20 non-nucleotide moieties; includes at least one, 1-20, 1-5, 6-10, 11-15, or 16-20 purine nucleotides. Preferably, in embodiments in which non-nucleotide moieities are present, the linkages between such moieties or between such moieties and nucleotides are at least 25, 35, 50, 70, 90, or 100 % as resistant to acidic conditions as PS linkages in a 40-mer polyC oligonucleotide as evaluated by gel electrophoresis under conditions appropriate for the size and chemistry of the oligonucleotide.

Oligonucleotides can also be used in combinations, e.g., as a mixture. Such combinations or mixtures can include, for example, at least 2, 3, 4, 5, 10, 20, 50, 100, 1000, 10000, 100,000, 1 ,000,000, or more different oligonucleotides, e.g., any combination of oligonucleotides are described herein. Such combinations or mixtures can, for example, be different sequences and/or different lengths and/or different modifications and/or different linked or conjugated molecules. In particular embodiments of such combinations or mixtures, a plurality of oligonucleotides have a minimum length or are in a length range as specified above for oligonucleotides. In particular embodiments of such combinations or mixtures, at least one, a plurality, or each of the oligonucleotides can have any of the other properties specified herein for individual antiviral oligonucleoties (which can also be in any consistent combination).

In certain embodiments, the sequence of the oligonucleotide is not perfectly complementary to any equal length portion of the genome sequence of the target virus, or has less than 95, 90, 80, 70, 60, or 50% complementarity to any equal length portion of the genomic sequence of the target virus, the oligonucleotide sequence does not consist essentially of polyA, polyC, polyG, polyT, Gquartet, or a TG-rich sequence.

As used in connection with the present oligos, the term "TG-rich" indicates that the sequence of the antiviral oligonucleotide consists of at least 50 percent T and G nucleotides, or if so specified, at.least 60, 70, 80, 90, or 95% T and G, or even 100%.

In a related aspect, the invention provides a mixture of antiviral oligonucleotides that includes at least two different antiviral oligonucleotides as described herein, e.g., at least 2, 3, 4, 5, 7, 10, 50, 100, 1000, 10,000, 100,000, 1 ,000,000, or even more.

As used herein in connection with oligonucleotides or other materials, the term "antiviral" refers to an effect of the presence of the oligonucleotides or other material in inhibiting production of viral particles, i.e., reducing the number of infectious viral particles formed, in a system otherwise suitable for formation of infectious viral particles for at least one virus. In certain embodiments of the present invention, the antiviral oligonucleotides will have antiviral activity against multiple different viruses. The term "antiviral oligonucleotide formulation" refers to a preparation that includes at least one antiviral oligonucleotide that is adapted for use as an antiviral agent. The formulation includes the oligonucleotide or oligonucleotides, and can contain other materials that do not interfere with use of the formulation as an antiviral agent in vivo. Such other materials can include without restriction diluents, excipients, carrier materials, and/or other antiviral materials.

As used herein, the term "pharmaceutical composition" refers to an antiviral oligonucleotide formulation that includes a physiologically or pharmaceutically acceptable carrier or excipient. Such compositions can also include other components that do not make the composition unsuitable for administration to a desired subject, e.g., a human.

In the context of the present invention, unless specifically limited the term "oligonucleotide (ON)" means oligodeoxynucleotide (ODN) or oligodeoxyribonucleotide or oligoribonucleotide. Thus, "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) and/or deoxyribonucleic acid (DNA) and/or analogs thereof. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as" well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases. Examples of modifications that can be used are described herein. Oligonucleotides that include backbone and/or other modifications can also be referred to as oligonucleosides.

In the present context, the phrase "modified internucleotidic linkage" refers to a linkage between nucleotides or nucleotide analogs in an oligonucleotide that differs from the phosphodiester linkage generally found in naturally-occurring polynucleotides. Examples include phosphorothioate linkages, phosphorodithioate linkages, and methylphosphonate linkages.

Specification of particular lengths for oligonucleotides, e.g., at least 20 nucleotides in length, means that the oligonucleotide includes at least 20 linked nucleotides. Unless clearly indicated to the contrary, the oligonucleotide may also include additional, non- nucleotide moieties, which may form part of the backbone of the oligonucleotide chain. Unless otherwise indicated, when non-nucleotide moieities are present in the backbone, at least 10 of the linked nucleotides are contiguous. As used in connection with an antiviral formulation, pharmaceutical composition, or other material, the phrase "adapted for use as an antiviral agent" indicates that the material exhibits an antiviral effect and does not include any component or material that makes it unsuitable for use in inhibiting viral production in an in vivo system, e.g., for administering to a subject such as a human subject.

As used herein in connection with antiviral action of an antiviral oligonucleotide, "sequence independent mode of action" indicates that the particular biological activity (e.g., antiviral activity) is not dependent on a particular oligonucleotide sequence in the oligonucleotide. For example, the activity does not depend on sequence dependent hybridization such as with antisense activity, or a particular sequence resulting in a sequence dependent aptameric interaction. Similarly, the phrase "non-sequence complementary mode of action" indicates that the mechanism by which the material exhibits an antiviral effect is not due to hybridization of complementary nucleic acid sequences, e.g., an antisense effect. Conversely, a "sequence complementary mode of action" means that the antiviral effect of a material involves hybridization of complementary nucleic acid sequences or sequence specific aptameric interaction. Thus, indicating that the antiviral activity of a material is due to a sequence independent mode of action" or that the activity is "not primarily due to a sequence complementary mode of action" means that the the activity of the oligonucleotide satisfies at least one of the 4 tests provided herein (see Example, 10). In particular embodiments, the oligonucleotide satisfies test 1 , test 2, test 3, test 4, or test 5; the oligonucleotide satisfies a combination of two of the tests, i.e., tests 1 & 2; tests 1 & 3; tests 1 & 4, tests 1 & 5, tests 2 & 3, tests 2 & 4, test 2 & 5, tests 3 & 4, tests 3 & 5, or tests 4 & 5; the oligonucleotide satisfies a combination of 3 of the tests, i.e., tests 1 , 2, and 3, tests 1 , 2, and 4, test 1 , 2, & 5, tests 1 , 3, and 4, tests 1 , 3, & 5, tests 2, 3, and 4, tests 2, 3, & 5, tests 3, 4, & 5; the oligonucleotide satisifies all of tests 1 , 2, 3, and 4.

As used herein in connection with administration of an antiviral material, the term "subject" refers to a living higher organism, including, for example, animals such as mammals, e.g., humans, non-human primates, bovines, porcines, ovines, equines, dogs, and cats; birds (Aves),; and plants, e.g., fruit trees.

A related aspect concerns an antiviral oligonucleotide randomer or randomer formulation that contains at least one randomer, where the antiviral activity of the randomer occurs principally by a sequence independent, e.g., non-sequence complementary mode of action. Such a randomer formulation can, for example, include a mixture of randomers of different lengths, e.g., at least 2, 3, 5, 10, or more different lengths, or other mixtures as described herein.

As used herein in connection with oligonucleotide sequences, the term "random" characterizes a sequence or an ON that is not complementary to a viral mRNA, and which is selected to not form hairpins and not to have palindromic sequences contained therein. When the term "random" is used in the context of antiviral activity of an oligonucleotide toward a particular virus, it implies the absence of complementarity to a viral mRNA of that particular virus. The absence of complementarity may be broader, e.g., for a plurality of viruses, for viruses from a particular viral family, or for infectious human viruses.

In the present application, the term "randomer" is intended to mean a single stranded DNA having a wobble (N) at every position, such as NNNNNNNNNN. Each base is synthesized as a wobble such that this ON actually exists as a population of different randomly generated sequences of substantially the same size. It is recognized that preparation of such a randomer will normally generate a distribution of sizes around a particular length (primarily shorter lengths); unless clearly indicated to the contrary, in the present context such a preparation is regarded as a randomer of the particular length.

The phrase "derived from a viral genome" indicates that a particular sequence has a nucleotide base sequence that has at least 70% identity to a viral genomic nucleotide sequence or its complement (e.g., is the same as or complementary to such viral genomic sequence), or is a corresponding RNA sequence. In particular embodiments of the present invention, the term indicates that the sequence is at least 70% identical to a viral genomic sequence of the particular virus against which the oligonucleotide is directed, or to its complementary sequence. In particular embodiments, the identity is at least 80, 90, 95, 98, 99, or 100%.

The invention also provides an antiviral pharmaceutical composition that includes a therapeutically effective amount of a pharmacologically acceptable, antiviral oligonucleotide or mixture of oligonucleotides as described herein, e.g., at least 6 nucleotides in length or other length as listed herein, where the antiviral activity of the oligonucleotide occurs principally by a sequence independent, e.g., non-sequence complementary, mode of action, and a pharmaceutically acceptable carrier. In particular embodiments, the oligonucleotide or a combination or mixture of oligonucleotides is as specified above for individual oligonucleotides or combinations or mixtures of oligonucleotides. In particular embodiments, the pharmaceutical compositions are approved for administration to a human, or a non-human animal such as a non_rhuman primate.

In particular embodiments, the pharmaceutical composition is adapted for the treatment, control, or prevention of a disease with a viral etiology; adapted for treatment, control, or prevention of a prion disease; is adapted for delivery by intraocular administration, oral ingestion, enteric administration, inhalation, cutaneous, subcutaneous, intramuscular, intraperitoneal, intrathecal, intratracheal, or intravenous injection, or topical administration.

In particular embodiments, the pharmaceutical composition can be formulated for delivery by a mode selected from the group consisting of but not restricted to oral ingestion, oral mucosal delivery, intranasal drops or spray, intraocular injection, subconjunctival injection, eye drops, ear drops, by inhalation, intratracheal injection or spray, intrabronchial injection or spray, intrapleural injection, intraperitoneal injection perfusion or irrigation, intrathecal injection or perfusion, intracranial injection or perfusion, intramuscular injection, intravenous injection or perfusion, intraarterial injection or perfusion, intralymphatic injection or perfusion, subcutaneous injection or perfusion, intradermal injection, topical skin application, by organ perfusion, by topical application during surgery, intratumoral injection, topical application, gastric injection perfusion or irrigation, enteral injection or perfusion, colonic injection perfusion or irrigation, rectal injection perfusion or irrigation, by rectal suppository or enema, by urethral suppository or injection, intravesical injection perfusion or irrigation, or intraarticular injection.

In particular embodiments, the composition includes a delivery system, e.g., targeted to specific cells or tissues; a liposomal formulation, another antiviral drug, e.g., a non- nucleotide antiviral polymer, an antisense molecule, an siRNA, or a small molecule drug.

In particular embodiments, the antiviral oligonucleotide, oligonucleotide preparation, oligonucleotide formulation, or antiviral pharmaceutical composition has an in vitro IC₅₀ for a target virus (e.g., any of particular viruses or viruses in a group of viruses as indicated herein) of 10, 5, 2, 1 , 0.50, 0.20, 0.10, 0.09. 0.08, 0.07, 0.75, 0.06, 0.05, 0.045, 0.04, 0.035, 0.03, 0.025, 0.02, 0.015, or 0.01 μM or less. In particular embodiments of formulations, pharmaceutical compositions, uses for prophylaxis or treatment and methods for prophylaxis or treatment, the composition or formulation is adapted for treatment, control, or prevention of a disease with viral etiology; is adapted for the treatment, control or prevention of a prion disease; is adapted for delivery by a mode selected from the group consisting of intraocular, oral ingestion, enterally, inhalation, or cutaneous, subcutaneous, intramuscular, or intravenous injection delivery; further comprises a delivery system, which can include or be associated with a molecule increasing affinity with specific cells; further comprises at least one other antiviral drug in combination; and/or further comprises an antiviral polymer in combination.

In particular embodiments, the pharmaceutical composition contains at least one polypyrimidine oligonucleotide as described herein. In view of the resistance to low pH discovered for polypyrimidine oligonucleoides; in certain embodiments such a composition is adapted for delivery to an acidic in vivo site, e.g., oral delivery or vaginal delivery.

In particular embodiments of compositions and formulations for oral administration containing such polypyrimidine oligonucleotides, the composition or formulation is prepared in the form of a powder, granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, emulsion (e.g., microemulsion), capsule, gel capsule, sachet, tablet, or minitablet. In certain embodiments, thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be included. In some embodiments, the oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and/or chelators, e.g. and without restriction, fatty acids and/or esters or salts thereof (for example, arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1- monocaprate, i-dodecylazacycloheptan-Z-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g. sodium), bile acids and/or salts thereof (for example, chenodeoxycholic acid (CDCA) and ursodeoxychenedeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate, sodium glycodihydrofusidate). Some embodiments include a combination of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts such as the sodium salt of lauric acid, capric acid and UDCA. Further exemplary penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.

In particular embodiments in which the oligonucleotides of the invention are prepared in granular form (including sprayed dried particles) or complexed to form micro or nanoparticles, a complexing agent(s) is used that is selected, without restriction, from poly-amino acids; polyimines; polyacrytates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses, and starches, or more specifically selected from chitosan, N-trimethytchitosan, poly-L-lysine, polyhistidine, polyorithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylamino-methylethylene P(TDAE), polyaminostyrene (e.g. p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylatc), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE- dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co- glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG).

In particular embodiments, the composition is adapted for vaginal administration. In such embodiments, the composition may be prepared, without limitation, in the form of tablets, a solution, a cream, a gel, a suppository.

In particular embodiments, the composition is adapted for topical administration.

As used herein, the terms "polypyrimidine oligonucleotide" or "pyrimidine oligonucleotide" means an oligonucleotide that contains greater than 50% pyrimidine nucleotides.

As used in relation to in vivo administration of the present oligonucleotides and compositions, the term "acidic site" means a site that has a pH of less than 7. Examples include the stomach (pH generally 1-2), the vagina (pH generally 4-5 but may be lower), and to a lesser degree, the skin (pH generally 4-6).

As used herein, the phrase "adapted for oral delivery" and like terms indicate that the composition is sufficiently resistant to acidic pH to allow oral administration without a clinically excessive loss of activity, e.g., an excessive first pass loss due to stomach acidity of less than 50% (or is indicated, less than 40%, 30%, 20%, 10%, or 5%). As used herein, the phrase "adapted for vaginal administration" and like terms indicate that the composition is prepared such that when appropriately administered, the composition will not degrade to a clinically unacceptable extent (e.g., less than 50%, 40%, 30%, 20%, 10%, or 5% over a specified time for retention) and will remain substantially in the vagina (excluding material that is absorbed) for at least 1 hour (or if indicated, for at least 2 hr, 4 hr, 8 hr, 12 hr, 1 day, or 2 days). Such retention may be due to any of a number of different factors or combinations of factors, for example, due to physical form or adhesive properties, and the like.

As used herein in connection with antiviral oligonucleotides and formulations, and the like, in reference to a particular virus or group of viruses the term "targeted" indicates that the oligonucleotide is selected to inhibit that virus or group of viruses. As used in connection with a particular tissue or cell type, the term indicates that the oligonucleotide, formulation, or delivery system is selected such that the oligonucleotide is preferentially present and/or preferentially exhibits an antiviral effect in or proximal to the particular tissue or cell type.

As used herein, the term "delivery system" refers to a component or components that, when combined with an oligonucleotide (e.g., an antisense oligo, siRNA, or oligonucleotide as described herein), increases the amount of the oligonucleotide that contacts the intended location in vivo, and/or extends the duration of its presence at the target, e.g., by at least 20, 50, or 100%, or even more as compared to the amount and/or duration in the absence of the delivery system, and/or prevents or reduces interactions that cause side effects.

As used herein in connection with antiviral agents and other drugs or test compounds, the term "small molecule" means that the molecular weight of the molecule is 1500 daltons or less. In some cases, the molecular weight is 1000, 800, 600, 500, or 400 daltons or less.

In another aspect, the invention provides a kit that includes at least one antiviral oligonucleotide, antiviral oligonucleotide mixture, antiviral oligonucleotide formulation, or antiviral pharmaceutical composition that includes such oligonucleotide, oligonucleotide mixture, or oligonucleotide formulation in a labeled package, where the antiviral activity of the oligonucleotide occurs principally by a sequence independent e.g., non-sequence complementary, mode of action and the label on the package indicates that the antiviral oligonucleotide can be used against at least one virus. In particular embodiments the kit includes a pharmaceutical composition that includes at least one antiviral oligonucletide as described herein. In one embodiment, the kit contains a mixture of at least two different antiviral oligonucleotides. In one embodiment, the antiviral oligonucleotide is adapted for in vivo use in an animal and/or the label indicates that the oligonucleotide or composition is acceptable and/or approved for use in an animal; the animal is a mammal, such as human, or a non-human mammal such as bovine, porcine, a ruminant, ovine, or equine; the animal is a non-human animal; the animal is a bird, the kit is approved by a regulatory agency such as the U.S. Food and Drug Administration or equivalent agency for use in an animal, e.g., a human.

In another aspect, the invention provides a method for selecting an antiviral oligonucleotide, e.g, a non-sequence complementary antiviral oligonucleotide, for use as an antiviral agent. The method involves synthesizing a plurality of different random oligonucleotides, testing .the oligonucleotides for activity in inhibiting the ability of a virus to produce infectious virions, and selecting an oligonucleotide having a pharmaceutically acceptable level of activity for use as an antiviral agent.

In particular embodiments, the different random oligonucleotides comprises randomers of different lengths; the random oligonucleotides can have different sequences or can have sequence in common, such as the sequence of the shortest oligos of the plurality, and/or the different random oligonucleotides comprise a plurality of oligonucleotides comprising a randomer segment at least 5 nucleotides in length or the different random oligonucleotides include a plurality of randomers of different lengths. Other oligonucleotides, e.g., as described herein for antiviral oligonucleotides, can be tested in a particular system.

In yet another aspect, the invention provides a method for the prophylaxis or treatment of a viral infection in a subject by administering to a subject in need of such treatment a therapeutically effective amount of at least one pharmacologically acceptable oligonucleotide as described herein, e.g., a non-sequence complementary oligonucleotide at least 6 nucleotides in length, or an antiviral pharmaceutical composition or formulation or mixture containing such oligonucleotide(s). In a further embodiment, the invention provides a use for the prophylaxis or treatment of a viral infection in a subject by administering to a subject in need of such treatment a therapeutically effective amount of at least one pharmacologically acceptable oligonucleotide as described herein, e.g., a non-sequence complementary oligonucleotide at least 6 nucleotides in length, or an antiviral pharmaceutical composition or formulation or mixture containing such oligonucleotide(s). In particular embodiments, the virus can be any of those listed herein as suitable for inhibition using the present invention; the infection is related to a disease or condition indicated herein as related to a viral infection; the subject is a type of subject as indicated herein, e.g., human, non-human animal, non-human mammal, bird, plant, and the like; the treatment is for a viral disease or disease with a viral etiology, e.g., a disease as indicated in the Background section herein.

In yet another aspect, the invention provides a method for the prophylaxis or treatment of a viral infection in an acidic environnement in a subject, comprising administering to a subject in need of such a treatment a therapeutically effective amount of at least one pharmacologically acceptable antiviral pharmaceutical composition of the invention, said composition being adapted for administration to an acidic in vivo site.

In yet another aspect, the invention provides a use for the prophylaxis or treatment of a viral infection in an acidic environnement in a subject, comprising administering to a subject in need of such a treatment a therapeutically effective amount of at least one pharmacologically acceptable antiviral pharmaceutical composition of the invention, said composition being adapted for administratjon to an acidic in vivo site.

In particular embodiments, an antiviral oligonucleotide (or oligonucleotide formulation or pharmaceutical composition) as described herein is administered; administration is a method as described herein; a delivery system or method as described herein is used; the viral infection is of a DNA virus or an RNA virus; the virus is a parvoviridae, papovaviridae, adenoviridae, herpesviridae, poxviridae, hepadnaviridae, or papillomaviridae; the virus is a arenaviridae, bunyaviridae, calciviridae, coronaviridae, filoviridae, flaviridae, orthomyxoviridae, paramyxoviridae, picornaviridae, reoviridae, rhabdoviridae, retroviridae, or togaviridae; the herpesviridae virus is EBV, HSV-1 , HSV- 2, CMV, VZV, HHV-6, HHV-7, or HHV-8; the virus is HIV-1 or HIV-2; the virus is respiratory syncytical virus (RSV); the virus is parainfluenza-3 virus; the virus is an influenza virus, e.g., influenza A; the virus is HBV; the virus is smallpox virus or vaccinia virus; the virus is a coronavirus; the virus is SARS virus; the virus is West Nile Virus; the virus is a hantavirus; the virus is a parainfluenza virus; the virus is coxsackievirus; the virus is rhinovirus; the virus is yellow fever virus; the virus is dengue virus; the virus is hepatitis C virus; the virus is Ebola virus; the virus is Marburg virus; the virus is Lassa fever virus; the virus is Varicella Zoster Virus; the virus is Epstein Barr Virus; the virus is Human Herpesvirus 6A or 6B; the virus is HBV; the virus is parainfluenza virus; the virus is human metapneumovirus; the virus is Rift Valley fever virus; the virus is Crimean Congo Hemorrhagic Fever virus; the virus is Western Equine Encephalitis virus. In a particular embodiment, the oligonucleotide of the invention targets influenza virus.

In particular embodiments, the oligonucleotide is a polypyrimidine oligonucleotide (or a formulation or pharmaceutical composition containing such polypyrimidine oligonucleotide), which may be adapted for oral or vaginal administration, e.g., as described herein.

Similarly, in a related aspect, the invention provides a method for the prophylactic treatment of cancer caused by oncoviruses in a human or animal by administering to a human or animal in need of such treatment, a pharmacologically acceptable, therapeutically effective amount of at least one random oligonucleotide of at least 6 nucleotides in length (or another length as described herein), or a formulation or pharmaceutical composition containing such oligonucleotide. In one embodiment, a mixture of oligonucleotides of the invention.

Similarly, in a related aspect, the invention provides a use for the prophylactic treatment of cancer caused by oncoviruses in a human or animal by administering to a human or animal in need of such treatment, a pharmacologically acceptable, therapeutically effective amount of at least one random oligonucleotide of at least 6 nucleotides in length (or another length as described herein), or a formulation or pharmaceutical composition containing such oligonucleotide. In one embodiment, a mixture of oligonucleotides of the invention.

In particular embodiments, the oligonucleotide(s) is as described herein for the present invention, e.g., having a length as described herein; a method of administration as described herein is used; a use as described herein is used; a delivery system as described herein is used.

The term "therapeutically effective amount" refers to an amount that is sufficient to effect a therapeutically or prophylactically significant reduction in production of infectious virus particles when administered to a typical subject of the intended type. In aspects involving administration of an antiviral oligonucleotide to a subject, typically the oligonucleotide, formulation, or composition should be administered in a therapeutically effective amount.

In certain embodiments involving oligonucleotide formulations, pharmaceutical compositions, treatment and prophylactic methods and/or treatment and prophylactic uses described herein, the oligonucleotide(s) having a sequence independent mode of action is not associated with a transfection agent; the oligonucleotide(s) having a sequence independent mode of action is not encapsulated in liposomes and/or non- liposomal lipid particles. In certain embodiments, the oligonucleotide(s) having a sequence independent mode of action is in a pharmaceutical composition or is administered in conjunction with (concurrently or sequentially) an antiviral oligonucleotide that acts principally by a sequence dependent mode of action, e.g., antisense oligonucleotide or siRNA, where the oligonucleotide(s) having a sequence dependent mode of action can be associated with a transfection agent and/or encapsulated in liposomes and/or non-liposomal lipid particles.

In another aspect, the discovery that sequence independent, e.g., non-sequence complementary, interactions produce effective antiviral activity provides a method of screening to identify a compound that alters binding of an oligonucleotide to a viral component, such as one or more viral proteins (e.g., extracted or purified from a viral culture of infected host organisms, or produced by recombinant methods). For example, the method can involve determining whether a test compound reduces the binding of oligonucleotide to one or more viral components.

As used herein, the term "screening" refers to assaying a plurality of compounds to determine if they possess a desired property. The plurality of compounds can, for example, be at least 10, 100, 1000, 10,000 or more test compounds.

In particular embodiments, any of a variety of assay formats and detection methods can be used to identify such alteration in binding, e.g., by contacting the oligonucleotide with the viral component(s) in the presence and absence of a compound(s) to be screened (e.g., in separate reactions) and determining whether a difference occurs in binding of the oligo the viral component(s) in the presence of the compound compared to the absence of the compound. The presence of such a difference is indicative that the compound alters the binding of the random oligonucleotide to the viral component. Alternatively, a competitive displacement can be used, such that oligonucleotide is bound to the viral component and displacement by added test compound is determined, or conversely test compound is bound and displacement by added oligonucleotide is determined.

In particular embodiments, the oligonucleotide is as described herein for antiviral oligonucleotides; the oligonucleotide is at least 6, 8, 10, 15, 20, 25, 29, 30, 32, 34, 36, 38, 40, 46, 50, 60, 70, 80, 90, 100, 110, or 120 nucleotides in length or at least another length specified herein for the antiviral oligonucleotides, or is in a range defined by taking any two of the preceding values as inclusive endpoints of the range; the test compound(s) is a small molecule; the test compound has a molecular weight of less than 400, 500, 600, 800, 1000, 1500, 2000, 2500, or 3000 daltons, or is in a range defined by taking any two of the preceding values as inclusive endpoints of the range; the viral extract or component is from a virus as listed herein; at least 100, 1000, 10,000, 20,000, 50,000, or 100,000 compounds are screened; the oligonucleotide has an in vitro ICso of equal to or less than 10, 5, 2, 1 , 0.500, 0.200, 0.100, 0.075, 0.05, 0.045, 0.04, 0.035, 0.03, 0.025, 0.02, 0.015, or 0.01 μM.

The present invention further provides oligonucleotides described in Table 21.

The present invention further provides an antiviral oligonucleotide as set forth in any one of REP 1001 , REP 2001 , REP 3007, REP 2004, REP 2005, REP 2006, REP 2007, REP 2008, REP 2017, REP 2018, REP 2020, REP 2021 , REP 2024, REP 2036, A20, G20, C20, REP 2029, REP 2031, REP 2030, REP 2033, REP 2055, REP 2056, REP 2057, REP 2060 and REP 2107.

As used herein, the term "viral component" refers to a product encoded by a virus or produced by infected host cells as a consequence of the viral infection. Such components can include proteins as well as other biomolecules. Such viral components, can, for example, be obtained from viral cultures, infected host organisms, e.g., animals and plants, or can be produced from viral sequences in recombinant systems (prokaryotes and eukaryotes), as well synthetic proteins having amino acid sequences corresponding to viral encoded proteins. The term "viral culture extract" refers to an extract from cells infected by a virus that will include virus-specific products. Similarly, a "viral protein" refers to a virus-specific protein, usually encoded by a virus, but can also be encoded at least in part by host sequences as a consequence of the viral infection.

In a related aspect, the invention provides an antiviral compound identified by the preceding method, e.g., a novel antiviral compound.

In a further aspect, the invention provides a method for purifying oligonucleotides binding to at least one viral component from a pool of oligonucleotides by contacting the pool with at least one viral component, e.g., bound to a stationary phase medium, and collecting oligonucleotides that bind to the viral component(s). Generally, the collecting involves displacing the oligonucleotides from the viral component(s). The method can also involve sequencing and/or testing antiviral activity of collected oligonucleotides (i.e., oligonucleotides that bound to viral protein). In particular embodiments, the bound oligonucleotides of the pool are displaced from the stationary phase medium by any appropriate method, e.g., using an ionic displacer, and displaced oligonucleotides are collected. Typically for the various methods of displacement, the displacement can be performed in increasing stringent manner (e.g., with an increasing concentration of displacing agent, such as a salt concentration, so that there is a stepped or continuous gradient), such that oligonucleotides are displaced generally in order of increased binding affinity. In many cases, a low stringency wash will be performed to remove weakly bound oligonucleotides, and one or more fractions will be collected containing displaced, tighter binding oligonucleotides. In some cases, it will be desired to select fractions that contain very tightly binding oligonucleotides (e.g., oligonucleotides in fractions resulting from displacement by the more stringent displacement conditions) for further use.

Similarly, the invention provides a method for enriching oligonucleotides from a pool of oligonucleotides binding to at least one viral component, by contacting the pool with one or more viral proteins, and amplifying oligonucleotides bound to the viral proteins to provide an enriched oligonucleotide pool. The contacting and amplifying can be performed in multiple rounds, e.g., at least 1 , 2, 3, 4, 5, 10, or more additional times using the enriched oligonucleotide pool from the preceding round as the pool of oligonucleotides for the next round. The method can also involve sequencing and testing antiviral activity of oligonucleotides in the enriched oligonucleotide pool following one or more rounds of contacting and amplifying.

The method can involve displacing oligonucleotides from the viral component (e.g., viral protein bound to a solid phase medium) with any of a variety of techniques, such as those described above, e.g., using a displacement agent. As indicated above, it can be advantageous to select the tighter binding oligonucleotides for further use, e.g., in further rounds of binding and amplifying. The method can further involve selecting one or more enriched oligonucleotides, e.g., high affinity oligonucleotides, for further use. In particular embodiments, the selection can include eliminating oligonucleotides that have sequences complementary to host genomic sequences (e.g., human) for a particular virus of interest. Such elimination can involve comparing the oligonucleotide sequence(s) with sequences from the particular host in a sequence database(s), e.g., using a sequence alignment program (e.g., a BLAST search), and eliminating those oligonucleotides that have sequences identical or with a particular level of identity to a host sequence. Eliminating such host complementary sequences and/or selecting one or more oligonucleotides that are not complementary to host sequences can also be done for the other aspects of the present invention.

In the preceding methods for identifying, purifying, or enriching oligonucleotides, the oligonucleotides can be of types as described herein. The above methods are advantageous for identifying, purifying or enriching high affinity oligonucleotides, e.g., from an oligonucleotide randomer preparation.

In a related aspect, the invention concerns an antiviral oligonucleotide preparation that includes one or more oligonucleotides identified using a method of any of the preceding methods for identifying, obtaining, or purifying antiviral oligonucleotides from an initial oligonucleotide pool, where the oligonucleotides in the oligonucleotide preparation exhibit higher mean binding affinity with one or more viral proteins than the mean binding affinity of oligonucletides in the initial oligonucleotide pool.

In particular embodiments, the mean binding affinity of the oligonucleotides is at least two-fold, 3-fold, 5-fold, 10-fold, 20-fold, 50-fold, or 100-fold greater than the mean binding affinity of oligonucleotides in the initial oligonucleotide pool, or even more; the median of binding affinity is at least two-fold, 3-fold, 5-fold, 10-fold, 20-fold, 50-fold, or 100-fold greater relative to the median of the binding affinity of the initial oligo pool, where median refers to the middle value.

In yet another aspect, the invention provides an antiviral polymer mix that includes at least one antiviral oligonucleotide and at least one non-nucleotide antiviral polymer. In particular embodiments, the oligonucleotide is as described herein for antiviral oligonucleotides and/or the antiviral polymer is as described herein or otherwise known in the art or subsequently identified.

In yet another aspect, the invention provides an oligonucleotide randomer, where the randomer is at least 6 nucleotides in length. In particular embodiments the randomer has a length as specified above for antiviral oligonucleotides; the randomer includes at least one phosphorothioate linkage, the randomer includes at least one phosphorodithioate linkage or other modification as listed herein; the randomer oligonucleotides include at least one non-randomer segment (such as a segment complementary to a selected virus nucleic acid sequence), which can have a length as specified above for oligonucleotides; the randomer is in a preparation or pool of preparations containing at least 5, 10, 15, 20, 50, 100, 200, 500, or 700 micromol, 1, 5, 7, 10, 20, 50, 100, 200, 500, or 700 mmol, or 1 mole of randomer, or a range defined by taking any two different values from the preceding as inclusive end points, or is synthesized at one of the listed scales or scale ranges.

Likewise, the invention provides a method for preparing antiviral randomers, by synthesizing at least one randomer, e.g., a randomer as described above.

As indicated above, for any aspect involving a viral infection or risk of viral infection or targeting to a particular virus, in particular embodiments the virus is as listed above.

The expression "human and animal viruses" is intended to include, without limitation, DNA and RNA viruses in general. DNA viruses include, for example, parvoviridae, papovaviridae, adenoviridae, herpesviridae, poxviridae, hepadnaviridae, and papillomaviridae. RNA viruses include, for example, arenaviridae, bunyaviridae, calciviridae, coronaviridae, filoviridae, flaviridae, orthomyxoviridae, paramyxoviridae, picomaviridae, reoviridae, rhabdoviridae, retroviridae, or togaviridae.

In connection with modifying characteristics of an oligonucleotide by linking or conjugating with another molecule or moiety, the modifications in the characteristics are evaluated relative to the same oligonucleotide without the linked or conjugated molecule or moiety.

Additional embodiments will be apparent from the Detailed Description and from the claims.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT The present invention is concerned with the identification and use of antiviral oligonucleotides that act by a sequence independent mechanism, and includes the discovery that for many viruses, the antiviral activity is greater for larger oligonucleotides, and is typically optimal for oligonucleotides that are 40 nucleotides or more in length.

In accordance with the present invention there is provided an oligonucleotide comprising at least one modified internucleotidic linkage, wherein said oligonucleotide has an antiviral activity against a target virus wherein said activity operates predominantly by a sequence independent mode of action.

In accordance with the present invention, there is provided an oligonucleotide, having at least 50% of its nucleotides in said oligonucleotide modified at the 2'-position of the ribose moiety and having at least 50% of its internucleotidic linkages modified, wherein said oligonucleotide has an antiviral activity against a target virus, said activity operating predominantly by a sequence independent mode of action. In one embodiment, 50%, 80% respectively. In one embodiment, 80%, 80% respectively. In one embodiment, 90%, 90% respectively. In one embodiment, 100%, 100% respectively.

Lengths & not self-complementary

The present invention further provides an oligonucleotide having at least 15 nucleotides in length. In one embodiment, at least 20 nucleotides in length. In one embodiment, at least 25 nucleotides in length. In one embodiment, at least 30 nucleotides in length. In one embodiment, at least 35 nucleotides in length. In one embodiment, at least 40 nucleotides in length. In one embodiment, at least 45 nucleotides in length. In one embodiment, at least 50 nucleotides in length. In one embodiment, at least 60 nucleotides in length. In one embodiment, at least 80 nucleotides in length.

The present invention further provides an oligonucleotide having 20-30 nucleotides in length. In one embodiment, 30-40 nucleotides in length. in one embodiment, 40-50 nucleotides in length. In one embodiment, 50-60 nucleotides in length. In one embodiment, 60-70 nucleotides in length. In one embodiment, 70-80 nucleotides in length.

The present invention further provides an oligonucleotide which is free from self- complementary sequences of greater than 5 contiguous nucleotides, in one embodiment, greater than 10 contiguous nucleotides. In one embodiment, greater than 20 contiguous nucleotides.

The present invention further provides an oligonucleotide which is free of catalytic activity.

Random

The present invention further provides an oligonucleotide having an antiviral activity against a target virus, and the sequence of said oligonucleotide not being complementary to any equal length portion of the genomic sequence of said target virus. The present invention further provides an oligonucleotide, wherein said oligonucleotide is not complementary to any equal length portion of the genomic sequence of a human pathogenic virus .

The present invention further provides an oligonucleotide, wherein said oligonucleotide is not complementary to any equal length portion of the genomic sequence of a human pathogenic virus sequenced as of January 1st, 2005.

The present invention further provides an oligonucleotide which is not complementary to any equal length portion of the genomic sequence of a human.

The present invention further provides an oligonucleotide which is not complementary to any equal length portion of the genomic sequence of one or more animals selected from the group consisting of cattle, horse, swine, sheep, bird, dog, cat and fish.

RNA and other chain moiety limitations

The present invention further provides an oligonucleotide wherein at least 30% of the nucleotides are ribonucleotides. In one embodiment, at least 50% of the nucleotides are ribonucleotides. In one embodiment, at least 70% of the nucleotides are ribonucleotides. In one embodiment, at least 80% of the nucleotides are ribonucleotides. In one embodiment, at least 90% of the nucleotides are ribonucleotides. In one embodiment, all of the nucleotides are ribonucleotides.

The present invention further provides an oligonucleotide comprising 1-4 non-nucleotide chain moieties.

Randomer

The present invention further provides an oligonucleotide comprising at least 10 contiguous nucleotides of randomer sequence. In one embodiment, at least 20 nucleotides of randomer sequence. In one embodiment, at least 30 nucleotides of randomer sequence. In one embodiment, at least 40 nucleotides of randomer sequence.

The present invention further provides an oligonucleotide wherein said oligonucleotide is randomer oligonucleotide. Homopolymer

The present invention further provides an oligonucleotide comprising a homopolymer sequence of at least 10 contiguous A nucleotides. In one embodiment, at least 10 contiguous T nucleotides In one embodiment,at least 10 contiguous U nucleotides. In one embodiment, at least 10 contiguous C nucleotides. In one embodiment,at least 10 contiguous G nucleotides. In one embodiment, at least 10 contiguous I nucleotide analogs.

Heterodimers

The present invention further provides an oligonucleotide comprising a polyAT sequence at least 10 nucleotides in length. In one embodiment.a polyAC sequence at least 10 nucleotides in length. In one embodiment.a polyAG sequence at least 10 nucleotides in length. In one embodiment, a polyAU sequence at least 10 nucleotides in length. In one embodiment, a polyAI sequence at least 10 nucleotides in length. In one embodiment.a polyGC sequence at least 10 nucleotides in length. In one embodiment, a polyGT sequence at least 10 nucleotides in length. In one embodiment, a polyGU sequence at least 10 nucleotides in length. In one embodiment, a polyGI sequence at least 10 nucleotides in length. In one embodiment.a polyCT sequence at least 10 nucleotides in length. In one embodiment, a polyCU sequence at least 10 nucleotides in length. In one embodiment.a polyCI sequence at least 10 nucleotides in length. In one embodiment.a polyTI sequence at least 10 nucleotides in length.

Modified linkages, including ps and ps2

The present invention further provides an oligonucleotide, wherein the modified linkages are selected from the group consisting of phosphorothioate linkages, phosphorodithioate linkages, and boranophosphate linkages.

The present invention further provides an oligonucleotide wherein at least 50% of the internucleotidic linkages are modified linkages. In one embodiment, wherein at least 80% of the internucleotidic linkages are modified linkages. In one embodiment, wherein at least 90% of the internucleotidic linkages are modified linkages. In one embodiment, wherein all of the internucleotidic linkages are modified linkages.

The present invention further provides an oligonucleotide, wherein at least 50% of the internucleotidic linkages are phosphorothioate linkages. In one embodiment, wherein at least 80% of the internucleotidic linkages are phosphorothioate linkages. In one embodiment, wherein at least 90% of the internucleotidic linkages are phosphorothioate linkages. In one embodiment, wherein all of the internucleotidic linkages are phosphorothioate linkages.

The present invention further provides an oligonucleotide, wherein at least 50% of the internucleotidic linkages are phosphorodithioate linkages. In one embodiment, wherein at least 80% of the internucleotidic linkages are phosphorodithioate linkages. In one embodiment, wherein all of the internucleotidic linkages are phosphorodithioate linkages.

2'-modifications, combinations with modified linkages

The present invention further provides an oligonucleotide, wherein said oligonucleotide comprises at least one phosphodiester linkage. In one embodiment, wherein said oligonucleotide comprises at least 10% phosphodiester linkages. In one embodiment , wherein said oligonucleotide comprises at least 20% phosphodiester linkages.

In one embodiment, wherein at least 50% of the nucleotides in said oligonucleotide are modified at the 2'-position of the ribose moiety. In one embodiment, wherein at least 60% of the nucleotides in said oligonucleotide are modified at the 2'-position of the ribose moiety. In one embodiment, wherein at least 70% of the nucleotides in said oligonucleotide are modified at the 2'-position of the ribose moiety. In one embodiment, wherein at least 80% of the nucleotides in said oligonucleotide are modified at the T- position of the ribose moiety. In one embodiment, wherein at least 90% of the nucleotides in said oligonucleotide are modified at the 2'-position of the ribose moiety. In one embodiment, wherein 100% of the nucleotides in said oligonucleotide are modified at the 2'-position of the ribose moiety.

The present invention further provides an oligonucleotide, wherein at least 50% of the internucleotidic linkages are modified and at least 50% of the nucleotides in said oligonucleotide are modified at the 2'-position of the ribose moiety. In one embodiment, wherein at least 60% of the internucleotidic linkages are modified and at least 60% of the nucleotides in said oligonucleotide are modified at the 2'-position of the ribose moiety. In one embodiment, wherein at least 70% of the internucleotidic linkages are modified and at least 70% of the nucleotides in said oligonucleotide are modified at the 2'-position of the ribose moiety. In one embodiment, wherein at least 80% of the internucleotidic linkages are modified and at least 80% of the nucleotides in said oligonucleotide are modified at the 2'-position of the ribose moiety. In one embodiment, wherein all of the internucleotidic linkages are modified and all of the nucleotides in said oligonucleotide are modified at the 2'-position of the ribose moiety.

The present invention further provides an oligonucleotide, wherein at least 15% of the nucleotides in said oligonucleotide comprise 2'-OMe moieties at the 2'-position of the ribose moiety. In one embodiment, wherein at least 20% of the nucleotides in said oligonucleotide comprise 2'-OMe moieties at the 2'-position of the ribose moiety. In one embodiment, wherein at least 30% of the nucleotides in said oligonucleotide comprise 2'-0Me moieties at the 2'-position of the ribose moiety. In one embodiment, wherein at least 50% of the nucleotides in said oligonucleotide comprise 2'-OMe moieties at the 2'- position of the ribose moiety. In one embodiment, wherein at least 60% of the nucleotides in said oligonucleotide comprise 2'-OMe moieties at the 2'-position of the ribose moiety. In one embodiment, wherein at least 70% of the nucleotides in said oligonucleotide comprise 2'-0Me moieties at the 2'-position of the ribose moiety. In one embodiment, wherein at least 80% of the nucleotides in said oligonucleotide comprise 2'-OMe moieties at the 2'-position of the ribose moiety. In one embodiment, wherein at least 90% of the nucleotides in said oligonucleotide comprise 2'-OMe moieties at the 2'- position of the ribose moiety. In one embodiment, wherein all of the nucleotides in said oligonucleotide comprise 2'-OMe moieties at the 2'-position of the ribose moiety.

Misc. Characteristics

The present invention further provides an oligonucleotide, wherein said oligonucleotide is a concatemer consisting of two or more oligonucleotide sequences joined by a linker.

The present invention further provides an oligonucleotide, wherein said oligonucleotide is linked or conjugated at one or more nucleotide residues, to a molecule modifying the characteristics of the oligonucleotide to obtain one or more characteristics selected from the group consisting of higher stability, lower serum interaction, higher cellular uptake, higher viral protein interaction, an improved ability to be formulated for delivery, a detectable signal, higher antiviral activity, better pharmacokinetic properties, specific tissue distribution, lower toxicity.

The present invention further provides an oligonucleotide, wherein said oligonucleotide is double stranded. The present invention further provides an oligonucleotide, wherein said oligonucleotide is double or single stranded and comprises at least one base which is capable of hybridizing via non-watson-crick interactions.

The present invention further provides an oligonucleotide, wherein said oligonucleotide comprises a portion complementary to a viral mRNA.

The present invention further provides an oligonucleotide, wherein said oligonucleotide binds to one or more viral components.

The present invention further provides an oligonucleotide, wherein said oligonucleotide interacts with one or more host components, wherein said interaction results in inhibition of viral activity or production.

The present invention further provides an oligonucleotide, wherein at least a portion of the sequence of said oligonucleotide is derived from a viral genome.

The present invention further provides an oligonucleotide, wherein at least a portion of the sequence of said oligonucleotide is derived from a viral genome and has an antiviral activity that is predominantly a non-sequence complementary mode of action.

The present invention further provides an oligonucleotide, wherein at least a portion of the sequence of said oligonucleotide is derived from a viral packaging sequence or other viral sequence involved in an aptameric interaction.

The present invention further provides an oligonucleotide, wherein at least a portion of the sequence of said oligonucleotide is involved in an aptameric interaction with a viral component or a host component or both.

Activity levels

The present invention further provides an oligonucleotide, wherein said oligonucleotide has an IC₅₀ for a target virus of 0.10 μm or less. In one embodiment, wherein said oligonucleotide has an IC₅₀ for a target virus of 0.05 μm or less. In one embodiment, wherein said oligonucleotide has an IC₅₀ for a target virus of 0.025 μm or less. In one embodiment, wherein said oligonucleotide has an IC₅₀ for a target virus of 0.015 μm or less. Target viruses

The present invention further provides an oligonucleotide, wherein said oligonucleotide targets a DNA virus. In one embodiment, an RNA virus. In one embodiment, a member of the herpesviridae. In one embodiment, HSV-1. In one embodiment, HSV-2. In one embodiment, CMV. In one embodiment, a member of the hepadnaviridae In one embodiment, HBV. In one embodiment, a member of the parvoviridae. In one embodiment, a member of the poxviridae. In one embodiment, a member of the papillomaviridae. In one embodiment, a member of the adenoviridae In one embodiment, a member of the retroviridae In one embodiment, HIV-1. In one embodiment, HIV-2 In one embodiment, a member of the paramyxoviridae. In one embodiment, RSV. In one embodiment, parainfluenza virus. In one embodiment, a member of the bunyaviridae. In one embodiment, hantavirus In one embodiment, a member of the picornaviridae In one embodiment, coxsackievirus. In one embodiment, rhinovirus. In one embodiment, a member of the flaviviridae In one embodiment, yellow fever virus In one embodiment, dengue virus. In one embodiment, West Nile virus In one embodiment, hepatitis C virus. In one embodiment, a member of the filoviridae. In one embodiment, Ebola virus In one embodiment, Marburg virus In one embodiment, a member of the orthomyxoviridae. In one embodiment, influenza virus. In one embodiment, a member of the togaviridae. In one embodiment, a member of the coronaviridae. In one embodiment, a member of the reoviridae. In one embodiment, a member of the rhabdoviridae. In one embodiment, a member of the arenaviridae. In one embodiment, a member of the calciviridae. In one embodiment, Varicella Zoster Virus. In one embodiment, Epstein Barr Virus. In one embodiment, Herpesvirus 6A or 6B. In one embodiment, a member of hepadnaviridae. In one embodiment, human metapneumovirus. In one embodiment, Rift Valley fever virus. In one embodiment, Crimean Congo Hemorrhagic Fever virus. In one embodiment, Western Equine Encephalitis virus. In one embodiment, lassa fever virus.

Oligonucleotide

The present invention further provides an oligonucleotide comprising at least 20 linked nucleotides, wherein at least 80% of the linkages are modified; and at least 80% of the nucleotides comprise 2'-modifications of the ribose sugar moiety. In one embodiment, this oligonucleotide has an antiviral activity. In one embodiment, wherein at least 90% of the internucleotidic linkages are modified In one embodiment, , wherein all of the internucleotidic linkages are modified. In one embodiment, wherein at least 90% of the nucleotides comprise 2'-modifications of the ribose sugar. In one embodiment, wherein all of the nucleotides comprise 2'- modifications of the ribose sugar.

The present invention further provides an oligonucleotide, wherein said 2'-modifications are 2'-OMe substitutions. In one embodiment, wherein at least 90% of the nucleotides comprise 2'-OMe substitutions. In one embodiment, wherein all of the nucleotides comprise 2'-OMe substitutions.

The present invention further provides an oligonucleotide, wherein said 2'-modifications are 2'-methoxyethoxy substitutions. In one embodiment, at least 15% of the nucleotides comprise 2'- methoxyethoxy substitutions. In one embodiment, at least 50% of the nucleotides comprise 2'- methoxyethoxy substitutions. In one embodiment, at least 90% of the nucleotides comprise 2'- methoxyethoxy substitutions. In one embodiment, all of the nucleotides comprise 2'- methoxyethoxy substitutions.

The present invention further provides an oligonucleotide, wherein said oligonucleotide is at least 40 nucleotides in length. In one embodiment, at least 50 nucleotides in length. In one embodiment, at least 60 nucleotides in length. In one embodiment, at least 80 nucleotides in length

The present invention further provides an oligonucleotide, wherein said oligonucleotide is 30-40 nucleotides in length. In one embodiment, 40-50 nucleotides in length. In one embodiment, 50-60 nucleotides in length. In one embodiment, 60-70 nucleotides in length. In one embodiment, 70-80 nucleotides in length.

The present invention further provides an oligonucleotide, wherein said oligonucleotide is free from self-complementary sequences of greater than 5 contiguous nucleotides. In one embodiment, greater than 10 contiguous nucleotides. In one embodiment, greater than 20 contiguous nucleotides.

The present invention further provides an oligonucleotide, wherein said oligonucleotide is free of catalytic activity. Chain moiety limitations

The present invention further provides an oligonucleotide, further comprising 1-4 non- nucleotide chain moieties.

Mixtures

The present invention further provides an oligonucleotide mixture, comprising a mixture of at least two different antiviral oligonucleotides of the invention. In one embodiment, at least ten different antiviral oligonucleotides. In one embodiment, at least 100 different antiviral oligonucleotides. In one embodiment, at least 1000 different antiviral oligonucleotides. In one embodiment, at least 106 different antiviral oligonucleotides.

The present invention further provides a mixture, wherein a plurality of said different oligonucleotides are at least 10 nucleotides in length. In one embodiment, at least 20 nucleotides in length. In one embodiment, at least 30 nucleotides in length. In one embodiment, at least 40 nucleotides in length. In one embodiment, at least 50 nucleotides in length. In one embodiment, at least 60 nucleotides in length. In one embodiment, at least 70 nucleotides in length. In one embodiment, at least 80 nucleotides in length. In one embodiment, at least 120 nucleotides in length.

Pharmaceutical compositions

The present invention further provides an antiviral pharmaceutical composition comprising a therapeutically effective amount of at least one pharmacologically acceptable, antiviral oligonucleotide, polypyrimidine or oligonucleotide mixture, wherein the antiviral activity of said oligonucleotide or the oligonucleotides in said mixture occurs principally by a sequence independent mode of action; and a pharmaceutically acceptable carrier.

The present invention further provides an antiviral pharmaceutical composition, adapted for the treatment, control, or prevention of a disease with a viral etiology.

The present invention further provides an antiviral pharmaceutical composition, adapted for the treatment, control or prevention of a prion disease.

The present invention further provides an antiviral pharmaceutical composition, adapted for delivery by a mode selected from the group consisting of intraocular, oral ingestion, enterally, inhalation, cutaneous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, intrathecal injection, intratrachael injection, and intravenous injection.

The present invention further provides an antiviral pharmaceutical composition, wherein said composition further comprises a delivery system. In one embodiment, said delivery system targets specific cells or specific tissues. In one embodiment, said composition further comprises at least one other antiviral drug in combination. In one embodiment, said composition further comprises a non-nucleotide antiviral polymer in combination. In one embodiment, said composition further comprises an antiviral antisense oligonucleotide in combination. In one embodiment, said comoposition further comprises an antiviral RNAi-inducing oligonucleotide. In one embodiment, said antiviral RNAi- inducing oligonucleotide is an siRNA.

The present invention further provides an antiviral pharmaceutical composition, wherein said composition has an ICs₀ for a target virus of 0.10 μM or less. In one embodiment, an IC₅₀ for a target virus of 0.05 μM or less. In one embodiment, an IC₅₀ for a target virus of 0.025 μM or less. In one embodiment, an IC₅₀ for a target virus of 0.015 μM or less.

Kits

The present invention further provides a kit comprising at least one antiviral oligonucleotide, mixture, or antiviral pharmaceutical composition in a labeled package, wherein the antiviral activity of said oligonucleotide occurs principally by a non- sequence complementary mode of action and the label on said package indicates that said antiviral oligonucleotide can be used against at least one virus.

The present invention further provides a kit, wherein said kit contains a mixture of at least two different antiviral oligonucleotides.

The present invention further provides a kit approved by a regulatory agency for use in humans.

The present invention further provides a kit approved by a regulatory agency for use in at least one non-human animal. In one embodiment, said non-human animal is a primate In one embodiment, said non-human animal is a feline In one embodiment, said non-human animal is a bovine. In one embodiment, said non-human animal is an ovine. In one embodiment, said non-human animal is a canine In one embodiment, said non- human animal is a porcine. In one embodiment, said non-human animal is an equine. Method of treatment

The present invention further provides use of at least one oligonucleotide according to the invention, or pharmaceutical composition according to the invention in the manufacture of a medicament for the prophylaxis or treatment of a viral infection in a subject.

In one embodiment, said subject is a human. In one embodiment, said subject is a non-human animal. In one embodiment, said non-human animal is a primate. In one embodiment, said non-human animal is a feline. In one embodiment, said non-human animal is a bovine. In one embodiment, said non-human animal is an ovine. In one embodiment, said non-human animal is a canine. In one embodiment, said non-human animal is a porcine. In one embodiment, said non-human animal is an equine. In one embodiment, said subject is a plant.

The present invention further provides use of at least one oligonucleotide according to the invention, or pharmaceutical composition according to the invention in the manufacture of a medicament for the prophylactic treatment of cancer caused by oncoviruses in a human or a non-human animal.

In one embodiment, said oligonucleotide is administered to a human. In one embodiment, said oligonucleotide is administered to a non-human animal. In one embodiment, said non-human animal is a primate. In one embodiment, said non- human animal is a feline. In one embodiment, said non-human animal is a bovine. In one embodiment, said non-human animal is an ovine. In one embodiment, said non- human animal is a canine. In one embodiment, said non-human animal is a porcine. In one embodiment, said non-human animal is an equine.

Polypyrimidine oligo-related

The present invention further provides an oligonucleotide comprising at least 50% of pyrimidine residues. In one embodiment, at least 80%. In one embodiment, at least 90%. In one embodiment, only pyrimidine residues.

The present invention further provides an oligonucleotide wherein the pyrimidine residues are cytosine residues. In one embodiment, thymine residues. In one embodiment, cytosine or thymine residues.

The present invention further provides an antiviral pharmaceutical composition comprising a therapeutically effective amount of at least one pharmacologically acceptable, polypyrimidine oligonucleotide or polypyrimidine oligonucleotide mixture, wherein the antiviral activity of said oligonucleotide or the oligonucleotides in said mixture occurs principally by a sequence independent mode of action; and a pharmaceutically acceptable carrier. In one embodiment, said oligonucleotide comprises at least one modified internucleotidic linkage.

In one embodiment, said composition is adapted for administration to an acidic in vivo site.

In one embodiment, said composition further comprises a penetration enhancer.

In one embodiment, said composition further comprises a surfactant.

In one embodiment, said composition is in the form of a powder.

In one embodiment, said composition is in the form of granules.

In one embodiment, said composition is in the form of microparticulates.

In one embodiment, said composition is in the form of nanoparticulates.

In one embodiment, said composition is in the form of a suspension or solution.

In one embodiment, said composition is in the form of an emulsion.

In one embodiment, said composition is adapted for oral administration.

In one embodiment, wherein said composition is adapted for vaginal administration.

In one embodiment, said composition comprises at least one polyC oligonucleotide.

In one embodiment, said composition comprises at least one polyT oligonucleotide.

In one embodiment, said composition comprises at least one polyCT oligonucleotide.

In one embodiment, said composition is approved for administration to a human.

In one embodiment, said composition is approved for administration to a mammal.

In one embodiment, said composition is approved for administration to a non-mammal animal. The present invention further provides use of a pharmaceutical composition adapted for administration to an acidic in vivo site, wherein said composition contains at least one pharmacologically acceptable polypyrimidine oligonucleotide in the manufacture of a medicament for the prophylaxis or treatment of a viral infection in a subject.

In one embodiment, said subject is a human. In one embodiment, said subject is a mammal. In one embodiment, said subject is a non-mammal animal.

As described in the Background, a number of antisense oligonucleotides (ONs) have been tested for antiviral activity. However, such antisense ONs are sequence-specific, and typically are about 16-20 nucleotides in length.

As demonstrated by the results in Examples 1 and 2, the antiviral effect of random PS- ONs is not sequence specific. Considering the volumes and concentrations of PS-ONs used in those tests, it is almost theoretically impossible that a particular random sequence is present at more than 1 copy in the mixture. This means than there can be no antisense effect in these PS-ON randomers. In the latter example, should the antiviral effect be caused by the sequence-specificity of the PS-ONs, such effect would thus have to be caused by only one molecule, a result that does not appear possible. For example, for an ON randomer 40 bases in length, any particular sequence in the population would theoretically represent only 1/4⁴⁰ or 4.1 X 10^"41 of the total fraction. Given that 1 mole = 6.022X10²³ molecules, and the fact that our largest synthesis is currently done at the 15 micromole scale, all possible sequences will not be present and also, each sequence is present most probably as only one copy. Of course, one skilled in the art applying the teaching of the present invention could also use ONs that have sequences of such sequence specific ONs₁ but utilize the sequence independent activity discovered in the present invention. Accordingly, the present invention is not to be restricted to non-sequence complementary ONs₁ but disclaims what has been disclosed in the prior art regarding sequence-specific antisense and RNAi (e.g., siRNA) ONs for treating viral infections.

For applicable viruses (including, for example, those for which data is described herein), as the size of the randomer increases, so does its antiviral potency for lengths up to and even exceeding 40 nucleotides. It should be pointed out that due to limitations in current phosphoramidite-based oligonucleotide synthesis, the larger PS-ONs (e.g., 80- and 120-mers) have a significant contamination of fragments smaller than the desired size. The weaker effects (on a per base basis) seen with larger oligos (80 and 120 bp) may reflect the lower concentration of full-length randomers in these populations and may also reflect a decreased availability at the appropriate site. It may be possible to achieve much larger increases in antiviral activity if larger randomers (>40 bases) of reasonable purity (e.g., at least 75% full length) are synthesized or purified, and/or if the delivery of any of these ONs is facilitated by a delivery system, e.g., a delivery system providing targeting or sustained release.

In the present invention, randomers (or other antiviral oligonucleotides as described herein) may block viral replication by several mechanisms, including but not limited to the following: 1. preventing the adsorption or receptor interaction of virions, thus preventing infection, 2. doping the virus assembly or the packaging of viral genomes into capsids (competing with viral DNA or RNA for packaging), resulting in defective virions, 3. disrupting and or preventing the formation of capsids during packaging or the interaction of capsid proteins with other structural proteins, resulting in inhibition of viral release or causing the release of defective virions, 4. binding to key viral components and preventing or reducing their activity, 5. binding to key host components required for viral proliferation.

Without being limited on the mechanism by which the present viral inhibition is achieved, as indicated above there are several possible mechanisms that could explain and/or predict the inhibitory properties of ONs against viral replication. The first of these is that the general aptameric effect of ONs is allowing for their attachment, either to proteins on the cell surface or to viral proteins, preventing viral adsorption and fusion. The size threshold for effect may be a result of a certain cumulative charge required for interaction.

A second possible mechanism is that ONs may function within the cell by preventing packaging and/or assembly of the virus. ONs above a certain size threshold may compete or interfere with the normal capsid/nucleic acid interaction, preventing the packaging of a functional viral genome inside new viruses. Alternatively, ONs may prevent the formation of a normal capsid, which could prevent normal viral budding, alter viral stability, or prevent proper virion disassembly upon internalization.

While the mechanism of action is not yet entirely clear, assay results demonstrate that the present ONs can exhibit greater efficacy in viral inhibition compared to the clinical correlates, acyclovir, gancyclovir, Ribavirin, and protease inhibitors. ONs in accordance with the present invention could thus be used for treating or preventing viral infection. The viral infections treated could be those caused by human, animal, and plant viruses Chemical modification of oligonucleotides can advantageously be used to enhance the stability and/or activity of the present antiviral oligonucleotides. Methoxylation and other modifications at the 2'-position of the ribose on RNA have been shown to render RNA stable to nucleases, to minimize the protein binding observed with phosphorothioated nucleic acids and to increase the melting temperature of these oligos with their target sequences. While 2'-0 methylation and other 2'-modifιcations are currently used to improve the characteristics of antisense oligonucleotides, oligonucleotides with such modfications do not elicit RNase H activity when present on every ribose, making completely 2'-modifιed oligonucleotides poorer candidates for antisense activity. This has resulted in the use of 2'-0 methyl and other 2' modification "gapmers" which contain 2' modifications only at the extremities of the oligonucleotide, thus retaining the ability of the oligo to activate RNase H. To our knowledge, there is no report of a non-sequence specific antiviral oligonucleotide with phosphorothioate linkages and ribonucleotides such as 2'-O-methyl or other 2' modification on each ribose sugar in the oligonucleotide.

As described herein, we had found that the 40 base PS-ON randomer is a potent inhibitor of several different viruses. We suggest the non-limiting hypothesis that the thioated backbone imparts an increased hydrophobic character to the ON randomer, which may allow it to interact with hydrophobic domains in viral fusion proteins. These hydrophobic domains are believed to be essential for the membrane fusion activity of many different viruses including HSV, HIV, influenza, RSV, and Ebola. In the case of HIV, such hydrophobic domain has been used as a target for the development of fusion inhibitors.

Thus, the incorporation of phosphorothioate linkages and ribonucleotide modifications, including 2'-O-methyl and other 2' sugar modifications, into oligonucleotides of this invention, is useful for improving characteristics of non-sequence specific antiviral oligonucleotides. Results demonstrate that modification at the '2-position of each ribose of PS-ONs does not significantly alter their antiviral activity, but that such modification reduces the general interaction of the PS-ONs with serum proteins and renders them significantly more resistant to low pH. These properties promise to increase the pharmacokinetic performance and reduce the toxic side effects normally seen with PS-

ONs. For example, their pH resistance make them more suitable for oral delivery. Also their lowered interaction with serum proteins promises to improve their pharmacokinetic behaviour without affecting their antiviral activity. Thus, oligonucleotides having each linkage phosphorothioated and each ribonucleotide modified at the 2'-position of the ribose, e.g., 2'-0-methyl modifications, have antiviral activity but do not trigger RNase H activity , a property desirable for traditional antisense oligonucleotide but completely dispensable for the activity described in this present invention. Results also demonstrate that modifications at the '2-position of each ribose of PS-ONs renders the ON more resistant to nucleases in comparison with a PS-ON comprising the same modifications but only at both ends (gapmer). Gapmers are preferentially used in the antisense technology. Nuclease resistance of PS-ONs including modifications at the '2- position of each ribose should display beneficial properties, such as improved pharmakokinetics and/or oral availability.

In addition, while PS-ONs that include modifications at the 2'-position of each ribose show desirable characteristics, PS-ONs with substantial numbers of modifications at the 2'-position of riboses would also display desirable characteristic, e.g., modification at at least 50 % of the riboses and more preferably 80% or even more.

As described above, the activity of the present oligonucleotides does not target any nucleic acid by hybridization since randomers, for example, have no antisense activity. Thus, we believe that the oligonucleotides target proteins. Since the addition of 2'-O- methyl ribose modifications to phosphorothioate oligonucleotides lowers the protein binding activity (Kandimalla et al., 1998, Bioorganic Med Chem Lett. 8:2103-2108; Mou et al., 2002, Nucleic Acids Res. 30:749-758), it would be expected that these modifications would lower antiviral activity. Unexpectedly, we found that addition of 2'-O- methyl ribose modifications to phosphorothioate oligonucleotides does not affect the antiviral activity.

Assay results for a number of different oligonucleotides are described herein. Unless otherwise indicated, the tested oligonucleotides have 2'-H moieties (2'-deoxy) and are thus ODNs. However, the sequence independent activities of the present invention are not limited to oligonucleotides with such 2'-H moieties, but is also present for oligos containing. nucleotides having 2'-OH moieties as well as other 2'-modifications, for example, 2'-O-methyl and 2'-fluoro.

The description herein utilizes a number of abbreviations, including the following:

Selected abbreviations

ON: Oligonucleotide

ODN: Oligodeoxynucleotide

PS: Phosphorothioate 5 001623

PS2: Phosphorodithioate

PRA: Plaque reduction assay

PFU: Plaque forming unit

INF A: Influenza A virus

HIV: Human immunodeficiency virus (includes both HIV-1 and HIV-2 if not specified)

HSV: Herpes simplex virus (includes both HSV-2 and HSV-3 if not specified)

RSV: Respiratory syncytial virus

COX: Coxsackievirus

DHBV: Duck hepatitis B virus

Broad spectrum antiviral activity

According to the conclusions discussed above and the data reported herein, it appeared that random ONs and ON randomers could have broad-spectrum antiviral activity with viruses where assembly and/or packaging and/or encapsidation of the viral genome is a required step in replication. Therefore to test this hypothesis, several PS-ON randomers of different sizes were selected to be tested in cellular models of various viral Infections.

A number of such tests are described herein in the Examples, including tests with CMV, HIV-1 , RSV₁ Coxsackie virus B2, DHBV, Hantavirus, Parainfluenza virus, and Vaccinia virus, as well as the tests on HSV-1 and HSV-2 described in Examples 1 and 2.

Conclusions on broad spectrum antiviral activity

The efficacy studies with different viruses demonstrate that random ONs and randomers display inhibitory properties against a variety of different viruses. Moreover, these studies support the conclusion that larger randomers display greater efficacy for viral inhibition than smaller randomers. This suggests a common size and/or charge dependent mechanism for the random ONs or ON randomers activity in all encapsidating viruses. While HSV and CMV are both double-stranded DNA viruses of the herpesviridae family, HIV is a RNA virus from the retroviridae, and RSV a RNA virus from the paramyxoviridae. Given the fact that ON randomers can inhibit viral function in a variety of different viruses, without being limited to the mechanisms listed, as discussed above the following mechanisms are reasonable: A) ONs/ON randomers are inhibiting viral infection via an aptameric effect, preventing viral fusion with the plasma membrane; and/or B) ONs/ON randomers are preventing or doping the assembly of virions or the packaging of viral DNA within capsids resulting in defective virions; and/or C) ONs/ON randomers are interfering with host proteins or components required in the assembly and/or packaging and/or gene expression of the virus.

Requirement for antiviral activity

Since a randomized DNA sequence seems to be sufficient for viral inhibition, it was interesting to see if antiviral activity could be maintained in the absence of the phosphorothioate modification and also if the efficacy was augmented by either choosing a random sequence or a specific sequence found in the viral genome.

Accordingly, DNA and RNA modifications were investigated with respect to their effect on the antiviral efficacy of the randomers. Since randomers work via a sequence independent, e.g., non-sequence complementary, mechanism, these experiments were designed to test the slight changes in nucleic acid conformation and charge distribution on antiviral efficacy.

To test if ONs with different nucleotide/nucleoside modifications could inhibit HSV-1 , REP 2024, 2026, 2059, and 2060 were tested in the HSV-1 PRA as described in the Examples. REP 2024 (a PS-ON with a 2-O-Methyl modification to the ribose on 4 bases at both termini of the ON), REP 2026 (a PO-ON with methylphosphonate modifications to the linkages between the 4 bases at both termini of the ON), REP 2059 (RNA PS-ON randomer 20 bases in length), and REP 2060 (RNA PS-ON randomer 30 bases in length) showed anti-HSV-1 activity. The assay was conducted as a plaque reduction assay in VERO cells using HSV-1 (strain KOS). The PS-ONs were tested in increasing concentrations. IC₅₀ values calculated from linear regressions were 0.14, 3.41 , 1.36, and 0.80 respectively.

In the latter example, should the antiviral effect be caused only by the ONs consisting of DNA phosphorothioate backbone, such effect would thus be caused by only one molecule. But other backbones and modifications gave positive antiviral activity. Of course, one skilled in the art applying the teaching of the present invention could also use different chemistry ONs. A modification of the ON, such as, but not limited to, a phosphorothioate modification, appears to be beneficial for antiviral activity. This is most likely due to the needed charge of ONs and/or the requirement for stabilization of DNA both in the media and intracellular^, and it may also be due to the chirality of the PS-ONs.

Compound REP 2026 showed an antiviral activity while having a central portion comprising unmodified PO-nucleotides and 4 methylphosphonate linkages at both termini protecting from degradation. This indicates that PO-ONs can be used as antivirals while protected from degradation. This protection can be achieved by modifying nucleotides at termini and/or by using a suitable delivery system as described later.

In general, the sequence composition of the DNA used has little effect on the overall efficacy, whether randomer, random sequence or a specific HSV-1 sequence. However, at intermediate lengths, HSV-1 sequence was almost 3X more potent than a random sequence. This data suggests that while specific antisense functionality exists for specific HSV sequences, sequence independent mechanism (the non-antisense mechanism) elucidated herein may represent the predominant part of this activity. Indeed, as the ON grows to 40 bases, essentially all of the antiviral activity can be attributed to a sequence independent (e.g., non-antisense) effect.

Lower toxicity of randomer

One goal of using an ON randomer is to lower the toxicity. It is known that different sequences may trigger different responses in the animal, such as general toxicity, interaction with serum proteins, and interaction with immune system (Monteith et al (1998) Toxicol Sci 46:365-375). The mixture of ONs may thus decrease toxic effects because the level of any particular sequence will be very low, so that no significant interaction due to sequence or nucleotide composition is likely.

Pharmaceutical compositions

The ONs of the invention may be in the form of a therapeutic composition or formulation useful for treating (or prophylaxis of) viral diseases, which can be approved by a regulatory agency for use in humans or in non-human animals, and/or against a particular virus or group of viruses. These ONs may be used as part of a pharmaceutical composition when combined with a physiologically and/or pharmaceutically acceptable carrier. The characteristics of the carrier may depend on the route of administration. The pharmaceutical composition of the invention may also contain other active factors and/or agents which enhance activity.

Administration of the ONs of the invention used in the pharmaceutical composition or formulation or to practice the method of treating an animal can be carried out in a variety of conventional ways, such as intraocular, oral ingestion, enterally, inhalation, or cutaneous, subcutaneous, intramuscular, intraperitoneal, intrathecal, intratracheal, or intravenous injection.

The pharmaceutical composition or oligonucleotide formulation of the invention may further contain other chemotherapeutic drugs for the treatment of viral diseases, such as, without limitation, Rifampin, Ribavirin, Pleconaryl, Cidofovir, Acyclovir, Pencyclovir,

Gancyclovir, Valacyclovir, Famciclovir, Foscamet, Vidarabine, Amantadine, Zanamivir,

Oseltamivir, Resquimod, antiproteases, pegylated interferon (Pegasys™) anti HIV proteases (e.g. lopinivir, saquinivir, amprenavir, HIV fusion inhibitors, nucleotide HIV RT inhibitors (e.g., AZT, Lamivudine, Abacavir), non-nucleotide HIV RT inhibitors,

^■ Doconosol, Interferons, Butylated Hydroxytoluene (BHT) and Hypericin. Such additional factors and/or agents may be included in the pharmaceutical composition, for example, to produce a synergistic effect with the ONs of the invention.

The pharmaceutical composition or oligonucleotide formulation of the invention may further contain a polymer, such as, without restriction, polyanionic agents, sulfated polysaccharides, heparin, dextran sulfate, pentosan polysulfate, polyvinylalcool sulfate, acemannan, polyhydroxycarboxylates, cellulose sulfate, polymers containing sulfonated benzene or naphthalene rings and naphthalene sulfonate polymers, acetyl phthaloyl cellulose, poly-L-lysine, sodium caprate, cationic amphiphiles, cholic acid. Polymers are known to affect the entry of virions in cells by, in some cases, binding or adsorbing to the virion itself. This characteristic of antiviral polymers can be useful in competing with ONs for the binding, or adsorption to the virion, the result being an increased intracellular activity of the ONs compared to its extracellular activity.

Exemplary lipid encapsulation and delivery

Although PS-ONs (as well as oligonucleotides with other modified linkages) are more resistant to endogenous nucleases than natural phosphodiesters, they are not completely stable and are slowly degraded in blood and tissues. A limitation in the clinical application of PS oligonucleotide drugs is their propensity to activate complement on i.v. administration. In general, liposomes and other delivery systems enhance the therapeutic index of drugs, including ONs, by reducing drug toxicity, increasing residency time in the plasma, and delivering more active drug to disease tissue by extravasation of the carriers through hyperpermeable vasculature. Moreover in the case of PS-ON, lipid encapsulation prevents the interaction with potential protein- binding sites while in circulation (Klimuk et al. (2000) J Pharmacol Exp Ther 292:480- 488).

According to our results described herein, an approach is to use a delivery system such as, but without restriction, lipophilic molecules, polar lipids, liposomes, monolayers, bilayers, vesicles, programmable fusogenic vesicles, micelles, cyclodextrins, PEG, iontophoresis, powder injection, and nanoparticles (such as PIBCA, PIHCA, PHCA, gelatine, PEG-PLA) for the delivery of ONs described herein and/or antisense and siRNA oligonucleotides. Use of such delivery systems can, without limitation, provide one or more of the following benefits: lower the toxicity of the active compound in animals and humans, lower the IC₅₀, increase the duration of action from the standpoint of drug delivery, and protect the oligonucleotides from non-specific binding with serum proteins.

Thus, we have shown that the antiviral activity of PS-ON randomers increases with increasing size. Moreover this activity is correlated with increased affinity for viral proteins (in a viral lysate). Since it is well known in the art that the phosphorothioate modification increases the affinity of protein-DNA interaction, we tested the ability of increasingly larger PS-ON randomers to bind to fetal bovine serum (FBS) using the same FP-based assay used for measuring interaction with viral lysates. In this assay, 250ug of non-heat inactivated FBS was complexed with a fluorescently labeled 20 base PS-ON randomer, under conditions where the binding (mP value) was saturated.

Unlabelled PS-ON randomers of increasing size (REP 2003, REP 2004, REP 2006 and REP 2007) were used to compete the interaction of FBS with the labeled bait. The results of this test clearly show that as the size of the PS-ON randomer increases, so does its affinity for FBS. This result suggests that the most highly active anti-viral PS- ONs will also be the ones to bind with the highest affinity to proteins.

However, it is known in the art that one of the main therapeutic problems for phosphorothioate antisense oligonucleotides is their side effects due mainly to an increased interaction with proteins (specifically with serum proteins) as described by Kandimalla and co-workers (Kandimalla et al. (1998) Bioorg. Med. Chem. Lett. 8:2103- 2108). Therefore, in some cases it may be beneficial to use a suitable delivery system capable of delivering antiviral ONs to the site of action while preventing their interaction with serum proteins. In addition, it may be beneficial to use suitable delivery systems for combination use of the present sequence independent ONs with other types of ant-viral ONs such as antisense oligonucleotides and siRNAs.

To demonstrate certain effects of a delivery system, we tested two different delivery technologies which are liposomal based; Cytofectin and DOTAP. We measured the protection of REP2006 from serum protein interactions by DOTAP and Cytofectin in our in vitro FP-based interaction assay. Unencapsulated REP 2006 was able to compete bound fluorescent oligo from serum but when REP 2006 was encapsulated with either DOTAP or Cytofectin it was no longer able to compete for serum binding. These data suggest that encapsulation protects oligos from serum interaction and will result in better pharmacokinetic behaviour with fewer side effects.

We also measured the delivery of the PS-ON randomer REP 2006 (encapsulated with either Cytofectin or DOTAP) into 293A cells in the presence of high concentrations of serum (50%) by measuring the intracellular concentration of labeled REP 2006 by fluorometry. These results show that such delivery agents increase the intracellular concentration of REP 2006, and also that, in the case of DOTAP, the levels of intracellular REP 2006 after 24 hours were markedly increased. Finally, we measured the protection of REP2006 from serum protein interactions by DOTAP and cytofectin in our in vitro FP-based interaction assay. Unencapsulated REP 2006 was able to compete bound fluorescent oligo from serum but when REP 2006 was encapsulated with either DOTAP or cytofectin it was no longer able to compete for serum binding. These data suggest that encapsulation protects oligos from serum interaction and will result in better pharmacokinetic behaviour with fewer side effects.

Similarly demonstrating the effect of lipid encapsulation of oligonucleotides, we monitored the uptake of an additional PS-ON randomer by exposing cultured cells to fluorescently labeled randomers and then examined the fluorescence intensity in lysed cells after two rounds of washing. The cellular uptake of cells exposed to 25OnM REP 2004-FL was tested with no delivery and after encapsulation in one of the following lipid based delivery systems; Lipofectamine™ (Invitrogen), Polyfect™ (Qiagen) and Oligofectamine™ (Invitrogen). After 4 hours, cells were washed twice with PBS and lysed using MPER lysis reagent (PROMEGA). The relative fluorescence yield from equivalent numbers of exposed cells with and without lipid system was detected. We observed that in the presence of all three agents tested, there was a significant increase in the intracellular PS-ON concentration compared to no delivery. In keeping with the test results, the use of a delivery system can serve to protect oligonucleotides from serum interactions, reducing side effects and increasing tissue distribution and/or can significantly increase the intracellular delivery of ONs.

Another potential benefit in using a delivery system is to protect the ONs from interactions, such as adsorption, with infective virions in order to prevent amplification of viral infection through different mechanisms such as increased cellular penetration of virions.

Another approach is to accomplish cell specific delivery by associating the delivery system with a molecule(s) that will increase affinity with specific cells, such molecules being without restriction antibodies, receptor ligands, vitamins, hormones and peptides.

Additional options for delivery systems are provided below.

Linked ON

In certain embodiments, ONs of the invention are modified in a number of ways without compromising their ability to inhibit viral replication. For example, the ONs are linked or conjugated, at one or more of their nucleotide residues, to another moiety. Thus, modification of the oligonucleotides of the invention can involve chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution, increase transfer across cellular membranes specifically or not, or protecting against degradation or excretion, or providing other advantageous characteristics. Such advantageous characteristics can, for example, include lower serum interaction, higher viral-protein interaction, the ability to be formulated for delivery, a detectable signal, improved pharmacokinetic properties, and lower toxicity. Such conjugate groups can be covalently bound to functional groups such as primary or secondary hydroxyl groups. For example, conjugate moieties can include a steroid molecule, a non-aromatic lipophilic molecule, a peptide, cholesterol, bis-cholesterol, an antibody, PEG, a protein, a water soluble vitamin, a lipid soluble vitamin, another ON, or any other molecule improving the activity and/or bioavailability of ONs.

In greater detail, exemplary conjugate groups of the invention can include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, SATE, t- butyl-SATE, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acfidine, fluoresceins, rhodamines, coumarins, fluorescent nucleobases, and dyes.

Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that enhance oligomer resistance to degradation and/or protect against serum interaction. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve oligomer uptake, distribution, metabolism or excretion. Exemplary conjugate groups are described in International Patent Application PCT/US92/09196, filed Oct. 23, 1992, which is incorporated herein by reference in its entirety.

Conjugate moieties can include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lef., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let, 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et at., EMBO J., 1991, 10, 1111- 1118; Kabanov et al., FEBS Lett, 1990, 259, 327-330; Svinarchuk et at., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et at., Tetrahedron Lett, 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et at., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et at, Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et at., Biochim. Biophys. Acta, 1995, 1264, 229- 237), or an octadecylamine or hexylaminocarbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol Exp. Ther., 1996, 277, 923-937.

The present oligonucleotides may also be conjugated to active drug substances, for example without limitation, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5- triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

Exemplary U.S. patents that describe the preparation of exemplary oligonucleotide conjugates include, for example, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541 ,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439;

5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737;

4,824,941 ; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963;

5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371 ,241 , 5,391 ,723; 5,416,203,

5,451 ,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is incorporated by reference herein in its entirety.

Another approach is to prepare antiviral ONs as lipophilic pro-oligonucleotides by modification with enzymatically cleavable charge neutralizing adducts such as s- acetylthio-ethyl or s-pivasloylthio-ethyl (Vives et al., 1999, Nucl Acids Res 27: 4071- 4076). Such modifications have been shown to increase the uptake of ONs into cells, and therefore are beneficial for ONs that are active intracellular^.

Design of non-specific ONs

In another approach, an antiviral ON demonstrating low, preferably the lowest possible, homology with the human (or other subject organism) genome is designed. The goal is to obtain an ON that will show the lowest toxicity due to interactions with human or animal genome sequence(s) and mRNAs. The first step is to produce the desired length sequence of the ON, e.g., by aligning nucleotides A, C, G, T in a random fashion, manually or, more commonly, using a computer program. The second step is to compare the ON sequence with a library of human sequences such as GenBank and/or the Ensemble Human Genome Database. The sequence generation and comparison can be performed repetitively, if desired, to identify a sequence or sequences having a desired low homology level with the subject genome. Desirably, the ON sequence is at the lowest homology possible with the entire genome, while also preferably minimizing self interaction.

Non-specific ONs with antisense activity

In another approach, an antiviral non-specific sequence portion(s) is/are coupled with an antisense sequence portion(s) to increase the activity of the final ON. The non-specific portion of the ONs is described in the present invention. The antisense portion is complementary to a viral mRNA. Non-specific ONs with a G-rich motif activity

In another approach, an antiviral non-specific sequence portion(s) is/are coupled with a motif portion(s) to improve the activity of the final ON. The non-specific portion of the ON is described in the present invention. The motif portion can, as non-limiting examples, include, CpG, Gquartet, and/or CG that are described in the literature as stimulators of the immune system. Agrawal et al. (2001) Curr. Cancer Drug Targets 3:197-209.

Non-Watson-Crick ONs

Another approach is to use an ON composed of one type or more of non-Watson-Crick nucleotides/nucleosides. Such ONs can mimic PS-ONs with some of the following characteristics similar to PS-ONs: a) the total charge; b) the space between the units; c) the length of the chain; d) a net dipole with accumulation of negative charge on one side; e) the ability to bind to proteins; f) the ability to bind viral proteins, g) the ability to penetrate cells, h) an acceptable therapeutic index, i) an antiviral activity. The ON has a preferred phosphorothioate backbone but is not limited to it. Examples of non-Watson- Crick nucleotides/nucleosides are described in Kool, 2002, Ace. Chem. Res. 35:936- 943; and Takeshita et al., (1987) J. Biol. Chem. 262:10171-10179 where ONs containing synthetic abasic sites are described.

Antiviral polymer

Another approach is to use a polymer mimicking the activity of phosphorothioate ONs. As described in the literature, several anionic polymers were shown to have antiviral inhibitory activity. These polymers belong to several classes: (1) sulfate esters of polysaccharides (dextrin and dextran sulfates; cellulose sulfate); (2) polymers containing sulfonated benzene or naphthalene rings and naphthalene sulfonate polymers; (3) polycarboxylates (acrylic acid polymers); and acetyl phthaloyl cellulose (Neurath et al. (2002) BMC Infect Dis 2:27); and (4) abasic oligonucleotides (Takeshita et al., 1987, J. Biol. Chem. 262:10171-10179). Other examples of non-nucleotide antiviral polymers are described in the literature. The polymers described herein mimic PS-ONs described in this invention and have the following characteristics similar to PS-ONs: a) the length of the chain; b) a net dipole with accumulation of negative charge on one side; c) the ability to bind to proteins; d) the ability to bind viral protein, e) an acceptable therapeutic index, f) an antiviral activity. In order to mimic the effect of a PS-ON, the antiviral polymer may preferably be a polyanion displaying similar space between its units as compared to a PS-ON. It may also have the ability to penetrate cells alone or in combination with a delivery system.

Antiviral activity of double-stranded PS-ONs

A random sequence (REP 2017) and its complement (either PS modified or unmodified) are fluorescently labeled as described elsewhere and tested for their ability to bind to purified HSV-1 and HIV-1 proteins by fluorescence polarization as described in the present invention. Hybridization was verified by acrylamide gel electrophoresis.

Unmodified REP 2017 (2017U), either single (ss) or double stranded (ds), had no binding activity in either HSV-1 or HIV-1 lysates. However, PS modified REP 2017, either single stranded or double stranded, was capable of HSV-1 and HIV-1 interaction.

According to our results described herein, an approach is to use double stranded ONs as effective antiviral agents. Preferentially such ONs have a phosphorothioate backbone but may also have other and/or additional modifications which increase antiviral activity and/or stability and/or delivery characteristics as described herein for singie stranded ONs.

In vitro assay for drug discovery

An in vitro assay is developed based on fluorescence polarization to measure the ability of PS-ONs to bind to viral components, e.g., viral proteins. When a protein (or another interactor) binds to the fluorescently labeled bait, the three dimensional tumbling of the bait in solution is retarded. The retardation of this tumbling is measured by an inherent increase in the polarization of excited light from the labeled bait. Therefore, increased polarization (reported as a dimensionless measure [mP]) is correlated with increased binding.

One methodology is to use as bait a PS-ON randomer labeled at the 3' end with FITC using an inflexible linker (3'-(6-Fluorescein) CPG). This PS-ON randomer is diluted to

2nM in assay buffer (1OmM Tris, pH7.2, 8OmM NaCI, 1OmM EDTA, 10OmM b- mercaptoethanol and 1% tween 20). This oligo is then mixed with an appropriate interactor. In this case, we use lysates of sucrose gradient purified HSV-1 (strain

Maclntyre), HIV-1 (strain Mn) or RSV (strain A2) suspended in 0.5M KCI and 0.5% Triton X-100 (HSV-1 and HIV-1) or 1OmM Tris, pH7.5, 15OmM NaCI, 1mM EDTA and

0.1% Triton X-100 (RSV). Following bait interaction, the complexes are challenged with various unlabelled PS-ONs to assess their ability to displace the bait from its complex. In a preliminary test with three baits of different sizes; 6 (REP 2032-FL), 10 (REP 2003- FL) and 20 bases (REP 2004-FL), the baits were tested for their ability to interact with HSV-1 , HIV-1 , and RSV lysates. Viral lysate binding to baits of different sizes was determined by fluorescence polarization. In the presence of any of the viral lysates the degree of binding was dependent on the size of the bait used, with 2004-FL displaying the largest shift in mP (binding) in the presence of viral lysate. We note that this is similar to the size dependent antiviral efficacy of PS-ON randomers. This bait was then used to assess the ability of PS-ONs of different sizes to compete the interaction of the bait with the lysate.

The interaction of REP 2004-FL with HSV-1 , HIV-1 , and RSV lysates was challenged with PS-ONs of increasing size. Determination of affinity of PS-ON randomers for the viral lysates was detected by fluorescence polarization. Using REP 2004-FL as the bait, complex formation with HSV-1 lysate, HIV-1 lysate, or RSV lysate was challenged with increasing concentrations of REP 2003, REP 2004, REP 2006 or REP 2007. For each viral lysate tested, we note that REP 2003 is unable to compete the bait away from the lysate. The bait interaction was very strong as revealed by the relatively weak competition elicited by the REP 2004 (unlabeled bait) competitor. However, it was observed that as the size of the competitor PS-ON increased above 20 bases, its ability to displace the bait became more robust. This indicates an increased affinity to protein components in the viral lysate as the PS-ON randomer size increases. This phenomenon mirrors the increased antiviral activity of larger PS-ON randomers against HSV-1 , HSV-2, CMV, HIV-1 and RSV.

The similarity between the efficacy in bait competition and antiviral activity of PS-ON randomers indicates that this assay paradigm is a good predictor of antiviral activity. This assay is robust, easy to perform and very stable, making it a very good candidate for a high throughput screen to identify novel antiviral molecules based not on specific target identification but on their ability to interact with one or more components, e.g., viral proteins.

While the exemplary method described herein utilizes fluorescence polarization to measure interaction with the viral lysate, numerous techniques are known in the art for monitoring protein interactions, and can be used in the present methods. These include without restriction surface plasmon resonance, fluorescence resonance energy transfer

(FRET), enzyme linked immunosorbent assay (ELSIA), gel electrophoresis (to measure mobility shift), isothermal titration and differential scanning microcalorimetry and column chromatography. These other different techniques can be applied to measure the interaction of ONs with a viral lysate or component, and thus can be useful in screening for compounds which have anti-viral activity.

The method described herein is used to screen for novel compounds from any desired source, for example, from a library synthesized by combinatorial chemistry or isolated by purification of natural substances. It can be used to a) determine appropriate size, modifications, and backbones of novel ONs; b) test novel molecules including novel polymers; predict a particular virus' susceptibility to novel ONs or novel compounds; or d) determine the appropriate suite of compounds to maximally inhibit a particular virus.

The increased lysate affinity with larger sized PS-ON randomers suggests that the antiviral mechanism of action of PS-ON randomers is based on an interaction with one or more viral protein components which prevents either the infection or correct replication of virions. It also suggests that this interaction is charge (size) dependent and not dependent on sequence. As these PS-ON randomers have a size dependent activity across multiple viruses spanning several different families, we suggest that PS- ON randomers interfere with common, charge dependent protein-protein interactions, protein-DNA/RNA interactions, and/or other molecule-molecule interactions. These interactions can include (but are not limited to):

The interaction between individual capsid subunits during capsid formation. The interaction between the capsid/nucleocapsid protein and the viral genome. The interaction between the capsid and glycoproteins during budding.

The interaction between glycoproteins and their receptors during infection. The interaction between other key viral components involved in viral replication.

These multiple, simultaneous inhibitions of protein-protein interactions represent a novel mechanism for antiviral inhibition.

Effect of PS-ON sequence composition on viral lysate interaction

We monitored the ability of PS-ONs of different sequences to interact with several viral lysates. In each case, a 20-mer PS-ON is labeled at the 3' end with FITC as previously described herein. The PS-ONs tested consisted of A20, T20, G20, C20, AC10, AGI O, TC10, TG10, REP 2004 and REP 2017. Each of these sequences is diluted to 4nM in assay buffer and incubated in the presence of 1ug of HSV-1 , HIV-1 or RSV lysate. Interaction is measured by fluorescence polarization.

The profile of interaction with all sequences tested is similar in all viral lysates, indicating that the nature of the binding interaction is very similar. The ability of 20-mer PS-ONs of different sequence compositions (A20, C20, G20, T20, AC10, AGIO, TC10, TG10, REP2004, REP2017) to bind to viral lysates was measured by fluorescence polarization. PS-ONs 3' labeled with FITC were incubated in the presence of 1ug of HSV-1, HIV-1 or RSV lysates. Within each lysate, the PS-ONs of uniform composition (A20, G20, T20, C20) were the weakest interactors with A20 being the weakest interactor of these by a significant margin. For the rest of the PS-ONs tested, all of them displayed a similar, strong interaction with the exception of TG10, which consistently displayed the strongest interaction in each lysate. The binding profiles for these PS-ONs is similar in all three viral lysates.

Target identification for PS-ON randomers in HlV-I

The ability of PS-ON randomers to bind to purified HIV-1 proteins was tested by fluorescence polarization as described in example 9. Increasing quantities of purified HIV-1 p24 or purified HIV-1 gp41 were reacted with REP 2004-FL We note that for both these proteins, there is a protein concentration dependent shift in fluorescence polarization, indicating an interaction with both these proteins.

The ability of a range of sizes of PS-ON randomers to bind to these proteins was also tested using fluorescent versions of REP 2032, REP 2003, REP 2004, REP 2006 and REP 2007. We observed that for p24, there is no size dependent interaction with p24, however; we did see an increase in gp41 binding in PS-ON randomers larger than 20 bases versus those less than 20 bases. This suggests when PS-ON randomer length increases above 20 bases, multiple copies of gp41 can bind to individual randomers, increasing their polarization.

This is a significant observation as it demonstrates the potential of larger ONs to sequester structural proteins during viral synthesis and limit their availability for the formation of new virions.

High affinity oligonucleotides

Another approach is a method to enrich or purify antiviral ON(s) having a higher affinity for viral components, such as viral proteins, than the average affinity of the ONs in a starting pool of ONs. The method will thus provide one or more non-sequence complementary ON(s) that will exhibit increased affinity to one or more viral components, e.g., having a three-dimensional shape contributing to such elevated binding affinity. The rationale is that while ON(s) will act as linear molecules in binding with viral components, they can also fold into a 3-dimensional shape that can enhance the interaction with such viral components. Without being limited to the specific technique, high affinity ONs can be purified or enriched in the following ways.

One method for purifying a high affinity ON, or a plurality of high affinity ONs, involves using a stationary phase medium with bound viral protein(s) as an affinity matrix to bind ONs, which can then be eluted under increasingly stringent conditions (e.g., increasing concentration of salt or other chaotropic agent, and/or increasing temperture and/or changes in pH). Such a method can, for example, be carried out by.

(a) loading a pool of ONs onto an exchange column having a viral protein or several viral proteins or a viral lysate bound to a stationary phase; (b) displacing (eluting) bound ONs from the column, e.g., by using a displacer solution such as an increasing salt solution;

(c) collecting fractions of eluted ONs at different salt concentration;

(d) cloning and sequencing eluted ONs from different fractions, more preferably from a fraction(s) at high salt concentration, such that the ONs eluted at the high salt concentration have a greater binding affinity with the viral protein(s); and

(e) Testing the activity of sequenced ON(s) in assays such binding and/or viral inhibiton assay, e.g., a fluorescence polarization-binding assay as decribed herein and/or in a cellular viral inhibition assay and/or in an animal viral inhibition assay.

In a second example, a method derived and modified from the SELEX methodology (Morris et al (1998) Biochemistry 95:2902-2907) can be used for purifying the high affinity ON. One implementation of such a method can be performed as:

(a) providing a starting ON pool material, for example, a collection of synthetic random ONs containing a high number of sequences, e.g., one hundred trillion (10¹⁴) to ten quadrillion (10¹⁶) different sequences. Each ON molecule contains a segment of random sequence flanked by primer-binding sequences at each end to facilitate polymerase chain reaction (PCR). Because the nucleotide sequences of essentially all of the molecules are unique, an enormous number of structures are sampled in the population. These structures determine each molecule's biochemical properties, such as the ability to bind a given viral target molecule;

(b) contacting ONs with a viral protein or several viral proteins or a viral lysate;

(c) selecting ONs that bind to viral protein(s), using a partition technique(s) that can partition bound and unbound ONs, such as native gel shifts and nitrocellulose filtration. Either of these methods physically separates the bound species from the unbound species, allowing preferential recovery of those sequences that bind best. Also, to select ON (s) that bind to a small protein, it is desirable to attach the target to a solid support and use that support as an affinity purification matrix. Those molecules that are not bound get washed off and the bound ones are eluted with free target, again physically separating bound and unbound species;

(d) amplifying the eluted binding ON(s), e.g., by using PCR using primers hybridizing with both flanking sequences of ONs;

(e) steps (b) (c) and (d) can be performed multiple times (i.e., multiple cycles or rounds of enrichment and amplification) in order to preferentially recover ONs that display the highest binding affinity to viral protein(s). After several cycles of enrichment and amplification, the population is dominated by sequences that display the desired biochemical property;

(f) cloning and sequencing one or more ONs selected from from an enrichment cycle, e.g., the last such cycle; and

(g) testing the binding and/or activity of sequenced ON(s) in assays, e.g., in a fluorescence polarization binding assay as decribed herein and/or in a cellular viral inhibition assay and/or in an animal viral inhibition assay.

Another approach is to apply a modification of a split synthesis methodology to create one-bead one-PS-ON and one-bead one-PS2-ON libraries as described in Yang et al

(2002) Nucl. Acids Res. 30(e132):1-8. Binding and selection of specific beads to viral proteins can be done. Sequencing both the nucleic acid bases and the positions of any thioate/dithioate linkages can be carried out by using a PCR-based identification tag of the selected beads. This approach can allow for the rapid and convenient identification of PS-ONs or PS2-ONs that bind to viral proteins and that exhibit potent antiviral properties.

Once the specific sequences that bind to the viral proteins with high affinity are determined (e.g., by amplification and sequencing of individual sequences), one or more such high affinity sequences can be selected and synthesized (e.g., by either chemical or enzymatic synthesis) to provide a preparation of high affinity ON(s), which can be modified to improve their activity, including improving their pharmacokinetic properties. Such high affinity ONs can be used in the present invention. Prion diseases

Another approach is used in an alternative embodiment of the present invention for the treatment, the control of the progression, or the prevention of prion disease. This fatal neurodegenerative disease is infectious and can affect both humans and animals. Structural changes in the cellular prion protein, PrPC to its scrapie isoform, PrPSC, are considered to be the obligatory step in the occurrence and propagation of the prion disease. Amyloid polymers are associated with neuropathology of the prion disease.

The incubation of a prion protein fragment and double stranded nucleic acid results in the formation of amyloid fibres (Nandi et al (2002), J MoI Biol 322: 153-161). ONs having affinity to proteins such as phosphorothioates are used to compete or inhibit the interaction of double stranded nucleic acid with the PrPC and consequently stop the formation of the amyloid polymers. Such ONs of different sizes and different compositions can be used in an appropriate delivery form to treat patients suffering from prion diseases or for prophylaxis in high risk situations. Such interfering ONs can be identified by measuring folding changes of amyloid polymerase as described by Nandi et al. (supra) in the presence of test ONs.

Putative viral etiologies

Another approach is used in another embodiment of the present invention for the treatment or prevention of diseases or conditions with putative viral etiologies as described without limitation in the following examples. Viruses are putative causal agents in diseases and conditions that are not related to a primary viral infection. For example, arthritis is associated with HCV (Olivieri et al. (2003) Rheum Dis CHn North Am 29:111-122), Parvovirus B19, HIV, HSV, CMV, EBV, and VZV (Stahl et al. (2000) CHn Rheumatol 19:281-286). Other viruses have also been identified as playing a role in different diseases. For example, influenza A in Parkinson's disease (Takahashi et al. (1999), Jpn J Infect Dis 52:89-98), Coronavirus, EBV and other viruses in Multiple Sclerosis (Talbot et al (2001) Curr Top Microbiol Immunol 253:247-71); EBV, CMV and HSV-6 in Chronic Fatigue Syndrome (Lerner et al. (2002) Drugs Today 38:549-561); and paramyxoviruses in asthma (Walter et al (2002) J CHn Invest 110:165-175) and in Paget's disease; and HBV, HSV, and influrenza in Guillain-Barre Syndrome.

Because of these etiologies, inhibition of the relevant virus using the present invention can delay, slow, or prevent development of the corresponding disease or condition, or at least some symptoms of that disease. Oligonucleotide Modifications and Synthesis

As indicated in the Summary above, modified oligonucleotides are useful in this invention. Such modified oligonucleotides include, for example, oligonucleotides containing modified backbones or non-natural intemucleoside linkages. Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.

Such modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotri- esters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'- alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, carboranyl phosphate and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Oligonucleotides having inverted polarity typically include a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.

Preparation of oligonucleotides with phosphorus-containing linkages as indicated above are described, for example, in U.S. Pat Nos. 3,687,808; 4,469,863; 4,476,301;

5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717;

5,321 ,131 ; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925;

5,519,126; 5,536,821 ; 5,541 ,306; 5,550,111; 5,563,253; 5,571 ,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, each of which is incorporated by reference herein in its entirety.

Some exemplary modified oligonucleotide backbones that do not include a phosphodiester linkage have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N₁ 0, S and CH₂ component parts. Particularly advantageous are backbone linkages that include one or more charged moieties. Examples of U.S. patents describing the preparation of the preceding oligonucleotides include U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141 ; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489, 677; 5,541 ,307; 5,561 ,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, each of which is incorporated by reference herein in its entirety.

Modified oligonucleotides may also contain one or more substituted sugar moieties. For example, such oligonucleotides can include one of the following 2'-modifications: OH; F; O— , S-, or N-alkyl; O-, S-, or N-alkenyl; O— , S— or N-alkynyl; or O-alkyl-0-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to C₁₀ alkyl or C₂ to Cm alkenyl and alkynyl, or 2'-O-(O-carboran-1-yl)methyl. Particular examples are O[(CH₂)_nO]_mCH₃, O(CH₂)~OCH₃, 0(CHz)_nNH₂, O(CH₂)_nCH₃, O(CH₂)_πONH₂, and O(CH₂)_nON [(CH₂)_nCH₃)]₂₎ where n and m are from 1 to 10. Other exemplary oligonucleotides include one of the following 2'-modifications: C₁ to Ci₀ lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH₁ SCH₃, OCN, Cl, Br, CN, CF₃. OCF₃, SOCH₃, SO₂CH₃, ONO₂, NO₂, N₃, NH₂, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide. Examples include 2'-methoxyethoxy (2'-0 — CH₂CH₂OCH₃, also known as 2'-O-(2-methoxyethyl).or 2'-MOE) (Martin et al., HeIv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group; 2'-dimethy-laminooxyethoxy, i.e., a O(CH₂)₂ON(CH₃)₂ group, also known as 2'-DMAOE; and 2'-dimethylaminoethoxyethoxy (also known as 2'-O- dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-0-CH₂-O-CH₂-N(CHz)₂.

Other modifications include Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage can be a methelyne ( — CH₂ — )~ group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226, which are incorporated herein by reference in their entireties. Other modifications include sulfur-nitrogen bridge modifications, such as locked nucleic acid as described in Orum et al. (2001) Curr. Opin. MoI. Ther. 3:239-243.

Other modifications include 2'-methoxy (2'-0-CH₃), 2'-methoxyethyl (2'0-CH₂-CH₃ ), 2'-ethyl, 2'-ethoxy, 2'-aminopropoxy (2'-OCH₂CH₂CH₂NH₂), 2'-allyl (2'-CH₂-CH=CH₂), 2'-O-allyl (2'-0-CH₂-CH=CH₂) and 2'-fluoro (2'-F).

The 2'-modification may be in the arabino (up) position or ribo (down) position. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of the 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Exemplary U.S. patents describing the preparation of such modified sugar structures include, for example, U.S. Pat. Nos. 4,981 ,957; 5,118,800; 5,319,080; 5,359,044; 5,393, 878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567, 811 ; 5,576,427; 5,591 ,722; 5,597,909; 5,610,300; 5,627, 053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792, 747; and 5,700,920, each of which is incorporated by reference herein in its entirety.

Still other modifications include an ON concatemer consisting of multiple oligonucleotide sequences joined by a linker(s). The linker may, for example, consist of modified nucleotides or non-nucleotide units. In some embodiments, the linker provides flexibility to the ON concatemer. Use of such ON concatemers can provide a facile method to synthesize a final molecule, by joining smaller oligonucleotide building blocks to obtain the desired length. For example, a 12 carbon linker (C12 phosphoramidite) can be used to join two or more ON concatemers and provide length, stability, and flexibility.

As used herein, "unmodified" or "natural" bases (nucleobases) include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Oligonucleotides may also include base modifications or substitutions. Modified bases include other synthetic and naturally-occurring bases such as 5- methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl( — C≡C — CH₃) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5- uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2- F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7- deazaadenine and 3-deazaguanine and 3-deazaadenine. Additional modified bases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4- b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1 H-pyrimido[5,4- b][l,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido [5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H- pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified bases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7- deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those described in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991 , 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993.

Another modification includes phosphorodithioate linkages. Knowing that phosphorodithioate ONs (PS2-ONs) and PS-ONs have a similar binding affinity to proteins (Tonkinson et al. (1994) Antisense Res. Dev. 4 :269-278)(Cheng et al. (1997) J. MoI. Recogn. 10:101-107) and knowing that a possible mechanism of action of ONs is binding to viral proteins, it could be desirable to include phosphorodithioate linkages on the antiviral ONs described in this invention.

Another approach to modify ONs is to produce stereodefined or stereo-enriched ONs as described in Yu at al (2000) Bioorg. Med. Chem. 8:275-284 and in Inagawa et al. (2002)

FEBS Lett. 25:48-52. ONs prepared by conventional methods consist of a mixture of diastereomers by virtue of the asymmetry around the phosphorus atom involved in the internucleotide linkage. This may affect the stability of the binding between ONs and viral components such as viral proteins. Previous data showed that protein binding is significantly stereo-dependent (Yu et al.). Thus, using stereodefined or stereo-enriched

ONs could improve their protein binding properties and improve their antiviral efficacy.

The incorporation of modifications such as those described above can be utilized in many different incorporation patterns and levels. That is, a particular modification need not be included at each nucleotide or linkage in an oligonucleotide, and different modifications can be utilized in combination in a single oligonucleotide, or even in a single nucleotide.

As examples and in accordance with the description above, modified oligonucleotides containing phosphorothioate or dithioate linkages may also contain one or more substituted sugar moieties particularly modifications at the sugar moieties including, without restriction, 2'-ethyl, 2'-ethoxy, 2'-methoxy, 2'-aminopropoxy, 2'-allyl, 2'-fluoro, 2¹- pentyl, 2'-propyl, 2'-dimethylaminooxyethoxy, and 2'-dimethylaminoethoxyethoxy. The 2'-modification may be in the arabino (up) position or ribo (down) position. A preferred 2'-arabino modification is 2'-fluoro. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2 '-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Moreover ONs may have a structure of or comprise a portion consisting of glycol nucleic acid (GNA) with an acyclic propylene glycol phosphodiester backbone (Zhang L, et al (2005) J. Am. Chem. Soc. 127(12):4174-5). Such GNA may comprise phosphorothioate linkages and may comprise only pyrimidine bases.

Oligonucleotide Synthesis

The present oligonucleotides can by synthesized using methods known in the art. For example, unsubstituted and substituted phosphodiester (P=O) oligonucleotides can be synthesized on an automated DNA synthesizer (e.g., Applied Biosystems model 380B) using standard phosphoramidite chemistry with oxidation by iodine. Phosphorothioates (P=S) can be synthesized as for the phosphodiester oligonucleotides except the standard oxidation bottle can be replaced by 0.2 M solution of 311-1,2-benzodithiole-3- one 1,1-dioxide in acetonitrile for the step-wise thioation of the phosphite linkages. The thioation wait step can be increased to 68 sec, followed by the capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55⁰C. (18 h), the oligonucleotides can be purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCI solution.

Phosphinate oligonucleotides can be prepared as described in U.S. Pat. No. 5,508,270; alkyl phosphonate oligonucleotides can be prepared as described in U.S. Pat. No. 4,469,863; 3'-Deoxy-3'-methylene phosphonate oligonucleotides can be prepared as described in U.S. Pat. Nos. 5,610,289 and 5,625,050; phosphoramidite oligonucleotides can be prepared as described in U.S. Pat. No. 5,256,775 and U.S. Pat. No. 5,366,878; alkylphosphonothioate oligonucleotides can be prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively); 3'-Deoxy-3'-amino phosphoramidate oligonucleotides can be prepared as described in U.S. Pat. No. 5,476,925; Phosphotriester oligonucleotides can be prepared as described in U.S. Pat. No. 5,023,243; boranophosphate oligonucleotides can be prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198; methylenemethylimino linked oligonucleotides, also identified as MMI linked oligonucleotides, methylenedimethyl-hydrazo linked oligonucleotides, also identified as MDII linked oligonucleotides, and methylenecarbonylamino linked oligonucleotides, also identified as amide-3 linked oligonucleotides, and methyleneaminocarbonyl linked oligo¬ nucleotides, also identified as amide-4 linked oligonucleo-sides, as well as mixed backbone compounds having, for instance, alternating MMI and P=O or P=S linkages can be prepared as described in U.S. Pat. Nos. 5,378, 825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289; formacetal and thioformacetal linked oligonucleotides can be prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564; and ethylene oxide linked oligonucleotides can be prepared as described in U.S. Pat. No. 5,223,618. Each of the cited patents and patent applications is incorporated by reference herein in its entirety.

Oligonucleotide Formulations and Pharmaceutical Compositions

The present oligonucleotides can be prepared in an oligonucleotide formulation or pharmaceutical composition. Thus, the present oligonucleotides may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Exemplary United States patents that describe the preparation of such uptake, distribution and/or absorption assisting formulations include, for example, U.S. Pat. Nos. 5,108,921 ; 5,354,844; 5,416,016; 5,459,127; 5,521 ,291 ; 5,543,158; 5,547,932; 5,583,020; 5,591 ,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221 ; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; _, 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is incorporated herein by reference in its entirety.

The oligonucleotides, formulations, and compositions of the invention include any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.

The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular embodiments, prodrug versions of the present oligonucleotides are prepared as SATE [(S-acetyl-2- thioethyl) phosphate] derivatives according to the methods disclosed in Gosselin et al., WO 93/24510 and in lmbach et al., WO 94/26764 and U.S. Pat. No. 5,770,713, which are hereby incorporated by reference in their entireties.

The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the present compounds: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. Many such pharmaceutically acceptable salts are known and can be used in the present invention.

For oligonucleotides, useful examples of pharmaceutically acceptable salts include but are not limited to salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and salts formed from elemental anions such as chlorine, bromine, and iodine.

The present invention also includes pharmaceutical compositions and formulations which contain the antiviral oligonucleotides of the invention. Such pharmaceutical compositions may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. For example, administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery); pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal; intranasal; epidermal and transdermal; oral; or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.

Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. Preferred topical formulations include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). Oligonucleotides may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters include but are not limited arachidonic acid, oleic acid, eicosanoic acid, laurie acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1 -monocaprate, 1- dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C_1-10 alkyl ester (e.g. isopropylmyristate IPM)₁ monoglyceride, diglyceride or pharmaceutically acceptable salt thereof.

Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Exemplary surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Exemplary bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenedeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, , glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate, sodium glycodihydrofusidate. Exemplary fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1- monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g. sodium). Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further exemplary penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents include poly-amino acids; polyimines; polyacrytates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylat.es; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses, and starches. Particularly advantageous complexing agents include chitosan, N- trimethytchitosan, poly-L-lysine, polyhistidine, polyorithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylamino-methylethylene P(TDAE), polyaminostyrene (e.g. p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylatc), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE- hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG).

Compositions for vaginal delivery can be in various forms, including for example, a gel, cream, tablet, pill, capsule, suppository, film, or any other pharmaceutically acceptable form that adheres to the mucosa and does not wash away easily. A large variety of different formulations for vaginal delivery are further described in the art, for example in U.S. Pat. No. 4,615,697 and 6,699,494, which are incorporated herein by reference in their entireties.

Additionally, additives (such as those described in the Patent 4,615,697 patent) may be combined in the formulation for maximum or desired efficacy of the delivery system or for the comfort of the patient. Such additives include, for example, lubricants, plasticizing agents, preservatives, gel formers, tablet formers, pill formers, suppository formers, film formers, cream formers, disintegrating agents, coatings, binders, vehicles, coloring agents, taste and/or odor controlling agents, humectants, viscosity controlling agents, pH-adjusting agents, and similar agents. In certain embodiments, a composition can include a cross-linked polycarboxylic acid polymer formulation, generally described in U.S. Pat. No. 4,615,697. In general, in such embodiments at least eighty percent of the monomers of the polymer in such a formulation should contain at least one carboxyl functionality. The cross-linking agent should be present at such an amount as to provide enough bioadhesion to allow the system to remain attached to the target epithelial surfaces for a sufficient time to allow the desired dosing to take place.

For vaginal administration, such a formulation remains attached to the epithelial surfaces for a period of at least about twenty-four to forty-eight hours. Such results may be measured clinically over various periods of time, by testing samples from the vagina for pH reduction due to the continued presence of the polymer. This preferred level of bioadhesion is usually attained when the cross-linking agent is present at about 0.1 to 6.0 weight percent of the polymer, with about 1.0 to 2.0 weight percent being most preferred, as long as the appropriate level of bioadhesion results. Bioadhesion can also be measured by commercially available surface tensiometers utilized to measure adhesive strength.

The polymer formulation can be adjusted to control the release rate by varying the amount of cross-linking agent in the polymer. Suitable cross-linking agents include divinyl glycol, divinylbenzene, N,N-diallylacrylamide, 3,4-dihydroxy-1 ,5-hexadiene, 2,5- dimethyl-1 ,5-hexadiene and similar agents.

A preferred polymer for use in such a formulation is Polycarbophil, U.S. P., which is commercially available from B. F. Goodrich Speciality Polymers of Cleveland, Ohio under the trade name NOVEON.RTM.-AA1. The United States Pharmacopeia, 1995 edition, United States Pharmacopeial Convention, Inc., Rockville, Md., at pages 1240- 41 , indicates that polycarbophil is a polyacrylic acid, cross-linked with divinyl glycol.

Other useful bioadhesive polymers that may be used in such a drug delivery system formulation are mentioned in the 4,615,697 patent. For example, these include polyacrylic acid polymers cross-linked with, for example, 3,4-dihydroxy-1 ,5-hexadiene, and polymethacrylic acid polymers cross-linked with, for example, divinyl benzene. Typically, these polymers would not be used in their salt_' form, because this would decrease their bioadhesive capability. Such bioadhesive polymers may be prepared by conventional free radical polymerization techniques utilizing initiators such as benzoyl peroxide, azobisisobutyronitrile, and the like. Exemplary preparations of useful bioadhesives are provided in the 4,615,697 patent. Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.

The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s).

In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaking the product.

The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

In one embodiment of the present invention the pharmaceutical compositions may be formulated and used as foams. Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product. The preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention.

Emulsions

The formulations and compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter. (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (lids.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et at., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed. Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion.

Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 199). Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: non-ionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 285).

Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 335; Idson, in Pharmaceutical Dosag& Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 199).

Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong inter- facial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.

Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid, Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 199). Emulsion formulations for oral delivery have been very widely used because of reasons of ease of formulation, efficacy from an absorption and bioavailabiity standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.

In one embodiment of the present invention, the compositions of oligonucleotides are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically micro- emulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185- 215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML31O), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DA0750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.

Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11 , 1385-1390; Ritschet, MeW. Find. Exp. CHn. Pharmacol., 1993, 13, 205). Micro-emulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et at., Pharmaceutical Research, 1994, 11 , 1385; Ho et al., J. Pharm. Set, 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or oligonucleotides. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.

Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories - surfactants, fatty acids, bile salts, chelating agents, and non- chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , p. 92).

Liposomes

There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles offer specificity and extended duration of action for drug delivery. Thus, as used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers, i.e., liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion typically contains the composition to be delivered. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores. Additional factors for liposomes include the lipid surface charge, and the aqueous volume of the liposomes.

Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 245).

For topical administration, there is evidence that liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin, generally resulting in targeting of the upper epidermis.

Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et at., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. The DNA is thus entrapped in the aqueous interior of these liposomes. pH-sensitive liposomes have been used, for example, to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

One major type of liposomal composition includes phospholipids other than naturally- derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC₁ and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

Several studies have assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means (e.g. as a solution or as an emulsion) were ineffective (Weiner et at., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).

Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasone™ I (glyceryl dilaurate/cholesterol/polyoxyethylene-IO-stearyl ether) and Novasome™ Il (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et at. S.T.P. Pharma. Sci., 1994, 4, 6, 466).

Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome include one or more glycolipids, such as monosialoganglioside G_Mi, or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Without being bound by any particular theory, it is believed that for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the increase in circulation half-life of these sterically stabilized liposomes is due to a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et at., FEBS Lett, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765). Various liposomes that include one or more glycolipids have been reported in Papahadjopoulos et al., Ann. N.Y. Acad. Sci., 1987, 507, 64 (monosiatoganglioside G_Mi, galactocerebroside sulfate and phosphatidylinositol); Gabizon et at., Proc. Natl. Acad. Sci. USA., 1988, 85, 6949,;Allen et al., US. Pat. No. 4,837,028 and International Application Publication WO 88/04924 (sphingomyelin and the ganglioside G_M1 or a galactocerebroside sulfate ester); Webb et al., U.S. Pat. No. 5,543,152 (sphingomyelin); Lim et al., WO 97/13499 (1,2-sn-dimyristoylphosphatidylcholine).

Liposomes that include lipids derivatized with one or more hydrophilic polymers, and methods of preparation are described, for example, in Sunamoto et al., Bull. Chem. Soc. Jpn., 1980, 53, 2778 (a nonionic detergent, 2C₁₂15G, that contains a PEG moiety); Ilium et al., FEBS Lett., 1984, 167, 79 (hydrophilic coating of polystyrene particles with polymeric glycols); Sears, U.S. Pat. Nos. 4,426,330 and 4,534, 899 (synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG)); Klibanov et al., FEBS Lett., 1990, 268, 235 (phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate); Blume et al., Biochimica et Biophysica Acta, 1990, 1029, 91 (PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG); Fisher, European Patent No. EP 0 445 131 B1 and WO 90/04384 (covalently bound PEG moieties on liposome external surface); Woodle et al., U.S. Pat. Nos. 5,013,556 and 5,356,633, and Martin et al., U.S. Pat. No. 5,213,804 and European Patent No. EP 0 496 813 B1 (liposome compositions containing 1-20 mole percent of PE derivatized with PEG); Martin et al., WO 91/05545 and U.S. Pat. No. 5,225,212 and in Zalipsky et al., WO 94/20073 (liposomes containing a number of other lipid-polymer conjugates); Choi et al., WO 96/10391 (liposomes that include PEG-modified ceramide lipids); Miyazaki et al., U.S. Pat. No. 5,540,935, and Tagawa et al., U.S. Patent No. 5,556,948 (PEG- containing liposomes that can be further derivatized with functional moieties on their surfaces).

Liposomes that include nucleic acids have been described, for example, in Thierry et al., WO 96/40062 (methods for encapsulating high molecular weight nucleic acids in liposomes); Tagawa et al., U.S. Pat. No. 5,264,221 (protein-bonded liposomes containing RNA); Rahman et al., U.S. Pat. No. 5,665,710 (methods of encapsulating oligodeoxynucleotides in liposomes); Love et al., WO 97/04787 (liposomes that include antisense oligonucleotides).

Another type of liposome, transfersomes are highly deformable lipid aggregates which are attractive for drug delivery vehicles. (Cevc et al., 1998, Biochim Biophys Acta. 1368(2):201-15.) Transfersomes may be described as lipid droplets which are so highly deformable that they can penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, for example, they are shape adaptive, self-repairing, frequently reach their targets without fragmenting, and often self-loading. Transfersomes can be made, for example, by adding surface edge-activators, usually surfactants, to a standard liposomal composition.

Surfactants

Surfactants are widely used in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the

, properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants are widely used in pharmaceutical and cosmetic products and are usable over a wide range of pH values, and with typical HLB values from 2 to about 18 depending on structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters; and nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most commonly used members of the nonionic surfactant class.

Surfactant molecules that carry a negative charge when dissolved or dispersed in water are classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isothionates, acyl laurates and sulfosuccinates, and phosphates. The alkyl sulfates and soaps are the most commonly used anionic surfactants.

Surfactant molecules that carry a positive charge when dissolved or dispersed in water are classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines, with the quaternary ammonium salts used most often. Surfactant molecules that can carry either a positive or negative charge are classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

The use of surfactants in drug products, formulations and in emulsions has been reviewed in Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

Penetration Enhancers

In some embodiments, penetration enhancers are used in or with a composition to increase the delivery of nucleic acids, particularly oligonucleotides, to the skin or across mucous membranes of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , p.92). Each of these classes of penetration enhancers is described below in greater detail.

Surfactants: In connection with the present invention, surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the mucosa is enhanced. These penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et at., CriticalReviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252), each of which is incorporated herein by reference in its entirety.

Fatty acids: Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1- monocaprate, i-dodecylazacycloheptan^-one, acylcarnitines, acylcholines, C₁-I₀ alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and diglycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654), each of which is incorporated herein by reference in its entirety.

Bile salts: The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardmah et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto ct al., J. Pharm. Exp. Then, 1992, 263, 25; Yamashita et al., J. Pharm:. Sci., 1990, 79, 579-583).

Chelating Agents: In the present context, chelating agents can be regarded as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Without limitation, chelating agents include disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1- 33; Buur et al., J. Control ReI., 1990, 14, 43-51).

Non-chelating non-surfactants: As used herein, non-chelating non-surfactant penetration enhancing compounds are compounds that do not demonstrate significant chelating agent or surfactant activity, but still enhance absorption of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). Examples of such penetration enhancers include unsaturated cyclic ureas, 1 -alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , page 92); and nonsteroidal anti¬ inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al,, J. Pharm. Pharmacol., 1987, 39, 621-626).

Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions and formulations of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (LoIIo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of oligonucleotides.

Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2- pyrrol, azones, and terpenes such as limonene and menthone.

Carriers

Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, often with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs. For example, the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido- 4'isothiocyano-stilbene-2,2-disulfonic acid (Miyao et al.,AntisenseRes. Dev., 1995,5, 115-121; Takakura et al., Antisensβ & NucL Acid Drug Dev., 1996, 6, 177-183), each of which is incorporated herein by reference in its entirety.

Excipients

In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal, and is typically liquid or solid. A pharmaceutical carrier is generally selected to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition, in view of the intended administration mode. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycotate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).

Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

Formulations for topical administration of nucleic acids may include sterile and non- sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used. Other Pharmaceutical Composition Components

The present compositions may additionally contain other components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti¬ inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

Aqueous suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran, and/or stabilizers.

Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antiviral oligonucleotides and (b) one or more other chemotherapeutic agents which function by a different mechanism. Examples of such chemotherapeutic agents include but are not limited to daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethytmetamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5- FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin, and diethylstilbestrol (DES). See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al., eds., Rahway, NJ. When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-EU₁ MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to Ribavirin, cidofovir, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, NJ., pages 2499-2506 and 46-49, respectively). Other non-oligonucleotide chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.

EXAMPLES

Example 1 : Herpes Simplex Virus

Herpes simplex virus (HSV) affects a significant proportion of the human population. It was found in the present invention that random ONs or ON randomers inhibited the infectivity of viruses such as HSV. Using cellular HSV replication assays in VERO cells (susceptible to HSV-1 (strain KOS) and HSV-2 (strain MS2) infection) it was found that a single stranded PS-ON complementary to the HSV origin of replication inhibited replication of HSV-1 and HSV-2. Surprisingly, control PS-ONs complementary to human (343 ARS) and plasmid (pBR322/pUC) origins also inhibited viral infectivity. Experiments with random sequence PS-ONs and PS-ON randomers demonstrated that inhibition of viral infection increased with increasing ON size. These data show that ONs are potent antiviral agents useful for therapeutic treatment of viral infection.

The inventors have theorized that a potential mechanism for blocking the spread of viruses such as HHVs was to prevent the replication of its DNA. With this in mind, phosphorothioate oligonucleotides (ONs) complementary to the origin of replication of HSV1 and HSV2 were introduced into infected cells. These ONs would cause DNA triplex formation at the viral origin of replication, blocking the association of necessary trans-acting factors and viral DNA replication. Surprising results are presented herein of these experiments which show that, in an experimental paradigm, the potency of ONs in inhibiting viral infection increases as their size (length) increases.

Inhibition of HSV-1

The ability of PS-ONs to inhibit HSV-1 is measured in a plaque reduction assay (PRA). Immortalized African Green Monkey kidney (VERO) cells are cultured at 37⁰C and 5% CO₂ in MEM (minimal essential medium) plus 10% fetal calf serum supplemented with gentamycin, vancomycin and amphoterecin B. Cells are seeded in 12 well plates at a density which yields a confluent monolayer of cells after 4 days of growth. Upon reaching confluency, the media is changed to contain only 5% serum plus supplements as described above and cells are then exposed to HSV-1 (strain KOS, approximately 40-60 PFU total) in the presence of the test compound for 90 minutes. After viral exposure, the media is replaced with new "overlay" media containing 5% serum, 1% human immunoglobulins, supplements as described above and the test compound. Plaque counting is performed 3-4 days post infection following formalin fixation and cresyl violet staining of infected cultures.

All ONs (except where noted otherwise) were synthesized at the University of Calgary Core DNA Services lab. ONs (see table 21) are prepared on a.1 or 15 micromol synthesis scale, deprotected and desalted on a 50cm Sephadex G-25 column. The resulting ONs are analyzed by UV shadowing gel electrophoresis and are determined to contain -95% of the full length, n-1 and n-2 oligo and up to 5% of shorter oligo species (these are assumed to have random deletions). For random oligo synthesis, adenine, guanosine, cytosine and thymidine amidites are mixed together in equimolar quantities to maximize the randomness of incorporation at each position of the ONs during synthesis.

To test if PS-ONs could inhibit HSV-1 , REP 1001 , 2001 and 3007 are tested in the HSV- 1 PRA. It would have been expected that only REP 2001 will show any activity as this PS-ON is directed against the origin of replication in HSV (the other two are directed against replication origins in humans and plasmids). However all three PS-ONs showed anti-HSV-1 activity. The testing was carried out in a plaque reduction assay conducted in VERO cells using HSV-1 (strain KOS). Infected cells were treated with increasing concentrations of REP 1001, REP 2001 , or REP 3007. IC₅₀ values calculated from linear regressions of the assay results were 2.76, 0.77, and 5.33 micromolar respectively. Moreover, the potentcy of the anti-HSV-1 effect was found to be dependent on the size of the oligo.

To confirm the size dependence and relative sequence independence of PS-ONs on anti-HSV-1 activity, we tested PS-ONs that vary in size (REP 2002, 2003, 2004, 2005 and 2006) along with the antiviral drug Acyclovir. These PS-ONs are rendered inert with respect to sequence specific effects by synthesizing each base as a "wobble" (N) so that each PS-ON actually represents a population of different random sequences with the same size; these PS-ONs are termed "randomers". Plaque reduction assay was conducted in VERO cells using HSV-1 (strain KOS). Infected cells are treated with increasing concentrations of REP 2001, REP 2002 or REP 3003, REP 2004, REP 2005, REP 2006, and Acyclovir. IC₅₀ values were calculated from linear regressions of assay data. The relationship between PS-ON size and IC₅₀ against HSV-1 was determined by plotting the IC₅₀ values against the specific size of each PS-ON tested which showed anti-HSV-1 activity. The IC₅₀ for Acyclovir was used as a reference to a clinical correlate. We found that oligos 10 bases or lower have no detectable anti-HSV-1 activity but as the size of the PS-ON increases above 10 bases, the potency also increases (IC₅₀ decreases). We also noted that PS-ONs greater than 20 bases had IC₅₀ values significantly lower than a clinically accepted anti-HSV-1 drug, acyclovir.

To better define the effective size range for PS-ON anti-HSV-1 activity, we tested PS- ON randomers covering a broader range of sizes from 10 to 120 bases. Plaque reduction assay was conducted in VERO cells using HSV-1 (strain KOS). A broad range of PS-ON randomer sizes were tested in increasing concentrations; REP 2003, REP 2009, REP 2010, REP 2011 , REP 2012, REP 2004, REP 2006, REP 2007, and REP 2008. IC₅₀ values were calculated from linear regressions. We discovered that oligos 12 bases and larger have detectable anti-HSV-1 activity and that the efficacy against HSV-1 also increases with increased PS-ON randomer length up to at least 120 bases. However, the increases in efficacy per base increase in size are smaller in PS- ON randomers greater than 40 bases.

To compare the efficacy of non-PS-ON randomers, a random sequence PS-ON and a HSV-1 specific sequence PS-ON, we tested these three types of modifications in ONs 10, 20 and 40 bases in size. Plaque reduction assay was conducted in VERO cells using HSV-1 (strain KOS). Unmodified ONs, PS-ONs with a random sequence, and PS-ONs targeting the start codon of HSV-1 IE110 were tested in increasing concentrations. The ONs were REP 2013, REP 2014, REP 2015, REP 2016, REP 2017, REP 2018, REP 2019, REP 2020, and REP 2021. IC₅₀ values were calculated from linear regressions. In this system, unmodified ON randomers have no detectable anti-HSV-1 activity at tested sizes. Both random sequence and specific HSV-1 sequence PS-ONs show size dependent anti-HSV-1 activity (no activity is observed at 10 bases for either of these modifications. A comparison of random sequence, specific HSV-1 sequence and randomer PS-ONs showed that for PS-ONs 20 bases in length, there is an enhancement of anti-HSV-1 activity with the specific HSV-1 sequence but that at 40 bases in length, all modifications, whether randomer, random sequence or specific HSV-1 sequence were equally efficacious against HSV-1. To the best of our knowledge, this is the first time IC₅₀S for HSV-1 as low as 0.059 μM and 0.043 μM are reported for PS-ONs.

Example 2: Inhibition of HSV-2

The ability of PS-ONs to inhibit HSV-2 is measured by PRA. Immortalized African Green Monkey kidney (VERO) cells are cultured at 37°C and 5% CO₂ in MEM plus 10% fetal calf serum supplemented with gentamycin, vancomycin and amphoterecin B. Cells are seeded in 12 well plates at a density which yields a confluent monolayer of cells after 4 days of growth. Upon reaching confluency, the media is changed to contain only 5% serum plus supplements as described above and cells are then exposed to HSV-2 (strain MS2, approximately 40-60 PFU total) in the presence of the test compound for 90 minutes. After viral exposure, the media is replaced with new "overlay" media containing 5% serum, 1% human immunoglobulins, supplements as described above and the test compound. Plaque counting is performed 3-4 days post infection following formalin fixation and cresyl violet staining of infected cultures.

To test if PS-ONs could inhibit HSV-2, REP 1001 , 2001 and 3007 are tested in the HSV- 2 PRA. Plaque reduction assay was conducted in human fibroblast cells using HSV-2 (strain MS2), with infected cells treated with increasing concentrations of REP 1001 , REP 2001 , or REP 3007. IC₅₀ values were calculated from linear regressions. If the inhibitory activity were due to an antisense or other sequence complementary mechanism, it would be expected that only REP 2001 would show any activity as this PS-ON is directed against the origin of replication in HSV-1 /2 (the other two are directed against replication origins in humans and plasmids respectively). However all three PS- ONs showed anti-HSV-2 activity. Moreover, the potency of the anti-HSV-2 effect is dependent on the size of the PS-ON and independent of the sequence.

To confirm the size dependence and sequence independence of PS-ONs on anti-HSV-2 activity, we tested PS-ONs that vary in size (REP 2001 , 2002, 2003, 2004, 2005 and 2006). These PS-ONs are rendered inert with respect to sequence specific effects by synthesizing each base as a "wobble" (N) so that each PS-ON actually represents a population of different random sequences with the same size, these PS-ONs are termed "randomers". When these PS-ONs are tested in the HSV-2 PRA, we find that PS-ONs 10 bases or lower had no detectable anti-HSV-2 activity but as the size of the PS-ON increases above 10 bases, the potency also increases (IC₅₀ decreases). We also noted that PS-ONs greater than 20 bases had IC₅₀ values significantly lower than a clinically accepted anti-HSV-2 drug, acyclovir ™. To the best of our knowledge, this is the first time an IC₅₀ for HSV-2 as low as 0.012 μM has been reported for a PS-ON.

To determine if non-specific sequence composition has an effect on ON antiviral activity, several PS-ONs of equivalent size but differing in their sequence composition were tested for anti-HSV1 activity in the HSV-1 PRA. The PS-ONs tested were REP 2006

(N20), REP 2028 (G40)_r REP 2029 (A40), REP 2030 (T40) and REP 2031 (C40). The

IC₅₀ values generated from the HSV-1 PRA show that REP 2006 (N40) was the most active of all sequences tested while REP 2029 (A40) was the least active. We also note that, all the other PS-ONs were significantly less active than N40 with their rank in terms of efficacy being N40>C40>T40>A40»G40.

We also tested the efficacy of different PS ONs having varying sequence composition with two different nucleotides. The PS-ON randomer (REP 2006) was significantly more efficacious against HSV-1 than AC20 (REP 2055), TC20 (REP 2056) or AG20 (REP 2057) with their efficacies ranked as follows: N40>AG>AOTC. This data suggests that although the anti-viral effect is non-sequence complementary, certain non-specific sequence compositions (ie C40 and N40) have more potent anti-viral activity. We suggest that this phenomenon can be explained by the fact that, while retaining intrinsic protein binding ability, sequences like C40, A40, T40 and G40 bind fewer viral proteins with high affinity, probably due to some restrictive tertiary structure formed in these sequences. On the other hand, due to the random nature of N40, it retains its ability to bind with high affinity to a broad range of anti-viral proteins which contributes to its robust anti-viral activity.

Example 3: Inhibition of CMV

The ability of PS-ONs to inhibit CMV is measured in a plaque reduction assay (PRA). This assay is identical to the assay used for testing anti-HSV-1 and anti-HSV-2 except that CMV (strain AD169) is used as the viral innoculum and human fibroblasts were used as cellular host.

To test the size dependence and sequence independence of PS-ONs on anti-CMV activity, we tested PS-ON randomers that vary in size. Plaque reduction assay was conducted in VERO cells using CMV (strain AD169). Infected cells were treated with increasing concentrations of REP 2004 (a) or REP 2006 (b). IC₅₀ values were calculated, from linear regressions, and relationship between PS-ON size and IC₅₀ against CMV was determined by plotting IC₅_ values against the specific size of each PS-ON tested. When these PS-ONs are tested in the CMV PRA, we find that as the size of the PS-ON increases, the potency also increases (IC50 decreases).

To more clearly elucidate the effective size range for PS-ON anti-CMV activity, we tested PS-ON randomers covering a broader range of sizes from 10 to 80 bases. We also included several clinically accepted small molecule CMV treatments (Gancyclovir, Foscarnet and Cidofovir) as well as 2 versions of a marketed antisense treatment for CMV retinitis, (Vitravene™; commercially available and synthesized by the University of Calgary). Plaque reduction assay was conducted in VERO cells using CMV (strain AD169). Three clinical CMV therapies were tested: Gancyclovir, Foscarnet, and Cidofovir. A broad range of PS-ON randόmer sizes were also tested in increasing concentrations; REP 2003, REP 2004, REP 2006, and REP 2007. Finally, REP 2036 (Vitravene) was tested as synthesized in house and as commercially available. IC₅₀ values were calculated from linear regressions. We discovered that while increased PS- ON randomer size leads to increased efficacy, this effect saturates at about 40 bases. Moreover, the 20, 40 and 80 base PS-ON randomers are all significantly more efficacious than any of the small molecule treatments tested. In addition, 40 and 80 base PS-ON randomers are more efficacious than Vitravene™.

To the best of our knowledge, this is the first time an IC₅₀ for CMV as low as 0.067 μM has been reported for a PS-ON.

Example 4: Inhibition of HIV-1

The ability of PS-ON randomers to inhibit HIV-1 is measured by two different assays:

Cvtopathic Effect (CPE)

Cytopathic effect is monitored using MTT dye to report the extent of cellular metabolism.

Immortalized human lymphocyte (MT4) cells are cultured at 37⁰C and 5% CO₂ in MEM plus 10% fetal calf serum supplemented with antibiotics. Cells are seeded in 96 well plates in media containing the appropriate test compound and incubated for 2 hours.

After preincubation with the test compound, HIV-1 (strain NL 4-3) was added to the wells (0.0002 TCID₅₀/cell). After 6 days of additional incubation, CPE is monitored by

MTT conversion. Cytotoxicity is measured by incubating the drugs for 6 days in the absence of viral inoculation. For transformation of MTT absorbance values into % survival, the absorbance of uninfected, untreated cells is set to 100% and the absorbance of infected, untreated cells is set to 0 %. Replication Assay (RA)

The ability of HIV to replicate is monitored in immortalized human embryonic kidney

(293A) cells. These cells are cotransfected with two plasmids. One plasmid contains a recombinant wild type HIV-1 genome (NL 4-3) having its env gene disrupted by a luciferase expression cassette (identified as strain CNDO), the other plasmid contains the env gene from murine leukemia virus (MLV). These two plasmids provide all the protein factors in trans to produce a mature chimeric virus having all the components from HIV-1 except the protein products provided in trans from the MLV env gene.

Virions produced from these cells are infectious and replicative but cannot produce another generation of infectious virions because they will lack the env gene products.

24 hours after transfection, these cells are trypsinized and plated in 96 well plates. After the cells have adhered, the media is washed and replaced with media containing the test compound. Virus production is allowed to proceed for an additional 24 hours. The supernatant is then harvested and used to reinfect naive 293A cells. Naive cells that are infected are identified by the luciferase gene product. The number of luciferase positive cells is a measure of the extent of replication and/or infection by the recombinant HIV-1. This assay is also adapted to test the resistance to many clinically accepted anti-HIV-1 drugs by using a HIV-1 genome with several point mutations known to induce resistance to several different classes of anti-HIV drugs. Percentage inhibition is set to 100% for no detectable luciferase positive cells and 0% for the number of positive cells in infected, untreated controls.

To test the size dependence and sequence independence of PS-ONs on anti-HIV-1 activity, we tested PS-ON randomers that vary in size. CPE assay was conducted in MT4 cells using HIV-1 (strain NL4-3). Infected cells were treated with increasing concentrations of REP 2004 or REP 2006. IC₅₀ values were calculated from linear regressions. Cytotoxicity profiles in uninfected MT4 cells were determined for REP 2004 and REP 2006. We found that as the size of the PS-ON increases, the potency also increases (IC₅₀ decreases). We also noted that the PS-ON randomers exhibited no significant toxicity to the host cells in this assay.

To the best of our knowledge, this is the first time an IC₅₀ for HIV-1 as low as 0.011 μM has been reported for a PS-ON.

To more clearly elucidate the effective size range for PS-ON anti-HIV-1 activity, we tested more PS-ON randomers covering a broader range of sizes from 10 to 80 bases by RA using wild-type HIV-I (recombinant NL 4-3 (CNDO)). Replication assay was conducted in 293A cells using recombinant wild type HIV-1NL4-3 (strain CNDO). In addition, we tested four protease inhibitors currently used in the clinic (aprenavir, indinavir, lopinavir and saquinavir). Infected cells were treated with increasing concentrations of Amprenavir, Indinavir, Lopinavir, Saquinavir, REP 2003, REP 2004, REP 2006, and REP 2007. We discovered that PS-ON randomers 10 bases and larger have anti-HIV-1 activity and that the efficacy against HIV-1 also increases with increased PS-ON randome.r length but is saturated at about 40 bases. Moreover, the 40 and 80 base PS-ON randomers were almost equivalent in efficacy with the 4 clinical controls.

To the best of our knowledge, this is the first time an IC₅₀ for HIV-1 as low as 0.014 μM has been reported for a PS-ON.

To test the ability of PS-ON randomers to inhibit a drug resistant strain of HIV, we duplicated the above test using the recombinant MDRC4 strain of HIV-1. This recombinant strain exhibits significant resistance to at least 16 different clinically accepted drugs from all classes: nucleotide RT inhibitors, non-nucleotide RT inhibitors and protease inhibitors. We found that all the PS-ON randomers tested perform as well against the resistant strain as they do against the wild type strain. However, three of the four protease inhibitors show a reduction in their efficacy against the mutant strain, such that the 40 and 80 base PS-ON randomers were more potent against this resistant strain than these drugs.

Example 5: Inhibition of RSV

The ability of PS-ON randomers to inhibit RSV is measured by monitoring CPE with alamar blue (an indirect measure of cellular metabolism). Human larynx carcinoma (Hep2) cells are cultured at 37⁰C and 5% CO₂ in MEM plus 5% fetal calf serum. Cells are seeded in 96 well plates at a density which yields a confluent monolayer of cells after 5-6 days of growth. The day after plating, cells were infected with RSV (strain A2, 10⁸-²TCID₅₀/ml) in the presence of the test compound in a reduced volume for 2 hours. Following inoculation, the media was changed and was supplemented with test compound. 6 days after infection, CPE was monitored by measuring the fluorescent conversion of alamar blue. Toxicity of test compounds in Hep2 cells was monitored by treating uninfected cells for 7 days and measuring alamar blue conversion in these cells. The alamar blue readings in uninfected, untreated cells were set to 100% survival and the readings in infected, untreated cells were set to 0% survival. To confirm the size dependence and sequence independence of PS-ONs on anti-RSV activity, we tested PS-ON randomers that vary in size. In addition, we tested the clinically accepted treatment for RSV infection, Ribavirin (Virazole™). CPE assay was conducted in Hep2 cells using RSV (strain A2). Infected cells are treated with increasing concentrations of REP 2004, REP 2006, REP 2007, or Ribavirin. IC₅₀ values were calculated from linear regressions are reported in each graph. Cytotoxicity profiles in uninfected Hep2 cells were determined for REP 2004, REP 2006, REP 2007, or Ribavirin. We found that as the size of the PS-ON randomer increases, the potency also increases but saturates at about 40 bases in size. We also noted that 20, 40 and 80 base PS-ON randomers had IC₅₀ values significantly lower than a clinically accepted anti-RSV drug, Ribavirin. PS-ON randomers exhibited no toxicity in Hep2 cells while Ribavirin was significantly toxic (therapeutic index = 2.08).

To the best of our knowledge, this is the first time an IC₅₀ for RSV-1 as low as 0.015 μM has been reported for a PS-ON.

Example 6: Inhibition of Coxsackie virus B2

The ability of PS-ON randomers to inhibit COX B2 is measured monitoring CPE with alamar blue (an indirect measure of cellular metabolism). Rhesus monkey kidney (LLC- MK2) cells are cultured at 37⁰C and 5% CO₂ in MEM plus 5% fetal calf serum. Cells are seeded in 96 well plates at a density which yields a confluent monolayer of cells after 5-6 days of growth. The day after plating, cells were infected with COX B2 (strain Ohio-1 , 10^{7 8} TCID₅₀/ml) in the presence of the test compound in a reduced volume for 2 hours. Following inoculation, the media was changed and was supplemented with test compound. 6 days after infection, CPE was monitored by measuring the fluorescent conversion of alamar blue. Toxicity of test compounds in LLC-MK2 cells was monitored by treating uninfected cells for 7 days and measuring alamar blue conversion in these cells. The alamar blue readings in uninfected, untreated cells were set to 100% survival and the readings in infected, untreated cells were set to 0% survival.

We tested the anti-COX B2 activity of REP 2006 in the COX B2 CPE assay. The CPE assay was conducted in LLC-MK2 cells using Coxsackievirus B2 (strain Ohio-1). Infected cells were treated with increasing concentrations of REP 2006. The cytotoxicity profile for REP 2006 in LLC-MK2 cells was determined. We found that, while exhibiting some slight toxicity in LLC-MK2 cells, this PS-ON randomer was able to partially rescue infected LLC-M K2 cells from COX B2 infection. Example 7: Inhibition of vaccinia virus

We used the vaccinia infection model as an indicator of the efficacy of our compounds against poxviruses, including smallpox virus. The ability of PS-ON randomers to inhibit Vaccinia is measured by monitoring CPE with alamar blue (an indirect measure of cellular metabolism). Vero cells are cultured at 37⁰C and 5% CO₂ in MEM plus 5% fetal calf serum. Cells are seeded in 96 well plates at a density which yields a confluent monolayer of cells after 5-6 days of growth. The day after plating, cells were infected with Vaccinia (10⁷⁹ TCID₅₀/ml) in the presence of the test compound in a reduced volume for 2 hours. Following inoculation, the media was changed and was supplemented with test compound (all at 10μM, except for Cidofovir which was used at 50μM). Five days after infection, the supernatants were harvested. The viral load in the supernatant was determined by reinfection of VERO cells with supernatant diluted 1:100 and the monitoring of CPE 7 days after reinfection by measuring the fluorescent conversion of alamar blue.

We tested PS-ON randomers that vary in size (REP 2004, 2006 and 2007). In addition, we tested a known effective treatment for Vaccinia infection, Cidofovir (Vistide™). Indirect determination of viral load in infected supernatants from vaccinia infected VERO cells was determined by measuring the CPE induced by these supernatants in naive cells. REP 2004, 2006 and 2007 were tested at 10μM while Cidofovir was tested at 50μM. When tested in the Vacinnia CPE assay, we found that treatment with REP 2004, 2006 and 2007 all displayed antiviral activity (ie. resulted in supernatants which showed a decreased CPE upon reinfection) but that this activity was weaker than that seen for Cidofovir.

Example 8: Inhibition of DHBV, Parainfluenza-3 virus, and Hanta virus.

Because DHBV₁ Parainfluenza-3 virus and Hanta virus do not readily generate measurable plaques or CPE, we tested the efficacy of REP 2006 in these viruses using a fluorescence focus forming unit (FFFU) detection. In this assay, REP 2006 (at a final concentration of 10μM) is mixed with the virus which is then adsorbed onto the cells. After adsorption, infected cells are allowed to incubate for an additional 7-14 days at which point they are fixed in methanol. Regions of viral replication are detected by immunofluorescence microscopy against the appropriate viral antigen. For each of the three viruses tested, the specific experimental conditions and results are described in Table 1 below: Table 1. Inhibition of DHBV, Parainfluenza-3 virus, and Hanta virus.

This initial data shows that at 10μM, REP 2006 is effective in inhibiting DHBV, Parainfluenza-2 and Hanta Virus. We anticipate that given the robust response in the preliminary test that IC₅₀ values will be lower. These data support the efficacy of PS-ON randomers for the treatment of human infections of Hanta Virus and Hepatitis B (closely related to DHBV) as well as providing a rationale for the immediate treatment of pediatric bronchiolitis caused by RSV and Parainfluenza-3, which may not require differential diagnosis for treatment to begin.

Example 9: Currently Non-responsive viruses

To date we have not observed a detectable anti-viral efficacy with PS-ON randomers (up to 10μM) without using a delivery system, a drug combination, or a chemical modification in the following viral systems described in Table 2:

Table 2. Viral Systems

Under the current testing procedures, we did not demonstrate activity. However, the lack of demonstrated antiviral activity may be due to limitations of the particular assays used. Additional testing is underway to demonstrate efficacious results with these viruses.

Since our evidence indicates that the charge characteristics of a PS-ON are important for the inhibition of viruses from several different families, we expect that this charge dependent mechanism for the inhibition of viral activity has the potential to inhibit the activity of all encapsidating viruses. The corollary to this is that the lack of detected anti¬ viral efficacy against those viruses listed in Example 9 suggests that the interaction between the PS-ON and the structural proteins of these viruses may not strong be enough to prevent the interaction of viral proteins during the replication of these viruses. In this case, one way of achieving efficacy against these viruses is to alter the charge characteristics of the DNA or anti-viral polymer (e.g., substituting phosphorodithioate for phosphorothioate linkages in DNA) so their affinity for viral proteins is increased.

Example 10: Inhibition of Influenza A

The ability of PS-ONs to inhibit the influenza virus (INF) A is measured in a plaque reduction assay (PRA). Immortalized Canine kidney (MDCK) cells are cultured at 37°C and 5 CO₂ in MEM plus 10% fetal calf serum supplemented with gentamycin, vancomycin and amphoterecin B. Cells are seeded in 6 well plates at a density which yields a confluent monolayer of cells after 6 days of growth. Upon reaching confluency, the media is changed to contain only supplements as described above and cells are then exposed to INF A (strain H3N2, approximately 35-70 PFU total) in the presence of the test compound for 60 minutes. After viral exposure, the media is replaced with new media containing drug only. 24 hours after infection, media is again replaced with overlay media containing 4% albumin, 0.025% DEAE dextran, 2mg/ml TPCK-treated trypsin and 0.8% seaplaque agarose, supplements as described above and no test compound. Plaque counting is performed 2-3 days post infection following formalin fixation and cresyl violet staining of infected cultures.

We tested the anti INF A activity of a variety of PS-ON randomers in the INF A PRA assay. We found that only REP 2006 showed any measurable antiviral activity but that this activity was significant (see following table 3).

Table 3. Activity of PS-ON randomers against INF A (H3N2).

RandomerlC₅₀ (μM)

REP 2003 >10

REP 2004 >10

REP 2006 ~3 Since only the largest randomer seemed to have any activity and we know that the activity of randomers in many other viruses was size dependent, we tested the antiviral activity of a larger size distribution of randomers using a broader dilution range. We discovered that as for other viruses we had tested, the anti-INF A activity of randomers became more potent as their length increased but that no significant increase in activity was seen for randomers above 40 bases in length.

Table 4. Size dependent anti-INF A activity of PS-ON randomers.

Randomer IC₅₀ (μM)

REP 2032 >50

REP 2003 >50

REP 2004 -25

REP 2005 -6.25

REP 2006 -1.25

REP 2007 -0.625

To determine the mechanism of action of REP 2006 we attempted to determine the effect of adding REP 2006 (at IC99 concentration) at various times before, during and after infection. In this experiment, we observed that even 5 hours (300min) after infection, adding REP 2006 resulted in a complete inhibition of INF A activity (see following table). These results indicate that at least a significant portion of the action of

REP 2006 against influenza occurs post infection. Since PS-ON randomers do not readily enter the cell, PS-ON randomers may also interfere with viral budding from the host cell.

623

Table 5. Time of addition of REP 2006 versus effect on INF A activity.

Example 11: Tests for Determining if an Oligonucleotide Acts Predominantly by a Sequence Independent Mode of Action

We have shown herein that the antiviral activity of the present ONs occurs by a sequence-independent mode of action. Of course a person skilled in the art could prepare sequence-specific ONs₁ for example an antisense ON targeting a mRNA of a particular virus and incorporating all phosphorothioate and 2' O-methyl modifications. However such an ON would have benefited from the ON modifications we have described herein and the fact that we have demonstrated herein that the activity of such a modified ON is sequence independent. Thus, an ON shall be considered to have sequence-independent activity if it meets the criteria of any one of the 5 tests outlined below, i.e., if a substantial part of its function is due to a sequence-independent activity. The ONs used in the following tests can be prepared following the general methodology described in example 12 for the synthesis of PS-ONs.

TEST #1 - Effect of partial degeneracy of a candidate ON on its antiviral efficacy

This test serves to measure the antiviral activity of a candidate ON sequence when part of its sequence is made degenerate. If the degenerate version of the candidate ON having the same chemistry retains its activity as described below, is it deemed to have sequence-independent activity. Candidate ONs will be made degenerate according to the following rule: L = the number of bases in the candidate ON

X = the number of bases on each end of the oligo to be made degenerate (but having the same chemistry as the candidate ON) If L is even, then X=integer (L/4)

If L is odd, then X=integer ((L+1)/4) X must be equal to or greater than 4

If the candidate ON is claimed to have an anti-viral activity against a member of the herpesviridae, retroviridae, or paramyxoviridae families, the IC₅₀ generation will be performed using the assay described herein for that viral family preferably using the viral strains indicated. If the candidate ON is claimed to have an anti-viral activity against a member of a particular virus family not mentioned above, then the IC₅₀ values shall be generated by a test of antiviral efficacy accepted by the pharmaceutical industry. IC₅₀ values shall be generated using a minimum of seven concentrations of compound, with three or more points in the linear range of the dose response curve. Using these tests, the IC50 of the candidate ON shall be compared to its degenerate counterpart. If the IC₅₀ of the partially degenerate ON is less than 5-fold greater than the original candidate ON (based on minimum triplicate measurements, standard deviation not to exceed 15% of mean) then the ON shall be deemed to act predominantly by a sequence independent mode of action.

TEST #2 - Comparison of antiviral activity of a candidate ON with an ON randomer.

This test serves to compare the anti-viral efficacy of a candidate ON with the antiviral efficacy of a randomer ON of equivalent size and chemistry in the same virus.

If the candidate ON is claimed to have an anti-viral activity against a member of the herpesviridae, retroviridae, or paramyxoviridae families, the IC₅₀ generation will be performed using the assay described herein for that viral family preferably using the viral strains indicated. If the candidate ON is claimed to have an anti-viral activity against a member of a particular virus family not mentioned above, then the IC₅₀ values shall be generated by a test of antiviral efficacy accepted by the pharmaceutical industry. IC₅₀ values shall be generated using a minimum of seven concentrations of compound, with three or more points in the linear range of the dose response curve. Using this test, the IC₅₀ of the candidate ON shall be compared to an ON randomer of equivalent size and chemistry. If the IC₅₀ of the ON randomer is less than 5-fold greater than the candidate ON (based on minimum triplicate measurements, standard deviation not to exceed 15% of mean) then the candidate ON shall be deemed to act predominantly by a sequence independent mode of action.

TEST #3 - Comparison of antiviral activity of a candidate ON in two non¬ homologous viruses from the same viral family

This test serves to compare the efficacy of a candidate ON against a target virus whose genome is homologous to the candidate ON with the efficacy of the candidate ON against a second virus whose genome has no homology to that candidate ON but is in the same viral family. For example, if a candidate ON is reported to have activity against HSV, its activity against HSV will be compared to its activity against CMV or VZV etc . The comparison of the relative activities of the candidate ON in the target virus and the second virus is accomplished by using the activities of an ON randomer of the same length and chemistry in both viruses to normalize the IC₅₀ values for the candidate ON obtained in the two viruses.

Thus, if the candidate ON is claimed to have an anti-viral activity against a certain virus, then the IC₅₀ generation will be determined in this virus using one of the assays described herein for the herpesviridae, retroviridae, or paramyxoviridae families, or other assays known in the art. Similarly, IC₅₀ generation will be performed for the candidate ON against a second virus using one of the assays as described herein or an assay accepted by the industry for a virus whose genome has no homology to the sequence of the candidate ON but is from the same viral family. IC₅₀ generation is also performed for a randomer of equivalent size and chemistry against each of the viruses. The IC₅₀ of the ON randomer against the two viruses are used to normalize the IC₅₀ values for the candidate ON against the two viruses as follows:

An equivalent algebraic transformation is applied to the IC₅₀ of the candidate ON and the ON randomer in the first (homologous) virus such that the IC₅₀ of the randomer is now 1. An equivalent algebraic transformation is applied to the IC₅₀ of the candidate ON and the ON randomer in the second (non-homologous) virus such that the IC₅₀ of the randomer is now 1.

The fold difference in the ICs₀S for the candidate ON in the homologus versus the non-homologous virus is calculated by dividing the transformed IC₅₀ of the candidate ON in the non-homologous virus by the transformed IC₅₀ of the candidate ON in the homologous virus. The candidate ON shall be deemed to act predominantly by a sequence independent mode of action if the fold difference in IC₅₀ between the two viruses is less than 5.

TEST #4: Antiviral activity of a candidate ON in a different viral family This test serves to determine if a candidate ON has a drug-like activity in a virus where the sequence of the candidate ON is not homologous to any portion of the viral genome and the virus is from a different family. Thus the candidate ON shall be tested using one of the assays described herein for the herpesviridae, retroviridae or paramyxoviridae such that the sequence of the candidate ON tested is not homologous to any portion of the genome of the virus to be used. An IC5₀ value shall be generated using a minimum of seven concentrations of the candidate ON, with three or more points in the linear range. If the resulting dose response curve indicates a drug-like activity (which can typically be seen as a decay or sigmoidal curve, having reduced anti-viral efficacy with decreasing concentrations of candidate ON) and the IC₅₀ generated from the curve is less than 10 μM, the candidate ON shall be deemed to have a drug-like activity. If the candidate ON is deemed to have a drug-like activity in a virus from a different family for which the candidate ON is not complementary and thus can have no sequence dependent antisense activity, it shall be considered to act predominantly by a sequence independent mode of action.

Test #5. Extracellular antiviral activity of a candidate ON

Our current results indicate that the sequence-independent antiviral activity of ONs occurs outside the cell. The state of the art in ON technology teaches that, since ONs are not readily cell permeable, they must be delivered across the cell membrane by an appropriate carrier to have antisense activity. Thus, the antiviral activity of antisense ONs by definition is dependent on delivery inside cells for activity. If a particular sequence-specific candidate ON has in vitro antiviral activity when used naked (and therefore having poor intracellular penetration), it must benefit from the sequence- independent properties of ONs described in this invention.

If the sequence-specific candidate ON is complementary to a portion of the genome of HSV-1, HIV-1 or RSV, then the presence of a sequence-independent antiviral activity of the candidate ON shall be determined in the appropriate assay described below. If the candidate ON is complementary to a virus which is not HSV-1 , HIV-1 or RSV, then the antiviral activity of the candidate ON shall be determined using an assay accepted by the pharmaceutical industry. Using the appropriate assay, the antiviral activity of the naked candidate ON shall be compared to that of the encapsulated (for transfection) candidate ON (using identical candidate ON concentrations in both naked and encapsulated conditions). The activity shall be measured by a dose response curve with not less than 7 concentrations, at least 3 of which fall in the linear range which includes the 50% inhibition of viral activity. The IC₅₀ (the concentration which reduces viral activity by 50%) shall be calculated by linear regression of the linear range of the dose response curve as defined above. If the IC₅₀ of the naked candidate ON is less than 5-fold greater than that of the encapsulated candidate ON, then the activity of the candidate ON shall be deemed to act predominantly by a sequence independent mode of action .

Thresholds used in these tests

The purpose of these tests are to determine by a reasonable analysis, if ONs benefit from or utilize the sequence-independent antiviral properties of ONs which we have described herein and is acting with sequence-independent activity. Of course anyone skilled in the art will realize that, given the inherent variability of all testing methodologies, especially antiviral testing methods, a determination of differences in antiviral activity between two compounds may not be reliably concluded if the threshold is set at a 2 or 3 fold difference between the activities of said compounds. This is due to the fact that variations from experiment to experiment with the same compound in these assays can yield IC₅₀S which vary in this range. Thus, to be reasonably certain that real differences between the activities of two compounds (e.g. two ONs) exist, we set a threshold of at least a 5-fold difference between the IC₅₀S of said compounds. This threshold ensures the reliability of the assessment of the above mentioned tests.

The thresholds described in tests 1 to 3 and 5 above are the default thresholds. If specifically indicated, other thresholds can be used in the comparison tests 1 to 3 and 5 described above. Thus for example, if specifically indicated, the threshold for determining whether an ON is acting with sequence-independent activity can be any of 10-fold, 8-fold, 6-fold, 5-fold, 4-fold, 3-fold, 2-fold, 1.5-fold, or equal. The threshold described in test 4 above is also a default threshold. If specifically indicated, the threshold for determining whether an ON has sequence-independent activity in test 4 can be an IC₅₀ of less than 10μM, 5μM, 1 μM, 0.8 μM, 0.6μM, 0.5μM, 0.4 μM, 0.3 μM, 0.2 μM or 0.1 μM.

Similarly, though the default is that satisfying any one of the above 5 tests is sufficient, if specifically indicated, the ON can be required to satisfy any two (e.g., tests 1 & 2, 1 & 3, 1 & 4, 1 & 5, 2 & 3, 2& 4, 2 & 5, 3 & 4, and 3 & 5), any three (e.g., tests 1 & 2 & 3, 1 & 2 & 4, 1 ,& 2 & 5, 1 & 3 & 4, 1 & 3 & 5, 2 & 3 & 4, and 2 & 4 & 5), any 4 of the tests (e.g., 1 & 2 & 3 & 4, 1 & 2 & 3 & & 5, and 2 & 3 & 4 & 5) at a default threshold, or if specifically indicated, at another threshold(s) as indicated above.

Example 12. Methodologies

The following methods are provided for application in the tests described in example 11.

Oligonucleotide Synthesis

The present oligonucleotides can by synthesized using methods known in the art. For example, unsubstituted and substituted phosphodiester (P=O) oligonucleotides can be synthesized on an automated DNA synthesizer (e.g., Applied Biosystems model 380B or Akta Oligopilot 100) using standard phosphoramidite chemistry with oxidation by iodine. Phosphorothioates (P=S) can be synthesized as for the phosphodiester oligonucleotides except the standard oxidation bottle can be replaced by 0.2 M solution of 311-1,2-benzodithiole-3-one 1 ,1 -dioxide in acetonitrile for the step-wise thioation of the phosphite linkages. The thioation wait step can be increased to 68 sec, followed by the capping step. After cleavage from the support column and deblocking in concentrated ammonium hydroxide at 55⁰C. (18 h), the oligonucleotides can be purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCI solution.

Antiviral assay for herpesviridae

A plaque reduction assay for herpesviridae is performed as follows:

For HSV-1 or HSV-2, VERO cells (ATCC# CCL-81) are grown to confluence in 12 well tissue culture plates (NUNC or equivalent) at 37 ⁰C and 5% CO₂ in the presence of MEM supplemented with 10% heat inactivated fetal calf serum and gentamycin, vancomycin and amphoterecin B . Upon reaching confluency, the media is changed to contain 5% fetal calf serum and antibiotics as detailed above supplemented with either HSV-1 (strain KOS, 40-60 PFU total) or HSV-2 (strain MS2, 40-60 PFU total). Viral adsorbtion proceeds for 90 minutes, after which cells are washed and replaced with new "overlay" media containing 5% fetal calf serum and 1% human immunoglobins. Three to four days after adsorbtion, cells are fixed by formalin and plaques are counted following formalin fixation and cresyl violet staining.

For CMV, human fibroblasts are grown as specified for VERO cells in the HSV-1/2 assay. Media components and adsorbtion / overlay procedures are identical with the following exceptions:

1. CMV (strain AD169, 40-60 PFU total) is used to infect cells during the adsorbtion.

2. In the overlay media, 1% human immunoglobins are replaced by 4% sea- plaque agarose.

For other herpesviridae, testing is to be conducted in the plaque assay described above using an appropriate cellular host and 40-60 PFU of virus during the adsorbtion.

This test is only valid if identifiable plaques are present in the absence of compound at the end of the test.

In this test, ICs₀ is the concentration at which 50% of the plaques are present compared to the untreated control.

Compound to be tested is present during the adsorption and in the overlay.

Antiviral assay for retroviridae

Assaying for the retroviridae HIV-1 is performed by detection of total p24 in the supernatant of HIV-1 infected cells by ELISA is performed as follows:

PBMCs were isolated from fresh human blood obtained from screened donors, seronegative for HIV and HBV. Peripheral blood cells were pelleted/washed 2-3 times by low speed centrifugation and resuspension in PBS to remove contaminating platelets. The washed blood cells were then diluted 1 :1 with Dulbecco's phosphate buffered saline (PBS) and layered over 14 ml_ of Lymphocyte Separation Medium (LSM; cellgro® by Mediatech, Inc.; density 1.078+/- 0.002 g/ml; Cat.# 85-072-CL) in a 50 mL centrifuge tube and centrifuged for 30 minutes at 600 X g. Banded PBMCs were gently aspirated from the resulting interface and subsequently washed 2X with PBS by low speed centrifugation. After the final wash, cells were counted by trypan blue exclusion and resuspended at 1 x 10⁷ cells/mL in RPMI 1640 supplemented with 15 % Fetal Bovine Serum (FBS), 2 mM L-glutamine, 4 μg/mL PHA-P. The cells were allowed to incubate for 48-72 hours at 37⁰C. After incubation, PBMCs were centrifuged and resuspended in RPMI 1640 with 15% FBS, 2 mM L-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, 10 μg/mL gentamycin, and 20 U/mL recombinant human IL-2. PBMCs were maintained in this medium at a concentration of. 1-2 x 10⁶ cells/mL with biweekly medium changes until used in the assay protocol. Monocytes were depleted from the culture as the result of adherence to the tissue culture flask.

For the standard PBMC assay, PHA-P stimulated cells from at least two normal donors were pooled, diluted in fresh medium to a final concentration of 1 x 10⁶ cells/mL, and plated in the interior wells of a 96 well round bottom microplate at 50 μL/well (5 x 104 cells/well). Test drug dilutions were prepared at a 2X concentration in microtiter tubes and 100 μL of each concentration was placed in appropriate wells in a standard format.

After a 2-hr preincubation period (cells + drug), 50 μL of a predetermined dilution of virus stock was placed in each test well (final MOI 0.1). Wells with cells and virus alone were used for virus control. Separate plates were prepared identically without virus for drug cytotoxicity studies using an MTS assay system (described below). The PBMC cultures were maintained for seven days following infection, at which time cell-free supernate samples were collected and assayed for reverse transcriptase activity as described below.

P24 ELISA kits were purchased from Coulter Electronics. The assay is performed according to the manufacturer's instructions. Control curves are generated in each assay to accurately quantify the amount of p24 antigen in each sample. Data are obtained by spectrophotometric analysis at 450 nm using a Molecular Devices Vmax plate reader. Final concentrations are calculated from the optical density values

This test is only valid if there is an accumulation of p24 in the tissue culture supernatant in the infected, untreated cells.

In this test, IC₅₀ is the concentration at which the amount of p24 detectable is 50% of the p24 present in the untreated control.

Compound to be tested is present during the adsorption and in the media after adsorption.

I ll Antiviral assay for paramvxoviridae

For RSV, a measurement of CPE is performed as follows:

Hep2 cells were plated in 96 well plates and allowed to grow overnight in MEM plus 5% fetal calf serum at 37 ⁰C and 5% CO₂. The next day, cells are infected with RSV (strain A2, 10⁸² TCID50/ml in 100ul/well) by adsorbtion for 2 hours. Following adsorbtion, media is changed and after 7 days growth, CPE is measured by conversion of Alamar Blue dye to its fluorescent adduct by living cells.

This test is only valid if CPE measurement (as measured by Alamar Blue conversion) in infected cells in the absence of compound is 10% of the conversion measured in uninfected cells.

For purposes of IC₅₀ comparison, 100% CPE is set at the conversion level seen in infected cells and 0% CPE is set at the conversion seen in uninfected cells. Therefore IC₅₀ is the concentration of compound which generates 50% CPE.

Compound to be tested is present during the adsorption and in the media after adsorption.

Example 13. 2'-0 Methylated phosphorothioated randomers exhibit potent antiviral activity with increased pH resistance and lower serum protein binding.

We show herein that PS-ON randomers do not act via a sequence specific mechanism (i.e. their activity does not require them to bind to nucleic acid and their activity is not due to a sequence specific aptameric effect). We further show in this example the effect of oligonucleotides combining unmodified linkages, phosphorothiate linkages, 2'-0 methyl modified riboses and unmodified ribonucleotides on a 40 base randomer with respect to their antiviral activity, serum protein interaction and chemical stability.

All randomers were prepared using standard solid phase, batch synthesis at the University of Calgary Core DNA Services lab on a 1 or 15 Dmol synthesis scale, deprotected and desalted on a 50cm Sephadex G-25 column.

For antiviral activity testing in influenza A (INF A), immortalized Canine kidney (MDCK) cells are cultured at 37⁰C and 5% CO₂ in MEM plus 10% fetal calf serum supplemented with gentamycin, vancomycin and amphoterecin B. Cells are seeded in 6 well plates at a density which yields a confluent monolayer of cells after 6 days of growth. Upon reaching confluency, the media is changed to contain only supplements as described above and cells are then exposed to INF A (strain H3N2, approximately 35-70 PFU total) for 60 minutes. After viral exposure, the media is replaced with new media containing drug only. Plaque counting is performed 2-3 days post infection following formalin fixation and cresyl violet staining of infected cultures.

For antiviral testing in HSV, immortalized African Green Monkey kidney (VERO) cells are cultured at 37⁰C and 5% CO₂ in MEM plus 10% fetal calf serum supplemented with gentamycin, vancomycin and amphoterecin B. Cells are seeded in 12 well plates at a density which yields a confluent monolayer of cells after 4 days of growth. Upon reaching confluency, the media is changed to contain only 5% serum plus supplements as described above and cells are then exposed to HSV-1 (strain KOS, approximately 40-60 PFU total) in the presence of the test compound for 90 minutes. After viral exposure, the media is replaced with new "overlay" media containing 5% serum, 1% human immunoglobulins, supplements as described above and the test compound. Plaque counting is performed 3-4 days post infection following formalin fixation and cresyl violet staining of infected cultures.

To determine serum protein interaction, a phosphorothioate randomer labeled at the 3" end with FITC (the bait) is diluted to 2nM in assay buffer (1OmM Tris, pH7.2, 8OmM

NaCI, 1OmM EDTA, 10OmM b-mercaptoethanol and 1% tween 20). This oligo is then mixed with the appropriate amount of non heat-inactivated FBS. Following randomer-

FBS interaction, the complexes are challenged with various unlabelled randomers to assess their ability to displace the bait from its complex. Displaced bait is measured by fluorescence polarization. The displacement curve was used to determine Kd.

pH resistance was determined by incubation of randomers in PBS adjusted to the appropriate pH with HCI. 24 hours after incubation, samples were neutralized with 1M TRIS, pH 7.4 and run on denaturing acryalmide gels and visualized following EtBr staining.

For these experiments, we compared the behaviours of different modified randomers: REP 2006, REP 2024, REP 2107, REP 2086 and REP 2060 (see Table 6 in this example). The antiviral activities of these randomers were tested for antiviral activity in HSV and influenza A by plaque reduction assay (see Table 7 in this example). In these two viruses, REP 2006, 2024 and 2107 had similar and potent anti-viral activity, REP 2060 showed significant anti-HSV activity and REP 2086 had no detectable antiviral activity in either HSV-1 or influenza A under these assay conditions.

Table 6. Randomer description

N = unmodified deoxyribonucleotide, unmodified linkage

N = unmodified deoxyribonucleotide, phosphorothiate linkage

N = 2'-0 methyl modified ribose, unmodified linkage

N = 2'-0 methyl modified ribose + phosphorothioate linkage

N = unmodified ribonucleotide + phosphorothioate linkage

Table 7. Antiviral activity of various randomers in HSV and influenza A

The relative affinity of these randomers for serum proteins was determined as described above. The results of these experiments showed that REP 2107 has a lower affinity to serum proteins than REP 2006 or REP 2024 (see Table 8 in this example) and that there was no interaction detected between REP 2086 and serum proteins. Moreover, at saturation of competition, REP 2107 was less effective at displacing bound bait than REP 2006 or REP 2024 (see Table 9 in this example).

Table 8. Serum protein affinity of various randomers.

Table 9. Displacement of bait randomer at saturation.

Finally, we tested the pH stability of these randomers in the range of pH 1 to pH 7 over 24 hours of incubation at 37 ⁰C. While REP 2006 and REP 2024 showed significant degredation at pH 3 and complete degredation at pH 2.5, REP 2107, 2086 and 2060 were completely stable at pH 1 after 24h of incubation.

These results duplicate -our previous findings that the phosphorothioation of ON randomers is highly beneficial for their antiviral activity. We further demonstrate here that the incorporation of 2'-0 methyl modifications in PS-ON randomers does not affect the antiviral activity of these molecules, even when every ribose in the PS-ON randomer contains a 2'-O-methyl modification. Moreover, the fully 2'-O-methylated, fully phosphorothioated randomer (REP 2107) has a weaker interaction with serum proteins and shows a significantly increased resistance to low pH induced hydrolysis

Example 14. PS-ONs act by a predominantly extracellular mode of action.

Prior art has taught that the use of delivery agents to increase the intracellular concentrations of PS-ONs would be beneficial to their activity. We demonstrate here that the antiviral activity of PS-ONs acts predominantly outside the cell and therefore would not receive a major benefit from the transfection enhancement of an intracellular delivery agent. ,

In this example, we use a PS-ON made of deoxyribonucleotides (DNA) without other modifications such as ribonucleotides (RNA) or 2'-O-methyl modification. It is safe to consider that this data will apply to PS-ON bearing additional modifications because it is known is the art that these molecules do not penetrate cells in vitro easily without the aide of a delivery system or a tranfection agent, especially in cases of antisense antivity.

For the determination of cellular delivery, HeLa cells were cultured under standard conditions and then incubated with fluorescently labelled REP 2006 (FL-REP2006, a 3' fluorescein isothiocynate conjugated 40 base PS-ON randomer), either naked or encapsulated with a delivery agent (in this case DOTAP [1 ,2-Dioleoyl-3- Trimethylammonium-Propane], a cationic lipid). After various times of incubation, cells were thoroughly washed with PSB to remove any non-internalized ON and the cells were subsequently lysed. The level of intracellular ON in the cell lysate was determined using a fluorescence plate reader.

The determination of antiviral efficacy with naked, DOTAP and PEI (polyethylene imine) encapsulated REP 2006 in HSV-1and influenza was determined as described above.

The determination of the time of action of REP 2006 during the infectious cycle of HSV- 1 was determined as described above, but adding REP 2006 at various times before, during and after infection. In HIV-1 , this was determined by adding REP 2006 to HIV- LTR-beta-gal HeLa cells at various time before, during and after infection. HIV-1 infection was monitored by a colourmetric assay of beta-gal production using absorbance spectroscopy.

We first determined that DOTAP and PEI could deliver fluorescent REP 2006 inside cells (see table 10). This data showed that both DOTAP and PEI were capable of delivering FL-2006 (and by inference REP 2006) inside cells.

Table 10. Intracellular concentration of FL-REP 2006 with and without delivery

(pmol/cell)

We then determined the activity of encapsulated (DOTAP or PEI) REP2006 in HSV-1 influenza A (see Table 11 and 12 in this example) These results showed that encapsulated REP 2006 had no detectable antiviral activity in both HSV-1 and influenza.

Table 11. Activity of encalsulated REP 2006 in HSV-1 (IC₅₀, μM)

Table 12. Activity of PEI encapsulated REP 2006 in influenza A % inhibition of la ue formation

Finally, a time of addition study in HSV-1 and HIV-1 was performed where REP 2006 was added at various times before, during and after the infection. These results showed that in both viruses, REP 2006 was most effective when present before or during the infection, indicating that it was a fusion / entry inhibitor in HSV-1 and HIV-I

These results demonstrate that the antiviral activity or REP 2006 and PS-ONs bearing additional modifications such as, but without restriction, ribonucleotides (RNA) or 2'-O- methyl, occurs principally outside the cell.

Example 15. REP 2107 exhibits superior nuclease resistance.

40 mer randomers of various chemistries were assessed for their ability to resist degredation by various nucleases for 4 hours at 37 ⁰C (see Table 13 in this example). While most chemistries exhibited resistance to more than one nuclease, only REP 2107 was resistant to all four nucleases tested. It is important to note that REP 2024 (which has 2'-O methyl modifications at the 4 riboses at each end of the molecule) showed the same resistance profile as its parent molecule REP 2006, being sensitive to S1 nuclease degredation while 2107 (fully 2'-0 methyl modified) was resistant to this enzyme. These results suggest that REP 2107 will be the most effective of the tested oligonucleotides in resisting degredation by nucleases in the blood.

Table 13. Resistance to various nucleases by different randomer chemistries.

Sensitive (S) or Resistant (R) after 4h incubation at 37 ⁰C

Example 16. Phosphorothioated polypyrimidine ONs exhibit acid and nuclease resistance.

To determine the extent of ONs acid resistance of ONs, various 40 base ONs having different chemistries and/or sequences are incubated in PBS buffered to different pH values for 24 hours at 37 ⁰C. The degradation of these ONs was assessed by urea- polyacryamide gel electrophoresis (see table 14).

The results of these studies show that randomer ONs (containing both pyrimidine and purine nucleotides) are resistant to acidic pH only when they were fully 2'-0-methylated.

Our data indicated that even partially 2'-0-methylated ONs (gapmers, REP 2024) do not display any significant increase in acid resistance compared to fully phosphorothioated

ONs. Even fully phosphorothioated randomers show no increased pH resistance compared to unmodified ONs. In contrast, we noted that the phosphorothioated 40mer ONs containing only the pyrimidine nucleotides cytosine (polyC, REP 2031) or thymidine

(polyT, REP 2030) or the polyTC heteropolymer (REP 2056) had equivalent acid resistance compared to the fully 2'-0-methylated randomers whether phosphorothioated

(REP 2107) or not (REP 2086). Contrary to the results for the polypyrimidine oligonucleotides, phosphorothioated oligonucleotides containing only the purine nucleotide adenosine (polyA, REP 2029) or any adenosine or guanosine nucleotides

(REP 2033, 2055, 2057) showed no greater acid resistance compared to unmodified

DNA.

These results are significant because the preferred way described in the prior art to achieve greater acid resistance compared to phosphorothioated ONs was to add 2'-O- methyl modifications (or other 2'-ribose modifications) or other modifications. The present data demonstrates that the 2'-O-methyl ribose modification or other 2'-ribose modifications are not required if the ON is a polypyrimidine (i.e. contains only pyrimidine nucleotides [e.g. homopolymers of cytosine or thymidine or a heteropolymer of cytosines and thymidines]) to achieve pH and nuclease resistance. The presence of purines (A or G) even in the presence of pyrimidines, can render ONs acid labile. Table 14. Acid stability of various 40 mer ONs

PII = phosphodiesterase II, S1 = S1 nuclease, Exo1 = Exonuclease 1, PS = all linkages phosphorothioated, 2'OMe = all riboses are 2'0 methylated. +++ = no degradation, ++ = less than 5-% degradation, -/+ = ^: more than 90% degradation, - = completely degraded

To determine the extent of ON nucleotide composition and modifications on nuclease resistance, various 40 base ONs having different nucleotide compositions and modifications were incubated in the presence of various endo and exonucleases for 4 hours at 37 ⁰C. The degradation of these ONs was assessed by urea-polyacryamide gel electrophoresis.

The results of these studies showed that randomer ONs were resistant to all four enzymes tested (phosphodiesterase Il [Sigma], S1 nuclease [Fermentas], Bal31 [New England Biolabs] and exonuclease 1 [New England Biolabs]) only when they were fully phosphorothioated and fully 2'-0 -methylated (see table 15). Omission of any of these modifications in randomers resulted in increased sensitivity to one or more of the nucleases tested. We noted that the fully phosphorothioated, partially 2'-0 -methylated randomer (REP 2024) was equivalent in nuclease resistance to REP 2006, indicated that 2'-O- methylation may be required on each nucleotide of a phosphorothioated ON to achieve the optimal nuclease resistance. However, we noted that the phosphorothioated 40mer polypyrimidine poly cytosine (poly C, REP 2031) had equivalent nuclease resistance compared to the fully phosphorothioated, fully 2'0 methylated randomer (REP 2107).

These results are significant because the prior art teaches that the preferred way to enhance nuclease resistance of phosphorothioated ONs is to add 2'-O -methyl modifications, other 2'- ribose modifications, or other modifications. This new data demonstrates that the 2'-O-methyl modification or other 2'-ribose modifications or any other modifications are not required to enhance nuclease resistance if the ON is fully phosphorothioated and consists of a homopolymer of pyrimidines.

Table 15. Nuclease resistance of various 40 mer ONs

PlI = phosphodiesterase II, S1 = S1 nuclease, Exo1 = Exonuclease 1, PS = all linkages phosphorothioated, 2'OMe = all riboses are 2'0 methylated. - = complete degredation, ++++ = no degredation, PS = phosphorothioate, 2'OMe = 2'-O-methyl modification of the ribose.

These results demonstrate that phosphorothioated ONs containing only pyrimidine nucleotides, including cytosine and/or thymidine and/or other pyrimidines are resistant to low pH and phosphorothioated ONs containing only cytosine nucleotides exhibit superior nuclease resistance, two important characteristics for oral administration of an antiviral ON. Thus, high pyrimidine nucleotide content of an antiviral ON is advantageous to provide resistance to low pH resistance and high cytosine content is advantagaeous to provide improved nuclease resistance. For example, in certain embodiments, the pyrimidine content of such an oligonucleotide is more than 50%, more than 60%, or more than 70%, or more than 80%, or more than 90%, or 100%. Furthermore, these results show the potential of a method of treatment using oral administration of a therapeutically effective amount of at least one pharmacologically acceptable ON composed of pyrimidine nucleotides. These results also show the potential of ONs containing high levels of pyrimidine nucleotides as a component of an antiviral ON formulation.

Example 17. Sequence independent broad spectrum activity of ONs in vivo.

We show here that a 40 base sequence-independent PS-ON randomer has potent antiviral activity in six different animal models of viral infection (see table 16). The 40 base PS-ON randomer was introduced to animals by multiple routes of administration including subcutaneous, intraperitoneal and aerosol (inhalation). These data strongly support the therapeutic potential of sequence independent ONs as broad spectrum antivirals.

Table 16. PS-ON randomers have potent broad spectrum in vivo antiviral activity

ND = not determined

Example 18. Oligonucleotides have antiviral activity in a broad spectrum of viruses

We show here that a 40 PS-ON randomer has antiviral activity in vitro against 13 viral families (see table 17). Table17. PS-ON randomers have broad spectrum in vitro antiviral activity

Example 19. In vivo and in vitro anti-influenza activity of PS-ONs

In order to further assess the anti-influenza activity of ONs, REP 2006 was tested against different strains of influenza using a hemagluttination assay. REP 2006 displayed a broad spectrum anti-influenza activity as shown in Table 18.

Table 18. Broad spectrum antiviral activity of a REP 2006 against multiple strains of influenza.

In order to asses the potential of ONs as drugs for the treatment of influenza, REP 2006 was tested in a mouse model of influenza infection. REP 2006 was prepared at two concentrations in water for injection and aerosolized by nebulization where the outlet was connected to an Anderson cascade chamber. 2Og Balb/c mice were exposed daily to aerosolized randomer 1 for 30 minutes using 10ml of REP 2006 at various concentrations in an aerosol chamber. Mice were intranasally infected with -100TCID of influenza A (H3N2, A/Hong Kong/68) and after 4 days of infection, animals were sacrificed and lung viral titers were determined by hemagluttination assay. REP 2006 demonstrated a potent anti-influenza activity in vivo as shown in Table 19.

Table 19. In vivo efficacy of the REP2006 against influenza A.

SDA = small droplet aerosol, IP = intraperitoneal, SC = subcutaneous) "indicates two daily doses given 12 hours apart.

Example 20. Phosphorothioated polypyrimidine ON exhibits improved antiviral activity in acidic environment in vivo.

In order to assess the resistance of polypyrimidine ONs to low pH and their capacity to 0 be active drugs at lower pH in vivo, REP 2031 (PS polyC) was tested in a HSV-2 vaginal mouse model. Groups of Female Swiss Webster were administered a 0.1 ml suspension containing 3 mg of medroxyprogesterone acetate by subcutaneous injection

7 and 1 days prior to viral challenge, to increase susceptibility to vaginal HSV-2 infection. The vaginal vault was swabbed twice, first with a moistened type 1 calcium 5 alginate-tipped swab and then with a dry swab. Animals were treated with 15 μl of either the candidate solution or a placebo control using a positive displacement pipetter.

Five minutes later, animals were inoculated by instillation of 15 μl of a suspension containing 10⁴ pfu of HSV-2, strain 186. Vaginal swabs samples were collected from all animals on day 2 after inoculation and stored frozen (-8O⁰C) until assayed for the 0 presence of virus by culture. Mice were evaluated daily up to day 21 after inoculation, for evidence of symptomatic infection that can include hair loss and erythema around the perineum, chronic urinary incontinence, hind-limb paralysis, and mortality. Animals that did not develop symptoms were defined as infected if virus was isolated from vaginal swab samples collected on day 2 after inoculation. Results showed (Table 20) that polypyrimidine REP 2031 had an antiviral activity in an acidic environment , such as the vagina in this example or the stomach.

Table 20. Vaginal efficacy of ONs against HSV-2

All patents and other references cited in the specification are indicative of the level of skill of those skilled in the art to which the invention pertains, and are incorporated by reference in their entireties, including any tables and figures, to the same extent as if each reference had been incorporated by reference in its entirety individually.

One skilled in the art would readily appreciate that the present invention is well adapted to obtain the ends and advantages mentioned, as well as those inherent therein. The methods, variances, and compositions described herein as presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art, which are encompassed within the spirit of the invention, are defined by the scope of the claims.

It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. For example, variations can be made to synthesis conditions and compositions of the oligonucleotides. Thus, such additional embodiments are within the scope of the present invention and the following claims.

The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. Thus, for example, in each instance herein any of the terms "comprising", "consisting essentially of and "consisting of may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.

In addition, where features or aspects of the invention are described in terms of Markush groups or other grouping of alternatives, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group or other group.

Also, unless indicated to the contrary, where various numberical values are provided for embodiments, additional embodiments are described by taking any 2 different values as the endpoints of a range. Such ranges are also within the scope of the described invention.

Thus, additional embodiments are within the scope of the invention and within the following claims.

TABLE 21 - DESCRIPTION OF OLIGONUCLEOTIDES

REP 1001 20mer from human autonomously replicating sequence SEQUENCE TTGATAAATAGTACTAGGAC |(SEQ ID NO:1) PS ••••••••••••••••••••

REP 2001 22mer from HSV-I origin of replication SEQUENCE GAAGCGTTCGCACTTCGTCCCA [(SEQ ID NO:2)| PS ••••••••••••••••••••••

REP 3007 16mer from pUC19/pBR322 origin of replication SEQUENCE CTTGCGGTATTCGGAA |(SEQ ID NO:3)| PS ••••••••••••••••

REP 2002 5mer randomer

SEQUENCE NNNNN

PS •••••

REP 2032 6mer randomer

SEQUENCE NNNNNN

PS ••••••

REP 2003 lOmer randomer

SEQUENCE NNNNNNNNNN

PS ••••••••••

REP 2009 12mer randomer

SEQUENCE NNNNNNNNNNNN

PS ••••••••••••

REP 2010 14mer randomer

SEQUENCE NNNNNNNNNNNNNN

PS ••••••••••••••

REP 2011 lβmer randomer

SEQUENCE NNNNNNNNNNNNNNNN

PS ••••••••••••••••

REP 2012 18mer randomer

SEQUENCE NNNNNNNNNNNNNNNNNN

PS ••••••"•••••••••••• REP 2004 20mer randomer

SEQUENCE NNNNNNNNNNNNNNNNNNNN

PS ••••••••••••••••••••

_RECΌ 28 DEC 2005

REP 2005 30mer randomer

SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

PS ••••••••••••••••••••••••••••••

REP 2006 40mer randomer

SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

PS ••••••••••••••••••••••••••••••••••••••••

REP 2007 80mer randomer

SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 60

PS •••••••••••••••••••••••4

SEQUENCE NNNNNNNNNNNNNNNNNNNN 80

PS •••••••••••••••••••a

REP 2008 120mer randomer

SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 60 PS

SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 120 PS

REP 2013 lOmer randomer SEQUENCE NNNNNNNNNN no modification

REP 2014 20mer randomer SEQUENCE NNNNNNNNNNNNNNNNNNNN no modification

REP 2015 40mer randomer

SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN no modification

REP 2016 lOmer random sequence SEQUENCE TCCGAAGACG | ( SEQ I D N0 : 4 j PS REP 2017 20mer random sequence SEQUENCE ACACCTCCGAAGACGATAAC [( SEQ ID NO : 5 ) PS ••••••••»•••••••••••

REP 2018 40mer random sequence

SEQUENCE CTACAGACATACACCTCCGAAGACGATAACACTAGACATA |(SEQ ID NO:6)| PS ••••••••••••••••••••••••••••••••••••••••

REP 2019 lOmer sequence centered around start codon of HSV-I IEIlO protein

(NCBI accession # X04614) SEQUENCE CCCCCATGGA| I(SEQ ID NO: 7; PS ••••••••••

REP 2020 20mer sequence centered around start codon of HSV-I IEIlO protein (NCBI accession # X04614)

SEQUENCE TACGACCCCCATGGAGCCCΘ |(SEQ ID N0:8] PS •••••••••••••••••••a

REP 2021 40mer sequence centered around start codon of HSV-I IEIlO protein (NCBI accession # X04614)

SEQUENCE TCCAGCCGCATACGACCCCCATGGAGCCCCGCCCCGGAGς |(SEQ ID NO:9) PS •••••••••••••••••••••••••••••••••••••••a

REP 2024 40mer randomer

SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

PS ••••••••••••••••••••••••••••••••••••••••

2-0 Me •••• ••••

REP 2026 40mer randomer

SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

PCH3 •••• ••••

REP 2036 21mer commercially marketed antisense against CMV

(vitravine/fomvirisen) SYNTHESIZED INTERNALLY SEQUENCE GCGTTTGCTCTTCTTCTTGCG I ( SEQ ID NO : 10 ) | PS ••••••••••••••••••••• REP 2107 40mer RNA randomer

SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN_. 1(SEQ ID NO:27;

PS ••••••••••••••••••••••••••••••••••••••••

2-0 Me ••••••••••••••••••••••••••••••••••••••••

REP 2086 40mer RNA randomer

SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN |(SEQ ID NO:28)| 2-0 Me ••••••••••••••••••••••••••••••••••••••••

129c

Claims

WHAT IS CLAIMED IS:

1. An oligonucleotide, having at least 50% of its nucleotides in said oligonucleotide modified at the 2'-position of the ribose moiety and having at least 50% of its internucleotidic linkages modified, wherein said oligonucleotide has an antiviral activity against a target virus, said activity operating predominantly by a sequence independent mode of action.

2. The oligonucleotide according to claim 1 , wherein said oligonucleotide has at least 50% of its nucleotides in said oligonucleotide modified at the 2'-position of the ribose moiety and has at least 80% of its internucleotidic linkages modified, wherein said oligonucleotide has an antiviral activity against a target virus, said activity operating predominantly by a sequence independent mode of action.

3. The oligonucleotide according to claim 1 , wherein said oligonucleotide has at least 80% of its nucleotides in said oligonucleotide modified at the 2'-position of the ribose moiety and has at least 80% of its internucleotidic linkages modified, wherein said oligonucleotide has an antiviral activity against a target virus, said activity operating predominantly by a sequence independent mode of action.

4. The oligonucleotide according to claim 1 , wherein said oligonucleotide has at least 90% of its nucleotides in said oligonucleotide modified at the 2'-position of the ribose moiety and having at least 90% of its internucleotidic linkages modified, wherein said oligonucleotide has an antiviral activity against a target virus, said activity operating predominantly by a sequence independent mode of action.

5. The oligonucleotide according to claim 1 , wherein said oligonucleotide has at least 100% of its nucleotides in said oligonucleotide modified at the 2'-position of the ribose moiety and having at least 100% of its internucleotidic linkages modified, wherein said oligonucleotide has an antiviral activity against a target virus, said activity operating predominantly by a sequence independent mode of action.

6. The oligonucleotide of any one of claims 1 to 5, wherein the modified linkages are selected from the group consisting of phosphorothioate linkages, phosphorodithioate linkages, and boranophosphate linkages.

130

7. The oligonucleotide of any one of claims 1 to 5, wherein at least 50% of the nucleotides in said oligonucleotide comprises 2'-OMe moieties at the 2'-position of the ribose moiety.

8. The oligonucleotide of any one of claims 1 to 5, wherein at least 50% of the nucleotides in said oligonucleotide comprise 2'- methoxyethoxy substitutions at the 2'-position of the ribose moiety.

9. The oligonucleotide of any one of claims 1 to 8, wherein said oligonucleotide is at least 30 nucleotides in length.

10. The oligonucleotide of any one of claims 1 to 9, comprising a homopolymer sequence of at least 10 contiguous nucleotides selected from the group consisting of A, T, U, C, G, and I.

11. The oligonucleotide of any one of claims 1 to 9, comprising a sequence of at least 10 nucleotides in length selected from the group consisting of polyAT, polyAC, polyAG, polyAU, polyAI, polyGC, polyGT, polyGU, polyGI, polyCT, polyCU, polyCI, and polyTI.

12. The oligonucleotide of any one of claims 1 to 11, wherein at least 15% of the nucleotides in said oligonucleotide comprise 2'- methoxyethoxy or 2'OMe substitutions at the 2'-position of the ribose moiety.

13. The oligonucleotide of any one of claims 1 to 12, wherein said oligonucleotide is a concatemer consisting of two or more oligonucleotide sequences joined by a linker.

14. The oligonucleotide of any one of claims 1 to 13, wherein said oligonucleotide is linked or conjugated at one or more nucleotide residues, to a molecule modifying the characteristics of the oligonucleotide to obtain one or more characteristics selected from the group consisting of higher stability, lower serum interaction, higher cellular uptake, higher viral protein interaction, an improved ability to be formulated for delivery, a detectable signal, higher antiviral activity, better pharmacokinetic properties, specific tissue distribution, lower toxicity.

15. The oligonucleotide of any one of claims 1 to 14, wherein said oligonucleotide is double stranded.

16. The oligonucleotide of any one of claims 1 to 15, wherein said oligonucleotide targets a DNA virus or a RNA virus.

131 7. The oligonucleotide of any one of claims 1 to 16, wherein said oligonucleotide targets a member of the group consisting of herpesviridae, HSV-1, HSV-2, CMV Varicella Zoster Virus, Epstein Barr Virus, Human Herpesvirus 6A and 6B, hepadnaviridae, HBV, parvoviridae, poxviridae, papillomaviridae, adenoviridae, retroviridae, HIV-1, HIV-2, paramyxoviridae, RSV, parainfluenza virus, human metapneumovirus, bunyaviridae, hantavirus, Rift Valley fever virus, Crimean Congo Hemorrhagic Fever virus, picornaviridae, coxsackievirus, rhinovirus, flaviviridae, yellow fever virus, dengue virus, West Nile virus, hepatitis C virus, filoviridae, Ebola virus, Marburg virus, orthomyxoviridae, influenza virus, togaviridae, Western Equine Encephalitis virus, coronaviridae, reoviridae rhabdoviridae, arenaviridae, lassa fever virus and calciviridae.

18. An oligonucleotide as set forth in any one of REP 1001 , REP 2001, REP 3007, REP 2004, REP 2005, REP 2006, REP 2007, REP 2008, REP 2017, REP 2018, REP 2020, REP 2021 , REP 2024, REP 2036, A20, G20, C20, REP 2029, REP 2031, REP 2030, REP 2033, REP 2055, REP 2056, REP 2057, REP 2060 and REP 2107.

19. An oligonucleotide mixture comprising a mixture of at least two different antiviral oligonucleotides of any one of claims 1 to 18.

20. An oligonucleotide mixture comprising a mixture of at least ten different antiviral oligonucleotides of any one of claims 1 to 18.

21. An antiviral pharmaceutical composition comprising a therapeutically effective amount of at least one pharmacologically acceptable, antiviral oligonucleotide as defined in any one of claims 1 to 18; and a pharmaceutically acceptable carrier.

22. A kit comprising at least one antiviral oligonucleotide as defined in any one of claims 1 to 18, in a labeled package, wherein the antiviral activity of said oligonucleotide occurs principally by a non-sequence complementary mode of action and the label on said package indicates that said antiviral oligonucleotide can be used against at least one virus.

23. The kit of claim 22, wherein said kit contains a mixture of at least two different antiviral oligonucleotides.

24. An antiviral pharmaceutical composition comprising a therapeutically effective amount of at least one pharmacologically acceptable, polypyrimidine oligonucleotide

132 and a pharmaceutically acceptable carrier, wherein the antiviral activity of said oligonucleotide occurs principally by a sequence independent mode of action.

25. The antiviral pharmaceutical composition of claim 24, wherein the oligonucleotide comprises at least one modified internucleotidic linkage.

26. The composition of any one of claims 24 or 25, wherein said composition is formulated for administration to an acidic in vivo site.

27. The composition of any one of claims 24 to 26, wherein said composition is adapted for oral, vaginal, or topical administration.

28. The composition of any one of claims 24 to 27, wherein said composition comprises at least one polyC oligonucleotide.

29. The composition of any one of claims 24 to 27, wherein said composition comprises at least one polyT oligonucleotide.

30. The composition of any one of claims 24 to 27, wherein said composition comprises at least one polyCT oligonucleotide.

31. An oligonucleotide, having at least 50% of its internucleotidic linkages modified, wherein said oligonucleotide has an antiviral activity against a target virus, said activity operating predominantly by a sequence independent mode of action, said oligonucleotide comprising at least 80% of pyrimidine residues.

32. The oligonucleotide of claim 31 , wherein said oligonucleotide has at least 80% of its internucleotidic linkages modified.

33. The oligonucleotide of claim 31 , wherein said oligonucleotide has at least 80% of its internucleotidic linkages modified and has 100% of pyrimidine residues.

34. The oligonucleotide of claim 31, wherein said oligonucleotide has 100% of its internucleotidic linkages modified and has at least 80% of pyrimidine residues.

35. The oligonucleotide of claim 31 , wherein said oligonucleotide has 100% of its internucleotidic linkages modified and has 100% of pyrimidine residues.

36. The oligonucleotide of any one of claims 31 to 35, wherein the modified linkages are selected from the group consisting of phosphorothioate linkages, phosphorodithioate linkages, and boranophosphate linkages.

133

37. The oligonucleotide of any one of claims 31 to 35, wherein the modified linkages are phosphorothioate linkages.

38. The oligonucleotide of any one of claims 31 to 37, wherein the pyrimidine residues are cytosine residues.

39. The oligonucleotide of any one of claims 31 to 37, wherein the pyrimidine residues are thymine residues.

40. The oligonucleotide of any one of claims 31 to 37, wherein the pyrimidine residues are cytosine or thymine residues.

41. The oligonucleotide of any one of claims 31 to 40, wherein said oligonucleotide is at least 30 nucleotides in length.

42. The oligonucleotide of any one of claims 31 to 40, wherein said oligonucleotide is at least 40 nucleotides in length.

43. The oligonucleotide of any one of claims 31 to 42, wherein at least 15% of the nucleotides in said oligonucleotide comprise 2'- methoxyethoxy or 2'-OMe substitutions at the 2'-position of the ribose moiety.

44. The oligonucleotide of any one of claims 31 to 43, wherein said oligonucleotide is a concatemer consisting of two or more oligonucleotide sequences joined by a linker.

45. The oligonucleotide of any one of claims 31 to 44, wherein said oligonucleotide is linked or conjugated at one or more nucleotide residues, to a molecule modifying the characteristics of the oligonucleotide to obtain one or more characteristics selected from the group consisting of higher stability, lower serum interaction, higher cellular uptake, higher viral protein interaction, an improved ability to be formulated for delivery, a detectable signal, higher antiviral activity, better pharmacokinetic properties, specific tissue distribution, lower toxicity.

46. The oligonucleotide of any one of claims 31 to 45, wherein said oligonucleotide is double stranded.

47. The oligonucleotide of any one of claims 31 to 46, wherein said oligonucleotide targets a DNA virus or a RNA virus.

48. The oligonucleotide of any one of claims 31 to 46, wherein said oligonucleotide targets a member of the group consisting of herpesviridae, HSV-1 , HSV-2, CMV

134 Varicella Zoster Virus, Epstein Barr Virus, Human Herpesvirus 6A and 6B, hepadnaviridae, HBV, parvoviridae, poxviridae, papillomaviridae, adenoviridae, retroviridae, HIV-1, HIV-2, paramyxoviridae, RSV, parainfluenza virus, human metapneumovirus, bunyaviridae, hantavirus, Rift Valley fever virus, Crimean Congo Hemorrhagic Fever virus, picomaviridae, coxsackievirus, rhinovirus, flaviviridae, yellow fever virus, dengue virus, West Nile virus, hepatitis C virus, filoviridae, Ebola virus, Marburg virus, orthomyxoviridae, influenza virus, togaviridae, Western Equine Encephalitis virus, coronaviridae, reoviridae rhabdoviridae, arenaviridae, lassa fever virus and calciviridae.

49. An oligonucleotide mixture comprising a mixture of at least two different antiviral oligonucleotides of any one of claims 31 to 48.

50. An oligonucleotide mixture comprising a mixture of at least ten different antiviral oligonucleotides of any one of claims 31 to 48.

51. An antiviral pharmaceutical composition comprising a therapeutically effective amount of at least one pharmacologically acceptable, antiviral oligonucleotide as defined in any one of claims 31 to 48; and a pharmaceutically acceptable carrier.

52. The composition of claim 51, wherein said composition is formulated for administration to an acidic in vivo site.

53. The composition of any one of claims 51 to 52, wherein said composition is adapted for oral, vaginal, or topical administration.

54. A kit comprising at least one antiviral oligonucleotide as defined in any one of claims 31 to 48, in a labeled package, wherein the antiviral activity of said oligonucleotide occurs principally by a non-sequence complementary mode of action and the label on said package indicates that said antiviral oligonucleotide can be used against at least one virus.

55. The kit of claim 54, wherein said kit contains a mixture of at least two different antiviral oligonucleotides.

56. An antiviral pharmaceutical composition comprising a therapeutically effective amount of at least one pharmacologically acceptable, polypyrimidine oligonucleotide and a pharmaceutically acceptable carrier, wherein the antiviral activity of said

135 oligonucleotide occurs principally by a sequence independent mode of action; and a pharmaceutically acceptable carrier.

57. The antiviral pharmaceutical composition of claim 56, wherein the oligonucleotide comprises modified intemucleotidic linkages.

58. The composition of claim 56 or 57, wherein said composition is formulated for administration to an acidic in vivo site.

59. The composition of any one of claims 56 to 58, wherein said composition is in the form of a powder.

60. The composition of any one of claims 56 to 58, wherein said composition is adapted for oral, vaginal, or topical administration.

61. The composition of any one of claims 56 to 58, wherein said composition comprises at least one polyC oligonucleotide.

62. The composition of any one of claims 56 to 58, wherein said composition comprises at least one polyT oligonucleotide.

63. Use of at least one pharmacologically acceptable oligonucleotide as defined in any one of claims 1 to 18 and 31 to 48 in the manufacture of a medicament for the prophylaxis or treatment of a viral infection in a subject .

64. Use of at least one pharmacologically acceptable oligonucleotide as defined in any one of claims 1 to 18 and 31 to 48 for the prophylaxis or treatment of a viral infection in a subject.

65. Use of a therapeutically effective amount of at least one pharmacologically acceptable oligonucleotide mixture as defined in claim 19, 20, 49 or 50 in the manufacture of a medicament for the prophylaxis or treatment of a viral infection in a subject.

66. Use of a therapeutically effective amount of at least one pharmacologically acceptable oligonucleotide mixture as defined in claim 19, 20, 49 or 50 for the prophylaxis or treatment of a viral infection in a subject.

67. Use of a therapeutically effective amount of at least one pharmacologically acceptable antiviral pharmaceutical composition as defined in any one of claims 21 ,

136 24 to 30, 51 to 53, and 56 to 62, in the manufacture of a medicament for the prophylaxis or treatment of a viral infection in a subject.

68. Use of a therapeutically effective amount of at least one pharmacologically acceptable antiviral pharmaceutical composition as defined in any one of claims 21, 24 to 30, 51 to 53, and 56 to 62, for the prophylaxis or treatment of a viral infection in a subject.

69. Use of a therapeutically effective amount of at least one pharmacologically acceptable oligonucleotide as defined in any one of claims 1 to 18 and 31 to 48 to in the manufacture of a medicament for the prophylactic treatment of cancer caused by oncoviruses in a human or a non-human animal..

70. Use of a therapeutically effective amount of at least one pharmacologically acceptable oligonucleotide as defined in any one of claims 1 to 18 and 31 to 48 for the prophylactic treatment of cancer caused by oncoviruses in a human or a non- human animal.

71. Use of a therapeutically effective amount of at least one pharmacologically acceptable oligonucleotide mixture as defined in claim 19, 20, 49 or 50 in the manufacture of a medicament for the prophylactic treatment of cancer caused by oncoviruses in a human or a non-human animal.

72. Use of a therapeutically effective amount of at least one pharmacologically acceptable oligonucleotide mixture as defined in claim 19, 20, 49 or 50 for the prophylactic treatment of cancer caused by oncoviruses in a human or a non-human animal.

73. Use of a therapeutically effective amount of at least one pharmacologically acceptable antiviral pharmaceutical composition as defined in any one of claims 21, 24 to 30, 51 to 53, and 56 to 62 in the manufacture of a medicament for the prophylactic treatment of cancer caused by oncoviruses in a human or a non-human animal.

74. Use of a therapeutically effective amount of at least one pharmacologically acceptable antiviral pharmaceutical composition as defined in any one of claims 21 , 24 to 30, 51 to 53, and 56 to 62 for the prophylactic treatment of cancer caused by oncoviruses in a human or a non-human animal.

137

75. Use of a therapeutically effective amount of at least one pharmacologically acceptable antiviral pharmaceutical composition as defined in any one of claims 51 to 53, said composition being adapted for administration to an acidic in vivo site in the manufacture of a medicament for the prophylaxis or treatment of a viral infection in an acidic environnement in a subject.

76. Use of a therapeutically effective amount of at least one pharmacologically acceptable antiviral pharmaceutical composition as defined in any one of claims 51 to 53, said composition being adapted for administration to an acidic in vivo site for the prophylaxis or treatment of a viral infection in an acidic environnement in a subject.

138