WO2006039399A2 - Staufen 1 (stau1) - mediated mrna decay - Google Patents

Staufen 1 (stau1) - mediated mrna decay Download PDF

Info

Publication number
WO2006039399A2
WO2006039399A2 PCT/US2005/035011 US2005035011W WO2006039399A2 WO 2006039399 A2 WO2006039399 A2 WO 2006039399A2 US 2005035011 W US2005035011 W US 2005035011W WO 2006039399 A2 WO2006039399 A2 WO 2006039399A2
Authority
WO
WIPO (PCT)
Prior art keywords
staul
substance
mrna
smd
upfl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/035011
Other languages
French (fr)
Other versions
WO2006039399A3 (en
Inventor
Lynne E. Maquat
Yoon Ki Kim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Rochester
Original Assignee
University of Rochester
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Rochester filed Critical University of Rochester
Publication of WO2006039399A2 publication Critical patent/WO2006039399A2/en
Anticipated expiration legal-status Critical
Publication of WO2006039399A3 publication Critical patent/WO2006039399A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]

Definitions

  • Mammalian Staufenl is an RNA binding protein that binds to extensive RNA secondary structures, primarily through one or more double-stranded RNA-binding domains (Marion et al., 1999; Wickham et al., 1999).
  • Staufen functions in the transport and localization of bicoid and oskar mRNAs to, respectively, the anterior and posterior poles of oocytes, and prospero mRNA during asymmetric divisions of embryonic neuroblasts (Broadus et al., 1998; Li et al., 1997; Matsuzaki et al., 1998; Schuldt et al., 1998; Shen et al., 1998; St Johnston, 1995).
  • Drosophila Staufen also functions in the translational derepression of oskar mRNA once the mRNA has been localized to the posterior pole of an oocyte (Ephrussi et al., 1991; Kim- Ha et al., 1995; Kim-Ha et al., 1991 ; Micklem et al., 2000).
  • the Staul gene is ubiquitously expressed and generates protein isoforms having apparent molecular weights of 55 and 63 kDa (Kiebler et al., 1999; Marion et al., 1999; Monshausen et al., 2001; Wickham et al., 1999).
  • the 55-kDa isoform associates with 4OS and 60S ribosomal subunits and co-localizes with the rough endoplasmic reticulum (Luo et al., 2002; Marion et al., 1999; Wickham et al., 1999).
  • Staul interacts with telomerase RNA, suggesting that it functions during DNA replication, cell division or both, possibly by influencing telomerase RNA processing or RNP assembly or localization (Bachand et al., 2001; Le et al., 2000).
  • this invention in one aspect, relates to methods of treating subjects with conditions that result from or modified by affecting Staul -mediated mRNA decay and to screening for and manufacturing those therapeutic agents that modulate Staul mediated mRNA decay.
  • Figure 1 shows that Human Upfl interacts with human Staufen (Stau)l in a yeast two-hybrid analyses, in vitro binding assays, and immunopurifications (IPs) of Staul -HA 3 from Cos cells.
  • Figure IA shows yeast two-hybrid screening. Human Upfl as bait interacts with human Staul from the pMyr-cDNA library (upper). Negative and positive controls were provided by Stratagene. The region of Staul that interacts with Upfl was mapped to reside within the double-stranded RNA binding domain (dsRBD)4 and tubulin binding domain (TBD) (lower).
  • Figure IB shows GST pull-down assays. E. coli lysates that expressed GST-Upfl (+) were mixed with E.
  • Cos cells were transiently transfected with a plasmid that expressed the 55-kDa isoform of Staul-HA 3 .
  • RNA and protein were purified from the lysate before and after IP using anti-HA antibody or, to control for the specificity of the IP, rat (r) IgG.
  • RNase A was added to half of each sample prior to IP.
  • SMG7 mRNA was analyzed using RT-PCR to demonstrate that the RNase A digestion was complete (lower). The four left-most lanes represent 2-fold serial dilutions of RNA and demonstrate that the RT-PCR is semi-quantitative. Western blotting was used to detect the specified proteins (upper).
  • Figure IE shows IP of cellular Upf3/3X. Lysate from untransfected Cos cells was immunopurified using anti-Upf3/3X antibody or, as a control for nonspecific IP, normal rabbit serum (NRS). Western blotting was used to analyze the specified proteins. Upf3 co-migrated with Ig heavy chains and, thus, could not be analyzed.
  • Figure IF shows IP of FLAG-Upfl .
  • Lysates of HeLa cells that did (+ pCI- neo-FLAG-UPFl) or did not (- pCI-neo-FLAG-UPFl) stably express FLAG-Upfl was analyzed either before or after IP using anti-Flag antibody by Western blotting for the specified proteins.
  • FIG. 2 shows that down-regulating cellular Staul has no detectable effect on the EJC-dependent NMD of Gl 39Ter or GPxI 46Ter mRNA.
  • HeLa cells were transiently transfected with Staul siRNA, Upf3X siRNA, or a nonspecific Control siRNA. Two days later, cells were re-transfected with pmCMV-Gl and pmCMV-GPxl test plasmids, either nonsense-free (Norm) or nonsense-containing (Ter), and the phCMV-MUP reference plasmid. After an additional day, protein and RNA were purified.
  • Figure 2A shows the Western blot analysis of the siRNA-mediated down-regulation of Staul or Upf3X, where the level of eIF3b served to control for variations in protein loading.
  • Figure 2B shows the RT-PCR analysis of the level of Gl mRNA (left) or GPxI mRNA (right), which was normalized to the level of MUP mRNA. Normalized levels of Norm mRNA in the presence of each siRNA were defined as 100%. Levels in three independently performed experiments did not vary by more than 7%.
  • Figure 3 shows that tethering Staul to the FLuc mRNA 3' UTR reduces FLuc mRNA abundance.
  • Figure 3 A shows the schematic representations of firefly (F) and renilla (R) luciferase (Luc) expression plasmids pcFLuc-MS2bs, pcFLuc, and pRLuc, where X8 specifies eight tandem repeats of the MS2 coat protein binding site.
  • HeLa cells were co- transfected with the specified pcFLuc-MS2bs reporter plasmid, the pRLuc reference plasmid, as well the specified effector plasmid. Two days after transfection, protein and RNA were purified. Western blotting using anti-HA antibody demonstrates effector expression (left).
  • RT-PCR demonstrates that tethered Staul reduces FLuc-MS2bs mRNA abundance (right). Numbers below the figure represent the levels of FLuc or FLuc-MS2bs mRNA, which were normalized to the level of RLuc mRNA. Each normalized level of FLuc or FLuc-MS2bs mRNA was then calculated as a percentage of the normalized level of FLuc or FLuc-MS2bs mRNA that was obtained in the presence of pMS2-HA or pcNMS2, which was defined as 100%. RT-PCR results in at least three independently performed experiments did not vary by more than 9%.
  • Figure 4 shows that the abundance of FLuc-MS2bs mRNA is reduced by only specific proteins, such as MS2-HA-Staul or MS2-Upfl , but not MS2-HA-eIF4AIII, myc-
  • FIG. 4 A shows the western blot analysis of MS2-HA, MS2-HA-Staul and MS2-HA- eIF4Ai ⁇ expression using anti-HA antibody (left), MS2-Upfl, myc-Upfl and endogenous Upfl expression using anti-Upfl antibody (upper right), and MS2-HA, MS2-HA-Staul and Stau-HA 3 expression using anti-Staul antibody (lower right). Endogenous Staul was detectable with enhanced chemiluminescence.
  • Figure 4B shows RT-PCR analysis of the levels of FLuc-MS2bs and RLuc mRNAs.
  • Figure 5 shows that siRNA-mediated down-regulation of cellular Upfl but not Upf2 or UpfiX inhibits the reduction in FLuc-MS2bs mRNA abundance that is mediated by tethered Staul .
  • Figure 5 A and 5B show that HeLa cells were transiently transfected with the specified siRNA. Two days later, cells were transfected with the pcFLuc-MS2bs reporter plasmid, the pRLuc reference plasmid, and the specified effector plasmid. Alternatively, cells were transfected with a pmCMV-Gl test plasmid (either Norm or Ter) and the phCMV-MUP reference plasmid. After an additional two days, protein and RNA were purified.
  • pmCMV-Gl test plasmid either Norm or Ter
  • Figures 5A-5C show that Western blotting was used to quantitate the extent of down-regulation.
  • Figures 5A-5B shows that RT-PCR was used to quantitate the effects of siRNA on Gl mRNA abundance, as in Figure 2B.
  • Figures 5A-5C (right) show that RT-PCR was used to quantitate the effects of siRNA on mRNA abundance that were mediated by tethering the specified protein as in Figure 3B.
  • mRNA levels in at least two independently performed experiments did not differ by more than 10 %.
  • Figure 6 shows evidence that Staul reduces mRNA abundance in a way that depends on an upstream termination codon that is located upstream of the Staul binding site.
  • HeLa cells were transfected as described in the legend to Figure 3 using the specified test, reference and effector plasmids.
  • Figure 6A shows schematic representations of the pcFLuc-MS2bs, pcFLuc (UAA->CAA)-MS2bs, pcGl-MS2bs, and pcGl(UAA ⁇ UAC)- MS2bs test plasmids (the latter two were called pc/3-6bs and pcj3UAC-6bs, respectively, in Lykke-Andersen et al., 2000).
  • Figure 6B shows the quantitation of MS2-HA and MS2-HA- Staul expression.
  • This figure is like Figure 3, except that pcFLuc(UAA-»CAA)-MS2bs was used as the reporter plasmid.
  • Figure 6C is like Figure 3, except that pcGl-MS2bs or pcGl(UAA-»UAC)-MS2bs was the reporter plasmid, and phCMV-MUP was the reference plasmid. Results represent two independently performed experiments and do not vary by more than 11%.
  • Figure 7 shows that Staul binds Arfl mRNA.
  • Figure 7 A shows the IP of Staul - HA 3 . 293 cells were transiently transfected with a plasmid that expressed Staul-HA 3 or, to control for nonspecific IP, Staul -6xHis. Two days later, cells were lysed, a fraction of cell lysates was immunopurified using anti-HA antibody, and Staul was identified before and after IP using Western blotting and anti-Staul antibody. Asterisks denote the 63-kDa and 55-kDa isoforms of endogenous Staul.
  • Figure 7B shows the identification of Arfl mRNA in Staul -containing RNP.
  • Biotin-labeled cRNA was synthesized from RNA that had been immunopurified using anti-HA antibody from Staul-HA 3 - or Staul -6xHis-expressing cells or poly(A) + RNA from untransfected cells.
  • the histogram represents the amount of hybridized Arfl mRNA that was either immunopurified using anti-HA antibody from
  • FIG. 7C shows RT-PCR of Arfl mRNA in Staul -containing RNPs. 293 cells were transiently transfected with a plasmid that expressed either Staul-HA 3 or, as a control, Staul-6xHis. As in 1OA, except that immunopurified RNA was purified, and Arfl mRNA was amplified using RT-PCR (two left-most lanes). Alternatively, lysates from untransfected 293 cells were immunopurified using with anti-Staul antibody (right) or an unrelated ascites fluid for the analysis of Arfl mRNA.
  • Figure 8 shows that Staul binds the 3' UTR of Arfl mRNA and reduces its abundance in a mechanism that involves Upfl .
  • Figure 8 A shows schematic representations of the Arfl gene and the pSport-Arfl and pSport-Arfl ⁇ (3'UTR) cDNA expression plasmids.
  • Figure 8B is a parallel study to Figure 4A, except that HeLa cells were transiently transfected with the specified siRNA. Two days later, cells were re-transfected with a pSport-Arfl test plasmid and the reference phCMV-MUP plasmid. After an additional day, protein and RNA were isolated for Western analysis and RT-PCR, respectively.
  • FIG. 8D shows IP of Staul -HA 3 .
  • Cos cells were transiently transfected with the Staul -HA 3 expression vector, pSport-Arfl or pSport- Arfl ⁇ (3 'UTR), and phCMV-MUP. Notably, cells were transfected with only half as much pSport-Arfl ⁇ (3'UTR) relative to pSport-Arfl in order to compensate for the difference in the level of product mRNA.
  • Figure 9 shows a comparable increase in the abundance of Arfl mRNA that derives from pSport-Arfl is obtained using two different Staul siRNAs and two different Upfl siRNAs. As in Figure 8B; however, Staul (A) and Upfl (A) siRNAs were analyzed in parallel to, respectively, the Staul and Upfl siRNAs that were analyzed in the Figure 8B.
  • Figure 9 A shows that the western blotting demonstrates down-regulation of Staul (left), and RT-PCR demonstrates that down-regulating Staul increases the level of Arfl mRNA abundance (right).
  • Figure 9B is like 9A, except that Up ⁇ was down-regulated. Results represent two independently performed experiments and do not vary by more than 12%.
  • FIG 10 shows that Staul binds within an ⁇ 230-nt region of the Arfl mRNA 3' UTR, and this region reduces the half- life of Arfl mRNA in a Staul -mediated mechanism.
  • Figure 1OA shows the schematic representations of the various Arfl mRNAs harboring deletions within the 3' UTR. Numbering is relative to the first nucleotide of endogenous Arfl mRNA, which is defined as 1. The upper-most construct represents full-length mRNA.
  • Figure 1OB shows that the 293 cells were transfected with the Staul -HA 3 expression vector and the specified pSport-Arfl test plasmid. One-tenth of each IP was used to determine IP efficiencies using Western blotting (upper).
  • Figure 1OC shows that the L cells were transfected with mouse (m)Staul, mUpfl, mUpf2, or Control siRNA. Two days later, cells were re- transfected with the pfos-Arfl-SBS test plasmid (upper left) and the phCMV-MUP reference plasmid in the absence of serum.
  • Serum was added to 15% after an additional 24 hr, and protein was purified from the cytoplasmic fraction for Western blotting (second- from-top, left and right).
  • RNA was purified from the nuclear fraction for RT-PCR analysis at the specified times (second-from-bottom, left and right).
  • the level of pfos-Arfl-SBS mRNA was normalized to the level of MUP mRNA. Normalized levels were calculated as a percentage of the normalized level of fos- Arfl -SBS mRNA at 30 min in the presence of each siRNA, which was defined as 100. Normalized levels represent the average of two independently performed experiments and are plotted as a function of time after serum addition (bottom, left and right).
  • Figure 11 shows that inserting the Staul binding site (SBS; nts 622-924) of the Arfl mRNA 3'UTR within FLuc mRNA results in a Staul -dependent reduction in FLuc mRNA halflife, whereas inserting a different region (No SBS; nts 899-1144) of the Arfl mRNA 3'UTR does not.
  • Figure 1 IA shows schematic representations of pcFLuc-SBS and pcFLuc-No SBS test plasmids.
  • the Arfl SBS maintains the distance and sequence of the minimized Staul binding site (nts 688-919) relative to the normal termination codon.
  • Figure 12 shows the 3' UTR of PAICS mRNA, which encodes phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazole succinocarboxamide synthetase activities, also binds Staul, and down-regulating Staul increases PAICS mRNA abundance.
  • Figure 12A is like Figure 1OB, except that 293 cells were transfected with test plasmid pSport-PAICS or, as a negative control, pCDNA3-RSV- CK2A2, which encodes casein kinase 2 alpha prime polypeptide.
  • Figure 12B is like Figure 8D, except that pSport-PAICS or pSport-PAICS ⁇ (3'UTR) was the test plasmid.
  • the small amount of MUP mRNA that was detected in the IP represents background since (i) MUP mRNA was never detected in other IPs and (ii) a comparison of the levels of PAICS and MUP mRNAs before and after IP shows a 110-fold enrichment of PAICS mRNA relative to MUP mRNA after IP.
  • Figure 12C is like Figure 8B, except that pSport-PAICS was the test plasmid. Results represent two independently performed experiments and do not vary by more than 2%.
  • Figure 13 shows that down-regulating Staul has no effect on the half-life of fos- Arfl ⁇ (3'UTR) mRNA.
  • Figure 13 was conduct in the same manner as Figure 1 IB, except that the test plasmid was pfos-Arfl ⁇ (3'UTR). Results represent two independently performed experiments, and RT-PCR quantitations did not vary by more than 19%.
  • Figure 14 shows the models for EJC-dependent NMD and SMD of Arfl mRNA in mammalian cells.
  • Figure 14A shows the recruitment of Upfl to one of the four EJCs of Arfl mRNA via Upf2 and Upf3/3X.
  • EJC exon junction complex
  • EJC consists of the NMD factor Upf3 or UpOX, each of which binds U ⁇ f2, and Upf2 is thought to subsequently bind Upfl .
  • EJC-dependent NMD occurs if translation terminates prematurely more than -50-55 nucleotides upstream of any exon-exon junction, which would be -20-25 nucleotide upstream of the corresponding EJC (only the 3'-most of which is shown).
  • Figure 14B shows the recruitment of Upfl to the 3' UTR of Arfl mRNA via Staul. Staul, which binds the 3' UTR of Arfl mRNA, recruits Upfl independently of an EJC. Data indicate that SMD occurs when translation terminates properly.
  • Staul binding site would reside more than ⁇ 20-25 nts downstream of the normal termination codon in order to elicit SMD. This is consistent with the finding that Staul binds at least 67-nt downstream of this codon.
  • FIG. 15 Demonstration that 11 of 12 transcripts that were upregulated in human cells depleted of Staul using three independently performed microarray analysis are upregulated using RT-PCR and transcript-specific primers.
  • RNAs analyzed were identical to the RNAs from Control and Staul siRNA-treated samples analyzed in Figure 17.
  • the level of each test transcript was normalized to the level of SMG7 mRNA, which is insensitive to Staul siRNA (data not shown) and served to control for variations in RNA recovery. Numbers below each lane specify the fold change in the level of each test transcript in cells treated with Stau siRNA relative to Control siRNA, the latter of which was defined as 1.
  • Figure 17 shows that c-JUN, SERPINEl and JX7R mRNAs are increased in abundance in human cells depleted of either Upfl or Staul but not Upf2.
  • HeLa cells were transiently transfected with Staul, Staul (A), Upfl, Upfl (A) or Upf2 siRNA or, to control for nonspecific depletion, Control siRNA.
  • Staul Staul
  • Upfl Upfl
  • Upfl Upfl
  • Upf2 siRNA Upf2 siRNA
  • Figure 17A shows Western blot analysis, where the level of Vimentin serves to control for variations in protein loading, and the normal level of Staul, Upfl or Upf2 is determined in the presence of Control siRNA.
  • Figure 17B shows RT-PCR analysis of the level of endogenous c-JUN mRNA (upper), SERPJJSfEl mRNA or JL7R mRNA (lower), each of which is normalized to the level of endogenous SMG7 mRNA.
  • the normalized level of each mRNA in the presence of Control siRNA is defined as 1.
  • RT-PCR results are representative of three independently performed experiments that did not differ by the amount specified.
  • FIG. 18 shows that Staul binds within the 3'UTR of c-JUN, SERPINEl and JX7R mRNAs.
  • Cos cells were transiently transfected with three plasmids: (i) pcFLuc-c-JUN 3'UTR, pcFLuc-SERPINEl 3'UTR and pcFLuc-IL7R 3'UTR test plasmids, which encode FLuc mRNA in which all of the FLuc 3'UTR has been replaced by, respectively, part of the c- JUN 3'UTR or all of the SERPINEl or IL7R 3'UTR; (ii) the Staul-HA 3 expression vector; (iii) the pcFLuc-SBS test plasmid, which encodes FLuc mRNA in which the 3'UTR has been replaced by the 231 -nucleotide Staul binding site (SBS) of Arfl mRNA (Kim et al., 2005)
  • FIG. 18A shows schematic representations of pcFLuc-c-JUN, pcFLuc-SERPINE 1 , pcFLuc-IL7R and pcFLuc-SBS test plasmids.
  • Figure 18B shows Western blotting using anti( ⁇ )-HA or anti-Calnexin demonstrated that Staul -HA 3 but, as expected, not Calnexin was immunopurified.
  • Figure 18C shows RT-PCR analysis demonstrates that c-JUN, SERPINEl and IL7R 3'UTRs, like the Arfl SBS, bind Staul-HA 3 , whereas MUP mRNA does not. Results are representative of three independently performed experiments.
  • Figure 19 shows that depleting cells of Staul or Upfl increases the half-life of FLuc mRNA when the 3'UTR consists of the Staul binding site of the c-JUN, SERPME1 or IL7R 3'UTR.
  • L cells were transfected with mouse (m)Staul, mUpfl or Control siRNA.
  • Figure 19B shows Western blotting of mStaul or mUpfl, where the level of ⁇ -actin serves to control for variations in protein loading. mStaul was depleted to 35% its normal level, and mUpfl was depleted to 30% of its normal level.
  • Figure 19C shows RT-PCR analysis of the SMD candidate mRNAs. For each time point, the level of each mRNA transcribed from the fos promoter is normalized to the level of MUP mRNA. Normalized levels are calculated as a percentage of the normalized level of each mRNA transcribed at 30 minutes in the presence of each siRNA, which is defined as 100 (left). These levels are plotted as a function of time after serum addition (right).
  • FIG. 26 shows that GAP43 mRNA is an SMD target.
  • Figure 2OA shows RT- PCR demonstrating that depleting cells of Staul or Upfl increases the cellular abundance of GAP43 mRNA.
  • Figure 2OB shows IP revealing that Staul binds to the 3' UTR of GAP43 mRNA and, as a positive control Arfl SBS.
  • Cos cells were transfected with three plasmids: (i) pcFLuc-GAP43 3 ' UTR (left), (ii) the Staul - HA 3 expression vector; (iii) pcFLuc-SBS (left), and (iv) phCMV-MUP and analyzed as described in the legend to Figure 2 except that FLuc-GAP43 3' UTR and FLuc-Arfl SBS mRNAs were analyzed instead of the other FLuc mRNA derivatives.
  • Figure 2OC shows Western blot (upper right) and RT-PCR analysis (lower left) demonstrating that depleting cells of Staul or Upfl increases the half-life of FLuc mRNA when the 3'UTR consists of the Staul binding site of GAP43 mRNA.
  • L cells were transfected with mStaul, mUpfl or Control siRNA. Two days later, cells were re-transfected with the pfos-FLuc-GAP43 3' UTR test plasmid and the phCMV-MUP reference plasmid in the absence of serum. Subsequent treatment and analyses were as described in the legend to Figure 19 except that fos-FLuc- GAP43 3 ' UTR mRNA was analyzed instead of the other fos-FLuc mRNA derivatives. Results are representative of two independently performed experiments.
  • Ranges may be expressed herein as from “about” one particular value, and/or to "about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.
  • Primers are a subset of probes which are capable of supporting some type of enzymatic manipulation and which can hybridize with a target nucleic acid such that the enzymatic manipulation can occur.
  • a primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art which do not interfere with the enzymatic manipulation.
  • Probes are molecules capable of interacting with a target nucleic acid, typically in a sequence specific manner, for example through hybridization. The hybridization of nucleic acids is well understood in the art and discussed herein. Typically a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.
  • chemical refers to any reagent that can bind, mutate, dissolve, cleave, initiate a reaction that results in a new substance, or alter the confirmation of a target substance.
  • An example of a chemical would be a small molecule.
  • pioneer round of translation or “pioneering round” refers to an initial round of mRNA translation prior to steady-state translation.
  • the round is characterized by the presence of CBP80 and CBP20 as the CAP binding proteins, PABP2 as a polyadenylation binding protein, and involves Upf2 and Upf3 or UpOX.
  • Staul is involved in mRNA decay. Also, Staul -mediated mRNA decay involves the nonsense-mediated mRNA decay (NMD) factor Upfl .
  • NMD nonsense-mediated mRNA decay
  • the expression of protein-encoding genes requires a series of steps in which pre-mRNA is processed to mRNA in the nucleus before mRNA is translated into protein in the cytoplasm. These steps are subject to quality control to ensure that only completely processed mRNA is exported to the cytoplasm (reviewed in Maquat and Carmichael, 2001).
  • One form of quality control called mRNA surveillance or NMD.
  • NMD in mammalian cells is generally a splicing-dependent mechanism that degrades newly synthesized mRNAs that prematurely terminate translation more than 50-55 nucleotides upstream of an exon-exon junction as a means to prevent the synthesis of potentially harmful truncated proteins (reviewed in Frischmeyer and Dietz, 1999; Hentze and Kulozik, 1999; Li and Wilkinson, 1998; Maquat, 2004a; Maquat, 2004b; Wilusz et al, 2001). By so doing, NMD precludes the synthesis of the encoded truncated proteins, which can function in deleterious ways (see, e.g., Inoue et al., 2004). NMD also targets naturally occurring mRNAs such as certain selenoprotein mRNAs and an estimated one-third of alternatively spliced mRNAs, some of which encode functional protein isoforms (Maquat, 2004b).
  • the dependence of NMD on splicing reflects the deposition of an exon junction complex (EJC) of proteins -20-24 nucleotides upstream of splicing-generated exon-exon junctions (Kataoka et al., 2000; Kim et al., 2001; Le Hir et al., 2000a; Le Hir et al., 2000b; Lykke-Andersen et al., 2001).
  • EJC exon junction complex
  • This EJC includes NMD factors Up ⁇ (also called UpOa) or Up ⁇ X (also called Upfib), Upf2 and, presumably, Upfl (Gehring et al., 2003; Kim et al., 2001; Lejeune et al., 2002; Lykke-Andersen et al., 2000; Lykke-Andersen et al., 2001).
  • Up ⁇ and Up ⁇ X appear to play a comparable role in NMD (Kim et al., 2001 ; Lykke-Andersen et al., 2001), although different isoforms of Up ⁇ can form distinct protein complexes (Ohashi et al., 2002).
  • EJC EJC
  • Y14 RNPSl, SRml ⁇ O, REF/Aly, UAP56, Mago, Pinin, and eIF4Am
  • Ferraiuolo et al., 2004 Kataoka et al., 2000; Kim et al., 2001 ; Le Hir et al., 2001 ; Le Hir et al., 2000b; Luo, et al., 2001 ; Palacios et al., 2004; Shibuya et al., 2004; Tarn et al., 2003).
  • EJCs are present on mRNA that is bound at the cap by the mostly nuclear cap binding protein (CBP)80-CBP20 heterodimer, which is consistent with data indicating that NMD targets CBP80-bound mRNA during a pioneer round of translation (Chiu et al., 2004; Ishigaki et al., 2001 ; Lejeune et al., 2002; Lejeune et al., 2004).
  • CBP nuclear cap binding protein
  • Staul binds the NMD factor Upfl and the 3' untranslated region (UTR) of mRNA that encodes ADP-ribosylation factor (Arf)l.
  • URR 3' untranslated region
  • Rhf ADP-ribosylation factor
  • Staul mediates Arfl mRNA decay in a mechanism that differs from NMD by occurring independently of splicing or Upf2 and Up ⁇ X.
  • SMD Staul -mediated mRNA decay
  • Staul plays no detectable role in the EJC-dependent NMD of either /3-globin or glutathione peroxidase 1 mRNA.
  • the invention described herein in one aspect relates to methods of treating a disorder in a subject comprising administering to the subject a substance, wherein the substance modulates Staul -mediated mRNA decay (SMD).
  • SMD Staul -mediated mRNA decay
  • treating can refer to any method that improves a disorder in a subject.
  • the improvement can include but is not limited to a decrease in one or more symptoms of the disorder such that the disorder is reduced.
  • Treating is understood to include small improvements in the disorder up to and including the complete ablation of the disorder.
  • the treatment can result in a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the disorder.
  • a disorder means any inherited or acquired disease or condition associated with Staul mediated mRNA decay that has a negative effect relative to the wild-type state.
  • the disorder can be inherited genetic disorder.
  • Inherited genetic disorders are disorders that result from the presence of an abherent gene or genes that alter the way an interaction, system or pathway works.
  • system refers to any cell, organism, or in vitro assay or culture. Such a system includes components necessary for SMD activity. Such components can include, for example, but are not limited to Staul and Upfl.
  • the disorder is a genetic disorder
  • the genetic disorder can be selected from the group consisting of cystic fibrosis, hemophilia, mucopolysaccharidoses, muscular dystrophy, anemia, glycolytic enzyme deficiency, connective tissue disorder, DNA repair disorder, dementia, Sandhoff disease, epidermolysis bullosa simplex, insulin resistance, maple syrup urine disease, hereditary fructose intolerance, inherited immunodeficiency, inherited cancer, carbohydrate metabolism disorder, amino acid metabolism disorder, lipoprotein metabolism disorder, lipid metabolism disorder, lysomal enzymes disorder, steroid metabolism disorder, purine metabolism disorder, pyrimidine metabolism disorder, metal metabolism disorder, porphyrin metabolism disorder, and heme metabolism disorder.
  • a disorder can be dementia.
  • Dementias can include but are not limited to Alzheimer's, Lewy Body dementia, Binswanger's dementia, or dementias associated with Parkinson's Disease, progressive supranuclear palsy, Huntingdon's disease, Pick's disease, Creutzfeldt- Jakob disease, Gerstmann-Straussler-Scheinker disease, AIDS, or trauma.
  • disorders can also include acquired disorders.
  • Acquired disorders are disorders that result from some external insult or injury, or from an unknown mechanism that is not derived from a genetic characteristic.
  • acquired disorder is meant any disorder that lacks a clear genetically inherited link.
  • acquired disorders can result from chemical exposure, radiation exposure, or random mutation in a gene that was not present in the subject earlier.
  • an acquired disorder can comprise a cancer. 44.
  • methods of the invention wherein the disorder is an acquired disorder.
  • the acquired disorder is, by way of example but not by way of a limitation, a cancer. Such a cancer may be related to mutations such as mutations in p53 or BRCA-I .
  • the disclosed compositions can be used to treat any disease where uncontrolled cellular proliferation occurs such as cancers.
  • a representative but non-limiting list of cancers that the disclosed compositions can be used to treat is the following: lymphoma, B cell lymphoma, T cell lymphoma, leukemia, carcinoma, sarcoma, glioma, blastoma, neuroblastoma, plasmacytoma, histiocytoma, melanoma, mycosis fungoide, hypoxic tumor, myeloma, metastatic cancer, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, colon cancer, cervical cancer, breast cancer, epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, hematopoietic cancers, testicular cancer, and colorectal cancer.
  • SMD occurs in or as a result of the pioneering round of translation.
  • SMD can also occur during steady- state translation.
  • steady-state translation can target eIF4E-bound mRNA.
  • subject refers to any cell, tissue, system, or organism used to study or treat a disorder relating to SMD, including, for example, human patients with conditions that result from SMD or cell lines used to study aspects of SMD.
  • subject is a mammal. It is specifically contemplated that mammal can include but is not limited to human, monkey, mouse, dog, pig, rabbit, and cow.
  • the disclosed methods function by modulating SMD.
  • modulation or “modulating” is meant either an increase or a decrease in SMD activity.
  • Staufen 1 can modulate mRNA transcripts through the stabilization or destabilization of an mRNA.
  • SMD levels are increased or decreased in a subject with a condition resulting from a mutation that generates a nonsense codon (including but not limited to a nonsense mutatation) depends on the particular mRNA that is affected, the binding of Staufenl and, where binding of Staul occurs.
  • a decrease in SMD activity could increase the amount of mRNA that is available for translation.
  • modulation can be measured by, e.g., comparing the level of the mRNA harboring a premature or alternative termination codon relative to an unaffected cellular RNA to the level of that mRNA lacking a premature or alternative termination codon to the same unaffected cellular RNA. Subsequent nonsense suppression could be used to increase the amount of the encoded full-length protein. Conversely, an increase in SMD activity would decrease the amount of mRNA that is available for translation so as to reduce production of the encoded truncated protein.
  • the disclosed methods can be used to modulate the expression of genes by modulating SMD (e.g., to decrease mRNA from a truncated protein, one would increase SMD activity. A decrease in SMD activity would be used to increase the amount of mRNA of a truncated protein available).
  • SMD can also target mRNAs that do not have a premature or alternative termination codon, providing another means by which gene expression could be regulated.
  • a decrease in Staul -mediated mRNA decay can refer to any change that results in a smaller amount of Staul mRNA mediated decay.
  • a decrease can refer to a reduction in an activity.
  • a substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed.
  • a decrease can include, but is not limited to, a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction.
  • a decrease can but does not have to result in the complete ablation of a substance or activity. Therefore, for example, a decrease in SMD would result in the presence of more gene products with early or alternative termination sites (i.e., a decrease in SMD activity).
  • the term “inhibits” or “inhibition” refers to any degree of decrease as compared to a control. Thus, for example, “inhibition” can refer to a 10% " 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction as compared to a control.
  • an increase in Staul - mediated mRNA decay can refer to any change that results in a larger amount of a Staul mediated mRNA decay activity.
  • an increase in the amount in SMD of a particular mRNA can include but is not limited to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase. It is understood and herein contemplated that an increase in SMD would result in a subsequent decrease in the amount of gene products with early or alternative termination sites. 51. It is understood and herein contemplated that Staul can bind mRNA at AU rich elements (ARE).
  • ARE AU rich elements
  • Staul binds mRNA at Type HI AREs.
  • the binding of Staul to AREs can affect the level of gene expression for the mRNA transcript to which it binds. It is also understood and herein contemplated that the binding of Staul to AREs can have a stabilizing effect. Therefore, herein disclosed is the ability of Staul to bind stabilizing or destabilizing elements.
  • methods wherein the modulation of SMD results in the stabilization of mRNA are also disclosed are methods wherein the modulation of SMD results in the destabilization of mRNA.
  • a disorder in a subject comprising administering to the subject a substance, wherein the substance modulates Staul -mediated mRNA decay.
  • Modulation of Staul -mediated mRNA decay can result in a decrease in SMD.
  • the decrease in SMD would increase the abundance of the nRNA containing a premature or alternative termination codon.
  • the disclosed methods can be used to modulate the level of mRNA or protein expression.
  • Staul can increase or decrease the abundance of an mRNA independently of SMD.
  • not all SMD activity occurs through the involvement of Staul and Upfl, but can be Upfl independent.
  • modulating the level of mRNA is meant that the abundance of a target transcript can be increased or decreased by the expression of Staul .
  • the ability to modulate the abundance of target genes can be achieved in conjunction with or independently of Upfl . It is understood that such effect can be either direct or indirect.
  • direct effect is meant that Staul acts on the targeted mRNA itself and by “indirect effect” is meant that Staul acts by an intermediary, including for example, a nucleic acid.
  • Staul down-regulation can result either directly or indirectly in the down reulation of target mRNA levels. It is understood that whether the effect is direct or indirect will depend on the target gene. One of skill in the art will be able to determine whether the effect is direct or indirect given the target gene.
  • identifying genes modulated by the down-regulation of Staul comprising a) incubating a substance that down- regulates SMD with a stably transfected cell comprising a reporter gene with a nonsense- mutation and Staul, and b) assaying the amount of mRNA present for a gene of a microarray, wherein a increase or decrease in the amount of mRNA relative to the amount of mRNA in the absence of the substance indicates a gene that is modulated by Staul activity. It is understood that these methods can be used to identify genes that are up- regulated or down regulated by the down-regulation of Staul as well as identify those genes whose abundance increases or decreases with the down-regulation of Staul .
  • RNA small interfering RNA
  • a componenet of SMD such as Staul or Upfl.
  • methods of identifying genes modulated by the down- regulation of Staul comprising a) transfecting a small interfering RNA (siRNA) that down- regulates SMD into a cell comprising Staul and one or more selected genes comprising one or more nonsense-mutations, and b) assaying the amount of protein expressed of the gene being screened or mRNA present for the gene being screened, wherein a increase or decrease in the amount of protein or mRNA relative to the amount of protein or mRNA in the absence of the siRNA indicates a gene that is modulated by Staul activity.
  • the siRNA can be for example, Staul siRNA.
  • the methods can also be used to identify genes that are stabilized or destabilized by the down-regulation of Staul.
  • Staul can modulate mRNA levels independently of Upfl and SMD, dependent modulation can also occur.
  • methods of identifying genes modulated by the down-regulation of Upfl comprising a) transfecting a small interfering RNA (siRNA) that down-regulates SMD into a cell comprising Upfl and one or more selected genes comprising one or more nonsense-mutations, and b) assaying the amount of protein expressed of the gene being screened or mRNA present for the gene being screened, wherein a increase or decrease in the amount of protein or mRNA relative to the amount of protein or mRNA in the absence of the siRNA indicates a gene that is modulated by Upfl activity.
  • siRNA small interfering RNA
  • Also disclosed are method of identifying genes modulated by the down- regulation of SMD comprising a) transfecting a small interfering RNA (siRNA) that down- regulates SMD into a cell comprising UPfI, Staul, and one or more selected genes comprising one or more nonsense-mutations, and b) assaying the amount of protein expressed of the gene being screened or mRNA present for the gene being screened, wherein a increase or decrease in the amount of protein or mRNA relative to the amount of protein or mRNA in the absence of the siRNA indicates a gene that is modulated by SMD activity.
  • the siRNA can be, for example, Upfl siRNA or Staul siRNA.
  • RNA levels can be measured by microarray or RT-PCR.
  • Protein expression can be measured by Western blot. It is understood and herein contemplated that the disclosed methods of identifying genes can be used with any method of measuring schoolein expression or mRNA levels known to those of skill in the art.
  • Also disclosed are methods of modulating the level of an mRNA comprising administering to a subject an effective amount of a substance that modulates Staul, wherein the modulation Staul directly or indirectly modulates the mRNA. Also disclosed are methods of treating a disorder in a subject comprising administering to the subject a substance, wherein the substance modulates Staul wherein the modulation of Staul modulates that level of mRNA abundance of another gene.
  • the disclosed methods make use of substances administered to a subject to achieve a desired effect.
  • “substance” can refer to any agent, compound, functional nucleic acid, siRNA, peptide, protein, antibody, or small molecule.
  • one embodiment of the disclosed methods is a method of treating a subject with a substance, wherein the substance is Staul or a complex comprising Staul and Upfl.
  • Staul can be administered directly or by transferr with a subject with a Staul encoding nucleic acid or by administering to the subject a compound that modulates SMD.
  • a substance that modulates SMD wherein the substance is an antibody or fragment thereof that modulates SMD.
  • the antibody can be an antibody that binds Upfl or Staul and affects SMD activity.
  • specifically disclosed is antibody, wherein the antibody binds Staul.
  • an antibody, wherein the antibody binds Upfl .
  • a substance that modulates SMD can also be a nucleic acid. Therefore specifically disclosed and herein contemplated is a substance, wherein the substance is a vector comprising a nucleic acid that encodes an SMD modulator. Also disclosed is a vector comprising a nucleic acid that encodes an SMD modulator. Also disclosed is a cell comprising the disclosed vectors.
  • siRNA can bind any factor that modulates SMD.
  • an siRNA specifically disclosed is an siRNA, wherein the siRNA binds Upfl .
  • a substance comprising siRNA, wherein the siRNA binds Staul is also disclosed.
  • binds or “interacts” means to affect a substance either directly or indirectly through cooperative function, competitive inhibition, non ⁇ competitive inhibition, binding, or contacting the substance, a target molecule, an accessory molecule, or alternative portion of a system so as to effect at least one function.
  • the interaction can be stimulatory or cooperative in nature having an additive or synergistic effect.
  • the interaction can also result in the inhibition of a process or target molecule.
  • a system comprising the components for SMD with Staul.
  • methods of facilitating Staul -mediated mRNA decay comprising contacting with Upfl a system, wherein the system comprises the components for SMD.
  • methods of facilitating Staul -mediated mRNA decay comprising contacting with Staul and Upfl, a system comprising the components for SMD.
  • compositions can also be administered in vivo in a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject, along with the nucleic acid or vector, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
  • the carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.
  • compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, although topical intranasal administration or administration by inhalant is typically preferred.
  • topical intranasal administration means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector. The latter may be effective when a large number of animals is to be treated simultaneously.
  • Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism.
  • compositions can also be directly to any area of the respiratory system (e.g., lungs) via intubation.
  • the exact amount of the compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.
  • Parenteral administration of the composition is generally characterized by injection.
  • I ⁇ jectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions.
  • a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.
  • the materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands.
  • Vehicles such as "stealth” and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
  • the following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)).
  • receptors are involved in pathways of endocytosis, either constitutive or ligand induced.
  • receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes.
  • the internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).
  • compositions can be used therapeutically in combination with a pharmaceutically acceptable carrier.
  • Pharmaceutical carriers are known to those skilled in the art. These most typically would be standard carriers for administration of drugs to humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH. The compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.
  • Pharmaceutical compositions may include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice. Pharmaceutical compositions may also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like.
  • the pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be topically (including ophthalmically, vaginally, rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection.
  • the disclosed antibodies or other agents can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, or transdermally.
  • Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like.
  • Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
  • Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable.
  • compositions may potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid
  • organic acids such as formic acid, acetic acid, propionic acid, glyco
  • the dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms disorder are effected.
  • the dosage should not be so large as to cause adverse side effects, such as unwanted cross- reactions, anaphylactic reactions, and the like.
  • the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art.
  • the dosage can be adjusted by the individual physician in the event of any counterindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days.
  • the disclosed methods and compositions can also be used for example as tools to isolate and test new drug candidates for a variety of diseases. They can also be used for the continued isolation and study, for example, the cell cycle. There use as exogenous DNA delivery devices can be expanded for nearly any reason desired by those of skill in the art.
  • compositions and methods can be used to evaluate the expression of genes involved in SMD and in particular in or as a result of the pioneer round of translation. Specifically contemplated are methods wherein mRNA from a system comprising a nonsense-mutation is assayed using a micro array. Genes identified as having significantly (as determined by the manufacturers specifications of the array) increased or decreased expression are comodulators of SMD.
  • chips where at least one address is the sequences or part of the sequences set forth in any of the nucleic acid sequences disclosed herein. Also disclosed are chips where at least one address is the sequences or portion of sequences set forth in any of the peptide sequences disclosed herein.
  • chips where at least one address is a variant of the sequences or part of the sequences set forth in any of the nucleic acid sequences disclosed herein. Also disclosed are chips where at least one address is a variant of the sequences or portion of sequences set forth in any of the peptide sequences disclosed herein.
  • a substance that is able to modulate SMD is useful for the treatment and study of SMD related disorders.
  • methods of screening for a substance that modulates Staul -mediated mRNA decay (SMD) comprising incubating the substance to be screened with a Staul mRNA decay complex and assaying for a change in SMD.
  • An increase or decrease in SMD activity indicates a modulating substance.
  • SMD complex is any combination of one or more of the essential components of SMD.
  • screening methods wherein the complex comprises Upfl and Staul.
  • screening methods wherein the complex comprises one of Upfl and Staul. 81.
  • a method of screening for a substance that modulates Staul - mediated mRNA decay comprising incubating the substance to be screened with a stably transfected cell comprising a reporter gene with a nonsense-mutation and Staul, and assaying the amount of SMD in the cell, wherein a increase or decrease in the amount of mRNA relative to the amount of mRNA in the absence of the substance indicates a substance that modulates SMD activity.
  • SMD Staul - mediated mRNA decay
  • a substance that inhibits Staul -mediated mRNA decay comprising incubating the substance with Upfl and Staul forming a substance-Upfl -Staul mixture, and assaying the amount of Upfl -Staul complex present in the mixture, a decrease in the amount of Upfl-Staulcomplex relative to the amount of Upfl -Staul complex in the absence of the substance indicating the substance inhibits SMD.
  • SMD Staul -mediated mRNA decay
  • Also disclosed are method of screening for a substance that promotes Staul -mediated mRNA decay (SMD) comprising incubating the substance with Upfl and Staul forming a substance- Upfl -Staul mixture, and assaying the amount of Upfl-Staul complex present in the mixture, wherein a increase in the amount of Upfl-Staul complex relative to the amount of Upfl-Staul complex in the absence of the substance indicates that the substance promotes SMD.
  • SMD Staul -mediated mRNA decay
  • Staul has at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 2, or an SMD- active fragment thereof.
  • Upfl has at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 4, or an SMD- active fragment thereof.
  • SMD Staul- mediated mRNA decay
  • methods of screening for a substance that modulates Staul- mediated mRNA decay comprising, administering a substance to a system, wherein the system comprises the components for SMD activity, and assaying the effect of the substance on the amount of SMD activity in the system, a change in the amount of SMD activity present in the system compared to the amount of SMD activity in the system in the absence of the substance indicates the substance is a modulator.
  • SMD Staul-mediated mRNA decay
  • Also disclosed are methods of making a substance that modulates Staul -mediated mRNA decay (SMD) activity comprising admixing a substance identified by the disclosed screening methods with a pharmaceutically acceptable carrier.
  • the agents that can be used to modulate SMD can function by inhibiting the binding of Staul to its binding site.
  • a substance that competitively binds a Staul binding site can inhibit SMD. Therefore, specifically disclosed are methods of identifying an agent that binds a Staul binding site comprising contacting the agent to be screened with the Staul binding site. Also disclosed are methods of identifying an agent that binds a Staul binding site wherein the Staul binding site comprises SEQ ID NO: 56.
  • compositions can be used as targets for any combinatorial technique to identify molecules or macromolecular molecules that interact with the disclosed compositions in a desired way.
  • the nucleic acids, peptides, and related molecules disclosed herein can be used as targets for the combinatorial approaches.
  • the molecules identified and isolated when using the disclosed compositions, such as, Staul are also disclosed.
  • the products produced using the combinatorial or screening approaches that involve the disclosed compositions, such as, Staul are also considered herein disclosed.
  • Combinatorial chemistry includes but is not limited to all methods for isolating small molecules or macromolecules that are capable of binding either a small molecule or another macromolecule, typically in an iterative process.
  • Proteins, oligonucleotides, and sugars are examples of macromolecules.
  • oligonucleotide molecules with a given function, catalytic or ligand-binding can be isolated from a complex mixture of random oligonucleotides in what has been referred to as "in vitro genetics" (Szostak, TIBS 19:89, 1992).
  • Combinatorial techniques are particularly suited for defining binding interactions between molecules and for isolating molecules that have a specific binding activity, often called ap tamers when the macromolecules are nucleic acids.
  • RNA molecule is generated in which a puromycin molecule is covalently attached to the 3 '-end of the RNA molecule.
  • An in vitro translation of this modified RNA molecule causes the correct protein, encoded by the RNA to be translated.
  • the puromycin a peptidyl acceptor which cannot be extended, the growing peptide chain is attached to the puromycin which is attached to the RNA.
  • the protein molecule is attached to the genetic material that encodes it. Normal in vitro selection procedures can now be done to isolate functional peptides.
  • nucleic acid manipulation procedures are performed to amplify the nucleic acid that codes for the selected functional peptides.
  • new RNA is transcribed with puromycin at the 3 '-end, new peptide is translated and another functional round of selection is performed.
  • protein selection can be performed in an iterative manner just like nucleic acid selection techniques.
  • the peptide which is translated is controlled by the sequence of the RNA attached to the puromycin. This sequence can be anything from a random sequence engineered for optimum translation (i.e. no stop codons etc.) or it can be a degenerate sequence of a known RNA molecule to look for improved or altered function of a known peptide.
  • the two-hybrid system is a powerful molecular genetic technique for identifying new regulatory molecules, specific to the protein of interest (Fields and Song, Nature 340:245-6 (1989)). Cohen et al. modified this technology so that novel interactions between synthetic or engineered peptide sequences could be identified which bind a molecule of choice.
  • the benefit of this type of technology is that the selection is done in an intracellular environment.
  • the method utilizes a library of peptide molecules that attached to an acidic activation domain.
  • Combinatorial libraries can be made from a wide array of molecules using a number of different synthetic techniques. For example, libraries containing fused 2,4- pyrimidinediones (United States patent 6,025,371) dihydrobenzopyrans (United States Patent 6,017,768and 5,821,130), amide alcohols (United States Patent 5,976,894), hydroxy- amino acid amides (United States Patent 5,972,719) carbohydrates (United States patent 5,965,719), l,4-benzodiazepin-2,5-diones (United States patent 5,962,337), cyclics (United States patent 5,958,792), biaryl amino acid amides (United States patent 5,948,696), thiophenes (United States patent 5,942,387), tricyclic Tetrahydroquinolines (United States patent 5,925,527), benzofurans (United States patent 5,919,955), isoquinolines (Uni
  • combinatorial methods and libraries included traditional screening methods and libraries as well as methods and libraries used in interative processes.
  • the disclosed compositions can be used as targets for any molecular modeling technique to identify either the structure of the disclosed compositions or to identify potential or actual molecules, such as small molecules, which interact in a desired way with the disclosed compositions.
  • the nucleic acids, peptides, and related molecules disclosed herein can be used as targets in any molecular modeling program or approach.
  • Computer modeling technology allows visualization of the three-dimensional atomic structure of a selected molecule and the rational design of new compounds that will interact with the molecule.
  • the three-dimensional construct typically depends on data from x-ray crystallographic analyses or NMR imaging of the selected molecule.
  • the molecular dynamics require force field data.
  • the computer graphics systems enable prediction of how a new compound will link to the target molecule and allow experimental manipulation of the structures of the compound and target molecule to perfect binding specificity. Prediction of what the molecule-compound interaction will be when small changes are made in one or both requires molecular mechanics software and computationally intensive computers, usually coupled with user-friendly, menu-driven interfaces between the molecular design program and the user.
  • antibodies is used herein in a broad sense and includes both polyclonal and monoclonal antibodies. In addition to intact immunoglobulin molecules, also included in the term “antibodies” are fragments or polymers of those immunoglobulin molecules, and human or humanized versions of immunoglobulin molecules or fragments thereof, as described herein. The antibodies are tested for their desired activity using the in vitro assays described herein, or by analogous methods, after which their in vivo therapeutic and/or prophylactic activities are tested according to known clinical testing methods.
  • the term "monoclonal antibody” as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies within the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules.
  • the monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired antagonistic activity (See, U.S. Pat. No. 4,816,567 and Morrison et al., Proc. Natl. Acad. ScL USA, 81:6851-6855 (1984)).
  • Monoclonal antibodies of the invention can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975).
  • a hybridoma method a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
  • the lymphocytes may be immunized in vitro, e.g., using the Staul or Upfl described herein.
  • the monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567 (Cabilly et al.).
  • DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
  • Libraries of antibodies or active antibody fragments can also be generated and screened using phage display techniques, e.g., as described in U.S. Patent No. 5,804,440 and U.S. Patent No. 6,096,441.
  • In vitro methods are also suitable for preparing monovalent antibodies.
  • Digestion of antibodies to produce fragments thereof, particularly, Fab fragments can be Ii ⁇ Il ..; Ui S ⁇ :.:::» ,/iller; ⁇ admir& !';,:* H, J ...Ii IL.
  • digestion can be performed using papain. Examples of papain digestion are described in WO 94/29348 and U.S. Pat. No. 4,342,566.
  • Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields a fragment that has two antigen combining sites and is still capable of cross-linking antigen.
  • the fragments can also include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the antibody or antibody fragment is not significantly altered or impaired compared to the non-modified antibody or antibody fragment. These modifications can provide for some additional property, such as to remove/add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc.
  • the antibody or antibody fragment must possess a bioactive property, such as specific binding to its cognate antigen.
  • Functional or active regions of the antibody or antibody fragment may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide.
  • antibody or “antibodies” can also refer to a human antibody and/or a humanized antibody.
  • Many non-human antibodies e.g., those derived from mice, rats, or rabbits
  • are naturally antigenic in humans and thus can give rise to undesirable immune responses when administered to humans. Therefore, the use of human or humanized antibodies in the methods of the invention serves to lessen the chance that an antibody administered to a human will evoke an undesirable immune response.
  • the human antibodies of the invention can be prepared using any technique. Examples of techniques for human monoclonal antibody production include those described by Cole et al. ⁇ Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77, 1985) and by Boemer et al. (J. Immunol., 147(l):86-95, 1991). Human antibodies of the invention (and fragments thereof) can also be produced using phage display libraries (Hoogenboom et al., J. MoI. Biol, 227:381, 1991; Marks et al., J. MoI. Biol, 222:581, 1991).
  • the human antibodies of the invention can also be obtained from transgenic animals.
  • transgenic, mutant mice that are capable of producing a full j
  • a humanized form of a non-human antibody is a chimeric antibody or antibody chain (or a fragment thereof, such as an Fv, Fab, Fab', or other antigen-binding portion of an antibody) which contains a portion of an antigen binding site from a non-human (donor) antibody integrated into the framework of a human (recipient) antibody.
  • a humanized antibody residues from one or more complementarity determining regions (CDRs) of a recipient (human) antibody molecule are replaced by residues from one or more CDRs of a donor (non-human) antibody molecule that is known to have desired antigen binding characteristics (e.g., a certain level of specificity and affinity for the target antigen).
  • CDRs complementarity determining regions
  • donor non-human antibody molecule that is known to have desired antigen binding characteristics
  • Fv framework (FR) residues of the human antibody are replaced by corresponding non-human residues.
  • Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Humanized antibodies generally contain at least a portion of an antibody constant region (Fc), typically that of a human antibody (Jones et al., Nature, 321 :522-525 (1986), Reichmann et al., Nature, 332:323-327 (1988), and Presta, Curr. Opin. Struct. Biol, 2:593-596 (1992)).
  • Fc antibody constant region
  • humanized antibodies can be generated according to the methods of Winter and co-workers (Jones et al., Nature, 321:522-525 (1986), Riechmann et al., Nature, 332:323-327 (1988), Verhoeyen et al., Science, 239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
  • Methods that can be used to produce humanized antibodies are also described in U.S. Patent No. 4,816,567, U.S. Patent No. 5,565,332, U.S. Patent No. 5,721,367, U.S. Patent No. 5,837,243, U.S. Patent No. 5, 939,598, U.S. Patent No. 6,130,364, and U.S. Patent No. 6,180,377.
  • Antibodies of the invention are preferably administered to a subject in a pharmaceutically acceptable carrier as described above. Effective dosages and schedules for administering the antibodies may be determined empirically, and making such determinations is within the skill in the art. Those skilled in the art will understand that the dosage of antibodies that must be administered will vary depending on, for example, the subject that will receive the antibody, the route of administration, the particular type of antibody used and other drugs being administered. Guidance in selecting appropriate doses for antibodies is found in the literature on therapeutic uses of antibodies, e.g., Handbook of Monoclonal Antibodies, Ferrone et al., eds., Noges Publications, Park Ridge, NJ., (1985) ch. 22 and pp.
  • a typical daily dosage of the antibody used alone might range from about 1 ⁇ g/kg to up to 100 mg/kg of body weight or more per day, depending on the factors mentioned above.
  • the efficacy of the therapeutic antibody can be assessed in various ways well known to the skilled practitioner. Specifically, SMD can be assessed directly or indirectly as taught herein.
  • the nucleic acids of the present invention can be in the form of naked DNA or RNA, or the nucleic acids can be in a vector for delivering the nucleic acids to the cells, whereby the antibody-encoding DNA fragment is under the transcriptional regulation of a promoter, as would be well understood by one of ordinary skill in the art.
  • the vector can be a commercially available preparation, such as an adenovirus vector (Quantum Biotechnologies, Inc. (Laval, Quebec, Canada). Delivery of the nucleic acid or vector to cells can be via a variety of mechanisms. As one example, delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WI), as well as other liposomes developed according to procedures standard in the art.
  • LIPOFECTIN LIPOFECTAMINE
  • SUPERFECT Qiagen, Inc. Hilden, Germany
  • TRANSFECTAM Promega Biotec, Inc., Madison, WI
  • nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (ImaRx Pharmaceutical Corp., Arlington, AZ).
  • vector delivery can be via a viral system, such as a retroviral vector system which can package a recombinant retroviral genome (see e.g., Pastan et al., Proc. Natl. Acad. ScL U.S.A. 85:4486, 1988; Miller et al., MoI. Cell. Biol.
  • a viral system such as a retroviral vector system which can package a recombinant retroviral genome
  • the recombinant retrovirus can then be used to infect and thereby deliver to the infected cells nucleic acid encoding a broadly neutralizing antibody (or active fragment thereof) of the invention.
  • the exact method of introducing the altered nucleic acid into mammalian cells is, of course, not limited to the use of retroviral vectors. Other techniques are widely available for this procedure including the use of adenoviral vectors (Mitani et al., Hum. Gene Ther.
  • AAV adeno-associated viral
  • lentiviral vectors Non-deficiency virus vectors
  • pseudotyped retroviral vectors Agrawal et al., Exper. Hematol. 2A:12>Z-1A1, 1996.
  • Physical transduction techniques can also be used, such as liposome delivery and receptor- mediated and other endocytosis mechanisms (see, for example, Schwartzenberger et al., Blood 87:472-478, 1996). This invention can be used in conjunction with any of these or other commonly used gene transfer methods.
  • the dosage for administration of adenovirus to humans can range from about 10 7 to 10 9 plaque forming units (pfu) per injection but can be as high as 10 12 pfu per injection (Crystal, Hum. Gene Ther. 8:985-1001, 1997; Alvarez and Curiel, Hum. Gene Ther. 8:597-613, 1997).
  • a subject can receive a single injection, or, if additional injections are necessary, they can be repeated at six month intervals (or other appropriate time intervals, as determined by the skilled practitioner) for an indefinite period and/or until the efficacy of the treatment has been established.
  • Parenteral administration of the nucleic acid or vector of the present invention is generally characterized by injection.
  • Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for P Il I! / U :!3 U :::::» ⁇ • ⁇ êt:::!; :::::» Ul .1. ,1, solution of suspension in liquid prior to injection, or as emulsions.
  • a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.
  • suitable formulations and various routes of administration of therapeutic compounds see, e.g., Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995.
  • Staul can include proteins or nucleic acid sequences having at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ED NO: 1 or 2, or fragment thereof. Also disclosed are methods of the invention, wherein the Upfl or a nucleic acid encoding Upfl has at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 3 or 4, or fragment thereof.
  • SEQ ID NO: 1 sets forth a particular sequence of a Staul encoding nucleic acid
  • SEQ ID NO: 2 sets forth a particular sequence of the protein encoded by SEQ ID NO: 1, an Staul protein.
  • variants of these and other genes and proteins herein disclosed which have at least, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent homology to the stated sequence.
  • the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
  • nucleic acid based there are a variety of molecules disclosed herein that are nucleic acid based, including for example the nucleic acids that encode, for example Staul and Upfl, as well as various functional nucleic acids.
  • the disclosed nucleic acids are made up of, for example, nucleotides, nucleotide analogs, or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. It is understood that for example, when a vector is expressed in a cell, that the expressed mRNA will typically be made up of A, C, G, and U.
  • an antisense molecule is introduced into a cell or cell environment through for example exogenous delivery, it is advantagous that the antisense molecule be made up of nucleotide analogs that reduce the degradation of the antisense molecule in the cellular environment.
  • a nucleotide is a molecule that contains a base moiety, a sugar moiety and a phosphate moiety. Nucleotides can be linked together through their phosphate moieties and sugar moieties creating an internucleoside linkage.
  • the base moiety of a nucleotide can be adenin-9-yl (A), cytosin-1-yl (C), guanin-9-yl (G), uracil- 1-yl (U), and thymin-1-yl (T).
  • the sugar moiety of a nucleotide is a ribose or a deoxyribose.
  • the phosphate moiety of a nucleotide is pentavalent phosphate.
  • An non-limiting example of a nucleotide would be 3'- AMP (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate).
  • a nucleotide analog is a nucleotide which contains some type of modification to either the base, sugar, or phosphate moieties. Modifications to the base moiety would include natural and synthetic modifications of A, C, G, and T/U as well as different purine or pyrimidine bases, such as uracil-5-yl (.psi.), hypoxanthin-9-yl (T), and 2-aminoadenin-9-yl.
  • a modified base includes but is not limited to 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines
  • Nucleotide analogs can also include modifications of the sugar moiety. Modifications to the sugar moiety would include natural modifications of the ribose and deoxy ribose as well as synthetic modifications. Sugar modifications include but are not limited to the following modifications at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-0-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to Qo, alkyl or C 2 to Ci 0 alkenyl and alkynyl.
  • 2' sugar modiifcations also include but are not limited to -O[(CH 2 ) n O] m CH 3 , -O(CH 2 ) n OCH 3 , -O(CH 2 )n NH 2 , -O(CH 2 ) n CH 3 , -O(CH 2 ) n -ONH 2 , and -O(CH 2 ) n ON[(CH 2 ) n CH 3 )J 2 , where n and m are from 1 to about 10.
  • sugars Similar modifications may also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Modified sugars would also include those that contain modifications at the bridging ring oxygen, such as CH 2 and S. Nucleotide sugar analogs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • Modified phosphate moieties include but are not limited to those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl phosphonates including 3'-alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates.
  • these phosphate or modified phosphate linkage between two nucleotides can be through a 3'-5' linkage or a 2'-5' linkage, and the linkage can contain inverted polarity such as 3'-5' to 5'-3' or 2'-5' to 5'-2'.
  • Various salts, mixed salts and free acid forms are also included.
  • nucleotides containing modified phosphates include but are not limited to, 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference.
  • nucleotide analogs need only contain a single modification, but may also contain multiple modifications within one of the moieties or between different moieties.
  • Nucleotide substitutes are molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes are molecules that will recognize nucleic acids in a Watson- Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structure when interacting with the appropriate target nucleic acid.
  • PNA peptide nucleic acid
  • Nucleotide substitutes are nucleotides or nucleotide analogs that have had the phosphate moiety and/or sugar moieties replaced. Nucleotide substitutes do not contain a standard phosphorus atom. Substitutes for the phosphate can be for example, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH 2 component parts.
  • conjugates can be chemically linked to the nucleotide or nucleotide analogs.
  • conjugates include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem.
  • a thioether e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
  • Functional nucleic acids are nucleic acid molecules that have a specific function, such as binding a target molecule or catalyzing a specific reaction.
  • Functional nucleic acid molecules can be divided into the following categories, which are not meant to be limiting.
  • functional nucleic acids include antisense molecules, aptamers, ribozymes, triplex forming molecules, and external guide sequences.
  • the functional nucleic acid molecules can act as affectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules.
  • Antisense molecules are designed to interact with a target nucleic acid molecule through either canonical or non-canonical base pairing. The interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNAseH mediated RNA-DNA hybrid degradation. Alternatively the antisense molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. Numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule exist. Exemplary methods would be in vitro selection experiments and DNA modification studies using DMS and DEPC.
  • antisense molecules bind the target molecule with a dissociation constant (k d ) less than 10 "6 . It is more preferred that antisense molecules bind with a k d less than 10 "8 . It is also more preferred that the antisense molecules bind the target moelcule with a k d less than 10 "10 . It is S-" i,;; Ii / 11...11 :;» u a../ ,3 !b. u ,;. ». ,:; «.. also preferred that the antisense molecules bind the target molecule with a kd less than 10 " .
  • Aptamers are molecules that interact with a target molecule, preferably in a specific way.
  • aptamers are small nucleic acids ranging from 15-50 bases in length that fold into defined secondary and tertiary structures, such as stem-loops or G-quartets.
  • Aptamers can bind small molecules, such as ATP (United States patent 5,631,146) and theophiline (United States patent 5,580,737), as well as large molecules, such as reverse transcriptase (United States patent 5,786,462) and thrombin (United States patent 5,543,293).
  • Aptamers can bind very tightly with k d S from the target molecule of less than 10 "12 M.
  • the aptamers bind the target molecule with a k d less than 10 "6 . It is more preferred that the aptamers bind the target molecule with a k d less than 10 " . It is also more preferred that the aptamers bind the target molecule with a k ⁇ j less than 10 "10 . It is also preferred that the aptamers bind the target molecule with a k d less than 10 '12 . Aptamers can bind the target molecule with a very high degree of specificity.
  • aptamers have been isolated that have greater than a 10000 fold difference in binding affinities between the target molecule and another molecule that differ at only a single position on the molecule (United States patent 5,543,293). It is preferred that the aptamer have a k d with the target molecule at least 10 fold lower than the k d with a background binding molecule. It is more preferred that the aptamer have a k d with the target molecule at least 100 fold lower than the k d with a background binding molecule. It is more preferred that the aptamer have a k d with the target molecule at least 1000 fold lower than the k d with a background binding molecule.
  • the aptamer have a k d with the target molecule at least 10000 fold lower than the k d with a background binding molecule. It is preferred when doing the comparison for a polypeptide for example, that the background molecule be a different polypeptide.
  • Representative examples of how to make and use aptamers to bind a variety of different target molecules can be found in the following non-limiting list of United States patents: 5,476,766, 5,503,978, 5,631,146, 5,731,424 , 5,780,228, 5,792,613, F Il Il / IUi :'3 IUi :::::n ,, ⁇ ' ,.::;i; 1 Ia U ...Il L
  • siRNA referes to double-stranded RNAs that can induce sequence-specific post-transcriptional gene silencing, thereby decreasing or even inhibiting gene expression.
  • an siRNA triggers the specific degradation of homologous RNA molecules, such as mRNAs, within the region of sequence identity between both the siRNA and the target RNA.
  • mRNAs homologous RNA molecules
  • WO 02/44321 discloses siRNAs capable of sequence-specific degradation of target mRNAs when base-paired with 3' overhanging ends. The direction of dsRNA processing determines whether a sense or an antisense target RNA can be cleaved by the produced siRNA endonuclease complex.
  • siRNAs can be used to modulate transcription, for example, by silencing genes such as Staul and Upfl .
  • the effects of siRNAs have been demonstrated in cells from a variety of organisms, including Drosophila, C. elegans, insects, frogs, plants, fungi, mice and humans (for example, WO 02/44321; Gitlin et al., Nature 418:430-4, 2002; Caplen et al., Proc. Natl. Acad. Sci. 98:9742-9747, 2001 ; and Elbashir et al., Nature 411 :494-8, 2001).
  • siRNAs are directed against certain target genes to down regulate gene expression.
  • Staul or Upfl expression can be down regulated by specifically targeting the siRNA to Staul or Upfl.
  • Staul protein and Upfl protein As discussed herein there are numerous variants of the Staul protein and Upfl protein that are known and herein contemplated. In addition, to the known functional Staul and Upfl strain variants, there are derivatives of the Staul and Upfl proteins which also function in the disclosed methods and compositions. Protein variants and derivatives are well understood to those of skill in the art and in can involve amino acid sequence modifications. For example, amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional or deletional variants. Insertions include amino and/or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues.
  • Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues.
  • Immunogenic fusion protein derivatives such as those described in the examples, are made by fusing a polypeptide sufficiently large to confer immunogenicity to the target sequence by cross-linking in vitro or by recombinant cell culture transformed with DNA encoding the fusion. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any p il Il ,• ⁇ II...I' ::::i ⁇ i ⁇ ,.. ⁇ :::::n / constructive..:!.
  • Deletions or insertions preferably are made in adjacent pairs, i.e. a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. The mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional variants are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Tables 1 and 2 and are referred to as conservative substitutions.
  • Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain.
  • substitutions which in general are expected to produce the greatest changes in the protein properties will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g.
  • an electropositive side chain e.g., lysyl, arginyl, or histidyl
  • an electronegative residue e.g., glutamyl or aspartyl
  • the replacement of one amino acid residue with another that is biologically and/or chemically similar is known to those skilled in the art as a conservative H-" Ii Ii ,.• ⁇ 'i..,!' .::;:n u,..n :::;» . ⁇ ⁇ • .3 ,;::: ⁇ > u ,,, ⁇ ii,, substitution.
  • a conservative substitution would be replacing one hydrophobic residue for another, or one polar residue for another.
  • the substitutions include combinations such as, for example, GIy, Ala; VaI, He, Leu; Asp, GIu; Asn, GIn; Ser, Thr; Lys, Arg; and Phe, Tyr.
  • Such conservatively substituted variations of each explicitly disclosed sequence are included within the mosaic polypeptides provided herein.
  • Substitutional or deletional mutagenesis can be employed to insert sites for N-glycosylation (Asn-X-Thr/Ser) or O-glycosylation (Ser or Thr).
  • Deletions of cysteine or other labile residues also may be desirable.
  • Deletions or substitutions of potential proteolysis sites, e.g. Arg is accomplished for example by deleting one of the basic residues or substituting one by glutaminyl or histidyl residues.
  • Certain post-translational derivatizations are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the o- amino groups of lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco pp 79-86 [1983]), acetylation of the N-terminal amine and, in some instances, amidation of the C-terminal carboxyl.
  • variants and derivatives of the disclosed proteins herein are through defining the variants and derivatives in terms of homology/identity to specific known sequences.
  • SEQ ID NO: 2 sets forth a particular sequence of Staul
  • SEQ ID NO: 4 sets forth a particular sequence of a Upfl protein.
  • variants of these and other proteins herein disclosed which have at least, 70% or 75% or 80% or 85% or 90% or 95% homology to the stated sequence.
  • the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
  • Another way of calculating homology can be performed by published algorithms.
  • Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WT), or by inspection. 147.
  • the same types of homology can be obtained for nucleic acids by for example the algorithms disclosed in Zuker, M.
  • nucleic acids that can encode those protein sequences are also disclosed. This would include all degenerate sequences related to a specific protein sequence, i.e. all nucleic acids having a sequence that encodes one particular protein sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the protein sequences.
  • each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed protein sequence. For example, one of the many nucleic acid sequences that can encode the protein sequence set forth in SEQ ID NO:2 is set forth in SEQ ED NO:1.
  • nucleic acid sequences that encode this particular derivative of the Staul or Upfl are also disclosed including for example SEQ ID NO:1 and SEQ ID NO:3 which set forth two of the degenerate nucleic acid sequences that encode the particular polypeptide set forth in SEQ ID NO:2 and 4, respectively. It is also understood that while no amino acid sequence indicates what particular DNA sequence encodes that protein within an organism, where particular variants of a disclosed protein are disclosed herein, the known nucleic acid sequence that encodes that protein in the particular Staul from which that protein arises is also known and herein disclosed and described. 150. There are a number of compositions and methods which can be used to deliver nucleic acids to cells, either in vitro or in vivo.
  • nucleic acids can be delivered through a number II' 11 ' II,,,-,. Sf ' 1 I,..! 1 Il «...!' I 1 • ⁇ ' l> 1' "Mi ..11 II,. of direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationic liposomes.
  • direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationic liposomes.
  • Transfer vectors can be any nucleotide construction used to deliver genes into cells (e.g., a plasmid), or as part of a general strategy to deliver genes, e.g., as part of recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)).
  • plasmid or viral vectors are agents that transport the disclosed nucleic acids, such as Staul and Upfl into the cell without degradation and include a promoter yielding expression of the gene in the cells into which it is delivered.
  • Viral vectors are, for example, Adenovirus, Adeno-associated virus, Herpes virus, Vaccinia virus, Polio virus, ADDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviruses include Murine Maloney Leukemia virus, MMLV, and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector. However, they are not as useful in non-proliferating cells.
  • Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non-dividing cells.
  • Pox viral vectors are large and have several sites for inserting genes, they are thermostable and can be stored at room temperature.
  • a preferred embodiment is a viral vector which has been engineered so as to suppress the immune response of the host organism, elicited by the viral antigens.
  • Preferred vectors of this type will carry coding regions for Interleukin 8 or 10.
  • Viral vectors can have higher transaction (ability to introduce genes) abilities than chemical or physical methods to introduce genes into cells.
  • viral vectors II TM!!:,,,, i
  • ,.' %,. ⁇ > .,,..Il 1...I' mull ,.' I' Ii II...I1 mil,, . together11, contain, nonstructural early genes, structural late genes, an RNA polymerase ED transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome.
  • viruses typically have one or more of the early genes removed and a gene or gene/promotor cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material.
  • the necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.
  • a retrovirus is an animal virus belonging to the virus family of Retro viridae, including any types, subfamilies, genus, or tropisms.
  • Retroviral vectors in general, are described by Verma, LM. , Retroviral vectors for gene transfer. In Microbiology-1985, American Society for Microbiology, pp. 229-232, Washington, (1985), which is incorporated by reference herein. Examples of methods for using retroviral vectors for gene therapy are described in U.S. Patent Nos. 4,868,116 and 4,980,286; PCT applications WO 90/02806 and WO 89/07136; and Mulligan, (Science 260:926-932 (1993)); the teachings of which are incorporated herein by reference.
  • a retrovirus is essentially a package which has packed into it nucleic acid cargo.
  • the nucleic acid cargo carries with it a packaging signal, which ensures that the replicated daughter molecules will be efficiently packaged within the package coat, hi addition to the package signal, there are a number of molecules which are needed in cis, for the replication, and packaging of the replicated virus.
  • a retroviral genome contains the gag, pol, and env genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that it is to be transferred to the target cell.
  • Retrovirus vectors typically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome.
  • a packaging signal for incorporation into the package coat a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the
  • gag, pol, and env genes allow for about 8 kb of foreign sequence to be inserted into the viral genome, become reverse transcribed, and upon replication be packaged into a new retroviral particle.
  • II,, arri ⁇ iint of nucleic acid is sufficient for the delivery of a one to many genes depending on the size of each transcript. It is preferable to include either positive or negative selectable markers along with other genes in the insert.
  • a packaging cell line is a cell line which has been transfected or transformed with a retrovirus that contains the replication and packaging machinery, but lacks any packaging signal.
  • the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals.
  • viruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586 (1993); Kirshenbaum, J. Clin. Invest. 92:381-387 (1993); Roessler, J. Clin. Invest.
  • Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J. Virology 55:442-449 (1985); Seth, et al., J. Virol. 51 :650-655 (1984); Seth, et Et Ci- It ••' 1 U I 1 «...1 1' .' ....I' I' ! 1..J i ...Il II,, al., Mol. Cell. Biol. 4:1528-1533 (1984); Varga et al., J. Virology 65:6061-6070 (1991); Wickham et al., Cell 73:309-319 (1993)).
  • a viral vector can be one based on an adenovirus which has had the El gene removed and these virons are generated in a cell line such as the human 293 cell line. In another preferred embodiment both the El and E3 genes are removed from the adenovirus genome.
  • AAV adeno-associated virus
  • This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans.
  • AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site specific integration property are preferred.
  • An especially preferred embodiment of this type of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and/or a marker gene, such as the gene encoding the green fluorescent protein, GFP. 160.
  • the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell- specific expression operably linked to a heterologous gene.
  • ITRs inverted terminal repeats
  • Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or Bl 9 parvovirus.
  • the vectors of the present invention thus provide DNA molecules which are capable of integration into a mammalian chromosome without substantial toxicity.
  • the inserted genes in viral and retroviral usually contain promoters, and/or enhancers to help control the expression of the desired gene product.
  • a promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site.
  • a promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements.
  • HSV herpes simplex virus
  • EBV Epstein-Barr virus
  • Other useful systems include, for example, replicating and host-restricted non-replicating vaccinia virus vectors.
  • compositions can be delivered to the target cells in a variety of ways.
  • the compositions can be delivered through electroporation, or through lipofection, or through calcium phosphate precipitation.
  • the delivery mechanism chosen will depend in part on the type of cell targeted and whether the delivery is occurring for example in vivo or in vitro.
  • compositions can comprise, lipids such as liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes.
  • liposomes such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes.
  • Liposomes can further comprise proteins to facilitate targeting a particular cell, if desired.
  • Administration of a composition comprising a compound and a cationic liposome can be administered to the blood afferent to a target organ or inhaled into the respiratory tract to target cells of the respiratory tract.
  • liposomes see, e.g., Brigham et al. Am. J. Resp. Cell. MoI. Biol. 1 :95-100 (1989); Feigner et al. Proc. Natl. Acad. Sci USA 84:7413-7417 (1987); U.S. Pat. No.4,897,355.
  • the compound can be administered as a component of a microcapsule that can be targeted to specific cell types, such as macrophages, or where the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dosage. 168.
  • delivery of the compositions to cells can be via a variety of mechanisms.
  • delivery can be via a liposome, using commercially available liposome preparations such as UPOFECTTN " , LIPOFEcf AMINE (GIBCO-BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc.
  • nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (ImaRx Pharmaceutical Corp., Arlington, AZ).
  • the materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands.
  • the following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol,
  • Vehicles such as "stealth” and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
  • the following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)).
  • receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes.
  • the internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation.
  • Nucleic acids that are delivered to cells which are to be integrated into the host cell genome typically contain integration sequences. These sequences are often viral related sequences, particularly when viral based systems are used. These viral intergration systems can also be incorporated into nucleic acids which are to be delivered using a non- nucleic acid based system of deliver, such as a liposome, so that the nucleic acid contained in the delivery system can be come integrated into the host genome.
  • Other general techniques for integration into the host genome include, for example, systems designed to promote homologous recombination with the host genome. These systems typically rely on sequence flanking the nucleic acid to be expressed that has enough homology with a target sequence within the host cell genome that recombination between the vector nucleic acid and the target nucleic acid takes place, causing the delivered nucleic acid to be integrated into the host genome. These systems and the methods necessary to promote homologous recombination are known to those of skill in the art.
  • compositions can be administered in a pharmaceutically acceptable carrier and can be delivered to the subject's cells in vivo and/or ex vivo by a variety of mechanisms well known in the art (e.g., uptake of naked DNA, liposome fusion, intramuscular injection of DNA via a gene gun, endocytosis and the like).
  • cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art.
  • the compositions can be introduced into the cells via any gene transfer mechanism, such as, for example, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes.
  • the transduced cells can then be infused (e.g., in a pharmaceutically acceptable carrier) or homo topically transplanted back into the subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject.
  • the nucleic acids that are delivered to cells typically contain expression controlling systems.
  • the inserted genes in viral and retroviral systems usually contain promoters, and/or enhancers to help control the expression of the desired gene product.
  • a promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site.
  • a promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements. « ⁇ •' 11 Ii ./ u ..a ⁇ :,;» ,••' ,:J 3 U ,JI ii,
  • Preferred promoters controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g. beta actin promoter.
  • viruses such as polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g. beta actin promoter.
  • the early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication (Fiers et al., Nature, 273: 113 (1978)).
  • the immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindUl E restriction fragment (Greenway, PJ. et al., Gene 18: 355-360 (1982)).
  • promoters from the host cell or related species also are useful herein.
  • Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78: 993 (1981)) or 3' (Lusky, M.L., et al., MoI. Cell Bio, 3: 1108 (1983)) to the transcription unit. Furthermore, enhancers can be within an intron (Banerji, J.L. et al., Cell 33: 729 (1983)) as well as within the coding sequence itself (Osborne, T.F., et al., MoI. Cell Bio. 4: 1293 (1984)).
  • Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression of a gene. While many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, ⁇ -fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression.
  • Preferred examples are the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • the promotor and/or enhancer may be specifically activated either by light or specific chemical events which trigger their function.
  • Systems can be regulated by reagents such as tetracycline and dexamethasone.
  • reagents such as tetracycline and dexamethasone.
  • irradiation such as gamma irradiation, or alkylating chemotherapy drugs.
  • the promoter and/or enhancer region can act as a constitutive promoter and/or enhancer to maximize expression of the region of the transcription unit to be transcribed, hi certain constructs the promoter and/or enhancer region be active in all eukaryotic cell types, even if it is only expressed in a particular type of cell at a particular time.
  • a preferred promoter of this type is the CMV promoter (650 bases).
  • Other preferred promoters are SV40 promoters, cytomegalovirus (full length promoter), and retroviral vector LTF. 179. It has been shown that all specific regulatory elements can be cloned and used to construct expression vectors that are selectively expressed in specific cell types such as melanoma cells.
  • the glial fibrillary acetic protein (GFAP) promoter has been used to selectively express genes in cells of glial origin.
  • Expression vectors used in eukaryotic host cells may also contain sequences necessary for the termination of transcription that may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3' untranslated regions also include transcription termination sites. It is preferred that the transcription unit also contain a polyadenylation region. One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA.
  • the identification and use of polyadenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs.
  • the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of about 400 bases. It is also preferred that the transcribed units contain other standard sequences alone or in combination with the above sequences improve expression from, or stability of, the construct.
  • the viral vectors can include a nucleic acid sequence encoding a marker product. This marker product is used to determine if the gene has been delivered to the cell and once delivered is being expressed.
  • Preferred marker genes are the E. CoIi lacZ gene, which encodes ⁇ -galactosidase, and green fluorescent protein.
  • the marker may be a selectable marker.
  • suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin.
  • DHFR dihydrofolate reductase
  • thymidine kinase thymidine kinase
  • neomycin neomycin analog G418, hydromycin
  • puromycin puromycin.
  • selectable markers When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure.
  • These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media.
  • An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells that were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media.
  • the second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells that have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, (Southern P. and Berg, P.,_J. Molec. Appl. Genet. 1: 327 (1982)), mycophenolic acid, (Mulligan, R.C. and Berg, P. Science 209: 1422 (1980)) or hygromycin, (Sugden, B. et al., MoI. Cell. Biol. 5: 410-413 (1985)).
  • the three examples employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively.
  • Others include the neomycin analog G418 and puramycin.
  • kits that are drawn to reagents that can be used in practicing the methods disclosed herein.
  • the kits can include any reagent or combination of reagents discussed herein or that would be understood to be required or beneficial in the practice of the disclosed methods.
  • the kits could include primers to perform the amplification reactions discussed in certain embodiments of the methods, as well as the buffers and enzymes required to use the primers as intended.
  • the kits could include systems comprising the essential elements of SMD activity.
  • compositions disclosed herein and the compositions necessary to perform the disclosed methods can be made using any method known to those of skill in the art for that particular reagent or compound unless otherwise specifically noted.
  • the invention also provides substances made by methods of the invention. 187.
  • a modulator of Staul -mediated mRNA decay comprising a) administering a substance to a system, wherein the system comprises SMD activity, b) assaying the effect of the substance on the amount of SMD activity in the system, c) selecting a substance which causes a change in the amount of SMD activity present in the system compared to the amount of SMD activity in the system in the absence of substance, and d) synthesizing the substance.
  • SMD Staul -mediated mRNA decay
  • Staul-HA 3 also co-immunopurifled with Barentsz and CBP80, although in an RNase A-sensitive manner, but did not co-immunopurify with eIF4E or a non ⁇ specific control, Vimentin, which is a component of intermediate filaments ( Figure ID, upper).
  • the co-IP of Staul with Barentsz had previously been shown to be RNase A-sensitive (Macchi et al., 2003).
  • Example 2 Down-Regulating Cellular Staul Has No Detectable Consequence to the FJC -Dependent NMD of Gl or GPxI mRNA 194.
  • Staul functions in EJC-dependent NMD
  • the effect of down-regulating the level of cellular Staul on the NMD of mRNAs for /3-globin (Gl) and glutathione peroxidase (GPx)I was examined using small interfering (si)RNAs.
  • si small interfering
  • HeLa cells were transfected with Staul siRNA, UpDX siRNA or a non-specific "Control" siRNA and, two days later, with three plasmids: (i) the pmCMV-Gl test plasmid that was either nonsense-free (Norm) or nonsense- containing (39Ter), (ii) the pmCMV-GPxl test plasmid, either Norm or 46Ter, and (iii) the phCMV-MUP reference plasmid. 195.
  • the level of each Staul isoform was down-regulated to 28% of normal, where normal is defined as the level in the presence of the non-specific Control siRNA, and the level of UpOX was down-regulated to 24% of normal ( Figure 2A).
  • Example 3 Tethered Staul Reduces mRNA Abundance in a Mechanism that Involves Upfl and an Upstream Nonsense Codon but Not Upf2 or UpOX 196.
  • Staul could elicit a type of EJC-independent mRNA decay based on the finding that it binds to Upfl .
  • fusions of each Upf protein and the bacteriophage MS2 coat protein were shown to reduce mRNA abundance when tethered to a series of MS2 coat protein binding sites that were located more than 50 nts downstream of the normal termination codon (Lykke- Andersen et al., 2000). Since the reduced mRNA abundance was dependent on the normal termination codon, it was attributed to NMD.
  • MS2-Upfl and MS2-Upf2 were also of no consequence to the level of FLuc mRNA that lacked the MS2bs but elicited a 2-to-5-fold reduction in the level of FLuc mRNA that harbored the MS2bs ( Figure 3B, right).
  • tethering an unrelated protein, HA-eIF4Ai ⁇ , or expressing Stau-HA 3 or myc-Upfl that could not be tethered failed to affect the abundance of FLuc-MS2bs mRNA ( Figure 8). 199.
  • the other combination consisted of the pcFLuc-MS2bs test plasmid, the pRLuc reference plasmid, and an effector plasmid that produces MS2-HA, MS2-HA-Staul, MS2, MS2-Upfl, MS2-Upf2 or MS2-Upf3.
  • ADP-ribosylation factor (Arf)l mRNA which encodes a Ras-related G protein that regulates membrane traffic and organelle structure (Donaldson and Jackson, 2000), was identified as a natural ligand of Staul using two methods.
  • Staul -containing RNPs were immunopurified from human 293 cells that transiently expressed either Staul -HA 3 or, as a control for IP specificity, Staul -6xHis using anti-HA antibody ( Figure 7A).
  • PSMD 12 NM_002816 proteasome (prosome macropain) 26S subunit non-ATPase 12
  • PRKAR2A BF246917 protein kinase cAMP-dependent regulatory type II alpha
  • PAICS AA902652 phosphoribosylaminoimidazole carboxylase phosphoribosylaminoimidazole succinocarboxamide synthetase
  • 293 cells were transiently transfected with a plasmid that expressed Staul -HA3 or, to control for nonspecific IP, Staul -6xHis.
  • Biotin-labeled cRNA was synthesized from RNA that had been immunopurif ⁇ ed using anti-HA antibody and hybridized to Affymetrix U133A microarrays. Changes of at least 2.5-fold were scored as Staul -interacting transcripts.
  • plasmids consisted of: (i) a pSport-Arfl or pSport-Arfl ⁇ (3'UTR) test plasmid, the latter of which lacks all nucleotides that reside downstream of the normal termination codon ( Figure 8A), and (ii) the phCMV-MUP reference plasmid.
  • the HeLa-cell Arfl gene contains four introns (Lee et al., 1992; Figure 8A) so that the resulting newly synthesized mRNA would harbor four EJCs.
  • Arfl cDNA within either pSport plasmid lacks all introns, the resulting newly synthesized mRNA would lack EJCs.
  • Cos cells were transiently transfected with the Staul -HA 3 expression vector, the pSport-Arfl or pSport- Arfl ⁇ (3 'UTR) test plasmid, and the phCMV-MUP reference plasmid. Notably, cells were transfected with only half as much pSport-Arfl ⁇ (3'UTR) as pSport-Arfl in order to compensate for the difference in the level of product mRNA. Cell extract was prepared two days later, and a fraction was immunopurified using anti-HA antibody or, as a control for nonspecific IP, rat (r) IgG.
  • the transcripts that we reported in Table 3 can be weak targets for decay.
  • the transcripts can be up-regulated by Staul binding.
  • microarray analysis was performed (Tables 4 and 5).
  • G protein 205184_at guanine nucleotide binding protein (G protein) gamma 4
  • MDR/TAP 203192_at ATP-binding cassette sub-family B
  • SMD can be utilized by mammalian cells to regulate the abundance of hundreds of cellular transcripts and, hence, expression of the encoded proteins.
  • Transcripts identified to be regulated by SMD have a broad range of cellular functions that include signal transduction, cell proliferation, cell metabolism, immune response, DNA repair, and transcriptional regulation. Therefore, SMD can play a key role in establishing and maintaining cellular homeostasis.
  • SMD naturally targets transcripts encoding the IL- 7 receptor (IL- 7R), c-JUN, and SERPINEl (also called PAIl). Down regulating cellular Staufenl or Upfl but not Upf2 increased the abundance of each cellular mRNA. Notably, the abundance of many transcripts was down-regulated in the cells depleted of Staul.
  • Example 5 A Minimized Staul Binding Site Resides > 67 Nucleotides Downstream of the Normal Termination Codon of Arfl mRNA and Mediates mRNA Decay 210.
  • a series of deletions was generated from the distal-most nucleotide of the Arfl 3' UTR within pSport- Arfl ( Figure 10A).
  • Each of the resulting test plasmids was transiently introduced into 293 cells together with the Stau-HA 3 expression vector. Cell extract was prepared two days later, and a fraction was immunopurified using anti-HA antibody. Western blotting of immunopurified protein revealed relative IP efficiencies ( Figure 1OB, upper).
  • Staul also binds within the 3' UTR downstream of nucleotide 919 or upstream of nucleotide 688
  • the finding that inserting the Staul binding site (SBS, nucleotides 622-924) within the 3' UTR of the heterologous FLuc mRNA reduced FLuc mRNA abundance ( Figure 11) corroborates that Staul indeed binds between nucleotides 689 and 919. It was concluded that Staul binds to the 3' UTR of Arfl mRNA at a position that is predicted to reduce mRNA abundance.
  • Down-regulating mUpfl relative to normal also increased the half-life of nucleus- associated fos-Arfl-SBS mRNA (ie., abrogated the nucleus associated NMD), whereas down-regulating mUpf2 or mUpOX relative to normal did not.
  • down- regulating mStaul and mUpfl also increased the half-life of a heterologous mRNA (fos- FLuc-Arfl) harboring the SBS, but had no effect on fos-FLuc-Arfl without the SBS.
  • Staul binds to an ⁇ 230-nt region of the 3' UTR of Arfl mRNA so as to recruit Upfl independently of other Upf proteins and, as a consequence, reduce Arfl mRNA half-life ( Figures 7, 8, 9, 10, 11). 213. It was found that Staul plays no detectable role in the EJC-dependent NMD of
  • Hrb27C inhibits the removal by nuclear splicing of intron 3 from P-element encoded transposase pre-mRNA in Drosophila (Hammond et al., 1997; Siebel et al., 1994) and also binds directly to Drosophila gurken mRNA so as to regulate gurken mRNA cytoplasmic localization and translation (Goodrich et al., 2004).
  • Barentsz and Y14 are essential for EJC-dependent NMD in mammalian cells (Ferraiuolo et al., 2004; Gehring et al., 2003; Palacios et al., 2004; Shibuya et al., 2004) and also function in localizing Drosophila oskar mRNA to the posterior pole of the oocyte (Hachet and Ephrussi, 2001 ; Hachet and Ephrussi, 2004; Mohr et al., 2001 ; van Eeden et al., 2001).
  • mammalian Staul which is a component of RNPs that are transported and localized within dendrites of mature hippocampal neurons (Kiebler et al., 1999; Kohrmann et al., 1999), is involved in a new type of EJC-independent NMD.
  • Staul In mammals, Staul is ubiquitously expressed, but its level of expression varies among tissues (Wickham et al., 1999; Marion et al., 1999; Monshausen et al., 2001). For example, it is highly expressed in brain, heart, liver, testis, pancreas and placenta, whereas it is generally expressed to lesser but varying degrees in other tissues. Additionally, differential splicing generates several isoforms that are not uniformly expressed among tissues. Staul also contains several putative phosphorylation sites that could regulate function, and Staul has been shown to interact with protein phosphate 1 (Monshausen et al., 2002).
  • Upfl phosphorylation influences Upfl function in NMD (Pal et al., 2001 ; Ohnishi et al., 2003, it is possible that Upfl phosphorylation also regulates its function or the function of Staul in SMD. Therefore, Staul functions can be modulated in different tissues according to the level of expression and the nature of each expressed isoform and, possibly, the degree of Upfl or Staul phosphorylation.
  • Staul is linked to mRNA transport in neurons (Kohrmann et al., 1999) and to HIV- 1 replication (Mouland et al., 2000). Its association with polysomes (Marion et al., 1999; Luo et al., 2002) suggests a role in the translational regulation Staul-bound mRNAs.
  • Staul is a component of large RNA granules (Krishevsky and Kosik, 2001; Kanai et al., 2004; Mallardo et al., 2003; Villace et al., 2004, Brendel et al., 2004; Ohashi et al., 2002) that contain ribosomes, mRNA and several other proteins. It is shown herein that several Staul-bound mRNAs encode key regulatory enzymes that control cell metabolism, proteins involved in organelle trafficking, cell division or the cell cycle, or both. Arfl is involved in protein trafficking, and it may modulate vesicle budding and uncoating within the Golgi apparatus.
  • PAICS controls steps 6 and 7 of the purine nucleotide biosynthetic pathway.
  • the level of PAICS mRNA varies with the cell cycle in synchronized rat 3Yl fibroblasts (Iwahana et al., 1995). This variation can be controlled by SMD.
  • GNE is a regulatory enzyme that regulates the first step in the biosynthesis of N-acetylneuraminic acid (NeuAc), which is a precursor to sialic acids (Hinderlich et al., 1997). Modification of cell surface molecules with sialic acid is essential for many biological processes, such as cell adhesion and signal transduction. Modulation of sialylation is involved in the tumorigenicity and metastatic behavior of malignant cells.
  • pGEX-UPFl was constructed by ligating the Notl/Klenow-filled EcoRI fragment from pCMV-Myc-UPFl that contains UPFl cDNA to the Notl/Klenow-filled BamHI fragment from pGEX-6p- 1 +NdeI (a gift from J. Wedekind).
  • pGEX-Staul was constructed by ligating the BamHI/NotI fragment from pGEX-6p-l+NdeI to a PCR-amplified fragment that had been digested with BgIH and Notl.
  • the PCR fragment was amplified using the human Staul cDNA expression vector phStaul 55 - HA 3 (Luo et al., 2002) and two primers: 5 '-
  • pRSET B-Staul was constructed by ligating the Klenow-filled Ndel/NotI fragment from pGEX-Staul to the Klenow-filled BgIH fragment from pRSET B (Invitrogen).
  • MS2 coat protein-encoding fragment was amplified using pET-MS2 (Coller et al., 1998) and two primers: 5'- CGCTACTAGCTAGCCGCCATGGCTTCTAACTTTACTCAGTTCGTTC-S ' (SEQ E) NO. 7) (sense) and 5'-
  • ATAAGAATGCGGCCGCCTAGGATCCAGCGTAGTCTGGAACGTCGTATGGGTAGA TGCCGGAGTTTGCTGCGATTG-3' (SEQ ID NO. 8) (antisense), where underlined and bold nucleotides specify the Nhel or Notl site and HA tag sequence, respectively.
  • the Staul cDNA-containing sequence was amplified using phStaul 55 -HA 3 and two primers: 5'- GAAGATCTAGAATGAAACTTGGAAAAAAACCAATGTATAAG-S' (SEQ ED NO. 5) (sense) and 5'- ATAAGAATGCGGCCGCTCAGCACCTCCCACACACAGACATTGGTCC-S' (SEQ ID NO. 6) (antisense), where underlined nucleotides specify the Bgi ⁇ or Notl site, respectively.
  • pMS2-HA that harbors an N-terminal MS2 coat protein followed by an HA tag
  • pCI-neo that had been digested with Nhel and Notl was ligated to the same PCR- amplified fragment that contains the MS2 coat protein-encoding sequence and was similarly digested with Nhel and Notl (see above).
  • pcFLuc-MS2bs which contains eight tandem repeats of the MS2 coat protein- binding sites within the 3'UTR of firefly luciferase (FLuc) cDNA, was generated from pq8- 8bs (Lykke- Andersen et al., 2000) by replacing /3-globin cDNA with FLuc cDNA.
  • pcFLuc which lacks the MS2 coat protein-binding sites, was generated from pcFLuc-8bs by cleaving with PspOMI and Notl followed by self-ligation after generating blunt ends using Klenow (New England Biolabs).
  • pRLuc which encodes renilla luciferase (RLuc) was generated from p21uc (Grentzmann et al., 1998) by precisely deleting FLuc cDNA.
  • AGGTCTAGATCGGAGCAGCAGCCTCTGAGGTGT-3' (SEQ ID NO. 9) (sense) and 5'- GGCTCGAGCTAATAGCTATAATTACAGTGCTTGTTTGTCGAAATG-S' (SEQ ID NO. 10) (antisense), where underlined nucleotides specify the Xbal and Xhol site, respectively.
  • the PCR product was digested with Xbal and Xhol and ligated to pSport ⁇ -gal (Invitrogen) that had been digested with Xbal and Xhol.
  • the resulting plasmid, pSport ⁇ -gal- Arfl was digested with Notl, purified, and self-ligated to generate pSport- Arfl .
  • pSport-Arfl ⁇ (3'UTR) pSport- Arfl was digested with Kpnl and Xhol. The resulting vector-containing fragment was ligated to a PCR-amplified fragment that contains the Arfl open translational reading frame and had been digested with Kpnl and Xhol. PCR was carried out using pSport- Arfl and two primers: 5 '-
  • GCTATTTAGGTGACACTATAGAAGGTAC-S' (SEQ ID NO. 11) (sense) and 5'- CCGCTCGAGTTCACTTCTGGTTCCGGAGCTGATTG-3' (SEQ ID NO. 12) (antisense), where underlined nucleotides specify the Hindi ⁇ site.
  • Deletions within the 3' UTR of Arfl cDNA were generated using pSport-Arfl, 5'-CATTTCGACAAACAAGCACTGTAATTATAGCTATTAG-S' (SEQ ED NO. 13) (sense) and one of the following antisense primers: 5'-CCAAGGACAAGCGAGTTGCG- 3'( ⁇ 1229-1794) (SEQ ID NO.
  • pfos- Arfl -SBS was digested with Ncol and EcoRI and ligated to a PCR-amplified fragment that contains Arfl -SBS cDNA.
  • PCR was carried out using pSport-Arfl and two primers : 5'- ACAACCATGGGGAACATCTTCGCCAACCTCTTC-3' (sense) (SEQ E) NO. 19) and 5'- CCGGAATTCTGGGCCTACATCCCCTCTCAGCACTGAAC-S ' (SEQ E) NO. 20) (antisense), where underlined nucleotides specify the Ncol or EcoRI site.
  • pMS2-HA-eE T 4AE[ which encodes N-terminal oligomerization- defective MS2 coat protein followed successively by an HA tag and full-length human eE ⁇ AEI cDNA
  • pCI-neo that had been digested with Nhel and Notl was ligated to two fragments: the Nhel/BamHI fragment from pMS2-HA-Staul that contains the MS2 coat protein-encoding sequence, and a PCR-amplified fragment that contains human eIF4A ⁇ i cDNA and had been digested with BamHI and Notl.
  • eD?4AIE was amplified using pcDNA3- HA-eIF4AE[ (Chiu et al., 2004) and two primers: 5'- CGCGGATCCATGGCGACCACGGCCACGATGGCGACC-3' (SEQ E) NO. 21) (sense) and 5 '- AT AAGAATGCGGCCGCTC AGAT AAGATC AGC AACGTTC ATCGG-3 ' (SEQ E) NO. 22) (antisense), where underlined nucleotides specify the BamHI or Notl site, respectively.
  • pcFLuc(UAA-»CAA)-MS2bs which lacks a termination codon upstream of the MS2 binding sites
  • pcFLuc-8bs that had been digested with Notl and EcoRV was ligated to a PCR-amplified fragment that contains C-terminus of FLuc in which the UAA codon was converted to a CAA codon and had been digested with Notl and EcoRV.
  • the PCR reactions were performed using pR/HCV/F (Kim et al., 2003) and two primers: 5'- TTGACCGCTTGAAGTCTTTAATTAAATAC-3' (SEQ E) NO.
  • pcFLuc-8bs were digested with Xbal and ligated to a Xbal-digested PCR-amplified fragment that had been generated using pSport-Arfl and two primers: 5'-
  • GCTCTAGAGGGCCCGAGGGGAACAGCTGGGCTGGCGACTGG-S' (antisense) for pcFLuc-Arfl No SBS.
  • Underlined nucleotides specify Xbal sites.
  • pfos-Arfl-SBS or pfos-Arfl-No SBS was digested with Ncol and EcoRI and ligated to a PCR-amplified fragment that contains Arfl-SBS cDNA or Arfl-No SBS cDNA.
  • PCR was carried out using pSport-Arfl and two primers : 5 '-AC AACCATGGGGAACATCTTCGCCAACCTCTTC-3 ' (sense) (SEQ ID NO: 57) and 5'-CCGGAATTCTGGGCCTACATCCCCTCTCAGCACTGAAC- 3' (antisense) (SEQ ID NO: 58) for Arfl-SBS cDNA or 5'- CCGGAATTCTC ACTTCTGGTTCCGGAGCTGATTGGAC-3' (SEQ ID NO: 59) (antisense) for Arfl-No SBS cDNA, where underlined nucleotides specify the Ncol or EcoRI site.
  • pSport-PAICS was purchased from ATCC (catalog # MGC-5024, NCBI Accession # BCOl 0273).
  • pSport-PAICS ⁇ (3'UTR) was generated using pSpoit-PAICS and two primers: 5'-CCAAGCTTACGCGTACCCAGCTTTC-S' (SEQ ID NO. 29) (sense) and 5'- CCCCTAAAAAATTCAATGGCATTCTTTC-S' (SEQ ID NO. 30) (antisense).
  • PCR amplification was carried out using PfU Ultra (Stratagene). The PCR product was incubated with Dpnl to digest the methylated template DNA, phosphorylated at the 5' ends using T4 polynucleotide kinase (Fermentas), and circularized by ligation.
  • pCDNA3-RSV-CK2A2 was constructed by inserting a BamHI-XhoI fragment from pOTB7-CK2A2 (ATCC catalog # MGC-10397, NCBI Accession # BC008812 ) into pCDNA3-RSV that had been digested using BamHI and Xhol.
  • Example 7 Yeast Two-Hybrid Analysis 238. Proteins that interact with human Upfl were identified using the CytoTrap Two- Hybrid System (Stratagene). The yeast strain cdc25H was transformed with pSos-Upfl and the pMyr library of HeLa-cell cDNAs (Stratagene). Transformants were processed following manufacturer instructions.
  • Example 8 siRNA-Mediated Down-Regulation of Human Upfl, Upf2, Upf3X or Staul
  • HeLa cells (2 x 10 6 ) were grown in DMEM medium (Gibco-BRL) containing 10% fetal bovine serum (Gibco-BRL) in 60-mm dishes and transiently transfected with 100 nM of in vitro-synthesized small interfering (si)RNA (Xeragon or Dharmacon) using Oligofectamine (Invitrogen).
  • Upfl, Upf2, UpBX or Staul were down-regulated using, respectively, 5'-r(GAUGCAGUUCCGCUCCAUU)d(TT)-3' (SEQ ID NO. 31), 5'- r(GGCUUUUGUCCCAGCCAUC)d(TT)-3' (SEQ ID NO.
  • Staul (A) siRNA consisted of 5 1 -r(GUUUGAGAUUGCACUUAAA)d(TT)-3 I (SEQ ID NO. 35), and Upfl (A) siRNA consisted of 5'- r(AACGUUUGCCGUGGAUGAG)d(TT)-3' (SEQ ID NO. 36).
  • HeLa cells (2 x 10 6 ) were transiently transfected using Lipofectamine Plus (Invitrogen) with 0.3 ⁇ g of the reporter plasmid pcFLuc or pcFLuc-MS2bs, 0.02 ⁇ g of the reference plasmid pRLuc, and 5 ⁇ g of one of the following effector plasmids: pMS2-HA, pMS2-HA-Staul, pcNMS2, pcNMS2-U ⁇ fl, pcNMS2-Upf2 or pcNMS2-Upf3. Cells were harvested two days later. Protein was purified from half of the cells using passive lysis buffer (Promega), and total RNA was purified from the other half using TRIzol Reagent (Invitrogen).
  • Ltk " cells (4 X lO 6 ) were transiently transfected with 200 nM of Control siRNA or 100 nM each of two different mouse Staul siRNAs [5'- r(CAACUGUACUACCUUUCCA)d(TT)-3' (SEQ ID NO. 37) or 5' r(AACGGUAACUGCCAUGAUA)d(TT)-3' (SEQ ID NO. 38)].
  • Cos-7 or HeLa cells were cultured as described above but in 150-mm dishes. Transfections and immunopurifications (IPs) were performed as described (Chiu et al., 2004;
  • Protein was electrophoresed in SDS-polyacrylamide, transferred to Hybond ECL nitrocellulose (Amersham), and probed with antibodies that recognize FLAG (Sigma), GST (Qiagen), HA (Roche), Upfl (Lykke-Andersen et al., 2000), Upf2 (Serin et al., 2001),
  • RNAs were quantitated using RT-PCR as described (Sun et al., 1998).
  • FLuc, ⁇ -G ⁇ and MUP mRNAs were amplified as described previously (Chiu et al., 2004; Lejeune et al., 2003), and RLuc mRNA was amplified using the primers 5 - ATGACTTCGAAAGTTTATG-S ' (SEQ ID NO. 39) (sense) and 5'- TTCAGATTTGATC AACGC A-3' (SEQ ID NO. 40) (antisense).
  • Cellular Arfl mRNA or Arfl mRNA that derived from a pSport vector was amplified using the primers 5 - AACCAACGCCTGGCTCGG-3' (SEQ ID NO. 41) (sense) and 5'-
  • RT-PCR products were electrophoresed in 5% polyacrylamide and quantitated by Phosphorlmaging (Molecular Dynamics).
  • RT-PCR analysis of Arfl mRNA was performed using One Step RT-PCR (Qiagen), the primer pair 5'-GCTATTTAGGTGACACTATAGAAGGTAC-S' (SEQ ID NO. 45) (sense) and 5'- CTCTGTC ATTGCTGTCC ACC ACG-3' (SEQ ID NO. 46) (antisense), and ethidium bromide staining.
  • FLuc-MS2bs mRNA or FLuc(UAA ⁇ CAA)-MS2bs mRNA was amplified using the primers 5'-CAACACCCCAACATCTTCG-S' (SEQ ID NO. 47) (sense) and 5'- CTTTCCGCCCTTCTTGGCC-3' (SEQ ID NO. 48) (antisense).
  • Gl(U AA- »U AC)-MS2bs was amplified using the primers 5 - AATACGACTCACTATAGGGA-3 ' (SEQ ID NO. 49) (sense), which anneals to the T7 promoter, and 5 '-GATACTTGTGGGCCAGGGCA-3 ' (SEQ ID NO. 50) (antisense).
  • FLuc- Arfl mRNA was amplified using the same T7 promoter primer (sense) and 5 - TCTAGAGGATAGAATGGCG-3 ' (SEQ ID NO. 51) (antisense).
  • PAICS mRNA was amplified using the primers 5'-AGCAGGCTGGTACCGGTCCG-S' (SEQ ID NO. 52) (sense) and 5 '-ACC AATGTTCAGTACCTCAG-3 ' (SEQ ID NO. 53) (antisense).
  • Example 14 Far-Western Blotting
  • FLAG-Upfl was purified from HeLa cells that had been stably transfected with pCI-neo-FLAG-UPFl as previously described (Pal et al., 2001).
  • GST-Upfl was purified from E. coli using Bulk GST Purification Modules (Amersham). 252. Lysates of E. coli that were or were not induced to express ⁇ xHis-Staul or GST-
  • HeLa-cell RNA from three independently performed transfections in which the level of cellular Staul was depleted to as little as 4% of normal (where normal is defined as the level in the presence of Control siRNA), was separately hybridized to microarrays. Sequences from 18,279 HeLa-cell transcripts were analyzed, representing 34% of the array probe sets, in all three hybridization experiments. It was observed that 124 transcripts, or 1.1 % of the HeLa-cell transcriptome that was analyzed, were upregulated at least 2-fold in all three transfections (Table 6).
  • Table 6 Transcripts upregulated in human cells depleted of Staul in three independently performed microarray analyses
  • I factor (complement) 8.78 IF 1555564_a_at fibronectin 1 7.98 FN1 216442_x_at interferon-induced protein with tetratricopeptide repeats 2 7.51 IFIT2 226757_at
  • FLJ20378 [Homo sapiens] 4.46 235629_at insulin-like growth factor binding protein 5 4.30 IGFBP5 211959_at integrin beta 3 (platelet glycoprotein MIa antigen CD61) 4.18 ITGB3 204627_s_at interferon-induced protein with tetratricopeptide repeats 4 4.13 IFIT4 229450_at alpha-actinin-2-associated LIM protein 3.97 ALP 210170_at transgelin 3.94 TAGLN 205547_s_at
  • Homo sapiens cDNA FLJ20914 fis clone ADSE00646 3.76 234597_at thrombospondin 1 3.73 THBS1 201108_s_at protein tyrosine phosphatase receptor type O 3.62 PTPRO 1554199_at cyclin-E binding protein 1 3.60 CEB1 219863_at
  • Homo sapiens transcribed sequences 2.61 229242_at v-jun sarcoma virus 17 oncogene homolog (avian) 2.58 JUN 201466_s_at integrin alpha 4 (antigen CD49D alpha 4 subunit of VLA-4 receptor) 2.56 ITGA4 205885_s_at
  • Homo sapiens cDNA FLJ46457 fis clone THYMU3020856 2.44 225007_at thymosin beta identified in neuroblastoma cells 2.44 TMSNB 205347_s_at prostaglandin E receptor 4 (subtype EP4) 2.42 PTGER4 204897_at chromosome 14 open reading frame 128 2.41 C14orf128 228889_at ganglioside-induced differentiation-associated protein 1 2.41 GDAP1 226269_at zinc finger protein 36 C3H type-like 1 2.38 ZFP36L1 211965_at uracil-DNA glycosylase 2.37 UNG 202330_s_at hypothetical protein MGC27277 2.37 MGC27277 242283_at
  • CDK5 regulatory subunit associated protein 1-like 1 2.34 CDKAL1 214877_at
  • cytokine receptor-like factor 2 2.32 227547_at aldehyde dehydrogenase 1 family member A3 2.32 ALDH 1 A3 203180_at proteasome (prosome macropain) subunit beta type 9 (large multifunctional protease 2) 2.29 PSMB9 204279_at
  • KIAA0143 protein 2.26 KIAA0143 212150_at guanylate binding protein 1 interferon-inducible 67kDa 2.26 GBP1 202270_at epiplakin 1 2.25 EPPK1 232164_s_at actinin alpha 1 2.24 ACTN 1 211160_x_at ring finger protein 20 2.22 RNF20 222683_at leucine rich repeat (in FLII) interacting protein 1 2.22 LRRFIP1 223492_s_at
  • 2.21 1556111_s_at hypothetical protein LOC150759 2.21 LOC150759 213703_at dihydropyrimidinase-like 3
  • 2.20 DPYSL3 201431_s_at type I transmembrane receptor (seizure-related protein) 2.20 PSK-1 233337_s_at zinc finger protein 90 homolog (mouse)
  • ZFP90 235698_at tumor protein p53 (Li-Fraumeni syndrome) 2.20 TP53 211300_s_at
  • LOC284120 Homo sapiens hypothetical LOC284120 (LOC284120) mRNA 2.13 241394_at suppressor of cytokine signaling 2 2.13 SOCS2 203373_at cyclin-dependent kinase 5 regulatory subunit 1 (p35) 2.11 CDK5R1 204995_at likely ortholog of mouse Sds3 2.11 SDS3 233841_s_at
  • TIA1 cytotoxic granule-associated RNA binding protein 2.00 TIA1 1554890 a at
  • MAX dimerization protein 1 0.50 MAD 228846_at ecotropic viral integration site 5 0.50 EVI5 209717_at
  • T-cell leukemia translocation altered gene 0.49 TCTA 203054_s_at ubiquitin-conjugating enzyme E2R 2 0.49 UBE2R2 226954_at hypothetical protein FLJ30794 0.49 FLJ30794 238029_s_at kelch-like 8 ⁇ Drosophila) 0.49 KLHL8 242648_at junction-mediating and regulatory protein 0.49 JMY 241985_at tripartite motif-containing 37 0.49 TRIM37 213009_s_at tubulin-tyrosine ligase 0.48 TTL 224896_s_at cystathionase (cystathionine gamma-lyase) 0.48 CTH 217127_at
  • SARIa gene homolog 2 (S. cerevisiae) 0.47 SARA2 1554482_a_at putative nucleic acid binding protein RY-1 0.47 RY1 212440_at TATA element modulatory factor 1 0.47 TMF1 227685_at hydroxysteroid (17-beta) dehydrogenase 12 0.46 HSD17B12 217869_at disabled homolog 2 mitogen-responsive phosphoprotein (Drosophila) 0.46 DAB2 201280_s_at
  • GABA(A) receptors associated protein like 3 0.45 GABARAPL3 211458_s_at nuclear receptor subfamily 4 group A member 2 0.45 NR4A2 204622_x_at
  • GABA(A) receptor-associated protein like 1 0.43
  • GABARAPL1 208868_s_at solute carrier family 11 proton-coupled divalent metal ion transporters
  • member 2 0.43
  • SMPDL3A 213624_at neuronal pentraxin I 0.43
  • NPTX1 204684_at fucosyltransferase 11 alpha (13) fucosyltransferase
  • DKFZp762C111 hypothetical protein DKFZp762C1112 0.43 2 225974_at sorting nexin 13 0.43 SNX13 227031_at fibronectin leucine rich transmembrane protein 2 0.42 FLRT2 204359_at
  • BRAMY2013590 0.42 225728_at protein tyrosine phosphatase type IVA member 1 0.42 PTP4A1 200732_s_at glutamate-cysteine ligase modifier subunit 0.42 GCLM 234986_at guanine nucleotide binding protein (G protein) alpha activating activity polypeptide olfactory type 0.42 GNAL 218178_s_at chromosome 13 open reading frame 1 0.42 C13orf1 230151_at heat shock 7OkDa protein 9B (mortalin-2) 0.42 HSPA9B 200690_at
  • Transcripts that were upregulated upon Staul depletion and, thus, represent possible SMD targets encode proteins that are involved in signal transduction, cell proliferation or both (Table 9).
  • Table 9 Selected examples of transcripts upregulated in human cells depleted of Staul in three independently performed microarray analyses
  • Rho GDP dissociation inhibitor (GDI) beta thymosin beta identified in neuroblastoma cells tissue factor pathway inhibitor 2
  • cell cycle chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha) chromosome 14 open reading frame 141 cyclin-dependent kinase 5 regulatory subunit 1 (p35) cyclin-E binding protein 1 dual specificity phosphatase 6 ets variant gene 1 growth associated protein 43 histone deacetylase 8 signaling lymphocytic activation molecule family member 1 spinal cord-derived growth factor-B suppressor of cytokine signaling 2 rumor protein p53 (Li-Fraumeni syndrome) v-jun sarcoma virus 17 oncogene homolog (avian) VIII. Apoptosis catenin (cadherin-associated protein) alpha-like 1 TIAl cytotoxic granule-associated RNA binding protein tumor protein p53 (Li-Fraumeni syndrome)
  • chemokine (C-X-C motif) ligand 1 melanoma growth stimulating activity alpha
  • fibronectin 1 growth associated protein 43
  • integrin beta 3 platelet glycoprotein Ilia antigen CD61
  • interferon-induced protein 44
  • PHD finger protein 11 transducin-like enhancer of split 4 E(spl) homolog Drosophila) transforming growth factor beta 1 induced transcript 1 tumor protein p53 (Li-Fraumeni syndrome) v-jun sarcoma virus 17 oncogene homolog (avian) zinc finger protein 90 homolog (mouse)
  • Rho GDP dissociation inhibitor beta signaling lymphocytic activation molecule family member 1 spinal cord-derived growth factor-B stathmin-like 3 suppressor of cytokine signaling 2 tenascin C (hexabrachion) thrombospondin 1 transducin-like enhancer of split 4 (E(spl) homolog Drosophil ⁇ ) transforming growth factor beta 1 induced transcript 1 type I transmembrane receptor (seizure-related protein)
  • Rho GDP dissociation inhibitor beta stathmin-like 3 suppressor of cytokine signaling 2 thrombospondin 1 transducin-like enhancer of split 4 (E(spl) homolog Drosophild) transgelin tumor protein p53 (Li-Fraumeni syndrome)
  • transcripts that were upregulated encode proteins that function in the immune response. Still others produce proteins that participate in cell adhesion, motility, the extracellular matrix, or other aspects of cell structure. A number encode factors that regulate transcription. Others encode proteins involved in RNA metabolism, including the TIAl cytotoxic granule- associated RNA binding protein, which regulates the alternative splicing of pre-mRNA that encodes the human apoptotic factor Fas(Forch et al., 2002) and translationally silences mRNAs that encode inhibitors of apotosis such as tumor necrosis factor a. (TNF-a)(Piecyk et al., 2000; Li et al., 2004).
  • RNA metabolic protein that was upregulated upon Staul depletion is Dcp2, which mediates transcript decapping(Wang et al., 2002). It is worth noting, however, that the abundance of an mRNA could be upregulated upon Staul depletion via a mechanism that involves an alteration in its half-life, such as SMD, or via the product of another mRNA that itself is directly regulated by Staul .
  • Staul or Upfl depletion increases the abundance of c-JUN, SERPINE and IL7R 3' mRNAs
  • Serine (or cysteine) proteinase inhibitor clade E Bait for tissue plasminogen activator, 3.2 3.8 (nexin plasminogen activator inhibitor type 1) urokinase, and protein C member 1 (SERPINEl) Interleukin 7 receptor (IL7R) Receptor for interleukin 7 3.0 2.1 v-jun sarcoma virus 17 oncogene homolog (avian) Proto oncogene 2.6 5.3 (c-JUN)
  • the three transcripts encode serine (or cysteine) proteinase inhibitor clade E (nexin plasminogen activator inhibitor type 1) member 1 (Serpinel), interleukin 7 receptor (IL7R), and v-jun sarcoma virus 17 oncogene homolog (avian) (c-jun).
  • serpinel serine proteinase inhibitor clade E
  • IL7R interleukin 7 receptor
  • v-jun sarcoma virus 17 oncogene homolog avian
  • RNAs small interfering (si) RNAs
  • Staul or Staul (A) siRNA which targeted a different Staul mRNA sequence
  • Upfl or Upfl(A) siRNA which targeted a different UPFl mRNA sequence
  • Upf2 siRNA which has no effect on SMD
  • protein and RNA were isolated for analysis using Western blotting and RT-PCR, respectively.
  • nucleotides 481-671 of the c-JUN 3' UTR which include the 151-nucleotide class IJJ (i.e., II-" Il Il .. • ' 'U i ::::ii !.J !:,;:i ⁇ ,,' ,,;:;
  • nucleotide 1 is defined as the nucleotide immediately 3' to the normal termination codon.
  • Cos cells were transfected with four test plasmids : pcFLuc-c- JUN 3 'UTR, pcFLuc-SERPHNEl 3'UTR, pcFLuc-IL7R 3'UTR and pcFLuc-Arfl SBS ( Figure 18A), the latter of which serves as a positive control for Staul-HA 3 binding since it contains the minimized Staul binding site (SBS) from the Arfl 3'UTR (Kim et al., 2005).
  • SBS Staul binding site
  • L cells were transfected with mouse (m)Staul siRNA, mUpfl siRNA or a nonspecific Control siRNA (Kim et al., 2005) and, two days later, with the four pfos-FLuc test plasmids and the phCMV-MUP reference plasmid.
  • the reference plasmid controls for variations in transfection Il « Il ..-' ⁇ O ::::::n i
  • serum was added, and protein and RNA were purified from, respectively, cytoplasmic and nuclear fractions after 0, 30, 45 and 60 minutes.
  • Staufen binding site exists within Drosophila bicoid mRNA (Ferrandon et al., 1994). Linker scanning mutations that disrupted the interaction of Staufen with this mRNA mapped to three noncontiguous regions: 148 nucleotides of stem IJJ, 89 nucleotides of the distal region of stem IV, and 88 nucleotides of the distal region of stem V (Ferrandon et al., 1994). Given the structural complexity of human Staufen binding site(s), it may be difficult to identify human Staul binding sites exclusively from our existing mRNA immunopurification and half-life data.
  • Arfl , c-JUN, SERPINEl , IL7R and GAP43 mRNAs will not be the only transcripts among those upregulated upon Staul depletion that are targeted for SMD.
  • CYR61 mRNA which encodes the cysteine-rich angiogenic inducer 61, was upregulated upon Staul depletion in only two of our three microarray analyses and, thus, fell below the stringent criteria as a candidate target for SMD.
  • this mRNA may very well be targeted for SMD since it was also among the transcripts upregulated upon Upfl depletion (Forch et al., 2002).
  • Interferon-induced protein with tetrat ⁇ copeptide repeats 4 (IFIT4) 4 1 7 7 22 AI075407
  • KIAA0143 protein (KIAA0143) 2 0 2 2 44 AW470003
  • Rho GTPase activating protein 19 (ARHGAP 19) 2 1 2 2 00 U79256
  • pcFLuc-8bs (Kim et al., 2005) was digested with Xbal and ligated to one of four PCR-amplified fragments that contained the (i) c-JUN ARE HI plus 45 nucleotides that had been digested with Xbal, (ii) SERPINEl 3'UTR without the normal termination codon that had been digested with Xbal, (iii) EL7R without the normal termination codon that had been digested with Nhel or (iv) GAP43 3'UTR without the normal termination codon that had been digested with Xbal .
  • the c-JUN ARE fragment was amplified using the Human HeLa BDTM Marathon-Ready cDNA (BD Biosciences) and two primers: 5'- CGCTCTAGAGTGAGAACTCTTTCTGGCCTGCCTTCGTTAAC-S ' (SEQ ID NO: 63) (sense) and 5 ' -CGCTCT AGATTAC AAATGGTAAACTCAGAGTGCTCC-3 ' (SEQ ID NO: 64) (antisense), where underlined nucleotides specify the Xbal site.
  • the SERPINEl 3'UTR fragment was amplified using pCMV6-XL5-SERPINEl (Origene Technologies) and two primers: 5 '-CGCTCTAGAGTGACCCTGGGGAAAGACGCCTTC ATCTG-3 ' (SEQ ID NO: 65) (sense) and 5'-CGCTCTAGAGCTTCTATTAGATTACATTCATTTCAC-S ' (SEQ ID NO: 66) (antisense), where underlined nucleotides specify the Xbal site.
  • the IL7R 3'UTR fragment was amplified using Human HeLa BDTM Marathon-Ready cDNA and two primers: 5'-CGCGCTAGCGTGAAGTGTAAGAAACCCAGACTGAAC-S' (SEQ ID NO: 67) (sense) and 5'-CGCGCTAGCTTTTTTTCCTCTCATGCTCTCTTCCTGC-S' (SEQ ID NO: 68) (antisense), where underlined nucleotides specify the Nhel site.
  • the GAP43 fragment was amplified using HeLa-cell total cDNA prepared from Staul siRNA-treated cells and two primers: 5'-CGCTCTAGAGTGAACTCTAAGAAATGGCTTTCCACATC- 3' (sense) (SEQ ID NO: 141) and 5'- CGCTCTAGAGTGAGAATTCACTCGATATTTTGGACTCCTCAG-S' (antisense) (SEQ ID NO: 142), where underlined nucleotides specify the Xbal site.
  • pfos-Gl (Kim et al., 2005) was digested with EcoRI and Ncol and ligated to one of three PCR-amplified H I! H .. ⁇ i
  • Each PCR fragment was amplified using the pcFLuc-c-JUN 3'UTR, pcFLuc-SERPINEl 3'UTR, or pcFLuc-IL7R 3'UTR and two primers: 5'-CATGCCATGGAAGACGCCAAAAACATAAAGAAAGGC-S' (SEQ ID NO: 69) (sense) and 5 ' -CGGAATTC AGGCTGATC AGCGAGCTCTAGC ATTT AGG-3 ' (SEQ E) NO: 70) (antisense), where underlined nucleotides specify the Ncol and EcoRI site, respectively.
  • pSport-Arfl-SBS derivatives harboring ⁇ (250-300), ⁇ (200- 300), ⁇ (l 50-300), ⁇ (100-300) or ⁇ (50-300).
  • pSport was digested with Xbal and Hpal and ligated to one of five PCR-amplified fragments that had been digested with Xbal.
  • Each PCR fragment was amplified using pSport-Arfl-SBS, the common sense primer 5'- GCTATTT AGGTGACACTATAGAAGGTAC-S' (SEQ ID NO: 143) and the specific antisense primer: 5'-CTTTTTACAATAAAAAAAGCTGAGTAATAT-S' (SEQ ID NO: 144), 5'-TGCCTCATTGGAAACAAAAACTATTTACAT-S' (SEQ DD NO: 145), 5'- AGGCTGCGTCTGCC ACATTTAC-3' (SEQ ID NO: 146), 5'- ACCACGGAGGCAGCTTCTGG-3' (SEQ ID NO: 147), or 5'- ATGAGAGTAAAGC AGAGGGC AAG-3' (SEQ ID NO: 148).
  • PCR amplifications were carried out using Pfu Ultra (Stratagene). PCR products were incubated with Dpnl to digest the methylated template DNA, phosphorylated at the 5' ends using T4 polynucleotide kinase (Fermentas), and circularized by ligation.
  • CATAGGAGTACCACTTCCTGCCTCATTGG-3' antisense, Single and Double, where underlined nucleotides specify mutated nucleotides
  • SEQ ID NO: 156 or 5'- CCACGGAGGCAGAAAGTGGCACTCACACC-3' (antisense, Double)
  • CCAATGAGGCAGGAAGTGGTACTCCTATG-3' (sense, Single and Double, where underlined nucleotides specify mutated nucleotides) (SEQ ID NO: 158) or 5'- GGTGTGAGTGCCACTTTCTGCCTCCGTGG-3' (sense, Double) (SEQ ID NO: 159) and the common antisense primer 5'-GTGCCC ATGGGCCTAC ATCC-3 1 (SEQ ID NO: 160).
  • the resulting fragments were mixed with the same sense and antisense primers that amplified, respectively, the 5' and 3' fragments to generate a joined product.
  • PCR products were digested with Xbal, and inserted into the Xbal and Hpal sites of pSport. To construct ⁇ (Loop), a 5'fragment was amplified using the primer pair 5'- GCTATTTAGGTGACACTATAGAAGGTAC-3' (sense) (SEQ ID NO: 161) and 5'-
  • AATTCTCGAGAGGCAGCTTCTGGCACTC-3' antisense, where underlined nucleotides specify a Xhol site
  • SEQ ID NO: 162 AATTCTCGAGAGGCAGCTTCTGGCACTC-3' (antisense, where underlined nucleotides specify a Xhol site)
  • SEQ ID NO: 163 AATTCTCGAGAGGCAGCTTCTGGCACTC-3' (antisense, where underlined nucleotides specify a Xhol site)
  • SEQ ID NO: 163 antisense, where underlined nucleotides specify a Xhol site
  • pcFLuc-8bs was digested with Xbal and ligated to one of three Xbal-digested PCR-amplified fragments that had been generated using pcFLuc-c-JUN 3 'UTR and two primers: 5 '-
  • CGCTCTAGAGTGATTCGTTAACTGTGTATGTAC-S' (SEQ ID NO: 71) (sense) and 5'- CGCTCTAGAAAATTAAAAAATATATATATG-S ' (SEQ ID NO: 72) (antisense) for pcFLuc-c-JUN 3'UTR (500-539), 5'- CGCTCTAGAGTGAGATGAAAGCTGATTACTGTC-3' (SEQ ID NO: 73) (sense) and 5'- CGCTCTAGAAACTTACAAAGGCATGAAGC-3 ' (SEQ ID NO: 74) (antisense) for pcFLuc-c-JUN 3'UTR (540-587), or 5'-
  • pcFLuc-8bs was digested with Xbal and ligated to one of three Xbal-digested PCR-amplified fragments that had been generated using pcFLuc-c-JUN 3'UTR and two primers: 5'- CGCTCTAGAGTGATTCGTTAACTGTGTATGTAC-3' (sense) (SEQ ID NO: 165) and ii «,..,. Ii .. ⁇ ' 1 I.,,!' .,,;:i ⁇ n..,n :;;;;n ,.• • constructive;;:!> ::;::n i
  • pcFLuc-8bs was digested with Xbal and ligated to one of four Xbal-digested PCR-amplified fragments that had been generated using pcFLuc-SERPINEl 3'UTR and two primers: 5'-
  • pcFLuc-8bs was digested with Xbal and ligated to one of four Xbal-digested PCR-amplified fragments that had been generated using pcFLuc-SERPESfEl 3'UTR and two primers: 5'-
  • pcFLuc-8bs was digested with Xbal and ligated to one of three Xbal-digested PCR-amplifled fragments that had been generated using pcFLuc-GAP43 3'UTR and two primers: 5'- CGCTCTAGAGTGAACTCTAAGAAATGGCTTTCCA-3' (SEQ ID NO: 85) (sense) and 5'-CGCTCTAGATGTTTGACTTGGGATCTTTCCTGC-S' (SEQ ID NO: 86) (antisense) for pcFLuc-GAP43 3'UTR (1-206), or 5'-
  • pcFLuc-8bs was digested with Xbal and ligated to one of two Nhel-digested PCR-amplified fragments that had been generated using pcFLuc-IL7R 3'UTR and two primers: 5'-
  • Human HeLa cells (2 x 10 6 ) were propagated in DMEM medium (GIBCO- BRL) containing 10% fetal bovine serum (GIBCO-BRL) in 60-mm dishes and, where specified, transiently transfected with plasmid DNA, in vitro-synthesized siRNA, or both as described (Kim et al., 2005).
  • Monkey Cos cells which were used in experiment involving immunopurification, were similarly treated as were mouse L cells, which effectively support fos promoter induction upon the addition of serum after serum deprivation. All human and mouse siRNAs have been previously reported as has been the serum-induced transcription of fos-FLuc and the isolation of total-cell or nuclear protein and RNA (Kim et al., 2005).
  • Example 24 Western blotting and RT-PCR
  • HeLa-cell RNA was purified using TriZol reagent (Invitrogen) and deemed to be intact using an RNA 6000 Nano LabChip® (Agilent) together with a Bio analysesr 2100 and Biosizing software (Agilent). Biotin-labeled cRNAs were generated and hybridized to Ul 33 Plus 2.0 Array human gene chips (comprising more than 47,000 transcripts and variants).
  • Hybridized chips were scanned using an Affymetrix GeneChip® 3000 Scanner. Results were recorded using the GeneChip® Operating Software (GCOS) platform, which included the GeneChip® Scanner 3000 high-resolution scanning patch that enables feature extraction (Affymetrix). Notably, the Affymetrix Gene Expression Assay identifies changes that are greater than 2-fold with 98% accuracy (Wodicka et al., 1997). Arrays were undertaken using three independently generated RNA samples. Transcripts that showed at least a 2-fold increase in abundance with a p value of less than 0.05 in each of the three analyses were scored as potential SMD targets. 285. Throughout this application, various publications are referenced.
  • Nonsense but not missense mutations can decrease the abundance of nuclear mRNA for the mouse major urinary protein, while both types of mutations can facilitate exon skipping. MoI. Cell. Biol. 14, 6326-6336. Bono, F., Ebert, J., Unterholzner, L., Guttler, T., Izaurralde, E., and Conti, E. (2004). Molecular insights into the interaction of PYM with the Mago-Y14 core of the exon junction complex. EMBO Rep. 5, 304-310.
  • eIF4A3 is a novel component of the exon junction complex. RNA 10, 200-209.
  • mRNA stabilization by poly(A) binding protein is independent of poly(A) and requires translation. Genes Dev. 12, 3226- 3235. Curatola, A.M., Nadal, M.S. & Schneider, RJ. Rapid degradation of AU-rich element (ARE) mRNAs is activated by ribosome transit and blocked by secondary structure at any position 5 1 to the ARE. MoI. Cell. Biol. 15, 6331-6340 (1995).
  • Ferrandon, D., Elphick, L., Nusslein-Volhard, C. & St Johnston, D. Staufen protein associates with the 3'UTR of bicoid mRNA to form particles that move in a microtubule- dependent manner. Cell 79, 1221-1232 (1994).
  • RNA 4, 479-486 A dual-luciferase reporter system for studying recoding signals.
  • Drosophila Y14 shuttles to the posterior of the oocyte and is required for oskar mRNA transport. Curr. Biol. 77, 1666-1674.
  • Pre-mRNA splicing imprints mRNA in the nucleus with a novel RNA-binding protein that persists in the cytoplasm. MoI. Cell 6, 673-682.
  • RNA granules a link between RNA localization and stimulation-dependent translation. Neuron 32, 683-696.
  • exon-exon junction complex provides a binding platform for factors involved in mRNA export and nonsense- mediated mRNA decay. EMBO J. 20, 4987-4997.
  • Nonsense-mediated mRNA decay in mammalian cells involves decapping, deadenylating, and exonucleolytic activities. MoI. Cell 12, 675-687.
  • Nonsense-mediated mRNA decay A comparative analysis of different species. Curr. Genomics 5, 175-190. Maquat, L. E. (2004b). Nonsense-mediated mRNA decay: splicing, translation and mRNP dynamics. Nat. Rev. MoI. Cell. Biol. 5, 89-99.
  • a human sequence homologue of Staufen is an RNA-binding protein that is associated with polysomes and localizes to the rough endoplasmic reticulum. MoI. Cell. Biol. 19, 2212-2219. Matsuzaki, F., Ohshiro, T., JJceshima-Kataoka, H., and Izumi, H. (1998). miranda localizes staufen and prospero asymmetrically in mitotic neuroblasts and epithelial cells in early Drosophila embryogenesis. Development 125, 4089-4098.
  • RNA-binding protein Tsunagi interacts with Mago Nashi to establish polarity and localize oskar mRNA during Drosophila oogenesis. Genes Dev. 15, 2886-2899.
  • Piecyk, M. et al. TIA-I is a translational silencer that selectively regulates the expression of TNF-alpha. EMBOJ. 19, 4154-4163 (2000).
  • eIF4Am binds spliced mRNA in the exon junction complex and is essential for nonsense-mediated decay. Nat. Struct. MoI. Biol. 11, 346-351.
  • Mammalian staufen is a double-stranded-RNA- and tubulin-binding protein which localizes to the rough endoplasmic reticulum. MoI. Cell. Biol. 19, 2220-2230. Wilusz, C. J., Wang, W., and Peltz, S. W. (2001). Curbing the nonsense: the activation and regulation of mRNA surveillance. Genes Dev. 15, 2781-2785.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

Disclosed are compositions and methods for treating subjects with conditions resulting from Stau 1 -mediated mRNA decay, screening for, and manufacturing those therapeutic agents. Described herein are novel mRNA decay mechanisms that involves mammalian Staufen (Stau)l, the nonsense-mediated mRNA decay (NMD) factor Upfl, and a termination codon. It is shown that Staul binds directly to Upfl and can elicit mRNA decay when tethered downstream of a termination codon. Also disclosed is the new pathway as a means for cells to down-regulate the expression of Staul-binding mRNAs.

Description

STAUFEN1 (Staul)-MEDIATEDmRNADECAY
1. This invention was made with government support under Grants DK033938, GM074593, and GM059614 awarded by NIH. The government has certain rights in the invention. I. BACKGROUND OF THE INVENTION
2. Mammalian Staufenl (Staul) is an RNA binding protein that binds to extensive RNA secondary structures, primarily through one or more double-stranded RNA-binding domains (Marion et al., 1999; Wickham et al., 1999). The role of Staufen is best characterized in Drosophila, where it functions in the transport and localization of bicoid and oskar mRNAs to, respectively, the anterior and posterior poles of oocytes, and prospero mRNA during asymmetric divisions of embryonic neuroblasts (Broadus et al., 1998; Li et al., 1997; Matsuzaki et al., 1998; Schuldt et al., 1998; Shen et al., 1998; St Johnston, 1995). Drosophila Staufen also functions in the translational derepression of oskar mRNA once the mRNA has been localized to the posterior pole of an oocyte (Ephrussi et al., 1991; Kim- Ha et al., 1995; Kim-Ha et al., 1991 ; Micklem et al., 2000).
3. In mammals, the Staul gene is ubiquitously expressed and generates protein isoforms having apparent molecular weights of 55 and 63 kDa (Kiebler et al., 1999; Marion et al., 1999; Monshausen et al., 2001; Wickham et al., 1999). The 55-kDa isoform associates with 4OS and 60S ribosomal subunits and co-localizes with the rough endoplasmic reticulum (Luo et al., 2002; Marion et al., 1999; Wickham et al., 1999). A role for Staul in mRNA transport and translational control has been inferred from its presence in RNA granules that migrate within the dendrites of hippocampal neurons in a microtubule- dependent manner (Kohrmann et al., 1999; Krichevsky and Kosik, 2001 ; Mallardo et al., 2003; Ohashi et al., 2002; Villace et al., 2004), as well as its encapsidation together with HIV-I RNA in virus particles (Mouland et al., 2000). Additionally, Staul interacts with telomerase RNA, suggesting that it functions during DNA replication, cell division or both, possibly by influencing telomerase RNA processing or RNP assembly or localization (Bachand et al., 2001; Le et al., 2000).
II. SUMMARY OF THE INVENTION 4. In accordance with the purposes of this invention, as embodied and broadly described herein, this invention, in one aspect, relates to methods of treating subjects with conditions that result from or modified by affecting Staul -mediated mRNA decay and to screening for and manufacturing those therapeutic agents that modulate Staul mediated mRNA decay.
5. Additional advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. III. BRIEF DESCRIPTION OF THE DRAWINGS
6. The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and together with the description, serve to explain the principles of the invention.
7. Figure 1 shows that Human Upfl interacts with human Staufen (Stau)l in a yeast two-hybrid analyses, in vitro binding assays, and immunopurifications (IPs) of Staul -HA3 from Cos cells. Figure IA shows yeast two-hybrid screening. Human Upfl as bait interacts with human Staul from the pMyr-cDNA library (upper). Negative and positive controls were provided by Stratagene. The region of Staul that interacts with Upfl was mapped to reside within the double-stranded RNA binding domain (dsRBD)4 and tubulin binding domain (TBD) (lower). Figure IB shows GST pull-down assays. E. coli lysates that expressed GST-Upfl (+) were mixed with E. coli lysates that did not (-) or did (+) express 6xHis-Staul, purified using Glutathione Sepharose beads (After) or not (Before), and subjected to Western blotting (WB) using anti-GST antibody (upper) or anti-His antibody (middle) either before or after GST pull-down. Additionally, a fraction of each sample before or after GST-pull-down was analyzed by Coomassie Blue staining to verify the presence of GST-Upfl and 6xHis-Staul (lower, indicated by dots). Figure 1C shows Far- Western analysis. E. coli lysates that did not (-) or did (+) produce either 6xHis-Staul or GST-Staul were subjected to Far- Western blotting (FW) using FLAG-Upfl that had been immunopurified from HeLa cells (middle) or GST-Upfl that had been immunopurified from E. coli (right). Interacting proteins were identified by Western blotting using anti-FLAG or anti-GST antibody, respectively. Expression of 6xHis-Staul and GST-Staul was also verified by staining each lysate with Coomassie Blue (left). Figure ID shows IP of Staul- HA3. Cos cells were transiently transfected with a plasmid that expressed the 55-kDa isoform of Staul-HA3. After cell lysis, RNA and protein were purified from the lysate before and after IP using anti-HA antibody or, to control for the specificity of the IP, rat (r) IgG. RNase A was added to half of each sample prior to IP. SMG7 mRNA was analyzed using RT-PCR to demonstrate that the RNase A digestion was complete (lower). The four left-most lanes represent 2-fold serial dilutions of RNA and demonstrate that the RT-PCR is semi-quantitative. Western blotting was used to detect the specified proteins (upper). The three left-most lanes represent 3-fold serial dilutions of protein before IP and demonstrate that the Western blotting is semi-quantitative. Figure IE shows IP of cellular Upf3/3X. Lysate from untransfected Cos cells was immunopurified using anti-Upf3/3X antibody or, as a control for nonspecific IP, normal rabbit serum (NRS). Western blotting was used to analyze the specified proteins. Upf3 co-migrated with Ig heavy chains and, thus, could not be analyzed. Figure IF shows IP of FLAG-Upfl . Lysates of HeLa cells that did (+ pCI- neo-FLAG-UPFl) or did not (- pCI-neo-FLAG-UPFl) stably express FLAG-Upfl was analyzed either before or after IP using anti-Flag antibody by Western blotting for the specified proteins.
8. Figure 2 shows that down-regulating cellular Staul has no detectable effect on the EJC-dependent NMD of Gl 39Ter or GPxI 46Ter mRNA. HeLa cells were transiently transfected with Staul siRNA, Upf3X siRNA, or a nonspecific Control siRNA. Two days later, cells were re-transfected with pmCMV-Gl and pmCMV-GPxl test plasmids, either nonsense-free (Norm) or nonsense-containing (Ter), and the phCMV-MUP reference plasmid. After an additional day, protein and RNA were purified. Figure 2A shows the Western blot analysis of the siRNA-mediated down-regulation of Staul or Upf3X, where the level of eIF3b served to control for variations in protein loading. Figure 2B shows the RT-PCR analysis of the level of Gl mRNA (left) or GPxI mRNA (right), which was normalized to the level of MUP mRNA. Normalized levels of Norm mRNA in the presence of each siRNA were defined as 100%. Levels in three independently performed experiments did not vary by more than 7%.
9. Figure 3 shows that tethering Staul to the FLuc mRNA 3' UTR reduces FLuc mRNA abundance. Figure 3 A shows the schematic representations of firefly (F) and renilla (R) luciferase (Luc) expression plasmids pcFLuc-MS2bs, pcFLuc, and pRLuc, where X8 specifies eight tandem repeats of the MS2 coat protein binding site. HeLa cells were co- transfected with the specified pcFLuc-MS2bs reporter plasmid, the pRLuc reference plasmid, as well the specified effector plasmid. Two days after transfection, protein and RNA were purified. Western blotting using anti-HA antibody demonstrates effector expression (left). RT-PCR demonstrates that tethered Staul reduces FLuc-MS2bs mRNA abundance (right). Numbers below the figure represent the levels of FLuc or FLuc-MS2bs mRNA, which were normalized to the level of RLuc mRNA. Each normalized level of FLuc or FLuc-MS2bs mRNA was then calculated as a percentage of the normalized level of FLuc or FLuc-MS2bs mRNA that was obtained in the presence of pMS2-HA or pcNMS2, which was defined as 100%. RT-PCR results in at least three independently performed experiments did not vary by more than 9%.
10. Figure 4 shows that the abundance of FLuc-MS2bs mRNA is reduced by only specific proteins, such as MS2-HA-Staul or MS2-Upfl , but not MS2-HA-eIF4AIII, myc-
Upfl or Staul-HA3. As in Figure 3, except that the specified effector plasmids were used. Figure 4 A shows the western blot analysis of MS2-HA, MS2-HA-Staul and MS2-HA- eIF4Aiπ expression using anti-HA antibody (left), MS2-Upfl, myc-Upfl and endogenous Upfl expression using anti-Upfl antibody (upper right), and MS2-HA, MS2-HA-Staul and Stau-HA3 expression using anti-Staul antibody (lower right). Endogenous Staul was detectable with enhanced chemiluminescence. Figure 4B shows RT-PCR analysis of the levels of FLuc-MS2bs and RLuc mRNAs. Numbers below the figure represent the level of FLuc-MS2bs mRNA, which was normalized to the level of RLuc mRNA. Normalized levels were then calculated as a percentage of the normalized level of FLuc-MS2bs mRNA that was obtained in the presence of pMS2-HA, ρcNMS2, pCMV-myc, or pCDNA3/RSV (i.e., the vector for hStaul-HA3 expression), each of which was defined as 100%. Results represent three independently performed experiments and do not vary by more than 10%.
11. Figure 5 shows that siRNA-mediated down-regulation of cellular Upfl but not Upf2 or UpfiX inhibits the reduction in FLuc-MS2bs mRNA abundance that is mediated by tethered Staul . Figure 5 A and 5B show that HeLa cells were transiently transfected with the specified siRNA. Two days later, cells were transfected with the pcFLuc-MS2bs reporter plasmid, the pRLuc reference plasmid, and the specified effector plasmid. Alternatively, cells were transfected with a pmCMV-Gl test plasmid (either Norm or Ter) and the phCMV-MUP reference plasmid. After an additional two days, protein and RNA were purified. Figures 5A-5C (left) show that Western blotting was used to quantitate the extent of down-regulation. Figures 5A-5B (middle) shows that RT-PCR was used to quantitate the effects of siRNA on Gl mRNA abundance, as in Figure 2B. Figures 5A-5C (right) show that RT-PCR was used to quantitate the effects of siRNA on mRNA abundance that were mediated by tethering the specified protein as in Figure 3B. For all RT-PCR results, mRNA levels in at least two independently performed experiments did not differ by more than 10 %.
12. Figure 6 shows evidence that Staul reduces mRNA abundance in a way that depends on an upstream termination codon that is located upstream of the Staul binding site. HeLa cells were transfected as described in the legend to Figure 3 using the specified test, reference and effector plasmids. Figure 6A shows schematic representations of the pcFLuc-MS2bs, pcFLuc (UAA->CAA)-MS2bs, pcGl-MS2bs, and pcGl(UAA→UAC)- MS2bs test plasmids (the latter two were called pc/3-6bs and pcj3UAC-6bs, respectively, in Lykke-Andersen et al., 2000). Figure 6B shows the quantitation of MS2-HA and MS2-HA- Staul expression. This figure is like Figure 3, except that pcFLuc(UAA-»CAA)-MS2bs was used as the reporter plasmid. Figure 6C is like Figure 3, except that pcGl-MS2bs or pcGl(UAA-»UAC)-MS2bs was the reporter plasmid, and phCMV-MUP was the reference plasmid. Results represent two independently performed experiments and do not vary by more than 11%.
13. Figure 7 shows that Staul binds Arfl mRNA. Figure 7 A shows the IP of Staul - HA3. 293 cells were transiently transfected with a plasmid that expressed Staul-HA3 or, to control for nonspecific IP, Staul -6xHis. Two days later, cells were lysed, a fraction of cell lysates was immunopurified using anti-HA antibody, and Staul was identified before and after IP using Western blotting and anti-Staul antibody. Asterisks denote the 63-kDa and 55-kDa isoforms of endogenous Staul. Figure 7B shows the identification of Arfl mRNA in Staul -containing RNP. Biotin-labeled cRNA was synthesized from RNA that had been immunopurified using anti-HA antibody from Staul-HA3- or Staul -6xHis-expressing cells or poly(A)+ RNA from untransfected cells. The histogram represents the amount of hybridized Arfl mRNA that was either immunopurified using anti-HA antibody from
Staul -HA3-expressing cells (left) or present in untransfected 293-cell poly(A)+ RNA (right), both of which are presented relative to the amount of hybridized Arfl mRNA that was immunopurified using anti-HA antibody from Staul -6xHis-expressing cells. A ratio of more than 2.5 is statistically significant. Figure 7C shows RT-PCR of Arfl mRNA in Staul -containing RNPs. 293 cells were transiently transfected with a plasmid that expressed either Staul-HA3 or, as a control, Staul-6xHis. As in 1OA, except that immunopurified RNA was purified, and Arfl mRNA was amplified using RT-PCR (two left-most lanes). Alternatively, lysates from untransfected 293 cells were immunopurified using with anti-Staul antibody (right) or an unrelated ascites fluid for the analysis of Arfl mRNA.
14. Figure 8 shows that Staul binds the 3' UTR of Arfl mRNA and reduces its abundance in a mechanism that involves Upfl . Figure 8 A shows schematic representations of the Arfl gene and the pSport-Arfl and pSport-ArflΔ(3'UTR) cDNA expression plasmids. Figure 8B is a parallel study to Figure 4A, except that HeLa cells were transiently transfected with the specified siRNA. Two days later, cells were re-transfected with a pSport-Arfl test plasmid and the reference phCMV-MUP plasmid. After an additional day, protein and RNA were isolated for Western analysis and RT-PCR, respectively. The efficiency of siRNA-mediated down-regulation of gene expression as assessed using Western blotting (upper). The levels of endogenous Arfl and SMG7 mRNAs (second down) or of Arfl mRNA that derived from pSport-Arfl and MUP mRNA (third down) as assessed using RT-PCR. Numbers below the panel represent the level of Arfl mRNA after normalization to the level of either SMG7 or MUP mRNA, where the normalized level of Arfl mRNA in the presence of Control siRNA was defined as 100%. Figure 8C is like 8B except that pSport Arfl or pSport-ArflΔ(3'UTR) was used as test plasmid. The level of Arfl mRNA or Arfl Δ(3 'UTR) mRNA that derives from pSport-Arfl and the level of MUP mRNA was assessed using RT-PCR. Figure 8D shows IP of Staul -HA3. Cos cells were transiently transfected with the Staul -HA3 expression vector, pSport-Arfl or pSport- Arfl Δ(3 'UTR), and phCMV-MUP. Notably, cells were transfected with only half as much pSport-ArflΔ(3'UTR) relative to pSport-Arfl in order to compensate for the difference in the level of product mRNA. Two days later, cells were lysed, and a fraction of lysates was immunopurifϊed using anti-HA antibody or, as a control, rlgG. Protein or RNA before and after IP was analyzed, respectively, using Western blotting and anti-HA antibody (upper), or RT-PCR (lower). For all RT-PCR results, mRNA levels in at least two independently performed experiments did not differ by more than 10 %.
15. Figure 9 shows a comparable increase in the abundance of Arfl mRNA that derives from pSport-Arfl is obtained using two different Staul siRNAs and two different Upfl siRNAs. As in Figure 8B; however, Staul (A) and Upfl (A) siRNAs were analyzed in parallel to, respectively, the Staul and Upfl siRNAs that were analyzed in the Figure 8B. Figure 9 A shows that the western blotting demonstrates down-regulation of Staul (left), and RT-PCR demonstrates that down-regulating Staul increases the level of Arfl mRNA abundance (right). Figure 9B is like 9A, except that UpΩ was down-regulated. Results represent two independently performed experiments and do not vary by more than 12%.
16. Figure 10 shows that Staul binds within an ~230-nt region of the Arfl mRNA 3' UTR, and this region reduces the half- life of Arfl mRNA in a Staul -mediated mechanism. Figure 1OA shows the schematic representations of the various Arfl mRNAs harboring deletions within the 3' UTR. Numbering is relative to the first nucleotide of endogenous Arfl mRNA, which is defined as 1. The upper-most construct represents full-length mRNA. Figure 1OB shows that the 293 cells were transfected with the Staul -HA3 expression vector and the specified pSport-Arfl test plasmid. One-tenth of each IP was used to determine IP efficiencies using Western blotting (upper). RNA was isolated from the rest of the IP, and the level of Arfl mRNA from each Sport test plasmid was quantitated by RT-PCR and ethidium bromide staining (lower). The level of Arfl mRNA from each pSport test plasmid was similarly assessed before IP to control for variations in transfection efficiencies and RNA recovery. Figure 1OC shows that the L cells were transfected with mouse (m)Staul, mUpfl, mUpf2, or Control siRNA. Two days later, cells were re- transfected with the pfos-Arfl-SBS test plasmid (upper left) and the phCMV-MUP reference plasmid in the absence of serum. Serum was added to 15% after an additional 24 hr, and protein was purified from the cytoplasmic fraction for Western blotting (second- from-top, left and right). RNA was purified from the nuclear fraction for RT-PCR analysis at the specified times (second-from-bottom, left and right). For each time point, the level of pfos-Arfl-SBS mRNA was normalized to the level of MUP mRNA. Normalized levels were calculated as a percentage of the normalized level of fos- Arfl -SBS mRNA at 30 min in the presence of each siRNA, which was defined as 100. Normalized levels represent the average of two independently performed experiments and are plotted as a function of time after serum addition (bottom, left and right).
17. Figure 11 shows that inserting the Staul binding site (SBS; nts 622-924) of the Arfl mRNA 3'UTR within FLuc mRNA results in a Staul -dependent reduction in FLuc mRNA halflife, whereas inserting a different region (No SBS; nts 899-1144) of the Arfl mRNA 3'UTR does not. Figure 1 IA shows schematic representations of pcFLuc-SBS and pcFLuc-No SBS test plasmids. Notably, the Arfl SBS maintains the distance and sequence of the minimized Staul binding site (nts 688-919) relative to the normal termination codon. (A, middle and right) As in Figures 5B and C, except that only Staul was down-regulated and pcFLuc-SBS or pcFLuc-No SBS were the test plasmids. Western blotting revealed that Staul siRNA reduced the level of Staul to 11% of normal. Figure 1 IB was performed as in Figure 1OC, except that only mStaul was down-regulated and pfos-FLuc-SBS was the test plasmid. Western blotting revealed that mStaul siRNA reduced the level of mStaul to 29%. Results represent two independently performed experiments, and RT-PCR quantitations did not vary by more than 9% (A) or 29% (B).
18. Figure 12 shows the 3' UTR of PAICS mRNA, which encodes phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazole succinocarboxamide synthetase activities, also binds Staul, and down-regulating Staul increases PAICS mRNA abundance. Figure 12A is like Figure 1OB, except that 293 cells were transfected with test plasmid pSport-PAICS or, as a negative control, pCDNA3-RSV- CK2A2, which encodes casein kinase 2 alpha prime polypeptide. Figure 12B is like Figure 8D, except that pSport-PAICS or pSport-PAICSΔ (3'UTR) was the test plasmid. The small amount of MUP mRNA that was detected in the IP represents background since (i) MUP mRNA was never detected in other IPs and (ii) a comparison of the levels of PAICS and MUP mRNAs before and after IP shows a 110-fold enrichment of PAICS mRNA relative to MUP mRNA after IP. Figure 12C is like Figure 8B, except that pSport-PAICS was the test plasmid. Results represent two independently performed experiments and do not vary by more than 2%.
19. Figure 13 shows that down-regulating Staul has no effect on the half-life of fos- ArflΔ(3'UTR) mRNA. Figure 13 was conduct in the same manner as Figure 1 IB, except that the test plasmid was pfos-ArflΔ(3'UTR). Results represent two independently performed experiments, and RT-PCR quantitations did not vary by more than 19%.
20. Figure 14 shows the models for EJC-dependent NMD and SMD of Arfl mRNA in mammalian cells. Figure 14A shows the recruitment of Upfl to one of the four EJCs of Arfl mRNA via Upf2 and Upf3/3X. Within the nucleus, pre-mRNA splicing deposits an exon junction complex (EJC) of proteins that consists of RNPSl, Y14, SRmlόO, REF/Aly, Mago, UAP56, and eIF4Am (Chan et al., 2004; Ferraiuolo et al., 2004; Kataoka et al., 2000; Kim et al., 2001; Le Hir et al., 2000b; Lejeune et al., 2002; Luo, et al., 2001; Palacios et al., 2004) and is located -20-25 nucleotides upstream of each ex on-exon junction (Le Hir et al., 2000a). It is unknown if every protein is present within every EJC. The EJC consists of the NMD factor Upf3 or UpOX, each of which binds Uρf2, and Upf2 is thought to subsequently bind Upfl . EJC-dependent NMD occurs if translation terminates prematurely more than -50-55 nucleotides upstream of any exon-exon junction, which would be -20-25 nucleotide upstream of the corresponding EJC (only the 3'-most of which is shown). Figure 14B shows the recruitment of Upfl to the 3' UTR of Arfl mRNA via Staul. Staul, which binds the 3' UTR of Arfl mRNA, recruits Upfl independently of an EJC. Data indicate that SMD occurs when translation terminates properly. By analogy to EJC-dependent NMD, the Staul binding site would reside more than ~20-25 nts downstream of the normal termination codon in order to elicit SMD. This is consistent with the finding that Staul binds at least 67-nt downstream of this codon.
21. Figure 15. Demonstration that 11 of 12 transcripts that were upregulated in human cells depleted of Staul using three independently performed microarray analysis are upregulated using RT-PCR and transcript-specific primers. Notably, RNAs analyzed were identical to the RNAs from Control and Staul siRNA-treated samples analyzed in Figure 17. The level of each test transcript was normalized to the level of SMG7 mRNA, which is insensitive to Staul siRNA (data not shown) and served to control for variations in RNA recovery. Numbers below each lane specify the fold change in the level of each test transcript in cells treated with Stau siRNA relative to Control siRNA, the latter of which was defined as 1.
22. Figure 16. Demonstration that 6 of 6 transcripts that were downregulated in human cells depleted of Staul using three independently performed microarray analysis are downregulated using RT-PCR and transcript-specific primers. The experimental procedure was as described in Figure 15.
23. Figure 17 shows that c-JUN, SERPINEl and JX7R mRNAs are increased in abundance in human cells depleted of either Upfl or Staul but not Upf2. HeLa cells were transiently transfected with Staul, Staul (A), Upfl, Upfl (A) or Upf2 siRNA or, to control for nonspecific depletion, Control siRNA. Three days later, protein and RNA were purified. Figure 17A shows Western blot analysis, where the level of Vimentin serves to control for variations in protein loading, and the normal level of Staul, Upfl or Upf2 is determined in the presence of Control siRNA. Figure 17B shows RT-PCR analysis of the level of endogenous c-JUN mRNA (upper), SERPJJSfEl mRNA or JL7R mRNA (lower), each of which is normalized to the level of endogenous SMG7 mRNA. The normalized level of each mRNA in the presence of Control siRNA is defined as 1. RT-PCR results are representative of three independently performed experiments that did not differ by the amount specified.
24. Figure 18 shows that Staul binds within the 3'UTR of c-JUN, SERPINEl and JX7R mRNAs. Cos cells were transiently transfected with three plasmids: (i) pcFLuc-c-JUN 3'UTR, pcFLuc-SERPINEl 3'UTR and pcFLuc-IL7R 3'UTR test plasmids, which encode FLuc mRNA in which all of the FLuc 3'UTR has been replaced by, respectively, part of the c- JUN 3'UTR or all of the SERPINEl or IL7R 3'UTR; (ii) the Staul-HA3 expression vector; (iii) the pcFLuc-SBS test plasmid, which encodes FLuc mRNA in which the 3'UTR has been replaced by the 231 -nucleotide Staul binding site (SBS) of Arfl mRNA (Kim et al., 2005) and serves as a positive control for Staul -HA3 binding; and (iv) phCMV-MUP, which encodes MUP mRNA that serves as a negative control for Staul -HA3 binding. Two days later, cells were lysed, and a fraction of each lysate was immunopurified using anti-HA or, as a control for immunopurification (IP) specificity, rat (r)IgG. Figure 18A shows schematic representations of pcFLuc-c-JUN, pcFLuc-SERPINE 1 , pcFLuc-IL7R and pcFLuc-SBS test plasmids. Figure 18B shows Western blotting using anti(α)-HA or anti-Calnexin demonstrated that Staul -HA3 but, as expected, not Calnexin was immunopurified. Figure 18C shows RT-PCR analysis demonstrates that c-JUN, SERPINEl and IL7R 3'UTRs, like the Arfl SBS, bind Staul-HA3, whereas MUP mRNA does not. Results are representative of three independently performed experiments.
25. Figure 19 shows that depleting cells of Staul or Upfl increases the half-life of FLuc mRNA when the 3'UTR consists of the Staul binding site of the c-JUN, SERPME1 or IL7R 3'UTR. L cells were transfected with mouse (m)Staul, mUpfl or Control siRNA. Two days later, cells were re-transfected with the pfos-FLuc-Arfl SBS, pfos-FLuc-c-JUN 3'UTR, pfos-FLuc-SERPHNE 1 3 'UTR or pfos-FLuc-IL7R 3 'UTR test plasmid and the phCMV-MUP reference plasmid in the absence of serum. Serum was added to 15% after an additional 24 hours. Protein was immediately purified from the cytoplasmic fraction (at 0 minutes) for Western blotting. RNA was purified from the nuclear fraction for RT-PCR analysis at the specified times. Figure 19A shows schematic representations of each test plasmid. Figure 19B shows Western blotting of mStaul or mUpfl, where the level of β-actin serves to control for variations in protein loading. mStaul was depleted to 35% its normal level, and mUpfl was depleted to 30% of its normal level. Figure 19C shows RT-PCR analysis of the SMD candidate mRNAs. For each time point, the level of each mRNA transcribed from the fos promoter is normalized to the level of MUP mRNA. Normalized levels are calculated as a percentage of the normalized level of each mRNA transcribed at 30 minutes in the presence of each siRNA, which is defined as 100 (left). These levels are plotted as a function of time after serum addition (right). Error bars specify the extent of variation among two or three independently performed experiments. 26. Figure 20 shows that GAP43 mRNA is an SMD target. Figure 2OA shows RT- PCR demonstrating that depleting cells of Staul or Upfl increases the cellular abundance of GAP43 mRNA. RNA derived from samples used in Figure 1. Figure 2OB shows IP revealing that Staul binds to the 3' UTR of GAP43 mRNA and, as a positive control Arfl SBS. Cos cells were transfected with three plasmids: (i) pcFLuc-GAP43 3 ' UTR (left), (ii) the Staul - HA3 expression vector; (iii) pcFLuc-SBS (left), and (iv) phCMV-MUP and analyzed as described in the legend to Figure 2 except that FLuc-GAP43 3' UTR and FLuc-Arfl SBS mRNAs were analyzed instead of the other FLuc mRNA derivatives. Figure 2OC shows Western blot (upper right) and RT-PCR analysis (lower left) demonstrating that depleting cells of Staul or Upfl increases the half-life of FLuc mRNA when the 3'UTR consists of the Staul binding site of GAP43 mRNA. L cells were transfected with mStaul, mUpfl or Control siRNA. Two days later, cells were re-transfected with the pfos-FLuc-GAP43 3' UTR test plasmid and the phCMV-MUP reference plasmid in the absence of serum. Subsequent treatment and analyses were as described in the legend to Figure 19 except that fos-FLuc- GAP43 3 ' UTR mRNA was analyzed instead of the other fos-FLuc mRNA derivatives. Results are representative of two independently performed experiments.
IV. DETAILED DESCRIPTION
27. The present invention may be understood more readily by reference to the following detailed description of preferred embodiments of the invention and the Examples included therein and to the Figures and their previous and following description.
28. Before the present compounds, compositions, articles, devices, and/or methods are disclosed and described, it is to be understood that this invention is not limited to specific synthetic methods, specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
29. As used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.
30. Ranges may be expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.
31. In this specification and in the claims which follow, reference will be made to a number of terms which shall be defined to have the following meanings:
32. "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
33. "Primers" are a subset of probes which are capable of supporting some type of enzymatic manipulation and which can hybridize with a target nucleic acid such that the enzymatic manipulation can occur. A primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art which do not interfere with the enzymatic manipulation.
34. "Probes" are molecules capable of interacting with a target nucleic acid, typically in a sequence specific manner, for example through hybridization. The hybridization of nucleic acids is well understood in the art and discussed herein. Typically a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.
35. As used herein, "chemical" refers to any reagent that can bind, mutate, dissolve, cleave, initiate a reaction that results in a new substance, or alter the confirmation of a target substance. An example of a chemical would be a small molecule.
36. As used herein, "pioneer round of translation" or "pioneering round" refers to an initial round of mRNA translation prior to steady-state translation. The round is characterized by the presence of CBP80 and CBP20 as the CAP binding proteins, PABP2 as a polyadenylation binding protein, and involves Upf2 and Upf3 or UpOX.
37. Staul is involved in mRNA decay. Also, Staul -mediated mRNA decay involves the nonsense-mediated mRNA decay (NMD) factor Upfl . In mammalian cells, the expression of protein-encoding genes requires a series of steps in which pre-mRNA is processed to mRNA in the nucleus before mRNA is translated into protein in the cytoplasm. These steps are subject to quality control to ensure that only completely processed mRNA is exported to the cytoplasm (reviewed in Maquat and Carmichael, 2001). One form of quality control, called mRNA surveillance or NMD. NMD in mammalian cells is generally a splicing-dependent mechanism that degrades newly synthesized mRNAs that prematurely terminate translation more than 50-55 nucleotides upstream of an exon-exon junction as a means to prevent the synthesis of potentially harmful truncated proteins (reviewed in Frischmeyer and Dietz, 1999; Hentze and Kulozik, 1999; Li and Wilkinson, 1998; Maquat, 2004a; Maquat, 2004b; Wilusz et al, 2001). By so doing, NMD precludes the synthesis of the encoded truncated proteins, which can function in deleterious ways (see, e.g., Inoue et al., 2004). NMD also targets naturally occurring mRNAs such as certain selenoprotein mRNAs and an estimated one-third of alternatively spliced mRNAs, some of which encode functional protein isoforms (Maquat, 2004b).
38. The dependence of NMD on splicing reflects the deposition of an exon junction complex (EJC) of proteins -20-24 nucleotides upstream of splicing-generated exon-exon junctions (Kataoka et al., 2000; Kim et al., 2001; Le Hir et al., 2000a; Le Hir et al., 2000b; Lykke-Andersen et al., 2001). This EJC includes NMD factors Upβ (also called UpOa) or UpβX (also called Upfib), Upf2 and, presumably, Upfl (Gehring et al., 2003; Kim et al., 2001; Lejeune et al., 2002; Lykke-Andersen et al., 2000; Lykke-Andersen et al., 2001). Upβ and UpβX appear to play a comparable role in NMD (Kim et al., 2001 ; Lykke-Andersen et al., 2001), although different isoforms of Upβ can form distinct protein complexes (Ohashi et al., 2002). Other constituents of the EJC include Y14, RNPSl, SRmlόO, REF/Aly, UAP56, Mago, Pinin, and eIF4Am (Chan et al., 2004; Ferraiuolo et al., 2004; Kataoka et al., 2000; Kim et al., 2001 ; Le Hir et al., 2001 ; Le Hir et al., 2000b; Luo, et al., 2001 ; Palacios et al., 2004; Shibuya et al., 2004; Tarn et al., 2003). EJCs are present on mRNA that is bound at the cap by the mostly nuclear cap binding protein (CBP)80-CBP20 heterodimer, which is consistent with data indicating that NMD targets CBP80-bound mRNA during a pioneer round of translation (Chiu et al., 2004; Ishigaki et al., 2001 ; Lejeune et al., 2002; Lejeune et al., 2004).
39. Mammalian Staul binds the NMD factor Upfl and the 3' untranslated region (UTR) of mRNA that encodes ADP-ribosylation factor (Arf)l. As a consequence, Staul mediates Arfl mRNA decay in a mechanism that differs from NMD by occurring independently of splicing or Upf2 and UpβX. Analogously to the Staul -mediated mRNA decay (SMD) of Arfl mRNA, artificially tethering Staul downstream of a normal termination codon also reduces mRNA abundance in a mechanism that depends on the normal termination codon and Upfl but neither splicing nor Upf2, Upβ or UpβX. Notably, Staul plays no detectable role in the EJC-dependent NMD of either /3-globin or glutathione peroxidase 1 mRNA.
40. The invention described herein in one aspect relates to methods of treating a disorder in a subject comprising administering to the subject a substance, wherein the substance modulates Staul -mediated mRNA decay (SMD). It is understood and herein contemplated that the term "treating" can refer to any method that improves a disorder in a subject. The improvement can include but is not limited to a decrease in one or more symptoms of the disorder such that the disorder is reduced. Treating is understood to include small improvements in the disorder up to and including the complete ablation of the disorder. For example, the treatment can result in a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the disorder.
41. There are many disorders that can be treated with the disclosed methods. It is understood and herein contemplated that a "disorder" means any inherited or acquired disease or condition associated with Staul mediated mRNA decay that has a negative effect relative to the wild-type state. For example, the disorder can be inherited genetic disorder. Inherited genetic disorders are disorders that result from the presence of an abherent gene or genes that alter the way an interaction, system or pathway works. As used herein, "system" refers to any cell, organism, or in vitro assay or culture. Such a system includes components necessary for SMD activity. Such components can include, for example, but are not limited to Staul and Upfl. Thus for example, specifically contemplated are methods disclosed herein wherein the disorder is a genetic disorder, and wherein the genetic disorder can be selected from the group consisting of cystic fibrosis, hemophilia, mucopolysaccharidoses, muscular dystrophy, anemia, glycolytic enzyme deficiency, connective tissue disorder, DNA repair disorder, dementia, Sandhoff disease, epidermolysis bullosa simplex, insulin resistance, maple syrup urine disease, hereditary fructose intolerance, inherited immunodeficiency, inherited cancer, carbohydrate metabolism disorder, amino acid metabolism disorder, lipoprotein metabolism disorder, lipid metabolism disorder, lysomal enzymes disorder, steroid metabolism disorder, purine metabolism disorder, pyrimidine metabolism disorder, metal metabolism disorder, porphyrin metabolism disorder, and heme metabolism disorder.
42. Also for example, a disorder can be dementia. Dementias can include but are not limited to Alzheimer's, Lewy Body dementia, Binswanger's dementia, or dementias associated with Parkinson's Disease, progressive supranuclear palsy, Huntingdon's disease, Pick's disease, Creutzfeldt- Jakob disease, Gerstmann-Straussler-Scheinker disease, AIDS, or trauma.
43. Disorders can also include acquired disorders. Acquired disorders are disorders that result from some external insult or injury, or from an unknown mechanism that is not derived from a genetic characteristic. Thus by "acquired disorder" is meant any disorder that lacks a clear genetically inherited link. For example, an infection or malignancy without a clear genetically inherited link. For example, acquired disorders can result from chemical exposure, radiation exposure, or random mutation in a gene that was not present in the subject earlier. Thus for example, an acquired disorder can comprise a cancer. 44. Also disclosed are methods of the invention, wherein the disorder is an acquired disorder. The acquired disorder is, by way of example but not by way of a limitation, a cancer. Such a cancer may be related to mutations such as mutations in p53 or BRCA-I .
45. The disclosed compositions can be used to treat any disease where uncontrolled cellular proliferation occurs such as cancers. A representative but non-limiting list of cancers that the disclosed compositions can be used to treat is the following: lymphoma, B cell lymphoma, T cell lymphoma, leukemia, carcinoma, sarcoma, glioma, blastoma, neuroblastoma, plasmacytoma, histiocytoma, melanoma, mycosis fungoide, hypoxic tumor, myeloma, metastatic cancer, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, colon cancer, cervical cancer, breast cancer, epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, hematopoietic cancers, testicular cancer, and colorectal cancer.
46. Disclosed and herein contemplated are methods wherein the SMD occurs in or as a result of the pioneering round of translation. Notably, SMD can also occur during steady- state translation. During steady-state translation, can target eIF4E-bound mRNA.
47. As used herein, "subject" refers to any cell, tissue, system, or organism used to study or treat a disorder relating to SMD, including, for example, human patients with conditions that result from SMD or cell lines used to study aspects of SMD. Thus, in one embodiment the subject is a mammal. It is specifically contemplated that mammal can include but is not limited to human, monkey, mouse, dog, pig, rabbit, and cow.
48. The disclosed methods function by modulating SMD. Herein, it is understood that by "modulation" or "modulating" is meant either an increase or a decrease in SMD activity. Alternatively, Staufen 1 can modulate mRNA transcripts through the stabilization or destabilization of an mRNA. Whether SMD levels are increased or decreased in a subject with a condition resulting from a mutation that generates a nonsense codon (including but not limited to a nonsense mutatation) depends on the particular mRNA that is affected, the binding of Staufenl and, where binding of Staul occurs. A decrease in SMD activity could increase the amount of mRNA that is available for translation. Thus, for example, modulation can be measured by, e.g., comparing the level of the mRNA harboring a premature or alternative termination codon relative to an unaffected cellular RNA to the level of that mRNA lacking a premature or alternative termination codon to the same unaffected cellular RNA. Subsequent nonsense suppression could be used to increase the amount of the encoded full-length protein. Conversely, an increase in SMD activity would decrease the amount of mRNA that is available for translation so as to reduce production of the encoded truncated protein. Thus, it is understood and herein contemplated that the disclosed methods can be used to modulate the expression of genes by modulating SMD (e.g., to decrease mRNA from a truncated protein, one would increase SMD activity. A decrease in SMD activity would be used to increase the amount of mRNA of a truncated protein available). Notably, SMD can also target mRNAs that do not have a premature or alternative termination codon, providing another means by which gene expression could be regulated.
49. Thus, for example, specifically disclosed are methods wherein the modulation is a decrease in Staul -mediated mRNA decay. A "decrease" can refer to any change that results in a smaller amount of Staul mRNA mediated decay. Thus, a "decrease" can refer to a reduction in an activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. In the case of a decrease in Staul mRNA mediated decay, it is understood and herein contemplated that a decrease can include, but is not limited to, a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction. A decrease can but does not have to result in the complete ablation of a substance or activity. Therefore, for example, a decrease in SMD would result in the presence of more gene products with early or alternative termination sites (i.e., a decrease in SMD activity). It is understood that the term "inhibits" or "inhibition" refers to any degree of decrease as compared to a control. Thus, for example, "inhibition" can refer to a 10%" 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction as compared to a control.
50. Also disclosed are methods wherein the modulation is an increase in Staul - mediated mRNA decay. An "increase" can refer to any change that results in a larger amount of a Staul mediated mRNA decay activity. Thus, for example, an increase in the amount in SMD of a particular mRNA can include but is not limited to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase. It is understood and herein contemplated that an increase in SMD would result in a subsequent decrease in the amount of gene products with early or alternative termination sites. 51. It is understood and herein contemplated that Staul can bind mRNA at AU rich elements (ARE). For example, it is contemplated that Staul binds mRNA at Type HI AREs. The binding of Staul to AREs can affect the level of gene expression for the mRNA transcript to which it binds. It is also understood and herein contemplated that the binding of Staul to AREs can have a stabilizing effect. Therefore, herein disclosed is the ability of Staul to bind stabilizing or destabilizing elements. Thus, herein contemplated are methods wherein the modulation of SMD results in the stabilization of mRNA. Also disclosed are methods wherein the modulation of SMD results in the destabilization of mRNA.
52. Therefore, herein disclosed are methods of treating a disorder in a subject comprising administering to the subject a substance, wherein the substance modulates Staul -mediated mRNA decay. Modulation of Staul -mediated mRNA decay can result in a decrease in SMD. The decrease in SMD would increase the abundance of the nRNA containing a premature or alternative termination codon.
53. It is understood and herein contemplated that the disclosed methods can be used to modulate the level of mRNA or protein expression. It is also understood and herein contemplated that Staul can increase or decrease the abundance of an mRNA independently of SMD. Likewise, it is understood and herein contemplated that not all SMD activity occurs through the involvement of Staul and Upfl, but can be Upfl independent. By "modulating the level of mRNA" is meant that the abundance of a target transcript can be increased or decreased by the expression of Staul . The ability to modulate the abundance of target genes can be achieved in conjunction with or independently of Upfl . It is understood that such effect can be either direct or indirect. By "direct effect" is meant that Staul acts on the targeted mRNA itself and by "indirect effect" is meant that Staul acts by an intermediary, including for example, a nucleic acid. Thus, Staul down-regulation can result either directly or indirectly in the down reulation of target mRNA levels. It is understood that whether the effect is direct or indirect will depend on the target gene. One of skill in the art will be able to determine whether the effect is direct or indirect given the target gene. Thus specifically disclosed and herein contemplated are methods of identifying genes modulated by the down-regulation of Staul comprising a) incubating a substance that down- regulates SMD with a stably transfected cell comprising a reporter gene with a nonsense- mutation and Staul, and b) assaying the amount of mRNA present for a gene of a microarray, wherein a increase or decrease in the amount of mRNA relative to the amount of mRNA in the absence of the substance indicates a gene that is modulated by Staul activity. It is understood that these methods can be used to identify genes that are up- regulated or down regulated by the down-regulation of Staul as well as identify those genes whose abundance increases or decreases with the down-regulation of Staul . It is understood and herein contemplated that one example of a substance that can down regulate SMD is small interfering RNA (siRNA) to a componenet of SMD such as Staul or Upfl. Thus, for example, disclosed herein are methods of identifying genes modulated by the down- regulation of Staul comprising a) transfecting a small interfering RNA (siRNA) that down- regulates SMD into a cell comprising Staul and one or more selected genes comprising one or more nonsense-mutations, and b) assaying the amount of protein expressed of the gene being screened or mRNA present for the gene being screened, wherein a increase or decrease in the amount of protein or mRNA relative to the amount of protein or mRNA in the absence of the siRNA indicates a gene that is modulated by Staul activity. In these methods, the siRNA can be for example, Staul siRNA. The methods can also be used to identify genes that are stabilized or destabilized by the down-regulation of Staul.
54. Although Staul can modulate mRNA levels independently of Upfl and SMD, dependent modulation can also occur. Thus, disclosed herein are methods of identifying genes modulated by the down-regulation of Upfl comprising a) transfecting a small interfering RNA (siRNA) that down-regulates SMD into a cell comprising Upfl and one or more selected genes comprising one or more nonsense-mutations, and b) assaying the amount of protein expressed of the gene being screened or mRNA present for the gene being screened, wherein a increase or decrease in the amount of protein or mRNA relative to the amount of protein or mRNA in the absence of the siRNA indicates a gene that is modulated by Upfl activity. Also disclosed are method of identifying genes modulated by the down- regulation of SMD comprising a) transfecting a small interfering RNA (siRNA) that down- regulates SMD into a cell comprising UPfI, Staul, and one or more selected genes comprising one or more nonsense-mutations, and b) assaying the amount of protein expressed of the gene being screened or mRNA present for the gene being screened, wherein a increase or decrease in the amount of protein or mRNA relative to the amount of protein or mRNA in the absence of the siRNA indicates a gene that is modulated by SMD activity. It is understood that the siRNA can be, for example, Upfl siRNA or Staul siRNA.
55. Various assays are known in the art that can be used to measure mRNA levels or protein expression. For example, mRNA levels can be measured by microarray or RT-PCR.
Protein expression can be measured by Western blot. It is understood and herein contemplated that the disclosed methods of identifying genes can be used with any method of measuring preotein expression or mRNA levels known to those of skill in the art.
56. Also disclosed are methods of modulating the level of an mRNA comprising administering to a subject an effective amount of a substance that modulates Staul, wherein the modulation Staul directly or indirectly modulates the mRNA. Also disclosed are methods of treating a disorder in a subject comprising administering to the subject a substance, wherein the substance modulates Staul wherein the modulation of Staul modulates that level of mRNA abundance of another gene.
57. The disclosed methods make use of substances administered to a subject to achieve a desired effect. It is understood and herein contemplated that "substance" can refer to any agent, compound, functional nucleic acid, siRNA, peptide, protein, antibody, or small molecule. Thus, for example, one embodiment of the disclosed methods is a method of treating a subject with a substance, wherein the substance is Staul or a complex comprising Staul and Upfl. It is understood that by "SMD complex" is any combination of one or more of the essential components of SMD. Such administration can be direct or indirect. For example, the Staul can be administered directly or by transferr with a subject with a Staul encoding nucleic acid or by administering to the subject a compound that modulates SMD.
58. Also disclosed is a substance that modulates SMD, wherein the substance is an antibody or fragment thereof that modulates SMD. For example, the antibody can be an antibody that binds Upfl or Staul and affects SMD activity. Thus, specifically disclosed is antibody, wherein the antibody binds Staul. Also disclosed is an antibody, wherein the antibody binds Upfl . 59. A substance that modulates SMD can also be a nucleic acid. Therefore specifically disclosed and herein contemplated is a substance, wherein the substance is a vector comprising a nucleic acid that encodes an SMD modulator. Also disclosed is a vector comprising a nucleic acid that encodes an SMD modulator. Also disclosed is a cell comprising the disclosed vectors.
60. Thus specifically contemplated and disclosed herein is a substance that modulates SMD, wherein the substance is an siRNA that modulates SMD. It is understood that the siRNA can bind any factor that modulates SMD. For example, specifically disclosed is an siRNA, wherein the siRNA binds Upfl . Also disclosed is a substance comprising siRNA, wherein the siRNA binds Staul .
61. Thus, specifically disclosed are methods of treating a Staul -mediated mRNA decay related disorder in a subject comprising administering to the subject Staul or a complex comprising Staul and Upfl. Also disclosed are methods, wherein the substance binds Upfl or Staul. As used herein, "binds" or "interacts" means to affect a substance either directly or indirectly through cooperative function, competitive inhibition, non¬ competitive inhibition, binding, or contacting the substance, a target molecule, an accessory molecule, or alternative portion of a system so as to effect at least one function. The interaction can be stimulatory or cooperative in nature having an additive or synergistic effect. The interaction can also result in the inhibition of a process or target molecule. 62. Specifically disclosed herein are methods of facilitating Staul -mediated mRNA decay comprising contacting a system comprising the components for SMD with Staul. Also disclosed are methods of facilitating Staul -mediated mRNA decay comprising contacting with Upfl a system, wherein the system comprises the components for SMD. Also disclosed are methods of facilitating Staul -mediated mRNA decay comprising contacting with Staul and Upfl, a system comprising the components for SMD. The combination of Staul and Upfl ccan be simultaneous or sequential.
63. As described above, the compositions can also be administered in vivo in a pharmaceutically acceptable carrier. By "pharmaceutically acceptable" is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject, along with the nucleic acid or vector, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained. The carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.
64. The compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, although topical intranasal administration or administration by inhalant is typically preferred. As used herein, "topical intranasal administration" means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector. The latter may be effective when a large number of animals is to be treated simultaneously. Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism. Delivery can also be directly to any area of the respiratory system (e.g., lungs) via intubation. The exact amount of the compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.
65. Parenteral administration of the composition, if used, is generally characterized by injection. Iηjectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions. A more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein. 66. The materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol, 42:2062- 2065, (1991)). Vehicles such as "stealth" and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). In general, receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes. The internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).
67. The compositions, including antibodies, can be used therapeutically in combination with a pharmaceutically acceptable carrier. 68. Pharmaceutical carriers are known to those skilled in the art. These most typically would be standard carriers for administration of drugs to humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH. The compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art. 69. Pharmaceutical compositions may include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice. Pharmaceutical compositions may also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like.
70. The pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be topically (including ophthalmically, vaginally, rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection. The disclosed antibodies or other agents can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, or transdermally.
71. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like.
Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
72. Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
73. Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable.
74. Some of the compositions may potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
75. The dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms disorder are effected. The dosage should not be so large as to cause adverse side effects, such as unwanted cross- reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any counterindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days.
76. The disclosed methods and compositions can also be used for example as tools to isolate and test new drug candidates for a variety of diseases. They can also be used for the continued isolation and study, for example, the cell cycle. There use as exogenous DNA delivery devices can be expanded for nearly any reason desired by those of skill in the art.
77. The disclosed compositions and methods can be used to evaluate the expression of genes involved in SMD and in particular in or as a result of the pioneer round of translation. Specifically contemplated are methods wherein mRNA from a system comprising a nonsense-mutation is assayed using a micro array. Genes identified as having significantly (as determined by the manufacturers specifications of the array) increased or decreased expression are comodulators of SMD.
78. Disclosed are chips where at least one address is the sequences or part of the sequences set forth in any of the nucleic acid sequences disclosed herein. Also disclosed are chips where at least one address is the sequences or portion of sequences set forth in any of the peptide sequences disclosed herein.
79. Also disclosed are chips where at least one address is a variant of the sequences or part of the sequences set forth in any of the nucleic acid sequences disclosed herein. Also disclosed are chips where at least one address is a variant of the sequences or portion of sequences set forth in any of the peptide sequences disclosed herein.
80. A substance that is able to modulate SMD is useful for the treatment and study of SMD related disorders. Thus, specifically disclosed are methods of screening for a substance that modulates Staul -mediated mRNA decay (SMD) comprising incubating the substance to be screened with a Staul mRNA decay complex and assaying for a change in SMD. An increase or decrease in SMD activity indicates a modulating substance. It is understood that by "SMD complex" is any combination of one or more of the essential components of SMD. Thus, for example, specifically disclosed are screening methods wherein the complex comprises Upfl and Staul. Also disclosed are screening methods wherein the complex comprises one of Upfl and Staul. 81. Disclosed is a method of screening for a substance that modulates Staul - mediated mRNA decay (SMD) comprising incubating the substance to be screened with a stably transfected cell comprising a reporter gene with a nonsense-mutation and Staul, and assaying the amount of SMD in the cell, wherein a increase or decrease in the amount of mRNA relative to the amount of mRNA in the absence of the substance indicates a substance that modulates SMD activity. Therefore, specifically disclosed are methods of screening for a substance that inhibits Staul -mediated mRNA decay (SMD) comprising incubating the substance with Upfl and Staul forming a substance-Upfl -Staul mixture, and assaying the amount of Upfl -Staul complex present in the mixture, a decrease in the amount of Upfl-Staulcomplex relative to the amount of Upfl -Staul complex in the absence of the substance indicating the substance inhibits SMD. Also disclosed are method of screening for a substance that promotes Staul -mediated mRNA decay (SMD) comprising incubating the substance with Upfl and Staul forming a substance- Upfl -Staul mixture, and assaying the amount of Upfl-Staul complex present in the mixture, wherein a increase in the amount of Upfl-Staul complex relative to the amount of Upfl-Staul complex in the absence of the substance indicates that the substance promotes SMD. It is understood that many fragments or minor variants of the disclosed Staul and Upfl proteins can be used in the disclosed methods. Thus, specifically disclosed are screening methods wherein the Staul has at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 2, or an SMD- active fragment thereof. Also disclosed are screening methods wherein the Upfl has at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 4, or an SMD- active fragment thereof.
82. Disclosed herein are methods of screening for a substance that modulates Staul- mediated mRNA decay (SMD) comprising, administering a substance to a system, wherein the system comprises the components for SMD activity, and assaying the effect of the substance on the amount of SMD activity in the system, a change in the amount of SMD activity present in the system compared to the amount of SMD activity in the system in the absence of the substance indicates the substance is a modulator. Thus, specifically contemplated and herein disclosed are methods of modulating Staul -mediated mRNA decay (SMD) activity comprising administering a substance, wherein the substance is identified by the disclosed screening methods. Also disclosed are methods of making a substance that modulates Staul -mediated mRNA decay (SMD) activity comprising admixing a substance identified by the disclosed screening methods with a pharmaceutically acceptable carrier. 83. The agents that can be used to modulate SMD can function by inhibiting the binding of Staul to its binding site. For example, a substance that competitively binds a Staul binding site can inhibit SMD. Therefore, specifically disclosed are methods of identifying an agent that binds a Staul binding site comprising contacting the agent to be screened with the Staul binding site. Also disclosed are methods of identifying an agent that binds a Staul binding site wherein the Staul binding site comprises SEQ ID NO: 56.
84. The disclosed compositions can be used as targets for any combinatorial technique to identify molecules or macromolecular molecules that interact with the disclosed compositions in a desired way. The nucleic acids, peptides, and related molecules disclosed herein can be used as targets for the combinatorial approaches. Also disclosed are the compositions that are identified through combinatorial techniques or screening techniques in which the compositions disclosed in SEQ ID NOS:1, 2, 3, 4, and 56 or portions thereof, are used as the target in a combinatorial or screening protocol. 85. It is understood that when using the disclosed compositions in combinatorial techniques or screening methods, molecules, such as macromolecular molecules, will be identified that have particular desired properties such as inhibition or stimulation or the target molecule's function. The molecules identified and isolated when using the disclosed compositions, such as, Staul, are also disclosed. Thus, the products produced using the combinatorial or screening approaches that involve the disclosed compositions, such as, Staul, are also considered herein disclosed.
86. Combinatorial chemistry includes but is not limited to all methods for isolating small molecules or macromolecules that are capable of binding either a small molecule or another macromolecule, typically in an iterative process. Proteins, oligonucleotides, and sugars are examples of macromolecules. For example, oligonucleotide molecules with a given function, catalytic or ligand-binding, can be isolated from a complex mixture of random oligonucleotides in what has been referred to as "in vitro genetics" (Szostak, TIBS 19:89, 1992). One synthesizes a large pool of molecules bearing random and defined sequences and subjects that complex mixture, for example, approximately 1015 individual sequences in 100 μg of a 100 nucleotide RNA, to some selection and enrichment process. Through repeated cycles of affinity chromatography and PCR amplification of the molecules bound to the ligand on the column, Ellington and Szostak (1990) estimated that 1 in 1010 RNA molecules folded in such a way as to bind a small molecule dyes. DNA molecules with such ligand-binding behavior have been isolated as well (Ellington and Szostak, 1992; Bock et al, 1992). Techniques aimed at similar goals exist for small organic molecules, proteins, antibodies and other macromolecules known to those of skill in the art. Screening sets of molecules for a desired activity whether based on small organic libraries, oligonucleotides, or antibodies is broadly referred to as combinatorial chemistry. Combinatorial techniques are particularly suited for defining binding interactions between molecules and for isolating molecules that have a specific binding activity, often called ap tamers when the macromolecules are nucleic acids.
87. There are a number of methods for isolating proteins which either have de novo SMD activity or a modified activity. For example, phage display libraries have been used to isolate numerous peptides that interact with a specific target. (See for example, United States Patent No. 6,031,071; 5,824,520; 5,596,079; and 5,565,332 which are herein incorporated by reference at least for their material related to phage display and methods relate to combinatorial chemistry) 88. A preferred method for isolating proteins that have a given function is described by Roberts and Szostak (Roberts R.W. and Szostak J.W. Proc. Natl. Acad. Sci. USA, 94(23)12997-302 (1997). This combinatorial chemistry method couples the functional power of proteins and the genetic power of nucleic acids. An RNA molecule is generated in which a puromycin molecule is covalently attached to the 3 '-end of the RNA molecule. An in vitro translation of this modified RNA molecule causes the correct protein, encoded by the RNA to be translated. In addition, because of the attachment of the puromycin, a peptidyl acceptor which cannot be extended, the growing peptide chain is attached to the puromycin which is attached to the RNA. Thus, the protein molecule is attached to the genetic material that encodes it. Normal in vitro selection procedures can now be done to isolate functional peptides. Once the selection procedure for peptide function is complete traditional nucleic acid manipulation procedures are performed to amplify the nucleic acid that codes for the selected functional peptides. After amplification of the genetic material, new RNA is transcribed with puromycin at the 3 '-end, new peptide is translated and another functional round of selection is performed. Thus, protein selection can be performed in an iterative manner just like nucleic acid selection techniques. The peptide which is translated is controlled by the sequence of the RNA attached to the puromycin. This sequence can be anything from a random sequence engineered for optimum translation (i.e. no stop codons etc.) or it can be a degenerate sequence of a known RNA molecule to look for improved or altered function of a known peptide. The conditions for nucleic acid amplification and in vitro translation are well known to those of ordinary skill in the art and are preferably performed as in Roberts and Szostak (Roberts R. W. and Szostak J.W. Proc. Natl. Acad. Sci. USA, 94(23)12997-302 (1997)). 89. Another preferred method for combinatorial methods designed to isolate peptides is described in Cohen et al. (Cohen B.A.,et al., Proc. Natl. Acad. Sci. USA 95(24): 14272-7 (1998)). This method utilizes and modifies two-hybrid technology. Yeast two-hybrid systems are useful for the detection and analysis of protein:protein interactions. The two-hybrid system, initially described in the yeast Saccharomyces cerevisiae, is a powerful molecular genetic technique for identifying new regulatory molecules, specific to the protein of interest (Fields and Song, Nature 340:245-6 (1989)). Cohen et al. modified this technology so that novel interactions between synthetic or engineered peptide sequences could be identified which bind a molecule of choice. The benefit of this type of technology is that the selection is done in an intracellular environment. The method utilizes a library of peptide molecules that attached to an acidic activation domain.
90. Using methodology well known to those of skill in the art, in combination with various combinatorial libraries, one can isolate and characterize those small molecules or macromolecules, which bind to or interact with the desired target. The relative binding affinity of these compounds can be compared and optimum compounds identified using competitive binding studies, which are well known to those of skill in the art.
91. Techniques for making combinatorial libraries and screening combinatorial libraries to isolate molecules which bind a desired target are well known to those of skill in the art. Representative techniques and methods can be found in but are not limited to United States patents 5,084,824, 5,288,514, 5,449,754, 5,506,337, 5,539,083, 5,545,568, 5,556,762, 5,565,324, 5,565,332, 5,573,905, 5,618,825, 5,619,680, 5,627,210, 5,646,285, 5,663,046, 5,670,326, 5,677,195, 5,683,899, 5,688,696, 5,688,997, 5,698,685, 5,712,146, 5,721,099, 5,723,598, 5,741,713, 5,792,431, 5,807,683, 5,807,754, 5,821,130, 5,831,014, 5,834,195, 5,834,318, 5,834,588, 5,840,500, 5,847,150, 5,856,107, 5,856,496, 5,859,190, 5,864,010, 5,874,443, 5,877,214, 5,880,972, 5,886,126, 5,886,127, 5,891,737, 5,916,899, 5,919,955, 5,925,527, 5,939,268, 5,942,387, 5,945,070, 5,948,696, 5,958,702, 5,958,792, 5,962,337, 5,965,719, 5,972,719, 5,976,894, 5,980,704, 5,985,356, 5,999,086, 6,001,579, 6,004,617, 6,008,321, 6,017,768, 6,025,371, 6,030,917, 6,040,193, 6,045,671, 6,045,755, 6,060,596, and 6,061,636. 92. Combinatorial libraries can be made from a wide array of molecules using a number of different synthetic techniques. For example, libraries containing fused 2,4- pyrimidinediones (United States patent 6,025,371) dihydrobenzopyrans (United States Patent 6,017,768and 5,821,130), amide alcohols (United States Patent 5,976,894), hydroxy- amino acid amides (United States Patent 5,972,719) carbohydrates (United States patent 5,965,719), l,4-benzodiazepin-2,5-diones (United States patent 5,962,337), cyclics (United States patent 5,958,792), biaryl amino acid amides (United States patent 5,948,696), thiophenes (United States patent 5,942,387), tricyclic Tetrahydroquinolines (United States patent 5,925,527), benzofurans (United States patent 5,919,955), isoquinolines (United States patent 5,916,899), hydantoin and thiohydantoin (United States patent 5,859,190), indoles (United States patent 5,856,496), imidazol-pyrido-indole and imidazol-pyrido- benzothiophenes (United States patent 5,856,107) substituted 2-methylene-2, 3- dihydrothiazoles (United States patent 5,847,150), quinolines (United States patent 5,840,500), PNA (United States patent 5,831,014), containing tags (United States patent 5,721,099), polyketides (United States patent 5,712,146), morpholino-subunits (United States patent 5,698,685 and 5,506,337), sulfamides (United States patent 5,618,825), and benzodiazepines (United States patent 5,288,514).
93. As used herein combinatorial methods and libraries included traditional screening methods and libraries as well as methods and libraries used in interative processes.
94. The disclosed compositions can be used as targets for any molecular modeling technique to identify either the structure of the disclosed compositions or to identify potential or actual molecules, such as small molecules, which interact in a desired way with the disclosed compositions. The nucleic acids, peptides, and related molecules disclosed herein can be used as targets in any molecular modeling program or approach.
95. It is understood that when using the disclosed compositions in modeling techniques, molecules, such as macromolecular molecules, will be identified that have particular desired properties such as inhibition or stimulation or the target molecule's function. The molecules identified and isolated when using the disclosed compositions, such as, Staul and Upfl, are also disclosed. Thus, the products produced using the molecular modeling approaches that involve the disclosed compositions, such as, Staul and Upfl, are also considered herein disclosed.
96. Thus, one way to isolate molecules that bind a molecule of choice is through rational design. This is achieved through structural information and computer modeling.
Computer modeling technology allows visualization of the three-dimensional atomic structure of a selected molecule and the rational design of new compounds that will interact with the molecule. The three-dimensional construct typically depends on data from x-ray crystallographic analyses or NMR imaging of the selected molecule. The molecular dynamics require force field data. The computer graphics systems enable prediction of how a new compound will link to the target molecule and allow experimental manipulation of the structures of the compound and target molecule to perfect binding specificity. Prediction of what the molecule-compound interaction will be when small changes are made in one or both requires molecular mechanics software and computationally intensive computers, usually coupled with user-friendly, menu-driven interfaces between the molecular design program and the user.
97. Examples of molecular modeling systems are the CHARMm and QUANTA programs, Polygen Corporation, Waltham, MA. CHARMm performs the energy minimization and molecular dynamics functions. QUANTA performs the construction, graphic modeling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other. 98. A number of articles review computer modeling of drugs interactive with specific proteins, such as Rotivinen, et al., 1988 Acta Pharmaceutica Fennica 97, 159-166; Ripka, New Scientist 54-57 (June 16, 1988); McKinaly and Rossmann, 1989 Annu. Rev. Pharmacol. Toxiciol. 29, 111-122; Perry and Davies, QSAR: Quantitative Structure-Activity Relationships in Drug Design pp. 189-193 (Alan R. Liss, Inc. 1989); Lewis and Dean, 1989 Proc. R. Soc. Lond. 236, 125-140 and 141-162; and, with respect to a model enzyme for nucleic acid components, Askew, et al., 1989 J. Am. Chem. Soc. I l l, 1082-1090. Other computer programs that screen and graphically depict chemicals are available from companies such as BioDesign, Inc., Pasadena, CA., Allelix, Inc, Mississauga, Ontario, Canada, and Hypercube, Inc., Cambridge, Ontario. Although these are primarily designed for application to drugs specific to particular proteins, they can be adapted to design of molecules specifically interacting with specific regions of DNA or RNA, once that region is identified.
99. Although described above with reference to design and generation of compounds which could alter binding, one could also screen libraries of known compounds, including natural products or synthetic chemicals, and biologically active materials, including proteins, for compounds which alter substrate binding or enzymatic activity.
100. The term "antibodies" is used herein in a broad sense and includes both polyclonal and monoclonal antibodies. In addition to intact immunoglobulin molecules, also included in the term "antibodies" are fragments or polymers of those immunoglobulin molecules, and human or humanized versions of immunoglobulin molecules or fragments thereof, as described herein. The antibodies are tested for their desired activity using the in vitro assays described herein, or by analogous methods, after which their in vivo therapeutic and/or prophylactic activities are tested according to known clinical testing methods.
101. The term "monoclonal antibody" as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies within the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules. The monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired antagonistic activity (See, U.S. Pat. No. 4,816,567 and Morrison et al., Proc. Natl. Acad. ScL USA, 81:6851-6855 (1984)).
102. Monoclonal antibodies of the invention can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method, a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro, e.g., using the Staul or Upfl described herein.
103. The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567 (Cabilly et al.). DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). Libraries of antibodies or active antibody fragments can also be generated and screened using phage display techniques, e.g., as described in U.S. Patent No. 5,804,440 and U.S. Patent No. 6,096,441.
104. In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be Ii ϋ Il ..; Ui S υ :.:::» ,/ „;„& !';,:* H, J ...Ii IL. accomplished using routine techniques known in the art. For instance, digestion can be performed using papain. Examples of papain digestion are described in WO 94/29348 and U.S. Pat. No. 4,342,566. Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields a fragment that has two antigen combining sites and is still capable of cross-linking antigen.
105. The fragments, whether attached to other sequences or not, can also include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the antibody or antibody fragment is not significantly altered or impaired compared to the non-modified antibody or antibody fragment. These modifications can provide for some additional property, such as to remove/add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc. In any case, the antibody or antibody fragment must possess a bioactive property, such as specific binding to its cognate antigen. Functional or active regions of the antibody or antibody fragment may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide. Such methods are readily apparent to a skilled practitioner in the art and can include site-specific mutagenesis of the nucleic acid encoding the antibody or antibody fragment. (Zoller, MJ. Curr. Opin. Biotechnol. 3:348-354, 1992). 106. As used herein, the term "antibody" or "antibodies" can also refer to a human antibody and/or a humanized antibody. Many non-human antibodies (e.g., those derived from mice, rats, or rabbits) are naturally antigenic in humans, and thus can give rise to undesirable immune responses when administered to humans. Therefore, the use of human or humanized antibodies in the methods of the invention serves to lessen the chance that an antibody administered to a human will evoke an undesirable immune response.
107. The human antibodies of the invention can be prepared using any technique. Examples of techniques for human monoclonal antibody production include those described by Cole et al. {Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77, 1985) and by Boemer et al. (J. Immunol., 147(l):86-95, 1991). Human antibodies of the invention (and fragments thereof) can also be produced using phage display libraries (Hoogenboom et al., J. MoI. Biol, 227:381, 1991; Marks et al., J. MoI. Biol, 222:581, 1991).
108. The human antibodies of the invention can also be obtained from transgenic animals. For example, transgenic, mutant mice that are capable of producing a full j| , „ „„, repertoire of human antibodies, in response to immunization, have been described (see, e.g.,
Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551-255 (1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann et al., Year in Immunol, 7:33 (1993)). Specifically, the homozygous deletion of the antibody heavy chain joining region (J (H)) gene in these chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production, and the successful transfer of the human germ-line antibody gene array into such germ-line mutant mice results in the production of human antibodies upon antigen challenge. Antibodies having the desired activity are selected using Env-CD4-co-receptor complexes as described herein. 109. Antibody humanization techniques generally involve the use of recombinant
DNA technology to manipulate the DNA sequence encoding one or more polypeptide chains of an antibody molecule. Accordingly, a humanized form of a non-human antibody (or a fragment thereof) is a chimeric antibody or antibody chain (or a fragment thereof, such as an Fv, Fab, Fab', or other antigen-binding portion of an antibody) which contains a portion of an antigen binding site from a non-human (donor) antibody integrated into the framework of a human (recipient) antibody.
110. To generate a humanized antibody, residues from one or more complementarity determining regions (CDRs) of a recipient (human) antibody molecule are replaced by residues from one or more CDRs of a donor (non-human) antibody molecule that is known to have desired antigen binding characteristics (e.g., a certain level of specificity and affinity for the target antigen). In some instances, Fv framework (FR) residues of the human antibody are replaced by corresponding non-human residues. Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. Humanized antibodies generally contain at least a portion of an antibody constant region (Fc), typically that of a human antibody (Jones et al., Nature, 321 :522-525 (1986), Reichmann et al., Nature, 332:323-327 (1988), and Presta, Curr. Opin. Struct. Biol, 2:593-596 (1992)).
111. Methods for humanizing non-human antibodies are well known in the art. For example, humanized antibodies can be generated according to the methods of Winter and co-workers (Jones et al., Nature, 321:522-525 (1986), Riechmann et al., Nature, 332:323-327 (1988), Verhoeyen et al., Science, 239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Methods that can be used to produce humanized antibodies are also described in U.S. Patent No. 4,816,567, U.S. Patent No. 5,565,332, U.S. Patent No. 5,721,367, U.S. Patent No. 5,837,243, U.S. Patent No. 5, 939,598, U.S. Patent No. 6,130,364, and U.S. Patent No. 6,180,377.
112. Antibodies of the invention are preferably administered to a subject in a pharmaceutically acceptable carrier as described above. Effective dosages and schedules for administering the antibodies may be determined empirically, and making such determinations is within the skill in the art. Those skilled in the art will understand that the dosage of antibodies that must be administered will vary depending on, for example, the subject that will receive the antibody, the route of administration, the particular type of antibody used and other drugs being administered. Guidance in selecting appropriate doses for antibodies is found in the literature on therapeutic uses of antibodies, e.g., Handbook of Monoclonal Antibodies, Ferrone et al., eds., Noges Publications, Park Ridge, NJ., (1985) ch. 22 and pp. 303-357; Smith et al., Antibodies in Human Diagnosis and Therapy, Haber et al., eds., Raven Press, New York (1977) pp. 365-389. A typical daily dosage of the antibody used alone might range from about 1 μg/kg to up to 100 mg/kg of body weight or more per day, depending on the factors mentioned above.
113. Following administration of an antibody for treating, inhibiting, or preventing a condition, the efficacy of the therapeutic antibody can be assessed in various ways well known to the skilled practitioner. Specifically, SMD can be assessed directly or indirectly as taught herein. 114. In the methods described above which include the administration and uptake of exogenous DNA into the cells of a subject (i.e., gene transduction or transfection), the nucleic acids of the present invention can be in the form of naked DNA or RNA, or the nucleic acids can be in a vector for delivering the nucleic acids to the cells, whereby the antibody-encoding DNA fragment is under the transcriptional regulation of a promoter, as would be well understood by one of ordinary skill in the art. The vector can be a commercially available preparation, such as an adenovirus vector (Quantum Biotechnologies, Inc. (Laval, Quebec, Canada). Delivery of the nucleic acid or vector to cells can be via a variety of mechanisms. As one example, delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WI), as well as other liposomes developed according to procedures standard in the art. In addition, the nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (ImaRx Pharmaceutical Corp., Tucson, AZ).
115. As one example, vector delivery can be via a viral system, such as a retroviral vector system which can package a recombinant retroviral genome (see e.g., Pastan et al., Proc. Natl. Acad. ScL U.S.A. 85:4486, 1988; Miller et al., MoI. Cell. Biol.
6:2895, 1986). The recombinant retrovirus can then be used to infect and thereby deliver to the infected cells nucleic acid encoding a broadly neutralizing antibody (or active fragment thereof) of the invention. The exact method of introducing the altered nucleic acid into mammalian cells is, of course, not limited to the use of retroviral vectors. Other techniques are widely available for this procedure including the use of adenoviral vectors (Mitani et al., Hum. Gene Ther. 5:941-948, 1994), adeno-associated viral (AAV) vectors (Goodman et al., Blood 84:1492-1500, 1994), lentiviral vectors (Naidini et al., Science 272:263-267, 1996), pseudotyped retroviral vectors (Agrawal et al., Exper. Hematol. 2A:12>Z-1A1, 1996). Physical transduction techniques can also be used, such as liposome delivery and receptor- mediated and other endocytosis mechanisms (see, for example, Schwartzenberger et al., Blood 87:472-478, 1996). This invention can be used in conjunction with any of these or other commonly used gene transfer methods.
116. As one example, if the antibody-encoding nucleic acid of the invention is delivered to the cells of a subject in an adenovirus vector, the dosage for administration of adenovirus to humans can range from about 107 to 109 plaque forming units (pfu) per injection but can be as high as 1012 pfu per injection (Crystal, Hum. Gene Ther. 8:985-1001, 1997; Alvarez and Curiel, Hum. Gene Ther. 8:597-613, 1997). A subject can receive a single injection, or, if additional injections are necessary, they can be repeated at six month intervals (or other appropriate time intervals, as determined by the skilled practitioner) for an indefinite period and/or until the efficacy of the treatment has been established.
117. Parenteral administration of the nucleic acid or vector of the present invention, if used, is generally characterized by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for P Il I! / U :!3 U :::::» ■•■ „:::!; :::::» Ul .1. ,1, solution of suspension in liquid prior to injection, or as emulsions. A more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein. For additional discussion of suitable formulations and various routes of administration of therapeutic compounds, see, e.g., Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995.
118. Disclosed are the components to be used to prepare the disclosed compositions as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular Staul or Upfl is disclosed and discussed and a number of modifications that can be made to a number of molecules including the Staul or Upfl are discussed, specifically contemplated is each and every combination and permutation of Staul and Upfl and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.
119. As used throughout, when reference is made to a particular protein or nucleic acid, some variation in amino acid or nucleotide sequence is expected without a substantial decline in function. Thus, Staul can include proteins or nucleic acid sequences having at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ED NO: 1 or 2, or fragment thereof. Also disclosed are methods of the invention, wherein the Upfl or a nucleic acid encoding Upfl has at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 3 or 4, or fragment thereof.
120. It is understood that one way to define any known variants and derivatives or those that might arise, of the disclosed genes and proteins herein is through defining the variants and derivatives in terms of homology to specific known sequences. For example SEQ ID NO: 1 sets forth a particular sequence of a Staul encoding nucleic acid, and SEQ ID NO: 2 sets forth a particular sequence of the protein encoded by SEQ ID NO: 1, an Staul protein. Specifically disclosed are variants of these and other genes and proteins herein disclosed which have at least, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent homology to the stated sequence. Those of skill in the art readily understand how to determine the homology of two proteins or nucleic acids, such as genes. For example, the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
121. Another way of calculating homology can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.
122. The same types of homology can be obtained for nucleic acids by for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment.
123. There are a variety of molecules disclosed herein that are nucleic acid based, including for example the nucleic acids that encode, for example Staul and Upfl, as well as various functional nucleic acids. The disclosed nucleic acids are made up of, for example, nucleotides, nucleotide analogs, or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. It is understood that for example, when a vector is expressed in a cell, that the expressed mRNA will typically be made up of A, C, G, and U. Likewise, it is understood that if, for example, an antisense molecule is introduced into a cell or cell environment through for example exogenous delivery, it is advantagous that the antisense molecule be made up of nucleotide analogs that reduce the degradation of the antisense molecule in the cellular environment.
124. A nucleotide is a molecule that contains a base moiety, a sugar moiety and a phosphate moiety. Nucleotides can be linked together through their phosphate moieties and sugar moieties creating an internucleoside linkage. The base moiety of a nucleotide can be adenin-9-yl (A), cytosin-1-yl (C), guanin-9-yl (G), uracil- 1-yl (U), and thymin-1-yl (T). The sugar moiety of a nucleotide is a ribose or a deoxyribose. The phosphate moiety of a nucleotide is pentavalent phosphate. An non-limiting example of a nucleotide would be 3'- AMP (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate).
125. A nucleotide analog is a nucleotide which contains some type of modification to either the base, sugar, or phosphate moieties. Modifications to the base moiety would include natural and synthetic modifications of A, C, G, and T/U as well as different purine or pyrimidine bases, such as uracil-5-yl (.psi.), hypoxanthin-9-yl (T), and 2-aminoadenin-9-yl. A modified base includes but is not limited to 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Additional base modifications can be found for example in U.S. Pat. No. 3,687,808, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993. Certain nucleotide analogs, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine can increase the stability of duplex formation. Often time base modifications can be combined with for example a sugar modifcation, such as 2'-O- methoxyethyl, to achieve unique properties such as increased duplex stability. There are numerous United States patents such as 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, which detail and describe a range of base modifications. Each of these patents is herein incorporated by reference.
126. Nucleotide analogs can also include modifications of the sugar moiety. Modifications to the sugar moiety would include natural modifications of the ribose and deoxy ribose as well as synthetic modifications. Sugar modifications include but are not limited to the following modifications at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-0-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to Qo, alkyl or C2 to Ci0 alkenyl and alkynyl. 2' sugar modiifcations also include but are not limited to -O[(CH2)n O]m CH3, -O(CH2)n OCH3, -O(CH2)n NH2, -O(CH2)n CH3, -O(CH2)n -ONH2, and -O(CH2)nON[(CH2)n CH3)J2, where n and m are from 1 to about 10.
127. Other modifications at the 2' position include but are not limted to: Ci to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2 CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. Similar modifications may also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Modified sugars would also include those that contain modifications at the bridging ring oxygen, such as CH2 and S. Nucleotide sugar analogs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. There are numerous United States patents that teach the preparation of such modified sugar structures such as 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is herein incorporated by reference in its entirety. 128. Nucleotide analogs can also be modified at the phosphate moiety. Modified phosphate moieties include but are not limited to those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl phosphonates including 3'-alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. It is understood that these phosphate or modified phosphate linkage between two nucleotides can be through a 3'-5' linkage or a 2'-5' linkage, and the linkage can contain inverted polarity such as 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. Numerous United States patents teach how to make and use nucleotides containing modified phosphates and include but are not limited to, 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference.
129. It is understood that nucleotide analogs need only contain a single modification, but may also contain multiple modifications within one of the moieties or between different moieties.
130. Nucleotide substitutes are molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes are molecules that will recognize nucleic acids in a Watson- Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structure when interacting with the appropriate target nucleic acid.
131. Nucleotide substitutes are nucleotides or nucleotide analogs that have had the phosphate moiety and/or sugar moieties replaced. Nucleotide substitutes do not contain a standard phosphorus atom. Substitutes for the phosphate can be for example, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones;formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Numerous United States patents disclose how to make and use these types of phosphate replacements and ϊnclude'bu't are'not limited to ' ^034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
132. It is also possible to link other types of molecules (conjugates) to nucleotides or nucleotide analogs to enhance for example, cellular uptake. Conjugates can be chemically linked to the nucleotide or nucleotide analogs. Such conjugates include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937. Numerous United States patents teach the preparation of such conjugates and include, but are not limited to U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538;
5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference. 133. There are a variety of sequences related to the Staul and UpΩ gene having the following Genbank Accession Numbers: BC050432 and NM_002911, respectively. These sequences and others are herein incorporated by reference in their entireties as well as for individual subsequences contained therein. 134. One particular sequence set forth in SEQ ID NO: 1 and having Genbank accession number BC050432 is used herein, as an example, to exemplify the disclosed compositions and methods. It is understood that the description related to this sequence is applicable to any sequence related to Staul unless specifically indicated otherwise. Those of skill in the art understand how to resolve sequence discrepancies and differences and to adjust the compositions and methods relating to a particular sequence to other related sequences (i.e. sequences of Upfl). Primers and/or probes can be designed for any Staul or Upfl sequence given the information disclosed herein and known in the art.
135. Functional nucleic acids are nucleic acid molecules that have a specific function, such as binding a target molecule or catalyzing a specific reaction. Functional nucleic acid molecules can be divided into the following categories, which are not meant to be limiting. For example, functional nucleic acids include antisense molecules, aptamers, ribozymes, triplex forming molecules, and external guide sequences. The functional nucleic acid molecules can act as affectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules.
136. Antisense molecules are designed to interact with a target nucleic acid molecule through either canonical or non-canonical base pairing. The interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNAseH mediated RNA-DNA hybrid degradation. Alternatively the antisense molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. Numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule exist. Exemplary methods would be in vitro selection experiments and DNA modification studies using DMS and DEPC. It is preferred that antisense molecules bind the target molecule with a dissociation constant (kd) less than 10"6. It is more preferred that antisense molecules bind with a kd less than 10"8. It is also more preferred that the antisense molecules bind the target moelcule with a kd less than 10"10. It is S-" i,;; Ii / 11...11 :;» u a../ ,3 !b. u ,;.»,. ,:;«.. also preferred that the antisense molecules bind the target molecule with a kd less than 10" . A representative sample of methods and techniques which aid in the design and use of antisense molecules can be found in the following non-limiting list of United States patents: 5,135,917, 5,294,533, 5,627,158, 5,641,754, 5,691,317, 5,780,607, 5,786,138, 5,849,903, 5,856,103, 5,919,772, 5,955,590, 5,990,088, 5,994,320, 5,998,602, 6,005,095, 6,007,995, 6,013,522, 6,017,898, 6,018,042, 6,025,198, 6,033,910, 6,040,296, 6,046,004, 6,046,319, and 6,057,437.
137. Aptamers are molecules that interact with a target molecule, preferably in a specific way. Typically aptamers are small nucleic acids ranging from 15-50 bases in length that fold into defined secondary and tertiary structures, such as stem-loops or G-quartets. Aptamers can bind small molecules, such as ATP (United States patent 5,631,146) and theophiline (United States patent 5,580,737), as well as large molecules, such as reverse transcriptase (United States patent 5,786,462) and thrombin (United States patent 5,543,293). Aptamers can bind very tightly with kdS from the target molecule of less than 10"12 M. It is preferred that the aptamers bind the target molecule with a kd less than 10"6. It is more preferred that the aptamers bind the target molecule with a kd less than 10" . It is also more preferred that the aptamers bind the target molecule with a k<j less than 10"10. It is also preferred that the aptamers bind the target molecule with a kd less than 10'12. Aptamers can bind the target molecule with a very high degree of specificity. For example, aptamers have been isolated that have greater than a 10000 fold difference in binding affinities between the target molecule and another molecule that differ at only a single position on the molecule (United States patent 5,543,293). It is preferred that the aptamer have a kd with the target molecule at least 10 fold lower than the kd with a background binding molecule. It is more preferred that the aptamer have a kd with the target molecule at least 100 fold lower than the kd with a background binding molecule. It is more preferred that the aptamer have a kd with the target molecule at least 1000 fold lower than the kd with a background binding molecule. It is preferred that the aptamer have a kd with the target molecule at least 10000 fold lower than the kd with a background binding molecule. It is preferred when doing the comparison for a polypeptide for example, that the background molecule be a different polypeptide. Representative examples of how to make and use aptamers to bind a variety of different target molecules can be found in the following non-limiting list of United States patents: 5,476,766, 5,503,978, 5,631,146, 5,731,424 , 5,780,228, 5,792,613, F Il Il / IUi :'3 IUi :::::n ,,' ,.::;i; 1Ia U ...Il L
5,795,721, 5,846,713, 5,858,660 , 5,861,254, 5,864,026, 5,869,641, 5,958,691, 6,001,988,
6,011,020, 6,013,443, 6,020,130, 6,028,186, 6,030,776, and 6,051,698.
138. It is understood herein that "siRNA" referes to double-stranded RNAs that can induce sequence-specific post-transcriptional gene silencing, thereby decreasing or even inhibiting gene expression. In one example, an siRNA triggers the specific degradation of homologous RNA molecules, such as mRNAs, within the region of sequence identity between both the siRNA and the target RNA. For example, WO 02/44321 discloses siRNAs capable of sequence-specific degradation of target mRNAs when base-paired with 3' overhanging ends. The direction of dsRNA processing determines whether a sense or an antisense target RNA can be cleaved by the produced siRNA endonuclease complex. Thus, siRNAs can be used to modulate transcription, for example, by silencing genes such as Staul and Upfl . The effects of siRNAs have been demonstrated in cells from a variety of organisms, including Drosophila, C. elegans, insects, frogs, plants, fungi, mice and humans (for example, WO 02/44321; Gitlin et al., Nature 418:430-4, 2002; Caplen et al., Proc. Natl. Acad. Sci. 98:9742-9747, 2001 ; and Elbashir et al., Nature 411 :494-8, 2001). In certain examples, siRNAs are directed against certain target genes to down regulate gene expression. For example, Staul or Upfl expression can be down regulated by specifically targeting the siRNA to Staul or Upfl.
139. As discussed herein there are numerous variants of the Staul protein and Upfl protein that are known and herein contemplated. In addition, to the known functional Staul and Upfl strain variants, there are derivatives of the Staul and Upfl proteins which also function in the disclosed methods and compositions. Protein variants and derivatives are well understood to those of skill in the art and in can involve amino acid sequence modifications. For example, amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional or deletional variants. Insertions include amino and/or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues. Immunogenic fusion protein derivatives, such as those described in the examples, are made by fusing a polypeptide sufficiently large to confer immunogenicity to the target sequence by cross-linking in vitro or by recombinant cell culture transformed with DNA encoding the fusion. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any p il Il ,• II...I' :::::iι iι,..ιι :::::n / „..:!. :r..:n u ,.,»„ Ji,, one site within the protein molecule. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example M 13 primer mutagenesis and PCR mutagenesis. Amino acid substitutions are typically of single residues, but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues. Deletions or insertions preferably are made in adjacent pairs, i.e. a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. The mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional variants are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Tables 1 and 2 and are referred to as conservative substitutions.
140. TABLE 1 : Amino Acid Abbreviations
Figure imgf000046_0001
U iu Ii / 1U1 ;::::iι u :::::» ,.■■ :ι>
Figure imgf000047_0001
141. Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in the protein properties will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g. leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine, in this case, (e) by increasing the number of sites for sulfation and/or glycosylation.
142. For example, the replacement of one amino acid residue with another that is biologically and/or chemically similar is known to those skilled in the art as a conservative H-" Ii Ii ,.• 'i..,!' .::;:n u,..n :::;» .■■• .3 ,;:::ι> u ,,,ιι ii,, substitution. For example, a conservative substitution would be replacing one hydrophobic residue for another, or one polar residue for another. The substitutions include combinations such as, for example, GIy, Ala; VaI, He, Leu; Asp, GIu; Asn, GIn; Ser, Thr; Lys, Arg; and Phe, Tyr. Such conservatively substituted variations of each explicitly disclosed sequence are included within the mosaic polypeptides provided herein.
143. Substitutional or deletional mutagenesis can be employed to insert sites for N-glycosylation (Asn-X-Thr/Ser) or O-glycosylation (Ser or Thr). Deletions of cysteine or other labile residues also may be desirable. Deletions or substitutions of potential proteolysis sites, e.g. Arg, is accomplished for example by deleting one of the basic residues or substituting one by glutaminyl or histidyl residues.
144. Certain post-translational derivatizations are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the o- amino groups of lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco pp 79-86 [1983]), acetylation of the N-terminal amine and, in some instances, amidation of the C-terminal carboxyl.
145. It is understood that one way to define the variants and derivatives of the disclosed proteins herein is through defining the variants and derivatives in terms of homology/identity to specific known sequences. For example, SEQ ID NO: 2 sets forth a particular sequence of Staul and SEQ ID NO: 4 sets forth a particular sequence of a Upfl protein. Specifically disclosed are variants of these and other proteins herein disclosed which have at least, 70% or 75% or 80% or 85% or 90% or 95% homology to the stated sequence. Those of skill in the art readily understand how to determine the homology of two proteins. For example, the homology can be calculated after aligning the two sequences so that the homology is at its highest level. 146. Another way of calculating homology can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WT), or by inspection. 147. The same types of homology can be obtained for nucleic acids by for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment. 148. It is understood that the description of conservative mutations and homology can be combined together in any combination, such as embodiments that have at least 70% homology to a particular sequence wherein the variants are conservative mutations.
149. As this specification discusses various proteins and protein sequences it is understood that the nucleic acids that can encode those protein sequences are also disclosed. This would include all degenerate sequences related to a specific protein sequence, i.e. all nucleic acids having a sequence that encodes one particular protein sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the protein sequences. Thus, while each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed protein sequence. For example, one of the many nucleic acid sequences that can encode the protein sequence set forth in SEQ ID NO:2 is set forth in SEQ ED NO:1. It is understood that all of the nucleic acid sequences that encode this particular derivative of the Staul or Upfl are also disclosed including for example SEQ ID NO:1 and SEQ ID NO:3 which set forth two of the degenerate nucleic acid sequences that encode the particular polypeptide set forth in SEQ ID NO:2 and 4, respectively. It is also understood that while no amino acid sequence indicates what particular DNA sequence encodes that protein within an organism, where particular variants of a disclosed protein are disclosed herein, the known nucleic acid sequence that encodes that protein in the particular Staul from which that protein arises is also known and herein disclosed and described. 150. There are a number of compositions and methods which can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non-viral based delivery systems. For example, the nucleic acids can be delivered through a number II'11' II,,,-,. Sf ' 1I,..!1 Il «...!' I1' l> 1' "Mi ..11 II,. of direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationic liposomes. Appropriate means for transfection, including viral vectors, chemical transfectants, or physico-mechanical methods such as electroporation and direct diffusion of DNA, are described by, for example, Wolff, J. A., et al., Science, 247, 1465-1468, (1990); and Wolff, J. A. Nature, 352, 815-818, (1991)Such methods are well known in the art and readily adaptable for use with the compositions and methods described herein. In certain cases, the methods will be modifed to specifically function with large DNA molecules. Further, these methods can be used to target certain diseases and cell populations by using the targeting characteristics of the carrier.
151. Transfer vectors can be any nucleotide construction used to deliver genes into cells (e.g., a plasmid), or as part of a general strategy to deliver genes, e.g., as part of recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)). 152. As used herein, plasmid or viral vectors are agents that transport the disclosed nucleic acids, such as Staul and Upfl into the cell without degradation and include a promoter yielding expression of the gene in the cells into which it is delivered. Viral vectors are, for example, Adenovirus, Adeno-associated virus, Herpes virus, Vaccinia virus, Polio virus, ADDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviruses include Murine Maloney Leukemia virus, MMLV, and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector. However, they are not as useful in non-proliferating cells. Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non-dividing cells. Pox viral vectors are large and have several sites for inserting genes, they are thermostable and can be stored at room temperature. A preferred embodiment is a viral vector which has been engineered so as to suppress the immune response of the host organism, elicited by the viral antigens. Preferred vectors of this type will carry coding regions for Interleukin 8 or 10.
153. Viral vectors can have higher transaction (ability to introduce genes) abilities than chemical or physical methods to introduce genes into cells. Typically, viral vectors II"™!!:,,,, i| ,.' %,.\> .,,..Il 1...I' mull ,.' I' Ii II...I1 mil,, .„11,, contain, nonstructural early genes, structural late genes, an RNA polymerase ED transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome. When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene/promotor cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material. The necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.
154. A retrovirus is an animal virus belonging to the virus family of Retro viridae, including any types, subfamilies, genus, or tropisms. Retroviral vectors, in general, are described by Verma, LM. , Retroviral vectors for gene transfer. In Microbiology-1985, American Society for Microbiology, pp. 229-232, Washington, (1985), which is incorporated by reference herein. Examples of methods for using retroviral vectors for gene therapy are described in U.S. Patent Nos. 4,868,116 and 4,980,286; PCT applications WO 90/02806 and WO 89/07136; and Mulligan, (Science 260:926-932 (1993)); the teachings of which are incorporated herein by reference.
155. A retrovirus is essentially a package which has packed into it nucleic acid cargo. The nucleic acid cargo carries with it a packaging signal, which ensures that the replicated daughter molecules will be efficiently packaged within the package coat, hi addition to the package signal, there are a number of molecules which are needed in cis, for the replication, and packaging of the replicated virus. Typically a retroviral genome, contains the gag, pol, and env genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that it is to be transferred to the target cell. Retrovirus vectors typically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome. The removal of the gag, pol, and env genes allows for about 8 kb of foreign sequence to be inserted into the viral genome, become reverse transcribed, and upon replication be packaged into a new retroviral particle. This if^^Λ,*, I! ■ '!,„!' ..„.!* H-Il U ..' H ,,,,,|t U ,,,l| II,, arriόiint of nucleic acid is sufficient for the delivery of a one to many genes depending on the size of each transcript. It is preferable to include either positive or negative selectable markers along with other genes in the insert.
156. Since the replication machinery and packaging proteins in most retroviral vectors have been removed (gag, pol, and env), the vectors are typically generated by placing them into a packaging cell line. A packaging cell line is a cell line which has been transfected or transformed with a retrovirus that contains the replication and packaging machinery, but lacks any packaging signal. When the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals.
157. The construction of replication-defective adenoviruses has been described (Berkner et al., J. Virology 61:1213-1220 (1987); Massie et al., MoI. Cell. Biol. 6:2872- 2883 (1986); Haj-Ahmad et al., J. Virology 57:267-27 '4 (1986); Davidson et al., J. Virology 61:1226-1239 (1987); Zhang "Generation and identification of recombinant adenovirus by liposome-mediated transfection and PCR analysis" BioTechniques 15:868-872 (1993)). The benefit of the use of these viruses as vectors is that they are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell, but are unable to form new infectious viral particles. Recombinant adenoviruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586 (1993); Kirshenbaum, J. Clin. Invest. 92:381-387 (1993); Roessler, J. Clin. Invest. 92:1085-1092 (1993); Moullier, Nature Genetics 4:154-159 (1993); La Salle, Science 259:988-990 (1993); Gomez-Foix, J. Biol. Chem. 267:25129-25134 (1992); Rich, Human Gene Therapy 4:461-476 (1993); Zabner, Nature Genetics 6:75-83 (1994); Guzman, Circulation Research 73:1201-1207 (1993); Bout, Human Gene Therapy 5:3-10 (1994); Zabner, Cell 75:207-216 (1993); Caillaud, Eur. J. Neuroscience 5:1287-1291 (1993); and Ragot, J. Gen. Virology 74:501-507 (1993)). Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J. Virology 55:442-449 (1985); Seth, et al., J. Virol. 51 :650-655 (1984); Seth, et Et Ci- It ••' 1U I1 «...1 1' .' .....I' I' !1..Ji ...Il II,, al., Mol. Cell. Biol. 4:1528-1533 (1984); Varga et al., J. Virology 65:6061-6070 (1991); Wickham et al., Cell 73:309-319 (1993)).
158. A viral vector can be one based on an adenovirus which has had the El gene removed and these virons are generated in a cell line such as the human 293 cell line. In another preferred embodiment both the El and E3 genes are removed from the adenovirus genome.
159. Another type of viral vector is based on an adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site specific integration property are preferred. An especially preferred embodiment of this type of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and/or a marker gene, such as the gene encoding the green fluorescent protein, GFP. 160. In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell- specific expression operably linked to a heterologous gene. Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or Bl 9 parvovirus.
161. Typically the AAV and B 19 coding regions have been deleted, resulting in a safe, noncytotoxic vector. The AAV ITRs, or modifications thereof, confer infectivity and site-specific integration, but not cytotoxicity, and the promoter directs cell-specific expression. United states Patent No. 6,261,834 is herein incorproated by reference for material related to the AAV vector.
162. The vectors of the present invention thus provide DNA molecules which are capable of integration into a mammalian chromosome without substantial toxicity.
163. The inserted genes in viral and retroviral usually contain promoters, and/or enhancers to help control the expression of the desired gene product. A promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site. A promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements.
164. Molecular genetic experiments with large human herpesviruses have provided a means whereby large heterologous DNA fragments can be cloned, propagated Ii"'1' l,ι- II ■' 1."f I' n"Λ " ■' •• •' I' 'i«.li .,Jl,, ,,,||,, and established in cells permissive for infection with herpesviruses (Sun et al., Nature genetics 8: 33-41, 1994; Cotter and Robertson,. Curr Opin MoI Ther 5: 633-644, 1999). These large DNA viruses (herpes simplex virus (HSV) and Epstein-Barr virus (EBV), have the potential to deliver fragments of human heterologous DNA > 150 kb to specific cells. EBV recombinants can maintain large pieces of DNA in the infected B-cells as episomal DNA. Individual clones carried human genomic inserts up to 330 kb appeared genetically stable The maintenance of these episomes requires a specific EBV nuclear protein, EBNAl, constitutively expressed during infection with EBV. Additionally, these vectors can be used for transfection, where large amounts of protein can be generated transiently in vitro. Herpesvirus amplicon systems are also being used to package pieces of DNA > 220 kb and to infect cells that can stably maintain DNA as episomes.
165. Other useful systems include, for example, replicating and host-restricted non-replicating vaccinia virus vectors.
166. The disclosed compositions can be delivered to the target cells in a variety of ways. For example, the compositions can be delivered through electroporation, or through lipofection, or through calcium phosphate precipitation. The delivery mechanism chosen will depend in part on the type of cell targeted and whether the delivery is occurring for example in vivo or in vitro.
167. Thus, the compositions can comprise, lipids such as liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes.
Liposomes can further comprise proteins to facilitate targeting a particular cell, if desired. Administration of a composition comprising a compound and a cationic liposome can be administered to the blood afferent to a target organ or inhaled into the respiratory tract to target cells of the respiratory tract. Regarding liposomes, see, e.g., Brigham et al. Am. J. Resp. Cell. MoI. Biol. 1 :95-100 (1989); Feigner et al. Proc. Natl. Acad. Sci USA 84:7413-7417 (1987); U.S. Pat. No.4,897,355. Furthermore, the compound can be administered as a component of a microcapsule that can be targeted to specific cell types, such as macrophages, or where the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dosage. 168. In the methods described above which include the administration and uptake of exogenous DNA into the cells of a subject (i.e., gene transduction or transfection), delivery of the compositions to cells can be via a variety of mechanisms. As one example, delivery can be via a liposome, using commercially available liposome preparations such as UPOFECTTN", LIPOFEcf AMINE (GIBCO-BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WI), as well as other liposomes developed according to procedures standard in the art. In addition, the nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (ImaRx Pharmaceutical Corp., Tucson, AZ).
169. The materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol,
42:2062-2065, (1991)). These techniques can be used for a variety of other speciifc cell types. Vehicles such as "stealth" and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). In general, receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes. The internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)). H-- II,,.,, I ■■■■ 'I- i' 'i-.!' I' .■• ..;..ι> n.;;ιι iui ,,.iι »„
170. Nucleic acids that are delivered to cells which are to be integrated into the host cell genome, typically contain integration sequences. These sequences are often viral related sequences, particularly when viral based systems are used. These viral intergration systems can also be incorporated into nucleic acids which are to be delivered using a non- nucleic acid based system of deliver, such as a liposome, so that the nucleic acid contained in the delivery system can be come integrated into the host genome.
171. Other general techniques for integration into the host genome include, for example, systems designed to promote homologous recombination with the host genome. These systems typically rely on sequence flanking the nucleic acid to be expressed that has enough homology with a target sequence within the host cell genome that recombination between the vector nucleic acid and the target nucleic acid takes place, causing the delivered nucleic acid to be integrated into the host genome. These systems and the methods necessary to promote homologous recombination are known to those of skill in the art.
172. As described above, the compositions can be administered in a pharmaceutically acceptable carrier and can be delivered to the subject's cells in vivo and/or ex vivo by a variety of mechanisms well known in the art (e.g., uptake of naked DNA, liposome fusion, intramuscular injection of DNA via a gene gun, endocytosis and the like).
173. If ex vivo methods are employed, cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art. The compositions can be introduced into the cells via any gene transfer mechanism, such as, for example, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes. The transduced cells can then be infused (e.g., in a pharmaceutically acceptable carrier) or homo topically transplanted back into the subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject.
174. The nucleic acids that are delivered to cells typically contain expression controlling systems. For example, the inserted genes in viral and retroviral systems usually contain promoters, and/or enhancers to help control the expression of the desired gene product. A promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site. A promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements. «■■•' 11 Ii ./ u ..a υ :,;» ,••' ,:J 3 U ,JI ii,
175. Preferred promoters controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g. beta actin promoter. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication (Fiers et al., Nature, 273: 113 (1978)). The immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindUl E restriction fragment (Greenway, PJ. et al., Gene 18: 355-360 (1982)). Of course, promoters from the host cell or related species also are useful herein.
176. Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78: 993 (1981)) or 3' (Lusky, M.L., et al., MoI. Cell Bio, 3: 1108 (1983)) to the transcription unit. Furthermore, enhancers can be within an intron (Banerji, J.L. et al., Cell 33: 729 (1983)) as well as within the coding sequence itself (Osborne, T.F., et al., MoI. Cell Bio. 4: 1293 (1984)). They are usually between 10 and 300 bp in length, and they function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression of a gene. While many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, α-fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression. Preferred examples are the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
177. The promotor and/or enhancer may be specifically activated either by light or specific chemical events which trigger their function. Systems can be regulated by reagents such as tetracycline and dexamethasone. There are also ways to enhance viral vector gene expression by exposure to irradiation, such as gamma irradiation, or alkylating chemotherapy drugs.
178. In certain embodiments the promoter and/or enhancer region can act as a constitutive promoter and/or enhancer to maximize expression of the region of the transcription unit to be transcribed, hi certain constructs the promoter and/or enhancer region be active in all eukaryotic cell types, even if it is only expressed in a particular type of cell at a particular time. A preferred promoter of this type is the CMV promoter (650 bases). Other preferred promoters are SV40 promoters, cytomegalovirus (full length promoter), and retroviral vector LTF. 179. It has been shown that all specific regulatory elements can be cloned and used to construct expression vectors that are selectively expressed in specific cell types such as melanoma cells. The glial fibrillary acetic protein (GFAP) promoter has been used to selectively express genes in cells of glial origin.
180. Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human or nucleated cells) may also contain sequences necessary for the termination of transcription that may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3' untranslated regions also include transcription termination sites. It is preferred that the transcription unit also contain a polyadenylation region. One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA. The identification and use of polyadenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs. In certain transcription units, the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of about 400 bases. It is also preferred that the transcribed units contain other standard sequences alone or in combination with the above sequences improve expression from, or stability of, the construct.
181. The viral vectors can include a nucleic acid sequence encoding a marker product. This marker product is used to determine if the gene has been delivered to the cell and once delivered is being expressed. Preferred marker genes are the E. CoIi lacZ gene, which encodes β-galactosidase, and green fluorescent protein.
182. In some embodiments the marker may be a selectable marker. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow independent of a supplemented media. Two examples are: CHO DHFR- cells and mouse LTK- cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media. An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells that were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media.
183. The second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells that have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, (Southern P. and Berg, P.,_J. Molec. Appl. Genet. 1: 327 (1982)), mycophenolic acid, (Mulligan, R.C. and Berg, P. Science 209: 1422 (1980)) or hygromycin, (Sugden, B. et al., MoI. Cell. Biol. 5: 410-413 (1985)). The three examples employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively. Others include the neomycin analog G418 and puramycin.
184. Disclosed herein are kits that are drawn to reagents that can be used in practicing the methods disclosed herein. The kits can include any reagent or combination of reagents discussed herein or that would be understood to be required or beneficial in the practice of the disclosed methods. For example, the kits could include primers to perform the amplification reactions discussed in certain embodiments of the methods, as well as the buffers and enzymes required to use the primers as intended. The kits could include systems comprising the essential elements of SMD activity.
185. The compositions disclosed herein and the compositions necessary to perform the disclosed methods can be made using any method known to those of skill in the art for that particular reagent or compound unless otherwise specifically noted.
186. Disclosed are methods of making a substance capable of modulating Staul- mediated mRNA decay (SMD) activity, including but not limited to, modulation during the pioneer round, comprising admixing a substance identified by the methods of the invention with a pharmaceutically acceptable carrier. The invention also provides substances made by methods of the invention. 187. Disclosed are methods of making a modulator of Staul -mediated mRNA decay (SMD) comprising a) administering a substance to a system, wherein the system comprises SMD activity, b) assaying the effect of the substance on the amount of SMD activity in the system, c) selecting a substance which causes a change in the amount of SMD activity present in the system compared to the amount of SMD activity in the system in the absence of substance, and d) synthesizing the substance.
188. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric. Example 1: Human Upfl Interacts With Human Staufenl
189. Using yeast two-hybrid analysis to screen a HeLa-cell cDNA library for encoded proteins that interact with full-length human Upfl, human Staul was identified in four out of one million transformants on the basis of growth at 37°C in galactose-containing medium but not glucose-containing medium (Figure IA, upper). Galactose promoted transcription of cDNAs in the library, and the interaction of cDNA-encoded protein with Upfl allowed for growth at 37°C. Sequence analysis of partial cDNAs that were obtained in the screen indicated that Upfl interacts with Staul within the fourth double-stranded RNA binding domain, the tubulin binding domain, or both (Figure IA, lower).
190. The ability of Upfl to interact directly with Staul was confirmed using co- purification assays. First, GST-Upfl that had been produced in E. coli interacted with 6xHis- Staul that had also been produced in E. coli. This was evident using GST pull-down to isolate GST-Upfl (Figure IB, upper) followed by either Western blotting using anti-His antibody (Figure IB, middle) or Coomassie Blue staining (Figure IB, lower) to confirm the presence of 6xHis-Staul. Notably, 6xHis-Staul was not detected in the GST pull-down in the absence of GST-Upfl.
191. Second, FLAG-Upfl that had been purified from HeLa cells as well as GST- Upfl that had been purified from E. coli were shown by Far- Western analysis to interact with 6xHis-Staul or GST-Staul that had been produced in E. coli. To this end, each tagged Staul protein was electrophoresed in SDS-polyacrylamide and probed with either FLAG-Upfl followed by Western blotting using anti-FLAG antibody (Figure 1C, middle) or GST-Upfl followed by Western blotting using anti-GST antibody (Figure 1C, right). Coomassie Blue staining confirmed the presence of 6xHis-Staul and GST-Staul (Figure 1C, left). 192. Third, Staul -HA3 that had been imrnunopurified from Cos cells using anti-HA antibody co-purified with cellular Upfl in a manner that was resistant to the addition of RNase A prior to immunopurification (IP) (Figure ID, upper). This indicates that the interaction of Staul and Upfl is stable in the absence of RNA. RNase A treatment was effective as demonstrated by the disappearance of cellular SMG7 mRNA in samples that were analyzed before IP (Figure ID, lower). Staul-HA3 also co-immunopurifled with Barentsz and CBP80, although in an RNase A-sensitive manner, but did not co-immunopurify with eIF4E or a non¬ specific control, Vimentin, which is a component of intermediate filaments (Figure ID, upper). The co-IP of Staul with Barentsz had previously been shown to be RNase A-sensitive (Macchi et al., 2003). Since Barentsz is essential for EJC-dependent NMD (Palacios et al., 2004), and since CBP80 and the EJC are components of the pioneer translation initiation complex (Chiu et al., 2004; Ishigaki et al., 2001; Lejeune et al., 2002), Staul and Barentsz are also likely to be components of this complex. While antibodies to EJC components Upf3 and Upf3X immunopurified the EJC component Upf2, they failed to immunopurify either Staul or Barentsz (Figure IE). These results indicate that: (i) the interaction of Staul and Barentsz with the EJC was destabilized by the experimental conditions, (ii) Staul and Barentsz only transiently interact with the EJC, as is the case for Upfl (Ishigaki et al., 2001), or (iii) neither Staul nor Barentsz are components of the EJC.
193. Fourth, FLAG-Upfl that had been isolated from HeLa cells using anti-FLAG antibody that was covalently conjugated to an agarose affinity gel (Pal et al., 2001) co-purified with both the 55-kDa and 63-kDa isoforms of Staul as well as Upf2 and UpDX but not Vimentin (Figure IF). These data also indicate that Staul and Upfl are components of the same complex.
Example 2: Down-Regulating Cellular Staul Has No Detectable Consequence to the FJC -Dependent NMD of Gl or GPxI mRNA 194. To gain insight into the possibility that Staul functions in EJC-dependent NMD, the effect of down-regulating the level of cellular Staul on the NMD of mRNAs for /3-globin (Gl) and glutathione peroxidase (GPx)I was examined using small interfering (si)RNAs. As a control, Upf3X was down-regulated in parallel. HeLa cells were transfected with Staul siRNA, UpDX siRNA or a non-specific "Control" siRNA and, two days later, with three plasmids: (i) the pmCMV-Gl test plasmid that was either nonsense-free (Norm) or nonsense- containing (39Ter), (ii) the pmCMV-GPxl test plasmid, either Norm or 46Ter, and (iii) the phCMV-MUP reference plasmid. 195. The level of each Staul isoform was down-regulated to 28% of normal, where normal is defined as the level in the presence of the non-specific Control siRNA, and the level of UpOX was down-regulated to 24% of normal (Figure 2A). Using the level of Gl 39Ter or GPxI 46Ter mRNA as a measure of NMD, down-regulating Staul was of no detectable consequence to the NMD of either mRNA, whereas down-regulating UpOX abrogated NMD 5-fold or 3-fold, respectively (Figure 2B). Therefore, Staul does not detectably function in the EJC-dependent NMD of nonsense-containing Gl and GPxI, which is consistent with the inability to detect Staul as a stable component of the EJC (Figure 1).
Example 3: Tethered Staul Reduces mRNA Abundance in a Mechanism that Involves Upfl and an Upstream Nonsense Codon but Not Upf2 or UpOX 196. In theory, Staul could elicit a type of EJC-independent mRNA decay based on the finding that it binds to Upfl . Previously, fusions of each Upf protein and the bacteriophage MS2 coat protein were shown to reduce mRNA abundance when tethered to a series of MS2 coat protein binding sites that were located more than 50 nts downstream of the normal termination codon (Lykke- Andersen et al., 2000). Since the reduced mRNA abundance was dependent on the normal termination codon, it was attributed to NMD. This or similar tethering methods were subsequently used to demonstrate that Y14, RNPSl, PYM and Barentsz also function in NMD (Bono et al., 2004; Gehring et al., 2003; Lykke- Andersen et al., 2001; Palacios et al., 2004).
197. Tethered Staul was similarly tested for the ability to reduce mRNA abundance depending on an upstream termination codon. HeLa cells were transiently transfected with three plasmids: (i) a pcFLuc test plasmid that produces Firefly (F) luciferase (Luc) from intronless FLuc cDNA that either did or did not harbor eight MS2 coat protein binding sites (MS2bs) within the 3' UTR (Figure 3A), (ii) the pRLuc reference plasmid that produces Renilla (R)Luc (Figure 3A), and (iii) a pMS2-HA or pMS2-HA-Staul effector plasmid that, respectively, harbored no insert so as to encode only MS2 coat protein (MS2)-HA or HA- Staul cDNA so as to encode a MS2-HA-Staul fusion protein.
198. Cells that had been transfected with pMS2-HA or pMS2-HA-Staul produced the expected fusion protein as evidenced by Western blotting using anti-HA antibody (Figure 3B, left)'."" As demonstrated using RT-PCR, while neither MS2-HA nor MS2-HA-Staul affected the level of FLuc mRNA that lacked the MS2bs, MS2-HA-Staul elicited a 3-to-4-fold reduction in the level of FLuc mRNA that harbored the MS2bs (Figure 3B, right). In control experiments that were performed in parallel, MS2-Upfl and MS2-Upf2 (Lykke- Andersen et al, 2000) were also of no consequence to the level of FLuc mRNA that lacked the MS2bs but elicited a 2-to-5-fold reduction in the level of FLuc mRNA that harbored the MS2bs (Figure 3B, right). Furthermore, tethering an unrelated protein, HA-eIF4Aiπ, or expressing Stau-HA3 or myc-Upfl that could not be tethered failed to affect the abundance of FLuc-MS2bs mRNA (Figure 8). 199. These data are consistent with the possibility that tethering Staul downstream of a normal termination codon elicits mRNA decay. This possibility was examined in two ways. First, the effects of down-regulating the level of cellular Upfl, Upf2 or UpOX on the Staul - mediated reduction in FLuc-MS2bs mRNA abundance was examined. To this end, HeLa cells were transiently transfected with the appropriate siRNA and, two days later, with a combination of plasmids. One combination consisted of the pmCMV-Gl test plasmid, either Norm or 39Ter, and the phCMV-MUP reference plasmid. The other combination consisted of the pcFLuc-MS2bs test plasmid, the pRLuc reference plasmid, and an effector plasmid that produces MS2-HA, MS2-HA-Staul, MS2, MS2-Upfl, MS2-Upf2 or MS2-Upf3.
200. Using Western blotting and the appropriate anti-Upf antibody, the level of Upfl or UpβX (Figure 5 A, left) or Up£2 (Figure 5B, left) was shown to be down-regulated, respectively, to 4%, 28% or 13% of normal. In control experiments, down-regulating each protein abrogated the NMD of Gl 39Ter mRNA 3-to-5-fold (Figure 5A&B, middle), as expected. Down-regulating Upfl but not Upf3X abrogated the decrease in the abundance of FLuc-MS2bs mRNA that was mediated by tethered Upf2 (Figure 5A, right). Furthermore, down-regulating Upf2 abrogated the decrease in the abundance of FLuc-MS2bs mRNA that was mediated by tethered Upf3 but had no effect on the decrease that was mediated by tethered Upfl (Figure 5B, right). Therefore, tethering Upf2 obviates the involvement of cellular Upf3 or UpOX but not Upfl in EJC-dependent NMD, and tethering Upfl obviates the involvement of the other Upf proteins in EJC-dependent NMD. It was conclude that Upf2 functions in NMD after UpO or UpOX but before Upfl . Additionally, down-regulating Upfl but not UpOX or Upf2 abrogated the decrease in the abundance of FLuc-MS2bs mRNA that was mediated by tethered Staul (Figure 5A&B, right). It was concluded that Upfl function obviates Staul function in the Staul -mediated reduction in mRNA abundance, and that Staul reduces mRNA abundance in a mechanism that is not likely to involve UpG, Upf3 or Upf3X. These results make sense given that Staul binds Upfl (Figure 1), and that Upfl is the last of the Upf proteins to function in EJC-dependent NMD (Lykke-Andersen et al., 2000).
201. In related experiments, the effect of down-regulating the level of cellular Staul or, as a control, cellular Upfl on the NMD that was elicited by tethering Upfl, Upf2 or Upf3 to FLuc mRNA was determined. The level of each Staul isoform was down-regulated to 29% of normal, and the level of Upfl was down-regulated to 7% of normal as evidenced using Western blotting (Figure 5C, left). According to expectations, down-regulating Upfl abrogated the NMD that was elicited by tethering either Upf2 or UpO as evidenced using RT- PCR (Figure 5C, right). In contrast, however, down-regulating Staul had no effect on the NMD that was elicited by tethering Upfl, Upf2 or Upf3 (Figure 5C, right). These results are consistent with the finding that Staul does not detectably affect EJC-dependent NMD (Figure
2).
202. Moving the translation termination codon from a position that resides upstream of the MS2-HA-Staul tethering site to a position that resides downstream of the site was found to inhibit the Staul -mediated reduction of both FLuc-MS2bs and Gl-MS2bs mRNA abundance (Figure 6). This result is consistent with the possibility that Staul reduces mRNA abundance by recruiting Upfl to a position that resides downstream of a termination (i.e., nonsense) codon. Example 4: Staul Binds the 3' UTR of Arfl mRNA and Reduces the Abundance of mRNA Independently of an EJC
203. In search of substrates that could be natural targets of Staul -mediated effects, ADP-ribosylation factor (Arf)l mRNA, which encodes a Ras-related G protein that regulates membrane traffic and organelle structure (Donaldson and Jackson, 2000), was identified as a natural ligand of Staul using two methods. First, Staul -containing RNPs were immunopurified from human 293 cells that transiently expressed either Staul -HA3 or, as a control for IP specificity, Staul -6xHis using anti-HA antibody (Figure 7A). When biotin- labeled cRNAs were generated from the constituent RNAs and used to probe oligonucleotide arrays of 22,000 human genes, Arfl mRNA was identified as one of at least 23 ligands of Staul (Figure 7B; Table 3). Second, using RT-PCR and a primer pair that specifically amplifies Arfl mRNA, Arfl mRNA was shown to be among the 293-cell transcripts that co- immunopurified with (i) anti-HA antibody in cells that expressed Staul -HA3 (Figure 7B) and (ii) anti-Staul antibody in untransfected cells (Figure 7C). f.T. Table 3. Genes that Encode Putative Staul -binding mRNAs as Determined by Microarray Analysis
Gene Symbol Accession Number Unigene Name
ARFl AA580004 ADP-ribosylation factor 1
MGC14799 BC005995 hypothetical protein MGC 14799
GNAS AF064092 GNAS complex locus
DFFA NM 004401 DNA fragmentation factor 45kDa alpha polypeptide
CSDA NM 003651 cold shock domain protein A
SEC61A1 NM 013336 Sec61 alpha 1 subunit (5. cerevisiae)
PSMD 12 NM_002816 proteasome (prosome macropain) 26S subunit non-ATPase 12
EIF5A NM 001970 eukaryotic translation initiation factor 5A
C4orf9 R06783 chromosome 4 open reading frame 9
FLJ10613 NM_019067 hypothetical protein FLJ 10613
GNE NM_005476 glucosamine (UDP-N-acetyl)-2-epimerase/N- acetylmannosamine kinase
FLJ30656 AW873564 H. sapiens transcribed sequences
LOC149603 AA085748 hypothetical protein LOC 149603
TEGT NM 003217 testis enhanced gene transcript (BAX inhibitor 1)
MCM4 AI859865 MCM4 minichromosome maintenance deficient 4 (5. cerevisiae)
LOC63929 NM 022098 hypothetical protein LOC63929
KIAAO 186 NM 021067 KIAAO 186 gene product
PRKAR2A BF246917 protein kinase cAMP-dependent regulatory type II alpha
NUTF2 NM 005796 nuclear transport factor 2
GDFl NM 001492 growth differentiation factor 1
PAICS AA902652 phosphoribosylaminoimidazole carboxylase phosphoribosylaminoimidazole succinocarboxamide synthetase
TMPO AFl 13682 thymopoietin
AAMP NM 001087 angio-associated migratory cell protein
293 cells were transiently transfected with a plasmid that expressed Staul -HA3 or, to control for nonspecific IP, Staul -6xHis. Biotin-labeled cRNA was synthesized from RNA that had been immunopurifϊed using anti-HA antibody and hybridized to Affymetrix U133A microarrays. Changes of at least 2.5-fold were scored as Staul -interacting transcripts.
204. It was rationalized that if Staul binds to Arfl mRNA at a position that reduces mRNA abundance, then down-regulating either Staul or UpΩ should up-regulate the level of Arfl mRNA. Futhermore, down-regulating either Staul or Upfl should fail to up-regulate the level of Arfl mRNA that lacks the Staul binding site. To test these possibilities, HeLa cells were transiently transfected with Control siRNA or siRNA that down-regulates Staul, Upfl, Upf2 or Upf3X. Two days later, cells were transiently transfected with two plasmids in order to measure effects on the abundance of Arfl mRNA that was transiently produced from Arfl cDNA. These plasmids consisted of: (i) a pSport-Arfl or pSport-ArflΔ(3'UTR) test plasmid, the latter of which lacks all nucleotides that reside downstream of the normal termination codon (Figure 8A), and (ii) the phCMV-MUP reference plasmid. Notably, the HeLa-cell Arfl gene contains four introns (Lee et al., 1992; Figure 8A) so that the resulting newly synthesized mRNA would harbor four EJCs. In contrast, since Arfl cDNA within either pSport plasmid lacks all introns, the resulting newly synthesized mRNA would lack EJCs.
205. The results of Western blotting demonstrated that the level of each Staul isoform was down-regulated to 26% of normal, and the level of Upfl, Upf2 or UpDX was down- regulated to, respectively, 21%, 22% or 13% of normal (Figure 8B, upper). The results of RT- PCR using RNA from the same cells demonstrated that the abundance of endogenous HeLa- cell Arfl mRNA relative to the abundance of SMG7 as well as the abundance of Arfl mRNA that derived from Arfl cDNA relative to MUP mRNA was increased 2-to-4-fold in the presence of Staul or Upfl siRNA relative to Control siRNA (Figure 8B, second and third down; see also Figure 9 for comparable results using a different Staul or Upfl siRNA). In contrast, and as expected from the Staul tethering results (Figures 3 and 5), the abundance of Arfl mRNA from the gene or cDNA was unaffected by down-regulating Upf3X (Figure 8B, second and third down). For reasons that are not entirely clear, the abundance of Arfl mRNA was decreased by down-regulating Upf2 (Figure 8B, second and third down). This decrease may simply reflect competition between Staul and Upf2 for binding to Upfl. Possibly, down- regulating Upf2 augments the interaction of Staul with Upfl, which could increase the efficiency of NMD. Consistent with this interpretation, Upf2 is not detected in association with Staul, whereas both Upf2 and Staul are detected in association with Upfl (Figure IF). However, down-regulating Upf2 did not augment NMD when Staul was tethered (Figure 5B). These data indicate that Staul reduces the abundance of Arfl mRNA in a mechanism that involves Upfl but not Upf2 or Uρf3X.
206. These findings also indicate that Staul binds Arfl mRNA at a position that is located within the 3' UTR. Consistent with this, deletion of the 3' UTR increased the level of Arfl mRNA 7-fold (Figure 8C). Moreover, in contrast to Arfl mRNA, the abundance of Arfl Δ(3 'UTR) mRNA was unaffected by Staul siRNA relative to Control siRNA (Figure 8C).
207. In order to test for Staul binding to the 3' UTR of Arfl mRNA, Cos cells were transiently transfected with the Staul -HA3 expression vector, the pSport-Arfl or pSport- Arfl Δ(3 'UTR) test plasmid, and the phCMV-MUP reference plasmid. Notably, cells were transfected with only half as much pSport-ArflΔ(3'UTR) as pSport-Arfl in order to compensate for the difference in the level of product mRNA. Cell extract was prepared two days later, and a fraction was immunopurified using anti-HA antibody or, as a control for nonspecific IP, rat (r) IgG. Western blotting of immunopurified protein demonstrated that the efficiency of IP was 11% (Figure 8D, upper). RT-PCR of immunopurified RNA demonstrated the presence of Arfl mRNA, a low level of ArflΔ(3'UTR) mRNA, and no detectable MUP mRNA (Figure 8D, lower). It was concluded that Staul binds to the 3' UTR of Arfl mRNA, as was predicted from data demonstrating that Arfl mRNA but not Arfl Δ(3 'UTR) mRNA is naturally targeted for a Staul -mediated reduction in abundance. Additionally, it was concluded that Staul also binds elsewhere within Arfl mRNA, albeit to a lesser extent. Consistent with this conclusion, and in support of the idea that a termination codon must reside upstream of a Staul binding site in order for Staul to mediate a reduction in mRNA abundance (Figure 6), the level of Arfl mRNA that derived from cDNA harboring a nonsense codon at position 35 was up-regulated 2-fold when Staul was down-regulated. It follows that Staul binds between codon 35 and the normal termination codon with less efficiency than it binds to the 3' UTR. Notably, the specificity of Staul binding to Arfl mRNA was illustrated by the failure of Staul to bind to MUP mRNA. 208. Since we now know that Staul binding to mRNA can lead to mRNA decay, the transcripts that we reported in Table 3, can be weak targets for decay. Alternatively, the transcripts can be up-regulated by Staul binding. To determine what transcripts are up- regulated and which are down-regulated after down-regulating Staul, microarray analysis was performed (Tables 4 and 5).
Table 4. Transcripts up-regulated after down-regulating Staul in two independently performed analyses (Note : Redundancies reflect different wells in each microarray)
AFFX-M27830_5_at Unknown transcript
211506_s_at Unknown transcript (don't know if same as above)
205660_at 2'-5'-oligoadenylate synthetase-like
210797_s_at 2'-5'-oligoadenylate synthetase-like /// 2'-5'-oligoadenylate synthetase-like
212543_at absent in melanoma 1
200974_at actin alpha 2 smooth muscle aorta
204470_at chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha)
228335_at claudin 11 (oligodendrocyte transmembrane protein)
202712_s_at creatine kinase mitochondrial 1 (ubiquitous)
219863_at cyclin-E binding protein 1
210764_s_at cysteine-rich angiogenic inducer 61
232165_at epiplakin 1
232164_s_at epiplakin 1
216442_x_at fibronectin 1 210495_x_at fibronectin 1
212464_s_at fibronectin 1
211719_x_at fibronectin 1 /// fibronectin 1
212473_s_at flavoprotein oxidoreductase MICAL2
226269_at ganglioside-induced differentiation-associated protein 1
20447 l_at growth associated protein 43
205184_at guanine nucleotide binding protein (G protein) gamma 4
209657_s_at heat shock transcription factor 2
227547 at Homo sapiens transcribed sequence with moderate similarity to protein ref:NP_071431.1 (H.sapiens) cytokine receptor- like factor 2; cytokine receptor CRL2 precusor [Homo sapiens]
23083 l_at Homo sapiens transcribed sequences
218986_s_at hypothetical protein FLJ20035
235417_at hypothetical protein FLJ25348
1562415_a_at hypothetical protein FLJ25348
212909_at hypothetical protein MGC29643
211959_at insulin-like growth factor binding protein 5
214453_s_at interferon-induced protein 44
226757_at interferon-induced protein with tetratricopeptide repeats 2
229450_at interferon-induced protein with tetratricopeptide repeats 4
205798_at interleukin 7 receptor
202859_x_at interleukin 8
201650_at keratin 19 /// keratin 19
224657_at mitogen-inducible gene 6
242456_at MREl 1 meiotic recombination 11 homolog A (S. cerevisiae)
210809_s_at osteoblast specific factor 2 (fasciclin I-like)
201288_at Rho GDP dissociation inhibitor (GDI) beta
204035_at secretogranin π (chromogranin C)
59705_at selenocysteine lyase
222557_at stathmin-like 3
221477_s_at superoxide dismutase 2 mitochondrial '
220325_at TAF7-like RNA polymerase π TATA box binding protein (TBP)- associated factor 5OkDa
235086_at thrombospondin 1
201108_s_at thrombospondin 1
201109_s_at thrombospondin 1
209277_at tissue factor pathway inhibitor 2
205547_s_at transgelin
1555724_s_at transgelin
206508_at tumor necrosis factor (ligand) superfamily member 7
202330 s at uracil-DNA glycosylase
Table 5. Transcripts down-regulated after down-regulating Staul in two independently performed analyses (Note : Redundancies reflect different wells in each microarray)
213017 at abhydrolase domain containing 3 237159_x_at adaptor-related protein complex 1 sigma 3 subunit 208030_s_at adducin 1 (alpha) /// adducin 1 (alpha) 22571 l_at ADP-ribosylation-like factor 6-interacting protein 6 1555854_at aldo-keto reductase family 1 member Cl (dihydrodiol dehydrogenase 1;
20-alpha (3-alpha)-hydroxysteroid dehydrogenase)
225229_at ALLl fused gene from 5q31
204288_s_at Arg/Abl-interacting protein ArgBP2
242037_at aspartate beta-hydroxylase
203192_at ATP-binding cassette sub-family B (MDR/TAP) member 6
200756_x_at calumenin
210735_s_at carbonic anhydrase XII
1569263_at casein kinase 1 delta
221156_x_at cell cycle progression 8 protein
222552_at CGI- 141 protein
230151_at chromosome 13 open reading frame 1
208763_s_at delta sleep inducing peptide immunoreactor
223772_s_at DKFZP564G2022 protein
202972_s_at family with sequence similarity 13 member Al
202916_s_at family with sequence similarity 20 member B
22332 l_s_at fibroblast growth factor receptor-like 1
229908_s_at GlcNAc-phosphotransferase gamma-subunit
218839_at hairy/enhancer-of-split related with YRPW motif 1
1568598_at Homo sapiens cDNA clone IMAGE:6094109 partial cds
226822_at Homo sapiens cDNA FLJ10532 fis clone NT2RP2001044.
232060_at Homo sapiens cDNA FLJ20769 fis clone COL06674
243940_at Homo sapiens hypothetical gene supported by NM_018692 (LOC374296) mRNA
228141_at Homo sapiens mRNA; cDNA DKFZp686G03142 (from clone
DKFZp686G03142)
244359_s_at Homo sapiens transcribed sequences
228437_at HSPC 163 protein
225867_at hypothetical protein BCO 13767
228574_at hypothetical protein DKFZp762A217
219383_at hypothetical protein FLJ 14213
204508_s_at hypothetical protein FLJ20151
226600_at hypothetical protein FLJ90492
226604_at hypothetical protein FLJ90492
232275_s_at hypothetical protein LOC283476
205227_at interleukin 1 receptor accessory protein
229139_at junctophilin 1
205206_at Kallmann syndrome 1 sequence
212792_at KIAA0877 protein
212942_s_at KIAAl 199 protein
232155_at KIAAl 618 protein
1561180_at low density lipoprotein receptor-related protein 11
212713_at microfibrillar-associated protein 4
32625_at natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
200732 s at protein tyrosine phosphatase type FVA member 1 225207_at pyruvate dehydrogenase kinase isoenzyme 4
205960_at pyruvate dehydrogenase kinase isoenzyme 4
205087_at RWD domain containing 3
223843_at scavenger receptor class A member 3
225123_at sestrin 3
235150_at sestrin 3
242943_at sialyltransferase 8D (alpha-2 8-polysialyltransferase)
217859_s_at solute carrier family 39 (zinc transporter) member 9
22703 l_at sorting nexin 13
202991_at START domain containing 3
207320_x_at staufen RNA binding protein (Drosophila)
211505_s_at staufen RNA binding protein (Drosophila)
213037_x_at staufen RNA binding protein (Drosophila)
208948_s_at staufen RNA binding protein (Drosophila)
209131_s_at synaptosomal-associated protein 23kDa
201009_s_at thioredoxin interacting protein
201010_s_at thioredoxin interacting protein
201008_s_at thioredoxin interacting protein
209295_at tumor necrosis factor receptor superfamily member 10b
227812_at tumor necrosis factor receptor superfamily member 19
221291_at UL 16 binding protein 2
205139_s_at uronyl-2-sulfotransferase
227278_at Unknown transcript
1568513 x at Unknown transcript (don't know if same as above)
209. The microarray results indicate that SMD can be utilized by mammalian cells to regulate the abundance of hundreds of cellular transcripts and, hence, expression of the encoded proteins. Transcripts identified to be regulated by SMD have a broad range of cellular functions that include signal transduction, cell proliferation, cell metabolism, immune response, DNA repair, and transcriptional regulation. Therefore, SMD can play a key role in establishing and maintaining cellular homeostasis. For example, SMD naturally targets transcripts encoding the IL- 7 receptor (IL- 7R), c-JUN, and SERPINEl (also called PAIl). Down regulating cellular Staufenl or Upfl but not Upf2 increased the abundance of each cellular mRNA. Notably, the abundance of many transcripts was down-regulated in the cells depleted of Staul. These results indicate that Staul can mediate the an increase in the abundance of some transcripts and also a decrease in the abundance of other transcripts.
Example 5: A Minimized Staul Binding Site Resides > 67 Nucleotides Downstream of the Normal Termination Codon of Arfl mRNA and Mediates mRNA Decay 210. To further localize the Staul binding site within the Arfl 3' UTR, a series of deletions was generated from the distal-most nucleotide of the Arfl 3' UTR within pSport- Arfl (Figure 10A). Each of the resulting test plasmids was transiently introduced into 293 cells together with the Stau-HA3 expression vector. Cell extract was prepared two days later, and a fraction was immunopurified using anti-HA antibody. Western blotting of immunopurified protein revealed relative IP efficiencies (Figure 1OB, upper). RT-PCR of immunopurified RNA demonstrated that Staul binds between nucleotides 689 and 919 (Figure 1OB, lower, where the first transcribed nucleotide of endogenous Arfl mRNA is defined as 1). Notably, the small amount of Staul binding that is detected using mRNAs that terminate at nucleotide 621 or 688 reflects the finding that Staul binds less efficiently to the coding region than to the 3' UTR (Figure 10D). While these data do not rule out the possibility that Staul also binds within the 3' UTR downstream of nucleotide 919 or upstream of nucleotide 688, the finding that inserting the Staul binding site (SBS, nucleotides 622-924) within the 3' UTR of the heterologous FLuc mRNA reduced FLuc mRNA abundance (Figure 11) corroborates that Staul indeed binds between nucleotides 689 and 919. It was concluded that Staul binds to the 3' UTR of Arfl mRNA at a position that is predicted to reduce mRNA abundance.
211. To determine if Staul mediates a reduction in Arfl mRNA half-life, the expression of Arfl cDNA harboring the SBS in place of the full-length 3' UTR was driven by the fos promoter (Figure 1OC, upper). This promoter is transiently inducible upon the addition of serum to serum-deprived cells and, thus, provides a way to analyze mRNA half- life (Lejeune et al., 2003). L cells were transfected with mouse (m)Staul or Control siRNA and, two days later, with the pfos- Arfl -SBS and the phCMV-MUP reference plasmid in the absence of serum. One day later, serum was added, and protein and RNA were purified from, respectively, cytoplasmic and nuclear fractions at 0, 30, 60, 90 and 120 min. Western blotting demonstrated that the level of mStaul was down-regulated to 21%, 18%, and 26% of normal (Figure 1OC, second-from-top, left and right). RT-PCR demonstrated that down- regulating mStaul increased the half-life of nucleus-associated fos- Arfl -SBS mRNA (Figure 1OC, second- from-bottom, left and right). These data demonstrate that Staul mediates the nucleus-associated decay of Arfl mRNA, which is called Staul -mediated mRNA decay (SMD). The specificity of the SBS in mediating SMD was evident with the finding that down-regulating Staul to 29% increased the level of fos-FLuc-SBS (Figure 1 IB), but down-regulating Stual to 212% had no effect on fos-Arfl (Δ3'UTR) mRNA (Figure 13), which is consistent with the increase evident after the addition of serum to serum-deprived cells, but did not increase the level of fos-Arfl (Δ3 ' UTR). This shows that Staul and Upfl mediate the instability of fos-Arfl mRNA in a way that depends on the Arfl 3' UTR. Down-regulating mUpfl relative to normal also increased the half-life of nucleus- associated fos-Arfl-SBS mRNA (ie., abrogated the nucleus associated NMD), whereas down-regulating mUpf2 or mUpOX relative to normal did not. Furthermore, down- regulating mStaul and mUpfl also increased the half-life of a heterologous mRNA (fos- FLuc-Arfl) harboring the SBS, but had no effect on fos-FLuc-Arfl without the SBS. These data, like steady-state data (Figures 5, 8, 9, 1 IB) indicate that SMD involves Upfl but not Uρf2 or UpOX.
212. hi this disclosure, a novel role for Staul and new type of mRNA decay that does not involves Upfl but not an EJC was described. It was demonstrated that mammalian Staul directly binds the NMD factor Upfl (Figure 1). It was also demonstrated that tethering Staul downstream of a termination codon reduces mRNA abundance (Figure 3) in a mechanism that appears to involve the termination codon (Figure 6) and Upfl but not Upf2 or Upf3X (Figure 5). This mechanism is shown to be physiologically relevant with the finding that Staul binds to an ~230-nt region of the 3' UTR of Arfl mRNA so as to recruit Upfl independently of other Upf proteins and, as a consequence, reduce Arfl mRNA half-life (Figures 7, 8, 9, 10, 11). 213. It was found that Staul plays no detectable role in the EJC-dependent NMD of
Gl and GPxI mRNAs (Figure 2). This is despite the ability of Staul to interact with Barentsz (Macchi et al., 2003; Figure 1), which interacts directly with the EJC component eIF4AIII (Chan et al., 2004; Palacios et al., 2004). However, neither Staul nor Barentsz is detected as a stable component of the EJC (Figure 1). 214. The finding in two independently performed microarray analyses that there are at least 23 293-cell mRNAs that bind Staul (Table 3) indicates that SMD is used by cells to coordinately regulate a battery of genes - a number of which are involved in cell growth, division or both - in response to changes in the cellular abundance or specific activity of Staul, Upfl or both (see below). If binding is sufficiently downstream of the normal termination codon, then these mRNAs should, like Arfl mRNA, be natural targets of SMD in a mechanism that is EJC-independent. hi fact, Staul binds the 3' UTR of PAICS mRNA (and also elsewhere within the mRNA), and down-regulating Staul increases PAICS mRNA abundance ~2-fold (Figure 12). Notably, natural substrates for SMD could, in theory, arise by alternative splicing, which has been proposed to result the generation of a premature termination codon one-third of the time (Hillman, RT et al., 2004). Furthermore, those Staul- binding mRNAs that are also products of pre-mRNA splicing will additionally be subject to EJC-dependent NMD if they terminate translation a sufficient distance upstream of an EJC. 215. As a rule, a termination codon that resides more than -50-55 nt upstream of an exon-exon junction elicits NMD (Nagy and Maquat, 1998). Considering that an EJC resides -20-25 nts upstream of an exon-exon junction (Le Hir et al., 2000a), it follows that a termination codon that resides more than -25 nt upstream of a Staul binding site should elicit SMD. These two scenarios are exemplified for Arfl mRNA, which harbors four exon-exon junctions and binds Staul > 67 nt downstream of the normal termination codon (Figure 14). In theory, it may be possible for a termination codon to be situated so that it elicits both EJC- independent and EJC-dependent NMD. In fact, the data indicate that this possibility exists for Arfl mRNA, which is normally a product of pre-mRNA splicing and binds Staul within its coding region as evidenced by the ability of 35Ter within Arfl cDNA to elicit SMD. 216. To date, there are a number of RNP proteins that function in two distinct RNA metabolic processes, one of which involves mRNA localization coupled to translational control. As one example, Hrb27C inhibits the removal by nuclear splicing of intron 3 from P-element encoded transposase pre-mRNA in Drosophila (Hammond et al., 1997; Siebel et al., 1994) and also binds directly to Drosophila gurken mRNA so as to regulate gurken mRNA cytoplasmic localization and translation (Goodrich et al., 2004). As other examples, Barentsz and Y14, the latter of which is a component of the EJC (Kim et al., 2001 ; Lau et al., 2003; Palacios et al., 2004), are essential for EJC-dependent NMD in mammalian cells (Ferraiuolo et al., 2004; Gehring et al., 2003; Palacios et al., 2004; Shibuya et al., 2004) and also function in localizing Drosophila oskar mRNA to the posterior pole of the oocyte (Hachet and Ephrussi, 2001 ; Hachet and Ephrussi, 2004; Mohr et al., 2001 ; van Eeden et al., 2001). Similarly, it was shown here that mammalian Staul, which is a component of RNPs that are transported and localized within dendrites of mature hippocampal neurons (Kiebler et al., 1999; Kohrmann et al., 1999), is involved in a new type of EJC-independent NMD.
217. In mammals, Staul is ubiquitously expressed, but its level of expression varies among tissues (Wickham et al., 1999; Marion et al., 1999; Monshausen et al., 2001). For example, it is highly expressed in brain, heart, liver, testis, pancreas and placenta, whereas it is generally expressed to lesser but varying degrees in other tissues. Additionally, differential splicing generates several isoforms that are not uniformly expressed among tissues. Staul also contains several putative phosphorylation sites that could regulate function, and Staul has been shown to interact with protein phosphate 1 (Monshausen et al., 2002). Since Upfl phosphorylation influences Upfl function in NMD (Pal et al., 2001 ; Ohnishi et al., 2003, it is possible that Upfl phosphorylation also regulates its function or the function of Staul in SMD. Therefore, Staul functions can be modulated in different tissues according to the level of expression and the nature of each expressed isoform and, possibly, the degree of Upfl or Staul phosphorylation.
218. Staul is linked to mRNA transport in neurons (Kohrmann et al., 1999) and to HIV- 1 replication (Mouland et al., 2000). Its association with polysomes (Marion et al., 1999; Luo et al., 2002) suggests a role in the translational regulation Staul-bound mRNAs. Furthermore, biochemical and proteomic analyses demonstrate that Staul is a component of large RNA granules (Krishevsky and Kosik, 2001; Kanai et al., 2004; Mallardo et al., 2003; Villace et al., 2004, Brendel et al., 2004; Ohashi et al., 2002) that contain ribosomes, mRNA and several other proteins. It is shown herein that several Staul-bound mRNAs encode key regulatory enzymes that control cell metabolism, proteins involved in organelle trafficking, cell division or the cell cycle, or both. Arfl is involved in protein trafficking, and it may modulate vesicle budding and uncoating within the Golgi apparatus. PAICS controls steps 6 and 7 of the purine nucleotide biosynthetic pathway. Interestingly, the level of PAICS mRNA varies with the cell cycle in synchronized rat 3Yl fibroblasts (Iwahana et al., 1995). This variation can be controlled by SMD. GNE is a regulatory enzyme that regulates the first step in the biosynthesis of N-acetylneuraminic acid (NeuAc), which is a precursor to sialic acids (Hinderlich et al., 1997). Modification of cell surface molecules with sialic acid is essential for many biological processes, such as cell adhesion and signal transduction. Modulation of sialylation is involved in the tumorigenicity and metastatic behavior of malignant cells. While the activity of GNE and its gene are regulated, the data indicates that the level of GNE mRNA can also be regulated by SMD. From these and other examples, it is recognized that modulation of Staul, Upfl or both through modulation in the level of isoform expression, post-translational modification, or both can control the level of SMD in response to signal transduction or other regulatory pathways. 219. In summary, the findings expand the role of Staul in post-transcriptional gene control. Significant issues that have been brought to light by these studies include if the Staul - mediated recruitment of Upfl to mRNAs impacts mammalian development, neuronal transmission, or cellular growth control. It will also be important to determine if Staufen and Upfl interact in Drosophila so as to elicit mRNA decay. Example 6: Plasmid Constructions
220. To construct the pSos-Upfl yeast two-hybrid bait plasmid, the Hindm/Klenow- filled Notl fragment that contains human UPFl cDNA from pCI-neo-FLAG-UPFl (Sun et al.,
1998) was inserted into the Notl/Klenow-filled Sail fragment from pSos (Stratagene).
221. For the bacterial production of human Upfl that harbors an N-terminal GST tag, pGEX-UPFl was constructed by ligating the Notl/Klenow-filled EcoRI fragment from pCMV-Myc-UPFl that contains UPFl cDNA to the Notl/Klenow-filled BamHI fragment from pGEX-6p- 1 +NdeI (a gift from J. Wedekind).
222. For the bacterial production of human Staufenl (Staul) that harbors an N- terminal GST tag, pGEX-Staul was constructed by ligating the BamHI/NotI fragment from pGEX-6p-l+NdeI to a PCR-amplified fragment that had been digested with BgIH and Notl. The PCR fragment was amplified using the human Staul cDNA expression vector phStaul55- HA3 (Luo et al., 2002) and two primers: 5 '-
GAAGATCTAGAATGAAACTTGGAAAAAAACCAATGTATAAG-S ' (SEQ ID NO. 5) (sense) and 5'-
ATAAGAATGCGGCCGCTCAGCACCTCCCACACACAGACATTGGTCC-S' (SEQ ID NO. 6) (antisense), where underlined nucleotides specify the Bgiπ or Notl site, respectively. 223. For the bacterial production of human Staul that harbors an N-terminal 6xHis tag, pRSET B-Staul was constructed by ligating the Klenow-filled Ndel/NotI fragment from pGEX-Staul to the Klenow-filled BgIH fragment from pRSET B (Invitrogen).
224. To construct pMS2-HA-Staul that encodes N-terminal oligomerization-defective MS2 coat protein followed successively by an HA tag and full-length human Staul, pCI-neo (Promega) that had been digested with Nhel and Notl was ligated to two fragments: a PCR- amplified fragment that contains the MS2 coat protein-encoding sequence that had been digested with Nhel and BamHI, and a PCR-amplified fragment that contains human Staul cDNA that had been digested with Bgiπ and Notl. The MS2 coat protein-encoding fragment was amplified using pET-MS2 (Coller et al., 1998) and two primers: 5'- CGCTACTAGCTAGCCGCCATGGCTTCTAACTTTACTCAGTTCGTTC-S ' (SEQ E) NO. 7) (sense) and 5'-
ATAAGAATGCGGCCGCCTAGGATCCAGCGTAGTCTGGAACGTCGTATGGGTAGA TGCCGGAGTTTGCTGCGATTG-3' (SEQ ID NO. 8) (antisense), where underlined and bold nucleotides specify the Nhel or Notl site and HA tag sequence, respectively. The Staul cDNA-containing sequence was amplified using phStaul55-HA3 and two primers: 5'- GAAGATCTAGAATGAAACTTGGAAAAAAACCAATGTATAAG-S' (SEQ ED NO. 5) (sense) and 5'- ATAAGAATGCGGCCGCTCAGCACCTCCCACACACAGACATTGGTCC-S' (SEQ ID NO. 6) (antisense), where underlined nucleotides specify the Bgiπ or Notl site, respectively.
225. To construct pMS2-HA that harbors an N-terminal MS2 coat protein followed by an HA tag, pCI-neo that had been digested with Nhel and Notl was ligated to the same PCR- amplified fragment that contains the MS2 coat protein-encoding sequence and was similarly digested with Nhel and Notl (see above).
226. pcFLuc-MS2bs, which contains eight tandem repeats of the MS2 coat protein- binding sites within the 3'UTR of firefly luciferase (FLuc) cDNA, was generated from pq8- 8bs (Lykke- Andersen et al., 2000) by replacing /3-globin cDNA with FLuc cDNA. pcFLuc, which lacks the MS2 coat protein-binding sites, was generated from pcFLuc-8bs by cleaving with PspOMI and Notl followed by self-ligation after generating blunt ends using Klenow (New England Biolabs).
227. pRLuc, which encodes renilla luciferase (RLuc), was generated from p21uc (Grentzmann et al., 1998) by precisely deleting FLuc cDNA.
228. Full-length Arfl cDNA was obtained by RT-PCR (RNA PCR Core Kit, Applied Biosystems) using total HEK293-cell RNA and two primers: 5'-
AGGTCTAGATCGGAGCAGCAGCCTCTGAGGTGT-3' (SEQ ID NO. 9) (sense) and 5'- GGCTCGAGCTAATAGCTATAATTACAGTGCTTGTTTGTCGAAATG-S' (SEQ ID NO. 10) (antisense), where underlined nucleotides specify the Xbal and Xhol site, respectively. The PCR product was digested with Xbal and Xhol and ligated to pSport β-gal (Invitrogen) that had been digested with Xbal and Xhol. The resulting plasmid, pSport β-gal- Arfl , was digested with Notl, purified, and self-ligated to generate pSport- Arfl .
229. To construct pSport-ArflΔ(3'UTR), pSport- Arfl was digested with Kpnl and Xhol. The resulting vector-containing fragment was ligated to a PCR-amplified fragment that contains the Arfl open translational reading frame and had been digested with Kpnl and Xhol. PCR was carried out using pSport- Arfl and two primers: 5 '-
GCTATTTAGGTGACACTATAGAAGGTAC-S' (SEQ ID NO. 11) (sense) and 5'- CCGCTCGAGTTCACTTCTGGTTCCGGAGCTGATTG-3' (SEQ ID NO. 12) (antisense), where underlined nucleotides specify the Hindiπ site. 230. Deletions within the 3' UTR of Arfl cDNA were generated using pSport-Arfl, 5'-CATTTCGACAAACAAGCACTGTAATTATAGCTATTAG-S' (SEQ ED NO. 13) (sense) and one of the following antisense primers: 5'-CCAAGGACAAGCGAGTTGCG- 3'(Δ1229-1794) (SEQ ID NO. 14), 5' -CGACTGGC ATCC AGGCCGT AAC-3'(Δ1123-1794) (SEQ E) NO. 15), 5 '-GTGCCCATGGGCCTACATCC-S '(Δ 920-1794) (SEQ ID NO. 16), 5'- ACGAGCCGCACGTTTGCCA-3'(Δ689-1794) (SEQ E) NO. 17), 5'- GTTCACTTCTGGTTCCGGAGCTG-3'(Δ622-1794) (SEQ E) NO. 18). PCR amplifications were carried out using Pfu Ultra (Stratagene). PCR products were incubated with Dpnl to digest the methylated template DNA, phosphorylated at the 5' ends using T4 polynucleotide kinase (Fermentas), and circularized by ligation.
231. To construct pfos- Arfl -SBS, pfos-Gl (Lejeune et al., 2004) was digested with Ncol and EcoRI and ligated to a PCR-amplified fragment that contains Arfl -SBS cDNA. PCR was carried out using pSport-Arfl and two primers : 5'- ACAACCATGGGGAACATCTTCGCCAACCTCTTC-3' (sense) (SEQ E) NO. 19) and 5'- CCGGAATTCTGGGCCTACATCCCCTCTCAGCACTGAAC-S ' (SEQ E) NO. 20) (antisense), where underlined nucleotides specify the Ncol or EcoRI site.
232. To construct pMS2-HA-eET4AE[, which encodes N-terminal oligomerization- defective MS2 coat protein followed successively by an HA tag and full-length human eE^AEI cDNA, pCI-neo that had been digested with Nhel and Notl was ligated to two fragments: the Nhel/BamHI fragment from pMS2-HA-Staul that contains the MS2 coat protein-encoding sequence, and a PCR-amplified fragment that contains human eIF4Aπi cDNA and had been digested with BamHI and Notl. eD?4AIE was amplified using pcDNA3- HA-eIF4AE[ (Chiu et al., 2004) and two primers: 5'- CGCGGATCCATGGCGACCACGGCCACGATGGCGACC-3' (SEQ E) NO. 21) (sense) and 5 '- AT AAGAATGCGGCCGCTC AGAT AAGATC AGC AACGTTC ATCGG-3 ' (SEQ E) NO. 22) (antisense), where underlined nucleotides specify the BamHI or Notl site, respectively.
233. To construct pcFLuc(UAA-»CAA)-MS2bs, which lacks a termination codon upstream of the MS2 binding sites, pcFLuc-8bs that had been digested with Notl and EcoRV was ligated to a PCR-amplified fragment that contains C-terminus of FLuc in which the UAA codon was converted to a CAA codon and had been digested with Notl and EcoRV. The PCR reactions were performed using pR/HCV/F (Kim et al., 2003) and two primers: 5'- TTGACCGCTTGAAGTCTTTAATTAAATAC-3' (SEQ E) NO. 23) (sense) and 5'- CGAAGCGGCCGCAATTACATTTTGCAATTTGGACTTTCCGCCCTTCTTGGC-S' (SEQ ID NO. 24) (antisense). Underlined nucleotides specify a Notl site.
234. To construct pcFLuc-Arfl SBS or pcFLuc-Arfl No SBS, pcFLuc-8bs were digested with Xbal and ligated to a Xbal-digested PCR-amplified fragment that had been generated using pSport-Arfl and two primers: 5'-
GCTCTAGAGTGACCGAATTCGTGAACGCGACCCCCCTCCCTCTCACTC-S' (SEQ BD NO. 25) (sense) and 5'-GCTCTAGAGGGCCCAGGTGCCCATGGGCCTACATCCCC-S' (SEQ ID NO. 26) (antisense) for pcFLuc-Arfl SBS, or 5'-
GCTCTAGAGTGACCGAATTCGTGAGAGGGGATGTAGGCCCATGGGCAC-S ' (SEQ ID NO. 27) (sense) and 5 '-
GCTCTAGAGGGCCCGAGGGGAACAGCTGGGCTGGCGACTGG-S' (SEQ ID NO. 28) (antisense) for pcFLuc-Arfl No SBS. Underlined nucleotides specify Xbal sites.
235. To construct pfos-Arfl-SBS or pfos-Arfl-No SBS, pfos-Gl (Lejeune et al., 2004) was digested with Ncol and EcoRI and ligated to a PCR-amplified fragment that contains Arfl-SBS cDNA or Arfl-No SBS cDNA. PCR was carried out using pSport-Arfl and two primers : 5 '-AC AACCATGGGGAACATCTTCGCCAACCTCTTC-3 ' (sense) (SEQ ID NO: 57) and 5'-CCGGAATTCTGGGCCTACATCCCCTCTCAGCACTGAAC- 3' (antisense) (SEQ ID NO: 58) for Arfl-SBS cDNA or 5'- CCGGAATTCTC ACTTCTGGTTCCGGAGCTGATTGGAC-3' (SEQ ID NO: 59) (antisense) for Arfl-No SBS cDNA, where underlined nucleotides specify the Ncol or EcoRI site.
236. pSport-PAICS was purchased from ATCC (catalog # MGC-5024, NCBI Accession # BCOl 0273). pSport-PAICS Δ(3'UTR) was generated using pSpoit-PAICS and two primers: 5'-CCAAGCTTACGCGTACCCAGCTTTC-S' (SEQ ID NO. 29) (sense) and 5'- CCCCTAAAAAATTCAATGGCATTCTTTC-S' (SEQ ID NO. 30) (antisense). PCR amplification was carried out using PfU Ultra (Stratagene). The PCR product was incubated with Dpnl to digest the methylated template DNA, phosphorylated at the 5' ends using T4 polynucleotide kinase (Fermentas), and circularized by ligation.
237. pCDNA3-RSV-CK2A2 was constructed by inserting a BamHI-XhoI fragment from pOTB7-CK2A2 (ATCC catalog # MGC-10397, NCBI Accession # BC008812 ) into pCDNA3-RSV that had been digested using BamHI and Xhol. Example 7: Yeast Two-Hybrid Analysis 238. Proteins that interact with human Upfl were identified using the CytoTrap Two- Hybrid System (Stratagene). The yeast strain cdc25H was transformed with pSos-Upfl and the pMyr library of HeLa-cell cDNAs (Stratagene). Transformants were processed following manufacturer instructions. Example 8: siRNA-Mediated Down-Regulation of Human Upfl, Upf2, Upf3X or Staul
239. HeLa cells (2 x 106) were grown in DMEM medium (Gibco-BRL) containing 10% fetal bovine serum (Gibco-BRL) in 60-mm dishes and transiently transfected with 100 nM of in vitro-synthesized small interfering (si)RNA (Xeragon or Dharmacon) using Oligofectamine (Invitrogen). Upfl, Upf2, UpBX or Staul were down-regulated using, respectively, 5'-r(GAUGCAGUUCCGCUCCAUU)d(TT)-3' (SEQ ID NO. 31), 5'- r(GGCUUUUGUCCCAGCCAUC)d(TT)-3' (SEQ ID NO. 32), 5'- r(GGAGAAGCGAGUAACCCUG)d(TT)-3' (SEQ ID NO. 33), or 51- r(CCUAUAACUACAACAUGAG)d(TT)-3' (SEQ ID NO. 34).
240. hi experiments that involved siRNA and tethering (see below), cells were re- transfected 48 h later with the specified reporter, effector, and reference plasmids. Cells were harvested two days later. To test for the abrogation of Gl, GPxI or Aril NMD, cells were re- transfected 48 h after siRNA introduction with (i) 0.05 μg of a pmCMV-Gl test plasmid, either nonsense-free (Norm) or nonsense-containing (39Ter) (Zhang et al., 1998), (ii) or 0.05 μg of a pmCMV-GPxl test plasmid, either Norm or 46Ter (Moriarty et al., 1998), (iii) 0.05 μg of a pSport- Arfl or pSport-Arfl Δ(3 'UTR) test plasmid, and (v) 0.1 μg of the phCMV-MUP reference plasmid (Belgrader and Maquat, 1994) using Lipofectamine Plus Reagent (Invitrogen).
241. Staul (A) siRNA consisted of 51-r(GUUUGAGAUUGCACUUAAA)d(TT)-3I (SEQ ID NO. 35), and Upfl (A) siRNA consisted of 5'- r(AACGUUUGCCGUGGAUGAG)d(TT)-3' (SEQ ID NO. 36).
242. Alternatively, in microarray experiments that involved the specific down regulation of Staul, HeLa cells (5 x 106) were grown in DMEM medium (Gibco-BRL) containing 10% fetal bovine serum (Gibco-BRL) in 100-mm dishes and transiently transfected with 50 nM of in v/trø-synthesized small interfering (si)RNA (Dharmacon) using Oligofectamine Reagent (Invitrogen). Staul was down-regulated using 5'- r(CCUAUAACUACAACAUGAG)d(TT)-3' (SEQ ID NO. 34). Protein was purified from half of the cells using passive lysis buffer (Promega) and used to determine the extent of down-regulation. RNA was purified from the other half using TRIzol Reagent (Invitrogen), 72 h after siRNA introduction, and analyzed using microarrays. Example 9: Tethering Experiments
243. HeLa cells (2 x 106) were transiently transfected using Lipofectamine Plus (Invitrogen) with 0.3 μg of the reporter plasmid pcFLuc or pcFLuc-MS2bs, 0.02 μg of the reference plasmid pRLuc, and 5 μg of one of the following effector plasmids: pMS2-HA, pMS2-HA-Staul, pcNMS2, pcNMS2-Uρfl, pcNMS2-Upf2 or pcNMS2-Upf3. Cells were harvested two days later. Protein was purified from half of the cells using passive lysis buffer (Promega), and total RNA was purified from the other half using TRIzol Reagent (Invitrogen).
Example 10: fos Promoter Induction Experiments
244. Ltk" cells (4 X lO6) were transiently transfected with 200 nM of Control siRNA or 100 nM each of two different mouse Staul siRNAs [5'- r(CAACUGUACUACCUUUCCA)d(TT)-3' (SEQ ID NO. 37) or 5' r(AACGGUAACUGCCAUGAUA)d(TT)-3' (SEQ ID NO. 38)]. Alternatively, Upfl, Upf2 or Upf3X siRNA was used [5'-r(UCAAGGUUCCUGAUAAUUA)dTT-3' (SEQ ID NO: 60), 5'-r(GAAACUUCUUGAUGAACAA)dTT-3' (SEQ ID NO: 61), or 5'- r(AGAGGCACUUCGAGAUAAA)dTT-3'(SEQ E) NO: 62), respectively]. Two days later, cells were retransfected with 0.3 μg of the pfos-Arfl-SBS test plasmid, and the phCMV-MUP reference plasmid as described above. The fos promoter was transiently induced, and cells were fractionated as described (Lejeune et al., 2003). However, serum was eliminated from the second transfection and added back one day later. Example 11: Immunopurifications
245. Cos-7 or HeLa cells were cultured as described above but in 150-mm dishes. Transfections and immunopurifications (IPs) were performed as described (Chiu et al., 2004;
Ishigaki et al., 2001; Lejeune et al., 2002). Example 12: Western Blotting
246. Protein was electrophoresed in SDS-polyacrylamide, transferred to Hybond ECL nitrocellulose (Amersham), and probed with antibodies that recognize FLAG (Sigma), GST (Qiagen), HA (Roche), Upfl (Lykke-Andersen et al., 2000), Upf2 (Serin et al., 2001),
UpD/3X (Serin et al., 2001), Barentsz (Macchi et al., 2003), CBP80 (Izaurralde et al., 1994), eIF4E (Santa Cruz), Vimentin (Santa Cruz), human Staul (Wickham et al., 1999), mouse Staul (Marion et al., 1999), PABPl (Gorlach et al., 1994), PABP2 (Krause et al., 1994), or eEF3b (a gift from N. Sonenberg) as described (Chiu et al., 2004; Lejeune et al., 2002; Lejeune et al., 2003). Example 13: RT-PCR
247. The levels of specific RNAs were quantitated using RT-PCR as described (Sun et al., 1998). FLuc, β-G\ and MUP mRNAs were amplified as described previously (Chiu et al., 2004; Lejeune et al., 2003), and RLuc mRNA was amplified using the primers 5 - ATGACTTCGAAAGTTTATG-S ' (SEQ ID NO. 39) (sense) and 5'- TTCAGATTTGATC AACGC A-3' (SEQ ID NO. 40) (antisense). Cellular Arfl mRNA or Arfl mRNA that derived from a pSport vector was amplified using the primers 5 - AACCAACGCCTGGCTCGG-3' (SEQ ID NO. 41) (sense) and 5'-
AGTCCTTCATAGAGCCCGTCG-3'(SEQ ID NO. 42) (antisense) or 5'- GCTATTTAGGTGACACTATAGAAGGTAC-3' (SEQ ID NO. 43) (sense) and 5'- TTCTTGTACTCCACGGTTTC-3'(SEQ ID NO. 44) (antisense), respectively.
248. RT-PCR products were electrophoresed in 5% polyacrylamide and quantitated by Phosphorlmaging (Molecular Dynamics).
249. In experiments that mapped Staul-HA binding within the Arfl mRNA 3' UTR, RT-PCR analysis of Arfl mRNA was performed using One Step RT-PCR (Qiagen), the primer pair 5'-GCTATTTAGGTGACACTATAGAAGGTAC-S' (SEQ ID NO. 45) (sense) and 5'- CTCTGTC ATTGCTGTCC ACC ACG-3' (SEQ ID NO. 46) (antisense), and ethidium bromide staining.
250. FLuc-MS2bs mRNA or FLuc(UAA→CAA)-MS2bs mRNA was amplified using the primers 5'-CAACACCCCAACATCTTCG-S' (SEQ ID NO. 47) (sense) and 5'- CTTTCCGCCCTTCTTGGCC-3' (SEQ ID NO. 48) (antisense). Gl-MS2bs or
Gl(U AA- »U AC)-MS2bs was amplified using the primers 5 - AATACGACTCACTATAGGGA-3 ' (SEQ ID NO. 49) (sense), which anneals to the T7 promoter, and 5 '-GATACTTGTGGGCCAGGGCA-3 ' (SEQ ID NO. 50) (antisense). FLuc- Arfl mRNA was amplified using the same T7 promoter primer (sense) and 5 - TCTAGAGGATAGAATGGCG-3 ' (SEQ ID NO. 51) (antisense). PAICS mRNA was amplified using the primers 5'-AGCAGGCTGGTACCGGTCCG-S' (SEQ ID NO. 52) (sense) and 5 '-ACC AATGTTCAGTACCTCAG-3 ' (SEQ ID NO. 53) (antisense). Example 14: Far-Western Blotting
251. FLAG-Upfl was purified from HeLa cells that had been stably transfected with pCI-neo-FLAG-UPFl as previously described (Pal et al., 2001). GST-Upfl was purified from E. coli using Bulk GST Purification Modules (Amersham). 252. Lysates of E. coli that were or were not induced to express όxHis-Staul or GST-
Staul using IPTG (Invitrogen) were resolved in 8% SDS-polyacrylamide and transferred to Hybond ECL nitrocellulose (Amersham). Membranes were incubated for 12 h at 4°C in blocking buffer [20 mM Hepes (pH 7.4), 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 1 mM DTT, 0.1% NP-40 and 2% milk], and then incubated overnight at 4°C in blocking buffer containing 10 μg of purified FLAG-Upfl or GST-Upfl . Interacting proteins were detected using Western blotting and anti-FLAG or anti-GST antibody. Example 15: Microarray Analysis
253. The IP of Staul -containing RNP was performed as previously described (Duchaine et al., 2000). Constituent RNAs were purified and deemed intact using an RNA 6000 Nano LabChip (Agilent) together with a Bioanalyser 2100 and Biosizing software (Agilent). Biotin-labeled cRNAs were generated and hybridized to Ul 33 A 22000 human genes chips. Hybridized chips were scanned using an Agilent GeneArray scanner 2500 (Affymetrix), and scanned images were analyzed using Microarray Analysis Suite version 5.0 (Affymetrix). Notably, the Affymetrix Gene Expression Assay identifies changes that are greater than 2-fold with 98% accuracy (Wodicka et al., 1997). Changes of at least 2.5-fold were scored as Staul -interacting transcripts.
Example 16: Identification of HeLa-cell transcripts are regulated upon Staul depletion
254. To identify physiologic SMD targets, HeLa-cell RNA from three independently performed transfections, in which the level of cellular Staul was depleted to as little as 4% of normal (where normal is defined as the level in the presence of Control siRNA), was separately hybridized to microarrays. Sequences from 18,279 HeLa-cell transcripts were analyzed, representing 34% of the array probe sets, in all three hybridization experiments. It was observed that 124 transcripts, or 1.1 % of the HeLa-cell transcriptome that was analyzed, were upregulated at least 2-fold in all three transfections (Table 6).
Table 6: Transcripts upregulated in human cells depleted of Staul in three independently performed microarray analyses
Transcript Fold change Abbreviation Probe set Homo sapiens hypothetical protein LOC339468 mRNA
(cDNA clone IMAGE:5166507) partial cds 9.79 1562908_at
I factor (complement) 8.78 IF 1555564_a_at fibronectin 1 7.98 FN1 216442_x_at interferon-induced protein with tetratricopeptide repeats 2 7.51 IFIT2 226757_at
5.91 211506_s_at interferon-induced protein 44 5.88 IFI44 214059_at secretogranin Il (chromogranin C) 5.62 SCG2 204035_at stathmin-like 3 5.53 STMN3 222557_at growth associated protein 43 5.48 GAP43 204471 _at creatine kinase mitochondrial 1 (ubiquitous) 5.35 CKMT1 202712_s_at osteoblast specific factor 2 (fasciclin l-like) 5.30 OSF-2 210809_s_at hypothetical protein FLJ25348 4.77 FLJ25348 1562415_a_at guanine nucleotide binding protein (G protein) gamma 4 4.75 GNG4 205184_at hypothetical protein FLJ33505 4.73 FLJ33505 1561114_a_at filamin-binding LIM protein-1 4.71 FBLP-1 1555480_a_at claudin 11 (oligodendrocyte transmembrane protein) 4.50 CLDN11 228335_at
Homo sapiens transcribed sequence with weak similarity to protein ref:NP_060265.1 (H.sapiens) hypothetical protein
FLJ20378 [Homo sapiens] 4.46 235629_at insulin-like growth factor binding protein 5 4.30 IGFBP5 211959_at integrin beta 3 (platelet glycoprotein MIa antigen CD61) 4.18 ITGB3 204627_s_at interferon-induced protein with tetratricopeptide repeats 4 4.13 IFIT4 229450_at alpha-actinin-2-associated LIM protein 3.97 ALP 210170_at transgelin 3.94 TAGLN 205547_s_at
2'-5'-oligoadenylate synthetase-like /// 2'-5'-oligoadenylate synthetase-like 3.86 OASL 210797_s_at tissue factor pathway inhibitor 2 3.82 TFPI2 209277_at catenin (cadherin-associated protein) alpha-like 1 3.80 CTNNAL1 213712_at
Homo sapiens cDNA: FLJ20914 fis clone ADSE00646 3.76 234597_at thrombospondin 1 3.73 THBS1 201108_s_at protein tyrosine phosphatase receptor type O 3.62 PTPRO 1554199_at cyclin-E binding protein 1 3.60 CEB1 219863_at
NADPH oxidase 4 3.59 NOX4 219773_at hypothetical protein MGC29643 3.58 MGC29643 212909_at
Homo sapiens uncharacterized gastric protein ZA43P mRNA partial cds 3.43 232696_at
Homo sapiens similar to KIAA0563-related gene
(LOC376854) mRNA 3.42 1562921_at hypothetical protein FLJ20035 3.40 FLJ20035 218986_s_at
Homo sapiens cDNA FLJ41180 fis clone BRACE2043142 3.40 227890_at tissue factor pathway inhibitor 2 3.35 TFPI2 209278_s_at absent in melanoma 1 3.34 AIM1 212543_at chromosome 14 open reading frame 141 3.29 C14orf141 223690_at dual specificity phosphatase 6 3.29 DUSP6 208891_at interferon alpha-inducible protein (clone IFI-15K) 3.19 G1 P2 205483_s_at serine (or cysteine) proteinase inhibitor clade E (nexin plasminogen activator inhibitor type 1 ) member 1 3.16 SERPINE1 202628_s_at
Homo sapiens cDNA FLJ23692 fis clone HEP10227 3.13 235846_at hypothetical protein FLJ20637 3.04 FLJ20637 219352_at signaling lymphocytic activation molecule family member 1 3.00 SLAMF1 206181_at selenocysteine lyase 2.98 SCLY 59705_at interleukin 7 receptor 2.97 IL7R 205798_at
Rho GDP dissociation inhibitor (GDI) beta 2.94 ARHGDIB 201288_at actin alpha 2 smooth muscle aorta 2.94 ACTA2 200974_at chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha) 2.84 CXCL1 204470 at DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 2.83 RIG-I 218943_s_at insulin-like growth factor binding protein 5 2.78 IGFBP5 211958_at interferon-induced protein with tetratricopeptide repeats 1 2.78 IFIT1 203153_at
Homo sapiens hypothetical protein LOC285103 mRNA
(cDNA clone IMAGE:5273139) partial cds 2.76 227966_s_at decapping enzyme hDcp2 2.74 DCP2 212919_at hypothetical protein FLJ34064 2.73 FLJ34064 1553244_at eukaryotic translation initiation factor 5A2 2.73 EIF5A2 235289_at hypothetical protein MGC19764 2.71 MGC19764 1557078_at
Homo sapiens BIC noncoding mRNA complete sequence 2.69 229437_at transducin-like enhancer of split 4 (E(sp1) homolog
Drosophila) 2.68 TLE4 235765_at dapper homolog 1 antagonist of beta-catenin (xenopus) 2.67 DACT1 219179_at chromosome 9 open reading frame 39 2.64 C9orf39 220095_at
Homo sapiens transcribed sequences 2.61 229242_at v-jun sarcoma virus 17 oncogene homolog (avian) 2.58 JUN 201466_s_at integrin alpha 4 (antigen CD49D alpha 4 subunit of VLA-4 receptor) 2.56 ITGA4 205885_s_at
Homo sapiens cDNA FLJ40697 fis clone THYMU2025406 2.53 235203_at
Homo sapiens transcribed sequences 2.53 236817_at tenascin C (hexabrachion) 2.52 TNC 201645_at hypothetical protein FLJ13621 2.50 FLJ13621 207286_at flavoprotein oxidoreductase MICAL2 2.47 MICAL2 212473_s_at
Homo sapiens cDNA FLJ46457 fis clone THYMU3020856 2.44 225007_at thymosin beta identified in neuroblastoma cells 2.44 TMSNB 205347_s_at prostaglandin E receptor 4 (subtype EP4) 2.42 PTGER4 204897_at chromosome 14 open reading frame 128 2.41 C14orf128 228889_at ganglioside-induced differentiation-associated protein 1 2.41 GDAP1 226269_at zinc finger protein 36 C3H type-like 1 2.38 ZFP36L1 211965_at uracil-DNA glycosylase 2.37 UNG 202330_s_at hypothetical protein MGC27277 2.37 MGC27277 242283_at
Homo sapiens cDNA FLJ10158 fis clone HEMBA1003463. 2.35 232125_at
CDK5 regulatory subunit associated protein 1-like 1 2.34 CDKAL1 214877_at
Homo sapiens transcribed sequence with moderate similarity to protein ref:NP_071431.1 {H.sapiens) cytokine receptor-like factor 2 2.32 227547_at aldehyde dehydrogenase 1 family member A3 2.32 ALDH 1 A3 203180_at proteasome (prosome macropain) subunit beta type 9 (large multifunctional protease 2) 2.29 PSMB9 204279_at
PHD finger protein 11 2.27 PHF11 221816_s_at
B-cell scaffold protein with ankyrin repeats 1 2.27 BANK1 219667_s_at
KIAA0143 protein 2.26 KIAA0143 212150_at guanylate binding protein 1 interferon-inducible 67kDa 2.26 GBP1 202270_at epiplakin 1 2.25 EPPK1 232164_s_at actinin alpha 1 2.24 ACTN 1 211160_x_at ring finger protein 20 2.22 RNF20 222683_at leucine rich repeat (in FLII) interacting protein 1 2.22 LRRFIP1 223492_s_at
Homo sapiens cDNA FLJ39819 fis clone SPLEN2010534. 2.21 1556111_s_at hypothetical protein LOC150759 2.21 LOC150759 213703_at dihydropyrimidinase-like 3 2.20 DPYSL3 201431_s_at type I transmembrane receptor (seizure-related protein) 2.20 PSK-1 233337_s_at zinc finger protein 90 homolog (mouse) 2.20 ZFP90 235698_at tumor protein p53 (Li-Fraumeni syndrome) 2.20 TP53 211300_s_at
Homo sapiens cDNA FLJ11465 fis clone HEMBA1001636. 2.19 228632_at dnaj-like protein 2.17 LOC148418 229402_at transforming growth factor beta 1 induced transcript 1 2.15 TGFB1 I1 209651_at ets variant gene 1 2.15 ETV1 221911 at Rho GTPase activating protein 19 2.14 ARHGAP19 212738 at
Homo sapiens hypothetical LOC284120 (LOC284120) mRNA 2.13 241394_at suppressor of cytokine signaling 2 2.13 SOCS2 203373_at cyclin-dependent kinase 5 regulatory subunit 1 (p35) 2.11 CDK5R1 204995_at likely ortholog of mouse Sds3 2.11 SDS3 233841_s_at
Homo sapiens transcribed sequences 2.09 244091_at spinal cord-derived growth factor-B 2.09 SCDGF-B 219304_s_at
Homo sapiens cDNA FLJ37290 fis clone BRAMY2014469. 2.09 231026_at histone deacetylase 8 2.07 HDAC8 223908_at
2.06 1567079_at
Homo sapiens transcribed sequence with weak similarity to protein pir:l38588 (H.sapiens) I38588 reverse transcriptase homolog - human retrotransposon L1 2.06 235302_at
Homo sapiens full length insert cDNA clone YP61C10 2.06 1561631_at high-mobility group box 3 2.05 HMGB3 225601_at
KIAA0931 protein 2.05 KIAA0931 213407_at
Homo sapiens cDNA FLJ33441 fis clone BRACE2021932. 2.04 1556081_at
DKFZp761 K hypothetical protein DKFZp761 K1423 2.04 1423 218613_at protein tyrosine phosphatase receptor type F 2.04 PTPRF 200635_s_at thioredoxin reductase 3 2.03 TXNRD3 59631_at
CGI-72 protein 2.03 CGI-72 231967_at hypothetical protein MGC15634 2.03 MGC15634 242923_at enoyl-Coenzyme A hydratase/3-hydroxyacyl Coenzyme A dehydrogenase 2.03 EHHADH 205222_at hairy and enhancer of split 1 (Drosophila) 2.02 HES1 203394_s_at chromosome 11 open reading frame 9 2.00 C11orf9 204073_s_at
TIA1 cytotoxic granule-associated RNA binding protein 2.00 TIA1 1554890 a at
Furthermore, 115 transcripts, or [£%! of the HeLa-cell transcriptome that was analyzed, were downregulated at least 2-fold in all three transfections (Table 7).
Table 7 Transcripts downregulated in human cells depleted of Staul in three independently performed microarray analyses
Transcript Fold change Abbreviation Probe set transmembrane protein 9 0.50 TMEM9 222988_s_at
MAX dimerization protein 1 0.50 MAD 228846_at ecotropic viral integration site 5 0.50 EVI5 209717_at
NEDD8-conjugating enzyme 0.50 NCE2 225783_at
ATPase H+ transporting lysosomal 9kDa VO subunit e 0.49 ATP6V0E 236527_at
RAP2A member of RAS oncogene family 0.49 RAP2A 225585_at
T-cell leukemia translocation altered gene 0.49 TCTA 203054_s_at ubiquitin-conjugating enzyme E2R 2 0.49 UBE2R2 226954_at hypothetical protein FLJ30794 0.49 FLJ30794 238029_s_at kelch-like 8 {Drosophila) 0.49 KLHL8 242648_at junction-mediating and regulatory protein 0.49 JMY 241985_at tripartite motif-containing 37 0.49 TRIM37 213009_s_at tubulin-tyrosine ligase 0.48 TTL 224896_s_at cystathionase (cystathionine gamma-lyase) 0.48 CTH 217127_at
LSM1 homolog U6 small nuclear RNA associated (S. cerevisiae) 0.48 LSM1 203534_at protein kinase H11 0.48 H11 221667_s_at
N-myc downstream regulated gene 1 0.48 NDRG1 200632 s at Homo sapiens mRNA 0.48 230251_at transmembrane 4 superfamily member 1 0.48 TM4SF1 215034_s_at guanine nucleotide binding protein (G protein) alpha inhibiting activity polypeptide 1 0.48 GNAM 227692_at v-raf murine sarcoma 3611 viral oncogene homolog 1 0.48 ARAF1 230652_at isocitrate dehydrogenase 1 (NADP+) soluble 0.48 IDH1 201193_at solute carrier family 39 (zinc transporter) member 9 0.48 SLC39A9 222445_at tumor necrosis factor receptor superfamily member 11b
(osteoprotegerin) 0.47 TNFRSF11B 204932_at insulin induced gene 1 0.47 INSIG1 201626_at
ALL1 fused gene from 5q31 0.47 AF5Q31 243487_at solute carrier organic anion transporter family member
3A1 0.47 SLCO3A1 210542_s_at hypothetical protein LOC154807 0.47 LOC154807 1553679_s_at Homo sapiens cDNA clone IMAGE:4304686 partial cds 0.47 1559007_s_at Homo sapiens transcribed sequence with moderate similarity to protein pdb:1 LBG (£. coli) B Chain B Lactose Operon Repressor Bound To 21 -Base Pair Symmetric Operator Dna Alpha Carbons Only 0.47 230048_at
SARIa gene homolog 2 (S. cerevisiae) 0.47 SARA2 1554482_a_at putative nucleic acid binding protein RY-1 0.47 RY1 212440_at TATA element modulatory factor 1 0.47 TMF1 227685_at hydroxysteroid (17-beta) dehydrogenase 12 0.46 HSD17B12 217869_at disabled homolog 2 mitogen-responsive phosphoprotein (Drosophila) 0.46 DAB2 201280_s_at
ATP citrate lyase 0.46 ACLY 210337_s_at chondroitin beta14 N-acetylgalactosaminyltransferase 0.46 ChGn 219049_at chromosome 9 open reading frame 12 0.46 C9orf12 219092_s_at hypothetical protein DKFZp762K222 0.46 DKFZp762K222 231969_at inhibitor of DNA binding 2 dominant negative helix-loop- helix protein 0.46 ID2 201565_s_at dual specificity phosphatase 1 0.46 DUSP1 201041_s_at
Homo sapiens transcribed sequences 0.45 238577_s_at transforming growth factor beta receptor III (betaglycan
30OkDa) 0.45 TGFBR3 226625_at
GABA(A) receptors associated protein like 3 0.45 GABARAPL3 211458_s_at nuclear receptor subfamily 4 group A member 2 0.45 NR4A2 204622_x_at
Homo sapiens cDNA FLJ38505 fis clone
HCHON2000226. 0.45 227443_at synaptosomal-associated protein 23kDa 0.45 SNAP23 209131_s_at
RWD domain containing 3 0.44 RWDD3 205087_at retinoic acid early transcript 1 E 0.44 RAET1 E 1552777_a_at polymerase (RNA) Il (DNA directed) polypeptide L
7.6kDa 0.44 POLR2L 202586_at kelch-like 2 Mayven (Drosophila) 0.44 KLHL2 219157_at solute carrier family 18 (vesicular monoamine) member
2 0.44 SLC18A2 230416_at sideroflexin 1 0.44 SFXN 1 230069_at
KIAA0256 gene product 0.43 KIAA0256 212450_at
0.43 227278_at
GABA(A) receptor-associated protein like 1 0.43 GABARAPL1 208868_s_at solute carrier family 11 (proton-coupled divalent metal ion transporters) member 2 0.43 SLC11A2 203124_s_at sphingomyelin phosphodiesterase acid-like 3A 0.43 SMPDL3A 213624_at neuronal pentraxin I 0.43 NPTX1 204684_at fucosyltransferase 11 (alpha (13) fucosyltransferase) 0.43 FUT11 226348_at
4-hydroxyphenylpyruvate dioxygenase 0.43 HPD 206024 at diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor) 0.43 DTR 203821_at
DKFZp762C111 hypothetical protein DKFZp762C1112 0.43 2 225974_at sorting nexin 13 0.43 SNX13 227031_at fibronectin leucine rich transmembrane protein 2 0.42 FLRT2 204359_at
START domain containing 7 0.42 STARD7 200028_s_at ubiquitin specific protease 31 0.42 USP31 229812_at
Homo sapiens cDNA FLJ37284 fis clone
BRAMY2013590. 0.42 225728_at protein tyrosine phosphatase type IVA member 1 0.42 PTP4A1 200732_s_at glutamate-cysteine ligase modifier subunit 0.42 GCLM 234986_at guanine nucleotide binding protein (G protein) alpha activating activity polypeptide olfactory type 0.42 GNAL 218178_s_at chromosome 13 open reading frame 1 0.42 C13orf1 230151_at heat shock 7OkDa protein 9B (mortalin-2) 0.42 HSPA9B 200690_at
FK506 binding protein 14 22 kDa 0.42 FKBP14 235311_at adducin 1 (alpha) /// adducin 1 (alpha) 0.42 ADD1 208030_s_at hypothetical protein FLJ20151 0.41 FLJ20151 214164_x_at sestrin 3 0.41 SESN3 225123_at
Homo sapiens transcribed sequence with strong similarity to protein ref:NP_078816.1 (H.sapiens) hypothetical protein FLJ20917 [Homo sapiens] 0.41 230728_at
Arg/Abl-interacting protein ArgBP2 0.41 ARGBP2 204288_s_at adaptor-related protein complex 1 gamma 1 subunit 0.41 AP1G1 215867_x_at cyclin C 0.41 CCNC 201955_at collagen type XXV alpha 1 0.41 COL25A1 1555253_at hypothetical protein BC013767 0.40 LOC114990 225867_at
KIAA0877 protein 0.40 KIAA0877 212792_at
HSPC163 protein 0.40 HSPC163 228437_at hypothetical protein FLJ14213 0.39 FLJ14213 219383_at
Homo sapiens mRNA 0.39 227628_at family with sequence similarity 20 member B 0.39 FAM20B 202916_s_at likely ortholog of mouse hypoxia induced gene 1 0.39 HIG1 221896_s_at nuclear receptor subfamily 4 group A member 3 0.38 NR4A3 207978_s_at aldo-keto reductase family 1 member C1 (dihydrodiol dehydrogenase 1 0.38 AKR1C1 1555854_at hypothetical protein FLJ90492 0.37 FLJ90492 226604_at low density lipoprotein receptor-related protein 11 0.37 LRP11 225060_at junctophilin 1 0.37 JPH1 229139_at calumenin 0.37 CALU 200756_x_at solute carrier family 2 (facilitated glucose transporter) member 13 0.37 SLC2A13 1552695_a_at
Homo sapiens Similar to LOC166075 clone IMAGE:5173621 mRNA partial cds 0.36 236738_at delta sleep inducing peptide immunoreactor 0.36 DSIPI 208763_s_at sperm associated antigen 1 0.36 SPAG1 210117_at carbonic anhydrase XII 0.35 CA12 210735_s_at inositol 145-triphosphate receptor type 1 0.34 ITPR1 216944_s_at uronyl-2-sulfotransferase 0.34 UST 205139_s_at stanniocalcin 2 0.34 STC2 203438_at clusterin (complement lysis inhibitor SP-4040 sulfated glycoprotein 2 testosterone-repressed prostate message 2 apolipoprotein J) 0.34 CLU 222043_at adaptor-related protein complex 1 sigma 3 subunit 0.31 AP1S3 237159_x_at Homo sapiens cDNA FLJ20769 fis clone COL06674 0.31 232060_at ADP-ribosylation-like factor 6-interacting protein 6 0.31 MGC33864 225711 at n- I!,,,,. ii ,.' >ι,,,ιι ιi iι,,,ιι ,,;.,ιi ,.•■ ,,;;;iι :::n u ,,.ii ii,. abhydrolase domain containing 3 0.31 ABHD3 213017_at pyruvate dehydrogenase kinase isoenzyme 4 0.31 PDK4 205960_at tumor necrosis factor receptor superfamily member 10b 0.30 TNFRSF10B 209295_at aspartate beta-hydroxylase 0.30 ASPH 242037_at
Homo sapiens mRNA 0.29 228141_at cell cycle progression 8 protein 0.28 CPR8 221156_x_at thioredoxin interacting protein 0.26 TXNIP 201008_s_at staufen RNA binding protein (Drosophila) 0.24 STAU 1 211505 s at
255. The validity of the microarray results was tested for 12 of the upregulated transcripts and 6 of the downregulated transcripts using RT-PCR and a primer pair that is specific for each transcript (Table 8).
Table 8 Primer pairs used to amplify transcripts found in microarray analyses to be upregulated or downregulated in human cells
Gene Primer (Sense) Primer (Antisense) c-JUN 5'-CTT GAA AGC TCA GAA SEQ ID NO: 99 5'-TCA GCC CCC GAC GGT SEQIDNO: 100
CTCGG-3' CTCTC-3'
SERPINEl 5'-ACC GCC AAT CGC AAG SEQIDNO: 101 5'-GCT GAT CTC ATC CTT SEQIDNO: 102
GCACC-3' GTT CC-3'
IL7R 5'-AAG TGG CTA TGC TCA SEQIDNO: 103 5'-TTC AGG CAC TTT ACC SEQIDNO: 104
AAATG-3' TCCAC-3'
IF 5'-CCT TGA CCT TGG GTT SEQIDNO: 105 5'-ATT TGC AAT GGA AGC SEQIDNO: 106
TCAAC-3' CTTTG-3'
GAP43 5'-TGT GCT GTA TGA GAA SEQIDNO: 107 5'-GCT TCA TCC TTC TTA SEQIDNO: 108
GAA CC-3' TTAGC-3'
CKMTl 5'-GAC TGG CCA GAT GCT SEQIDNO: 109 5'-ATC TTT GGG AAG CGG SEQIDNO: 110
CGTGG-3' CTATC-3'
STMN3 5'-CCA TGG CCA GCA CCA SEQ ID NO: 111 5'-ACC TCG GCC GCG TGC SEQIDNO: 112
TTT CC-3' AGCTC-3'
TAGLN 5'-TCC TTC CTG CGA GCC SEQIDNO: 113 5'-GCA CTG CTG CCA TGT SEQIDNO: 114
CTGAG-3' CTTTG-3'
OASL 5'-TGC AAT CAT TGA GGA SEQIDNO: 115 5'-CAC TGT CAA GTG GAT SEQIDNO: 116
TTGTG-3' GTCTC-3'
GDIl 5'-GAC AGA GAC GTG AAG SEQIDNO: 117 5'-CCA TAA ATG TTG CTT SEQIDNO: 118
CACTG-3' TAT CC-3'
CXCLl 5'-CCT GGT AGC CGC TGG SEQIDNO: 119 5'-CTT CTG GTC AGT TGG SEQIDNO: 120
CCGGC-3' ATTTG-3'
DCP2 5'-GAT TTA TGT TGT TGT SEQIDNO: 121 5'-CCA AGC AGC CAA TTT SEQIDNO: 122
AGTTG-3' TATTG-3'
TMSL8 5'-ACA GCC TTT CAC GAG SEQIDNO: 123 5'-CTG CTG TTG GGA GGC SEQIDNO: 124
TCTTC-3' GAT CC-3'
PSMB9 5'-GCG GGA GAA GTC CAC SEQIDNO: 125 5'-AGG CTG TCG AGT CAG SEQIDNO: 126
ACCGG-3' CATTC-3'
GDAPl 5'-AGT TAA CTG TGG ACT SEQIDNO: 127 5'-ACT TTC TCC AAC TCA SEQIDNO: 128
CCATG-3' TCAAG-3'
STC2 5'-CCT GTC CCT GCA GAA SEQIDNO: 129 5'-GTT CAC GAG GTC CAC SEQIDNO: 130
TACAG-3' GTAGG-3'
DUSP 5'-GCA AGT CTT CTT CCT SEQIDNO: 131 5'-TTC CTC CAG CAT TCT SEQIDNO: 132
CAAAG-3' TGATG-3'
GABARAPLl 5'-AAA TAT CCG GAC AGG SEQIDNO: 133 5'-TAG TCT TCC TCA TGA SEQIDNO: 134
TTGTC-3'
GTC CC-3'
TXNIP 5'-TCT GGA AGA CCA GCC SEQIDNO: 135 5'-TCA GCA TGG ATG GAA SEQIDNO: 136
AACAG-3' ATCTC-3'
TNFRSFlOB 5'-TCG CCG CGG TCC TGC SEQIDNO: 137 5'-TGA CCA TCC CTC TGG SEQIDNO: 138
TGTTG-3' GACAC-3' CCPGl 5'-GGT CTG GAC TGA TGA SEQ ID NO: 139 5'-CAC TGT GCC ATT TTG SEQ ID NO: 140
AAA TC-3' GCT GC-3'
Results demonstrated that 11 of the 12 were increased in abundance by 1.5-fold to 8.5-fold (Figure 15) and 6 of the 6 were decreased in abundance by 2-fold to 10-fold (Figure 16) upon Staul depletion. Therefore, the microarray results can generally be viewed as a reliable assessment of changes in transcript abundance upon Staul depletion.
256. Transcripts that were upregulated upon Staul depletion and, thus, represent possible SMD targets encode proteins that are involved in signal transduction, cell proliferation or both (Table 9). Table 9 Selected examples of transcripts upregulated in human cells depleted of Staul in three independently performed microarray analyses
V. Cell motility, cell adhesion, extracellular matrix actin alpha 2 smooth muscle aorta chromosome 14 open reading frame 141 fϊbronectin 1 filamin-binding LIM protein- 1 insulin-like growth factor binding protein 5 integrin alpha 4 (antigen CD49D alpha 4 subunit of VLA-4 receptor) integrin beta 3 (platelet glycoprotein HIa antigen CD61) osteoblast specific factor 2 (fasciclin I-like) protein tyrosine phosphatase receptor type F tenascin C (hexabrachion) thrombospondin 1 transforming growth factor beta 1 induced transcript 1
VI. Structural molecule activity, cytoskeleton, cytoskeleton organization and biogenesis actin alpha 2 smooth muscle aorta actinin alpha 1 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha) filamin-binding LIM protein- 1
Rho GDP dissociation inhibitor (GDI) beta thymosin beta identified in neuroblastoma cells tissue factor pathway inhibitor 2
VII. Regulation of cell growth, cell cycle chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha) chromosome 14 open reading frame 141 cyclin-dependent kinase 5 regulatory subunit 1 (p35) cyclin-E binding protein 1 dual specificity phosphatase 6 ets variant gene 1 growth associated protein 43 histone deacetylase 8 signaling lymphocytic activation molecule family member 1 spinal cord-derived growth factor-B suppressor of cytokine signaling 2 rumor protein p53 (Li-Fraumeni syndrome) v-jun sarcoma virus 17 oncogene homolog (avian) VIII. Apoptosis catenin (cadherin-associated protein) alpha-like 1 TIAl cytotoxic granule-associated RNA binding protein tumor protein p53 (Li-Fraumeni syndrome)
IX. Immune response
2'-5 '-oligoadenylate synthetase-like chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha) fibronectin 1 guanylate binding protein 1 interferon-inducible 67kDa interferon alpha-inducible protein (clone IFI-15K) interferon-induced protein with tetratricopeptide repeats 1 interferon-induced protein with tetratricopeptide repeats 2 interferon-induced protein with tetratricopeptide repeats 4 interleukin 7 receptor prostaglandin E receptor 4 (subtype EP4) proteasome (prosome macropain) subunit beta type 9 (large multifunctional protease 2)
Rho GDP dissociation inhibitor (GDI) beta signaling lymphocytic activation molecule family member 1
X. Response to stress (extracelluar stimuli) chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha) fibronectin 1 growth associated protein 43 integrin beta 3 (platelet glycoprotein Ilia antigen CD61) interferon-induced protein 44 interleukin 7 receptor signaling lymphocytic activation molecule family member 1 tissue factor pathway inhibitor 2
XI. Regulation of DNA recombination, DNA repair interleukin 7 receptor tumor protein ρ53 (Li-Fraumeni syndrome) uracil-DNA glycosylase
XII. Regulation of transcription ets variant gene 1 hairy and enhancer of split 1 {Drosophila) high-mobility group box 3 leucine rich repeat (in FLII) interacting protein 1
PHD finger protein 11 transducin-like enhancer of split 4 (E(spl) homolog Drosophila) transforming growth factor beta 1 induced transcript 1 tumor protein p53 (Li-Fraumeni syndrome) v-jun sarcoma virus 17 oncogene homolog (avian) zinc finger protein 90 homolog (mouse)
XIII. Regulation of translation eukaryotic translation initiation factor 5A2
XIV. Protein secretion secretogranin II (chromogranin C) XV. Signal cascade
2'-5'-oligoadenylate synthetase-like chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha) chromosome 14 open reading frame 141 dihydropyrimidinase-like 3 dual specificity phosphatase 6 growth associated protein 43 guanine nucleotide binding protein (G protein) gamma 4 hypothetical protein FLJ33505 insulin-like growth factor binding protein 5 integrin alpha 4 (antigen CD49D alpha 4 subunit of VLA-4 receptor) integrin beta 3 (platelet glycoprotein Ilia antigen CD61) interleukin 7 receptor prostaglandin E receptor 4 (subtype EP4) protein tyrosine phosphatase receptor type F protein tyrosine phosphatase receptor type O
Rho GDP dissociation inhibitor (GDI) beta signaling lymphocytic activation molecule family member 1 spinal cord-derived growth factor-B stathmin-like 3 suppressor of cytokine signaling 2 tenascin C (hexabrachion) thrombospondin 1 transducin-like enhancer of split 4 (E(spl) homolog Drosophilά) transforming growth factor beta 1 induced transcript 1 type I transmembrane receptor (seizure-related protein)
XVI. Complement and coagulation cascades
I factor (complement) serine (or cysteine) proteinase inhibitor clade E thrombospondin 1 tissue factor pathway inhibitor 2
XVII. Cellular metabolism aldehyde dehydrogenase 1 family member A3
CGI-72 protein cyclin-E binding protein 1 dihydropyrimidinase-like 3 enoyl-Coenzyme A hydratase/3-hydroxyacyl Coenzyme A dehydrogenase hypothetical protein FLJ25348 protein tyrosine phosphatase receptor type O selenocysteine lyase uracil-DNA glycosylase
XVIII. Development, Morphogenesis, Organogenesis actin alpha 2 smooth muscle aorta chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha) cyclin-dependent kinase 5 regulatory subunit 1 (p35) dihydropyrimidinase-like 3 filamin-binding LIM protein- 1 growth associated protein 43 hairy and enhancer of split 1 (Drosophila) high-mobility group box 3 osteoblast specific factor 2 (fasciclin I-l _ik_e_) __ ii" i),,,,. Ii ■■' 'U' Ii Ii ,.ιi ιi ,/ . :"iι ::.:'iι Ii ..Ii ...ii.. .. a..
Rho GDP dissociation inhibitor (GDI) beta stathmin-like 3 suppressor of cytokine signaling 2 thrombospondin 1 transducin-like enhancer of split 4 (E(spl) homolog Drosophild) transgelin tumor protein p53 (Li-Fraumeni syndrome)
XIX. Organelle organization and biogenesis thymosin beta identified in neuroblastoma cells
XX. Oxidoreductase activity fibronectin 1
XXI. Proteasome, ubiquitin cycle cyclin-E binding protein 1 hypothetical protein FLJ20637 proteasome (prosome macropain) subunit beta type 9 (large multifunctional protease 2)
Other transcripts that were upregulated encode proteins that function in the immune response. Still others produce proteins that participate in cell adhesion, motility, the extracellular matrix, or other aspects of cell structure. A number encode factors that regulate transcription. Others encode proteins involved in RNA metabolism, including the TIAl cytotoxic granule- associated RNA binding protein, which regulates the alternative splicing of pre-mRNA that encodes the human apoptotic factor Fas(Forch et al., 2002) and translationally silences mRNAs that encode inhibitors of apotosis such as tumor necrosis factor a. (TNF-a)(Piecyk et al., 2000; Li et al., 2004). Another RNA metabolic protein that was upregulated upon Staul depletion is Dcp2, which mediates transcript decapping(Wang et al., 2002). It is worth noting, however, that the abundance of an mRNA could be upregulated upon Staul depletion via a mechanism that involves an alteration in its half-life, such as SMD, or via the product of another mRNA that itself is directly regulated by Staul . Example 17: Staul or Upfl depletion increases the abundance of c-JUN, SERPINE and IL7R 3' mRNAs
257. Four of the transcripts that were found to be upregulated when Staul is depleted were also found in microarray analyses to be upregulated when Upfl is depleted (Mendell et al., 2004; Table 10).
Table 10 Transcripts upregulated in human cells depleted of either Staul (three independently performed microarray analyses in this study) or Upfl (Mendell et al., 2004) H Ii Ii ,.•■ iι.,.ιι .::::iι iui :::::n .,• . :.!, !'::„ ii ii i "ii
Relative increase (microarray value)
Transcript Product function
Staul UpΩ depletion depletion
Serine (or cysteine) proteinase inhibitor clade E Bait for tissue plasminogen activator, 3.2 3.8 (nexin plasminogen activator inhibitor type 1) urokinase, and protein C member 1 (SERPINEl) Interleukin 7 receptor (IL7R) Receptor for interleukin 7 3.0 2.1 v-jun sarcoma virus 17 oncogene homolog (avian) Proto oncogene 2.6 5.3 (c-JUN)
Protein tyrosine phosphatase receptor type F Cell adhesion receptor 2.0 2.8 (PTPRF)
Interestingly, the upregulation of three of these transcripts could not be explained by the EJC- dependent rule that applies to NMD. The three transcripts encode serine (or cysteine) proteinase inhibitor clade E (nexin plasminogen activator inhibitor type 1) member 1 (Serpinel), interleukin 7 receptor (IL7R), and v-jun sarcoma virus 17 oncogene homolog (avian) (c-jun).
258. To assess the possibility that each transcript is an SMD target, HeLa cells were transiently transfected with one of six small interfering (si) RNAs (Kim et al., 2005): Staul or Staul (A) siRNA, which targeted a different Staul mRNA sequence; Upfl or Upfl(A) siRNA, which targeted a different UPFl mRNA sequence; Upf2 siRNA, which has no effect on SMD; or a nonspecific Control siRNA. Two days later, protein and RNA were isolated for analysis using Western blotting and RT-PCR, respectively.
259. Western blotting revealed that Staul or Staul (A) siRNA depleted the cellular level of Staul to 21% or 3% of normal, respectively, Upfl or Upfl (A) siRNA depleted the cellular the level of Upfl to 1% or 2% of normal, respectively, and Upf2 siRNA depleted the cellular level of Upf2 to 1% of normal (Figure 17 A, where normal in each case is defined as the level in the presence of Control siRNA after normalization to the level of Vimentin). It was found that c-JUN, SERPINE and IL7R transcripts were upregulated 2.1 -fold to 3.8-fold when Staul or Upfl was depleted, but unaffected when Upf2 was depleted (Figure 17B, where each transcript is normalized to the level of SMG7 mRNA). These results indicate that each transcript is targeted for SMD. Example 18: Staul binds the 3' UTR of c-JUN, SERPINE and IL7R 3' mRNAs
260. To further investigate whether each of the three transcripts is an SMD target, (i) nucleotides 481-671 of the c-JUN 3' UTR, which include the 151-nucleotide class IJJ (i.e., II-" Il Il ..' 'Ui :::::ii !!.J !:,;:iι ,,' ,,;:;|! !:,::n Uf ,1. ,1. non- AUUUA) AU-rich element (ARE)(Peng et al, 1996) plus 45 flanking nucleotides; (ii) nucleotides 1-1575 of the SERPINEl 3' UTR or (iii) nucleotides 1-339 of IL7R mRNA were inserted immediately downstream of the Firefly (F) Luciferase (Luc) translation termination codon within pcFLuc (Kim et al., 2005). For each 3' UTR, nucleotide 1 is defined as the nucleotide immediately 3' to the normal termination codon. The encoded hybrid transcripts were tested for Staul -HA3 binding.
261. Cos cells were transfected with four test plasmids : pcFLuc-c- JUN 3 'UTR, pcFLuc-SERPHNEl 3'UTR, pcFLuc-IL7R 3'UTR and pcFLuc-Arfl SBS (Figure 18A), the latter of which serves as a positive control for Staul-HA3 binding since it contains the minimized Staul binding site (SBS) from the Arfl 3'UTR (Kim et al., 2005). Cells were simultaneously transfected with two additional plasmids: phStaul-HA3, which produces Staul -HA3, and pmCMV-MUP, which serves as a negative control for Staul -HA3 binding. In cells producing Staul -HA3 (Figure 18B), anti-HA immunopurified FLuc-Arfl SBS mRNA as well as FLuc-c-JUN 3'UTR, FLuc-SERPINEl 3'UTR and FLuc-IL7R 3'UTR mRNAs, but not MUP mRNA (Figure 18C). hi contrast, rat (r) IgG, which controls for nonspecific immunopuriflcation, failed to immunopurify any of the transcripts (Figure 18C). Furthermore, anti-HA failed to immunopurify FLuc mRNA that harbors the FLuc 3'UTR. Therefore, the 3'UTRs of C-JUN, SERPINEl and IL7R mRNAs bind Staul-HA3, as do the two known physiologic targets of SMD (Kim et al., 2005). Notably, a larger fraction of FLuc-Arfl SBS mRNA was bound by Staul-HA3 relative FLuc-c-JUN 3'UTR, FLuc-SERPINEl 3'UTR or FLuc-IL7R 3'UTR mRNA (Figure 18C), which is consistent with detection of Arfl mRNA but not C-JUN, SERPINEl or JJL7R mRNA in the earlier microarray analyses of transcripts that bind Staul -HA3. Example 19: c-JUN, SERPINEl and IL7R 3' UTRs trigger SMD 262. To determine if each 3'UTR sequence is sufficient to elicit SMD, the effect of depleting Staul or Upfl on the half-life of FLuc-c-JUN 3'UTR, FLuc-SERPINEl 3'UTR, or FLuc-JJL7R 3'UTR mRNA or, as a positive control, FLuc-Arfl -SBS mRNA was tested. Production of each mRNA was driven by the fos promoter (Figure 19A). This promoter is transiently inducible upon the addition of serum to serum-deprived mouse L cells and therefore provides a way to analyze mRNA half-life (Kim et al., 2005; Lejeune et al., 2003). L cells were transfected with mouse (m)Staul siRNA, mUpfl siRNA or a nonspecific Control siRNA (Kim et al., 2005) and, two days later, with the four pfos-FLuc test plasmids and the phCMV-MUP reference plasmid. The reference plasmid controls for variations in transfection Il « Il ..-' O :::::n i|. J !!;;» ./' ,.;::!; !!» Ui .1, ,1. efficiencies and RNA recovery. One day later, serum was added, and protein and RNA were purified from, respectively, cytoplasmic and nuclear fractions after 0, 30, 45 and 60 minutes. Under conditions where either mStaul or mUpfl was depleted (Figure 19B), the half-life of each fos-FLuc mRNA was increased in each of two or three independently performed experiments (Figure 19C). Therefore, Staul and Upfl together with the 3'UTR of c- JUN, SERPINEl or IL7R mRNAs mediate mRNA decay, indicating that c-JUN, SERPINEl and IL7R mRNAs are bone fide SMD targets. Example 20: GAP43 mRNA is an SMD target
263. The finding that SMD is conferred by 191 nucleotides of the c-JUN 3 'UTR, 151 of which constitute the c-JUN class HI ARE, together with microarray data indicating the class UJ ARE-containing mRNA for GAP43 is also upregulated when Staul is depleted (Table 9; Figure 15), led to testing to determine if GAP43 mRNA is another SMD target.
264. Using RNA from samples analyzed in Figure 17, depleting Staul or Upfl was found to increase the cellular abundance of GAP43 mRNA 3.8-fold to 4.6-fold whereas depleting Upf2 was of no appreciable consequence to GAP43 mRNA abundance. (Figure 20A).
265. In cells producing Staul -HA3, anti-HA immunopurified FLuc-GAP43 3' UTR mRNA (Figure 2OB, right), in which the FLuc 3' UTR had been replaced with the nucleotides 1-423 of the 3' UTR of GAP43 mRNA and, as a positive control, FLuc-Arfl SBS mRNA (Figure 2OB, left). In contrast, rlgG immunopurified neither mRNA.
266. Finally, in experiments that utilized pfos-FLuc-GAP43 3' UTR (Figure 2OC, upper left), depleting L cells of mStaul or mUpfl (Figure 2OC, upper right) increased the half- life of fos-FLuc-GAP43 3' UTR mRNA (Figure 2OC, lower left and right). Therefore, GAP43 mRNA is another SMD target. Example 21: RNA motifs that bind Staul
267. The best characterized Staufen binding site exists within Drosophila bicoid mRNA (Ferrandon et al., 1994). Linker scanning mutations that disrupted the interaction of Staufen with this mRNA mapped to three noncontiguous regions: 148 nucleotides of stem IJJ, 89 nucleotides of the distal region of stem IV, and 88 nucleotides of the distal region of stem V (Ferrandon et al., 1994). Given the structural complexity of human Staufen binding site(s), it may be difficult to identify human Staul binding sites exclusively from our existing mRNA immunopurification and half-life data. Additionally, while the double-stranded RNA binding domain 3 of Drosophila Staufen has been proposed to mediate direct binding of the protein to Il H . H 'I I' I' 'I H Il |ι ' 1H l| |l (I Il bicoid and oskar mRNAs (Micklem et al., 2000; Ramos et al., 2000), it is uncertain whether or not binding specificity can be influenced by other proteins. To complicate matters further, sequence disparities between Drosophila Staufen and human Staul likely confer differences in RNA binding specificity so that data pertaining to Drosophila Staufen may not be applicable to human Staul . Therefore, we aimed to more thoroughly characterize each of the 3' UTR sequences that were shown to bind Staul (Figures 18 and 20) and target an mRNA for SMD (Figures 19 and 20) to better define RNA sequences that bind human Staul .
268. It is very likely that Arfl , c-JUN, SERPINEl , IL7R and GAP43 mRNAs will not be the only transcripts among those upregulated upon Staul depletion that are targeted for SMD. For example, CYR61 mRNA, which encodes the cysteine-rich angiogenic inducer 61, was upregulated upon Staul depletion in only two of our three microarray analyses and, thus, fell below the stringent criteria as a candidate target for SMD. However, this mRNA may very well be targeted for SMD since it was also among the transcripts upregulated upon Upfl depletion (Forch et al., 2002). Furthermore, 20 transcripts (Table 11) that were upregulated upon Staul depletion in all three microarray analyses were also present in either two (10 transcripts) or all three (10 transcripts) new microarray analyses that assayed for Staul -HA3 binding (see Kim et al., 2005 for methodology).
Table 11. Transcripts upregulated in human cells depleted of Staul in three independently performed microarray analyses and that bind Staul -HA3 in three (white) or two (gray) independently performed microarray analyses
Relative increase Transcript (microarray value) Accession
Staul depletion Anti-HA IP
Homo sapiens cDNA FLJ40697 fis clone THYMU2025406 2 5 1 166 66 AA398756
Homo sapiens transcribed sequence with moderate similarity to protein 2 3 9 9 22 AA824321 ref NP_071431 1 (H sapiens) cytokine receptor-like factor 2
Interferon-induced protein with tetratπcopeptide repeats 4 (IFIT4) 4 1 7 7 22 AI075407
Stathmin-like 3 (STMN3) 5 5 6 6 44 AL353715
Interferon alpha-inducible protein (clone IFI-15K) (G1P2) 3 2 4 4 11 NM_005101
Cychn-dependent kinase 5 regulatory subunit 1 (p35) (CDK5R1) 2 1 3 3 88 AL567411
Decapping enzyme hDcp2 (DCP2) 2 7 2 2 66 AV715578
KIAA0143 protein (KIAA0143) 2 0 2 2 44 AW470003
Cyclin-E binding protein 1 (CEBl) 3 6 2 2 33 NM_016323
Rho GTPase activating protein 19 (ARHGAP 19) 2 1 2 2 00 U79256
Figure imgf000096_0001
H-' ij Ii ,■' 'I...1' .:,::ι> o :::::n ..■• ,,:::h :::::n n, Ji ,,,ιι ii
[KIAA0143 protein (KIAA0143) *■ Λygi - - I1--. ~ - ■■ ' -72.3T*" ' 7 23? ^805651 >.- ^j
Nevertheless, until an mRNA is shown to (i) bind Staul, (ii) manifest a longer half-life upon depletion of Staul and (iii) manifest a longer half-life upon depletion of Upfl, it cannot be considered to be a bone fide SMD target.
Example 22: Plasmid constructions
269. To construct pcFLuc harboring different 3'UTRs, pcFLuc-8bs (Kim et al., 2005) was digested with Xbal and ligated to one of four PCR-amplified fragments that contained the (i) c-JUN ARE HI plus 45 nucleotides that had been digested with Xbal, (ii) SERPINEl 3'UTR without the normal termination codon that had been digested with Xbal, (iii) EL7R without the normal termination codon that had been digested with Nhel or (iv) GAP43 3'UTR without the normal termination codon that had been digested with Xbal . The c-JUN ARE fragment was amplified using the Human HeLa BD™ Marathon-Ready cDNA (BD Biosciences) and two primers: 5'- CGCTCTAGAGTGAGAACTCTTTCTGGCCTGCCTTCGTTAAC-S ' (SEQ ID NO: 63) (sense) and 5 ' -CGCTCT AGATTAC AAATGGTAAACTCAGAGTGCTCC-3 ' (SEQ ID NO: 64) (antisense), where underlined nucleotides specify the Xbal site. The SERPINEl 3'UTR fragment was amplified using pCMV6-XL5-SERPINEl (Origene Technologies) and two primers: 5 '-CGCTCTAGAGTGACCCTGGGGAAAGACGCCTTC ATCTG-3 ' (SEQ ID NO: 65) (sense) and 5'-CGCTCTAGAGCTTCTATTAGATTACATTCATTTCAC-S ' (SEQ ID NO: 66) (antisense), where underlined nucleotides specify the Xbal site. The IL7R 3'UTR fragment was amplified using Human HeLa BD™ Marathon-Ready cDNA and two primers: 5'-CGCGCTAGCGTGAAGTGTAAGAAACCCAGACTGAAC-S' (SEQ ID NO: 67) (sense) and 5'-CGCGCTAGCTTTTTTTCCTCTCATGCTCTCTTCCTGC-S' (SEQ ID NO: 68) (antisense), where underlined nucleotides specify the Nhel site. The GAP43 fragment was amplified using HeLa-cell total cDNA prepared from Staul siRNA-treated cells and two primers: 5'-CGCTCTAGAGTGAACTCTAAGAAATGGCTTTCCACATC- 3' (sense) (SEQ ID NO: 141) and 5'- CGCTCTAGAGTGAGAATTCACTCGATATTTTGGACTCCTCAG-S' (antisense) (SEQ ID NO: 142), where underlined nucleotides specify the Xbal site.
270. To construct pfos-FLuc harboring different 3 'UTRs, pfos-Gl (Kim et al., 2005) was digested with EcoRI and Ncol and ligated to one of three PCR-amplified H I! H ..■■ i|.,,|i :::::iι 11...11 :::::n „■■ ,,:::iι ::;::n iui j L fragments that had been digested with EcoRI and Ncol. Each PCR fragment was amplified using the pcFLuc-c-JUN 3'UTR, pcFLuc-SERPINEl 3'UTR, or pcFLuc-IL7R 3'UTR and two primers: 5'-CATGCCATGGAAGACGCCAAAAACATAAAGAAAGGC-S' (SEQ ID NO: 69) (sense) and 5 ' -CGGAATTC AGGCTGATC AGCGAGCTCTAGC ATTT AGG-3 ' (SEQ E) NO: 70) (antisense), where underlined nucleotides specify the Ncol and EcoRI site, respectively.
271. To construct pSport-Arfl-SBS derivatives harboring Δ(250-300), Δ(200- 300), Δ(l 50-300), Δ(100-300) or Δ(50-300), pSport was digested with Xbal and Hpal and ligated to one of five PCR-amplified fragments that had been digested with Xbal. Each PCR fragment was amplified using pSport-Arfl-SBS, the common sense primer 5'- GCTATTT AGGTGACACTATAGAAGGTAC-S' (SEQ ID NO: 143) and the specific antisense primer: 5'-CTTTTTACAATAAAAAAAGCTGAGTAATAT-S' (SEQ ID NO: 144), 5'-TGCCTCATTGGAAACAAAAACTATTTACAT-S' (SEQ DD NO: 145), 5'- AGGCTGCGTCTGCC ACATTTAC-3' (SEQ ID NO: 146), 5'- ACCACGGAGGCAGCTTCTGG-3' (SEQ ID NO: 147), or 5'- ATGAGAGTAAAGC AGAGGGC AAG-3' (SEQ ID NO: 148).
272. pSport-Arfl-SBS derivatives harboring Δ(3-300), Δ(30-79), and Δ(30-179), were generated with the following primer pairs, respectively: 5'- CATTTCGACAAACAAGCACTGTAATTATAGCTATTAG-S1 (sense) (SEQ ID NO: 149) and 5I-GTTCACTTCTGGTTCCGGAGCTG-3I (antisense) (SEQ ID NO: 150), 5!- CCAGAAGCTGCCTCCGTGG-S' (sense) (SEQ ID NO: 151) and 5!- AAGAGGAGTGAGAGGGAGGG-S1 (antisense) (SEQ ID NO: 152), 51- TTTTTGTTTCC AATGAGGCAGTTTCTGGTA-S' (sense) (SEQ ID NO: 153) and 5'- AAGAGGAGTGAGAGGGAGGG-3' (antisense) (SEQ ID NO: 154). PCR amplifications were carried out using Pfu Ultra (Stratagene). PCR products were incubated with Dpnl to digest the methylated template DNA, phosphorylated at the 5' ends using T4 polynucleotide kinase (Fermentas), and circularized by ligation.
273. To construct Single and Double, overlap-extension PCR was used. A 5' fragment was amplified using the common sense primer 5'- GCT ATTTAGGTGACACT AT AGAAGGTAC-31 (SEQ ID NO: 155) and 5'-
CATAGGAGTACCACTTCCTGCCTCATTGG-3' (antisense, Single and Double, where underlined nucleotides specify mutated nucleotides) (SEQ ID NO: 156) or 5'- CCACGGAGGCAGAAAGTGGCACTCACACC-3' (antisense, Double) (SEQ ID NO: H-" ii Ii .• iι,.,i' .;::.! iι,,,ιι :,:::U ..■■ ,,;::ι. :::::n iι,,,ιι ,,,ιι Ii,.
157), and a 3' fragment was amplified using 5'-
CCAATGAGGCAGGAAGTGGTACTCCTATG-3' (sense, Single and Double, where underlined nucleotides specify mutated nucleotides) (SEQ ID NO: 158) or 5'- GGTGTGAGTGCCACTTTCTGCCTCCGTGG-3' (sense, Double) (SEQ ID NO: 159) and the common antisense primer 5'-GTGCCC ATGGGCCTAC ATCC-31 (SEQ ID NO: 160). The resulting fragments were mixed with the same sense and antisense primers that amplified, respectively, the 5' and 3' fragments to generate a joined product. PCR products were digested with Xbal, and inserted into the Xbal and Hpal sites of pSport. To construct Δ(Loop), a 5'fragment was amplified using the primer pair 5'- GCTATTTAGGTGACACTATAGAAGGTAC-3' (sense) (SEQ ID NO: 161) and 5'-
AATTCTCGAGAGGCAGCTTCTGGCACTC-3' (antisense, where underlined nucleotides specify a Xhol site) (SEQ ID NO: 162) and inserted into the Xbal and Xhol sites of pSport. The 3 'fragment was amplified using the primer pair 5'- AATTCTCGAGAGGCAGTTTCTGGTACTCCTATG-3' (sense, where underlined nucleotides specify a Xhol site) (SEQ BD NO: 163) and 5'-
GTGCCCATGGGCCTAC ATCC-3' (antisense) (SEQ ID NO: 164), and inserted into the Xhol and Hpal sites of the 5 'fragment-containing construct.
274. To construct deletions derivatives of pcFLuc-c-JUN 3' UTR, pcFLuc-8bs was digested with Xbal and ligated to one of three Xbal-digested PCR-amplified fragments that had been generated using pcFLuc-c-JUN 3 'UTR and two primers: 5 '-
CGCTCTAGAGTGATTCGTTAACTGTGTATGTAC-S' (SEQ ID NO: 71) (sense) and 5'- CGCTCTAGAAAATTAAAAAATATATATATG-S ' (SEQ ID NO: 72) (antisense) for pcFLuc-c-JUN 3'UTR (500-539), 5'- CGCTCTAGAGTGAGATGAAAGCTGATTACTGTC-3' (SEQ ID NO: 73) (sense) and 5'- CGCTCTAGAAACTTACAAAGGCATGAAGC-3 ' (SEQ ID NO: 74) (antisense) for pcFLuc-c-JUN 3'UTR (540-587), or 5'-
CGCTCTAGAGTGAATTTCTTGTTTGTTTGTTTGGG-S' (SEQ ID NO: 75) (sense) and 5'-CGCTCTAGATGCTCCAAATCTCTTATTTAC-S' (SEQ ID NO: 76) (antisense) for pcFLuc-c-JUN 3'UTR (588-650), where underlined nucleotides specify the Xbal site. 275. To construct deletions derivatives of pcFLuc-c-JUN 3 ' UTR, pcFLuc-8bs was digested with Xbal and ligated to one of three Xbal-digested PCR-amplified fragments that had been generated using pcFLuc-c-JUN 3'UTR and two primers: 5'- CGCTCTAGAGTGATTCGTTAACTGTGTATGTAC-3' (sense) (SEQ ID NO: 165) and ii «,..,. Ii ..' 1I.,,!' .,,;:iι n..,n :;;;;n ,.• „;;:!> ::;::n i|,,jι ,j \\,
5 '-CGCTCTAGAAAATTAAAAAAT AT ATAT ATG-3 ' (antisense) (SEQ ED NO: 166) for pcFLuc-c-JUN 3'UTR (500-539), 5'-
CGCTCTAGAGTGAGATGAAAGCTGATT ACTGTC-3' (sense) (SEQ ID NO: 167) and 5 '-CGCTCTAGAAACTTACAAAGGCATGAAGC-S ' (antisense) (SEQ ID NO: 168) for pcFLuc-c-JUN 3'UTR (540-587), or 5'-
CGCTCTAGAGTGAATTTCTTGTTTGTTTGTTTGGG-S' (sense) (SEQ ID NO: 169) and 5 '-CGCTCTAGATGCTCCAAATCTCTTATTTAC-S ' (antisense) (SEQ ID NO: 170) for pcFLuc-c-JUN 3'UTR (588-650), where underlined nucleotides specify the Xbal site.
276. To construct deletion derivatives of pcFLuc-SERPINE 1 3 ' UTR, pcFLuc-8bs was digested with Xbal and ligated to one of four Xbal-digested PCR-amplified fragments that had been generated using pcFLuc-SERPINEl 3'UTR and two primers: 5'-
CGCTCTAGAGTGACCCTGGGGAAAGACGCCTTCATCTG-3' (sense) (SEQ ID NO:
171) and 5'-CGCTCTAGATGTCTCTCTCACCCACCCCCCCCTCAC-S' (antisense)
(SEQ ID NO: 172) for pcFLuc-SERPINEl 3' UTR (1-1298), 5'- GCTCTAGAGTGATGACCCTGGGGAAAGACGCC-3 ' (sense) (SEQ ID NO: 173) and
5'-CGCTCTAGAGTTGGGCCACATGATGGGGG-S' (antisense) (SEQ ID NO: 174) for pcFLuc-SERPINEl 3'UTR (1-596), 5'-
CGCTCTAGAGTGATCTCCTGGCCTGGCCATCTC-3' (sense) (SEQ ID NO: 175) and
5 '-CGCTCTAGAGGTCAATTTCCATC AAGGGG-3 ' (antisense) (SEQ ID NO: 176) for pcFLuc- SERPINEl 3'UTR (597-1043), 5'-
CGCTCTAGAGTGAATACAATTTCATCCTCCTTC-3' (sense) (SEQ ID NO: 177) and
5'-CGCTCTAGATGTCTCTCTCACCCACCCCC-S' (antisense) (SEQ ID NO: 178) for pcFLuc-SERPINEl 3'UTR (1044-1298), or 5'-
CGCTCTAGAGCTTCTATTAGATT ACATTCATTTC AC-3' (sense) (SEQ ID NO: 179) and 5'-CGCTCTAGAGTGAGGCAGCTCGGATTCAACTACCTTAG-S ' (antisense) (SEQ
DD NO: 180) for pcFLuc- SERPINEl 3'UTR (1299-1575), where underlined nucleotides specify the Xbal site.
277. Alternatively, to construct deletion derivatives of pcFLuc-SERPINEl 3 ' UTR, pcFLuc-8bs was digested with Xbal and ligated to one of four Xbal-digested PCR-amplified fragments that had been generated using pcFLuc-SERPESfEl 3'UTR and two primers: 5'-
CGCTCTAGAGTGATGACCCTGGGGAAAGACGCC-3' (SEQ ID NO: 77) (sense) and 5'- CGCTCTAGAGTTGGGCCACATGATGGGGG-3' (SEQ ID NO: 78) (antisense) for pcFLuc-SERPINEl 3'UTR (1-596), 5'- CGCTCTAGAGTGATCTCCTGGCCTGGCCATCTC-S' (SEQ ID NO: 79) (sense) and 5'- CGCTCTAGAGGTC AATTTCC ATCAAGGGG-3 ' (SEQ ID NO: 80) (antisense) for pcFLuc- SERPINEl 3'UTR (597-1043), 5'-
CGCTCTAGAGTGAATACAATTTCATCCTCCTTC-3' (SEQ ED NO: 81) (sense) and 5'- CGCTCTAGATGTCTCTCTC ACCCACCCCC-3 ' (SEQ ID NO: 82) (antisense) for pcFLuc- SERPINEl 3'UTR (1044-1298), or 5'-CGCTCTAGAGTGA GGCAGCTCGGATTCAACTAC-3' (SEQ ID NO: 83) (sense) and 5'- CGCTCTAGAC ATTTC ACATCTGTGTGCAA-3 ' (SEQ ID NO: 84) (antisense) for pcFLuc- SERPINEl 3'UTR (1299-1575), where underlined nucleotides specify the Xbal site. 278. To construct pcFLuc harboring different regions of the GAP43 3 ' UTR, pcFLuc-8bs was digested with Xbal and ligated to one of three Xbal-digested PCR-amplifled fragments that had been generated using pcFLuc-GAP43 3'UTR and two primers: 5'- CGCTCTAGAGTGAACTCTAAGAAATGGCTTTCCA-3' (SEQ ID NO: 85) (sense) and 5'-CGCTCTAGATGTTTGACTTGGGATCTTTCCTGC-S' (SEQ ID NO: 86) (antisense) for pcFLuc-GAP43 3'UTR (1-206), or 5'-
CGCTCTAGAGTGAAAGTCAAACAGTGTGGCTTAAACA-3' (SEQ ID NO: 87) (sense) and 5'-CGCTCTAGAGAATTCACTCGATATTTTGGACTCCTC-S' (SEQ ID NO: 88) (antisense) for pcFLuc-GAP43 3'UTR (197-423), where underlined nucleotides specify the Xbal site. 279. To construct deletion derivatives of pcFLuc-IL7R 3 ' UTR, pcFLuc-8bs was digested with Xbal and ligated to one of two Nhel-digested PCR-amplified fragments that had been generated using pcFLuc-IL7R 3'UTR and two primers: 5'-
CGCGCTAGCGTGAAGTGTAAGAAACCC AGACTGAAC-3' (SEQ ID NO: 89) (sense) and 5'-CGCGCTAGCAACTCAGGAAGAGTGGTCAAAG-S' (SEQ ID NO: 90) (antisense) for pcFLuc-IL7R 3'UTR (1-165), or 5'-
CGCGCTAGCGTGACAGTGGCACTCAACATGAGTC-3' (SEQ ID NO: 91) (sense) and 5'-CGCGCTAGCTTTTTTTCCTCTCATGCTCTCTTCCTGC-S' (SEQ ID NO: 92) (antisense) for pcFLuc-IL7R 3'UTR (166-339), where underlined nucleotides specify the Nhel site. Example 23: Cell culture and transfections, and protein and RNA purification
280. Human HeLa cells (2 x 106) were propagated in DMEM medium (GIBCO- BRL) containing 10% fetal bovine serum (GIBCO-BRL) in 60-mm dishes and, where specified, transiently transfected with plasmid DNA, in vitro-synthesized siRNA, or both as described (Kim et al., 2005). Monkey Cos cells, which were used in experiment involving immunopurification, were similarly treated as were mouse L cells, which effectively support fos promoter induction upon the addition of serum after serum deprivation. All human and mouse siRNAs have been previously reported as has been the serum-induced transcription of fos-FLuc and the isolation of total-cell or nuclear protein and RNA (Kim et al., 2005). Example 24: Western blotting and RT-PCR
281. Blotting (Kim et al., 2005) and the RT-PCR of SMG7 and MUP mRNAs were as described previously (Lejeune et al., 2003; Chiu et al., 2004). FLuc-c-JUN 3'UTR, FLuc- SERPINEl, FLuc-EL7R or FLuc-SBS mRNA was amplified using 5'- AATACGACTCACTATAGGGA-S' (SEQ ID NO: 93) (sense, which annealed to the T7 promoter that resided downstream of the CMV promoter) and, respectively, 5'- AGGCAGGCCAGAAAGAGTTC-3'(SEQ ID NO: 94), 5'-
TGAAGGCGTCTTTCCCCAGG-3'(SEQ ID NO: 95), 5'-TCAGTCTGGGTTTCTTACAC- 3'(SEQ ID NO: 96), or 5'-GCCTGGCCGCAGGCTGCGTC-S' (SEQ ID NO: 97) (antisense). 282. FLuc-c-JUN 3'UTR, FLuc-SERPHNEl, FLuc-IL7R or FLuc-SBS mRNA that derived from pfos-FLuc constructs was amplified using the common sense primer 5'- AGACTGAGCCGATCCCGCGC-3' (SEQ ID NO: 98) and the corresponding antisense primer described above.
283. Primer pairs for the 21 transcripts in addition to c-JUN, SERPINEl and IL7R mRNAs that were amplified to test the validity of microarray results are provided (Table 11).
Example 25: Microarray analyses
284. HeLa-cell RNA was purified using TriZol reagent (Invitrogen) and deemed to be intact using an RNA 6000 Nano LabChip® (Agilent) together with a Bioanalyser 2100 and Biosizing software (Agilent). Biotin-labeled cRNAs were generated and hybridized to Ul 33 Plus 2.0 Array human gene chips (comprising more than 47,000 transcripts and variants).
Hybridized chips were scanned using an Affymetrix GeneChip® 3000 Scanner. Results were recorded using the GeneChip® Operating Software (GCOS) platform, which included the GeneChip® Scanner 3000 high-resolution scanning patch that enables feature extraction (Affymetrix). Notably, the Affymetrix Gene Expression Assay identifies changes that are greater than 2-fold with 98% accuracy (Wodicka et al., 1997). Arrays were undertaken using three independently generated RNA samples. Transcripts that showed at least a 2-fold increase in abundance with a p value of less than 0.05 in each of the three analyses were scored as potential SMD targets. 285. Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.
286. It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.
References Bachand, F., Triki, L, and Autexier, C. (2001). Human telomerase RNA-protein interactions. Nucleic Acids Res. 29, 3385-3393.
Belgrader, P., and Maquat, L. E. (1994). Nonsense but not missense mutations can decrease the abundance of nuclear mRNA for the mouse major urinary protein, while both types of mutations can facilitate exon skipping. MoI. Cell. Biol. 14, 6326-6336. Bono, F., Ebert, J., Unterholzner, L., Guttler, T., Izaurralde, E., and Conti, E. (2004). Molecular insights into the interaction of PYM with the Mago-Y14 core of the exon junction complex. EMBO Rep. 5, 304-310.
Broadus, J., Fuerstenberg, S., and Doe, C. Q. (1998). Staufen-dependent localization of prospero mRNA contributes to neuroblast daughter-cell fate. Nature 391, 792-795. Chan, C. C, Dostie, J., Diem, M. D., Feng, W., Mann, M., Rappsilber, J., and Dreyfuss, G. (2004). eIF4A3 is a novel component of the exon junction complex. RNA 10, 200-209.
Chen, CY. & Shyu, A.B. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. ScL 20, 465-470 (1995).
Chiu, S. Y., Lejeune, F., Ranganathan, A. C, and Maquat, L. E. (2004). The pioneer translation initiation complex is functionally distinct from but structurally overlaps with the steady-state translation initiation complex. Genes Dev. 18, 745-754.
Coller, J. M., Gray, N. K., and Wickens, M. P. (1998). mRNA stabilization by poly(A) binding protein is independent of poly(A) and requires translation. Genes Dev. 12, 3226- 3235. Curatola, A.M., Nadal, M.S. & Schneider, RJ. Rapid degradation of AU-rich element (ARE) mRNAs is activated by ribosome transit and blocked by secondary structure at any position 51 to the ARE. MoI. Cell. Biol. 15, 6331-6340 (1995).
Donaldson, J. G., and Jackson, C. L. (2000). Regulators and effectors of the ARF GTPases. Curr. Opin. Cell Biol. 12, 475-482. Duchaine, T., Wang, H. J., Luo, M., Steinberg, S. V., Nabi, I. R., and DesGroseillers, L. (2000). A novel murine Staufen isoform modulates the RNA content of Staufen complexes. MoI. Cell. Biol. 20, 5592-5601.
Ephrussi, A., Dickinson, L. K., and Lehmann, R. (1991). Oskar organizes the germ plasm and directs localization of the posterior determinant nanos. Cell 66, 37-50. Ferraiuolo, M. A., Lee, C. S., Ler, L. W., Hsu, J. L., Costa-Mattioli, M., Luo, M. J., Reed, R., and Sonenberg, N. (2004). A nuclear translation-like factor eIF4Aiπ is recruited to the mRNA during splicing and functions in nonsense-mediated decay. Proc. Natl. Acad. Sci. USA 707, 4118-4123.
Ferrandon, D., Elphick, L., Nusslein-Volhard, C. & St Johnston, D. Staufen protein associates with the 3'UTR of bicoid mRNA to form particles that move in a microtubule- dependent manner. Cell 79, 1221-1232 (1994).
Forch, P., Puig, O., Martinez, C, Seraphin, B. & Valcarcel, J. The splicing regulator TIA-I interacts with Ul-C to promote Ul snRNP recruitment to 5' splice sites. EMBOJ. 21, 6882- 6892 (2002). Frischmeyer, P. A., and Dietz, H. C. (1999). Nonsense-mediated mRNA decay in health and disease. Hum. MoI. Genet. 8, 1893-1900.
Gatfield, D., Unterholzner, L., Ciccarelli, F. D., Bork, P., and Izaurralde, E. (2003). Nonsense-mediated mRNA decay in Drosophila: at the intersection of the yeast and mammalian pathways. EMBO J. 22, 3960-3970. Gehring, N. H., Neu-Yilik, G., Schell, T., Hentze, M. W., and Kulozik, A. E. (2003). Y14 and hUpβb form an NMD-activating complex. MoI. Cell 11, 939-949.
Goodrich, J. S., Clouse, K. N., and Schupbach, T. (2004). Hrb27C, Sqd and Otu cooperatively regulate gurken RNA localization and mediate nurse cell chromosome dispersion in Drosophila oogenesis. Development 131, 1949-1958. Gorlach, M., Burd, C. G., and Dreyfuss, G. (1994). The mRNA poly(A)-binding protein: localization, abundance, and RNA-binding specificity. Exp. Cell Res. 277, 400-407.
Grentzmann, G., Ingram, J. A., Kelly, P. J., Gesteland, R. F., and Atkins, J. F. (1998). A dual-luciferase reporter system for studying recoding signals. RNA 4, 479-486.
Hachet, O., and Ephrussi, A. (2001). Drosophila Y14 shuttles to the posterior of the oocyte and is required for oskar mRNA transport. Curr. Biol. 77, 1666-1674.
Hachet, O., and Ephrussi, A. (2004). Splicing of oskar RNA in the nucleus is coupled to its cytoplasmic localization. Nature 428, 959-963. ir1 'i » •■■ '1...I* I' 'I..* .,..Ji ,.' ,,;;:ii :;μ i|,,,ii ,,,ιι ||,,
Hammond, L. E., Rudner, D. Z., Kanaar, R., and Rio, D. C. (1997). Mutations in the hip48 gene, which encodes a Drosophila heterogeneous nuclear ribonucleoprotein particle protein, cause lethality and developmental defects and affect P-element third-intron splicing in vivo. MoI. Cell. Biol. 17, 7260-7267. Hentze, M. W., and Kulozik, A. E. (1999). A perfect message: RNA surveillance and nonsense-mediated decay. Cell 96, 307-310.
Hillman RT et al., 2004 An unappreciated role for RNA surveillance. Genome Biol. 5:R8.
Inoue, K., Khajavi, M., Ohyama, T., Hirabayashi, S., Wilson, J., Reggin, J. D., Mancias, P., Butler, I. J., Wilkinson, M. F., Wegner, M., and Lupski, J. R. (2004). Molecular mechanism for distinct neurological phenotypes conveyed by allelic truncating mutations. Nat. Genet. 36, 361-369.
Ishigaki, Y., Li, X., Serin, G., and Maquat, L. E. (2001). Evidence for a pioneer round of mRNA translation: mRNAs subject to nonsense-mediated decay in mammalian cells are bound by CBP80 and CBP20. Cell 106, 607-617. Izaurralde, E., Lewis, J., McGuigan, C, Jankowska, M., Darzynkiewicz, E., and Mattaj, I. W. (1994). A nuclear cap binding protein complex involved in pre-mRNA splicing. Cell 78, 657-668.
Kataoka, N., Yong, J., Kim, V. N., Velazquez, F., Perkinson, R. A., Wang, F., and Dreyfuss, G. (2000). Pre-mRNA splicing imprints mRNA in the nucleus with a novel RNA-binding protein that persists in the cytoplasm. MoI. Cell 6, 673-682.
Kiebler, M. A., Hemraj, I., Verkade, P., Kohrmann, M., Fortes, P., Marion, R. M., Ortin, J., and Dotti, C. G. (1999). The mammalian staufen protein localizes to the somatodendritic domain of cultured hippocampal neurons: implications for its involvement in mRNA transport. J. Neurosci. 19, 288-297. Kim, V. N., Kataoka, N., and Dreyfuss, G. (2001). Role of the nonsense-mediated decay factor hUpf3 in the splicing-dependent exon-exon junction complex. Science 293, 1832- 1836.
Kim, Y. K., Lee, S. H., Kim, C. S., Seol, S. K., and Jang, S. K. RNA. (2003). Long-range RNA-RNA interaction between the 5' nontranslated region and the core-coding sequences of hepatitis C virus modulates the IRES-dependent translation. RNA 9, 599-606.
Kim, Y.K., Furic, L., DesGroseillers, L. & Maquat, L.E. Mammalian Staufen 1 recruits Upfl to specific mRNA 3'UTRs so as to elicit mRNA decay. Cell 120, 195-208 (2005).
Kim-Ha, J., Kerr, K., and Macdonald, P. M. (1995). Translational regulation of oskar mRNA by bruno, an ovarian RNA-binding protein, is essential. Cell 81, 403-412. Kim-Ha, J., Smith, J. L., and Macdonald, P. M. (1991). oskar mRNA is localized to the posterior pole of the Drosophila oocyte. Cell 66, 23-35.
Kohrmann, M., Luo, M., Kaether, C, DesGroseillers, L., Dotti, C. G., and Kiebler, M. A. (1999). Microtubule-dependent recruitment of Staufen-green fluorescent protein into large RNA-containing granules and subsequent dendritic transport in living hippocampal neurons. MoI. Biol. Cell 10, 2945-2953.
Krause, S., Fakan, S., Weis, K., and Wahle, E. (1994). Immunodetection of poly(A) binding protein II in the cell nucleus. Exp. Cell Res. 214, 75-82. Krichevsky, A. M., and Kosik, K. S. (2001). Neuronal RNA granules: a link between RNA localization and stimulation-dependent translation. Neuron 32, 683-696.
Lau, C. K., Diem, M. D., Dreyfuss, G., and Van Duyne, G. D. (2003). Structure of the Y14- Magoh core of the exon junction complex. Curr. Biol. 13, 933-941.
Le Hir, H., Gatfield, D., Izaurralde, E., and Moore, M. J. (2001). The exon-exon junction complex provides a binding platform for factors involved in mRNA export and nonsense- mediated mRNA decay. EMBO J. 20, 4987-4997.
Le Hir, H., Izaurralde, E., Maquat, L. E., and Moore, M. J. (2000a). The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. EMBO J. 19, 6860-6869. Le Hir, H., Moore, M. J., and Maquat, L. E. (2000b). Pre-mRNA splicing alters mRNP composition: evidence for stable association of proteins at exon-exon junctions. Genes Dev. 74, 1098-1108.
Le, S., Sternglanz, R., and Greider, C. W. (2000). Identification of two RNA-binding proteins associated with human telomerase RNA. MoI. Biol. Cell 11, 999-1010. Lee, C. M., Haun, R. S., Tsai, S. C, Moss, J., and Vaughan, M. (1992). Characterization of the human gene encoding ADP-ribosylation factor 1, a guanine nucleotide-binding activator of cholera toxin. J. Biol. Chem. 267, 9028-9034.
Lejeune, F., Ishigaki, Y., Li, X., and Maquat, L. E. (2002). The exon junction complex is detected on CBP80-bound but not eIF4E-bound mRNA in mammalian cells: dynamics of mRNP remodeling. EMBO J. 21, 3536-3545.
Lejeune, F., Li, X., and Maquat, L. E. (2003). Nonsense-mediated mRNA decay in mammalian cells involves decapping, deadenylating, and exonucleolytic activities. MoI. Cell 12, 675-687.
Li, P., Yang, X., Wasser, M., Cai, Y., and Chia, W. (1997). Inscuteable and Staufen mediate asymmetric localization and segregation of prospero RNA during Drosophila neuroblast cell divisions. Cell 90, 431-441.
Li, S., and Wilkinson, M. F. (1998). Nonsense surveillance in lymphocytes? Immunity 8, 135-141.
Li, W., Simarro, M., Kedersha, N. & Anderson, P. FAST is a survival protein that senses mitochondrial stress and modulates TIA-I -regulated changes in protein expression. MoI. Cell. Biol. 24, 10718-10732 (2004).
Luo, M. L., Zhou, Z., Magni, K., Christoforides, C, Rappsilber, J., Mann, M., and Reed, R. (2001). Pre-mRNA splicing and mRNA export linked by direct interactions between UAP 56 and AIy. Nature. 413, 644-647.
Luo, M., Duchaine, T. F., and DesGroseillers, L. (2002). Molecular mapping of the determinants involved in human Staufen-ribosome association. Biochem. J. 365, 817-824. Lykke-Andersen, J., Shu, M. D., and Steitz, J. A. (2000). Human Upf proteins target an mRNA for nonsense-mediated decay when bound downstream of a termination codon. Cell 703, 1121-1131.
Lykke-Andersen, J., Shu, M. D., and Steitz, J. A. (2001). Communication of the position of exon-exon junctions to the mRNA surveillance machinery by the protein RNPSl. Science 293, 1836-1839.
Macchi, P., Kroening, S., Palacios, I. M., Baldassa, S., Grunewald, B., Ambrosino, C, Goetze, B., Lupas, A., St Johnston, D., and Kiebler, M. (2003). Barentsz, a new component of the Staufen-containing ribonucleoprotein particles in mammalian cells, interacts with Staufen in an RNA-dependent manner. J. Neurosci. 23, 5778-5788. Mallardo, M., Deitinghoff, A., Muller, J., Goetze, B., Macchi, P., Peters, C, and Kiebler, M. A. (2003). Isolation and characterization of Staufen-containing ribonucleoprotein particles from rat brain. Proc. Natl. Acad. Sci. USA 100, 2100-2105.
Maquat, L. E. (2004a). Nonsense-mediated mRNA decay : A comparative analysis of different species. Curr. Genomics 5, 175-190. Maquat, L. E. (2004b). Nonsense-mediated mRNA decay: splicing, translation and mRNP dynamics. Nat. Rev. MoI. Cell. Biol. 5, 89-99.
Marion, R. M., Fortes, P., Beloso, A., Dotti, C, and Ortin, J. (1999). A human sequence homologue of Staufen is an RNA-binding protein that is associated with polysomes and localizes to the rough endoplasmic reticulum. MoI. Cell. Biol. 19, 2212-2219. Matsuzaki, F., Ohshiro, T., JJceshima-Kataoka, H., and Izumi, H. (1998). miranda localizes staufen and prospero asymmetrically in mitotic neuroblasts and epithelial cells in early Drosophila embryogenesis. Development 125, 4089-4098.
Mendell, J.T., Sharifi, N.A., Meyers, J.L., Martinez-Murillo, F. & Dietz, H.C. Nonsense surveillance regulates expression of diverse classes of mammalian transcripts and mutes genomic noise. Nat. Genet 36, 1073-1078 (2004).
Micklem, D. R., Adams, J., Grunert, S., and St Johnston, D. (2000). Distinct roles of two conserved Staufen domains in oskar mRNA localization and translation. EMBO J. 19, 1366-
1377.
Mohr, S. E., Dillon, S. T., and Boswell, R. E. (2001). The RNA-binding protein Tsunagi interacts with Mago Nashi to establish polarity and localize oskar mRNA during Drosophila oogenesis. Genes Dev. 15, 2886-2899.
Monshausen, M., Putz, U., Rehbein, M., Schweizer, M., DesGroseillers, L., Kuhl, D., Richter, D., and Kindler, S. (2001). Two rat brain staufen isoforms differentially bind RNA. J. Neurochem. 76, 155-165.
Moriarty, P. M., Reddy, C. C, and Maquat, L. E. (1998). Selenium deficiency reduces the abundance of mRNA for Se-dependent glutathione peroxidase 1 by a UGA-dependent mechanism likely to be nonsense codon-mediated decay of cytoplasmic mRNA. MoI. Cell. Biol. 18, 2932-2939.
Mouland, A. J., Mercier, J., Luo, M., Bernier, L., DesGroseillers, L., and Cohen, E. A. (2000). The double-stranded RNA-binding protein Staufen is incorporated in human immunodeficiency virus type 1 : evidence for a role in genomic RNA encapsidation. J. Virol. 74, 5441-5451. Nagy, E., and Maquat, L. E. (1998). A rule for termination-codon position within intron- containing genes: when nonsense affects RNA abundance. Trends Biochem. Sci. 23, 198- 199.
Ohashi, S., Koike, K., Omori, A., Ichinose, S., Ohara, S., Kobayashi, S., Sato, T. A., and Anzai, K. (2002). Identification of mRNA/protein (mRNP) complexes containing Puralpha, mStaufen, fragile X protein, and myosin Va and their association with rough endoplasmic reticulum equipped with a kinesin motor. J. Biol. Chem. 277, 37804-37810.
Pal, M., Ishigaki, Y., Nagy, E., and Maquat, L. E. (2001). Evidence that phosphorylation of human Upfl protein varies with intracellular location and is mediated by a wortmannin- sensitive and rapamycin-sensitive PI 3-kinase-related kinase signaling pathway. RNA 7, 5- 15.
Palacios, I. M., Gatfield, D., St Johnston, D., and Izaurralde, E. (2004). An eIF4AIII- containing complex required for mRNA localization and nonsense-mediated mRNA decay. Nature 427, 753-757.
Peng, S. S., Chen, CY. & Shyu, A.B. Functional characterization of a non-AUUUA AU-rich element from the c-jun proto-oncogene mRNA: evidence for a novel class of AU-rich elements. MoI. Cell. Biol. 16, 1490-1499 (1996).
Piecyk, M. et al. TIA-I is a translational silencer that selectively regulates the expression of TNF-alpha. EMBOJ. 19, 4154-4163 (2000).
Schuldt, A. J., Adams, J. H., Davidson, C. M., Micklem, D. R., Haseloff, J., St Johnston, D., and Brand, A. H. (1998). Miranda mediates asymmetric protein and RNA localization in the developing nervous system. Genes Dev. 12, 1847-1857.
Serin, G., Gersappe, A., Black, J. D., Aronoff, R., and Maquat, L. E. (2001). Identification and characterization of human orthologues to Saccharomyces cerevisiae Upf2 protein and Upf3 protein (Caenorhabditis elegans SMG-4). MoI. Cell. Biol. 21, 209-223. Shen, C. P., Knoblich, J. A., Chan, Y. M., Jiang, M. M., Jan, L. Y., and Jan, Y. N. (1998). Miranda as a multidomain adapter linking apically localized Inscuteable and basally localized Staufen and Prospero during asymmetric cell division in Drosophila. Genes Dev. 12, 1837-1846.
Shetty, S. & Well, S. Posttranscriptional regulation of plasminogen activator inhibitor- 1 in i!11" n- n ■■■■ u .:::;iι IUi :::::n ,■• ,,::;ι; :::;:n U ,.,!L ,1, human lung carcinoma cells in vitro. Am. J. Physiol. Lung Cell MoI. Physiol. 278, Ll 48- 156
(2000).
Shibuya, T., Tange, T. O., Sonenberg, N., and Moore, M. J. (2004). eIF4Am binds spliced mRNA in the exon junction complex and is essential for nonsense-mediated decay. Nat. Struct. MoI. Biol. 11, 346-351.
Siebel, C. W., Kanaar, R., and Rio, D. C. (1994). Regulation of tissue-specific P-element pre-mRNA splicing requires the RNA-binding protein PSI. Genes Dev 8, 1713-1725.
St Johnston, D. (1995). The intracellular localization of messenger RNAs. Cell 81, 161-170.
Sun, X., Perlick, H. A., Dietz, H. C, and Maquat, L. E. (1998). A mutated human homologue to yeast Upfl protein has a dominant-negative effect on the decay of nonsense- containing mRNAs in mammalian cells. Proc. Natl. Acad. Sci. USA 95, 10009-10014.
Tange, T.O., Nott, A. & Moore, MJ. The ever-increasing complexities of the exon junction complex. Curr. Opin. Cell Biol. 16, 279-284 (2004). van Eeden, F. J., Palacios, I. M., Petronczki, M., Weston, M. J., and St Johnston, D. (2001). Barentsz is essential for the posterior localization of oskar mRNA and colocalizes with it to the posterior pole. J. Cell. Biol. 154, 511-523.
Villace, P., Marion, R. M., and Ortin, J. (2004). The composition of Staufen-containing RNA granules from human cells indicates their role in the regulated transport and translation of messenger RNAs. Nucleic Acids Res. 32, 2411-2420. Wang, Z., Jiao, X., Carr-Schmid, A. & Kiledjian, M. The hDcp2 protein is a mammalian mRNA decapping enzyme. Proc. Natl. Acad. Sci. USA 99, 12663-12668 (2002).
Wickham, L., Duchaine, T., Luo, M., Nabi, I. R., and DesGroseillers, L. (1999). Mammalian staufen is a double-stranded-RNA- and tubulin-binding protein which localizes to the rough endoplasmic reticulum. MoI. Cell. Biol. 19, 2220-2230. Wilusz, C. J., Wang, W., and Peltz, S. W. (2001). Curbing the nonsense: the activation and regulation of mRNA surveillance. Genes Dev. 15, 2781-2785.
Wodicka, L., Dong, H., Mittmann, M., Ho, M. H., and Lockhart, D. J. (1997). Genome-wide expression monitoring in Saccharomyces cerevisiae. Nat. Biotechnol. 15, 1359-1367.
Zhang, J., Sun, X., Qian, Y., and Maquat, L. E. (1998). Intron function in the nonsense- mediated decay of beta-globin mRNA: indications that pre-mRNA splicing in the nucleus can influence mRNA translation in the cytoplasm. RNA 4, 801-815.

Claims

XXII. CLAIMSWhat is claimed is:
1. A method of treating a disorder in a subject comprising administering to the subject a substance, wherein the substance modulates Staul -mediated mRNA decay (SMD.
2. The method of claim 1, wherein the SMD occurs in the pioneering round of translation.
3. The method of claim 1, wherein the SMD targets eIF4E-bound mRNA during steady- state mRNA translation.
4. The method of claim 1, wherein the disorder is an inherited genetic disorder.
5. The method of claim 4, wherein the genetic disorder can be selected from the group consisting of cystic fibrosis, hemophilia, mucopolysaccharidoses, muscular dystrophy, anemia, glycolytic enzyme deficiency, connective tissue disorder, DNA repair disorder, dementia, Sandhoff disease, epidermolysis bullosa simplex, insulin resistance, maple syrup urine disease, hereditary fructose intolerance, inherited immunodeficiency, inherited cancer, carbohydrate metabolism disorder, amino acid metabolism disorder, lipoprotein metabolism disorder, lipid metabolism disorder, lysomal enzymes disorder, steroid metabolism disorder, purine metabolism disorder, pyrimidine metabolism disorder, metal metabolism disorder, porphyrin metabolism disorder, and heme metabolism disorder.
6. The method of claim 1 , wherein the disorder is an acquired disorder.
7. The method of claim 1, wherein the disorder is dementia.
8. The method of claim 6, wherein the acquired disorder is a cancer.
9. The method of claim 8, wherein the cancer is selected from the group consisting of lymphoma, B cell lymphoma, T cell lymphoma, leukemia, carcinoma, sarcoma, glioma, blastoma, neuroblastoma, plasmacytoma, histiocytoma, melanoma, mycosis fungoide, hypoxic tumor, myeloma, metastatic cancer, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, colon cancer, cervical cancer, breast cancer, epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, hematopoietic cancers, testicular cancer, and colorectal cancer.
10. The method of claim 1, wherein the subject is a mammal.
11. The method of claim 1, wherein the modulation is a decrease in Staul -mediated mRNA decay.
12. The method of claim 1, wherein the modulation is an increase in Staul -mediated mRNA decay.
13. The method of claim 1, wherein the substance is Staul or a complex comprising Staul and Upfl.
14. The method of claim 1, wherein the substance binds Upfl or Staul.
15. The method of claim 1, wherein the substance is a functional nucleic acid, siRNA, peptide, protein, antibody, or small molecule.
16. A method of treating a Staul -mediated mRNA decay related disorder in a subject comprising administering to the subject Staul or a complex comprising Staul and Upfl.
17. A method of screening for a substance that modulates Staul -mediated mRNA decay (SMD) comprising a) incubating the substance to be screened with a Staul mRNA decay complex, and b) assaying for a change in SMD, an increase or decrease in SMD activity indicating a modulating substance.
18. The method of claim 17, wherein the complex comprises Upfl and Staul.
19. The method of claim 17, wherein the complex one of Upfl and Staul.
20. A method of screening for a substance that modulates Staul -mediated mRNA decay (SMD) comprising a) incubating the substance with a stably transfected cell comprising a reporter gene with a nonsense-mutation and Staul, and b) assaying the amount of SMD in the cell, wherein a increase or decrease in the amount of mRNA relative to the amount of mRNA in the absence of the substance indicates a substance that modulates SMD activity.
21. A method of screening for a substance that inhibits Staul -mediated mRNA decay (SMD) comprising a) incubating the substance with Upfl and Staul forming a substance-Upfl- Staul mixture, and b) assaying the amount of Upfl -Staul complex present in the mixture, a decrease in the amount of Upfl -Staul complex relative to the amount of Upfl -Staul complex in the absence of the substance indicating the substance inhibits SMD.
22. The method of claim 21, wherein the Upfl has at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 3, or an SMD-active fragment thereof.
23. The method of claim 21, wherein the Staul has at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 1, or an SMD-active fragment thereof.
24. A method of screening for a substance that promotes Staul -mediated mRNA decay (SMD) comprising a) incubating the substance with Upfl and Staul forming a substance- Upfl- Staul mixture, and b) assaying the amount of Upfl -Staul complex present in the mixture, wherein a increase in the amount of Upfl -Staul complex relative to the amount of Upfl -Staul complex in the absence of the substance indicates that the substance promotes SMD.
25. The method of claim 24, wherein the Upfl has at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 3, or a fragment thereof.
26. The method of claim 24, wherein the Staul has at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 1, or a fragment thereof.
27. A method of screening for a substance that modulates Staul -mediated mRNA decay (SMD) comprising, a) administering a substance to a system, wherein the system comprises the components for SMD activity, and b) assaying the effect of the substance on the amount of SMD activity in the system, a change in the amount of SMD activity present in the system compared to the amount of SMD activity in the system in the absence of the substance indicates the substance is a modulator.
28. A method of modulating Staul -mediated mRNA decay (SMD) activity comprising administering a substance, wherein the substance is identified by the method of claim 27.
29. A method of making a substance that modulates Staul -mediated mRNA decay (SMD) activity comprising admixing a substance identified by the method of claim 28 with a pharmaceutically acceptable carrier.
30. A substance made by the method of claim 29.
31. A method of making a modulator of Staul -mediated mRNA decay (SMD) comprising, a) administering a substance to a system, wherein the system comprises the components for SMD activity; b) assaying the effect of the substance on the amount of SMD activity in the system; c) selecting the substance that causes a change in the amount of SMD activity present in the system compared to the amount of SMD activity in the system in the absence of substance; and d) synthesizing the substance.
32. A substance that modulates SMD, wherein the substance is an antibody or fragment thereof that modulates SMD.
33. The substance of claim 32, wherein the antibody binds Upfl.
34. The substance of claim 32, wherein the antibody binds Staul .
35. A substance that modulates SMD, wherein the substance is a vector comprising a nucleic acid that encodes an SMD modulator.
36. A vector comprising a nucleic acid that encodes an SMD modulator.
37. A cell comprising the vector of claim 35.
38. A substance that modulates SMD, wherein the substance is an siRNA that modulates SMD.
39. The substance of claim 38, wherein the siRNA binds Upfl.
40. The substance of claim 38, wherein the siRNA binds Staul.
41. A method of facilitating Staul -mediated mRNA decay comprising contacting a system comprising the components for SMD with Staul.
42. A method of identifying an agent that binds a Staul binding site comprising contacting the agent to be screened with the Staul binding site.
43. The method of claim 42, wherein the Staul binding site comprises SEQ ID NO: 56.
44. A method of identifying genes modulated by the down-regulation of Staul comprising a) incubating a substance that down-regulates SMD with a stably transfected cell comprising a reporter gene with a nonsense-mutation and Staul, and b) assaying the amount of mRNA present for a gene in a microarray, wherein a increase or decrease in the amount of mRNA relative to the amount of mRNA in the absence of the substance indicates a gene that is modulated by Staul activity.
45. The method of claim 44, wherein the gene is up-regulated by down-regulating Staul.
46. The method of claim 44, wherein the gene is down-regulated by down-regulating Staul .
47. The method of claim 44, wherein the abundance of the gene is increased by down- regulating Staul.
48. The method of claim 44, wherein the abundance of the gene is decreased by down- regulating Staul.
49. The method of claim 44, wherein the gene is stabilized by down-regulating of Staul.
50. The method of claim 44, wherein the gene is destabilized by down-regulating of Staul .
51. A method of identifying genes modulated by the down-regulation of Staul comprising a) transfecting a small interfering RNA (siRNA) that down-regulates SMD into a cell comprising Staul and one or more selected genes comprising one or more nonsense-mutations, and b) assaying the amount of protein expressed of the gene being screened or mRNA present for the gene being screened, wherein a increase or decrease in the amount of protein or mRNA relative to the amount of protein or mRNA in the absence of the siRNA indicates a gene that is modulated by Staul »■•■ ii,,,,. Ii ,. I...)" ..,,;iι ii.,,n ;;;;:n „.;,% :!;:;iι o ,,j|,, ,1, activity.
52. The method of claim 51, wherein the siRNA is Staul siRNA.
53. The method of claim 51, wherein the gene is up-regulated by down-regulating Staul.
54. The method of claim 51, wherein the gene is down-regulated by down-regulating Staul.
55. The method of claim 51, wherein the abundance of the gene is increased by down- regulating Staul.
56. The method of claim 51, wherein the abundance of the gene is decreased by down- regulating Staul.
57. The method of claim 51, wherein the gene is stabilized by down-regulating of Staul.
58. The method of claim 51 , wherein the gene is destabilized by down-regulating of Staul .
59. The method of claim 51, wherein the amount of mRNA present is measured by RT- PCR.
60. The method of claim 51, wherein the amount of protein expression is measured by western blotting.
61. A method of identifying genes modulated by the down-regulation of UPfI comprising a) transfecting a small interfering RNA (siRNA) that down-regulates SMD into a cell comprising UPfI and one or more selected genes comprising one or more nonsense-mutations, and b) assaying the amount of protein expressed of the gene being screened or mRNA present for the gene being screened, wherein a increase or decrease in the amount of protein or mRNA relative to the amount of protein or mRNA in the absence of the siRNA indicates a gene that is modulated by Upfl activity.
62. The method of claim 61, wherein the siRNA is Upfl siRNA.
63. The method of claim 61, wherein the gene is up-regulated by down-regulating Staul .
64. The method of claim 61, wherein the gene is down-regulated by down-regulating Staul.
65. The method of claim 61, wherein the abundance of the gene is increased by down- regulating Staul.
66. The method of claim 61, wherein the abundance of the gene is decreased by down- regulating Staul.
67. The method of claim 61, wherein the gene is stabilized by down-regulating of Staul.
68. The method of claim 61 , wherein the gene is destabilized by down-regulating of Stau 1.
69. The method of claim 61, wherein the amount of mRNA present is measured by RT- PCR.
70. The method of claim 61, wherein the amount of protein expression is measured by western blotting.
71. A method of treating a disorder in a subject comprising administering to the subject a substance, wherein the substance modulates Staul wherein the modulation of Staul modulates that level of mRNA abundance of another gene.
PCT/US2005/035011 2004-09-29 2005-09-29 Staufen 1 (stau1) - mediated mrna decay Ceased WO2006039399A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US61407104P 2004-09-29 2004-09-29
US60/614,071 2004-09-29
US64684405P 2005-01-25 2005-01-25
US60/646,844 2005-01-25

Publications (2)

Publication Number Publication Date
WO2006039399A2 true WO2006039399A2 (en) 2006-04-13
WO2006039399A3 WO2006039399A3 (en) 2007-04-19

Family

ID=36143051

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/035011 Ceased WO2006039399A2 (en) 2004-09-29 2005-09-29 Staufen 1 (stau1) - mediated mrna decay

Country Status (1)

Country Link
WO (1) WO2006039399A2 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2294216A4 (en) * 2008-05-14 2011-11-23 Dermtech Int Diagnosis of melanoma and solar lentigo by nucleic acid analysis
WO2012109476A3 (en) * 2011-02-09 2012-10-04 The University Of Rochester Methods and compositions related to staufen 1 binding sites formed by duplexing alu elements
WO2018107096A1 (en) * 2016-12-08 2018-06-14 University Of Utah Research Foundation Staufen1 agents and associated methods
US11578373B2 (en) 2019-03-26 2023-02-14 Dermtech, Inc. Gene classifiers and uses thereof in skin cancers
US11946046B2 (en) 2018-06-14 2024-04-02 University Of Utah Research Foundation Staufen1 regulating agents and associated methods
US11976332B2 (en) 2018-02-14 2024-05-07 Dermtech, Inc. Gene classifiers and uses thereof in non-melanoma skin cancers
USD1097166S1 (en) 2015-05-01 2025-10-07 Dermtech, Llc Dermatology adhesive patch

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20040241845A1 (en) * 1998-05-22 2004-12-02 Luc Desgroseillers Mammalian staufen and use thereof

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2294216A4 (en) * 2008-05-14 2011-11-23 Dermtech Int Diagnosis of melanoma and solar lentigo by nucleic acid analysis
US9057109B2 (en) 2008-05-14 2015-06-16 Dermtech International Diagnosis of melanoma and solar lentigo by nucleic acid analysis
US10407729B2 (en) 2008-05-14 2019-09-10 Dermtech, Inc. Diagnosis of melanoma by nucleic acid analysis
US11332795B2 (en) 2008-05-14 2022-05-17 Dermtech, Inc. Diagnosis of melanoma and solar lentigo by nucleic acid analysis
US11753687B2 (en) 2008-05-14 2023-09-12 Dermtech, Inc. Diagnosis of melanoma and solar lentigo by nucleic acid analysis
WO2012109476A3 (en) * 2011-02-09 2012-10-04 The University Of Rochester Methods and compositions related to staufen 1 binding sites formed by duplexing alu elements
US9206479B2 (en) 2011-02-09 2015-12-08 University Of Rochester Methods and compositions related to Staufen 1 binding sites formed by duplexing Alu elements
USD1097166S1 (en) 2015-05-01 2025-10-07 Dermtech, Llc Dermatology adhesive patch
US11723912B2 (en) * 2016-12-08 2023-08-15 University Of Utah Research Foundation Staufen1 agents and associated methods
US20240180953A1 (en) * 2016-12-08 2024-06-06 University Of Utah Research Foundation Staufen1 agents and associated methods
US12409189B2 (en) * 2016-12-08 2025-09-09 University Of Utah Research Foundation STAUFEN1 agents and associated methods
WO2018107096A1 (en) * 2016-12-08 2018-06-14 University Of Utah Research Foundation Staufen1 agents and associated methods
US11976332B2 (en) 2018-02-14 2024-05-07 Dermtech, Inc. Gene classifiers and uses thereof in non-melanoma skin cancers
US11946046B2 (en) 2018-06-14 2024-04-02 University Of Utah Research Foundation Staufen1 regulating agents and associated methods
US12565650B2 (en) 2018-06-14 2026-03-03 University Of Utah Research Foundation STAUFEN1 regulating agents and associated methods
US11578373B2 (en) 2019-03-26 2023-02-14 Dermtech, Inc. Gene classifiers and uses thereof in skin cancers

Also Published As

Publication number Publication date
WO2006039399A3 (en) 2007-04-19

Similar Documents

Publication Publication Date Title
US9206479B2 (en) Methods and compositions related to Staufen 1 binding sites formed by duplexing Alu elements
AU2020230272B2 (en) Hippo and dystrophin complex signaling in cardiomyocyte renewal
US9974289B2 (en) Knock-in rodent comprising a mutation in an endogenous CRBN locus and methods of use thereof
CN1854313B (en) Diagnostic methods for non-small cell lung cancer
WO2010120262A1 (en) Methods and compositions for the treatment of medical conditions involving cellular programming
US8927207B2 (en) miRNAs as therapeutic targets in cancer
US12458668B2 (en) Methods for treating facioscapulohumeral muscular dystrophy
WO2013155330A1 (en) Compositions and methods for characterizing and treating muscular dystrophy
US20110178162A1 (en) Targeting pax2 for the induction of defb1-mediated tumor immunity and cancer therapy
EP2132313B1 (en) Inhibitors of mrp4 for the treatment of vascular disorders
US8841269B2 (en) Polynucleotides for use in treating and diagnosing cancers
EP3259346B1 (en) P63 inactivation for the treatment of heart failure
AU2017250017B2 (en) Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof
US20060154883A1 (en) Nonsense-mediated mrna decay
KR20170076606A (en) Pharmaceutical composition for immunotherapy comprising an UPF1 inhibitor as an active ingredient
US9127273B2 (en) UNC-45A splice variants based cancer diagnostics and therapeutics
US20120252737A1 (en) Methods for Diagnosing and Treating Cancer
Nichols et al. Z-Form Stabilization By The Zα Domain Of Adar1p150 Has Subtle Effects On A-To-I Editing
US20220259596A1 (en) Inhibitors of microRNA 451a for Treatment of Endometriosis
WO2019246572A1 (en) Compositions and methods for treating primary aldosteonism
AU2012275552A1 (en) Microrna-31 compositions and methods for use in autoimmune disease

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase