WO2006037050A2 - Methods for treating congestive heart failure - Google Patents

Methods for treating congestive heart failure Download PDF

Info

Publication number
WO2006037050A2
WO2006037050A2 PCT/US2005/034846 US2005034846W WO2006037050A2 WO 2006037050 A2 WO2006037050 A2 WO 2006037050A2 US 2005034846 W US2005034846 W US 2005034846W WO 2006037050 A2 WO2006037050 A2 WO 2006037050A2
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
aryl
acid
group
independently
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/034846
Other languages
French (fr)
Other versions
WO2006037050A3 (en
Inventor
Daniela Salvemini
Yingjie Chen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Minnesota Twin Cities
Metaphore Pharmaceuticals Inc
University of Minnesota System
Original Assignee
University of Minnesota Twin Cities
Metaphore Pharmaceuticals Inc
University of Minnesota System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Minnesota Twin Cities, Metaphore Pharmaceuticals Inc, University of Minnesota System filed Critical University of Minnesota Twin Cities
Publication of WO2006037050A2 publication Critical patent/WO2006037050A2/en
Publication of WO2006037050A3 publication Critical patent/WO2006037050A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/555Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof

Definitions

  • the invention provides methods for treating heart failure by administering to a subject a therapeutically effective amount of a composition comprising a catalyst for the dismutation of superoxide anions and a peroxynitrite decomposition catalyst.
  • Heart failure means that the heart is not working efficiently enough to keep up with its workload, either during exercise or at rest.
  • the term "failure” indicates that the pumping action of the heart is inadequate to meet the body's needs for oxygen-rich blood. As a result, blood flow to body tissues is reduced and blood returning to the heart accumulates, causing congestion in the veins.
  • the term Congestive Heart Failure (“CHF”) is often synonymous with heart failure but also refers to the build up of body fluid in the lungs and elsewhere in the body that results from the inability of the heart to pump efficiently enough to meet the body's needs.
  • Heart failure usually develops slowly, often overyears as the heart gradually loses its pumping ability. Between 2 to 3 million Americans have heart failure and 400,000 new cases are diagnosed each year. Heart failure causes approximately 39,000 deaths a year and is a contributing factor in another 225,000 deaths.
  • CHF cardiac venous pressure
  • left ventricular failure is secondary to reduced forward flow into the aorta and systemic circulation.
  • systolic dysfunction is characterized by a dilated left ventricle with an inability to contract normally and expel sufficient blood, while diastolic dysfunction occurs in a normal or intact left ventricle with impaired ability to relax and fill normally.
  • the weaker pumping action of the heart means that less blood is sent to the kidneys, which results in fluid build-up by retaining water and salt in the kidneys.
  • classifications for heart failure include high output versus low output failure; acute versus chronic heart failure and right-sided versus left-sided heart failure. While the different classifications may be useful early in the course of the disease, the differences between the classifications and the associated symptoms in the later stages of heart failure and in chronic heart failure often become indistinguishable.
  • Managing CHF generally includes correction of any reversible causes including restrictions of dietary sodium. Diuretics may be prescribed to facilitate the removal of excess water and sodium. Digitalis has been used since the 18th century to strengthen the heart's pumping action and is still a component of modern therapy. Newer drugs for the treatment of heart failure include vasodilators including angiotensin-converting enzyme (ACE). Other drugs used in the treatment of heart failure include calcium-channel blockers, which dilate vessels; beta blockers, which slow the heart; and medications with affect heartbeat irregularities. Surgery is indicated under some circumstances including valve repair or artificial valve replacement. Heart transplants are last resort in treatment and are otherwise generally impractical because of cost and the shortage of organs. Other available options include portable pumps to continuously infuse medications, implanted devices for controlling arrhythmias, or ventricular dynamic cardiomyoplasty.
  • ACE angiotensin-converting enzyme
  • a method for treating congestive heart failure comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic.
  • Another aspect provides a method for increasing coronary blood flow in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic.
  • Yet another aspect provides a method for increasing MVO 2 in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic.
  • the superoxide dismutase mimetic can comprise an organic ligand chelated to a metal ion including Mn(II), Mn(III), Fe(II), Fe (III), Cu(H)ZZn(ItI), or Cu(lll)/Zn (II).
  • the subject can be a mammal and avian. In particular, the mammal can be a human.
  • the catalyst of the methods above can be a pentaaza- macrocyclic ligand complex or a substituted pentaaza-macrocyclic ligand complex.
  • the pentaaza-macrocyclic ligand complex can be represented by the following formula:
  • R 1 , R'-,, R 2 , R' 2 , R 3 , R 3 , Rt, RU, RS, R'B, Re, R' ⁇ . R?, R'?, Re, R' ⁇ . R ⁇ , R'9, R-io, and R'10 can independently be:
  • (i b ) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or
  • (i G ) a moiety independently including -OR 11 , -NRi 1 R 12 , -COR 11 , -CO 2 Rn, -CONR 11 R 12 , -SR 11 , -SOR 11 , -SO 2 R 11 , -SO 2 NR 11 R 12 , -N(OR 11 )(R 12 ), -P(O)(OR 11 )(OR 12 ), -P(O)(OR 11 )(Ri 2 ), -OP(O)(ORii)(OR 12 ), or substituents attached to the ⁇ -carbon of ⁇ -amino acids, wherein Rn and R 12 can independently include hydrogen or alkyl; and
  • R 10 or R' 1O and R 1 or R'-i, R 2 or R 2 and R 3 or R' 3 , R 4 or R' 4 and R 5 or R 5 , R 6 or R 6 and R 7 or R 7 , or R 8 or R' 8 and R 9 or R 9 together with the carbon atoms to which they can be attached independently can form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
  • I 1 J 1 K and L independently can be integers from 0 to 10 and Q, R and T can optionally include substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylaikyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza
  • M can be a transition metal
  • X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl aryl
  • X, Y and Z can independently include charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
  • X, Y and Z can independently be attached to one or more of R 1 , R'i, R 2 , R' 2 , R3.
  • n can be an integer from 0 to 3.
  • the pentaaza-macrocyclic ligand complex can be represented by the following formula:
  • a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen can be attached can independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W having 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
  • R 1 , R 2 , R 2, R3, R 3, R4, R 4, R5, R 5, Re, Re, R?, RV, Ra, R 8 , R9, R'9, and R10 can independently be:
  • (ii b ) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, . cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or
  • (ii c ) a moiety independently selected from the group consisting of -ORn, -NR 11 R 12 , -COR 11 , -CO 2 Ri 1 , -CONR 1I Ri 2 , -SR 11 , -SOR 11 , -SO 2 R 11 , -SO 2 NR 11 R 12 , -N(OR 11 )(R 12 ), -P(O)(OR 11 )(OR 12 ), -P(O)(OR 11 )(R 12 ), -OP(O)(OR 11 )(OR 12 ), or substituents attached to the ⁇ -carbon of ⁇ -amino acids, wherein R 11 and Ri 2 can independently include hydrogen or alkyl; and
  • R 1 and R 2 or R 2 , R 3 or R' 3 and R 4 or R 4 , R 5 or R' 5 and R 6 or R' 6 , R 7 or R' 7 and R 8 or R' 8 , R 9 or R' 9 and R 10 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
  • R 2 and R 2 , R 3 and R' 3l R 4 and R 4 , R 5 and R' 5l R 6 and R 6 , R 7 and R 7 , R 8 and R' 8 , and R 9 and R 9 together with the carbon atom to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
  • R 2 or R' 2 and R 3 or R' 3 , R 4 or R 4 and R 5 or R' 5> R 6 or R' 6 and R 7 or R' 7 , or R 8 or R' 8 and R 9 or R' 9 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
  • R 1 , R 2 , R' 2 , Ra, R'3, R 4 , R 4 , Rs, R'5, Re, R'e, R 7 , R 7 , R 8 , Rs, R 9 , Rg, and R 10 together with a different one of R 1 , R 2 , R 2 , R 3 , R' 3 , R 4 , R 4 , R5, R'5, R 6 , R'e, R7, R'7, R ⁇ , R' ⁇ , Rg, R'g, and Ri 0 , which can be attached to a different carbon atom in the macrocyclic ligand may be bound to form a strap represented by the formula:
  • I 1 J 1 K and L independently can be integers from 0 to 10 and Q, R and T can optionally be substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza
  • R 1 , R 2 , R 2 , R 3 , R 3 , R 4 , R 4 , R 5 , R' 5) R 6 , Re, R 7 , R 7 , R 8 , R' ⁇ , Rg, R' 9 , and R 10 may be bound to an atom of heterocycle W to form a strap represented by the formula:
  • I, J, K and L can independently be integers from 0 to 10 and Q, R and T can optionally be substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza
  • M can be a transition metal
  • X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl aryl
  • X, Y and Z can independently be charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
  • X, Y and Z can independently be attached to one or more of R 1 , R 2 , R' 2 , R 3 , R'3, R4, R'4, R5, R'5, R ⁇ > R F 6> R7.
  • n can be an integer from 0 to 3.
  • the pentaaza-macrocyclic ligand complex can be represented by the following formula:
  • a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen can be attached can independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W which can have 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
  • two sets of two adjacent carbon atoms of the macrocycle can independently form substituted or unsubstituted, saturated, partially saturated or unsaturated, cycles or heterocycles U and V having 3 to 20 carbon atoms;
  • Rs, R's, Re, R'e, R 7 , Rs, Rg, Rg, and R 10 can independently be:
  • (iii b ) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or
  • (iii c ) a moiety independently including -OR 11 , -NR 11 R 12 , -COR 11 , -CO 2 R 11 , -CONR 11 R 12 , -SR 11 , -SOR 11 , -SO 2 R 11 , -SO 2 NR 11 R 12 , -N(OR 11 )(R 12 ), -P(O)(OR 11 )(OR 12 ), -P(O)(OR 11 )(R 12 ), -OP(O)(OR 11 )(OR 12 ), or substituents attached to the ⁇ -carbon of ⁇ -amino acids, wherein R 11 and R 12 can independently include hydrogen or alkyl; and
  • R-i and R 2 or R 2 , R 5 or R' 5 and R 6 or R' 6 , R 9 or Rg and R 10 together with the carbon atoms to which they attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms;
  • R 2 and R 2 , R 5 and R' 5 , Re and R' 6 , and R 9 and R g, together with the carbon atom to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms;
  • R 2 or R' 2 and R 3 , R 4 and R 5 or R' 5 , R 6 or R' 6 and R 7 , or R 8 and R 9 or R' 9 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
  • I, J, K and L independently can be integers from 0 to 10 and Q, R and T can be optionally substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza
  • R 1 , R 2 , R 2 , R 3 , R 4 , R 5 , R' 5 , R 6 , R 6 , R 7 , R 8 , R 9 , R'g, and R 10 can be individually bound to an atom of heterocycles U, V and W to form a strap represented by the formula:
  • I, J, K and L independently can be integers from 0 to 10 and Q, R and T can be optionally substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza
  • M can be a transition metal
  • X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl aryl
  • X, Y and Z can independently include charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
  • X, Y and Z can independently be attached to one or more of R-i, R 2 , R' 2 , R 3 , R4, Rs, R's, Re, R'e, R7, Ra, Rg, Rg, and R 10 ; and
  • n can be an integer from 0 to 3.
  • the pentaaza-macrocyclic ligand complex can be represented by the following formulas:
  • W of the pentaaza-macrocyclic ligand complex can be a substituted pyridino moiety.
  • the superoxide dismutase mimetic can be a porphyrin ligand complex or a substituted porphyrin ligand complex.
  • the porphyrin ligand complex can be selected from the group consisting of a manganese (II) porphyrin complex, manganese(lll) porphyrin complex, iron (II) porphyrin complex, and an iron(lll) porphyrin complex.
  • the porphyrin ligand complex can be a 5,10,15, 20-tetrakis (2,4,6- trimethyl-3,5-disulfonatophenyl)-porphyrinato iron (III) (FeTMPS) complex.
  • a method for diagnosing congestive heart failure in a subject comprising obtaining a first coronary blood flow or IVlVO 2 measurement in the subject, administering a superoxide dismutase mimetic to the subject, and obtaining a second coronary blood flow or MVO 2 measurement after administration of the catalyst to the subject, wherein an increase in coronary blood flow or MVO 2 following administration of the superoxide dismutase mimetic is indicative of congestive heart failure.
  • the subject and superoxide dismutase mimetic can be those described above.
  • a method for treating heart failure comprising administering to a subject in need thereof a therapeutically effective amount of a peroxynitrite decomposition catalyst.
  • a method for increasing coronary blood flow in heart failure comprising administering to a subject in need thereof a therapeutically effective amount of a peroxynitrite decomposition catalyst.
  • a method for increasing MVO 2 in heart failure comprising administering to a subject in need thereof a therapeutically effective amount of a peroxynitrite decomposition catalyst.
  • the subject can be selected from the group consisting of a mammal and avian.
  • the mammal can be a human.
  • the peroxynitrite decomposition catalyst can be represented by a formula selected from the group of formulas consisting of:
  • R 3 , R 6 , R 9 or R 12 can independently include H, alkyl, alkenyl, CH 2 , COOH, phenyl, pyridinyl, or N-alkylpyridyl such that phenyl, pyridinyl and N-alkylpyridyl can be: Phenyl
  • phenyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH 2 , SO 3 H, NO 2 , NH 2 , N(R) 3+ or NHCOR 1 wherein R can include hydrogen, alkyl, aryl and alkaryl and R' can be alkyl, and
  • pyridinyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH 2 , SO 3 H, NO 2 , NH 2 , N(R) 3+ or NHCOR 1 wherein R and R 1 can be as defined above, and
  • N-alkylpyridyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH 2 , SO 3 H, NO 2 , NH 2 , N(R) 3+ or NHCOR 1 wherein R and R' can be as defined above; and
  • R 1 , R 2 , R 4 , R 5 , R 7 , R 8 , Rio, or R 11 can independently include H, alkyl, alkenyl, carboxyalkyl, Cl, Br, F, NO 2 , hydroxyalkyl, or SO 3 H, and further wherein R-,R 2 can be taken together to form a ring of from 5 to 8 carbons, and
  • X and Y can be ligands or charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand or ligand system or the corresponding anion thereof and can be independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl, amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl n
  • M can be selected from the group consisting of Mn, Fe, Ni and V;
  • n can be an integer from 1 to 3; or
  • R' can be CH or N
  • R 7 , Rs, Rg, Rio, Rn, R12, Ri 3 , R14, R15, and R 16 can independently include H, SO 3 H, COOH, NO 2 , NH 2 , and N-alkylamino
  • X, Y, Z, M and n can be as defined above; [0100] Structure III
  • R 1 , R 5 , R 9 , and R 13 can independently include a direct bond and
  • R 2 , R 2 ', R4, R 4 ', Re, Re', R ⁇ , R ⁇ ', R10, R10', Ri2 > Ri 2 1 , Ri4 > R14', R16, and R-i6' can independently include H and alkyl;
  • R 3 , R 7 , R 11 , R 15 can independently include H and alkyl; and [0104] X, Y, Z, M and n can be as defined above;
  • R 1 , Rs, Rs, and Ri 2 can independently include a direct bond
  • R 2 , R 2 1 , R 4 , R 4 1 , R 6 , R 6 1 , R 7 , R 9 , R 9 1 , R 11 , R 11 1 , R 13 , R 13 1 , and R 14 can independently include H and alkyl;
  • R 3 and R 10 can independently include H and alkyl; and [0108] X, Y, Z, M and n can be as defined above;
  • R-i, R 4 , Rs, R 12 can independently include direct bond and CH 2 ;
  • R 2 , R 2 ', R 3 , R 5 , Rs', R7, Rg, Rg', Rn, Rn', R13, R13' and R 14 can independently include H and alkyl;
  • R 10 can be H or alkyl; and [0112] X, Y, Z, M and n can be as defined above;
  • R 1 , R 4 , R 7 and R 10 can independently include direct bond and CH 2 ;
  • R 2 , R 2 ', R 3 , R 5 , R 5 ', R 6 , R 8 , Rs', Rg, Rn, Rn' and R 12 can independently include H and alkyl;
  • X, Y, Z, M and n can be as defined above;
  • R 1 , R 4 , Rs and R- ⁇ can independently include a direct bond
  • R 2 , R 3 , R 3 ', Rs, R 5 ", R?, R/. Rg, Rio> R10 1 , R12, R12 1 and R 13 can independently include H and alkyl;
  • R 6 can be hydrogen or alkyl
  • X, Y, Z, M and n can be as defined above;
  • R 1 , R 4 , R 7 and R 1 0 can independently include H and alkyl
  • R 2 , R 3 , R 3 ', R 5 , Rs', Re, Rs, Rg, Rg', R11, Rn' and R 12 can independently include H and alkyl
  • X, Y, Z, M and n can be as defined above;
  • R-i, R 3 , R 4 and R 6 can independently include H and alkyl;
  • R 2 and R 5 can independently include H, alkyl, SO 3 H, NO 2 , NH 2 , halogen, COOH and N(R) 3+ wherein R can be as defined above; and
  • X, Y, Z, M and n can be as defined above;
  • R 1 , R 2 , R 3 , R 4 can independently include H, alkyl, SO 3 H, NO 2 , NH 2 , halogen, COOH and N(R) 3+ wherein R can be as defined above; and [0127] X, Y, Z, M and n can be as defined above; and [0128] Structure IV
  • R 1 , R 1 ', R 2 , R 2 1 , R 3 , R3 1 , R4, R 4 ', Rs, R5 1 , Re, Re', R 7 and R 7 ' can independently include H, alkyl, alkoxy, NO 2 , aryl, halogen, NH 2 and SO 3 H, wherein R 6 , Re', R 7 and R 7 ' may each be taken together with one other of R 6 , R ⁇ , R 7 and- R 7 ' to form a cyclic group, preferably a 6 carbon cycloalkyl group;
  • M 1 can be selected from the group consisting of Fe, Ni or V;
  • X, Y, Z and n can be as defined above.
  • Figure 1 shows the effect of M40401 'in normal dogs.
  • the relationship between Myocardial 02 consumption (ml/min) and rate pressure product (mm Hg beats/min) were unchanged in normal dogs after taking M40401.
  • FIG 2 shows the effect of M40401 in normal dogs.
  • Coronary blood flow ml/min
  • rate pressure product mm Hg beats/min
  • Figure 3 shows the effect of M40401 and LNA (the nitric oxide synthase inhibitor NG-nitro-l-arginine) on endothelium dependent coronary vasodilation in normal dogs.
  • M40401 and LNA the nitric oxide synthase inhibitor NG-nitro-l-arginine
  • Figure 4 shows the effect of M40401 and LNA (the nitric oxide synthase inhibitor NG-nitro-l-arginine) on endothelium dependent coronary vasodilation in normal dogs. Inhibition of NO production with LNA blunted the increase in coronary flow produced by acetylcholine.
  • Figure 5 shows SOD isoenzyme content. Western analysis shows that norma! extracellular SOD was decreased, while Mn-SOD was increased in the failing heart.
  • LNA the nitric oxide synthase inhibitor NG-nitro-l-arginine
  • ROS reactive oxygen species
  • non-peptidic catalysts for the dismutation of superoxide or “non-proteinaceous catalysts for the dismutation of superoxide” mean a low- molecular weight catalyst for the conversion of superoxide anions into hydrogen peroxide and molecular oxygen.
  • These catalysts commonly consist of an organic ligand and a chelated transition metal ion, preferably copper, manganese(ll), manganese(lll), iron(ll) or iron(lll).
  • the term may include catalysts containing short-chain polypeptides (under 15 amino acids) or macrocyclic structures derived from amino acids, as the organic ligand.
  • the term explicitly excludes a superoxide dismutase enzyme obtained from any species.
  • the term "catalyst for the dismutation of superoxide” is used interchangeable with the term “superoxide dismutase mimetic (SODm)” and means any catalyst for the conversion of superoxide anions into hydrogen peroxide and molecular oxygen.
  • SODm superoxide dismutase mimetic
  • the term explicitly includes a superoxide dismutase enzyme obtained from any species.
  • the superoxide dismutase mimetics can include, generally, those superoxide dismutase mimetics disclosed in U.S. Patent Nos.
  • a mammal patient to which the catalyst for the dismutation of superoxide will be administered, in the methods or compositions of the invention, will be a human.
  • other mammal patients in veterinary e.g., companion pets and large veterinary animals
  • other conceivable contexts are also contemplated.
  • treatment relate to any treatment of heart failure and include: (1) preventing heart failure from occurring in a subject; (2) inhibiting the progression or initiation of heart failure, i.e., arresting or limiting its development; or (3) ameliorating or relieving the symptoms of existing heart failure.
  • terapéuticaally effective amount means those amounts that, when administered to a particular subject in view of the nature and severity of that subject's disease or condition of heart failure, will have the desired therapeutic effect, e.g., an amount which will cure, or at least partially arrest or inhibit the disease or condition or symptoms of heart failure.
  • heart failure is used interchangeably with the term CHF and indicates that the pumping action of the heart is inadequate to meet the body's needs for oxygen-rich blood. As a result, blood flow to body tissues is reduced and blood returning to the heart accumulates, causing congestion in the veins.
  • substituted means that the described moiety has one or more substituents comprising at least 1 carbon or heteroatom, and further comprising 0 to 22 carbon atoms, more preferably from 1 to 15 carbon atoms, and comprising 0 to 22, more preferably from 0 to 15.
  • heteroatom refers to those atoms that are neither carbon nor hydrogen bound to carbon and are selected from the group consisting of O, S, N, P, Si, B, F, Cl, Br, or I. These atoms may be arranged in a number of configurations, creating substituent groups which are unsaturated, saturated, or aromatic.
  • substituents include branched or unbranched alkyl, alkenyl, or alkynyl, cyclic, heterocyclic, aryl, heteroaryl, alkyl, polycycloalkyl, polycycloaryl, polycycloheteroaryl, imines, aminoalkyl, hydroxyalkyl, hydroxyl, phenol, amine oxides, thioalkyl, carboalkoxyalkyl, carboxylic acids and their derivatives, keto, ether, aldehyde, amine, amide, nitrite, halo, thiol, sulfoxide, sulfone, sulfonic acid, sulfide, disulfide, phosphoric acid, phosphonic acid, acrylic acid, sulphonamides, amino acids, peptides, proteins, carbohydrates, nucleic acids, fatty acids, lipids, nitro, hydroxylamines, hydroxamic acids, thiocarbonyls, thio
  • alkyl alone or in combination, means a straight-chain or branched-chain alkyl radical containing from 1 to about 22 carbon atoms, preferably from about 1 to about 18 carbon atoms, and most preferably from about 1 to about 12 carbon atoms.
  • radicals include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, iso-amyl, hexyl, octyl, nonyl, decyl, dodecyl, tetradecyl, hexadecyl, octadecyl and eicosyl.
  • alkenyl alone or in combination, means an alkyl radical having one or more double bonds.
  • alkenyl radicals include, but are not limited to, ethenyl, propenyl, 1-butenyl, cis-2-butenyl, traps-2-butenyl, iso-butylenyl, cis-2-pentenyl, traps-2-pentenyl, 3-methyl-l-butenyl, 2,3-dimethyl-2-butenyl, 1-pentenyl, 1-hexenyl, 1- octenyl, decenyl, dodecenyl, tetradecenyl, hexadecenyl, cis- and traps-9-octadecenyl, 1,3- pentadienyl, 2,4-pentadienyl, 2,3-pentadienyl, 1 ,3-hexadienyl, 2,
  • alkynyl alone or in combination, means an alkyl radical having one or more triple bonds.
  • alkenyl groups include, but are not limited to, ethynyl, propynyl (propargyl), 1-butenyl, 1-octynyl, 9-octadecynyl, 1,3-pentadiynyl, 2,4- pentadiynyl, 1 ,3-hexadiynyl, and 2,4-hexadiynyl.
  • cycloalkyl alone or in combination means a cycloalkyl radical containing from 3 to about 10, preferably from 3 to about 8, and most preferably from 3 to about 6, carbon atoms.
  • examples of such cycloalkyl radicals include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and perhydronaphthyl.
  • cycloalkylalkyl means an alkyl radical as defined above which is substituted by a cycloalkyl radical as defined above.
  • cycloalkylalkyl radicals include, but are not limited to, cyclohexylmethyl, cyclopentylmethyl, (4- iso ⁇ ropylcyclohexyl)methyl, (4-t-butyl-cyclohexyl)methyl, 3-cyclohexylpropyl, 2- cyclohexylmethylpentyl, 3-cyclopentylmethylhexyl, 1 -(4-neopentylcyclohexyl)methylhexyl, and 1 -(4-isopropylcyclohexyl)methylheptyl.
  • cycloalkylcycloalkyl means a cycloalkyl radical as defined above which is substituted by another cycloalkyl radical as defined above.
  • examples of cycloalkylcycloalkyl radicals include, but are not limited to, cyclohexylcyclopentyl and cyclohexylcyclohexyl.
  • cycloalkenyl alone or in combination, means a cycloalkyl radical having one or more double bonds.
  • examples of cycloalkenyl radicals include, but are not limited to, cyclopentenyl, cyclohexenyl, cyclooctenyl, cyclopentadienyl, cyclohexadienyl and cyclooctadienyl.
  • cycloalkenylalkyl means an alkyl radical as defined above which is substituted by a cycloalkenyl radical as defined above.
  • examples of cycloalkenylalkyl radicals include, but are not limited to, 2-cyclohexen-l-ylmethyl, 1-cyclopenten-l-ylmethyl, 2- (1 -cyclohexen-l-yl)ethyl, 3-(1 -cyclopenten-l-yl)propyl, 1 -(1 -cyclohexen-l-ylmethyOpentyl, 1 -(1 - cyclopenten-!-yl)hexyl, 6-(1-cyclohexen-l-yl)hexyl, 1-(1-cyclopenten-l-yl)nonyl and 1-(1- cyclohexen-l-yl)nonyl.
  • alkylcycloalkyl and alkenylcycloalkyl mean a cycloalkyl radical as defined above which is substituted by an alkyl or alkenyl radical as defined above.
  • alkylcycloalkyl and alkenylcycloalkyl radicals include, but are not limited to, 2- ethylcyclobutyl, 1-methylcyclopentyl, 1-hexylcyclopentyl, 1-methylcyclohexyl, 1-(9- octadecenyl)cyc!opentyl and 1-(9-octadecenyl)cyclohexyl.
  • alkylcycloalkenyl and “alkenylcycloalkenyl” means a cycloalkenyl radical as defined above which is substituted by an alkyl or alkenyl radical as defined above.
  • alkylcycloalkenyl and alkenylcycloalkenyl radicals include, but are not limited to, i-methyl-2-cyclopentyl, i-hexyl-2-cyclopentenyl, 1-ethyl-2-cyc(ohexenyl, 1- butyl-2-cyclohexenyl, 1-(9-octadecenyl)-2-cyclohexenyl and 1-(2-pentenyl)-2-cyclohexenyl.
  • aryl alone or in combination, means a phenyl or naphthyl radical which optionally carries one or more substituents selected from alkyl, cycloalkyl, cycloalkenyl, aryl, heterocycle, alkoxyaryl, alkaryl, alkoxy, halogen, hydroxy, amine, cyano, nitro, alkylthio, phenoxy, ether, trifluoromethyl and the like, such as phenyl, p-tolyl, 4- methoxyphenyl, 4-(tert-butoxy)phenyl, 4-fluorophenyl, 4-chlorophenyl, 4-hydroxyphenyl, 1- naphthyl, 2-naphthyl, and the like.
  • aralkyl alone or in combination, means an alkyl or cycloalkyl radical as defined above in which one hydrogen atom is replaced by an aryl radical as defined above, such as benzyl, 2-phenylethyl, and the like.
  • heterocyclic means ring structures containing at least one heteroatom within the ring.
  • heteroatom refers to atoms that are neither carbon nor hydrogen bound to a carbon.
  • heterocyclics include, but are not limited to, pyrrolidinyl, piperidyl, imidazolidinyl, tetrahydrofuryl, tetrahydrothienyl, furyl, thienyl, pyridyl, quinolyl, isoquinolyl, pyridazinyl, pyrazinyl, indolyl, imidazolyl, oxazolyl, thiazolyl, pyrazolyl, pyridinyl, benzoxadiazolyl, benzothiadiazolyl, triazolyl and tetrazolyl groups.
  • saturated, partially saturated or unsaturated cyclic means fused ring structures in which 2 carbons of the ring are also part of the fifteen-membered macrocyclic ligand.
  • the ring structure can contain 3 to 20 carbon atoms, preferably 5 to 10 carbon atoms, and can also contain one or more other kinds of atoms in addition to carbon. The most common of the other kinds of atoms include nitrogen, oxygen and sulfur.
  • the ring structure can also contain more than one ring.
  • saturated, partially saturated or unsaturated ring structure means a ring structure in which one carbon of the ring is also part of the fifteen-membered macrocyclic ligand.
  • the ring structure can contain 3 to 20, preferably 5 to 10, carbon atoms and can also contain nitrogen, oxygen and/or sulfur atoms.
  • nitrogen containing heterocycle means ring structures in which 2 carbons and a nitrogen of the ring are also part of the fifteen-membered macrocyclic ligand.
  • the ring structure can contain 2 to 20, preferably 4 to 10, carbon atoms, can be substituted or unsubstituted, partially or fully unsaturated or saturated, and can also contain nitrogen, oxygen and/or sulfur atoms in the portion of the ring which is not also part of the fifteen- membered macrocyclic ligand.
  • organic acid anion refers to carboxylic acid anions having from about 1 to about 18 carbon atoms.
  • halide means chloride, fluoride, iodide, or bromide.
  • R groups means ail of the R groups attached to the carbon atoms of the macrocycle, i.e., R, R', R 1 , R ⁇ , R 2 , R' 2> Ra, R's, R 4 , R ! 4, Rs, R' 5 , Re, R'e,
  • the present invention relates to the discovery that superoxide dismutase mimetics and peroxynitrite decompositions are effective in treating CHF and affecting other aspects of the mammalian and avian coronary system.
  • a method for treating CHF comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic or a peroxynitrite decomposition catalyst.
  • Another aspect provides a method for increasing coronary blood flow in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic or a peroxynitrite decomposition catalyst.
  • Yet another aspect provides a method for increasing MVO 2 in CHF, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic or a peroxynitrite decomposition catalyst.
  • the superoxide dismutase mimetics and peroxynitrite decomposition catalysts can include, generally, those superoxide dismutase mimetics disclosed in U.S. Patent Nos. 5,610,293, 5,637,578, 5,874,421, 5,976,498, 6,084,093, 6,180,620, 6,204,259, 6,214,817, 6,395,725, and 6,525,041 in addition to those disclosed herein.
  • the superoxide dismutase mimetic can comprise an organic ligand chelated to a metal ion including Mn(II), Mn(III), Fe(II), Fe (III), Cu(ll)/Zn(lll), or Cu(lll)/Zn (II).
  • the subject can be a mammal and avian. In particular, the mammal can be a human.
  • a method for diagnosing congestive heart failure in a subject comprising obtaining a first coronary blood flow or MVO 2 measurement in the subject, administering a superoxide dismutase mimetic or a peroxynitrite decomposition catalyst to the subject, and obtaining a second coronary blood flow or MVO 2 measurement after administration of the catalyst to the subject, wherein an increase in coronary blood flow or MVO 2 following administration of the superoxide dismutase mimetic is indicative of congestive heart failure.
  • the subject and superoxide dismutase mimetic can be those disclosed and incorporated herein.
  • CHF is associated with depressed myocardial oxygen consumption (MVO 2 ), decreased coronary blood flow (CBF), and coronary endothelial dysfunction.
  • MVO 2 myocardial oxygen consumption
  • CBF coronary blood flow
  • O 2 * superoxide
  • CHF left ventricular
  • MVO 2 left ventricular
  • LVEDP LV end-diastolic pressure
  • SOD mimetic M40401 increased CBF (18+5%, p ⁇ 0.01) and MVO 2 (14+6%, p ⁇ 0.01) in CHF dogs at rest and during exercise, and decreased LVEDP from 24+1.3 mmHg to 21+1.1 mmHg (p ⁇ 0.05>.
  • CHF oxidative stress
  • I mitochondria Dhalla et al., Am J Physiol. 266, H1280-285 (1994); Hill et al., Circulation 96, 2414-2420 (1997)).
  • superoxide (O 2 ) production is increased both in myocardial mitochondria (Ide et al., Circ. Res. 85, 357-363 (1999); lde et al., Circ. Res.
  • O 2 " can function as a messenger intermediate involved in signal transduction (Irani et al., Science 275, 1649-1652 (1997); Lander et al., Nature 381, 380-381 (1996)), but high concentrations of O 2 "can result in cell damage and tissue injury.
  • O 2 " reacts avidly with nitric oxide (NO) to form peroxynitrite (ONOO " ), a strong oxidant and nitrating species known to promote oxidative damage (Borutaite et al., Biochim. Biophys. Acta 1459, 405-412 (2000)). But in low concentrations peroxynitrite may play some regulatory role in mitochondrial physiology (Borutaite et al., Biochim Biophys Acta 1459, 405- 412 (2000); Go et al., Am J Physiol 277, H1647-H1653 (1999)). Since O 2 *' has low membrane permeability, reactions with this molecule occur in the compartment in which it is generated.
  • O 2 * produced in vessels can react locally with endothelium derived NO, thereby decreasing NO bioavailability and contributing to the endothelial dysfunction seen in CHF (Bauersachs et al., Circulation 100, 292-298 (1999); Bauersachs et al., Circulation 104, 982-985 (2001); Bauersachs et al., J. Am. Coll. Cardiol. 39, 351-358 (2002)).
  • O 2 ' " produced in mitochondria can react with NO to form ONOO ' which may have the potential to alter mitochondrial respiration both directly by inactivation of mitochondrial complexes I 1 II and V as well as by removing the inhibitory effect of NO on cytochrome c oxidase (Radi et al., Biol. Chem. 383, 401-409 (2002); Borutaite et al., Biochim. Biophys. Acta 1459, 405-412 (2000)).
  • increased O 2 *" production has the potential to alter both vascular reactivity and mitochondrial function in the failing heart.
  • the SOD mimetic M40401 is a novel synthetic low molecular weight S 1 S- dimethyl substituted biscyclohexylpyridine manganese-based superoxide dismutase (SOD) mimetic that is stable in vivo, possesses high activity (at pH 7.4 > 1x10 9 M “1 s "1 which is comparable to the native Cu/Zn SOD enzyme), and is selective for O 2 " with no activity toward hydrogen peroxide (H 2 O 2 ), ONOO " , NO, or hypochlorite (OCI " ) (Salvemini et al., Science 286, 304-306 (1999); Salvemini et al., Br. J. Pharmacol. 127, 685-692 (1999)).
  • SOD superoxide dismutase
  • M40401 The resting redox state of M40401 is the reduced state, Mn(II); as a consequence, the complex has no reactivity for reducing agents until it is oxidized to Mn(III) by O 2 *" (Salvemini et al., Science 286, 304-306 (1999); Salvemini et al., BrJ Pharmacol 127, 685-692 (1999); Cuzzocrea et al., Br J Pharmacol 132, 19-29 (2001)).
  • M40401 is relatively difficult to oxidize (+0.75 v (SHE)) so that many oxidants including NO and oxygen will not oxidize the complex (Salvemini et al., Science 286, 304-306 (1999); Salvemini et al., Br J Pharmacol 127, 685- 692 (1999)). Since M40401 operates via a facile one-electron oxidation pathway, two- electron non-radical oxidants are also not able to oxidize the Mn(II) complex; e.g., 0ONO 2 " , OCr.
  • the myocardial protein content of copper/zinc-containing SOD (CuZn-SOD), mitochondrial manganese SOD (Mn-SOD) and extracellular SOD (EC-SOD) were also measured to determine whether a decrease of these enzymes might contribute to increased oxidative stress in the failing heart.
  • Coronary blood flow responses to acetylcholine are shown in Figures 3 and 4.
  • lntracoronary infusion of acetylcholine in doses of 3.75 to 75 ⁇ g/min had no effect on heart rate or aortic pressure.
  • coronary flow increased from 60 ⁇ 4.9 ml/min at baseline to 190+8.7 ml/min during the maximum acetylcholine dose (75 ⁇ g/min).
  • M40401 had no effect on either resting coronary flow or the increase in flow produced by acetylcholine.
  • Inhibition of NO production with LNA significantly (p ⁇ 0.01) blunted the increase in coronary flow produced by acetylcholine (Figure 4).
  • CHF was associated with increases in resting heart rate and LVEDP, and decreases of aortic pressure, LV systolic pressure (LVSP), LV dp/dt max , CBF and MVO 2 (each p ⁇ 0.05) (Table 2).
  • LVSP LV systolic pressure
  • LV dp/dt max CBF and MVO 2
  • CBF CBF
  • MVO 2 each p ⁇ 0.05
  • M40401 caused a small but significant decrease of LVEDP at rest and during exercise (p ⁇ 0.05), while aortic pressure, LV systolic pressure, LV dP/dt max and rate- pressure product were unchanged. M40401 caused increases (p ⁇ 0.05) in coronary blood flow and MVO2 at rest and during exercise in CHF dogs ( Figures 1 and 2), while the relationship between MVO2 and CBF was unchanged.
  • M40401 significantly augmented the increase of coronary flow produced by acetylcholine (Figure 4), indicating enhanced endothelium-dependent vasodilation.
  • LNA inhibited the increase in coronary flow produced by acetylcholine (p ⁇ 0.01).
  • the compounds of the present methods can comprise a non-proteinaceous catalyst for the dismutation of superoxide anions (an "SOD mimic” or “SODm”) as opposed to a native form of the SOD enzyme and a peroxynitrite decomposition catalyst.
  • the catalysts explicitly exclude a SOD enzyme obtained from any natural sources.
  • SOD mimics can be useful in the method of the present invention as compared to native SOD because of the limitations associated with native SOD therapies. See, e.g., Salvemini et al., Science 286, 304-306 (1999).
  • the best known native SOD, CuZn has a molecular weight of 33,000 kD.
  • SOD mimics have an approximate molecular weight of 400 to 600 Daltons.
  • the catalyst of the methods above can be a pentaaza- macrocyclic ligand complex or a substituted pentaaza-macrocyclic ligand complex.
  • the pentaaza-macrocyclic ligand complex can be represented by the following formula:
  • R 1 , R'-,, R 2 , R' 2 , R 3 , R's, R 4 , R r 4, R 5 , R's, Re, R'e, R 7 , RV, Re, R's, R9, R'g, R10, and R' 1O can independently be:
  • (i b ) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or [0202] (i c ) a moiety independently including -ORn, -NR 11 R 12 , -CORi 1 , -CO 2 Ri 1 , -CONR 11 R 12 , -SRi 1 , -SOR 11 , -SO 2 R 11 , -SO 2 NR 11 R 12 , -N(ORn)(R 12 ), -P(O)(OR 11 )(OR 12 ), -P(O)(
  • R 1 or R'i and R 2 or R 2 , R 3 or R' 3 and R 4 or R f 4 , R 5 or R' 5 and R 6 or R' 6 , R 7 or R' 7 and R 8 or R' 8l R 9 or R' 9 and R 10 or R' 1O together with the carbon atoms to which they can be attached independently can form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
  • R 1 and R ⁇ , R 2 and R 2 , R 3 and R' 3 , R 4 and R' 4 , R 5 and R' 5 , R 6 and R 6 , R 7 and R' 7 , R 8 and R 8 , R 9 and R 9 , and R 10 and R' 1O together with the carbon atom to which they can be attached independently can form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
  • R 10 or R' 1O and R 1 or R'i, R 2 or R 2 and R 3 or R 3 , R 4 or R' 4 and R 5 or R 5 , R 6 or R' 6 and R 7 or R 7 , or R 8 or R' 8 and R 9 or R' 9 together with the carbon atoms to which they can be attached independently can form a substituted or unsubstituted nitrogen containing heterocycie having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
  • I, J, K and L independently can be integers from 0 to 10 and Q, R and T can optionally include substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza
  • M can be a transition metal
  • X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl aryl
  • X, Y and Z can independently include charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
  • X, Y and Z can independently be attached to one or more of R 1 , R ⁇ , R 2 , R' 2 , R3. R'3. R4. R'4. R5. R'51 Re. R r 6> R71 RV. Rs, R' ⁇ . R9> R'9, R10, or R'10; and
  • n can be an integer from 0 to 3.
  • the pentaaza-macrocyclic ligand complex can be represented by the following formula:
  • a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen can be attached can independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W having 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
  • R 1 , R 2 , R' 2 , R 3 , R's, R 4 , R r 4, R 5 , R' ⁇ , R 6 , R' ⁇ , R7, R'/, Rs, R' 8 , R 9 , Rg, and R 10 can independently be:
  • (ii b ) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or
  • (ii c ) a moiety independently selected from the group consisting of -ORi 1 , -NR 11 R 12 , -COR 11 , -CO 2 R 11 , -CONR 11 R 12 , -SR 11 , -SOR 11 , -SO 2 R 11 , -SO 2 NR 11 R 12 , -N(OR 11 )(R 12 ), -P(O)(OR 11 )(OR 12 ), -P(O)(OR 11 )(R 12 ), -OP(O)(OR 11 )(OR 12 ), or substituents attached to the ⁇ -carbon of ⁇ -amino acids, wherein Rn and R 12 can independently include hydrogen or alkyl; and
  • R 1 and R 2 or R 2 , R 3 or R' 3 and R 4 or R' 4 , R 5 or R' 5 and R 6 or R 6 , R 7 or R' 7 and R 8 or R' 8 , Rg or R' 9 and R 10 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
  • R 2 and R 2 , R 3 and R 3 , R 4 and R' 4l R 5 and R 5 , R 6 and R 6 , R 7 and R 7 , Rs and R 8 , and R 9 and R 9 together with the carbon atom to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms;
  • R 2 or R' 2 and R 3 or R' 3l R 4 or R' 4 and R 5 or R' 5 , Re or R' 6 and R 7 or R 7 , or R 8 or R' 8 and R 9 or R' 9 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
  • I, J, K and L independently can be integers from 0 to 10 and Q, R and T can optionally be substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza
  • R 1 , R 2 , R 2 , R 3 , R 3 , R 4 , R 4 , R 5 , R 5 , R 6 , R'e, R 7 , R' 7 , Rs, R's, Rg, R'9, and RTM may be bound to an atom of heterocycle W to form a strap represented by the formula:
  • I, J, K and L can independently be integers from 0 to 10 and Q, R and T can optionally be substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza
  • M can be a transition metal
  • X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl aryl
  • X, Y and Z can independently be charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
  • X, Y and Z can independently be attached to one or more of R 1 , R 2 , R' 2 , R 3 , R'3, R4, R'4, R5, R'5, Re. R'6 > R7. RV. R ⁇ > R' ⁇ . R ⁇ > R'91 and R-io! and
  • n can be an integer from 0 to 3.
  • the pentaaza-macrocyclic ligand complex can be represented by the following formula:
  • a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen can be attached can independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W which can have 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
  • two sets of two adjacent carbon atoms of the macrocycle can independently form substituted or unsubstituted, saturated, partially saturated or unsaturated, cycles or heterocycles U and V having 3 to 20 carbon atoms;
  • R 1 , R 2 , R 2, R 3 , R4, R 5 , R's, R 6 , R' ⁇ , R?, Rs, Rg, Rg, and R 10 can independently be:
  • (iii b ) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or
  • (iii c ) a moiety independently including -OR 11 , -NR 11 Ri 2 , -CORi 1 , -CO 2 R 1I , -CONR 11 R 12 , -SR 11 , -SORn, -SO 2 Rn, -SO 2 NRnR 12 , -N(OR 11 )(R 12 ), -P(O)(OR 11 )(OR 12 ), -P(O)(ORi 1 )(R 12 ), -OP(O)(OR 11 )(ORi 2 ), or substituents attached to the ⁇ -carbon of ⁇ -amino acids, wherein Rn and R 12 can independently include hydrogen or alkyl; and
  • R 1 and R 2 or R 2 , R 5 or R' 5 and R 6 or R' 6 , R 9 or R'g and Ri 0 together with the carbon atoms to which they attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms;
  • R 6 and R 6 , and R 9 and R'g, together with the carbon atom to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms;
  • R 2 or R' 2 and R 3 , R 4 and R 5 or R' 5 , R 6 or R' 6 and R 7 , or R 8 and R 9 or R' 9 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
  • I 1 J 1 K and L independently can be integers from 0 to 10 and Q 1 R and T can be optionally substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza
  • R 1 , R 2 , R 2 , R 3 , R 4 , R 5 , R 5 , Re, R'e, R 7 , Rs, R 9 , R'g, and R 1O can be individually bound to an atom of heterocycles U, V and W to form a strap represented by the formula:
  • I 1 J 1 K and L independently can be integers from 0 to 10 and Q 1 R and T can be optionally substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza
  • M can be a transition metal
  • X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl aryl
  • X, Y and Z can independently include charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
  • X, Y and Z can independently be attached to one or more of Ri, R 2 , R 2 , R 3 , R4, R5, R'5, Re, R' ⁇ i R71 Re. R91 R' ⁇ i and R10! and
  • n can be an integer from 0 to 3.
  • the pentaaza-macrocyclic ligand complex can be represented by the following formulas:
  • W of the pentaaza-macrocyclic ligand complex can be a substituted pyridino moiety.
  • the superoxide dismutase mimetic can be a porphyrin ligand complex or a substituted porphyrin ligand complex.
  • the porphyrin ligand complex can be selected from the group consisting of a manganese (II) porphyrin complex, manganese(lll) porphyrin complex, iron (II) porphyrin complex, and an iron(lll) porphyrin complex.
  • the porphyrin ligand complex can be a 5,10,15, 20-tetrakis (2,4,6- trimethyl-3,5-disulfonatophenyl)-porphyrinato iron (III) (FeTMPS) complex.
  • the peroxynitrite decomposition catalyst can be represented by a formula selected from the group of formulas consisting of: [0268] Structure
  • R 3 , R 6 , Rg or R 12 can independently include H, alkyl, alkenyl, CH 2 , COOH, phenyl, pyridinyl, or N-alkylpyridyl such that phenyl, pyridinyl and N-alkylpyridyl can be:
  • phenyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH 2 , SO 3 H, NO 2 , NH 2 , N(R) 3+ or NHCOR' wherein R can include hydrogen, alkyl, aryl and alkaryl and R 1 can be alkyl, and
  • pyridinyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH 2 , SO 3 H, NO 2 , NH 2 , N(R) 3+ or NHCOR' wherein R and R' can be as defined above, and
  • N-alkylpyridyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH 2 , SO 3 H, NO 2 , NH 2 , N(R) 3+ or NHCOR' wherein R and R' can be as defined above; and
  • Ri, R 2 , R4, R 5 , R 7 , Rs, Rio > or R 11 can independently include H, alkyl, alkenyl, carboxyalkyl, Cl, Br, F, NO 2 , hydroxyalkyl, or SO 3 H, and further wherein R 1 R 2 can be taken together to form a ring of from 5 to 8 carbons, and
  • X and Y can be ligands or charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand or ligand system or the corresponding anion thereof and can be independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl, amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl n
  • M can be selected from the group consisting of Mn, Fe, Ni and V;
  • n can be an integer from 1 to 3;
  • R' can be CH or N
  • Ri5i and R-i ⁇ can independently include H 1 SO 3 H, COOH, NO 2 , NH 2 , and N-alkylamino; and
  • X, Y, Z, M and n can be as defined above; [0282] Structure III
  • R 1 , R 5 , R 9 , and R 13 can independently include a direct bond and
  • R16. and R 16 1 can independently include H and alkyl;
  • R 3 , R 7 , R-n, Ri 5 can independently include H and alkyl; and [0286] X, Y, Z, M and n can be as defined above;
  • R 1 , R 5 , R 8 , and Ri 2 can independently include a direct bond and
  • R 2 , R 2 1 , R 4 , R 4 ', Re, R 6 ', R 7 , R 9 , R 9 ', Rn, Rn', R13, Ru 1 , and R 14 can independently include H and alkyl;
  • R 3 and R 10 can independently include H and alkyl; and [0290] X, Y, Z, M and n can be as defined above;
  • R 1 , R 4 , R 8 , R 12 can independently include direct bond and CH 2 ;
  • R13 1 and R 14 can independently include H and alkyl;
  • R-io can be H or alkyl
  • X, Y, Z, M and n can be as defined above;
  • R 1 , R 4 , R 7 and R 10 can independently include direct bond and CH 2 ;
  • R 2 , R 2 ', R 3 , R 5 , Rs , Re, Rs, Rs', Rg, Rii, Rn' and Ri 2 can independently include H and alkyl;
  • X, Y, Z, M and n can be as defined above;
  • Ri, R 4 , Rs and R 11 can independently include a direct bond and
  • R 2 , R 3 , R 3 1 , R 5 , Rs 1 , R?. R?', Rg, Rio, R-io', R12, R12' and R 13 can independently include H and alkyl;
  • R 6 can be hydrogen or alkyl
  • X, Y, Z, M and n can be as defined above;
  • R 1 , R 4 , R 7 and R 10 can independently include H and alkyl; [0303] R 2 , R 3 , Ra', Rs, R 5 ', Re, Re, Rg, FV. RH , RH 1 and R 12 can independently include H and alkyl; and
  • X, Y, Z, M and n can be as defined above;
  • R 1 , R 3 , R 4 and R 6 can independently include H and alkyl;
  • R 2 and R 5 can independently include H, alkyl, SO 3 H, NO 2 , NH 2 , halogen, COOH and N(R) 3+ wherein R can be as defined above; and
  • X, Y, Z, M and n can be as defined above;
  • R 1 , R 2 , R 3 , R 4 can independently include H, alkyl, SO 3 H, NO 2 , NH 2 , halogen, COOH and N(R) 3+ wherein R can be as defined above; and [0309] X, Y, Z, M and n can be as defined above; and [0310] Structure IV
  • R 1 , R 1 ", R 2 , R 2 ', R 3 , R 3 ', R 4 , R4', Rs, R5', Re, Re 1 , R7 and R 7 ' can independently include H, alkyl, alkoxy, NO 2 , aryl, halogen, NH 2 and SO 3 H, wherein R 6 , Re', R 7 and R 7 ' may each be taken together with one other of R 6 , R 6 ', R 7 and R 7 ' to form a cyclic group, preferably a 6 carbon cycloalkyl group;
  • M 1 can be selected from the group consisting of Fe, Ni or V;
  • X, Y, Z and n can be as defined above.
  • Contemplated equivalents of the general formulas set forth above for the compounds and derivatives as well as the intermediates are compounds otherwise corresponding thereto and having the same general properties such as tautomers of the compounds and such as wherein one or more of the various R groups are simple variations of the substituents as defined therein, e.g., wherein R is a higher alkyl group than that indicated, or where the tosyl groups are other nitrogen or oxygen protecting groups or wherein the O-tosyl is a halide.
  • Anions having a charge other than 1 e.g., carbonate, phosphate, and hydrogen phosphate, can be used instead of anions having a charge of 1 , so long as they do not adversely affect the overall activity of the complex.
  • a substituent is designated as, or can be, a hydrogen
  • the exact chemical nature of a substituent which is other than hydrogen at that position e.g., a hydrocarbyl radical or a halogen, hydroxy, amino and the like functional group, is not critical so long as it does not adversely affect the overall activity and/or synthesis procedure.
  • manganese(lll) complexes will be equivalent to the subject manganese(ll) complexes.
  • the compounds of the invention can be formulated as pharmaceutical or veterinary compositions. Depending on the subject to be treated, the mode of administration, and the type of treatment desired (e.g., inhibition, prevention, prophylaxis, therapy), the compounds can be formulated in ways consonant with these parameters.
  • the compounds of the present invention can comprise a therapeutically or prophylactically effective dosage of a catalyst.
  • the catalyst can be used in combination with a pharmaceutically acceptable carrier, either in the same formulation or in separate formulations.
  • the catalysts of the present invention can be incorporated in conventional pharmaceutical formulations (e.g., injectable solutions) for use in treating humans or animals in need thereof.
  • Pharmaceutical compositions can be administered by subcutaneous, intravenous, or intramuscular injection, or as large volume parenteral solutions and the like.
  • parenteral as used herein includes subcutaneous injections, intravenous, intramuscular, intrastemal injection, or infusion techniques.
  • a parenteral therapeutic composition may comprise a sterile isotonic saline solution containing between 0.1 percent and 90 percent weight to volume of the catalysts for the dismutation of superoxide.
  • a preferred solution contains from about 5 percent to about 25 weight percent catalysts for dismutation of superoxide in solution (% weight per volume).
  • the dosage of catalyst to be used may vary. A primary consideration for the dosage level of the catalysts is the monitoring of the known side effects in an individual.
  • Injectable preparations for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1 ,3-butanediol.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • the preparations may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the catalyst for the dismutation of superoxide.
  • the pack may for example comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the amount of catalyst that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. It will be appreciated that the unit content of active ingredients contained in an individual dose of each dosage form need not in itself constitute an effective amount, as the necessary effective amount could be reached by administration of a number of individual doses. The selection of dosage depends upon the dosage form utilized, the condition being treated, and the particular purpose to be achieved according to the determination of those skilled in the art.
  • the dosage regimen for treating a disease condition with the compounds and/or compositions of this invention is selected in accordance with a variety of factors, including the type, age, weight, sex, diet and medical condition of the patient, the route of administration, pharmacological considerations such as the activity, efficacy, pharmacokinetic and toxicology profiles of the particular compound employed, whether a drug delivery system is utilized and whether the compound is administered as part of a drug combination.
  • the dosage regimen actually employed may vary widely and therefore may deviate from the preferred dosage regimen set forth above.
  • the treatment comprises administering to a mammal in need of such treatment an amount of 10 mg/kg or less of a non-proteinaceous catalyst for the dismutation of superoxide anions, or a pharmaceutically acceptable salt, hydrate, solvate, or pro-drug thereof.
  • the amount of a non-proteinaceous catalyst for the dismutation of superoxide anions, or a pharmaceutically acceptable salt, hydrate, solvate, or pro-drug thereof can be between about 0.1 ⁇ g and about 10.0 mg; between about 1.0 ⁇ g and about 1.0 mg; between about 5.0 ⁇ g and about 15.0 ⁇ g; or between about 100.0 ⁇ g and about 300.0 ⁇ g.
  • compositions of the present invention are preferably administered to a human.
  • these extracts are also useful for veterinary treatment of companion animals, exotic animals and farm animals, including mammals, rodents, avians, and the like.
  • alterations in substrate preference in the failing heart with decreased free fatty acid uptake and increased glucose utilization, could contribute to decreased oxygen utilization (Davila- Roman et al., J. Am. Coll. Cardiol.40, 271-277 (2002».
  • NO can modulate mitochondrial respiration and ATP production through reversible binding to the oxygen-binding site of cytochrome oxidase (Borutaite et al., Biochim Biophys Acta 1459, 405-412 (2000)).
  • Blockade of NO production with nonselective NOS inhibitors increased MVO 2 in normal animals at rest and during treadmill exercise (Bernstein et al., Circ. Res. 79, 840-848 (1996); Altman et al., Cardiovasc. Res. 28, 119-124 (1994); Chen et al., Circulation 106, 273-279 (2002)).
  • stimulating endogenous endothelial NO production with bradykinin or administering an NO donor decreased oxygen consumption in isolated crystalloid perfused rat hearts (Poderoso et al., Am J Physiol 274, C112-119 (1998)) and in myocardial tissue slices from normal and failing hearts (Xie et al., Circ Res 79, 381-387 (1996); Xie et al., Circulation 94, 2580-2586 (1996)).
  • Heart failure of several etiologies is associated with increased myocardial free radical formation and increased products of oxygen free radical reactions (such as lipid peroxides) (Ide et al., Circ Res 85, 357-363 (1999); lde et al., Circ Res 8, 152-157 (2000); Dhalla 1996; Hill et al., Circulation 96, 2414-2420 (1997)).
  • oxygen free radical reactions such as lipid peroxides
  • pyrogallol which generates O 2 " through autoxidation, caused respiratory inhibition that was only partially reversible after washout of the pyrogallol (Xie et al., Circ Res 79, 381-387 (1996); Xie et al., Circulation 94, 2580-2586 (1996)).
  • the effect of pyrogallol was inhibited by the O 2 " scavenger tiron, but not the ONOO ' scavenger urate, indicating that O 2 " can directly inhibit respiration without conversion to ONOO ' .
  • Endothelial Dysfunction and Vascular O 2 " in CHF [0336] Endothelial Dysfunction and Vascular O 2 " in CHF [0337] Endothelium-derived NO is an important contributor to acetylcholine- induced vasodilation (Altman et al., Cardiovasc Res 28, 119-124 (1994)>and therefore decreased NO bioavailability could be responsible, at least in part, for the impaired acetylcholine response in heart failure. A decrease of NO bioavailability could result either from decreased production or increased inactivation of NO.
  • Three SOD isozymes have identified in the heart, including CuZn-SOD, which is primarily cytosolic in location, mitochondrial Mn-SOD, and extracellular EC-SOD (Oury, Lab Invest 75, 617-636 (1996); Fukai et al., Cardiovasc Res 55, 239-249 (2002)). Up to one half of the total SOD in vessels is EC-SOD, and EC-SOD has been implicated as a principal regulator of endothelium-derived NO bioavailability (Oury, Lab Invest 75, 617-636 (1996); Fukai et al., J. Clin. Invest.
  • Example 1 Effect Of Superoxide Dismutase Mimetics In The Normal Heart
  • Example 1 was performed in adult mongrel dogs weighing 20-26 kg trained to run on a treadmill. All experiments were performed in accordance with the Guiding Principles in the Care and Use of Laboratory Animals as approved by the council of the American Physiological Society and with prior approval of the University of Minnesota Animal Care Committee.
  • a final catheter was introduced into the right atrial appendage and advanced through the coronary sinus until the tip could be palpated at the origin of the anterior interventricular vein to allow selective sampling of blood draining the myocardium perfused by the left anterior descending coronary artery (LAD).
  • LAD left anterior descending coronary artery
  • a Doppler velocity probe (Craig Hartley, Houston, TX) was positioned on the LAD for measurement of coronary blood flow (CBF) and a silicone catheter (0.3 mm ID) was introduced into the LAD distal to the velocity probe. Catheters were tunneled to exit at the base of the neck; catheters were flushed daily to maintain patency.
  • Postoperative analgesia was provided with butorphanol, 0.4 ⁇ g/kg S.Q. q 4-6 h.
  • CHF was produced by rapid ventricular pacing (Traverse et al., Circ Res 84, 401-408 (1999)). After completion of studies during normal conditions, the pacemaker was activated at 220 beats/min; pacing was continued at this rate or adjusted upward to a maximum of 250 beats/min based on weekly assessments of hemodynamics obtained 30 minutes after deactivating the pacemaker. CHF was deemed to have developed when resting LVEDP was >20 mmHg or visual estimation of ejection fraction by 2-dimensional echocardiography was ⁇ 30%.
  • LV pressure was measured with the micromanometer; the first derivative of LV pressure (dP/dt) was obtained via electrical differentiation. Coronary blood velocity was measured with a Doppler flowmeter (Craig Hartley, Houston, TX). Data were recorded on an eight-channel recorder.
  • Tissue homogenates of left ventricular myocardium were separated on 12% SDS-PAGE, transferred onto nitrocellulose membrane, followed by routine Western blotting.
  • Antibodies against CuZn-SOD and Mn-SOD were purchased from BD Transduction Laboratories and Santa Cruz Biotech, respectively. The anti-extracellular SOD antibody was produced in our laboratory and has been previously reported (Fukai et al., J Clin Invest 101 , 2101-2111 (1998)). °
  • RNA was reverse-transcribed using random hexamers and Moloney murine leukemia virus (MMLV) reverse transcriptase (Life Technologies).
  • Oligonucleotide primers were designed according the corresponding canine cDNA sequences in the NIH gene bank.
  • the primer sequences of CuZn-SOD were: Sense, 5'- AGTGGGCCTGTTGTGGTATC (SEQ ID NO: 1); and antisense, 5'- AGTCACATTGCCCAGGTCTC (PCR-product of 189 bp) (SEQ ID NO: 2).
  • the primer sequences of GAPDH were: sense, 5'-TGCCCCCATGTTTGTGATG (SEQ ID NO: 3), and antisense, 5'-CCAGCCCCAGCGTCAAAGGTG (product of 519 bp) (SEQ ID NO: 4).
  • mRNA levels were compared by quantitative real-time RT-PCR analysis, using the Light Cycler Thermocycler (Roche Diagnostics Corp). Reactions were prepared in the presence of the fluorescent dye SYBR green I for specific detection of double-stranded DNA. Quantification was performed in the log-linear phase of the reaction and cycle numbers obtained at this point were plotted against a standard curve prepared from serially diluted control samples. Results were normalized to GAPDH expression levels.
  • the SOD mimetic M40401 was studied in seven normal dogs 10-14 days after surgery. Resting hemodynamics were recorded and 2 ml of blood was withdrawn from the aortic and coronary venous catheters for blood gas analysis. Subsequently, a 3-stage treadmill exercise protocol was begun (Stage 1: 3.2 km/hr at 0% grade; stage 2: 6.4 km/hr at 0% grade; stage 3: 6.4 km/hr at 5%). Each exercise stage was three minutes in duration; aortic and coronary venous blood samples were withdrawn during the last 30 seconds of each exercise stage. After a 10 minute rest period, M40401 , 1.5 mg/kg i.v. was infused over 10 minutes. Forty minutes after M40401 all measurements were repeated at rest and during exercise.
  • the SODm M40401 caused increases (p ⁇ 0.05) in coronary blood flow and MVO 2 at rest and during exercise in CHF dogs ( Figures 1 and 2), while the relationship between MVO 2 and CBF was unchanged. M40401 did not increase LV dP/dt ma)( in the failing hearts, possibly because any O 2 *" and peroxynitrite-induced protein modifications of the contractile apparatus would require a longer time period to recover. In the present study, the SOD mimetic M40401 caused significant increases of MVO 2 and coronary blood flow at rest and during exercise in animals with CHF suggesting that O 2 " contributed to the depressed MVO 2 in the failing hearts.
  • Example 3 Effects of SODm and Acetycholine (Ach) in Heart Failure
  • the methods for preparing the animals and collecting and analyzing data were the same as for the previous examples, except where specific differences are described.
  • M40401 caused no change of heart rate or mean aortic pressure.
  • M40401 significantly augmented the increase of coronary flow produced by acetylcholine ( Figure 4), indicating enhanced endothelium-dependent vasodilation.
  • Example 4 Effects of SODm and ACh in The Normal Heart
  • the methods for preparing the animals and collecting and analyzing data were the same as for the previous examples, except where specific differences are described.
  • the effects of M40401 on the vasodilator response to acetylcholine were examined in five normal dogs.
  • the increases in CBF produced by intracoronary acetylcholine (3.75 to 75 ⁇ g/min) were observed under control conditions, after M40401 (1.5 mg/kg intracoronary).
  • the SOD mimetic M40401 had no effect on either resting coronary flow or the increase in flow produced by acetylcholine.
  • Example 5 Effect of ACh Alone in The Normal Heart
  • Coronary blood flow responses to acetylcholine are shown in Figures 3 and 4.
  • lntracoronary infusion of acetylcholine in doses of 3.75 to 75 ⁇ g/min had no effect on heart rate or aortic pressure.
  • coronary flow increased from 60+4.9 ml/min at baseline to 190+8.7 ml/min during the maximum acetylcholine dose (75 ⁇ g/min). In the present example there was an increase of coronary flow in response to acetylcholine.
  • Example 9 Effect of SODms and LNA on Endothelium Dependent Coronary Vasodilation in Normal Dogs
  • Example 10 Effect of SODms and LNA on Endothelium-Dependent Coronary Vasodilation in CHF Dogs
  • M40401 caused no change of heart rate or mean aortic pressure. However, M40401 significantly augmented the increase of coronary flow produced by acetylcholine (Figure 4), indicating enhanced endothelium-dependent vasodilation. As expected, LNA inhibited the increase in coronary flow produced by acetylcholine (p ⁇ 0.01).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

What is provided is a method for treating congestive heart failure by administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic or a peroxynitrite decomposition catalyst.

Description

METHODS FOR TREATING CONGESTIVE HEART FAILURE
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority from U.S. Provisional Application Serial No. 60/613,039 filed on September 24, 2004, which is incorporated herein by reference in its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT [0002] This invention was made in part with Government support under U.S. Public Health Service Grants HL20598, HL70187, HL071790 and HL21872 from the National Heart, Lung and Blood Institute. The Government has certain rights in the invention.
FIELD
[0003] The invention provides methods for treating heart failure by administering to a subject a therapeutically effective amount of a composition comprising a catalyst for the dismutation of superoxide anions and a peroxynitrite decomposition catalyst.
INTRODUCTION
[0004] Heart failure means that the heart is not working efficiently enough to keep up with its workload, either during exercise or at rest. The term "failure" indicates that the pumping action of the heart is inadequate to meet the body's needs for oxygen-rich blood. As a result, blood flow to body tissues is reduced and blood returning to the heart accumulates, causing congestion in the veins. The term Congestive Heart Failure ("CHF") is often synonymous with heart failure but also refers to the build up of body fluid in the lungs and elsewhere in the body that results from the inability of the heart to pump efficiently enough to meet the body's needs. Heart failure usually develops slowly, often overyears as the heart gradually loses its pumping ability. Between 2 to 3 million Americans have heart failure and 400,000 new cases are diagnosed each year. Heart failure causes approximately 39,000 deaths a year and is a contributing factor in another 225,000 deaths.
[0005] Many symptoms of heart failure result from the congestion that develops as fluids backs up into the lungs and leaks into the tissues. The most severe manifestation of CHF, pulmonary edema, develops when this imbalance causes an increase in lung fluid secondary to leakage from pulmonary capillaries into the interstitium and alveoli of the lung. CHF can be categorized several different ways. One classification is forward or backward ventricular failure. Backward failure is secondary to elevated systemic venous pressure, while left ventricular failure is secondary to reduced forward flow into the aorta and systemic circulation.
[0006] Another classification for heart failure can be subdivided into systolic and diastolic dysfunction. Systolic dysfunction is characterized by a dilated left ventricle with an inability to contract normally and expel sufficient blood, while diastolic dysfunction occurs in a normal or intact left ventricle with impaired ability to relax and fill normally. In all cases, the weaker pumping action of the heart means that less blood is sent to the kidneys, which results in fluid build-up by retaining water and salt in the kidneys.
[0007] Other classifications for heart failure include high output versus low output failure; acute versus chronic heart failure and right-sided versus left-sided heart failure. While the different classifications may be useful early in the course of the disease, the differences between the classifications and the associated symptoms in the later stages of heart failure and in chronic heart failure often become indistinguishable.
[0008] Managing CHF generally includes correction of any reversible causes including restrictions of dietary sodium. Diuretics may be prescribed to facilitate the removal of excess water and sodium. Digitalis has been used since the 18th century to strengthen the heart's pumping action and is still a component of modern therapy. Newer drugs for the treatment of heart failure include vasodilators including angiotensin-converting enzyme (ACE). Other drugs used in the treatment of heart failure include calcium-channel blockers, which dilate vessels; beta blockers, which slow the heart; and medications with affect heartbeat irregularities. Surgery is indicated under some circumstances including valve repair or artificial valve replacement. Heart transplants are last resort in treatment and are otherwise generally impractical because of cost and the shortage of organs. Other available options include portable pumps to continuously infuse medications, implanted devices for controlling arrhythmias, or ventricular dynamic cardiomyoplasty.
[0009] Common side effects of drug treatments include fatigue, depression, irritability, urinary incontinence, and allergic reactions. More severe side effects can be low blood pressure, an extreme reduction in white blood cells, impaired kidney functions, and/or anemia. Heart transplantation and other surgical options have risks involved with many of medical devices, including bleeding, blood clots, infection, or heart failure.
[0010] Current treatment strategies focus on the treatment of the resulting symptoms of the heart failure, not on the prevention of oxidative stress in the cells associated with depressed myocardial oxygen consumption (MVO2) and decreased coronary blood flow (CBF) of heart failure. What are still needed are alternative treatments for heart failure. In addition, more effective, less invasive and less costly treatments are needed for heart failure. SUMMARY
[0011] In one aspect, a method is provided for treating congestive heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic. Another aspect provides a method for increasing coronary blood flow in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic. Yet another aspect provides a method for increasing MVO2 in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic.
[0012] In a further aspect, the superoxide dismutase mimetic can comprise an organic ligand chelated to a metal ion including Mn(II), Mn(III), Fe(II), Fe (III), Cu(H)ZZn(ItI), or Cu(lll)/Zn (II). The subject can be a mammal and avian. In particular, the mammal can be a human.
[0013] In a further aspect, the catalyst of the methods above can be a pentaaza- macrocyclic ligand complex or a substituted pentaaza-macrocyclic ligand complex. The pentaaza-macrocyclic ligand complex can be represented by the following formula:
Figure imgf000005_0001
[0014] wherein
[0015] (i) one or more of R1, R'-,, R2, R'2, R3, R 3, Rt, RU, RS, R'B, Re, R'β. R?, R'?, Re, R'β. RΘ, R'9, R-io, and R'10 can independently be:
[0016] (ia) hydrogen; or
[0017] (ib) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or
[0018] (iG) a moiety independently including -OR11, -NRi1R12, -COR11, -CO2Rn, -CONR11R12, -SR11, -SOR11, -SO2R11, -SO2NR11R12, -N(OR11)(R12), -P(O)(OR11)(OR12), -P(O)(OR11)(Ri2), -OP(O)(ORii)(OR12), or substituents attached to the σ-carbon of α-amino acids, wherein Rn and R12 can independently include hydrogen or alkyl; and
[0019] (H) optionally, one or more of R1 or R'i and R2 or R2, R3 or R3 and R4 or R'4> R5 or R'5 and R6 or R'6, R7 or R7 and R8 or R'8, R9 or R'9 and R10 or R'1O together with the carbon atoms to which they can be attached independently can form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0020] (iii) optionally, one or more of R1 and R^ , R2 and R'2, R3 and R'3, R4 and R4, R5 and R'5, R6 and R6, R7 and R'7, Rs and R'8> R9 and R9, and R10 and R'1O, together with the carbon atom to which they can be attached independently can form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0021] (iv) optionally, one or more of R10 or R'1O and R1 or R'-i, R2 or R2 and R3 or R'3, R4 or R'4 and R5 or R5, R6 or R 6 and R7 or R7, or R8 or R'8 and R9 or R9 together with the carbon atoms to which they can be attached independently can form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
[0022] (v) optionally, one or more of R1, R'i, R2, R'2, R3, R3, R4, R'4, R5, R5, R6, R 6, R7, R 7, R8, R'β, R9, Rg, R10, and R'1O, together with a different one of R1, R^, R2, R2, R3, R'3, R4, R4, R5, R's, Re, R'e, R?, RV, Rs, R'β, R9, Rg, R10, and R'1O, which can be attached to a different carbon atom in the macrocyclic ligand can be bound to form a strap represented by the formula: '
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2)L -
[0023] wherein
[0024] I1 J1 K and L independently can be integers from 0 to 10 and Q, R and T can optionally include substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylaikyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, or combinations thereof; and
[0025] (vi) combinations of any of (i) through (v) above; and
[0026] wherein
[0027] M can be a transition metal;
[0028] X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphate, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alky) dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, and anions of ion exchange resins, or the corresponding anions thereof; or
[0029] X, Y and Z can independently include charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
[0030] X, Y and Z can independently be attached to one or more of R1, R'i, R2, R'2, R3. R'3> R4. R'4. R5, R'5> Re. R'δi R7. RV. Re. R'βi R9. R'9. R-io> or R'-iol and
[0031] n can be an integer from 0 to 3.
[0032] In yet another aspect, the pentaaza-macrocyclic ligand complex can be represented by the following formula:
Figure imgf000008_0001
[0033] wherein
[0034] (i) a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen can be attached can independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W having 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
[0035] (ii) one or more of R1, R2, R 2, R3, R 3, R4, R 4, R5, R 5, Re, Re, R?, RV, Ra, R 8, R9, R'9, and R10 can independently be:
[0036] (iia) hydrogen; or
[0037] (iib) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, . cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or
[0038] (iic) a moiety independently selected from the group consisting of -ORn, -NR11R12, -COR11, -CO2Ri1, -CONR1IRi2, -SR11, -SOR11, -SO2R11, -SO2NR11R12, -N(OR11)(R12), -P(O)(OR11)(OR12), -P(O)(OR11)(R12), -OP(O)(OR11)(OR12), or substituents attached to the σ-carbon of σ-amino acids, wherein R11 and Ri2 can independently include hydrogen or alkyl; and
[0039] (iii) optionally, one or more of R1 and R2 or R2, R3 or R'3 and R4 or R4, R5 or R'5 and R6 or R'6, R7 or R'7 and R8 or R'8, R9 or R'9 and R10 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0040] (iv) optionally, one or more of R2 and R2, R3 and R'3l R4 and R4, R5 and R'5l R6 and R6, R7 and R7, R8 and R'8, and R9 and R9, together with the carbon atom to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0041] (v) optionally, one or more of R2 or R'2 and R3 or R'3, R4 or R4 and R5 or R'5> R6 or R'6 and R7 or R'7, or R8 or R'8 and R9 or R'9 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
[0042] (vi) optionally, one or more of R1, R2, R'2, Ra, R'3, R4, R4, Rs, R'5, Re, R'e, R7, R7, R8, Rs, R9, Rg, and R10, together with a different one of R1, R2, R2, R3, R'3, R4, R4, R5, R'5, R6, R'e, R7, R'7, Rε, R'β, Rg, R'g, and Ri0, which can be attached to a different carbon atom in the macrocyclic ligand may be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)κ -T -(CH2)L -
[0043] wherein
[0044] I1 J1 K and L independently can be integers from 0 to 10 and Q, R and T can optionally be substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, or combinations thereof; and
[0045] (vii) optionally, one or more of R1, R2, R2, R3, R3, R4, R4, R5, R'5) R6, Re, R7, R7, R8, R'β, Rg, R'9, and R10, may be bound to an atom of heterocycle W to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)κ -T -(CH2)L -
[0046] wherein
[0047] I, J, K and L can independently be integers from 0 to 10 and Q, R and T can optionally be substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, or combinations thereof; and
[0048] (viii) combinations of any of (i) through (vii) above; and [0049] wherein
[0050] M can be a transition metal;
[0051] X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, or anions of ion exchange resins, or the corresponding anions thereof; or
[0052] X, Y and Z can independently be charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
[0053] X, Y and Z can independently be attached to one or more of R1, R2, R'2, R3, R'3, R4, R'4, R5, R'5, Rε> RF6> R7. RVi Rs. Rr8> RΘ. R'9. and R10; and
[0054] n can be an integer from 0 to 3.
[0055] In still a further aspect, the pentaaza-macrocyclic ligand complex can be represented by the following formula:
Figure imgf000011_0001
[0056] wherein
[0057] (i) a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen can be attached can independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W which can have 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
[0058] (ii) two sets of two adjacent carbon atoms of the macrocycle can independently form substituted or unsubstituted, saturated, partially saturated or unsaturated, cycles or heterocycles U and V having 3 to 20 carbon atoms; and
[0059] (iii) one or more of R1, R2, R'2, R3, R4. Rs, R's, Re, R'e, R7, Rs, Rg, Rg, and R10 can independently be:
[0060] (iiia) hydrogen; or
[0061] (iiib) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or
[0062] (iiic) a moiety independently including -OR11, -NR11R12, -COR11, -CO2R11, -CONR11R12, -SR11, -SOR11, -SO2R11, -SO2NR11R12, -N(OR11)(R12), -P(O)(OR11)(OR12), -P(O)(OR11)(R12), -OP(O)(OR11)(OR12), or substituents attached to the σ-carbon of σ-amino acids, wherein R11 and R12 can independently include hydrogen or alkyl; and
[0063] (iv) optionally, one or more of R-i and R2 or R2, R5 or R'5 and R6 or R'6, R9 or Rg and R10 together with the carbon atoms to which they attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0064] (v) optionally, one or more of R2 and R2, R5 and R'5, Re and R'6, and R9 and R g, together with the carbon atom to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0065] (vi) optionally, one or more of R2 or R'2 and R3, R4 and R5 or R'5, R6 or R'6 and R7, or R8 and R9 or R'9 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
[0066] (vii) optionally, one or more of R1, R2, R2, R3, R4, R5, R'5, R6, R'e, R7, Rs. R9, Rg, and R10, together with a different one of R1, R2, R'2, R3, R4, Rs, R's, Re, R'e, R/, Rs, Rg, R'9> and R10, which can be attached to a different carbon atom in the macrocyclic ligand can be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2JL -
[0067] wherein
[0068] I, J, K and L independently can be integers from 0 to 10 and Q, R and T can be optionally substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, or combinations thereof; and
[0069] (viii) optionally, one or more of R1, R2, R2, R3, R4, R5, R'5, R6, R6, R7, R8, R9, R'g, and R10, can be individually bound to an atom of heterocycles U, V and W to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)κ -T -(CH2)L -
[0070] wherein
[0071] I, J, K and L independently can be integers from 0 to 10 and Q, R and T can be optionally substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, or combinations thereof; and
[0072] (ix) combinations of any of (i) through (viii) above; and [0073] wherein
[0074] M can be a transition metal;
[0075] X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphate, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, or anions of ion exchange resins, or the corresponding anions thereof; or
[0076] X, Y and Z can independently include charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
[0077] X, Y and Z can independently be attached to one or more of R-i, R2, R'2, R3, R4, Rs, R's, Re, R'e, R7, Ra, Rg, Rg, and R10; and
[0078] n can be an integer from 0 to 3.
[0079] Particularly, the pentaaza-macrocyclic ligand complex can be represented by the following formulas:
Figure imgf000014_0001
Figure imgf000014_0002
or
Figure imgf000014_0003
[0080] In another aspect, W of the pentaaza-macrocyclic ligand complex can be a substituted pyridino moiety.
[0081] In yet another aspect, the superoxide dismutase mimetic can be a porphyrin ligand complex or a substituted porphyrin ligand complex. Particularly, the porphyrin ligand complex can be selected from the group consisting of a manganese (II) porphyrin complex, manganese(lll) porphyrin complex, iron (II) porphyrin complex, and an iron(lll) porphyrin complex. Still further, the porphyrin ligand complex can be a 5,10,15, 20-tetrakis (2,4,6- trimethyl-3,5-disulfonatophenyl)-porphyrinato iron (III) (FeTMPS) complex.
[0082] In another aspect, a method is provided for diagnosing congestive heart failure in a subject, the method comprising obtaining a first coronary blood flow or IVlVO2 measurement in the subject, administering a superoxide dismutase mimetic to the subject, and obtaining a second coronary blood flow or MVO2 measurement after administration of the catalyst to the subject, wherein an increase in coronary blood flow or MVO2 following administration of the superoxide dismutase mimetic is indicative of congestive heart failure. The subject and superoxide dismutase mimetic can be those described above.
[0083] Further provided is a method for treating heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a peroxynitrite decomposition catalyst. In another aspect, a method is provided for increasing coronary blood flow in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a peroxynitrite decomposition catalyst. Still further, a method is provided for increasing MVO2 in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a peroxynitrite decomposition catalyst.
[0084] In some aspects, the subject can be selected from the group consisting of a mammal and avian. Particularly, the mammal can be a human.
[0085] In a further aspect, the peroxynitrite decomposition catalyst can be represented by a formula selected from the group of formulas consisting of:
[0086] Structure I
Figure imgf000015_0001
[0087] wherein R3, R6, R9 or R12 can independently include H, alkyl, alkenyl, CH2, COOH, phenyl, pyridinyl, or N-alkylpyridyl such that phenyl, pyridinyl and N-alkylpyridyl can be: Phenyl
Figure imgf000016_0001
Pyridyl
N-Alkylpyridyl
Figure imgf000016_0002
[0088] which can be attached at a carbon atom, and
[0089] wherein phenyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH2, SO3H, NO2, NH2, N(R)3+ or NHCOR1 wherein R can include hydrogen, alkyl, aryl and alkaryl and R' can be alkyl, and
[0090] pyridinyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH2, SO3H, NO2, NH2, N(R)3+ or NHCOR1 wherein R and R1 can be as defined above, and
[0091] N-alkylpyridyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH2, SO3H, NO2, NH2, N(R)3+ or NHCOR1 wherein R and R' can be as defined above; and
[0092] wherein R1, R2, R4, R5, R7, R8, Rio, or R11 can independently include H, alkyl, alkenyl, carboxyalkyl, Cl, Br, F, NO2, hydroxyalkyl, or SO3H, and further wherein R-,R2 can be taken together to form a ring of from 5 to 8 carbons, and
[0093] X and Y can be ligands or charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand or ligand system or the corresponding anion thereof and can be independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl, amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphate, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkyl aryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkyl aryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluorophosphate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, or anions of ion exchange resins, with the proviso that when the X and Y containing complex has a net positive charge then Z can be a counter ion which can be independently selected from the group consisting of X and Y, or when the X and Y containing complex has net negative charge then Z can be a counter ion selected from a group consisting of alkaline and alkaline earth cations, organic cations such as alkyl or alkylaryl ammonium cations;
[0094] M can be selected from the group consisting of Mn, Fe, Ni and V; and
[0095] n can be an integer from 1 to 3; or
[0096] Structure Il
Figure imgf000017_0001
[0097] wherein R' can be CH or N; [0098] R1, R2, R3, R4, R5, R6. R7, Rs, Rg, Rio, Rn, R12, Ri3, R14, R15, and R16 can independently include H, SO3H, COOH, NO2, NH2, and N-alkylamino; and [0099] X, Y, Z, M and n can be as defined above; [0100] Structure III
Figure imgf000018_0001
A
[0101] wherein R1, R5, R9, and R13 can independently include a direct bond and
CH2;
[0102] R2, R2', R4, R4', Re, Re', Rδ, Rδ', R10, R10', Ri2> Ri2 1, Ri4> R14', R16, and R-i6' can independently include H and alkyl;
[0103] R3, R7, R11, R15 can independently include H and alkyl; and [0104] X, Y, Z, M and n can be as defined above;
Figure imgf000018_0002
B [0105] wherein R1, Rs, Rs, and Ri2 can independently include a direct bond and
CH2;
[0106] R2, R2 1, R4, R4 1, R6, R6 1, R7, R9, R9 1, R11, R11 1, R13, R13 1, and R14 can independently include H and alkyl;
[0107] R3 and R10 can independently include H and alkyl; and [0108] X, Y, Z, M and n can be as defined above;
Figure imgf000019_0001
[0109] wherein R-i, R4, Rs, R12 can independently include direct bond and CH2; [0110] R2, R2', R3, R5, Rs', R7, Rg, Rg', Rn, Rn', R13, R13' and R14 can independently include H and alkyl;
[0111] R10 can be H or alkyl; and [0112] X, Y, Z, M and n can be as defined above;
Figure imgf000019_0002
[0113] wherein R1, R4, R7 and R10 can independently include direct bond and CH2; [0114] R2, R2', R3, R5, R5', R6, R8, Rs', Rg, Rn, Rn' and R12 can independently include H and alkyl; and
[0115] X, Y, Z, M and n can be as defined above;
Figure imgf000020_0001
[0116] wherein R1, R4, Rs and R-π can independently include a direct bond and
CH2;
[0117] R2, R3, R3', Rs, R5", R?, R/. Rg, Rio> R101, R12, R121 and R13 can independently include H and alkyl;
[0118] R6 can be hydrogen or alkyl; and
[0119] X, Y, Z, M and n can be as defined above;
Figure imgf000020_0002
[0120] wherein R1, R4, R7 and R10 can independently include H and alkyl; [0121] R2, R3, R3', R5, Rs', Re, Rs, Rg, Rg', R11, Rn' and R12 can independently include H and alkyl; and
[0122] X, Y, Z, M and n can be as defined above;
Figure imgf000021_0001
[0123] wherein R-i, R3, R4 and R6 can independently include H and alkyl; [0124] R2 and R5 can independently include H, alkyl, SO3H, NO2, NH2, halogen, COOH and N(R)3+ wherein R can be as defined above; and [0125] X, Y, Z, M and n can be as defined above;
Figure imgf000021_0002
H
[0126] wherein R1, R2, R3, R4 can independently include H, alkyl, SO3H, NO2, NH2, halogen, COOH and N(R)3+ wherein R can be as defined above; and [0127] X, Y, Z, M and n can be as defined above; and [0128] Structure IV
Figure imgf000022_0001
[0129] wherein R1, R1', R2, R2 1, R3, R31, R4, R4', Rs, R51, Re, Re', R7 and R7' can independently include H, alkyl, alkoxy, NO2, aryl, halogen, NH2 and SO3H, wherein R6, Re', R7 and R7' may each be taken together with one other of R6, R^, R7 and- R7' to form a cyclic group, preferably a 6 carbon cycloalkyl group;
[0130] M1 can be selected from the group consisting of Fe, Ni or V; and
[0131] X, Y, Z and n can be as defined above.
[0132] These and other features, aspects and advantages of the present invention will become better understood with reference to the following description, examples and appended claims.
DRAWINGS
[0133] Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
[0134] Figure 1 shows the effect of M40401 'in normal dogs. The relationship between Myocardial 02 consumption (ml/min) and rate pressure product (mm Hg beats/min) were unchanged in normal dogs after taking M40401.
[0135] Figure 2 shows the effect of M40401 in normal dogs. The relationship between Coronary blood flow (ml/min) and rate pressure product (mm Hg beats/min) was unchanged in normal dogs after taking M40401.
[0136] Figure 3 shows the effect of M40401 and LNA (the nitric oxide synthase inhibitor NG-nitro-l-arginine) on endothelium dependent coronary vasodilation in normal dogs. Coronary blood flow (%) responses to acetylcholine (microgram/min).
[0137] Figure 4 shows the effect of M40401 and LNA (the nitric oxide synthase inhibitor NG-nitro-l-arginine) on endothelium dependent coronary vasodilation in normal dogs. Inhibition of NO production with LNA blunted the increase in coronary flow produced by acetylcholine. [0138] Figure 5 shows SOD isoenzyme content. Western analysis shows that norma! extracellular SOD was decreased, while Mn-SOD was increased in the failing heart.
DETAILED DESCRIPTION
[0139] Abbreviations and Definitions
[0140] To facilitate understanding of the invention, a number of terms and abbreviations as used herein are defined below as follows:
[0141] As used herein, the terms "reactive oxygen species" or "ROS" refers to a superoxide anion (O2""), nitric oxide (NO*"), peroxynitrite (ONOO'") and the hydroxyl radical (OH"), and other free-radicals known to those of skill in the art.
[0142] As used herein, the terms "non-peptidic catalysts for the dismutation of superoxide" or "non-proteinaceous catalysts for the dismutation of superoxide" mean a low- molecular weight catalyst for the conversion of superoxide anions into hydrogen peroxide and molecular oxygen. These catalysts commonly consist of an organic ligand and a chelated transition metal ion, preferably copper, manganese(ll), manganese(lll), iron(ll) or iron(lll). The term may include catalysts containing short-chain polypeptides (under 15 amino acids) or macrocyclic structures derived from amino acids, as the organic ligand. The term explicitly excludes a superoxide dismutase enzyme obtained from any species.
[0143] The term "catalyst for the dismutation of superoxide" is used interchangeable with the term "superoxide dismutase mimetic (SODm)" and means any catalyst for the conversion of superoxide anions into hydrogen peroxide and molecular oxygen. The term explicitly includes a superoxide dismutase enzyme obtained from any species. The superoxide dismutase mimetics can include, generally, those superoxide dismutase mimetics disclosed in U.S. Patent Nos. 5,610,293, 5,637,578, 5,874,421 , 5,976,498, 6,084,093, 6,180,620, 6,204,259, 6,214,817, 6,395,725, and 6,525,041 , each of which is incorporated herein by reference in its entirety.
[0144] It is envisioned that a mammal patient to which the catalyst for the dismutation of superoxide will be administered, in the methods or compositions of the invention, will be a human. However, other mammal patients in veterinary (e.g., companion pets and large veterinary animals) and other conceivable contexts are also contemplated.
[0145] As used herein, the terms "treatment" or "treating" relate to any treatment of heart failure and include: (1) preventing heart failure from occurring in a subject; (2) inhibiting the progression or initiation of heart failure, i.e., arresting or limiting its development; or (3) ameliorating or relieving the symptoms of existing heart failure.
[0146] The term "therapeutically effective amount" means those amounts that, when administered to a particular subject in view of the nature and severity of that subject's disease or condition of heart failure, will have the desired therapeutic effect, e.g., an amount which will cure, or at least partially arrest or inhibit the disease or condition or symptoms of heart failure.
[0147] The term "heart failure" is used interchangeably with the term CHF and indicates that the pumping action of the heart is inadequate to meet the body's needs for oxygen-rich blood. As a result, blood flow to body tissues is reduced and blood returning to the heart accumulates, causing congestion in the veins.
[0148] The term "substituted" means that the described moiety has one or more substituents comprising at least 1 carbon or heteroatom, and further comprising 0 to 22 carbon atoms, more preferably from 1 to 15 carbon atoms, and comprising 0 to 22, more preferably from 0 to 15. As used herein, "heteroatom" refers to those atoms that are neither carbon nor hydrogen bound to carbon and are selected from the group consisting of O, S, N, P, Si, B, F, Cl, Br, or I. These atoms may be arranged in a number of configurations, creating substituent groups which are unsaturated, saturated, or aromatic. Examples of such substituents include branched or unbranched alkyl, alkenyl, or alkynyl, cyclic, heterocyclic, aryl, heteroaryl, alkyl, polycycloalkyl, polycycloaryl, polycycloheteroaryl, imines, aminoalkyl, hydroxyalkyl, hydroxyl, phenol, amine oxides, thioalkyl, carboalkoxyalkyl, carboxylic acids and their derivatives, keto, ether, aldehyde, amine, amide, nitrite, halo, thiol, sulfoxide, sulfone, sulfonic acid, sulfide, disulfide, phosphoric acid, phosphonic acid, acrylic acid, sulphonamides, amino acids, peptides, proteins, carbohydrates, nucleic acids, fatty acids, lipids, nitro, hydroxylamines, hydroxamic acids, thiocarbonyls, thiocarbonyls, borates, boranes, boraza, silyl, silaza, siloxy, and combinations thereof.
[0149] The term "alkyl", alone or in combination, means a straight-chain or branched-chain alkyl radical containing from 1 to about 22 carbon atoms, preferably from about 1 to about 18 carbon atoms, and most preferably from about 1 to about 12 carbon atoms. Examples of such radicals include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, iso-amyl, hexyl, octyl, nonyl, decyl, dodecyl, tetradecyl, hexadecyl, octadecyl and eicosyl.
[0150] The term "alkenyl", alone or in combination, means an alkyl radical having one or more double bonds. Examples of such alkenyl radicals include, but are not limited to, ethenyl, propenyl, 1-butenyl, cis-2-butenyl, traps-2-butenyl, iso-butylenyl, cis-2-pentenyl, traps-2-pentenyl, 3-methyl-l-butenyl, 2,3-dimethyl-2-butenyl, 1-pentenyl, 1-hexenyl, 1- octenyl, decenyl, dodecenyl, tetradecenyl, hexadecenyl, cis- and traps-9-octadecenyl, 1,3- pentadienyl, 2,4-pentadienyl, 2,3-pentadienyl, 1 ,3-hexadienyl, 2,4-hexadienyl, 5,8,11,14- eicosatetraenyl, and 9,12,15-octadecatrienyl.
[0151] The term "alkynyl", alone or in combination, means an alkyl radical having one or more triple bonds. Examples of such alkenyl groups include, but are not limited to, ethynyl, propynyl (propargyl), 1-butenyl, 1-octynyl, 9-octadecynyl, 1,3-pentadiynyl, 2,4- pentadiynyl, 1 ,3-hexadiynyl, and 2,4-hexadiynyl.
[0152] The term "cycloalkyl", alone or in combination means a cycloalkyl radical containing from 3 to about 10, preferably from 3 to about 8, and most preferably from 3 to about 6, carbon atoms. Examples of such cycloalkyl radicals include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and perhydronaphthyl.
[0153] The term "cycloalkylalkyl" means an alkyl radical as defined above which is substituted by a cycloalkyl radical as defined above. Examples of cycloalkylalkyl radicals include, but are not limited to, cyclohexylmethyl, cyclopentylmethyl, (4- isoρropylcyclohexyl)methyl, (4-t-butyl-cyclohexyl)methyl, 3-cyclohexylpropyl, 2- cyclohexylmethylpentyl, 3-cyclopentylmethylhexyl, 1 -(4-neopentylcyclohexyl)methylhexyl, and 1 -(4-isopropylcyclohexyl)methylheptyl.
[0154] The term "cycloalkylcycloalkyl" means a cycloalkyl radical as defined above which is substituted by another cycloalkyl radical as defined above. Examples of cycloalkylcycloalkyl radicals include, but are not limited to, cyclohexylcyclopentyl and cyclohexylcyclohexyl.
[0155] The term "cycloalkenyl", alone or in combination, means a cycloalkyl radical having one or more double bonds. Examples of cycloalkenyl radicals include, but are not limited to, cyclopentenyl, cyclohexenyl, cyclooctenyl, cyclopentadienyl, cyclohexadienyl and cyclooctadienyl.
[0156] The term "cycloalkenylalkyl" means an alkyl radical as defined above which is substituted by a cycloalkenyl radical as defined above. Examples of cycloalkenylalkyl radicals include, but are not limited to, 2-cyclohexen-l-ylmethyl, 1-cyclopenten-l-ylmethyl, 2- (1 -cyclohexen-l-yl)ethyl, 3-(1 -cyclopenten-l-yl)propyl, 1 -(1 -cyclohexen-l-ylmethyOpentyl, 1 -(1 - cyclopenten-!-yl)hexyl, 6-(1-cyclohexen-l-yl)hexyl, 1-(1-cyclopenten-l-yl)nonyl and 1-(1- cyclohexen-l-yl)nonyl.
[0157] The terms "alkylcycloalkyl" and "alkenylcycloalkyl" mean a cycloalkyl radical as defined above which is substituted by an alkyl or alkenyl radical as defined above. Examples of alkylcycloalkyl and alkenylcycloalkyl radicals include, but are not limited to, 2- ethylcyclobutyl, 1-methylcyclopentyl, 1-hexylcyclopentyl, 1-methylcyclohexyl, 1-(9- octadecenyl)cyc!opentyl and 1-(9-octadecenyl)cyclohexyl.
[0158] v The terms "alkylcycloalkenyl" and "alkenylcycloalkenyl" means a cycloalkenyl radical as defined above which is substituted by an alkyl or alkenyl radical as defined above. Examples of alkylcycloalkenyl and alkenylcycloalkenyl radicals include, but are not limited to, i-methyl-2-cyclopentyl, i-hexyl-2-cyclopentenyl, 1-ethyl-2-cyc(ohexenyl, 1- butyl-2-cyclohexenyl, 1-(9-octadecenyl)-2-cyclohexenyl and 1-(2-pentenyl)-2-cyclohexenyl.
[0159] The term "aryl", alone or in combination, means a phenyl or naphthyl radical which optionally carries one or more substituents selected from alkyl, cycloalkyl, cycloalkenyl, aryl, heterocycle, alkoxyaryl, alkaryl, alkoxy, halogen, hydroxy, amine, cyano, nitro, alkylthio, phenoxy, ether, trifluoromethyl and the like, such as phenyl, p-tolyl, 4- methoxyphenyl, 4-(tert-butoxy)phenyl, 4-fluorophenyl, 4-chlorophenyl, 4-hydroxyphenyl, 1- naphthyl, 2-naphthyl, and the like.
[0160] The term "aralkyl", alone or in combination, means an alkyl or cycloalkyl radical as defined above in which one hydrogen atom is replaced by an aryl radical as defined above, such as benzyl, 2-phenylethyl, and the like.
[0161] The term "heterocyclic" means ring structures containing at least one heteroatom within the ring. As used herein, "heteroatom" refers to atoms that are neither carbon nor hydrogen bound to a carbon. Examples of heterocyclics include, but are not limited to, pyrrolidinyl, piperidyl, imidazolidinyl, tetrahydrofuryl, tetrahydrothienyl, furyl, thienyl, pyridyl, quinolyl, isoquinolyl, pyridazinyl, pyrazinyl, indolyl, imidazolyl, oxazolyl, thiazolyl, pyrazolyl, pyridinyl, benzoxadiazolyl, benzothiadiazolyl, triazolyl and tetrazolyl groups.
[0162] The term "saturated, partially saturated or unsaturated cyclic" means fused ring structures in which 2 carbons of the ring are also part of the fifteen-membered macrocyclic ligand. The ring structure can contain 3 to 20 carbon atoms, preferably 5 to 10 carbon atoms, and can also contain one or more other kinds of atoms in addition to carbon. The most common of the other kinds of atoms include nitrogen, oxygen and sulfur. The ring structure can also contain more than one ring.
[0163] The term "saturated, partially saturated or unsaturated ring structure" means a ring structure in which one carbon of the ring is also part of the fifteen-membered macrocyclic ligand. The ring structure can contain 3 to 20, preferably 5 to 10, carbon atoms and can also contain nitrogen, oxygen and/or sulfur atoms.
[0164] The term "nitrogen containing heterocycle" means ring structures in which 2 carbons and a nitrogen of the ring are also part of the fifteen-membered macrocyclic ligand. The ring structure can contain 2 to 20, preferably 4 to 10, carbon atoms, can be substituted or unsubstituted, partially or fully unsaturated or saturated, and can also contain nitrogen, oxygen and/or sulfur atoms in the portion of the ring which is not also part of the fifteen- membered macrocyclic ligand.
[0165] The term "organic acid anion" refers to carboxylic acid anions having from about 1 to about 18 carbon atoms. [0166] The term "halide" means chloride, fluoride, iodide, or bromide.
[0167] As used herein, "R" groups means ail of the R groups attached to the carbon atoms of the macrocycle, i.e., R, R', R1, R\, R2, R'2> Ra, R's, R4, R!4, Rs, R'5, Re, R'e,
Figure imgf000027_0001
[0168] Application of SOD mimetic administration in CHF
[0169] The present invention relates to the discovery that superoxide dismutase mimetics and peroxynitrite decompositions are effective in treating CHF and affecting other aspects of the mammalian and avian coronary system. Thus, what is provided is a method for treating CHF, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic or a peroxynitrite decomposition catalyst. Another aspect provides a method for increasing coronary blood flow in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic or a peroxynitrite decomposition catalyst. Yet another aspect provides a method for increasing MVO2 in CHF, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic or a peroxynitrite decomposition catalyst.
[0170] Those of skill in the art will recognize that the superoxide dismutase mimetics and peroxynitrite decomposition catalysts can include, generally, those superoxide dismutase mimetics disclosed in U.S. Patent Nos. 5,610,293, 5,637,578, 5,874,421, 5,976,498, 6,084,093, 6,180,620, 6,204,259, 6,214,817, 6,395,725, and 6,525,041 in addition to those disclosed herein.
[0171] In a further aspect, the superoxide dismutase mimetic can comprise an organic ligand chelated to a metal ion including Mn(II), Mn(III), Fe(II), Fe (III), Cu(ll)/Zn(lll), or Cu(lll)/Zn (II). The subject can be a mammal and avian. In particular, the mammal can be a human.
[0172] In another aspect, a method is provided for diagnosing congestive heart failure in a subject, the method comprising obtaining a first coronary blood flow or MVO2 measurement in the subject, administering a superoxide dismutase mimetic or a peroxynitrite decomposition catalyst to the subject, and obtaining a second coronary blood flow or MVO2 measurement after administration of the catalyst to the subject, wherein an increase in coronary blood flow or MVO2 following administration of the superoxide dismutase mimetic is indicative of congestive heart failure. The subject and superoxide dismutase mimetic can be those disclosed and incorporated herein.
[0173] CHF is associated with depressed myocardial oxygen consumption (MVO2), decreased coronary blood flow (CBF), and coronary endothelial dysfunction. The following examples provide data helpful in assessing whether increased superoxide (O2 *") production by the failing heart contributes to these abnormalities. In the examples, the effect of a low molecular weight SOD mimetic M40401 (1.5 mg/kg iv) on MVO2 and CBF was examined in dogs during normal conditions and after CHF was produced by 4 weeks of rapid ventricular pacing. The development of CHF was associated with decreases of left ventricular (LV) systolic pressure, MVO2, and LV-dP/dtmax, while LV end-diastolic pressure (LVEDP) increased from 4 ±1.2 to 23 ± 1.4 mm Hg. CHF was associated with decreased CBF at rest and during treadmill exercise as well as coronary endothelial dysfunction with impaired vasodilation in response to acetylcholine. The SOD mimetic M40401 increased CBF (18+5%, p<0.01) and MVO2 (14+6%, p<0.01) in CHF dogs at rest and during exercise, and decreased LVEDP from 24+1.3 mmHg to 21+1.1 mmHg (p<0.05>. Furthermore, the impaired CBF response to acetylcholine in the failing heart was almost totally reversed by the SOD mimetic M40401. In normal dogs the SOD mimetic had no effect on MVO2, CBF or acetylcholine-induced coronary vasodilation. Western analysis demonstrated that extracellular SOD (EC-SOD) was significantly decreased in CHF hearts, while mitochondrial Mn-SOD was increased. Cytosolic CuZn-SOD was unchanged. The data disclose that O2 *" contributes to the depressed MVO2 and CBF in Heart Failure. Without being bound by a particular theory, both increased O2" production and decreased vascular O2" scavenging ability by EC-SOD may have contributed to endothelial dysfunction in the failing hearts.
[0174] Oxidative Stress in the failing heart
[0175] CHF is associated with increased oxidative stress (I mitochondria; Dhalla et al., Am J Physiol. 266, H1280-285 (1994); Hill et al., Circulation 96, 2414-2420 (1997)). Several investigators have reported that superoxide (O2") production is increased both in myocardial mitochondria (Ide et al., Circ. Res. 85, 357-363 (1999); lde et al., Circ. Res. 8, 152-157 (2000)) and in coronary arteries (Wiemer et al., Hypertension 38, 1367-1371 (2001); Bauersachs et al., Circulation 100, 292-298 (1999); Bauersachs et al., Circulation 104, 982-985 (2001); Bauersachs et al., J Am Coll. Cardiol. 39, 351-358 (2002)) from failing hearts. In physiological circumstances, O2" can function as a messenger intermediate involved in signal transduction (Irani et al., Science 275, 1649-1652 (1997); Lander et al., Nature 381, 380-381 (1996)), but high concentrations of O2"can result in cell damage and tissue injury. O2" reacts avidly with nitric oxide (NO) to form peroxynitrite (ONOO"), a strong oxidant and nitrating species known to promote oxidative damage (Borutaite et al., Biochim. Biophys. Acta 1459, 405-412 (2000)). But in low concentrations peroxynitrite may play some regulatory role in mitochondrial physiology (Borutaite et al., Biochim Biophys Acta 1459, 405- 412 (2000); Go et al., Am J Physiol 277, H1647-H1653 (1999)). Since O2 *'has low membrane permeability, reactions with this molecule occur in the compartment in which it is generated. Therefore, O2 *" produced in vessels can react locally with endothelium derived NO, thereby decreasing NO bioavailability and contributing to the endothelial dysfunction seen in CHF (Bauersachs et al., Circulation 100, 292-298 (1999); Bauersachs et al., Circulation 104, 982-985 (2001); Bauersachs et al., J. Am. Coll. Cardiol. 39, 351-358 (2002)). O2'" produced in mitochondria can react with NO to form ONOO' which may have the potential to alter mitochondrial respiration both directly by inactivation of mitochondrial complexes I1 II and V as well as by removing the inhibitory effect of NO on cytochrome c oxidase (Radi et al., Biol. Chem. 383, 401-409 (2002); Borutaite et al., Biochim. Biophys. Acta 1459, 405-412 (2000)). Thus, increased O2 *" production has the potential to alter both vascular reactivity and mitochondrial function in the failing heart.
[0176] The SOD mimetic M40401 is a novel synthetic low molecular weight S1S- dimethyl substituted biscyclohexylpyridine manganese-based superoxide dismutase (SOD) mimetic that is stable in vivo, possesses high activity (at pH 7.4 > 1x109 M"1 s"1 which is comparable to the native Cu/Zn SOD enzyme), and is selective for O2 " with no activity toward hydrogen peroxide (H2O2), ONOO", NO, or hypochlorite (OCI") (Salvemini et al., Science 286, 304-306 (1999); Salvemini et al., Br. J. Pharmacol. 127, 685-692 (1999)). The resting redox state of M40401 is the reduced state, Mn(II); as a consequence, the complex has no reactivity for reducing agents until it is oxidized to Mn(III) by O2 *" (Salvemini et al., Science 286, 304-306 (1999); Salvemini et al., BrJ Pharmacol 127, 685-692 (1999); Cuzzocrea et al., Br J Pharmacol 132, 19-29 (2001)). Moreover, M40401 is relatively difficult to oxidize (+0.75 v (SHE)) so that many oxidants including NO and oxygen will not oxidize the complex (Salvemini et al., Science 286, 304-306 (1999); Salvemini et al., Br J Pharmacol 127, 685- 692 (1999)). Since M40401 operates via a facile one-electron oxidation pathway, two- electron non-radical oxidants are also not able to oxidize the Mn(II) complex; e.g., 0ONO2 ", OCr. The selectivity of this agent for O2 *" in the presence of other ROS makes it possible to dissect the role of O2 *' in disease models in which ROS are implicated. Those of skill in the art will recognize that other superoxide dismutase mimetics disclosed and incorporated herein can have a similar efficacies as determined by well known methods.
[0177] Without being bound by a particular theory, it is possible that increased O2 *" production by myocardial mitochondria is partially responsible for the depressed MVO2 in the failing heart, so that scavenging O2 *" with an appropriate SOD mimetic, such as M40401 may cause an increase of oxygen uptake. In addition, it is possible that scavenging O2" may increase NO bioavailability in the coronary vessels, thereby enhancing endothelium- dependent vasodilation. The myocardial protein content of copper/zinc-containing SOD (CuZn-SOD), mitochondrial manganese SOD (Mn-SOD) and extracellular SOD (EC-SOD) were also measured to determine whether a decrease of these enzymes might contribute to increased oxidative stress in the failing heart.
[0178] Effect of M40401 in Normal Dogs
[0179] In seven normal animals M40401 caused no significant hemodynamic changes at rest or during exercise, and had no effect on CBF or MVO2 (Table 1). [*p<0.05 compared with corresponding resting conditions.]
TABLE 1. EFFECTS OF M40401 ON HEMODYNAMICS IN NORMAL DOGS (N=7) REST 3.2 KM/H, 0% 6.4 KM/H, 0% 6.4 KM/H, 5%
Mean aortic ressure, mm Hg
Figure imgf000030_0001
LV dP/dt-max mm H /s
Figure imgf000031_0001
[0180] The relationships between CBF or MVO2 and rate pressure product were unchanged after M40401 (Figures 1 and 2).
[0181] Effect of M40401 and LNA on Endothelium Dependent Coronary Vasodilation in Normal Dogs
[0182] Coronary blood flow responses to acetylcholine are shown in Figures 3 and 4. lntracoronary infusion of acetylcholine in doses of 3.75 to 75 μg/min had no effect on heart rate or aortic pressure. Under control conditions, coronary flow increased from 60±4.9 ml/min at baseline to 190+8.7 ml/min during the maximum acetylcholine dose (75 μg/min). M40401 had no effect on either resting coronary flow or the increase in flow produced by acetylcholine. Inhibition of NO production with LNA significantly (p<0.01) blunted the increase in coronary flow produced by acetylcholine (Figure 4).
[0183] Effect of M40401 in Animals with CHF
[0184] CHF was associated with increases in resting heart rate and LVEDP, and decreases of aortic pressure, LV systolic pressure (LVSP), LV dp/dtmax, CBF and MVO2 (each p<0.05) (Table 2). [*p<0.05 compared with corresponding resting conditions; f p<0.05 compared with control conditions (before M40401) (by two way ANOV A}.]
TABLE 2. EFFECTS OF M40401 ON HEMODYNAMICS IN CHF DOGS (N=9).
Figure imgf000031_0002
Figure imgf000032_0001
[0185] M40401 caused a small but significant decrease of LVEDP at rest and during exercise (p<0.05), while aortic pressure, LV systolic pressure, LV dP/dtmax and rate- pressure product were unchanged. M40401 caused increases (p<0.05) in coronary blood flow and MVO2 at rest and during exercise in CHF dogs (Figures 1 and 2), while the relationship between MVO2 and CBF was unchanged.
[0186] Effect of LNA in Animals with CHF
[0187] After completion of the M40401 measurements, in 5 dogs with CHF NOS inhibition with LNA (1.5 mg/kg intracoronary) was produced. In comparison with measurements after M40401 , LNA caused significant increases of aortic pressure, LV systolic pressure, LVEDP and rate-pressure product at rest and during exercise, while the heart rate and LV dP/dtmaχ were unchanged (Table 3).
TABLE 3. EFFECTS OF M40401 AND LNA ON HEMODYNAMICS IN CHF DOGS (N=7).
Figure imgf000032_0002
Figure imgf000033_0001
[0188] LNA also caused significant increases of MVO2 and coronary blood flow.
[0189] Effect of M40401 and LNA on Endothelium-Dependent Coronary Vasodilation in CHF Dogs
[0190] lntracoronary infusion acetylcholine (3.75 to 75 μg/min) had no effect on heart rate or aortic pressure, but caused dose-dependent increases of CBF in dogs with CHF (Figures 3 and 4). In comparison to normal dogs, acetylcholine induced coronary vasodilation was significantly attenuated in CHF dogs (Figure 3). Under control conditions, coronary flow in the CHF dogs increased from 40+2.2 ml/min during basal conditions to 113±11 ml/min during the maximum acetylcholine dose (75 μg/min). M40401 caused no change of heart rate or mean aortic pressure. However, M40401 significantly augmented the increase of coronary flow produced by acetylcholine (Figure 4), indicating enhanced endothelium-dependent vasodilation. As expected, LNA inhibited the increase in coronary flow produced by acetylcholine (p<0.01).
[0191] SOD Isoenzyme Content
[0192] Western analysis demonstrated that in comparison with normal extracellular SOD was decreased (1.0±0.1 in normal vs. 0.72+0.10 in CHF), while Mn-SOD was increased in the failing hearts (1.0+0.08 in normal vs. 1.28+0.07 in CHF) (each P<0.05). CuZn-SOD was unchanged (1.0+0.06 in normal vs. 1.07+0.07 in CHF) after the development of CHF (Figure 5).
[0193] Real-Time RT-PCR
[0194] The ratio of CuZn-SOD vs. GAPDH in CHF dogs (2.1±0.5) was not different from that in normal dogs (2.0±0.3).
[0195] Catalysts for the Dismutation of Superoxide
[0196] The compounds of the present methods can comprise a non-proteinaceous catalyst for the dismutation of superoxide anions (an "SOD mimic" or "SODm") as opposed to a native form of the SOD enzyme and a peroxynitrite decomposition catalyst. The catalysts explicitly exclude a SOD enzyme obtained from any natural sources. SOD mimics can be useful in the method of the present invention as compared to native SOD because of the limitations associated with native SOD therapies. See, e.g., Salvemini et al., Science 286, 304-306 (1999). For example, the best known native SOD, CuZn, has a molecular weight of 33,000 kD. In Contrast, SOD mimics have an approximate molecular weight of 400 to 600 Daltons.
[0197] Particularly, the catalyst of the methods above can be a pentaaza- macrocyclic ligand complex or a substituted pentaaza-macrocyclic ligand complex. The pentaaza-macrocyclic ligand complex can be represented by the following formula:
Figure imgf000034_0001
[0198] wherein
[0199] (i) one or more of R1, R'-,, R2, R'2, R3, R's, R4, Rr4, R5, R's, Re, R'e, R7, RV, Re, R's, R9, R'g, R10, and R'1O can independently be:
[0200] (ia) hydrogen; or
[0201] (ib) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or [0202] (ic) a moiety independently including -ORn, -NR11R12, -CORi1, -CO2Ri1, -CONR11R12, -SRi1, -SOR11, -SO2R11, -SO2NR11R12, -N(ORn)(R12), -P(O)(OR11)(OR12), -P(O)(OR1I)(R12), -OP(O)(OR11)(ORt2), or substituents attached to the α-carbon of σ-amino acids, wherein R11 and R12 can independently include hydrogen or alkyl; and
[0203] (ii) optionally, one or more of R1 or R'i and R2 or R2, R3 or R'3 and R4 or Rf 4, R5 or R'5 and R6 or R'6, R7 or R'7 and R8 or R'8l R9 or R'9 and R10 or R'1O together with the carbon atoms to which they can be attached independently can form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0204] (iii) optionally, one or more of R1 and R\, R2 and R2, R3 and R'3, R4 and R'4, R5 and R'5, R6 and R6, R7 and R'7, R8 and R8, R9 and R9, and R10 and R'1O, together with the carbon atom to which they can be attached independently can form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0205] (iv) optionally, one or more of R10 or R'1O and R1 or R'i, R2 or R 2 and R3 or R3, R4 or R'4 and R5 or R5, R6 or R'6 and R7 or R7, or R8 or R'8 and R9 or R'9 together with the carbon atoms to which they can be attached independently can form a substituted or unsubstituted nitrogen containing heterocycie having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
[0206] (v) optionally, one or more of R1, R'-,, R2, R2, R3, R3, R4, R'4, R5, R5, R6, R6, R7, R7, R8, R8, R9, R9, R10, and R'1O, together with a different one of R1, R'-,, R2, R2, R3, Rr3, R4, R'4, Rs, R's, R6, R'e, R7, RV, R8, R's, R9, Rg, Rio, and R'1O, which can be attached to a different carbon atom in the macrocyclic ligand can be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2)L -
[0207] wherein
[0208] I, J, K and L independently can be integers from 0 to 10 and Q, R and T can optionally include substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, or combinations thereof; and
[0209] (vi) combinations of any of (i) through (v) above; and [0210] wherein
[0211] M can be a transition metal;
[0212] X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, and anions of ion exchange resins, or the corresponding anions thereof; or
[0213] X, Y and Z can independently include charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
[0214] X, Y and Z can independently be attached to one or more of R1, R^ , R2, R'2, R3. R'3. R4. R'4. R5. R'51 Re. Rr6> R71 RV. Rs, R'δ. R9> R'9, R10, or R'10; and
[0215] n can be an integer from 0 to 3.
[0216] In yet another aspect, the pentaaza-macrocyclic ligand complex can be represented by the following formula:
Figure imgf000037_0001
[0217] wherein
[0218] (i) a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen can be attached can independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W having 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
[0219] (ii) one or more of R1, R2, R'2, R3, R's, R4, Rr4, R5, R'β, R6, R'β, R7, R'/, Rs, R'8, R9, Rg, and R10 can independently be:
[0220] (iia) hydrogen; or
[0221] (iib) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or
[0222] (iic) a moiety independently selected from the group consisting of -ORi1, -NR11R12, -COR11, -CO2R11, -CONR11R12, -SR11, -SOR11, -SO2R11, -SO2NR11R12, -N(OR11)(R12), -P(O)(OR11)(OR12), -P(O)(OR11)(R12), -OP(O)(OR11)(OR12), or substituents attached to the σ-carbon of σ-amino acids, wherein Rn and R12 can independently include hydrogen or alkyl; and
[0223] (iii) optionally, one or more of R1 and R2 or R2, R3 or R'3 and R4 or R'4, R5 or R'5 and R6 or R6, R7 or R'7 and R8 or R'8, Rg or R'9 and R10 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0224] (iv) optionally, one or more of R2 and R2, R3 and R3, R4 and R'4l R5 and R5, R6 and R 6, R7 and R7, Rs and R8, and R9 and R 9, together with the carbon atom to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0225] (v) optionally, one or more of R2 or R'2 and R3 or R'3l R4 or R'4 and R5 or R'5, Re or R'6 and R7 or R7, or R8 or R'8 and R9 or R'9 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
[0226] (vi) optionally, one or more of R1, R2, R 2, R3, R'3, R4, R4, R5, R'5, Re, R'e, R7, R'7> R8, R's, RQ, R'9, and R10, together with a different one of R-i, R2, R2, R3, R3, R4, R4, R5, R'5, Re, R'β. R7. RV, Rδ> R's, Rg, R'9, and Ri0, which can be attached to a different carbon atom in the macrocyclic ligand may be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2)L -
[0227] wherein
[0228] I, J, K and L independently can be integers from 0 to 10 and Q, R and T can optionally be substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, or combinations thereof; and
[0229] (vii) optionally, one or more of R1, R2, R2, R3, R3, R4, R4, R5, R5, R6, R'e, R7, R'7, Rs, R's, Rg, R'9, and R™, may be bound to an atom of heterocycle W to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)κ -T -(CH2)L -
[0230] wherein
[0231] I, J, K and L can independently be integers from 0 to 10 and Q, R and T can optionally be substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, or combinations thereof; and
[0232] (viii) combinations of any of (i) through (vii) above; and [0233] wherein
[0234] M can be a transition metal;
[0235] X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, or anions of ion exchange resins, or the corresponding anions thereof; or
[0236] X, Y and Z can independently be charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
[0237] X, Y and Z can independently be attached to one or more of R1, R2, R'2, R3, R'3, R4, R'4, R5, R'5, Re. R'6> R7. RV. Rβ> R'β. RΘ> R'91 and R-io! and
[0238] n can be an integer from 0 to 3.
[0239] In still a further aspect, the pentaaza-macrocyclic ligand complex can be represented by the following formula:
Figure imgf000040_0001
[0240] wherein
[0241] (i) a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen can be attached can independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W which can have 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
[0242] (ii) two sets of two adjacent carbon atoms of the macrocycle can independently form substituted or unsubstituted, saturated, partially saturated or unsaturated, cycles or heterocycles U and V having 3 to 20 carbon atoms; and
[0243] (iii) one or more of R1, R2, R 2, R3, R4, R5, R's, R6, R'β, R?, Rs, Rg, Rg, and R10 can independently be:
[0244] (iiia) hydrogen; or
[0245] (iiib) a moiety independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, or heterocyclyl; or
[0246] (iiic) a moiety independently including -OR11, -NR11Ri2, -CORi1, -CO2R1I, -CONR11R12, -SR11, -SORn, -SO2Rn, -SO2NRnR12, -N(OR11)(R12), -P(O)(OR11)(OR12), -P(O)(ORi1)(R12), -OP(O)(OR11)(ORi2), or substituents attached to the σ-carbon of σ-amino acids, wherein Rn and R12 can independently include hydrogen or alkyl; and
[0247] (iv) optionally, one or more of R1 and R2 or R2, R5 or R'5 and R6 or R'6, R9 or R'g and Ri0 together with the carbon atoms to which they attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0248] (v) optionally, one or more of R2 and R2, R5 and R'5| R6 and R6, and R9 and R'g, together with the carbon atom to which they can be attached can independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
[0249] (vi) optionally, one or more of R2 or R'2 and R3, R4 and R5 or R'5, R6 or R'6 and R7, or R8 and R9 or R'9 together with the carbon atoms to which they can be attached can independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which can be both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which can be both part of the heterocycle and the macrocycle can be absent; and
[0250] (vii) optionally, one or more of R1, R2, R2, R3, R4, R5, R's, Re, R'e, Rr, Rs, R9, Rg, and R10, together with a different one of R1, R2, R2, R3, R4, R5, R'5, R6, R'6, R7, R8, R9, R9, and R10, which can be attached to a different carbon atom in the macrocyclic ligand can be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2)L -
[0251] wherein
[0252] I1 J1 K and L independently can be integers from 0 to 10 and Q1 R and T can be optionally substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, or combinations thereof; and
[0253] (viii) optionally, one or more of R1, R2, R2, R3, R4, R5, R5, Re, R'e, R7, Rs, R9, R'g, and R1O, can be individually bound to an atom of heterocycles U, V and W to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2)L -
[0254] wherein
[0255] I1 J1 K and L independently can be integers from 0 to 10 and Q1 R and T can be optionally substituted moieties independently including alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, or combinations thereof; and
[0256] (ix) combinations of any of (i) through (viii) above; and [0257] wherein
[0258] M can be a transition metal;
[0259] X, Y and Z can independently include halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, or anions of ion exchange resins, or the corresponding anions thereof; or
[0260] X, Y and Z can independently include charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
[0261] X, Y and Z can independently be attached to one or more of Ri, R2, R2, R3, R4, R5, R'5, Re, R'βi R71 Re. R91 R'θi and R10! and
[0262] n can be an integer from 0 to 3.
[0263] Particularly, the pentaaza-macrocyclic ligand complex can be represented by the following formulas:
Figure imgf000043_0001
Figure imgf000043_0002
or
Figure imgf000043_0003
[0264] In another aspect, W of the pentaaza-macrocyclic ligand complex can be a substituted pyridino moiety.
[0265] In yet another aspect, the superoxide dismutase mimetic can be a porphyrin ligand complex or a substituted porphyrin ligand complex. Particularly, the porphyrin ligand complex can be selected from the group consisting of a manganese (II) porphyrin complex, manganese(lll) porphyrin complex, iron (II) porphyrin complex, and an iron(lll) porphyrin complex. Still further, the porphyrin ligand complex can be a 5,10,15, 20-tetrakis (2,4,6- trimethyl-3,5-disulfonatophenyl)-porphyrinato iron (III) (FeTMPS) complex.
[0266] Peroxynitrite Decomposition Catalysts
[0267] The peroxynitrite decomposition catalyst can be represented by a formula selected from the group of formulas consisting of: [0268] Structure
Figure imgf000044_0001
[0269] wherein R3, R6, Rg or R12 can independently include H, alkyl, alkenyl, CH2, COOH, phenyl, pyridinyl, or N-alkylpyridyl such that phenyl, pyridinyl and N-alkylpyridyl can be:
Phenyl
Figure imgf000044_0002
Pyridyl
N-Alkylpyridyl
Figure imgf000044_0003
[0270] which can be attached at a carbon atom, and
[0271] wherein phenyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH2, SO3H, NO2, NH2, N(R)3+ or NHCOR' wherein R can include hydrogen, alkyl, aryl and alkaryl and R1 can be alkyl, and
[0272} pyridinyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH2, SO3H, NO2, NH2, N(R)3+ or NHCOR' wherein R and R' can be as defined above, and
[0273] N-alkylpyridyl can optionally be substituted by halogen, alkyl, aryl, benzyl, COOH, CONH2, SO3H, NO2, NH2, N(R)3+ or NHCOR' wherein R and R' can be as defined above; and
[0274] wherein Ri, R2, R4, R5, R7, Rs, Rio> or R11 can independently include H, alkyl, alkenyl, carboxyalkyl, Cl, Br, F, NO2, hydroxyalkyl, or SO3H, and further wherein R1R2 can be taken together to form a ring of from 5 to 8 carbons, and
[0275] X and Y can be ligands or charge-neutralizing anions which can be derived from any monodentate or polydentate coordinating ligand or ligand system or the corresponding anion thereof and can be independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl, amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkyl aryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkyl aryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluorophosphate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, or anions of ion exchange resins, with the proviso that when the X and Y containing complex has a net positive charge then Z can be a counter ion which can be independently selected from the group consisting of X and Y, or when the X and Y containing complex has net negative charge then Z can be a counter ion selected from a group consisting of alkaline and alkaline earth cations, organic cations such as alkyl or alkylaryl ammonium cations;
[0276] M can be selected from the group consisting of Mn, Fe, Ni and V; and
[0277] n can be an integer from 1 to 3; or
[0278] Structure Il
Figure imgf000046_0001
[0279] wherein R' can be CH or N;
[0280] Ri, R2, R3, R4, R5. Re, R7. Re1 R9. Rio> R11. Ri2> Ri3, R-I4. Ri5i and R-iβ can independently include H1 SO3H, COOH, NO2, NH2, and N-alkylamino; and [0281] X, Y, Z, M and n can be as defined above; [0282] Structure III
Figure imgf000046_0002
[0283] wherein R1, R5, R9, and R13 can independently include a direct bond and
CH2
[0284] R2, R2', R4, R4', Re, Re , Rs, Re'. R10. R10'. R12. R12', R14. R141. R16. and R16 1 can independently include H and alkyl;
[0285] R3, R7, R-n, Ri5 can independently include H and alkyl; and [0286] X, Y, Z, M and n can be as defined above;
Figure imgf000047_0001
B [0287] wherein R1, R5, R8, and Ri2 can independently include a direct bond and
CH2
[0288] R2, R2 1, R4, R4', Re, R6', R7, R9, R9', Rn, Rn', R13, Ru1, and R14 can independently include H and alkyl;
[0289] R3 and R10 can independently include H and alkyl; and [0290] X, Y, Z, M and n can be as defined above;
Figure imgf000047_0002
[0291] wherein R1, R4, R8, R12 can independently include direct bond and CH2; [0292] R2, R2', R3, R5, Rs', R7. RQ, R9', Rn, Rn', R13. R131 and R14 can independently include H and alkyl;
[0293] R-io can be H or alkyl; and
[0294] X, Y, Z, M and n can be as defined above;
Figure imgf000048_0001
D
[0295] wherein R1, R4, R7 and R10 can independently include direct bond and CH2; [0296] R2, R2', R3, R5, Rs , Re, Rs, Rs', Rg, Rii, Rn' and Ri2 can independently include H and alkyl; and
[0297] X, Y, Z, M and n can be as defined above;
Figure imgf000048_0002
[0298] wherein Ri, R4, Rs and R11 can independently include a direct bond and
CH2;
[0299] R2, R3, R3 1, R5, Rs1, R?. R?', Rg, Rio, R-io', R12, R12' and R13 can independently include H and alkyl;
[0300] R6 can be hydrogen or alkyl; and
[0301] X, Y, Z, M and n can be as defined above;
Figure imgf000049_0001
[0302] wherein R1, R4, R7 and R10 can independently include H and alkyl; [0303] R2, R3, Ra', Rs, R5', Re, Re, Rg, FV. RH , RH1 and R12 can independently include H and alkyl; and
[0304] X, Y, Z, M and n can be as defined above;
Figure imgf000049_0002
G
[0305] wherein R1, R3, R4 and R6 can independently include H and alkyl; [0306] R2 and R5 can independently include H, alkyl, SO3H, NO2, NH2, halogen, COOH and N(R)3+ wherein R can be as defined above; and [0307] X, Y, Z, M and n can be as defined above;
Figure imgf000050_0001
H
[0308] wherein R1, R2, R3, R4 can independently include H, alkyl, SO3H, NO2, NH2, halogen, COOH and N(R)3+ wherein R can be as defined above; and [0309] X, Y, Z, M and n can be as defined above; and [0310] Structure IV
Figure imgf000050_0002
[0311] wherein R1, R1", R2, R2', R3, R3', R4, R4', Rs, R5', Re, Re1, R7 and R7' can independently include H, alkyl, alkoxy, NO2, aryl, halogen, NH2 and SO3H, wherein R6, Re', R7 and R7' may each be taken together with one other of R6, R6', R7 and R7' to form a cyclic group, preferably a 6 carbon cycloalkyl group;
[0312] M1 can be selected from the group consisting of Fe, Ni or V; and
[0313] X, Y, Z and n can be as defined above.
[0314] Activity of the porphyrin compounds or complexes of the present invention for catalyzing the dismutation of superoxide can be demonstrated using the stopped-flow kinetic analysis technique as described in Riley et al., Anal. Biochem. 196, 344-349 (1991) which is incorporated herein by reference. The stopped-flow kinetic analysis is suitable for screening compounds for SOD activity and activity of the porphyrin compounds or 'complexes of the present invention, as shown by stopped-flow analysis, correlate to treating the above disease states and disorders. However, the stopped-flow analysis is not an appropriate method for demonstrating the activity of all superoxide dismutase mimics. Other methods may be appropriate or preferred for some SOD mimics. See Weiss et al., J. Biol. Chem. 268(31), 23049-54 (Nov. 5, 1993).
[0315] Contemplated equivalents of the general formulas set forth above for the compounds and derivatives as well as the intermediates are compounds otherwise corresponding thereto and having the same general properties such as tautomers of the compounds and such as wherein one or more of the various R groups are simple variations of the substituents as defined therein, e.g., wherein R is a higher alkyl group than that indicated, or where the tosyl groups are other nitrogen or oxygen protecting groups or wherein the O-tosyl is a halide. Anions having a charge other than 1 , e.g., carbonate, phosphate, and hydrogen phosphate, can be used instead of anions having a charge of 1 , so long as they do not adversely affect the overall activity of the complex. However, using anions having a charge other than 1 will result in a slight modification of the general formula for the complex set forth above. In addition, where a substituent is designated as, or can be, a hydrogen, the exact chemical nature of a substituent which is other than hydrogen at that position, e.g., a hydrocarbyl radical or a halogen, hydroxy, amino and the like functional group, is not critical so long as it does not adversely affect the overall activity and/or synthesis procedure. Further, it is contemplated that manganese(lll) complexes will be equivalent to the subject manganese(ll) complexes.
[0316] Therapeutic Preparations
[0317] For use in the methods of the invention, the compounds of the invention can be formulated as pharmaceutical or veterinary compositions. Depending on the subject to be treated, the mode of administration, and the type of treatment desired (e.g., inhibition, prevention, prophylaxis, therapy), the compounds can be formulated in ways consonant with these parameters. The compounds of the present invention can comprise a therapeutically or prophylactically effective dosage of a catalyst. The catalyst can be used in combination with a pharmaceutically acceptable carrier, either in the same formulation or in separate formulations.
[0318] The catalysts of the present invention can be incorporated in conventional pharmaceutical formulations (e.g., injectable solutions) for use in treating humans or animals in need thereof. Pharmaceutical compositions can be administered by subcutaneous, intravenous, or intramuscular injection, or as large volume parenteral solutions and the like. The term parenteral as used herein includes subcutaneous injections, intravenous, intramuscular, intrastemal injection, or infusion techniques.
[0319] For example, a parenteral therapeutic composition may comprise a sterile isotonic saline solution containing between 0.1 percent and 90 percent weight to volume of the catalysts for the dismutation of superoxide. A preferred solution contains from about 5 percent to about 25 weight percent catalysts for dismutation of superoxide in solution (% weight per volume).
[0320] The dosage of catalyst to be used may vary. A primary consideration for the dosage level of the catalysts is the monitoring of the known side effects in an individual.
[0321] Additionally, one skilled in the art will appreciate that the methods of this invention may be used in conjunction with other therapies for heart failure, as are appropriate for any particular subject.
[0322] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1 ,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
[0323] The preparations may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the catalyst for the dismutation of superoxide. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.
[0324] The amount of catalyst that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. It will be appreciated that the unit content of active ingredients contained in an individual dose of each dosage form need not in itself constitute an effective amount, as the necessary effective amount could be reached by administration of a number of individual doses. The selection of dosage depends upon the dosage form utilized, the condition being treated, and the particular purpose to be achieved according to the determination of those skilled in the art. [0325] The dosage regimen for treating a disease condition with the compounds and/or compositions of this invention is selected in accordance with a variety of factors, including the type, age, weight, sex, diet and medical condition of the patient, the route of administration, pharmacological considerations such as the activity, efficacy, pharmacokinetic and toxicology profiles of the particular compound employed, whether a drug delivery system is utilized and whether the compound is administered as part of a drug combination. Thus, the dosage regimen actually employed may vary widely and therefore may deviate from the preferred dosage regimen set forth above. In one embodiment, the treatment comprises administering to a mammal in need of such treatment an amount of 10 mg/kg or less of a non-proteinaceous catalyst for the dismutation of superoxide anions, or a pharmaceutically acceptable salt, hydrate, solvate, or pro-drug thereof. For example, the amount of a non-proteinaceous catalyst for the dismutation of superoxide anions, or a pharmaceutically acceptable salt, hydrate, solvate, or pro-drug thereof, can be between about 0.1 μg and about 10.0 mg; between about 1.0 μg and about 1.0 mg; between about 5.0 μg and about 15.0μg; or between about 100.0 μg and about 300.0 μg.
[0326] The pharmaceutical compositions of the present invention are preferably administered to a human. However, besides being useful for human treatment, these extracts are also useful for veterinary treatment of companion animals, exotic animals and farm animals, including mammals, rodents, avians, and the like.
[0327] Effect of Oxidative Stress in the Failing Heart
[0328] NO reacts avidly with O2" to form ONOO' with two important results; first ONOO" has potent biological effects of its own that might contribute to the observed results; second, the reaction with O2" removes NO, thereby quenching its biological effects. Reactions with O2 *" are primarily confined to the compartment in which it is generated, so that the source of O2" affecting mitochondrial respiration is likely to be different from the O2" that might have an effect on endothelial function.
[0329] Oxygen Consumption in the Failing Heart [0330] The effect of heart failure on MVO2 is subject to some controversy. Hassenfuss et al (Basic Res. Cardiol. 87 Suppl. 1 , 107-116 (1992)) reported that both tension dependent (actin-myosin cross bridging) and tension independent (calcium cycling during contraction-relaxation) heat liberation were decreased in isolated muscle strips from failing human hearts, suggesting down regulation of energy utilizing processes. Oxygen consumption was decreased in saponin-skinned myocardial muscle bundles (Sharov et al., J MoI Cell Cardiol 30, 1757-1762 (1998)) as well as in isolated mitochondria (Saito et al., Recent Adv Stud Cardiac. Struct. Metab. 12, 199-202 (1976); Takaki et al., J MoI Cell Cardiol 27, 2009-2013 (1995)) obtained from failing hearts. In the in vivo situation, alterations in substrate preference in the failing heart, with decreased free fatty acid uptake and increased glucose utilization, could contribute to decreased oxygen utilization (Davila- Roman et al., J. Am. Coll. Cardiol.40, 271-277 (2002». In previous studies CHF produced by rapid ventricular pacing in dogs was associated with decreased MVO2 at rest and during treadmill exercise (Traverse et al., Circ. Res. 84, 401-408 (1999); Chen et al., Circulation 106, 273-279 (2002)) that was strongly correlated with the decrease of LV dP/dtmax. It has also been reported that CHF produced by 4-weeks of rapid ventricular pacing resulted in a -40% decrease of MVO2, although this did not achieve statistical significance (Recchia et al., Circ. Res. 83. 969-979 (1998)). In contrast, Shen et al. (Circulation 100, 2113-2118 (1999)) found an increase in MVO2 after the development of heart failure. It is likely that the differing results may be related to differences in the duration and severity of CHF, as well as in the specific protocols used to produce heart failure.
I
[0331] NO Regulation of Myocardial Oxygen Consumption
[0332] At physiologic concentrations NO can modulate mitochondrial respiration and ATP production through reversible binding to the oxygen-binding site of cytochrome oxidase (Borutaite et al., Biochim Biophys Acta 1459, 405-412 (2000)). Blockade of NO production with nonselective NOS inhibitors increased MVO2 in normal animals at rest and during treadmill exercise (Bernstein et al., Circ. Res. 79, 840-848 (1996); Altman et al., Cardiovasc. Res. 28, 119-124 (1994); Chen et al., Circulation 106, 273-279 (2002)). Conversely, stimulating endogenous endothelial NO production with bradykinin or administering an NO donor decreased oxygen consumption in isolated crystalloid perfused rat hearts (Poderoso et al., Am J Physiol 274, C112-119 (1998)) and in myocardial tissue slices from normal and failing hearts (Xie et al., Circ Res 79, 381-387 (1996); Xie et al., Circulation 94, 2580-2586 (1996)). KeIm et al. (Cardiovasc Res 36, 185-194 (1997)) demonstrated that the addition of an NO donor to the perfusate of isolated guinea pig hearts resulted in reversible decreases of MVO2, myocardial PCr, ATP and cardiac contractility, suggesting that NO can directly regulate both mitochondrial oxygen consumption and ATP production. In dogs with pacing-induced heart failure it has been reported that blockade of NO production with the nonselective NOS inhibitor LNA or the selective iNOS inhibitor S- methylisothiourea resulted in significant increases of MVO2 at rest and during exercise (Traverse et al., Circ Res 84, 401-408 (1999) ; Chen et al., Circulation 106, 273-279 (2002)). In addition to the inhibitory action of physiological concentrations of NO on mitochondrial respiration, high concentrations of NO can inhibit mitochondrial respiration by nitrosylating complexes I and Il of the electron transport chain (Borutaite et al., Biochim Biophys Acta 1459, 405-412 (2000); Riobo et a)., Biochem. J. 359:139-145 (2001)), and have been shown to increase O2" and hydrogen peroxide production in isolated mitochondria (Borutaite et al., Biochim Biophys Acta 1459, 405-412 (2000» and in perfused rat hearts (Poderoso et al., Am J Physiol 274, C112-119 (1998)), Unlike the rapidly reversible effects of NO on cytochrome oxidase, the protein modifications produced by supraphysiologic concentrations of NO are long lasting.
[0333] Oxidative Stress in Heart Failure
[0334] Heart failure of several etiologies is associated with increased myocardial free radical formation and increased products of oxygen free radical reactions (such as lipid peroxides) (Ide et al., Circ Res 85, 357-363 (1999); lde et al., Circ Res 8, 152-157 (2000); Dhalla 1996; Hill et al., Circulation 96, 2414-2420 (1997)). Furthermore, lde et al. reported that O2" and hydroxyl radical production were increased in mitochondria and submitochondrial particle fractions from pacing-induced failing canine hearts. These findings suggested that O2" might contribute to mitochondrial dysfunction in the failing heart. In isolated bovine LV muscle strips, pyrogallol, which generates O2" through autoxidation, caused respiratory inhibition that was only partially reversible after washout of the pyrogallol (Xie et al., Circ Res 79, 381-387 (1996); Xie et al., Circulation 94, 2580-2586 (1996)). The effect of pyrogallol was inhibited by the O2" scavenger tiron, but not the ONOO' scavenger urate, indicating that O2" can directly inhibit respiration without conversion to ONOO'. The combination of pyrogallol and the NO donor SNAP resulted in a greater inhibition of respiration than either pyrogallol or NO alone (Xie et al., Circ Res 79, 381-387 (1996); Xie et al., Circulation 94, 2580-2586 (1996)). Furthermore, the O2" scavenger tiron attenuated the inhibition produced by the combination of pyrogallol and SNAP (Xie et al., Circ Res 79, 381- 387 (1996); Xie et al., Circulation 94, 2580-2586 (1996)), implying that O2" can enhance the NO inhibition of respiration by formation of peroxynitrite. Since these effects occurred in nonworking muscle, they imply free radical mediated inhibition of mitochondrial respiration.
[0335] In addition to effects on mitochondria, free radicals have the potential to impair contractile function, possibly with a secondary decrease of myocardial energy utilization. The O2" scavenger tiron (Ferdinandy et al., Circ. Rec. 87, 241-247 (2000)) or OPC-6535 (Cheng et al., Cardiovasc Res 42, 651-659 (1999)) attenuated cytokine-induced myocardial failure, implicating a role for O2" in the contractile dysfunction. In open chest dogs with pacing-induced CHF, Arimura et al. (Am J Physiol Heart Circ Physiol 280, H68- H75 (2001)) reported that intracoronary infusion of the O2" scavenger tiron improved contractile function. In a previous study it was found that the depressed MVO2 in dogs with pacing-induced heart failure was strongly correlated with the decrease of LV dP/dtmax (Traverse et al., Circ Res 84, 401-408 (1999)).
[0336] Endothelial Dysfunction and Vascular O2 " in CHF [0337] Endothelium-derived NO is an important contributor to acetylcholine- induced vasodilation (Altman et al., Cardiovasc Res 28, 119-124 (1994)>and therefore decreased NO bioavailability could be responsible, at least in part, for the impaired acetylcholine response in heart failure. A decrease of NO bioavailability could result either from decreased production or increased inactivation of NO. Although no data are available from coronary resistance vessels, eNOS protein expression was increased (not decreased) in aortas from rats with LV dysfunction secondary to myocardial infarction (Bauersachs et al., Circulation 100, 292-298 (1999)). The presence of normal or increased vascular eNOS suggests that endothelial dysfunction was the result of augmented NO degradation. This concept is supported by the present finding that the SOD mimetic enhanced acetylcholine- induced coronary vasodilation. There are several possible endothelial sources of O2" including NADPH oxidase (Lang et al., Circ Res 86, 463-469 (2000); Hu et al., J. Biol. Chem. 277, 32546-32551 (2002); Li et al., Hypertension 40, 477-484 (2002)), uncoupled NOS that produces O2" rather than NO (Setoguchi et al., J Cardiovasc Pharmacol 39, 363-368 (2002)) and xanthine oxidase (Cappola et al., Circulation 104, 2407-2411 (2001); Landmesser et al., Circulation 106, 3073-3078 (2002)), and there is evidence that each of these sources may be increased in CHF (Cappola et al., Circulation 104, 2407-2411 (2001); Landmesser et al., Circulation 106, 3073-3078 (2002); Setoguchi et al., J Cardiovasc Pharmacol 39, 363-368 (2002); Li et al., Hypertension 40, 477-484 (2002)).
[0338] Previous studies using isolated aortic ring preparations have demonstrated impaired conduit vessel endothelial function in CHF animals that was associated with increased of O2'" and peroxynitrite production (Bauersachs et al., Circulation 100, 292-298 (1999); Wiemer et al., Hypertension 38, 1367-1371 (2001); Setoguchi et al., J Cardiovasc Pharmacol 39, 363-368 (2002)). In those previous studies, treatment with SOD improved endothelium-dependent vasodilation and normalized cGMP responses to the NO donor sodium nitroprusside, indicating that endothelial dysfunction resulted from inactivation NO by superoxide (Bauersachs et al., Circulation 100, 292-298 (1999)). Wiemer et al. (Hypertension 38, 1367-1371 (2001)) recently reported that calcium ionophore-induced NO release (assessed with a NO microsensor) was reduced in aortic endothelial cells from rats after the development of heart failure secondary to myocardial infarction, while O2'" and peroxynitrite production were increased. Arimura et al. (Am J Physiol Heart Circ Physiol 280, H68-H75 (2001)) reported that the O2" scavenger tiron improved endothelium- dependent coronary vasodilation in open chest dogs with CHF.
[0339] Superoxide Dismutases in Heart Failure
[0340] Three SOD isozymes have identified in the heart, including CuZn-SOD, which is primarily cytosolic in location, mitochondrial Mn-SOD, and extracellular EC-SOD (Oury, Lab Invest 75, 617-636 (1996); Fukai et al., Cardiovasc Res 55, 239-249 (2002)). Up to one half of the total SOD in vessels is EC-SOD, and EC-SOD has been implicated as a principal regulator of endothelium-derived NO bioavailability (Oury, Lab Invest 75, 617-636 (1996); Fukai et al., J. Clin. Invest. 101 , 2101-2111 (1998); Fukai et al., Cardiovasc Res 55, 239-249 (2002)). A decrease in SOD activity and an increase in lipid peroxides have been reported in volume overload heart failure in dogs (Prasad et al., J MoI Cell Cardiol 28, 375- 385 (1996)), pressure-overload heart failure in guinea pigs (Dhalla 1996), and myocardial infarct-induced heart failure in rats (Hill 1996). In addition, Landmesser et al. (Circulation 106, 3073-3078 (2002)) reported that EC-SOD was significantly decreased in coronary arteries of patients with heart failure, while Mn-SOD and CuZn-SOD were unchanged. Furthermore, they found that depression of endothelium-dependent coronary vasodilation was strongly correlated with the decrease of endothelium-bound EC-SOD (Landmesser et al., Circulation 101 , 2264-2270 (2000».
[0341] EXAMPLES
[0342] Aspects of the present teachings may be further understood in light of the following examples, which should not be construed as limiting the scope of the present teachings in any way.
[0343] Example 1 -- Effect Of Superoxide Dismutase Mimetics In The Normal Heart
[0344] Example 1 was performed in adult mongrel dogs weighing 20-26 kg trained to run on a treadmill. All experiments were performed in accordance with the Guiding Principles in the Care and Use of Laboratory Animals as approved by the council of the American Physiological Society and with prior approval of the University of Minnesota Animal Care Committee.
[0345] Surgical Preparation
[0346] Animals were anesthetized with sodium pentobarbital (25-30 mg/kg), intubated, and ventilated with 1-2 % isoflurane supplemented with oxygen. A left thoracotomy was performed and polyvinyl chloride catheters (3.0 mm OD) were inserted into the ascending aorta and the left ventricfe (LV). A solid-state micromanometer (Konigsberg Instruments, Pasadena, CA) was introduced into the LV at the apex. A final catheter was introduced into the right atrial appendage and advanced through the coronary sinus until the tip could be palpated at the origin of the anterior interventricular vein to allow selective sampling of blood draining the myocardium perfused by the left anterior descending coronary artery (LAD). A Doppler velocity probe (Craig Hartley, Houston, TX) was positioned on the LAD for measurement of coronary blood flow (CBF) and a silicone catheter (0.3 mm ID) was introduced into the LAD distal to the velocity probe. Catheters were tunneled to exit at the base of the neck; catheters were flushed daily to maintain patency. Postoperative analgesia was provided with butorphanol, 0.4μg/kg S.Q. q 4-6 h.
[0347] Production of CHF
[0348] CHF was produced by rapid ventricular pacing (Traverse et al., Circ Res 84, 401-408 (1999)). After completion of studies during normal conditions, the pacemaker was activated at 220 beats/min; pacing was continued at this rate or adjusted upward to a maximum of 250 beats/min based on weekly assessments of hemodynamics obtained 30 minutes after deactivating the pacemaker. CHF was deemed to have developed when resting LVEDP was >20 mmHg or visual estimation of ejection fraction by 2-dimensional echocardiography was <30%.
[0349] Hemodynamic Measurements
[0350] LV pressure was measured with the micromanometer; the first derivative of LV pressure (dP/dt) was obtained via electrical differentiation. Coronary blood velocity was measured with a Doppler flowmeter (Craig Hartley, Houston, TX). Data were recorded on an eight-channel recorder.
[0351] Myocardial Oxygen Consumption
[0352] PO2, PCO2, and pH were measured with a blood gas analyzer (Instrumentation Laboratory model 113, Lexington, MA). Hemoglobin was determined by the cyanmethemoglobin method. Hemoglobin oxygen saturation was calculated from the blood PO2, pH, and temperature using the oxygen dissociation curve for canine blood. Blood O2 content was computed as (hemoglobin x 1.34 x % O2 saturation) + (0.0031 x PO2). MVO2 was calculated as the product of LAD blood flow and the aortic-coronary vein O2 content difference. ' [0353] Western Blotting
[0354] Tissue homogenates of left ventricular myocardium were separated on 12% SDS-PAGE, transferred onto nitrocellulose membrane, followed by routine Western blotting. Antibodies against CuZn-SOD and Mn-SOD were purchased from BD Transduction Laboratories and Santa Cruz Biotech, respectively. The anti-extracellular SOD antibody was produced in our laboratory and has been previously reported (Fukai et al., J Clin Invest 101 , 2101-2111 (1998)). °
[0355] Real-Time RT-PCR
[0356] One μg of total RNA was reverse-transcribed using random hexamers and Moloney murine leukemia virus (MMLV) reverse transcriptase (Life Technologies). Oligonucleotide primers were designed according the corresponding canine cDNA sequences in the NIH gene bank. The primer sequences of CuZn-SOD were: Sense, 5'- AGTGGGCCTGTTGTGGTATC (SEQ ID NO: 1); and antisense, 5'- AGTCACATTGCCCAGGTCTC (PCR-product of 189 bp) (SEQ ID NO: 2). The primer sequences of GAPDH were: sense, 5'-TGCCCCCATGTTTGTGATG (SEQ ID NO: 3), and antisense, 5'-CCAGCCCCAGCGTCAAAGGTG (product of 519 bp) (SEQ ID NO: 4). mRNA levels were compared by quantitative real-time RT-PCR analysis, using the Light Cycler Thermocycler (Roche Diagnostics Corp). Reactions were prepared in the presence of the fluorescent dye SYBR green I for specific detection of double-stranded DNA. Quantification was performed in the log-linear phase of the reaction and cycle numbers obtained at this point were plotted against a standard curve prepared from serially diluted control samples. Results were normalized to GAPDH expression levels.
[0357] Data Analysis
[0358] Hemodynamic variables were measured from the chart recordings. Coronary flow was computed from the Doppler shift as previously described (1). Statistical analysis was performed using two-way (exercise level and treatment) ANOVA for repeated measures. Comparisons within groups were made using one-way ANOVA followed by Scheffe's post-hoc test. Comparisons between groups were made using Student's independent t-test. Significance was accepted at p<0.05. Data are presented as mean±SEM.
[0359] Effect of SOD Mimetics in the Normal Heart
[0360] The SOD mimetic M40401 was studied in seven normal dogs 10-14 days after surgery. Resting hemodynamics were recorded and 2 ml of blood was withdrawn from the aortic and coronary venous catheters for blood gas analysis. Subsequently, a 3-stage treadmill exercise protocol was begun (Stage 1: 3.2 km/hr at 0% grade; stage 2: 6.4 km/hr at 0% grade; stage 3: 6.4 km/hr at 5%). Each exercise stage was three minutes in duration; aortic and coronary venous blood samples were withdrawn during the last 30 seconds of each exercise stage. After a 10 minute rest period, M40401 , 1.5 mg/kg i.v. was infused over 10 minutes. Forty minutes after M40401 all measurements were repeated at rest and during exercise.
[0361] In the seven normal animals the SOD mimetic M40401 caused no significant hemodynamic changes at rest or during exercise, and had no effect on CBF or MVO2 (Table 1). The relationships between CBF or MVO2 and rate pressure product were unchanged after administration of the SOD mimetic M40401 (Figures 1 and 2).
[0362] Example 2 - Effect of SOD Mimetics in Animals with Heart Failure
[0363] The effect of the SOD mimetic M40401 was examined in eight CHF dogs. The methods for preparing the animals and collecting and analyzing data were the same as for Example 1 , except where specific differences are described. Studies were performed during sinus rhythm beginning 30 minutes after deactivating the pacemaker. Measurements were first obtained at rest and during two stages of treadmill exercise (3.2 km/h, 0% grade and 6.4 km/h, 0% grade); animals with CHF had exercise intolerance and were unable to perform the third exercise stage. M40401 (1.5 mg/kg i.v.) was then infused over 10 minutes and 40 minutes later rest and exercise measurements were repeated.
[0364] As shown in Table 2, heart failure was associated with increases in resting heart rate and LVEDP, and decreases of aortic pressure, LV systolic pressure (LVSP), LV dp/dtmax, CBF and MVO2 (each p<0.05). M40401 caused a small but significant decrease of LVEDP at rest and during exercise (p<0.05), while aortic pressure, LV systolic pressure, LV dP/dtmax and rate-pressure product were unchanged.
[0365] The SODm M40401 caused increases (p<0.05) in coronary blood flow and MVO2 at rest and during exercise in CHF dogs (Figures 1 and 2), while the relationship between MVO2 and CBF was unchanged. M40401 did not increase LV dP/dtma)( in the failing hearts, possibly because any O2 *"and peroxynitrite-induced protein modifications of the contractile apparatus would require a longer time period to recover. In the present study, the SOD mimetic M40401 caused significant increases of MVO2 and coronary blood flow at rest and during exercise in animals with CHF suggesting that O2" contributed to the depressed MVO2 in the failing hearts. Since the increase of CBF after M40401 in the failing hearts was not associated with an increase of coronary venous oxygen tension. [0366] Example 3 -- Effects of SODm and Acetycholine (Ach) in Heart Failure [0367] The methods for preparing the animals and collecting and analyzing data were the same as for the previous examples, except where specific differences are described. M40401 caused no change of heart rate or mean aortic pressure. However, M40401 significantly augmented the increase of coronary flow produced by acetylcholine (Figure 4), indicating enhanced endothelium-dependent vasodilation. The increase of CBF after M40401 in the failing hearts was associated with an increase of coronary venous oxygen tension after administration of a coronary vasodilator, the increase in coronary flow likely resulted from the increase of MVO2. Increase of coronary flow in response to acetylcholine was significantly decreased after the development of heart failure, in agreement with previous reports that CHF is associated with endothelial dysfunction (Traverse et al., Cardiovasc Res 52, 454-461 (2001); Wang et al., Am J Physiol 266, H670- H680 (1994)). This concept is supported by the present finding that the SOD mimetic enhanced acetylcholine-induced coronary vasodilation. In the present study, the SOD mimetic M40401 increased CBF at rest and during exercise and significantly enhanced acetylcholine induced coronary vasodilation in intact awake dogs with CHF but had no effect in normal dogs. These findings suggest that increased O2" production in the coronary resistance vessels is, at least in part, responsible for the blunted increase in coronary blood flow to acetylcholine in the failing heart.
[0368] Although Mn-SOD was increased in the failing hearts in the present study, this was apparently not sufficient to compensate for increased mitochondrial O2" production (Ide et al., Circ Res 85, 357-363 (1999); lde 2000). Consistent with this, EC-SOD was significantly decreased in the failing hearts, while Cu/Zn-SOD protein content was unchanged. The decreased EC-SOD protein expression suggests that attenuated O2" scavenging ability also could have contributed to endothelial dysfunction in the failing hearts.
[0369] Example 4 - Effects of SODm and ACh in The Normal Heart [0370] The methods for preparing the animals and collecting and analyzing data were the same as for the previous examples, except where specific differences are described. The effects of M40401 on the vasodilator response to acetylcholine were examined in five normal dogs. The increases in CBF produced by intracoronary acetylcholine (3.75 to 75 μg/min) were observed under control conditions, after M40401 (1.5 mg/kg intracoronary). The SOD mimetic M40401 had no effect on either resting coronary flow or the increase in flow produced by acetylcholine. In the present study, the SOD mimetic M40401 had no effect in normal dogs on CBF at rest and during exercise on acetylcholine induced coronary vasodilation in intact awake normal dogs. These findings suggest that increased O2*- production in the coronary resistance vessels is, at least in part, responsible for the blunted increase in coronary blood flow to acetylcholine in the failing heart.
[0371] Example 5 -- Effect of ACh Alone in The Normal Heart [0372] The methods for preparing the animals and collecting and analyzing data were the same as for the previous examples, except where specific differences are described. Coronary blood flow responses to acetylcholine are shown in Figures 3 and 4. lntracoronary infusion of acetylcholine in doses of 3.75 to 75 μg/min had no effect on heart rate or aortic pressure. Under control conditions, coronary flow increased from 60+4.9 ml/min at baseline to 190+8.7 ml/min during the maximum acetylcholine dose (75 μg/min). In the present example there was an increase of coronary flow in response to acetylcholine.
[0373] Example 6 - Effect of ACh with Heart Failure
[0374] The methods for preparing the animals and collecting and analyzing data were the same as for the previous examples, except where specific differences are described, lntracoronary infusion acetylcholine (3.75 to 75 μg/min) had no effect on heart rate or aortic pressure, but caused dose-dependent increases of CBF in dogs with CHF (Figures 3 and 4). In comparison to normal dogs, acetylcholine induced coronary vasodilation was significantly attenuated in CHF dogs (Figure 3). Under control conditions, coronary flow in the CHF dogs increased from 40+2.2 ml/min during basal conditions to 113+11 ml/min during the maximum acetylcholine dose (75 μg/min). In the present example the increase of coronary flow in response to acetylcholine was significantly decreased after the development of heart failure, in agreement with previous reports that CHF is associated with endothelial dysfunction (Traverse et al., Cardiovasc Res 52, 454-461 (2001); Wang et al., Am J Physiol 266, H670-H680 (1994)).
[0375] Example 7 - Effect Of LNA in the Normal Heart After Acetylcholine and After SODm in Normal Dogs
[0376] The methods for preparing the animals and collecting and analyzing data were the same as for the previous examples, except where specific differences are described. The effects of M40401 and the nitric oxide synthase inhibitor NG-nitro-l-arginine (LNA) on the vasodilator response to acetylcholine (ACh) were examined in five normal dogs (coronary endothelium-dependent vasodilation). The increases in CBF produced by intracoronary acetylcholine (3.75 to 75 μg/min) were observed under control conditions, after M40401 (1.5 mg/kg intracoronary), and after the addition of LNA, 1.5 mg/kg intracoronary. The increases in CBF produced by intracoronary acetylcholine (3.75 to 75 μg/min) were observed under control conditions, after M40401 (1.5 mg/kg intracoronary), Inhibition of NO production with LNA significantly (p<0.01) blunted the increase in coronary flow produced by acetylcholine (Figure 4).
[0377] Example 8 - Effect of LNA in Animals with Heart Failure After SODm
[0378] The methods for preparing the animals and collecting and analyzing data were the same as for Example 1 , except where specific differences are described. To study the effect of NOS blockade in dogs with CHF, LNA (1.5 mg/kg intracoronary) was administered to 6 dogs that previously had received M40401 and all measurements were repeated forty minutes later.
[0379] After completion of the M40401 measurements, in 5 dogs with CHF NOS inhibition with LNA (1.5 mg/kg intracoronary) was produced. In comparison with measurements after M40401 , LNA caused significant increases of aortic pressure, LV systolic pressure, LVEDP and rate-pressure product at rest and during exercise, while the heart rate and LV dP/dtmax were unchanged (Table 3). LNA also caused significant increases of MVO2 and coronary blood flow. The addition of LNA after M40401 caused a further increase of MVO2 in the failing hearts. Consequently, it was not unexpected that after M40401 the subsequent inhibition of NO synthesis with LNA would cause a further increase in MVO2. The addition of LNA after M40401 dramatically attenuated the acetylcholine-induced coronary vasodilation, supporting the concept that the enhanced coronary vasodilation after M40401 in CHF animals was due to an increase of NO bioavailability in the coronary resistance vessels.
[0380] Coronary endothelium-dependent vasodilation in CHF dogs: LNA inhibited the increase in coronary flow produced by acetylcholine (p<0.01).
[0381] Example 9 - Effect of SODms and LNA on Endothelium Dependent Coronary Vasodilation in Normal Dogs
[0382] The methods for preparing the animals and collecting and analyzing data were the same as for Example 1 , except where specific1 differences are described. Coronary blood flow responses to acetylcholine are shown in Figures 3 and 4. Intracoronary infusion of acetylcholine in doses of 3.75 to 75 μg/min had no effect on heart rate or aortic pressure. Under control conditions, coronary flow increased from 60+4.9 ml/min at baseline to 190+8.7 ml/min during the maximum acetylcholine dose (75 μg/min). M40401 had no effect on either resting coronary flow or the increase in flow produced by acetylcholine. Inhibition of NO production with LNA significantly (p<0.01) blunted the increase in coronary flow produced by acetylcholine (Figure 4).
[0383] Example 10 - Effect of SODms and LNA on Endothelium-Dependent Coronary Vasodilation in CHF Dogs
[0384] The methods for preparing the animals and collecting and analyzing data were the same as for Example 1 , except where specific differences are described, lntracoronary infusion acetylcholine (3.75 to 75 μg/min) had no effect on heart rate or aortic pressure, but caused dose-dependent increases of CBF in dogs with CHF (Figures 3 and 4). In comparison to normal dogs, acetylcholine induced coronary vasodilation was significantly attenuated in CHF dogs (Figure 3). Under control conditions, coronary flow in the CHF dogs increased from 40+2.2 ml/min during basal conditions to 113+11 ml/min during the maximum acetylcholine dose (75 μg/min). M40401 caused no change of heart rate or mean aortic pressure. However, M40401 significantly augmented the increase of coronary flow produced by acetylcholine (Figure 4), indicating enhanced endothelium-dependent vasodilation. As expected, LNA inhibited the increase in coronary flow produced by acetylcholine (p<0.01).
[0385] It is to be understood that the present invention has been described in detail by way of illustration and example in order to acquaint others skilled in the art with the invention, its principles, and its practical application. Particular formulations and processes of the present invention are not limited to the descriptions of the specific embodiments presented, but rather the descriptions and examples should be viewed in terms of the claims that follow and their equivalents. While some of the examples and descriptions above include some conclusions about the way the invention may function, the inventor does not intend to be bound by those conclusions and functions, but puts them forth only as possible explanations.
[0386] Other Embodiments
[0387] The detailed description set-forth above is provided to aid those skilled in the art in practicing the present invention. However, the invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed because these embodiments are intended as illustration of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description which do not depart from the spirit or scope of the present inventive discovery. Such modifications are also intended to fall within the scope of the appended claims. [0388] References Cited
[0389] All publications, patents, patent applications and other references cited in this application are incorporated herein by reference in their entirety for ail purposes to the same extent as if each individual publication, patent, patent application or other reference was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Citation of a reference herein shall not be construed as an admission that such is prior art to the present invention.

Claims

CLAIMS What is claimed is:
1. A method for treating congestive heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic.
2. A method for increasing coronary blood flow in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic.
3. A method for increasing MVO2 in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a superoxide dismutase mimetic.
4. A method according to claims 1 - 3, wherein the superoxide dismutase mimetic comprises an organic ligand chelated to a metal ion selected from the group of Mn(II), Mn(IlI), Fe(II)1 Fe (III), Cu(II)ZZn(III)1 and Cu(III)AZn (II).
5. A method according to claims 1 - 3, wherein the subject is selected from the group consisting of a mammal and avian.
6. A method according to claim 5, wherein the mammal is a human.
7. A method according to claims 1 - 3, wherein the catalyst is a pentaaza- macrocyclic ligand complex or a substituted pentaaza-macrocyclic ligand complex.
8. A method according to claim 7, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000066_0001
wherein
(i) one or more of R1, R^, R2, R'2, R3, R's, R4, R \, Rs, R 5, Re, R'β. R?, RV, R8, R'β, R9, Rg, R10, and R'1O are independently: (ia) hydrogen; or (ib) a moiety independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl; or
(ic) a moiety independently selected from the group consisting of -ORn,
-NR11R12, -COR11, -CO2R11, -CONR11R12, -SR11, -SOR11, -SO2R11, -SO2NRt1R12,
-N(OR11)(R12), -P(O)(OR11)(OR12), -P(O)(OR11)(R12), -OP(O)(OR11)(OR12), and substituents attached to the σ-carbon of α-amino acids, wherein R11 and R12 are independently hydrogen or alkyl; and
(ii) optionally, one or more of R1 or R'-i and R2 or R2, R3 or R 3 and R4 or R4, R5 or R'5 and R6 or R'6, R7 or R'7 and R8 or R'8, R9 or R'9 and R10 or R'1O together with the carbon atoms to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(iii> optionally, one or more of R-i and R'-i, R2 and R2, R3 and R3, R4 and R4, R5 and R5, R6 and R'6, R7 and R7, R8 and R8, Rg and R9, and Ri0 and R'1O, together with the carbon atom to ,which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(iv) optionally, one or more of R10 or R'1O and R1 or R'.,, R2 or R 2 and R3 or R'3, R4 or R'4 and R5 or R 5, R6 or R6 and R7 or R'7, or R8 or R'8 and R9 or R'9 together with the carbon atoms to which they are attached independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which is both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which are both part of the heterocycle and the macrocycle are absent; and
(v) optionally, one or more of R1, R'-,, R2, R 2, R3, R'3> R4, R4, R5, R 5, R6, R'6> R7, RV, Rs, R s, RQ. R'9, R10, and R'1O, together with a different one of R1, R'1; R2, R2, R3, R3, R4, R4, R5, R's, Re, R'e, R?, RV, RB, R 8, Rg, Rg, R10, and R'1O, which is attached to a different carbon atom in the macrocyclic ligand may be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2)L - wherein
I, J, K and L independently are integers from 0 to 10 and Q, R and T are optionally substituted moieties independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, aikynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycioalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, and combinations thereof; and
(vi) combinations of any of (i) through (v) above; and wherein
M is a transition metal;
X, Y and Z are independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, and anions of ion exchange resins, or the corresponding anions thereof; or X, Y and Z are independently selected from the group consisting of charge-neutralizing anions which are derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
X, Y and Z are independently attached to one or more of R1, R^, R2, R'2, R3, Rr 3> R4, R'4, R5, R'5, Re, R'β, R7. RV. Rs, R's, R9, R'91 R10, 3πd R'-io! snd n is an integer from 0 to 3.
9. A method according to claim 7, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000069_0001
wherein
(i) a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen is attached independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W having 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which is both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which are both part of the heterocycle and the macrocycle are absent; and
(ii) one or more of R1, R2, R'2, R3, R's, R4, R'4, R5, R's, R6, R'e, R7, RV, Rs, R's, R9, R'g, and R1O are independently:
(iia) hydrogen; or
(iib) a moiety independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, aikylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl; or
(iic) a moiety independently selected from the group consisting of -OR1I, -NR11R12, -COR11, -CO2R1I, -CONR11R12, -SR1-,, -SOR11, -SO2Ri1, -SO2NR11R12, -N(OR11)(R12), -P(O)(OR11)(OR12), -P(O)(OR11)(R12), -OP(O)(OR11)(OR12), and substituents attached to the σ-carbon of α-amino acids, wherein Rn and R12 are independently hydrogen or alkyl; and
(iii) optionally, one or more of Ri and R2 or R2, R3 or R'3 and R4 or R'4, R5 or R'5 and R6 or R'6> R7 or R'7 and R8 or R'8, R9 or Rg and R10 together with the carbon atoms to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(iv) optionally, one or more of R2 and R'2, R3 and R3, R4 and R4, R5 and R5, R6 and R'6l R7 and R7, R8 and R'8, and R9 and R'g, together with the carbon atom to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(v) ' optionally, one or more of R2 or R2 and R3 or R3, R4 or R'4 and R5 or R5, R6 or R6 and R7 or R7, or R8 or R'8 and Rg or R'g together with the carbon atoms to which they are attached independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which is both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which are both part of the heterocycle and the macrocycle are absent; and
(vi) optionally, one or more of R1, R2, R'2> R3, R3, R4, R4, Rs, Rs, Re, R'e, R?, RV, Rs, R's, Rg, Rg, and R10, together with a different one of R1, R2, R2, R3, R3, R4, R4, R5, R5, R6, R'6, R7, R7, R8, R's, R9, R9, and R10, which is attached to a different carbon atom in the macrocyclic ligand may be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2)L - • wherein
I1 J1 K and L independently are integers from 0 to 10 and Q, R and T are optionally substituted moieties independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, and combinations thereof; and
(vii) optionally, one or more of R1, R2, R2, R3, R3, R4, R4, R5, R5, R6, R6, R7, R'7, R8, R8, R9, R 9, and R10, may be bound to an atom of heterocycle W to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2)L - wherein I, J, K and L independently are integers from 0 to 10 and Q, R and T are optionally substituted moieties independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, suifonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, and combinations thereof; and
(viii) combinations of any of (i) through (vii) above; and wherein
M is a transition metal;
X, Y and Z are independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol tricarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, and anions of ion exchange resins, or the corresponding anions thereof; or
X, Y and Z are independently selected from the group consisting of charge-neutralizing anions which are derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or X, Y and Z are independently attached to one or more of R1, R2, R2, R3, R'3, R4, R 4, R5. R'51 Rβi R'β. R71 R 71 Rδ> R'δi R9. R'θi 3πd R-ioϊ and n is an integer from 0 to 3.
10. A method according to claim 7, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000072_0001
wherein
(i) a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen is attached independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W having 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which is both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which are both part of the heterocycle and the macrocycle are absent; and
(ii) two sets of two adjacent carbon atoms of the macrocycle independently form substituted or unsubstituted, saturated, partially saturated or unsaturated, cycles or heterocycles U and V having 3 to 20 carbon atoms; and
(iii) one or more of R1, R2, R'2, Rs, R4, Rs, R's, Re, R'e, R?, Ra, Rg, R'9, and R10 are independently:
(iiia) hydrogen; or
(iiib) a moiety independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl; or
(iiic) a moiety independently selected from the group consisting of -OR11,
-NR11R12, -COR11, -CO2R11, -CONR1IR12, -SR11, -SORi1, -SO2R11, -SO2NR11R12,
-N(OR11)(R12), -P(O)(OR11)(OR12), -P(O)(OR11)(R12), -OP(O)(OR11)(OR12), and substituents attached to the σ-carbon of σ-amino acids, wherein Rn and R12 are independently hydrogen or alkyl; and
(iv) optionally, one or more of R1 and R2 or R2, R5 or R'5 and R6 or R'6, R9 or R'9 and Rio together with the carbon atoms to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(v) optionally, one or more of R2 and R2, R5 and R's, Re and R '6, and R9 and R9, together with the carbon atom to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(vi) optionally, one or more of R2 or R2 and R3, R4 and R5 or R5, R6 or R6 and R7, or R8 and R9 or R9 together with the carbon atoms to which they are attached independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which is both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which are both part of the heterocycle and the macrocycle are absent; and
(vii) optionally, one or more of R1, R2, R2, R3, R4, Rs, R's, R6, R'e, R/, Rs, Rg, Rg, and R10, together with a different one of R1, R2, R'2, R3, R4, Rs, R's, R6, R'e, R7, Rs, Rg, Rg, and R10, which is attached to a different carbon atom in the macrocyclic ligand may be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2V - wherein
I1 J1 K and L independently are integers from 0 to 10 and Q, R and T are optionally substituted moieties independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, and combinations thereof; and
(viii) optionally, one or more of R1, R2, R2, R3, R4, R5, R5, R6, R'6, R7, Rs, Rg, Rg, and R10, may be individually bound to an atom of heterocycles U, V and W to form a strap represented, by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)κ -T -(CH2V - wherein I1 J1 K and L independently are integers from 0 to 10 and Q, R and T are optionally substituted moieties independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, and combinations thereof; and
(ix) combinations of any of (i) through (viii) above; and wherein
M is a transition metal;
X, Y and Z are independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, and anions of ion exchange resins, or the corresponding anions thereof; or
X, Y and Z are independently selected from the group consisting of charge-neutralizing anions which are derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or X, Y and Z are independently attached to one or more of R1, R2, R'2, R3, R4, R5, R'5, R6, R'β, R7, Rs, Rg, R'g, and R10; and n is an integer from 0 to 3.
11. A method according to claim 7, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000075_0001
12. A method according to claim 7, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000075_0002
13. A method according to claim 7, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000075_0003
14. A method according to claims 9 or 10, wherein W of the pentaaza- macrocyclic ligand complex is a substituted pyridino moiety.
15. A method according to claim 1 , wherein the superoxide dismutase mimetic is a porphyrin ligand complex or a substituted porphyrin ligand complex.
16. A method according to claim 15, wherein the porphyrin ligand complex is selected from the group consisting of a manganese (II) porphyrin complex, manganese(lll) porphyrin complex, iron (II) porphyrin complex, and an iron(lll) porphyrin complex.
17. A method according to claim 16, wherein the porphyrin ligand complex is a 5,10,15, 20-tetrakis (2,4,6-trimethyl-3,5-disulfonatophenyl)-porphyrinato iron (III) (FeTMPS) complex.
18. A method for diagnosing congestive heart failure in a subject, the method comprising: obtaining a first coronary blood flow or MVO2 measurement in the subject; administering a superoxide dismutase mimetic to the subject; and obtaining a second coronary blood flow or MVO2 measurement after administration of the catalyst to the subject, wherein an increase in coronary blood flow or MVO2 following administration of the superoxide dismutase mimetic is indicative of congestive heart failure.
19. A method according to claim 16, wherein the superoxide dismutase mimetic comprises an organic ligand chelated to a metal ion selected from the group of Mn(II), Mn(III), Fe(II), Fe (III), Cu(IIyZn(III), and Cu(IIIVZn (II).
20. A method according to claim 17, wherein the subject is selected from the group consisting of a mammal and avian.
21. A method according to claim 20, wherein the mammal is a human.
22. A method according to claim 18, wherein the superoxide dismutase mimetic is a pentaaza-macrocyclic ligand complex or a substituted pentaaza-macrocyclic ligand complex.
23. A method according to claim 22, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000077_0001
wherein
(i) one or more of R1, R'-,, R2, R'2, R3, R a, R4, RF4. Rs, R's, Re, R'e, R/, RV, Rs, R a, R9, Rg, R10, and R'1O are independently: (ia) hydrogen; or (ib) a moiety independently selected from the group consisting of alkenyl, alkenylcycioalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl; or
(ic) a moiety independently selected from the group consisting of -ORn,
-NRi1Ri2, -CORn, -CO2Rn, -CONR11R12, -SRn, -SORn, -SO2Rn, -SO2NR11R12,
-N(ORi1)(R12), -P(O)(OR11)(ORi2), -P(O)(OR11)(Ri2), -OP(O)(ORn)(ORi2), and substituents attached to the σ-carbon of σ-amino acids, wherein R11 and Ri2 are independently hydrogen or alkyl; and
(ii) optionally, one or more of R1 or R'i and R2 or R'2, R3 or R'3 and R4 or R'4, R5 or R'5 and R6 or R'6, R7 or R'7 and R8 or R'8, R9 or R9 and Ri0 or R'1O together with the carbon atoms to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(iii) optionally, one or more of R1 and R'-i, R2 and R2, R3 and R'3, R4 and R'4, R5 and R'5, R6 and R'6, R7 and R'7, Rs and R'8, R9 and R9, and Ri0 and R'i0, together with the carbon atom to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(iv) optionally, one or more of Ri0 or R'io and R1 or R\, R2 or R2 and R3 or R'3, R4 or R4 and R5 or R 5, R6 or R'6 and R7 or R'7, or R8 or R8 and R9 or R9 together with the carbon atoms to which they are attached independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which is both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which are both part of the heterocycle and the macrocycle are absent; and
(v) optionally, one or more of R1, R'-,, R2, R'2, R3, R'3> R4, R'4> Rs, R's, Re, R'e, R7, RV, Rs, R's, Rg, Rg, Rio, and R'1O, together with a different one Of R1, R^, R2, R2, R3, R3, R4, R4, Rs, R's, Re, R'e, R/, RV, Re, R's, Rg, R'ε>, Rio, and R'i0, which is attached to a different carbon atom in the macrocyclic ligand may be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)K -T -(CH2)L - wherein
I1 J1 K and L independently are integers from 0 to 10 and Q, R and T are optionally substituted moieties independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, and combinations thereof; and
(vi) combinations of any of (i) through (v) above; and wherein
M is a transition metal;
X, Y and Z are independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, and anions of ion exchange resins, or the corresponding anions thereof; or
X, Y and Z are independently selected from the group consisting of charge-neutralizing anions which are derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
X, Y and Z are independently attached to one or more of R1, R'-i, R2, R'2, R3, R 3, R4, R'4> R51 R'51 Rδ. R'β. R7. RVi Rs, R'β, RΘ> R'Θ, Rio, and R'-ioϊ and n is an integer from 0 to 3.
24. A method according to claim 22, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000079_0001
wherein
(i) a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen is attached independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W having 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which is both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which are both part of the heterocycle and the macrocycle are absent; and
(ii) one or more of R1, R2, R2, R3, R'3, R4, R'4, R5, R'β. R6, R'β, R?, RV, R8, R a, Rg, R'g, and R10 are independently: (iia) hydrogen; or
(iib) a moiety independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyciyl; or
(if) a moiety independently selected from the group consisting of -OR11,
-NR11Ri2, -COR11, -CO2R1I, -CONR11R12, -SR11, -SOR11, -SO2Ri1, -SO2NR11R12,
-N(OR11)(R12), -P(O)(OR11)(OR12), -P(O)(OR11)(R12), -OP(O)(OR11)(OR12), and substituents attached to the σ-carbon of σ-amino acids, wherein R11 and R12 are independently hydrogen or alkyl; and
(iii) optionally, one or more of R1 and R2 or R2, R3 or R'3 and R4 or R4, R5 or R'5 and R6 or R'6, R7 or R'7 and R8 or R8, Rg or R'9 and Ri0 together with the carbon atoms to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(iv) optionally, one or more of R2 and R'2> R3 and R'3, R4 and R4, R5 and R5, R6 and R6, R7 and R 7, Rs and R'8> and R9 and R'9, together with the carbon atom to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(v) optionally, one or more of R2 or R 2 and R3 or R'3> R4 or R4 and R5 or R5, R6 or R6 and R7 or R'7, or R8 or R'8 and R9 or R9 together with the carbon atoms to which they are attached independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which is both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which are both part of the heterocycle and the macrocycle are absent; and
(vi) optionally, one or more of R1, R2, R2, R3, R'3, R4, R4, R5, R5, R6, R6, R7, R7, Rs, Rs, Rg, R g. and R10, together with a different one of R1, R2, R2, R3, R'3l R4, R4, R5, R 5, R6, R6, R7, R'7, R8, Rr 8, Rg, R'9, and R10, which is attached to a different carbon atom in the macrocyclic ligand may be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)κ -T -(CH2)L - wherein
I1 J1 K and L independently are integers from O to 10 and Q, R and T are optionally substituted moieties independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, and combinations thereof; and
(vii) optionally, one or more of R1, R2, R'2, R3, R 3, R4, R'4, Rs, R 5, Re, R'e, R?, RV, Rs, R'β, R9, R'9, and Ri0, may be bound to an atom of heterocycle W to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)κ -T -(CH2).. - wherein
I, J, K and L independently are integers from 0 to 10 and Q, R and T are optionally substituted moieties independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide; phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, and combinations thereof; and
(viii) combinations of any of (i) through (vii) above; and wherein
M is a transition metal;
X, Y and Z are independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, and anions of ion exchange resins, or the corresponding anions thereof; or
X, Y and Z are independently selected from the group consisting of charge-neutralizing anions which are derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
X, Y and Z are independently attached to one or more of R1, R2, R'2, R3, R'3, R4, R'4, R5, R'5, Rε, R'β. R7> RVi Re1 R'βi R9, R'9. and R1Oi and n is an integer from 0 to 3.
25. A method according to claim 22, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000082_0001
wherein
(i) a nitrogen of the macrocycle and two adjacent carbon atoms to which the nitrogen is attached independently form a substituted or unsubstituted, saturated, partially saturated or unsaturated nitrogen-containing heterocycle W having 2 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which is both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which are both part of the heterocycle and the macrocycle are absent; and
(ii) two sets of two adjacent carbon atoms of the macrocycle independently form substituted or unsubstituted, saturated, partially saturated or unsaturated, cycles or heterocycles U and V having 3 to 20 carbon atoms; and
(iii) one or more of R1, R2, R2, R3, R4, Rs, R's, Re, R'β, R?, Rs, Rg, R'9, and R10 are independently:
(iiia) hydrogen; or (iiib) a moiety independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl; or
(iiic) a moiety independently selected from the group consisting of -OR11, -NR11R12, -COR11, -CO2R11, -CONRiiR12, -SR11, -SOR11, -SO2R11, -SO2NR11R12, -N(OR11)(R12), -P(O)(OR11)(OR12), -P(O)(OR11)(R12), -OP(O)(OR11)(OR12), and substituents attached to the σ-carbon of σ-amino acids, wherein R11 and R12 are independently hydrogen or alkyl; and
(iv) optionally, one or more of R1 and R2 or R2, R5 or R'5 and R6 or R'6l R9 or R '9 and R10 together with the carbon atoms to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(v) optionally, one or more of R2 and R2, R5 and R'5, R6 and R6, and R9 and R'g, together with the carbon atom to which they are attached independently form a substituted or unsubstituted and saturated, partially saturated, or unsaturated cycle or heterocycle having 3 to 20 carbon atoms; and
(vi) optionally, one or more of R2 or R2 and R3, R4 and R5 or R5, R6 or R'6 and R7, or R8 and R9 or R9 together with the carbon atoms to which they are attached independently form a substituted or unsubstituted nitrogen containing heterocycle having 3 to 20 carbon atoms, which may be an aromatic heterocycle in which case the hydrogen attached to the nitrogen which is both part of the heterocycle and the macrocycle and the R groups attached to the carbon atoms which are both part of the heterocycle and the macrocycle are absent; and
(vii) optionally, one or more of R1, R2, R2, R3, R4, R5, R'5, Re, R'e, R7, Rs, Rg, R9, and R10, together with a different one of R1, R2, R2, R3, R4, R5, R'5, Re, R'e, R?, Rs, R9, R'g, and R10, which is attached to a different carbon atom in the macrocyclic ligand may be bound to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)κ -T -(CH2)L - wherein
I1 J1 K and L independently are integers from O to 10 and Q1 R and T are optionally substituted moieties independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sulfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, and combinations thereof; and
(viii) optionally, one or more of R1, R2, R'2, R3, R4, Rs, R's, Re, R'e, Rz, Rs, R&, Rg, and R10, may be individually bound to an atom of heterocycles U, V and W to form a strap represented by the formula:
-(CH2), -Q -(CH2)J -R -(CH2)κ -T -(CH2)L - wherein
I, J, K and L independently are integers from 0 to 10 and Q, R and T are optionally substituted moieties independently selected from the group consisting of alkenyl, alkenylcycloalkenyl, alkenylcycloalkyl, alkyl, alkylcycloalkenyl, alkylcycloalkyl, alkynyl, aralkyl, aryl, cycloalkenyl, cycloalkyl, cycloalkylalkyl, cycloalkylcycloalkyl, cycloalkenylalkyl, and heterocyclyl, aza, amide, ammonium, oxa, thia, sύlfonyl, sulfinyl, sulfonamide, phosphoryl, phosphinyl, phosphino, phosphonium, keto, ester, alcohol, carbamate, urea, thiocarbonyl, borates, boranes, boraza, silyl, siloxy, silaza, and combinations thereof; and
(ix) combinations of any of (i) through (viii) above; and wherein
M is a transition metal;
X, Y and Z are independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkylaryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkylaryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, and anions of ion exchange resins, or the corresponding anions thereof; or
X, Y and Z are independently selected from the group consisting of charge-neutralizing anions which are derived from any monodentate or polydentate coordinating ligand and a ligand system and the corresponding anion thereof; or
X, Y and Z are independently attached to one or more of R1, R2, R'2) R3, R4, R5, R'5, R6, R'δ, R7, R8, R9, Rg, and R10; and n is an integer from 0 to 3.
26. A method according to claim 22, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000085_0001
27. A method according to claim 22, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000085_0002
28. A method according to claim 22, wherein the pentaaza-macrocyclic ligand complex is represented by the following formula:
Figure imgf000086_0001
29. A method according to claims 24 or 25, wherein W of the pentaaza- macrocyclic ligand complex is a substituted pyridino moiety.
30. A method according to claim 18, wherein the superoxide dismutase mimetic is a porphyrin ligand complex or a substituted porphyrin ligand complex.
31. A method according to claim 30, wherein the porphyrin ligand complex is selected from the group consisting of a manganese (II) porphyrin complex, manganese(lll) porphyrin complex, iron (II) porphyrin complex, and an iron(lll) porphyrin complex.
32. A method according to claim 32, wherein the porphyrin ligand complex is a 5,10,15, 20-tetrakis (2,4,6-trimethyl-3,5-disulfonatophenyl)-porphyrinato iron (III) (FeTMPS) complex.
33. A method for treating heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a peroxynitrite decomposition catalyst.
34. A method for increasing coronary blood flow in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a peroxynitrite decomposition catalyst.
35. A method for increasing MVO2 in heart failure, the method comprising administering to a subject in need thereof a therapeutically effective amount of a peroxynitrite decomposition catalyst.
36. A method according to claims 33 - 35, wherein the subject is selected from the group consisting of a mammal and avian.
37. A method according to claim 36, wherein the mammal is a human.
38. A method according to claims 33 - 35, wherein the peroxynitrite decomposition catalyst is represented by a formula selected from the group of formulas consisting of: Structure I
Figure imgf000087_0001
wherein R3, R6, Ra or R12 are independently selected from the group consisting of H, alkyl, alkenyl, CH2, COOH, phenyl, pyridinyl, and N-alkylpyridy! such that phenyl, pyridinyl and N-alkylpyridyl are:
Phenyl
Figure imgf000087_0002
Pyridyl
N-Alkylpyridyl
Figure imgf000087_0003
which are attached at a carbon atom; and wherein phenyl is optionally substituted by halogen, alkyl, aryl, benzyl, COOH, CONH2, SO3H, NO2, NH2, N(R)3+ or NHCOR' wherein R is selected from the group consisting of hydrogen, alkyl, aryl and alkaryl; and R1 is alkyl; pyridinyl is optionally substituted by halogen, alkyl, aryl, benzyl, COOH, CONH2, SO3H, NO2, NH2, N(R)3+ or NHCOR1 wherein R and R' are as defined above; and
N-alkylpyridyl is optionally substituted by halogen, alkyl, aryl, benzyl, COOH, CONH2, SO3H, NO2, NH2, N(R)3+ or NHCOR' wherein R and R' are as defined above; and wherein R1, R2, R4, R5, R7, Rs, R10. or Rn are independently selected from the group consisting of H, alkyl, alkenyl, carboxyalkyl, Cl, Br1 F, NO2, hydroxyalkyl, and SO3H; and further wherein R1R2 can be taken together to form a ring of from 5 to 8 carbons;
X and Y are ligands or charge-neutralizing anions which are derived from any monodentate or polydentate coordinating ligand or ligand system or the corresponding anion thereof and are independently selected from the group consisting of halide, oxo, aquo, hydroxo, alcohol, phenol, dioxygen, peroxo, hydroperoxo, alkylperoxo, arylperoxo, ammonia, alkylamino, arylamino, heterocycloalkyl amino, heterocycloaryl, amino, amine oxides, hydrazine, alkyl hydrazine, aryl hydrazine, nitric oxide, cyanide, cyanate, thiocyanate, isocyanate, isothiocyanate, alkyl nitrile, aryl nitrile, alkyl isonitrile, aryl isonitrile, nitrate, nitrite, azido, alkyl sulfonic acid, aryl sulfonic acid, alkyl sulfoxide, aryl sulfoxide, alkyl aryl sulfoxide, alkyl sulfenic acid, aryl sulfenic acid, alkyl sulfinic acid, aryl sulfinic acid, alkyl thiol carboxylic acid, aryl thiol carboxylic acid, alkyl thiol thiocarboxylic acid, aryl thiol thiocarboxylic acid, alkyl carboxylic acid, aryl carboxylic acid, urea, alkyl urea, aryl urea, alkyl aryl urea, thiourea, alkyl thiourea, aryl thiourea, alkyl aryl thiourea, sulfate, sulfite, bisulfate, bisulfite, thiosulfate, thiosulfite, hydrosulfite, alkyl phosphine, aryl phosphine, alkyl phosphine oxide, aryl phosphine oxide, alkyl aryl phosphine oxide, alkyl phosphine sulfide, aryl phosphine sulfide, alkyl aryl phosphine sulfide, alkyl phosphonic acid, aryl phosphonic acid-, alkyl phosphinic acid, aryl phosphinic acid, alkyl phosphinous acid, aryl phosphinous acid, phosphate, thiophosphate, phosphite, pyrophosphite, triphosphate, hydrogen phosphate, dihydrogen phosphate, alkyl guanidino, aryl guanidino, alkyl aryl guanidino, alkyl carbamate, aryl carbamate, alkyl aryl carbamate, alkyl thiocarbamate, aryl thiocarbamate, alkyl aryl thiocarbamate, alkyl dithiocarbamate, aryl dithiocarbamate, alkyl aryl dithiocarbamate, bicarbonate, carbonate, perchlorate, chlorate, chlorite, hypochlorite, perbromate, bromate, bromite, hypobromite, tetrahalomanganate, tetrafluoroborate, hexafluorophosphate, hexafluoroantimonate, hypophosphite, iodate, periodate, metaborate, tetraaryl borate, tetra alkyl borate, tartrate, salicylate, succinate, citrate, ascorbate, saccharinate, amino acid, hydroxamic acid, thiotosylate, and anions of ion exchange resins; with the proviso that when the X and Y containing complex has a net positive charge then Z is a counter ion which is independently selected from the group consisting of X and Y, or when the X and Y containing complex has net negative charge then Z is a counter ion selected from a group consisting of alkaline and alkaline earth cations, organic cations such as alkyl or alkylaryl ammonium cations; M is selected from the group consisting of Mn, Fe, Ni and V; and n is an integer from 1 to 3;
Structure Ii
Figure imgf000089_0001
wherein R1 is CH or N; ,
Ri . R21 R31 R4, R5. Re. R?. Rs. R9. Rio> R111 R12. Ri3ι R14. R15. ^rid Ri6 are independently selected from the group consisting of H, SO3H, COOH, NO2, NH2, and N- alkylamino; and
X, Y, Z, M and n are as defined above;
Structure
Figure imgf000089_0002
A wherein R1, R5, R9, and R13 are independently selected from the group consisting of a direct bond and CH2;
R2, R2 1, R4J R4 1I Re,
Figure imgf000090_0001
Re, Rs\ R101 RIO'> Ri2. Ri2'i Ri4, RWI R16, and R161 are independently selected from the group consisting of H and alkyl;
R3, R7. R11, Ri5 are independently selected from the group consisting of H and alkyl; and
X, Y, Z, M and n are as defined above;
Figure imgf000090_0002
B wherein R1, R5, R8, and R12 are independently selected from the group consisting of a direct bond and CH2;
R2, R2', R4, R4', R6, R6 1, R7, R91 Rg', Rii> Rn', R13, R13', and Rt4 are independently selected from the group consisting of H and alkyl;
R3 and R10 are independently selected from the group consisting of H and alkyl; and
X, Y, Z, M and n are as defined above;
Figure imgf000090_0003
wherein R-i, R4, R8, R12 are independently selected from the group consisting of a direct bond and CH2; R2> R2', R3, R5, R51, R7, Rg> R9', R11. R11'. Ri3, R13' and R14 are independently selected from the group consisting of H and alky]; R10 is H or alkyl; and X, Y, Z, M and n are as defined above;
Figure imgf000091_0001
D wherein R1, R4, R7 and Ri0 are independently selected from the group consisting of a direct bond and CH2;
R2, R2', R3, R5, R51, Re, Rs, Re'. R9, R11. R11' and R12 are independently selected from the group consisting of H and alkyl; and
X, Y, Z, M and n are as defined above;
Figure imgf000091_0002
wherein R-i, R4, R8 and R11 are independently selected from the group consisting of a direct bond and CH2;
R2, R3, R3', R5, R5', R7, R71, R9, R10, R10', R12, Ri2' and R-,3 are independently selected from the group consisting of H and alkyl;
R6 is hydrogen or alkyl; and
X, Y, Z, M and n are as defined above;
Figure imgf000092_0001
wherein R1, R4, R7 and R10 are independently selected from the group consisting of H and alkyl;
R2> R3, R31, R5, R51, Re, Rs, R9, R9', R11, R11' and R12 are independently selected from the group consisting of H and alkyl; and
X, Y, Z, M and n are as defined above;
Figure imgf000092_0002
G wherein R1, R3, R4 and R6 are independently selected from the group consisting of H and alkyl;
R2 and R5 are independently selected from the group consisting of H, alkyl, SO3H, NO2, NH2, halogen, COOH and N(R)3+ wherein R is as defined above; and
X, Y, Z, M and n are as defined above;
Figure imgf000093_0001
H wherein Ri, R2, R3, R4 are independently selected from the group consisting of H, alkyl, SO3H, NO2, NH2, halogen, COOH and N(R)3+ wherein R is as defined above; and X, Y, Z, M and n are as defined above; and
Structure IV
Figure imgf000093_0002
wherein R1, R1', R2, R2', R3, R3', R4, R41, Rs, R51, Re, Re', R? and R7' are independently selected from the group consisting of H, alkyl, alkoxy, NO2, aryl, halogen, NH2 and SO3H, wherein R6, R6', R7 and R7' may each be taken together with one other of R6, R6', R? and R7 1 to form a cyclic group, preferably a 6 carbon cycloalkyl group;
M1 is selected from the group consisting of Fe, Ni or V; and
X, Y, Z and n are as defined above.
PCT/US2005/034846 2004-09-24 2005-09-26 Methods for treating congestive heart failure Ceased WO2006037050A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US61303904P 2004-09-24 2004-09-24
US60/613,039 2004-09-24

Publications (2)

Publication Number Publication Date
WO2006037050A2 true WO2006037050A2 (en) 2006-04-06
WO2006037050A3 WO2006037050A3 (en) 2006-06-01

Family

ID=36119572

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/034846 Ceased WO2006037050A2 (en) 2004-09-24 2005-09-26 Methods for treating congestive heart failure

Country Status (1)

Country Link
WO (1) WO2006037050A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009027965A1 (en) * 2007-08-28 2009-03-05 Technion Research And Development Foundation Ltd. Transition metal complexes of corroles for preventing cardiovascular diseases or disorders

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0844889A1 (en) * 1995-08-17 1998-06-03 Monsanto Company Methods of diagnostic image analysis using metal complexes of nitrogen-containing macrocyclic ligands
GB9801398D0 (en) * 1998-01-22 1998-03-18 Anggard Erik E Chemical compounds
ATE312103T1 (en) * 1999-01-25 2005-12-15 Nat Jewish Med & Res Center SUBSTITUTED PORPHYRINS AND THEIR THERAPEUTIC USES

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009027965A1 (en) * 2007-08-28 2009-03-05 Technion Research And Development Foundation Ltd. Transition metal complexes of corroles for preventing cardiovascular diseases or disorders
AU2008293376B2 (en) * 2007-08-28 2013-07-11 Technion Research & Development Foundation Ltd. Transition metal complexes of corroles for preventing cardiovascular diseases or disorders
US8791099B2 (en) 2007-08-28 2014-07-29 Technion Research And Development Foundation Ltd. Transition metal complexes of corroles for preventing cardiovascular diseases or disorders

Also Published As

Publication number Publication date
WO2006037050A3 (en) 2006-06-01

Similar Documents

Publication Publication Date Title
DK2500018T3 (en) Prevention and / or treatment of cardiovascular disease and / or associated heart failure
US20230218633A1 (en) Methods of treating oral mucositis
Zhou et al. Designing Hypoxia‐Responsive Nanotheranostic Agents for Tumor Imaging and Therapy
Ding et al. Lead-induced hypertension: II. Response to sequential infusions ofL-arginine, superoxide dismutase, and nitroprusside
Vaziri et al. Role of nitric oxide resistance in erythropoietin-induced hypertension in rats with chronic renal failure
JP4162263B2 (en) Chelating agents and their metal chelates for treating free radical-induced conditions
Quyyumi et al. Nitric oxide activity in the human coronary circulation. Impact of risk factors for coronary atherosclerosis.
Horwitz et al. Iron-mediated cardiovascular injury
JP6831853B2 (en) Combinations for effective treatment of metastatic cancer in patients
Bianchi et al. A novel peroxynitrite decomposer catalyst (FP-15) reduces myocardial infarct size in an in vivo peroxynitrite decomposer and acute ischemia-reperfusion in pigs
Wu et al. Ghrelin maintains the cardiovascular stability in severe sepsis
WO2010096906A1 (en) Ethyl gallate and related compounds as a treatment for sepsis and septic shock
Kudryavtsev et al. Pharmacological efficacy of an inhibitor of arginase-2 KUD975 with L-NAME-induced endothelial dysfunction
WO2006037050A2 (en) Methods for treating congestive heart failure
US20090099150A1 (en) Methotrexate Combinations For Treating Inflammatory Diseases
US20040132706A1 (en) Composition comprising a catalyst for the dismutation of superoxide and use of the composition for preventing and treating hypotension
Morita et al. Studies of hypoxemic/reoxygenation injury: Without aortic clamping: IV. Role of the iron-catalyzed pathway: deferoxamine
Hatori et al. Beneficial effects of coronary venous retroinfusion but not left atrial administration of superoxide dismutase on myocardial necrosis in pigs
US20130131002A1 (en) Compositions and methods for treating pulmonary hypertension
JP2020143037A (en) Therapeutic pharmaceutical composition for heart failure associated with diabetes
CN112569255A (en) Metal-organic nano composite for efficiently triggering tumor cell iron death and construction method and application thereof
JP3860752B2 (en) Heme oxygenase-1 induction or induction enhancer
Finney et al. Pathophysiology of sepsis: the role of nitric oxide
Overgaard et al. The Effect of Vitamin C and L-NMMA on the Inotropic Response to Dobutamine in Patients with Heart Failure
Huang et al. Cuproptosis and Its Impact on Cardiovascular Health: Mechanisms and Therapeutic Opportunities

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase