WO2006034348A2 - Enhanced antisense oligonucleotides - Google Patents
Enhanced antisense oligonucleotides Download PDFInfo
- Publication number
- WO2006034348A2 WO2006034348A2 PCT/US2005/033837 US2005033837W WO2006034348A2 WO 2006034348 A2 WO2006034348 A2 WO 2006034348A2 US 2005033837 W US2005033837 W US 2005033837W WO 2006034348 A2 WO2006034348 A2 WO 2006034348A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gap
- wing
- region
- antisense oligonucleotide
- widened
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/12—Antihypertensives
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
Definitions
- the present invention provides chimeric antisense compounds having enhanced in vivo potency and thus an improved therapeutic index.
- the compounds described herein have widened deoxy gaps and enhanced in vivo potency which is unexpected based on their in vitro activity.
- Antisense oligonucleotides are accepted therapeutic modalities and many thousands of patients have been treated with antisense compounds.
- the original "first generation” antisense compounds employed in the first antisense clinical trials were oligodeoxynucleotides having 2'-deoxy ribonucleotides and phosphorotbioate internucleoside linkages.
- chimeric "second generation” antisense oligonucleotides exhibited a marked improvement in potency over first generation antisense oligonucleotides.
- Second generation antisense oligonucleotides are chimeric oligonucleotides typically having a 2'-deoxy "gap" region flanked by "wings” having nucleotides with 2'-modified ribonucleotides, referred to as "gapmers.”
- the most widely used of the "second generation” antisense motifs is often referred to as a "MOE gapmer" in which the 2'-modified ribonucleotide is a 2'-O-methoxyethyl (2'-MOE or simply MOE) modification, and each of the internucleotide linkages is a phosphorothioate.
- second generation oligonucleotides have a length of 20 nucleotides of which the 5 nucleotides at each terminus are 2'-MOE nucleotides and the center ten nucleotides are 2'-deoxyribonucleotides.
- These second generation oligonucleotides are referred to as "5-10-5 MOE gapmers" have a 5-10-5 wing-gap-wing motif. Chimeric antisense compounds with other arrangements of modifications have also been made.
- Hemimers are chimeric compounds in which there is a single 2'-modified "wing" adjacent to (on either the 5' ,or the 3' side of) a 2'-deoxy gap have been described (Geary et al., 2001, J. Pharm. Exp. Therap. , 296, 898-904).
- the present invention is directed to "gap-widened" antisense oligonucleotides having a gap region of greater than 11 2'deoxyribonucleotides flanked by two "wing" regions having from one to eight nucleotides which do not support RNase H activity.
- the gap-widened antisense oligonucleotide of the present invention have been shown to have an improved therapeutic index as compared to a corresponding antisense oligonucleotide having a 5-10-5 MOE gamer antisense oligonucletide with the same sequence.
- the gap-widened antisense oligonucleotides of the present invention exhibit increased in vivo potency or improved tissue exposure as compared with the corresponding 5-10-5 MOE gapmer antisense oligonucleotide with the same sequence. Most interestingly, there is a lack of correlation between the in vitro potency and the in vivo potency of the gap-widened antisense oligonucleotides described herein.
- the gap-widened antisense oligonucleotides of the present invention are 18 to 24 nucleotides in length.
- the gap-widened antisense oligonucleotides of the present invention have wing regions having 2'-O-(2-methoxyethyl) ribonucleotides.
- a method of reducing expression of a target RNA in an animal in need of reducing expression of said target RNA comprising administering to said animal a gap-widened antisense oligonucleotide 18 to 24 nucleotides in length comprising: a gap region having greater than 11 contiguous 2'-deoxyribonucleotides; and a first wing region and a second wing region flanking the gap region, wherein each of said first and second wing regions independently have 1 to 8 2'-O-(2-methoxyethyl) ribonucleotides, having an improved therapeutic index as compared to a corresponding 5-10-5 MOE gapmer antisense oligonucleotide having a gap region of 10 contiguous 2'-deoxyribonucleotides and a first wing region and a second wing region flanking the gap region of 5 2'-O-(2-methoxyethyl) ribonucleotides
- the improvement in therapeutic index is characterized by equal or increased potency coupled with a reduction in tissue concentration, or increased potency coupled with equal tissue exposures as compared to a corresponding 5-10-5 MOE gapmer antisense oligonucleotide of the same sequence.
- the improvement in therapeutic index may be characterized by an increased liver to kidney concentration ratio as compared to a corresponding 5-10-5 MOE gapmer antisense oligonucleotide of the same sequence.
- the method of the present invention is useful in reducing the expression of RNA targets expressed in the kidney, liver, or adipose tissues.
- the method of the present invention is also useful in reducing the expression of target RNA associated with a metabolic or cardiovascular disease or condition.
- the method of the present invention is useful wherein the metabolic disease or condition is selected from diabetes, hepatic steatosis, fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, or the like.
- the method of the present invention is useful wherein the cardiovascular disease or condition is selected from hypercholesterolemia, atherosclerosis, hyperlipidemia, familial hypercholesterolemia, or the like.
- An additional method of the present invention is a method of selecting a gap-widened antisense oligonucleotide with an improved therapeutic index, the method comprising: screening in vitro a plurality of antisense oligonucleotides targeting a human RNA and having a single wing-gap-wing motif; identifying a parent antisense oligonucleotide from the plurality of antisense oligonucleotides having a potent in vitro activity; synthesizing a plurality of gap-widened antisense oligonucleotides having the same sequence as the parent antisense oligonucleotide, wherein said gap-widened antisense oligonucleotide is 18 to 24 nucleotides in length comprising a gap region having greater than 11 contiguous T- deoxyribonucleotides; and a first wing region and a second wing region flanking the gap region, wherein each of said first and second wing regions independently has
- the method of selecting a gap-widened antisense oligonucleotide further comprises the step of designing a rodent sequence analogous or a non-human primate sequence to said parent antisense oligonucleotide.
- the step of determining the optimized gap- widened antisense oligonucleotide wing-gap-wing motif with an improved therapeutic index includes identifying a gap-widened antisense oligonucleotide which has equal or increased potency as compared to the parent antisense oligonucleotide.
- each of said antisense oligonucleotides has the same wing-gap-wing motif selected from 2-16-2, 3-14-3, 4-12-4, or 5-10-5.
- the wing portions of the gap-widened antisense oligonucleotides are 2'-O-(2-methoxyethyl) ribonucleotides.
- the step of screening is performed in primary hepatocytes, HepG2, bEND, or HeLa cells.
- the potent in vitro activity is greater than 50% reduction in the target mRNA expression as compared to a saline control.
- the potent in vitro activity is greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80%, or greater than 90%
- the gap-widened antisense oligonucleotides each have different wing-gap-wing motifs.
- the gap-widened antisense oligonucleotides have gaps of 12, 13, 14, 15, 16, 17, or 18 2'-deoxyribonucleotides in length.
- the animals are selected from rodents such as mice and rats, and non-human primates, such as cynomolgous monkeys.
- the tissue concentration data are concentrations of full-length gap- widened antisense oligonucleotides particularly measured in the liver, kidney, or adipose tissue.
- each optimized gap-widened antisense oligonucleotide is selected because of equal or improved potency data.
- each optimized gap-widened antisense oligonucleotide is selected because of reduced tissue exposure.
- each optimized gap-widened antisense oligonucleotide is selected because of reduced toxicity.
- each optimized gap-widened antisense oligonucleotide is selected because of improved therapeutic index.
- each optimized gap-widened antisense oligonucleotide is selected because of reduced tissue exposure, reduced toxicity, improved potency, or a combination thereof.
- the gap-widened antisense oligonucleotides described herein may have various wing-gap- wing motifs selected from: 1-16-1, 2-15-1, 1-15-2, 1-14-3, 3-14-1, 2-14-2, 1-13-4, 4-13-1, 2-13-3, 3- 13-2, 1-12-5, 5-12-1, 2-12-4, 4-12-2, 3-12-3, 1-11-6, 6-11-1, 2-11-5, 5-11-2, 3-11-4, 4-11-3, 1-17-1, 2- 16-1, 1-16-2, 1-15-3, 3-15-1, 2-15-2, 1-14-4, 4-14-1, 2-14-3, 3-14-2, 1-13-5, 5-13-1, 2-13-4, 4-13-2, 3- 13-3, 1-12-6, 6-12-1, 2-12-5, 5-12-2, 3-12-4, 4-12-3, 1-11-7, 7-11-1,
- Another aspect of the present invention is the use of a gap-widened antisense oligonucleotide 18- 24 nucleotides in length comprising: a gap region having greater than 11 contiguous T- deoxyribonucleotides; and a first wing region and a second wing region flanking the gap region, wherein each of said first and second wing regions independently have 1 to 8 2'-O-(2-methoxyethyl) ribonucleotides, having an improved therapeutic index as compared to a corresponding 5-10-5 antisense oligonucleotide having a gap region of 10 contiguous 2'-deoxyribonucleotides and a first wing region and a second wing region flanking the gap region of 5 2' -O-(2-methoxyethyl) ribonucleotides in the manufacture of a medicament for the treatment of disorders and diseases related to target RNA levels.
- Another embodiment of the present invention is a pharmaceutical composition
- Another embodiment of the present invention is a gap-widened antisense oligonucleotide 18-24 nucleotides in length comprising: a gap region having greater than 11 contiguous 2'-deoxyribonucleotides; and a first wing region and a second wing region flanking the gap region, wherein each of said first and second wing regions independently have 1 to 82'-O-(2- methoxyethyl) ribonucleotides, having lower kidney accumulation as compared to a corresponding 5- 10-5 antisense oligonucleotide having a gap region of 10 contiguous 2'-deoxyribonucleotides and a first wing region and a second wing region flanking the gap region of 5 2'-O-(2-methoxyethyl) ribonucleotides as measured by plasma protein binding capacity of said gap-widened antisense oligonucleotide.
- a method of modulating gene expression in an animal comprising the step of contacting said animal with the pharmaceutical composition.
- Another embodiment is a method of modulating gene expression in an animal comprising the step of contacting said animal with a gap-widened antisense oligonucleotide of the invention wherein the accumulation of the gap- widened antisense oligonucleotide in the kidney is less compared to a corresponding 5-10-5 antisense oligonucleotide having a gap region of 10 contiguous 2'-deoxyribonucleotides and a first wing region and a second wing region flanking the gap region of 5 2'-O-(2-methoxyethyl) ribonucleotides.
- the kidney accumulation is measured by plasma protein binding capacity of said gap- widened antisense oligonucleotide.
- Another embodiment of the present invention is a method of reducing levels of a preselected RNA target in the liver of an animal comprising administering to said animal a chimeric antisense compound 11 to 80 nucleobases in length which is targeted to said preselected RNA target wherein said chimeric antisense compound comprises a first gap region consisting of at least 10 contiguous T- deoxynucleotides and a wing region which consists of from 1 to 4 contiguous nucleosides or nucleoside analogs which are not substrates for RNaseH.
- said first gap region consists of at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous 2'-deoxynucleotides.
- the chimeric antisense compound comprises second wing region which consists of from 1 to 7 contiguous nucleosides or nucleoside analogs which are not substrates for RNase H, and wherein said gap region is located between said first wing region and said second wing region, hi another embodiment, the chimeric antisense compound is a chimeric antisense oligonucleotide, and the nucleosides or nucleoside analog which is not a substrate for RNase H is a nucleotide having a 2' modification of the sugar moiety.
- the nucleotide having a 2' modification of the sugar moiety is a 2'-O-methoxyethyl nucleotide, hi some embodiments the compound is a 2-16-2 MOE gapmer, a 3-12-3 MOE gapmer, a 3-10-7 MOE gapmer or a 7-10-3 MOE gapmer.
- the chimeric antisense oligonucleotide has at least one phosphorothioate backbone linkage.
- Another embodiment of the present invention is a pharmaceutical composition for use in reducing levels of a preselected RNA target in the liver of an animal comprising a chimeric antisense compound targeted to said preselected RNA target, wherein said chimeric antisense compound comprises a first gap region consisting of at least 10 contiguous 2'-deoxynucleotides and a wing region which consists of from 1 to 4 contiguous nucleosides or nucleoside analogs which are not substrates for RNase H.
- FIG. 1. Depicts a comparison of in vivo effects of a 5-10-5 MOE gapmer and the corresponding gap- widened 2-16-2 MOE gapmer.
- FIG. 2. Depicts a comparison the persistence of target mRNA modulation of a 5-10-5 MOE gapmer and the corresponding gap-widened 2-16-2 MOE gapmer.
- FIG. 3. Depicts a comparison of in vitro effects of a 5-10-5 MOE gapmer and the corresponding gap- widened 2-16-2 MOE gapmer.
- FIG. 4. Depicts a comparison of the concentrations of a 5-10-5 MOE gapmer and the corresponding gap-widened 2-16-2 MOE gapmer in liver and kidney tissues.
- FIG. 5 Depicts a comparison of the in vitro effects of oligonucleotides having the same sequence but varied wing-gap-wing motifs.
- FIG 6. Depicts a comparison of the in vivo effects of oligonucleotides having the same sequence but varied wing-gap-wing motifs.
- gap sizes are optimal for in vivo efficacy of antisense compounds.
- improved potency (3-1 Ox improvement) in jcnouse or rat liver has been demonstrated for gap-widened antisense oligonucleotides compared to standard 5-10-5 MOE gapmer (for example, 2-16-2, 2-14-2, 3- 12-3 gapmers) antisense oligonucleotides. This has been shown for several distinct antisense targets and this improved potency is not observed in cultured cells transfected with the same gap-widened antisense oligonucleotides.
- the "gap-widened" motifs appear to convey some benefit to in vivo potency, particularly in the liver.
- chimeric antisense compounds having a gap of greater than eleven contiguous deoxynucleotides flanked by wing regions consisting of from 1 to 4 nucleotides which are not substrates for RNase H are particularly effective at reducing target RNA levels in vivo, particularly in the liver.
- Therapeutic Index is a measure which relates the dose of a drug required to produce a specified effect to that which produces an undesired effect.
- improved therapeutic index of a gap-widened antisense oligonucleotide is characterized by equal or increased potency and a reduction in tissue concentration.
- improved therapeutic index of a gap- widened antisense oligonucleotide is characterized by increased potency and equal tissue concentrations as compared to a corresponding 5-10-5 antisense oligonucleotide.
- improved therapeutic index of a gap-widened antisense oligonucleotide is characterized by increased potency and decreased toxicity as compared to a corresponding 5-10-5 antisense oligonucleotide. In another embodiment, improved therapeutic index of a gap-widened antisense oligonucleotide is characterized by comparable potency and decreased toxicity as compared to a corresponding 5-10-5 antisense oligonucleotide. In some embodiments, the toxicity is renal toxicity. In some embodiments, the toxicity is hepatic toxicity.
- An embodiment of the present invention is a method of treating a disease or condition wherein a target RNA is associated with said disease or condition by administering a compound of the invention.
- Another embodiment of the present invention is a method of preventing or delaying the onset of a disease or condition wherein a target RNA is associated with said disease or condition by administering a compound of the invention.
- Diseases or conditions include metabolic and cardiovascular diseases or conditions.
- the disease or condition is metabolic syndrome, diabetes, obesity, hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, Type 2 diabetes, diet-induced obesity, hyperglycemia, or insulin resistance.
- the disease or condition is hepatic steatosis.
- the steatosis is steatohepatitis or NASH.
- the disease or condition is familial hypercholesterolemia, nonfamilial hypercholesterolemia, mixed dyslipidemia, dysbetalipoproteinemia, atherosclerosis, coronary artery disease, myocardial infarction, hypertension, carotid artery diseases, stroke, cerebrovascular disease, carotid artery disease, stroke, cerebrovascular disease, peripheral vascular disease, thrombosis, or arterial aneurism.
- nonalcoholic fatty liver disease encompasses a disease spectrum ranging from simple triglyceride accumulation in hepatocytes (hepatic steatosis) to hepatic steatosis with inflammation (steatohepatitis), fibrosis, and cirrhosis.
- NASH nonalcoholic steatohepatitis
- a second-hit capable of inducing necrosis, inflammation, and fibrosis is required for development of NASH.
- Candidates for the second-hit can be grouped into broad categories: factors causing an increase in oxidative stress and factors promoting expression of proinflammatory cytokines.
- liver triglycerides lead to increased oxidative stress in hepatocytes of animals and humans, indicating a potential cause-and-effect relationship between hepatic triglyceride accumulation, oxidative stress, and the progression of hepatic steatosis to NASH (Browning and Horton, J. Clin. Invest, 2004, 114, 147- 152).
- Hypertriglyceridemia and hyperfattyacidemia can cause triglyceride accumulation in peripheral tissues (Shimamura et al., Biochem. Biophys. Res. Commun., 2004, 322, 1080-1085).
- Methodabolic syndrome is defined as a clustering of lipid and non-lipid cardiovascular risk factors of metabolic origin. It is closely linked to the generalized metabolic disorder known as insulin resistance.
- NCEP National Cholesterol Education Program
- ATPIII Adult Treatment Panel m
- the five risk determinants are abdominal obesity defined as waist circumference of greater thanlO2 cm for men or greater than 88cm for women, triglyceride levels greater than or equal to 150 mg/dL, HDL cholesterol levels of less than 40 mg/dL for men and less than 50 mg/dL for women, blood pressure greater than or equal to 130/85 mm Hg and fasting glucose levels greater than or equal to 110 mg/dL.
- These determinants can be readily measured in clinical practice (JAMA, 2001, 285, 2486-2497).
- HbAIc is a stable minor hemoglobin variant formed in vivo via posttranslational modification by glucose, and it contains predominantly glycated NH2-terminal ⁇ -chains. There is a strong correlation between levels of HbAIc and the average blood glucose levels over the previous 3 months. Thus HbAIc is often viewed as the "gold standard" for measuring sustained blood glucose control (Bunn, H.F. et al., 1978, Science. 200, 21-7). HbAIc can be measured by ion-exchange HPLC or immunoassay; home blood collection and mailing kits for HbAIc measurement are now widely available. Serum fructosamine is another measure of stable glucose control and can be measured by a colorimetric method (Cobas Integra, Roche Diagnostics).
- Conditions associated with risk of developing a cardiovascular disease include, but are not limited to, history of myocardial infarction, unstable angina, stable angina, coronary artery procedures (angioplasty or bypass surgery), evidence of clinically significant myocardial ischemia, noncoronary forms of atherosclerotic disease (peripheral arterial disease, abdominal aortic aneurysm, carotid artery disease), diabetes, cigarette smoking, hypertension, low HDL cholesterol, family history of premature CHD, obesity, physical inactivity, elevated triglyceride, or metabolic syndrome(Jama, 2001, 285, 2486-2497; Grundy et al., Circulation, 2004, 110, 227-239).
- RNA expression can be assayed in a variety of ways known in the art.
- GCCR rnRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR.
- RNA analysis can be performed on total cellular RNA or poly(A)+ iriRNA by methods known in the art. Methods of RNA isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993.
- Northern blot analysis is routine in the art and is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1 , pp. 4.2.1 -4.2.9, John Wiley & Sons, Inc., 1996.
- Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISMTM 7700 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
- Levels of proteins encoded by a target RNA can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS).
- Antibodies directed to a protein encoded by a target RNA can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997.
- Enzyme-linked immunosorbent assays are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.
- the effect of oligomeric compounds of the present invention on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels.
- the effect of oligomeric compounds of the present invention on target nucleic acid expression can be routinely determined using, for example, PCR or Northern blot analysis.
- Cell lines are derived from both normal tissues and cell types and from cells associated with various disorders (e.g. hyperproliferative disorders). Cell lines derived from multiple tissues and species can be obtained from American Type Culture Collection (ATCC, Manassas, VA), the Japanese Cancer Research Resources Bank (Tokyo, Japan), or the Centre for Applied Microbiology and Research (Wiltshire, United Kingdom).
- ATCC American Type Culture Collection
- VA Manassas
- Tokyo Japanese Cancer Research Resources Bank
- Centre for Applied Microbiology and Research Wangshire, United Kingdom.
- Primary cells or those cells which are isolated from an animal and not subjected to continuous culture, can be prepared according to methods known in the art or obtained from various commercial suppliers. Additionally, primary cells include those obtained from donor human subjects in a clinical setting (i.e. blood donors, surgical patients).
- the mouse brain endothelial cell line b.END was obtained from Dr. Werner Risau at the Max Plank Institute (Bad Nauheim, Germany).
- b.END cells were routinely cultured in DMEM, high glucose (Invitrogen Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (Lnvitrogen Life Technologies, Carlsbad, CA). Cells were routinely passaged by trypsinization and dilution when they reached approximately 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of approximately 3000 cells/well for use in oligomeric compound transfection experiments.
- the human hepatoblastoma cell line HepG2 was obtained from the American Type Culture Collection (Manassas, VA). HepG2 cells were routinely cultured in Eagle's MEM supplemented with 10% fetal bovine serum, 1 mM non-essential amino acids, and 1 mM sodium pyruvate (Invitrogen Life Technologies, Carlsbad, CA). Cells were routinely passaged by trypsinization and dilution when they reached approximately 90% confluence. Multiwell culture plates are prepared for cell culture by coating with a 1:100 dilution of type 1 rat tail collagen (BD Biosciences, Bedford, MA) in phosphate- buffered saline.
- type 1 rat tail collagen BD Biosciences, Bedford, MA
- the collagen-containing plates were incubated at 37°C for approximately 1 hour, after which the collagen was removed and the wells were washed twice with phosphate-buffered saline. Cells were seeded into 96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford, MA) at a density of approximately 8,000 cells/well for use in oligomeric compound transfection experiments.
- Primary rat hepatocytes are prepared from Sprague-Dawley rats purchased from Charles River Labs (Wilmington, MA) and are routinely cultured in DMEM, high glucose (Invitrogen Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Life Technologies, Carlsbad, CA), 100 units per mL penicillin, and 100 ⁇ g/mL streptomycin (Invitrogen Life Technologies, Carlsbad, CA). Cells are seeded into 96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford, MA) at a density of approximately 4,000-6,000 cells/well treatment with the oligomeric compounds of the invention.
- oligomeric compounds When cells reached appropriate confluency, they were treated with oligonucleotide using a transfection method as described.
- suitable transfection reagents known in the art include, but are not limited to, LIPOFECTAMINETM, CYTOFECTINTM, OLIGOFECTAMINETM, and FUGENETM.
- Other suitable transfection methods known in the art include, but are not limited to, electroporation.
- Oligonucleotide When cells reach 65-75% confluency, they are treated with oligonucleotide. Oligonucleotide is mixed with LIPOFECTINTM Invitrogen Life Technologies, Carlsbad, CA) in Opti-MEMTM-1 reduced serum medium (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of oligonucleotide and a LEPOFECTTN TM concentration of 2.5 or 3 ⁇ g/mL per 100 nM oligonucleotide. This transfection mixture iss incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, wells are washed once with 100 ⁇ L OPTI-MEMTM-1 and then treated with 130 ⁇ L of the transfection mixture.
- Cells grown in 24-well plates or other standard tissue culture plates are treated similarly, using appropriate volumes of medium and oligonucleotide. Cells are treated and data are obtained in duplicate or triplicate. After approximately 4-7 hours of treatment at 37°C, the medium containing the transfection mixture is replaced with fresh culture medium. Cells are harvested 16-24 hours after oligonucleotide treatment.
- Quantitation of GCCR mRNA levels was accomplished by real-time quantitative PCR using the ABI PRISMTM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions.
- RNA quantification reagent (Molecular Probes, Inc. Eugene, OR). 170 ⁇ L of RiboGreenTM working reagent (RiboGreenTM reagent diluted 1 :350 in 1OmM Tris-HCl, 1 mM EDTA, pH 7.5) was pipetted into a 96-well plate containing 30 ⁇ L purified cellular RNA. The plate was read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485nm and emission at 530nm.
- GAPDH expression was quantified by RT, real-time PCR, either simultaneously with the quantification of the target or separately.
- primer-probe sets specific to the target gene being measured were evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction prior to quantitative PCR analysis.
- Multiplexing refers to the detection of multiple DNA species, in this case the target and endogenous GAPDH control, in a single tube, which requires that the primer-probe set for GAPDH does not interfere with amplification of the target.
- Probes and primers for use in real-time PCR were designed to hybridize to target-specific sequences. Methods of primer and probe design are known in the art. Design of primers and probes for use in real-time PCR can be carried out using commercially available software, for example Primer Express®, PE Applied Biosystems, Foster City, CA.
- the target-specific PCR probes have FAM covalently linked to the 5' end and TAMRA or MGB covalently linked to the 3' end, where FAM is the fluorescent dye and TAMRA or MGB is the quencher dye.
- RNA is subjected to sequential reverse transcriptase (RT) reaction and real-time PCR, both of which are performed in the same well.
- RT and PCR reagents were obtained from Invitrogen Life Technologies (Carlsbad, CA).
- RT real-time PCR was carried out in the same by adding 20 ⁇ L PCR cocktail (2.5x PCR buffer minus MgC12, 6.6 mM MgC12, 375 ⁇ M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5x ROX dye) to 96-well plates containing 30 ⁇ L total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48 0 C.
- PCR cocktail 2.5x PCR buffer minus MgC12, 6.6 mM MgC12, 375 ⁇ M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor
- Example 3 Increased potency of ISIS 344266 (2-16-2) in vivo compared to 5-10-5 compound is not due to enhanced oligonucleotide accumulation
- mice were dosed with ISIS 116847 (SEQ ID NO: 1) or ISIS 344266 (SEQ E) NO: 1) at 6, 3, 1.5 or 0.75 micromol/kg (approx 40, 20, 10 or 5 mg per kg), twice a week for three weeks and sacrificed 48 hours after the last dose was given.
- the left panel of Figure 1 is a graph showing percent reduction of target RNA in liver following administration of saline, ISIS 141923 (negative unrelated control oligonucleotide, incorporated herein as SEQ TD NO: 2), ISIS 116847 at four concentrations, or ISIS 344266 at four concentrations.
- ISIS 116847 and ISIS 344266 are targeted to mouse PTEN (GENBANK® Accession No: U92437.1, herein incorporated as SEQ ID NO: 103), and are cross- species oligonucleotides with perfect complementary to human, rat, and rabbit PTEN.
- saline nor negative control ISIS 141923 (6 micromoles/kg) reduced PTEN RNA levels.
- ISIS 116847 reduced PTEN RNA levels by approximately 21%, 44%, 64% and 81% at doses of 0.75, 1.5, 3 and 6 micromol/kg, respectively.
- ISIS 344266 the gap-widened antisense oligonucleotide, reduced PTEN RNA levels by approximately 54%, 79%, 88% and 91% at doses of 0.75, 1.5, 3 and 6 micromol/kg, respectively.
- a corresponding reduction of PTEN protein was demonstrated by Western blot as shown in the right panel of Figure 1.
- the ID50 (dose resulting in 50% reduction of PTEN RNA) calculated from these results was 1.9 micromol/kg for 116847 and 0.63 micromol/kg for 344266.
- the IC50 for ISIS 116847 was also over three-fold that of ISIS 344266.
- ISIS 344266 (2-16-2) supports similar persistence of action compared to ISIS 116847 (5-10-5). Mice were treated as described above with ISIS 344266 (1.5 or 6 micromol/kg) or ISIS 116847 (6 micromol/kg), or with saline. PTEN RNA levels were measured in mouse liver at days 1, 7, 14 and 28. As shown in Figure 2, the two compounds show similar durability of reduction of PTEN RNA levels, and even after 28 days the PTEN RNA levels in antisense-treated animals (either 116847 or 344266) had not returned to control levels.
- the advantage conveyed by the gap-widened antisense oligonucleotides of the present invention for target reduction in vivo is surprising because it is not observed in vitro.
- An in vitro comparison of the same PTEN oligonucleotides, ISIS 116847 (5-10-5) and ISIS 344266 (2-16-2) was performed in cultured mouse bEND cells. Cells were transfected with oligonucleotide at doses of 0.1 nM, 0.3 nJVI, 0.9 nM, 2.7 nM, 8.1 nM and 24.3 nM in the presence of 3 microgram/ml LIPOFECTESf.
- Figure 3 shows that the 5-10-5 gapmer was less potent than the 2-16-2 gapmer.
- the IC50 for reduction of PTEN RNA by the 5-10-5 gapmer (ISIS 116847) was 3.4 nM and 6.2 nM for the 2-16-2 gapmer
- the enhanced potency of the gap-widened (2-16-2) PTEN antisense oligonucleotide in liver is not due to increased concentrations in liver compared to the 5-10-5 gapmer. Oligonucleotide concentration in kidney and liver tissue from mice treated as described above with ISIS 116847 or
- a series of MOE gapmers (2-14-2 through 6-6-6) were designed to target mouse TRADD (consensus sequence built from mouse ESTs: aa013629,aa914725,aa013699, aal22508, aa881900, aa423244, aa930854, wl3708, aa201054, ail22320, aa611848, aa546092, and aa939422, incoporated herein as SEQ ID NO: 104).
- the compounds were tested in vitro in mouse bEND cells at concentrations of 0.1 nM, 0.5 nM,
- mice were treated with TRADD gapmer oligos (described above) ranging from 2-14-2 chimeras to 6-6-6 chimeras, each at doses of 1.56 micromole/kg, 3.12 micromol/kg and 6.24 micromol/kg.
- the negative control was ISIS 29837 (SEQ ID NO: 4) and animals treated with saline alone served as the control group to which data were normalized.
- potency in liver increased with increasing gap size (from 6 to 14 contiguous deoxynucleotides).
- the 2- 14-2 compound was approximately two-fold better than the 4-10-4 compound.
- Example 4 Antisense inhibition of human GCCR expression by 5-10-5 gapmers or 2-16-2 gapmers in vitro
- a series of oligomeric compounds was designed to target different regions of human GCCR, using published sequences (GENBANK® accession no: NM_000176.1, incoporated herein as SEQ ID NO: 105).
- the compounds are shown in Table 3. All compounds in Table 3 are chimeric oligonucleotides ("gapmers”) 20 nucleotides in length, composed of a central "gap" region consisting of 10 2'-deoxynucleotides, which is flanked on both sides (5' and 3') by five-nucleotide "wings".
- the wings are composed of 2'-O-(2-methoxyethyl) nucleotides, also known as 2'-MOE nucleotides.
- the internucleoside (backbone) linkages are phosphorothioate throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. Shown in Table 3 is the sequence of the oligonucleotide, and the target site which is the first (5' most) position on the target sequence to which the compound binds. The compounds were analyzed for their effect on gene target mRNA levels by quantitative real-time PCR as described in other examples herein, using a primer-probe set designed to hybridize to human GCCR.
- Gap-widened oligonucleotides having the same sequences as the compounds described in Table 4 were also tested. All compounds in Table 4 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of 162'-deoxynucleotides, which is flanked on both sides (5' and 3') by two-nucle ⁇ tide "wings". The wings are composed of 2'-O-(2- methoxyethyl) nucleotides, also known as 2'-MOE nucleotides. The internucleoside (backbone) linkages are phosphorothioate throughout the oligonucleotide.
- cytidine residues are 5- methylcytidines. Shown in Table 4 is the sequence of the oligonucleotide, and the target site which is the first (5' most) position on the target sequence to which the compound binds. The 2-16-2 motif compounds were analyzed for their effect on gene target mRNA levels by quantitative real-time PCR as described herein.
- oligonucleotides shown in Table 4 and the 5-10-5 oligonucleotides shown in Table 3 which reduced GCCR expression by at least 30% are preferred.
- the target segments to which these preferred sequences are complementary are herein referred to as "preferred target segments" and are therefore preferred for targeting by compounds of the present invention.
- Example 5 Cross-species oligonucleotides targeting GCCR
- oligonucleotides described in the previous example are complementary across species and are therefore expected to reduce expression of glucocorticoid receptor across species. Shown in Table 5 is the sequence of such cross-species oligonucleotides, and the ISIS numbers of the 5-10-5 motif version and the 2-16-2 motif version of the oligonucleotide. Also indicated for each sequence is the target site which is the first (5' most) position on the human target sequence (NM_000176.1, incorporated herein as SEQ ID NO: 105) to which the compound binds. The complementarity for human, cynomolgus monkey, rat, and mouse GCCR mRNA is indicated ("yes” means perfect complementarity and "1 mm” means one mismatch from perfect complementarity).
- Example 6 Antisense inhibition of human and rat GCCR mRNA levels — dose-response studies with 5-10-5 gapmers
- eleven oligonucleotides were selected for additional dose-response studies.
- Primary rat hepatocytes were treated with 5, 10, 25, 50, 100 or 200 nM of ISIS 180274, ISIS 180275, ISIS 180276, ISIS 180281, ISIS 180304, ISIS 361137, ISIS 361141, ISIS 361151, ISIS 361156, ISIS 345198, ISIS 361137 or the negative control oligonucleotide ISIS 141923 (CCTTCCCTGAAGGTTCCTCC, incorporated herein as SEQ ID NO: 2), and mRNA levels were measured as described in other examples herein.
- ISIS 141923 is a 5-10-5 gapmer comprising a ten deoxynucleotide gap flanked by 2'-MOE wings and a phosphorothioate backbone. All cytosines are 5-methylcytosines. Untreated cells served as the control to which the data were normalized.
- the same oligonucleotides were tested in the human HepG2 cell line for their ability to reduce GCCR mRNA expression at the indicated doses. Untreated cells served as the control to which the data were normalized.
- antisense oligonucleotides targeting GCCR are effective at reducing both human and rat target mRNA levels in a dose-dependent manner in vitro.
- Example 7 Antisense inhibition of rat GCCR mRNA levels — in vivo dose-response studies with 5-10-5 gapmers
- oligonucleotides Five of the 5-10-5 gapmer motif oligonucleotides (ISIS 180281, ISIS 361137, ISIS 345198, ISIS 180304, and ISIS 361141) were evaluated at various doses in rats for their ability to reduce GCCR mRNA levels in liver. Eight week-old Sprague Dawley rats were divided into treatment groups which received doses of 50, 25 or 12.5 mg/kg of one the indicated oligonucleotides via injection. Each treatment group was comprised of four animals, and was dosed twice weekly for 3 weeks. Animals injected with saline alone served as a control group. The animals were evaluated weekly for standard blood parameters (ALT/AST, cholesterol, triglycerides, and glucose).
- mice were sacrificed at the end of the study and liver tissue was collected and analyzed for target reduction using real-time PCR analysis methods described herein. Results are shown in Tables 8a and 8b (separate experiments) as the percentage reduction in GCCR mRNA measured after treatment with the indicated doses of the indicated oligonucleotides.
- Tables 8a and 8b show that antisense oligonucleotides targeted to GCCR are effective at reducing expression in vivo in a dose-dependent manner.
- ISIS 345198 (GTCAAAGGTGCTTTGGTCTG; SEQ ID NO: 16) was chosen for further evaluation in structure- activity experiments focusing on gap optimization. This compound is perfectly complementary to mouse, rat, human, monkey, rabbit and guinea pig glucocorticoid receptor RNA.
- oligomeric compounds were designed to target GCCR with varying sizes of the deoxynucleotide gap and 2'-MOE wings.
- Each of the oligonucleotides tested has the same nucleobase sequence (GTCAAAGGTGCTTTGGTCTG, incorporated herein as SEQ ID NO: 16) and therefore targets the same segment of SEQ ID NO: 105 (nucleobases 689 to 709).
- this oligonucleotide is also perfectly complementary to rat GCCR.
- White adipose tissue was analyzed for target reduction using real-time PCR analysis methods described herein. Results are shown in Tables 10a, 10b, and 10c (separate experiments) as the percentage reduction in GCCR mRNA measured after treatment with the indicated doses of the indicated oligonucleotides. Tissues from animals treated with each gap-widened oligonucleotide were assayed for target reduction alongside tissues from animals treated with the 5-10-5 motif oligonucleotide for comparison.
- Liver tissue was also analyzed for target reduction using real-time PCR analysis methods described herein. Results are shown in Tables 1 Ia, 1 Ib, and lie (separate experiments) as the percentage reduction in GCCR mRNA measured after treatment with the indicated doses of the indicated oligonucleotides. Tissues from animals treated with each gap-widened oligonucleotide were assayed for target reduction alongside tissues from animals treated with the 5-10-5 motif oligonucleotide for comparison.
- oligonucleotide concentration in kidney and liver were determined. Methods to determine oligonucleotide concentration in tissues are known in the art (Geary et al., Anal Biochem, 1999, 274, 241-248). Total oligonucleotide is the sum of all oligonucleotides metabolites detected in the tissue. Shown in Table 12 are the total concentration and the concentration of full length oligonucleotide (in ⁇ g/g) in the liver of animals treated with the indicated oligonucleotide at the indicated concentration. Table 12
- oligonucleotide of the present invention include gap-widened oligonucleotides that show enhanced or comparable potency with regard to target reduction to the corresponding 5-10-5 gapmer without enhanced accumulation of the compound in a target tissue.
- the target tissue is adipose and in some embodiments, the target tissue is liver.
- Example 9 Design of "gap-widened” antisense oligonucleotides targeting human GCGR
- oligomeric compounds were designed to target human GCGR (Genbank accession number: NM_000160.1, incorporated herein as SEQ ID NO: 108), with varying sizes of the deoxynucleotide gap and 2'-MOE wings.
- Each of the oligonucleotides is 20 nucleobases in length and has the same nucleobase sequence (GCACTTTGTGGTGCCAAGGC, incorporated herein as SEQ ID NO: 93), and therefore targets the same segment of SEQ ID NO: 108 (nucleobases 532 to 551).
- the compounds are shown in Table 13.
- Plain text indicates a deoxynucleotide, and nucleotides designated with bold, underlined text are 2'-O-(2-methoxyethyl) nucleotides, ⁇ iternucleoside linkages are phosphorothioate throughout, and all cytosines are 5-methylcytosines.
- Table 13 is the "motif of each compound, indicative of chemically distinct regions comprising the oligonucleotide.
- the 5-10-5 gapmer, ISIS 310457 was tested for its ability to reduce target mRNA levels in vitro. HepG2 cells were treated with ISIS 310457 using methods as described herein. ISIS 310457 was analyzed for its effect on human glucagon receptor mRNA levels by quantitative real-time PCR and was found to reduce expression of GCGR by about 96%.
- Example 10 Design of "gap-widened” antisense oligonucleotides targeting rat GCGR
- oligomeric compounds were designed to target rat GCGR (Genbank accession number: M96674.1, incorporated herein as SEQ ID NO: 109) with varying sizes of the deoxynucleotide gap and 2'-MOE wings.
- Each of the oligonucleotides tested has the same nucleobase sequence (GCACTTTGTGGTACCAAGGT, incorporated herein as SEQ ID NO: 94) and therefore targets the same segment of SEQ ED NO 109 (nucleobases 402 to 421).
- the segment targeted by the rat oligonucleotides corresponds to the segment of human GCGR targeted by ISIS 310457 (SEQ ID NO: 93).
- Example 11 Effects of antisense oligonucleotides targeting GCGR — in vivo rat study
- the oligonucleotides designed to target rat GCGR were tested in vivo.
- Salme-mjected animals served as a control.
- Each of the oligonucleotides tested has the same nucleobase sequence (GCACTTTGTGGTACCAAGGT, incorporated herein as SEQ ID NO: 94), and the chemistry and motif of each compound is described above.
- RNA isolation and target mRNA expression level quantitation are performed as descnbed by other examples herein using RIBOGREENTM. RNA from each treatment group was assayed alongside RNA from the group treated with ISIS 356171. Results are presented in Table 15a, 15b, 15c, 15d, 15e, and 15f as a percentage of saline-treated control levels.
- the gap-widened antisense oligonucleotides were effective at reducing GCGR levels in vivo in a dose-dependent manner.
- oligonucleotide concentration in kidney and liver were determined. Methods to determine oligonucleotide concentration in tissues are known in the art (Geary et al., Anal. Biochem., 1999, 274, 241-248). Shown in Table 16 are the total oligonucleotide concentration and the concentration of full length oligonucleotide (in ⁇ g/g) in the kidney or liver of animals treated with 25 mg/kg of the indicated oligonucleotide. Total oligonucleotide is the sum of all oligonucleotides metabolites detected in the tissue.
- the concentrations of the gap-widened oligonucleotides in kidney were generally reduced with respect to those found for ISIS 356171 in these tissues.
- these data suggest that gap-widened oligos, particularly ISIS 356371, ISIS 356372, and ISIS 356373 are, in essence, more effective than ISIS 356171 at reducing target levels in the liver.
- Example 12 Effects of antisense oligonucleotides targeting GCGR — in vivo study in cynomolgus monkeys
- ISIS 310457 (5-10-5 motif) or ISIS 325568 (2-16-2 motif) at doses of 3, 10, or 20 mg/kg per week.
- ISIS 310457 5-10-5 motif
- ISIS 325568 2-16-2 motif
- the duration of the study was 7 weeks, and the animals were dosed three times during the first week, followed by once-weekly dosing for 6 weeks.
- Each treatment group was comprised of 5 animals.
- Other treatment groups were sacrificed at the end of the study. Liver tissues were collected to assess target reduction. RNA isolation and target mRNA expression level quantitation were performed as described by other examples herein using RDBOGREENTM. Results are presented in Table 17 as a percentage of saline-treated control levels.
- oligonucleotide concentration in kidney and liver were determined. Methods to determine oligonucleotide concentration in tissues are known in the art (Geary et al., Anal Biochem, 1999, 274, 241-248). Shown in Table 18 are the total concentration and the concentration of full length oligonucleotide (in ⁇ g/g) in the kidney or liver of animals treated with the indicated oligonucleotide.
- the kidney concentration of the 5-10-5 motif oligonucleotide ISIS 310457 is higher than that measured for the 2-16-2 motif oligonucleotide ISIS 325568 at all concentrations tested.
- the target reduction data in Table 9 for the 2-16-2 motif oligonucleotide suggest that the gap-widened oligonucleotide is more potent than the corresponding 5-10-5 motif oligonucleotide, providing a more robust lowering of target mRNA levels in the liver without enhanced accumulation of oligonucleotide.
- Example 13 Effects of gap-widened oligonucleotides on reduction of DGAT2 mRNA levels — in vitro analysis
- oligonucleotides were designed to target DGAT2. Shown in Table 19 is the sequence of each oligonucleotide. Plain text indicates a deoxynucleotide, and nucleotides designated with bold, underlined text are 2'-O-(2-methoxyethyl) nucleotides. Also shown for each oligonucleotide in Table 19 is its motif, the target site on human DGAT2 mRNA (GENBANK® accession number NMJB2564.2, incorporated herein as SEQ DD NO: 110), and its cross-species identity. For each species listed, an "X” denotes perfect complementarity to the target sequence for that species, "1 MM” denotes one mismatch to the target sequence for the species, etc.
- each of these oligonucleotides was tested in vitro for their ability to reduce human DGAT2 mRNA levels using real time RT-PCR methods as described herein.
- each of the oligonucleotides in Table 19 demonstrated IC 50 values of about 20 nM.
- Example 14 Effects of gap-widened oligonucleotides on reduction of DGAT2 mRNA levels — in vivo analysis
- oligonucleotides described in Table 19, along with ISIS 217357 (ACACACTAGAAGTGAGCTTA, SEQ ID NO: 102), which is targeted to rat DGAT2, the complement of nucleotides 15333000 to 15365000 of GENBANK® accession number NW_047561.1, herein incorporated as SEQ ID NO: 111 were tested for their ability to reduce DGAT2 levels in vivo.
- Eight week-old male Sprague-Dawley rats were injected with 20 mg/kg of oligonucleotide per week for 2 weeks. Each treatment group was comprised of 6 animals. Animals injected with saline alone served as controls.
- oligonucleotide concentration in kidney and liver were determined. Methods to determine oligonucleotide concentration in tissues are known in the art (Geary et al., Anal Biochem, 1999, 274, 241-248). Total oligonucleotide is the sum of all oligonucleotides metabolites detected in the tissue. Shown in Table 20 are the total concentration and the concentration of full length oligonucleotide (in ⁇ g/g) in the liver of animals treated with the indicated oligonucleotide concentration.
- kidney concentrations of gap-widened oligonucleotides were generally lower than those of oligonucleotides with a 10- deoxynucleotide gap.
- Example 15 Effects of gap-widened oligonucleotides on reduction of DGAT2 mRNA levels — in vivo analysis
- Example 14 In another arm of the experiment described in Example 14, eight-week old male Sprague- Dawley rats were treated with the oligonucleotides at doses of 50 mg/kg per week for four weeks. Each treatment group was comprised of 4 animals. At the end of the treatment period, animals were sacrificed and target mRNA levels were determined using real-time RT-PCR as described herein. Results are shown in Table 21 as the average % inhibition for each treatment group.
- the gap-widened oligonucleotides targeted to DGAT2 show excellent inhibitory activity in the liver.
- ISIS 370727 and ISIS 370747 showed superior ability to reduce target expression.
- these data suggest that gap-widened oligonucleotides provide excellent to superior target reduction without enhanced accumulation of oligonucleotide in target tissues.
- the gap- widened oligonucleotides possess a preferred liver to kidney ratio as compared to the 5-10-5 motif oligonucleotides targeting DGAT2.
- Example 16 Effects of gap-widened oligonucleotides on reduction of CRP mRNA levels — in vivo analysis
- Monkey-human cross-species oligonucleotides targeted to C-reactive protein (CRP) were designed to target CRP using sequences known in the art (see US application publication number US2005-0014257, herein incorporated by reference in its entirety). Shown in Table 22 is the sequence of oligonucleotides targeted to CRP tested in cynomologus monkeys. Plain text indicates a deoxynucleotide, and nucleotides designated with bold, underlined text are 2'-O-(2-methoxyethyl) nucleotides. Also shown for each oligonucleotide in Table 22 is its motif.
- Toxicity profiles of gap-widened oligonucleotides were compared to the 5-10-5 oligonucleotides by treating monkeys with 14 or 40 mg/kg/wk for 4 weeks. Activity was compared in a dose-escalation study with each cycle containing four subcutaneous doses administered (Mon., Wed., Fri., Mon.) in 4 dosing cycles over 8 weeks. Doses were 2, 4 and 10 mg/kg.
- serum CRP levels were quantified over 36 hours. Serum CRP levels may be measured by ELISA using a commercially available kit (for example, ALerCHEK Inc., Portland, ME). Animals were sacrificed after the second and fourth cycles and liver CRP mRNA, tissue oligonucleotide concentration, clinical signs, serum chemistry, hematology, body weight, and histology were assessed. With regard to tissue oligonucleotide concentration and histology, the primary difference was 30% lower kidney concentration and fewer histologic changes in the 3-14-3 treated animals. Plasma cytokine and CRP levels were examined but not significantly increased.
- chimeric antisense compounds with gaps at least 11 nucleobases long and wings which are from independently from 1 to 4 nucleobases in length which are 2'-MOE-modified. This enhanced efficacy is not predicted by the rank order potency of these compounds in vitro (cell culture). 2-16-2 and 3-14-3 gapmer compounds as well as 3-10-7 and 7-10-3 gapmer compounds have been shown to be more effective than 5-10-5 chimeras of the equivalent sequence and wing modification. 4-12-4 gapmers are also believed to be a useful embodiment.
- Non-limiting examples of 2'-modified nucleosides useful in the compounds of the present invention include but are not limited to 2'-O-alkyl, 2'-O-alkyl-O-alkyl wherein alkyl is a Ci to C 6 alkyl or Ci to C 6 alkylene when alkyl is not a terminal substituent. These include 2'-O-methyl, 2'-0-propyl and 2'-O- methoxyethyl nucleosides.
- antisense compounds which are chimeric compounds.
- "Chimeric” antisense compounds or “chimeras,” in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide.
- These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, increased stability and/or increased binding affinity for the target nucleic acid.
- RNAse H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression.
- the cleavage of RNA:RNA hybrids can, in like fashion, be accomplished through the actions of endoribonucleases, such as RNAseL which cleaves both cellular and viral RNA.
- Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been , referred to in the art as hybrids or gapmers.
- the antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis.
- Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed.
- It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.Oligonucleotides: Unsubstituted and substituted phosphodiester (P O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.
- Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein incorporated by reference.
- Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein incorporated by reference.
- Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein incorporated by reference.
- 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein incorporated by reference.
- Phosphotriester oligonucleotides are prepared as described in U.S. Patent 5,023,243, herein incorporated by reference.
- Borano phosphate oligonucleotides are prepared as described in U.S.
- Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein incorporated by reference.
- Ethylene oxide linked oligonucleosides are prepared as described in U.S. Patent 5,223,618, herein incorporated by reference.
- RNA synthesis chemistry is based on the selective incorporation of various protecting groups at strategic intermediary reactions.
- a useful class of protecting groups includes silyl ethers.
- bulky silyl ethers are used to protect the 5'-hydroxyl in combination with an acid-labile orthoester protecting group on the 2 I hydroxyl.
- This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps.
- the early use of the silyl protecting groups during synthesis ensures facile removal when desired, without undesired deprotection of 2' hydroxyl.
- RNA oligonucleotides were synthesized. RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3'- to 5'-direction) to a solid support-bound oligonucleotide. The first nucleoside at the 3'-end of the chain is covalently attached to a solid support. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5'-end of the first nucleoside.
- the support is washed and any unreacted 5'- hydroxyl groups are capped with acetic anhydride to yield 5'-acetyl moieties.
- the linkage is then oxidized to the more stable and ultimately desired P(V) linkage.
- the 5'-silyl group is cleaved with fluoride.
- the cycle is repeated for each subsequent nucleotide.
- the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-cyanoethylene-l,l-dithiolate trihydrate (S2Na2) in DMF.
- the deprotection solution is washed from the solid supportbound oligonucleotide using water.
- the support is then treated with 40% methylamine in water for 10 minutes at 55 0 C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the T- groups.
- the oligonucleotides can be analyzed by anion exchange HPLC at this stage.
- the 2'-orthoester groups are the last protecting groups to be removed.
- the ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, CO), is one example of a useful orthoester protecting group which, has the following important properties.
- RNA synthesis is well known in the art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am. Chem. Soc, 1 "8,120,11820- 11821; Matteucci, M. D. and Caruthers, M. H. J. Am.
- RNA antisense compounds of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc (Lafayette, CO). Once synthesized, complementary RNA antisense compounds can then be annealed by methods known in the art to form double stranded (duplexed) antisense compounds.
- duplexes can be formed by combining 30 ⁇ l of each of the complementary strands of RNA oligonucleotides (50 uM RNA oligonucleotide solution) and 15 tl of 5X annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1 minute at 90 0 C, then 1 hour at 37°C.
- 5X annealing buffer 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate
- the resulting duplexed antisense compounds can be used in kits, assays, screens, or other methods to investigate the role of a target nucleic acid.
- Chimeric Oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end” type wherein the "gap” segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as “hemimers" or "wingmers”.
- Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy- 5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA portion and 5'-dimethoxytrityl-2'-O-methyl-3'- O-phosphoramidite for 5' and 3' wings.
- the standard synthesis cycle is modified by incorporating coupling steps with increased reaction times for the 5'-dimethoxytrityl-2'-O-methyl-3'-O- phosphoramidite.
- the fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH40H) for 12-16 hr at 55°C.
- the deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spetrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
- [2'-O-(2-methoxyethyl)] ⁇ [2'-deoxy] ⁇ [-2'-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2'0-methyl chimeric oligonucleotide, with the substitution of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites.
- [2'-0-(2-methoxyethyl phosphodiester]-[2'-deoxy phosphorothioate] ⁇ [2'-0(methoxyethyl) phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2'-O-methyl chimeric oligonucleotide with the substitution of 2'-O(methoxyethyl) amidites for the 2'-O-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.
- chimeric oligonucleotides chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to United States patent 5,623,065, herein incorporated by reference.
- the methods of the present invention are particularly useful in antisense therapeutics. It is not necessary that the antisense target be associated with liver disease per se, since many current antisense targets are expressed to high levels in liver and other organs. In particular, targets associated with metabolic and cardiovascular diseases and conditions are particularly amenable to knockdown in the liver and have been shown in animals and in clinical studies to have therapeutic effects).
- the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
- the antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA2580504A CA2580504C (en) | 2004-09-17 | 2005-09-19 | Enhanced antisense oligonucleotides |
JP2007532648A JP2008513507A (en) | 2004-09-17 | 2005-09-19 | Enhanced antisense oligonucleotides |
AU2005286738A AU2005286738A1 (en) | 2004-09-17 | 2005-09-19 | Enhanced antisense oligonucleotides |
EP05798891.7A EP1799859B1 (en) | 2004-09-17 | 2005-09-19 | Enhanced antisense oligonucleotides |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US61110004P | 2004-09-17 | 2004-09-17 | |
US60/611,100 | 2004-09-17 | ||
US66344205P | 2005-03-18 | 2005-03-18 | |
US60/663,442 | 2005-03-18 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2006034348A2 true WO2006034348A2 (en) | 2006-03-30 |
WO2006034348A3 WO2006034348A3 (en) | 2006-11-02 |
Family
ID=36090652
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2005/033837 WO2006034348A2 (en) | 2004-09-17 | 2005-09-19 | Enhanced antisense oligonucleotides |
Country Status (6)
Country | Link |
---|---|
US (2) | US7919472B2 (en) |
EP (2) | EP1799859B1 (en) |
JP (2) | JP2008513507A (en) |
AU (2) | AU2005286738A1 (en) |
CA (1) | CA2580504C (en) |
WO (1) | WO2006034348A2 (en) |
Cited By (22)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7399853B2 (en) | 2003-04-28 | 2008-07-15 | Isis Pharmaceuticals | Modulation of glucagon receptor expression |
US7750142B2 (en) | 2003-04-28 | 2010-07-06 | Isis Pharmaceuticals, Inc. | Modulation of glucagon receptor expression |
AU2006292293B2 (en) * | 2005-09-19 | 2012-09-13 | Isis Pharmaceuticals, Inc. | Modulation of glucocorticoid receptor expression |
US8865674B2 (en) | 2011-09-20 | 2014-10-21 | Isis Pharmaceuticals, Inc. | Antisense modulation of GCGR expression |
US8901098B2 (en) | 2011-10-25 | 2014-12-02 | Isis Pharmaceuticals, Inc. | Antisense modulation of GCCR expression |
US9765338B2 (en) | 2010-07-19 | 2017-09-19 | Ionis Pharmaceuticals, Inc. | Modulation of dystrophia myotonica-protein kinase (DMPK) expression |
CN103820450B (en) * | 2008-10-15 | 2018-08-21 | Ionis制药公司 | The adjusting of factor 11 expression |
EP2640853B1 (en) | 2010-11-17 | 2018-12-26 | Ionis Pharmaceuticals, Inc. | Modulation of alpha synuclein expression |
US10202599B2 (en) | 2011-08-11 | 2019-02-12 | Ionis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
US10260069B2 (en) | 2013-02-04 | 2019-04-16 | Ionis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
US10954519B2 (en) | 2013-08-09 | 2021-03-23 | lonis Pharmaceuticals, Inc. | Compounds and methods for modulation of dystrophia myotonica-protein kinase (DMPK) expression |
US11021710B2 (en) | 2018-05-09 | 2021-06-01 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing FXI expression |
US11118183B2 (en) | 2013-12-24 | 2021-09-14 | Ionis Pharmaceuticals, Inc. | Modulation of angiopoietin-like 3 expression |
US11225664B2 (en) | 2010-01-08 | 2022-01-18 | Ionis Pharmaceuticals, Inc. | Modulation of angiopoietin-like 3 expression |
US11230712B2 (en) | 2017-11-09 | 2022-01-25 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing SNCA expression |
US11236335B2 (en) | 2012-10-12 | 2022-02-01 | Ionis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
US11359197B2 (en) | 2018-01-12 | 2022-06-14 | Bristol-Myers Squibb Company | Antisense oligonucleotides targeting alpha-synuclein and uses thereof |
EP4035659A1 (en) | 2016-11-29 | 2022-08-03 | PureTech LYT, Inc. | Exosomes for delivery of therapeutic agents |
US11485975B2 (en) | 2018-02-09 | 2022-11-01 | Genentech, Inc. | Oligonucleotides for modulating TMEM106B expression |
US11535849B2 (en) | 2010-04-29 | 2022-12-27 | Ionis Pharmaceuticals, Inc. | Modulation of transthyretin expression |
US20230265436A1 (en) * | 2022-02-24 | 2023-08-24 | Q-State Biosciences, Inc. | Therapeutics for syngap haploinsufficiency |
US11833221B2 (en) | 2021-09-01 | 2023-12-05 | Ionis Pharmaceuticals, Inc. | Oligomeric compounds for reducing DMPK expression |
Families Citing this family (38)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7919472B2 (en) * | 2004-09-17 | 2011-04-05 | Isis Pharmaceuticals, Inc. | Enhanced antisense oligonucleotides |
JP5523705B2 (en) * | 2005-08-29 | 2014-06-18 | レグルス・セラピューティクス・インコーポレイテッド | Method of using to modulate MIR-122A |
ES2369328T3 (en) * | 2005-09-19 | 2011-11-29 | Isis Pharmaceuticals, Inc. | MODULATION OF GLUCAGON RECEIVER EXPRESSION. |
AU2007258117B2 (en) * | 2006-05-05 | 2013-05-30 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating gene expression |
JP5587777B2 (en) | 2007-07-31 | 2014-09-10 | ボード・オブ・リージエンツ,ザ・ユニバーシテイ・オブ・テキサス・システム | MicroRNA family modulating fibrosis and uses thereof |
EP2222851B1 (en) * | 2007-11-20 | 2017-06-28 | Ionis Pharmaceuticals, Inc. | Modulation of cd40 expression |
ES2616051T3 (en) | 2008-12-02 | 2017-06-09 | Wave Life Sciences Japan, Inc. | Method for the synthesis of modified nucleic acids in the phosphorus atom |
AU2010270714B2 (en) | 2009-07-06 | 2015-08-13 | Wave Life Sciences Ltd. | Novel nucleic acid prodrugs and methods use thereof |
US9006198B2 (en) | 2010-02-08 | 2015-04-14 | Isis Pharmaceuticals, Inc. | Selective reduction of allelic variants |
EP3321361B1 (en) * | 2010-02-08 | 2019-03-27 | Ionis Pharmaceuticals, Inc. | Selective reduction of allelic variants |
US20110213011A1 (en) * | 2010-02-26 | 2011-09-01 | Dean Nicholas M | Modulation of smad3 expression |
US10428019B2 (en) | 2010-09-24 | 2019-10-01 | Wave Life Sciences Ltd. | Chiral auxiliaries |
EP2734208B1 (en) | 2011-07-19 | 2017-03-01 | Wave Life Sciences Ltd. | Methods for the synthesis of functionalized nucleic acids |
US9243291B1 (en) * | 2011-12-01 | 2016-01-26 | Isis Pharmaceuticals, Inc. | Methods of predicting toxicity |
MX2015000577A (en) | 2012-07-13 | 2015-08-14 | Wave Life Sciences Pte Ltd | Chiral control. |
JP6246121B2 (en) | 2012-07-13 | 2017-12-13 | 株式会社新日本科学 | Chiral nucleic acid adjuvant |
CN107011400B (en) | 2012-07-13 | 2021-05-25 | 波涛生命科学有限公司 | Asymmetric auxiliary group |
EP2877579B1 (en) * | 2012-07-27 | 2019-12-18 | Ionis Pharmaceuticals, Inc. | Modulation of renin-angiotensin system (ras) related diseases by angiotensinogen |
AU2014222150A1 (en) * | 2013-03-01 | 2015-09-10 | National University Corporation Tokyo Medical And Dental University | Chimeric single-stranded antisense polynucleotides and double-stranded antisense agent |
DK3043827T3 (en) * | 2013-09-13 | 2019-08-26 | Ionis Pharmaceuticals Inc | MODULATORS OF COMPLEMENT FACTOR B |
US10144933B2 (en) | 2014-01-15 | 2018-12-04 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator |
US10149905B2 (en) | 2014-01-15 | 2018-12-11 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having antitumor effect and antitumor agent |
US10322173B2 (en) | 2014-01-15 | 2019-06-18 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent |
KR102423317B1 (en) | 2014-01-16 | 2022-07-22 | 웨이브 라이프 사이언시스 리미티드 | Chiral design |
EP3608406B1 (en) | 2014-05-01 | 2023-02-15 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating complement factor b expression |
JP6772156B2 (en) | 2015-02-04 | 2020-10-21 | ブリストル−マイヤーズ スクイブ カンパニーBristol−Myers Squibb Company | How to choose a therapeutic molecule |
SG11201706293XA (en) | 2015-02-04 | 2017-09-28 | Hoffmann La Roche | Tau antisense oligomers and uses thereof |
ES2917181T3 (en) * | 2015-07-10 | 2022-07-07 | Ionis Pharmaceuticals Inc | Diacylglycerol acyltransferase 2 (DGAT2) modulators |
MA43072A (en) | 2015-07-22 | 2018-05-30 | Wave Life Sciences Ltd | COMPOSITIONS OF OLIGONUCLEOTIDES AND RELATED PROCESSES |
EP3808340A1 (en) | 2015-09-18 | 2021-04-21 | Dnarx | Systems and methods for nucleic acid expression in vivo |
BR122020023854B1 (en) | 2015-10-08 | 2022-11-29 | Ionis Pharmaceuticals, Inc | COMPOUND COMPRISING MODIFIED OLIGONUCLEOTIDE AND ITS USE, USE OF THE MODIFIED OLIGONUCLEOTIDE, COMPOSITION AND ITS USE |
CN112587504B (en) * | 2016-10-17 | 2022-10-18 | 南京绿叶制药有限公司 | Lipid nanoparticle of antisense oligonucleotide for inhibiting bcl-2 and preparation method thereof |
CN110678202B (en) | 2017-03-23 | 2023-04-14 | Dnarx公司 | Systems and methods for in vivo nucleic acid expression |
EP3717646A4 (en) | 2017-12-01 | 2021-12-01 | The Texas A&M University System | Angelman syndrome antisense treatment |
EP4136092A4 (en) | 2020-11-18 | 2023-10-11 | Ionis Pharmaceuticals, Inc. | Compounds and methods for modulating angiotensinogen expression |
KR20240014532A (en) | 2021-05-29 | 2024-02-01 | 1글로브 헬스 인스티튜트 엘엘씨 | Asymmetric short duplex DNA and its uses as a novel gene silencing technology |
KR20240014533A (en) | 2021-05-29 | 2024-02-01 | 1글로브 헬스 인스티튜트 엘엘씨 | Short duplex DNA and its uses as a novel gene silencing technology |
US11879125B2 (en) | 2022-03-16 | 2024-01-23 | Empirico Inc. | GalNAc compositions for improving siRNA bioavailability |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002036743A2 (en) | 2000-10-30 | 2002-05-10 | Isis Pharmaceuticals, Inc. | Antisense modulation of calreticulin expression |
Family Cites Families (55)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
DE3788914T2 (en) | 1986-09-08 | 1994-08-25 | Ajinomoto Kk | Compounds for cleaving RNA at a specific position, oligomers used in the preparation of these compounds and starting materials for the synthesis of these oligomers. |
US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
DE3855864T2 (en) | 1987-11-30 | 1997-09-25 | Univ Iowa Res Found | DNA MOLECULES STABILIZED BY MODIFICATIONS ON THE 3'-TERMINAL PHOSPHODIESTERBINDING, THEIR USE AS NUCLEIC ACID PROBE AND AS A THERAPEUTIC AGENT FOR INHIBITING THE EXPRESSION OF SPECIFIC TARGET GENES |
US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
US5177198A (en) | 1989-11-30 | 1993-01-05 | University Of N.C. At Chapel Hill | Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
US5378825A (en) | 1990-07-27 | 1995-01-03 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs |
US5386023A (en) | 1990-07-27 | 1995-01-31 | Isis Pharmaceuticals | Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling |
US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
US5223618A (en) | 1990-08-13 | 1993-06-29 | Isis Pharmaceuticals, Inc. | 4'-desmethyl nucleoside analog compounds |
US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
RU95104940A (en) | 1992-07-27 | 1997-01-10 | Хайбрайдон | Method of incorporation of alkylphosphonothioate or arylphosphonothioate internucleotide linkage in oligonucleotide, method of oligonucleotide synthesis, method of gene expression inhibition, treatment method |
US5985558A (en) | 1997-04-14 | 1999-11-16 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide compositions and methods for the inibition of c-Jun and c-Fos |
US5872242A (en) | 1992-10-05 | 1999-02-16 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide inhibition of ras |
JPH06213660A (en) * | 1993-01-19 | 1994-08-05 | Aisin Seiki Co Ltd | Detecting method for approximate straight line of image |
KR960701077A (en) | 1993-01-25 | 1996-02-24 | 다알렌 반스톤 | Oligonucleotide Alkylphosphonate and Alkylphosphonothioate (ALIGLPHOSPHONATES AND ALKYLPHOSPHONOTHIOATES) |
US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
GB9304620D0 (en) | 1993-03-06 | 1993-04-21 | Ciba Geigy Ag | Compounds |
US5801154A (en) | 1993-10-18 | 1998-09-01 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of multidrug resistance-associated protein |
ES2149962T3 (en) | 1993-12-09 | 2000-11-16 | Univ Jefferson | COMPOUNDS AND METHODS FOR MUTATIONS DIRECTED TO THE SITE IN EUCARYTIC CELLS. |
US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
EP0975659A1 (en) * | 1997-04-14 | 2000-02-02 | Cor Therapeutics, Inc. | SELECTIVE FACTOR Xa INHIBITORS |
US20020004490A1 (en) * | 1999-04-12 | 2002-01-10 | Dean Nicholas M. | Antisense modulation of Fas mediated signaling |
US6133246A (en) * | 1997-08-13 | 2000-10-17 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide compositions and methods for the modulation of JNK proteins |
AU9509798A (en) | 1997-09-25 | 1999-04-12 | University Of Florida | Antisense oligonucleotide compositions targeted to angiotensi n converting enzy me mrna and methods of use |
US6238921B1 (en) | 1998-03-26 | 2001-05-29 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of human mdm2 expression |
US20030203862A1 (en) * | 1998-03-26 | 2003-10-30 | Miraglia Loren J. | Antisense modulation of MDM2 expression |
US6077709A (en) * | 1998-09-29 | 2000-06-20 | Isis Pharmaceuticals Inc. | Antisense modulation of Survivin expression |
US6228642B1 (en) | 1998-10-05 | 2001-05-08 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of tumor necrosis factor-(α) (TNF-α) expression |
US6900187B2 (en) * | 1999-02-26 | 2005-05-31 | The University Of British Columbia | TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications |
DE60037938T2 (en) | 1999-02-26 | 2009-01-29 | The University Of British Columbia, Vancouver | ANTISENSE THERAPY FOR TRPM-2 |
US7425545B2 (en) * | 2001-07-25 | 2008-09-16 | Isis Pharmaceuticals, Inc. | Modulation of C-reactive protein expression |
NZ546807A (en) * | 2002-03-27 | 2007-03-30 | Aegera Therapeutics Inc | Antisense IAP nucleobase oligomers and uses thereof |
JP2005525829A (en) * | 2002-05-20 | 2005-09-02 | ファルマシア・コーポレーション | Antisense regulation of glucocorticoid receptor expression |
US20050233985A1 (en) * | 2003-06-12 | 2005-10-20 | Smith Jeffrey A | Rsk inhibitors and therapeutic uses thereof |
EP1660512A4 (en) * | 2003-06-02 | 2009-12-23 | Isis Pharmaceuticals Inc | Oligonucleotide synthesis with alternative solvents |
US7825235B2 (en) | 2003-08-18 | 2010-11-02 | Isis Pharmaceuticals, Inc. | Modulation of diacylglycerol acyltransferase 2 expression |
ES2331006T3 (en) * | 2003-08-22 | 2009-12-18 | Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research | QUINASE S6 ACTIVITY INHIBITION FOR INSULIN RESISTANCE TREATMENT. |
US20050142581A1 (en) | 2003-09-04 | 2005-06-30 | Griffey Richard H. | Microrna as ligands and target molecules |
US20050074801A1 (en) | 2003-09-09 | 2005-04-07 | Monia Brett P. | Chimeric oligomeric compounds comprising alternating regions of northern and southern conformational geometry |
US20050053981A1 (en) | 2003-09-09 | 2005-03-10 | Swayze Eric E. | Gapped oligomeric compounds having linked bicyclic sugar moieties at the termini |
US7919472B2 (en) * | 2004-09-17 | 2011-04-05 | Isis Pharmaceuticals, Inc. | Enhanced antisense oligonucleotides |
US8935416B2 (en) | 2006-04-21 | 2015-01-13 | Fortinet, Inc. | Method, apparatus, signals and medium for enforcing compliance with a policy on a client computer |
US9400902B2 (en) | 2012-05-22 | 2016-07-26 | Trimble Navigation Limited | Multi-modal entity tracking and display |
-
2005
- 2005-09-19 US US11/231,243 patent/US7919472B2/en not_active Expired - Fee Related
- 2005-09-19 EP EP05798891.7A patent/EP1799859B1/en not_active Not-in-force
- 2005-09-19 WO PCT/US2005/033837 patent/WO2006034348A2/en active Application Filing
- 2005-09-19 AU AU2005286738A patent/AU2005286738A1/en not_active Abandoned
- 2005-09-19 JP JP2007532648A patent/JP2008513507A/en active Pending
- 2005-09-19 CA CA2580504A patent/CA2580504C/en not_active Expired - Fee Related
- 2005-09-19 EP EP11166957A patent/EP2397563A3/en not_active Withdrawn
-
2009
- 2009-12-24 AU AU2009251179A patent/AU2009251179B2/en not_active Ceased
-
2011
- 2011-01-18 US US13/008,704 patent/US20110207797A1/en not_active Abandoned
- 2011-06-21 JP JP2011137144A patent/JP2011256171A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002036743A2 (en) | 2000-10-30 | 2002-05-10 | Isis Pharmaceuticals, Inc. | Antisense modulation of calreticulin expression |
US6426220B1 (en) | 2000-10-30 | 2002-07-30 | Isis Pharmaceuticals, Inc. | Antisense modulation of calreticulin expression |
Non-Patent Citations (10)
Title |
---|
BEAUCAGE, S. L.; CARUTHERS, M. H., TETRAHEDRON LETT., vol. 22, 1981, pages 1859 - 1862 |
DAHL, B. J. ET AL., ACTA CHEM. SCAND, vol. 44, 1990, pages 639 - 641 |
GRIFFIN, B. E. ET AL., TETRAHEDRON, vol. 23, 1967, pages 2301 - 2313 |
GRIFFIN, B. E. ET AL., TETRAHEDRON, vol. 23, 1967, pages 2315 - 2331 |
MATTEUCCI, M. D.; CARUTHERS, M. H., J. AM. CHEM. SOC., vol. 103, 1981, pages 3185 - 3191 |
REDDY, M. P. ET AL., TETRAHEDROMLETT., vol. 25, 1994, pages 4311 - 4314 |
SCARINGE, S. A. ET AL., J. AM. CHEM. SOC., vol. 1''8, no. 120, pages 11820 - 11821 |
SCARINGE, S. A., PH.D. THESIS, 1996 |
See also references of EP1799859A4 |
WINCOTT, F. ET AL., NUCLEIC ACIDS RES., vol. 23, 1995, pages 2677 - 2684 |
Cited By (30)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7750142B2 (en) | 2003-04-28 | 2010-07-06 | Isis Pharmaceuticals, Inc. | Modulation of glucagon receptor expression |
US7919476B2 (en) | 2003-04-28 | 2011-04-05 | Isis Pharmaceuticals, Inc. | Modulation of glucagon receptor expression |
US8642753B2 (en) | 2003-04-28 | 2014-02-04 | Isis Pharmaceuticals, Inc. | Modulation of glucagon receptor expression |
US7399853B2 (en) | 2003-04-28 | 2008-07-15 | Isis Pharmaceuticals | Modulation of glucagon receptor expression |
AU2006292293B2 (en) * | 2005-09-19 | 2012-09-13 | Isis Pharmaceuticals, Inc. | Modulation of glucocorticoid receptor expression |
CN104212799B (en) * | 2008-10-15 | 2018-11-23 | Ionis制药公司 | The adjusting of factor 11 expression |
US11376273B2 (en) | 2008-10-15 | 2022-07-05 | Ionis Pharmaceuticals, Inc. | Modulation of factor 11 expression |
CN103820450B (en) * | 2008-10-15 | 2018-08-21 | Ionis制药公司 | The adjusting of factor 11 expression |
US11225664B2 (en) | 2010-01-08 | 2022-01-18 | Ionis Pharmaceuticals, Inc. | Modulation of angiopoietin-like 3 expression |
US11535849B2 (en) | 2010-04-29 | 2022-12-27 | Ionis Pharmaceuticals, Inc. | Modulation of transthyretin expression |
US9765338B2 (en) | 2010-07-19 | 2017-09-19 | Ionis Pharmaceuticals, Inc. | Modulation of dystrophia myotonica-protein kinase (DMPK) expression |
EP2640853B1 (en) | 2010-11-17 | 2018-12-26 | Ionis Pharmaceuticals, Inc. | Modulation of alpha synuclein expression |
US10815480B2 (en) | 2010-11-17 | 2020-10-27 | Ionis Pharmaceuticals, Inc. | Modulation of alpha synuclein expression |
US10202599B2 (en) | 2011-08-11 | 2019-02-12 | Ionis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
US9404114B2 (en) | 2011-09-20 | 2016-08-02 | Ionis Pharmaceuticals, Inc. | Antisense modulation of GCGR expression |
US8865674B2 (en) | 2011-09-20 | 2014-10-21 | Isis Pharmaceuticals, Inc. | Antisense modulation of GCGR expression |
US9567587B2 (en) | 2011-10-25 | 2017-02-14 | Ionis Pharmaceuticals, Inc. | Antisense modulation of GCCR expression |
US8901098B2 (en) | 2011-10-25 | 2014-12-02 | Isis Pharmaceuticals, Inc. | Antisense modulation of GCCR expression |
US11236335B2 (en) | 2012-10-12 | 2022-02-01 | Ionis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
US10260069B2 (en) | 2013-02-04 | 2019-04-16 | Ionis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
US10954519B2 (en) | 2013-08-09 | 2021-03-23 | lonis Pharmaceuticals, Inc. | Compounds and methods for modulation of dystrophia myotonica-protein kinase (DMPK) expression |
US11118183B2 (en) | 2013-12-24 | 2021-09-14 | Ionis Pharmaceuticals, Inc. | Modulation of angiopoietin-like 3 expression |
EP4035659A1 (en) | 2016-11-29 | 2022-08-03 | PureTech LYT, Inc. | Exosomes for delivery of therapeutic agents |
US11230712B2 (en) | 2017-11-09 | 2022-01-25 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing SNCA expression |
US11359197B2 (en) | 2018-01-12 | 2022-06-14 | Bristol-Myers Squibb Company | Antisense oligonucleotides targeting alpha-synuclein and uses thereof |
US11447775B2 (en) | 2018-01-12 | 2022-09-20 | Bristol-Myers Squibb Company | Antisense oligonucleotides targeting alpha-synuclein and uses thereof |
US11485975B2 (en) | 2018-02-09 | 2022-11-01 | Genentech, Inc. | Oligonucleotides for modulating TMEM106B expression |
US11021710B2 (en) | 2018-05-09 | 2021-06-01 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing FXI expression |
US11833221B2 (en) | 2021-09-01 | 2023-12-05 | Ionis Pharmaceuticals, Inc. | Oligomeric compounds for reducing DMPK expression |
US20230265436A1 (en) * | 2022-02-24 | 2023-08-24 | Q-State Biosciences, Inc. | Therapeutics for syngap haploinsufficiency |
Also Published As
Publication number | Publication date |
---|---|
JP2008513507A (en) | 2008-05-01 |
US20060063730A1 (en) | 2006-03-23 |
EP1799859A4 (en) | 2009-02-25 |
EP1799859B1 (en) | 2014-07-02 |
AU2009251179A1 (en) | 2010-01-21 |
EP1799859A2 (en) | 2007-06-27 |
US7919472B2 (en) | 2011-04-05 |
US20110207797A1 (en) | 2011-08-25 |
WO2006034348A3 (en) | 2006-11-02 |
AU2009251179B2 (en) | 2013-05-02 |
JP2011256171A (en) | 2011-12-22 |
CA2580504A1 (en) | 2006-03-30 |
EP2397563A3 (en) | 2012-07-18 |
CA2580504C (en) | 2013-10-29 |
EP2397563A2 (en) | 2011-12-21 |
AU2005286738A1 (en) | 2006-03-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2009251179B2 (en) | Enhanced antisense oligonucleotides | |
EP2218727B1 (en) | Modulation of c-reactive protein expression | |
US8258105B2 (en) | Antisense oligonucleotides optimized for kidney targeting | |
AU2009201229B2 (en) | Modulation of glucose-6-phosphatase translocase expression | |
WO2006026485A2 (en) | Modulation of hif1-beta expression | |
EP1633302A2 (en) | Modulation of apolipoprotein (a) expression | |
US8198253B2 (en) | Compositions and their uses directed to HBXIP | |
WO2005086804A2 (en) | Modulation of ace2 expression | |
WO2007137301A2 (en) | Modulation of chrebp expression | |
EP2013345A2 (en) | Compositions and methods for modulation of mcl-1 expression | |
AU2012244335A1 (en) | Modulation of c-reactive protein expression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2005286738 Country of ref document: AU Ref document number: 2580504 Country of ref document: CA Ref document number: 2007532648 Country of ref document: JP |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2005798891 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2005286738 Country of ref document: AU Date of ref document: 20050919 Kind code of ref document: A |
|
WWP | Wipo information: published in national office |
Ref document number: 2005286738 Country of ref document: AU |
|
WWP | Wipo information: published in national office |
Ref document number: 2005798891 Country of ref document: EP |