WO2006026358A2 - Sperm specific raft associated proteins - Google Patents

Sperm specific raft associated proteins Download PDF

Info

Publication number
WO2006026358A2
WO2006026358A2 PCT/US2005/030261 US2005030261W WO2006026358A2 WO 2006026358 A2 WO2006026358 A2 WO 2006026358A2 US 2005030261 W US2005030261 W US 2005030261W WO 2006026358 A2 WO2006026358 A2 WO 2006026358A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
sperm
amino acid
acid sequence
compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/030261
Other languages
French (fr)
Other versions
WO2006026358A3 (en
Inventor
Susan B. Sleight
John C. Herr
Bingfang Xu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
UVA Licensing and Ventures Group
University of Virginia UVA
Original Assignee
University of Virginia UVA
University of Virginia Patent Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Virginia UVA, University of Virginia Patent Foundation filed Critical University of Virginia UVA
Publication of WO2006026358A2 publication Critical patent/WO2006026358A2/en
Anticipated expiration legal-status Critical
Publication of WO2006026358A3 publication Critical patent/WO2006026358A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants

Definitions

  • Lipid raft domains are regions of plasma membranes that have distinct lipid content and are enriched in cholesterol and sphingolipids. The unique content of these domains is believed to recruit specific proteins to the plasma membrane and these domains are implicated in signal transduction. If the protein caveolin is present then the membrane domain is defined as a caveola. Caveolins are cholesterol binding proteins that can potentially regulate a variety of signal transduction pathways (Smart et al., (1999) MoI. Cell. Biol. 19, 7289-7304; Kurzchalia & Parton, (1999) Curr. Opin. Cell. Biol. 11, 424-431).
  • proteins associated with the lipid raft domains of sperm cells are isolated and characterized. Following ejaculation, sperm are motile yet lack fertilizing competence which they gain in the female reproductive tract in a time-dependent process collectively called capacitation [1, 2].
  • Capacitation correlates in vitro with a cyclic AMP-dependent rise in tyrosine phosphorylation and is associated with changes in both the head and tail that prepare the sperm to undergo a regulated acrosome reaction (e.g., in response to the zona pellucida of the egg) and to be capable of hyperactivated motility [3].
  • Capacitation can be accomplished in vitro using cauda epididymal or ejaculated sperm incubated in a defined medium that reflects the electrolytic composition of the oviductal fluid [I].
  • Capacitation is associated with significant changes in the properties of sperm membranes, including an efflux of cholesterol.
  • Bovine serum albumin (BSA), an essential component of in vitro capacitation medium, is believed to function as a cholesterol acceptor by removing it from the sperm plasma membrane [4-11]. Cholesterol and/or cholesterol analogues, if added to the capacitation medium inhibit sperm capacitation [12]. Additionally, other cholesterol-binding agents such as High density lipoprotein (HDL) [12-14] and ⁇ -cyclodextrins may substitute for BSA in capacitation media [15-18].
  • HDL High density lipoprotein
  • ⁇ -cyclodextrins may substitute for BSA in capacitation media [15-18].
  • lipid rafts are highly enriched in cholesterol, gangliosides, and sphmgolipids.
  • This lipid content contributes to the hydrophobic nature of raft domains and leads to two inherent biochemical properties: insolubility at 4°C in Triton XlOO detergent and light buoyant density after centrifugation in a sucrose density gradient. These properties can be used to isolate detergent-resistant membrane (DRM) as biochemical correlates of lipid rafts [21].
  • DRM detergent-resistant membrane
  • lipid rafts An additional property of lipid rafts, also due to their inherent hydrophobic nature, is the ability to recruit specific types of proteins including transmembrane proteins, membrane-bound, GPI-anchored, and saturated acyl chains lipid-modified proteins [22]. hi somatic cells, evidence is accumulating that lipid rafts, serve as centers for cholesterol traffic and for signal transduction pathways originating at the plasma membrane [23]. Signaling proteins in these domains are often cell-type and cell-state specific, and include receptor and non-receptor tyrosine kinases, G proteins, inositol phospholipids, GPI-anchored proteins, nitric oxide synthase and others congregate in lipid rafts [24-26].
  • caveolae A subset of lipid raft, called caveolae, are formed by polymerization of caveolins or caveolin-related integral membrane proteins (e.g. flotillin) which tightly bind cholesterol [27]. Caveolin forms high molecular weight (HMW) homo- and hetero-oligomers, ranging in size from 200-600 kDa [28-30]. Although the general functions of caveolae are still not completely defined, they are believed to be implicated in cholesterol transport [31], membrane trafficking [32] and signal transduction [33] in other systems. In mouse and guinea pig sperm, caveolin 1 (CAVl) is present in the plasma membrane overlying the acrosomal region and the flagellum [34, 35].
  • CAVl caveolin 1
  • cholesterol depletion As a method to evaluate whether a particular signaling pathway is regulated by changes in the properties of lipid rafts [36, 37].
  • ⁇ -cyclodextrins a plant derivative with strong affinity for cholesterol, which drastically depletes cells from their cholesterol content in a non-physiologic manner.
  • cholesterol acceptors e.g. BSA, ⁇ -cyclodextrins or HDL
  • Mammalian sperm acquire fertilization capacity after residing in the female tract in a process known as capacitation.
  • the present disclosure addressed whether cholesterol efflux during capacitation alters the biophysical properties of the sperm plasma membrane by potentially reducing the extent of lipid raft domains as analyzed by the isolation- of detergent-resistant membrane fractions using sucrose gradients.
  • this work investigated whether dissociation of the detergent resistant membrane fraction during capacitation alters resident sperm raft proteins.
  • Mouse sperm proteins associated with such fractions were studied by silver staining, tandem mass spectrometry and Western blotting. Caveolin 1 was identified in sperm lipid rafts in multimeric states, including a high molecular weight oligomer sensitive to degradation under reducing conditions at high pH.
  • Capacitation also resulted in a significant reduction in sperm labeling by the fluorescent lipid analogue DiIC 16 indicating capacitation alters the liquid-ordered domains in the sperm plasma membrane.
  • the observations that capacitation alters the protein composition of the detergent-resistant membrane fractions is consistent with the hypothesis that cholesterol efflux during capacitation dissociates lipid raft constituents initiating signaling events leading to sperm capacitation.
  • the present invention is directed to the human and mouse Band 10 (sPRVl-2) and TESlOl genes, their respective encoded proteins and antibodies against those proteins. More particularly, the present invention is directed to polypeptides comprising the amino acid sequences of the mouse Band 10 (SEQ ID NO: 1), human Band 10 (SEQ ID NO: 2), the mouse TESlOl (SEQ ID NO: 3), human TESlOl (SEQ ID NO: 4).
  • the present invention provides antagonists of Band 10 and/or TESlOl activity with utility as contraceptive agents, and thus, one aspect of the present invention is directed to a method of screening for inhibitors of Band 10 and/or TESlOl.
  • the present invention also encompasses antibodies specific for Band 10 and/or TES 101 and the use of such antibodies as therapeutic and diagnostic tools.
  • the amino acid sequences of SEQ DD NOs: 1, 2, 4, and 4 are as follows: SEQ ID NO: 1
  • Human Band 10 (sPRVl-2) protein 1 mgpqhlrlvq lfcllgaipt lpragallcy eatasrfrav afhnwkwllm rnmvcklqeg
  • Mouse TESlOl protein 1 mgacriqyvl liflliasrw tlvqntycqv sqtlsleddp grtfnwtska eqcnpgelcq
  • Human TESlOl protein 1 mgarqiqtss sqtspeeamg tpriqhllil lvlgasllts glelycqkgl smtveadpan
  • the invention comprises an isolated nucleic acid comprising a nucleic acid sequence encoding a human sPRVl-2.
  • the nucleic acid sequence encodes a polypeptide having SEQ ID NO:2, or a fragment, derivative, or homolog thereof.
  • the invention comprises an isolated nucleic acid comprising a nucleic acid sequence having the sequence of SEQ ID NO:5: cttgtctttgtgtcggttgtgattttcctaatctctgattttccttttctctcggacgctctcctcggacccat ⁇ cgtgcttcatgccctgatagcctggcccccttccccggcttcccttcgctaccggggacgcctctagtttttctgaatttctggctggctggctggct ct cccaccctccgcgttcatcttcctcaagagttcgcccctctgggggctcctctgtgtaatcgtcgccttctctgggtatttctctgt
  • the invention comprises an isolated nucleic acid comprising a nucleic acid sequence having the. sequence of SEQ ID NO:6: cttttctgcgggtcttggcacctttcttggccacagatttctgggttacagagcatgtgtgtctgaggcattgcaggca gaaaagggtggccgacgtgacctctagctggactgctgggcaggggagctgtcctagataaaattggaaagcaccttgtcca atgggaggacctaagtgggagagtgagagtcctgctttgagaagctaagatggtggatggtgcagaaacagtgacccagag acaggtggacaaagaattcggggactgatgggaactgagcttgggatccagactgaaactgattccagactgacctctagca
  • the invention provides an isolated nucleic acid comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence selected from the group of amino acid sequences consisting of SEQ ID NOs:3 and 4.
  • One aspect of the present invention relates to signaling events in mammalian sperm that regulate the functions of this highly differentiated cell. More particularly, in one embodiment the invention relates to signal transduction that modulates the acquisition of sperm fertilizing capacity. After ejaculation, sperm are able to move actively but lack fertilizing competence. They acquire the ability to fertilize in the female genital tract in a time-dependent process called capacitation.
  • Capacitation has been demonstrated to be accompanied by phosphorylation of several proteins on both serine/threonine and tyrosine residues, and that protein tyrosine phosphorylation is regulated downstream by a cAMP/PKA pathway that involves the crosstalk between these two signaling pathways.
  • PKA the other kinase(s) involved in the regulation of capacitation are still unknown.
  • Raft fractions can be isolated with reproducibility from mouse caudal sperm using ultracentrifugation of membranes in a sucrose gradient according to standard techniques known to titiose skilled in the art (see Fig. 6). As shown in Fig. 7 the proteins present in sucrose fractions of the isolated lipid raft domains isolated from noncapacitated sperm differ from those isolated from capacitated sperm. Silver stained PAGE analysis reveals that a number of proteins present in the lipid raft domains of noncapacitated sperm are not present in those domains in capacitated sperm, thus raft domains are diminished in protein content (especially true for fraction 4) upon capacitation of the sperm (see Fig. 7).
  • a sperm raft domain associated protein is isolated and characterized.
  • the human and mouse Band 10 (sPRVl-2) and/or TESlOl genes and proteins serve as targets for the development of novel drugs, including the identification of novel contraceptive agents.
  • antibodies are developed which target polypeptides of the invention, hi one embodiment, the human and mouse Band 10 (sPRVl-2) and/or TESlOl genes and proteins serve as targets for identifying drugs, compounds, and antibodies which modulate fertility.
  • compounds or antibodies of the invention directed against polypeptides of the invention are useful for modulating fertility.
  • fertility is modulated by inhibiting or reducing sperm capacitation.
  • antisense oligonucleotides complementary to nucleic acid sequences of the invention are provided.
  • compositions and methods of the invention may be employed using other samples, no matter how obtained, no matter the source, and no matter how treated.
  • Figure 1 represents images of gels summarizing that multiple electrophoretic isoforms of CAVl are present in mouse sperm.
  • Figure IA Sperm were prepared as described in the Examples; the extracts (200,000 sperm equivalent/lane) were separated using a 4-16% linear gradient SDS-PAGE, transferred to Immobilon P and CAVl visualized using specific antibodies (Fig IA, left lane). As a control for antibody specificity, identical blots were developed with the same antibody pre-absorbed with the antigenic peptide.
  • Fig. IB left panel: NON and CAP sperm proteins were prepared to maintain HMW caveolin complexes and analyzed as in Fig. IA.
  • Fig. 1C Sperm homogenates were sonicated in buffer containing 1 % TX 100 and incubated in the same buffer for 30 minutes on ice. Then sequential centrifugations were performed. First, a pellet (PlO) and supernatant were obtained after centrifugation at 10,000 x g for 10 min. Second, the supernatant was further centrifuged at 100,000 x g for 1 hour and the pellet (PlOO) and the supernatant (SlOO) were recovered. Each fraction was then prepared to maintain HMW CAVl complexes and separated in SDS- PAGE gels as before. The proteins were then transferred to PVDF membranes and the CAVl visualized with anti CAVl by Western Blot.
  • NON and CAP sperm (80-100 million) treated with 0.5% TXlOO in TEN buffer were adjusted to 40% sucrose.
  • Samples were prepared for DRM isolation as described in Methods. In each condition, nine 200 ⁇ l fractions were then collected from Top to Bottom, divided in two and analyzed in a linear gradient SDS-PAGE. One set was analyzed by silver staining of the fractions from the Top to Bottom of the sucrose gradient. The light-scattering visible light buoyant density fraction (*) band was observed in the non-capacitated population but not in the capacitated one. The second set of aliquots was analyzed by linear gradient SDS-PAGE, transferred to Immobilon P and immunostained with the CAVl antibody. This experiment was repeated six times with similar results. Upper two panels- NON; Lower two panels- CAP; Left two panels- silverstain; Right two panels- ⁇ -Cavl ⁇ . Figure 3. MS/MS analysis of lipid rafts.
  • Proteins detected by silver stain in the light buoyant density DRM fraction (#4) of non-capacitated sperm were numbered, excised and submitted for peptide analysis and protein identification as described in Methods. For simplicity, every other protein band is numbered while every arrow represents an excised silver-stained band.
  • the Sequest algorithmic program or manual EST database searches were used to match the peptides to known proteins. Proteins identified by this method are shown in Table I.
  • sPRVl-1 Two novel proteins belonging to the uPAR/Ly-6/Snake receptor family were detected ' from band 10,11 in this putative mouse sperm raft domain. They were designated as sPRVl-1, sPRVl-2 (also called BandlO herein) based on 30% similarity to human polycythemia rubra vera 1 (PRVl), which is a hematopoietic cell surface receptor, highly expressed in granulocytes from patients with polycythemia rubra vera (see Figure 3).
  • PRVl human polycythemia rubra vera 1
  • Figure 4 (four panels). Detection of TEXlOl and FfKl after sucrose gradient fractionation in non-capacitated and capacitated mouse sperm.
  • NON and CAP sperm (80-100 million) treated with 0.5% TXlOO in TEN buffer were adjusted to 40% sucrose and prepared for DRM isolation as described in Methods. In each condition, nine 200 ⁇ l fractions were then collected from Top to Bottom, divided in two and analyzed by linear gradient SDS-PAGE. The gels were then transferred to Immobilon P and Western blots conducted with antibodies against HKl and TEXlOl respectively. Upper two panels- ⁇ HKl; Lower two panels- ⁇ TES; Left two panels- NON; Right two panels- CAP. Molecular weight marker ranges are indicated on the left. The raft numbers are indicated across the top. non-capacitated (NON) and capacitated sperm (CAP)
  • Figure 5 (comprising Figures 5 A, 5B, 5C, and 5D). Detection of liquid-ordered plasma membrane domains in non- and capacitated sperm with the lipid analog probe DiICl 6.
  • NON Top, Figs. 5A and 5B
  • CAP Bottom, Figs. 5C and 5D
  • sperm were labeled with the lipid analog probe DiIC 16 to detect Io domains as described in Experimental Procedures. Labeling with DiIC 16 of fixed (Left, 5 A and 5C) and live (Right, 5B and 5D) sperm was performed as described in Experimental Procedures in order to compare probe binding of liquid-ordered domains in both conditions.
  • Figure 6 Comparison of the Mouse and Human Band 10 Proteins:
  • Figure 8 Locations of the clusters of PRVl similar genes on mouse chromosome 7 and human chromosome 19.
  • Figure 9 comprising Figures 9A, 9B, and 9C, illustrates the results of Northern blot analyses and RNA dot blot analysis of human sPRVl-2 expression.
  • FIG. 9A Northern analysis of human sPRVl-2 expression in 8 human tissues (spleen, thymus, prostate, testis, ovary, small intestine, colon, and peripheral blood leukocytes). HsPRV 1-2 was found only expressed in testis, and two major transcripts, hsPRVl-2A, hsPRVl-2B, approximately 2.0 kb and 1.0 Kb were detected (see Figure 9A).
  • Figure 9B demonstrates the results of an RNA dot blot analysis of 76 human tissues.
  • Figure 9C depicts the results of a northern analysis of human sPRVl-2 expression in human testis and lymph node. Two major transcripts were detected in testis but not in lymph node or ovary. RT-PCR (data not shown) only revealed a small amount of 1.0 kb transcript in human lymph node.
  • Figure 10 comprising a left panel, Fig. 1OA (human sperm protein), and a right panel, Fig. 1OB (mouse sperm protein), represents images of a western blot analysis demonstrating that polyclonal antisera against hsPRVl-2 recognizes sPRVl-2 proteins in human and mouse.
  • Human sperm protein extract was run on 1-D gel, then immunoblotted with anti-hsPRVl-2 rat serum (post) and preimmune-serum (pre). The left strip of each panel indicates incubation with preimmune serum and the right strip of each panel indicates incubation with postimmune serum.
  • Molecular weight markers are indicated as are hsPRVl-2 and possible multimers of hsPRVl-2.
  • Figure 11 comprising Figures 1 IA, B, C, D, E, F, G, and H, represents photomicrographs of immunofluorescence localization of hsPRVl-2 in human sperm.
  • FIG. 1 IA immunofluorescent staining of capacitated (Fig. 1 IA) and non-capacitated human sperm (Fig. HC) was performed using anti-hsPRVl-2 rat serum.
  • the corresponding phase contrast images (1 IB and HD) are adjacent to the immunofluorescent images.
  • immunofluorescent staining of capacitated (Fig. HE) and non-capacitated (Fig. 11G) human sperm was performed using preimmune serum from the same rat.
  • the corresponding phase contrast images (1 IF and 1 IH) are adjacent to the immunofluorescent images.
  • Figure 12 is a schematic representation of the possible post-translation modifications of human sPRVl-2A. The schematic indicates the signal peptide domain, a uPAR/Ly6 module, putative glycosylation and cleavage sites, and a super-sensitive site for serine proteases.
  • Figure 13 represents images of a 2-D gel electrophoretic analysis of sPRVl-2 isoforms in supernatants from live human sperm treated with PIPLC.
  • Figures 13A and 13B demonstrate the results of 2-D gel electrophoresis followed by Western blotting of the supernatants from human sperm treated without PIPLC (13A) or with PIPLC (13B) using anti-sPRVl-2.
  • Figure 13C represents the results of a 2-D blot of human sperm proteins probed with anti-sPRVl-2 antibody.
  • Figure 14 comprising Figures 14A, 14B, 14C, and 14D, represents a schematic comparison of the density of EST (Fig. 14A), the 6 exons of human sPRVl-2 (Fig. 14B), and transcripts A (Fig. 14C) and B (Fig. 14D) of sPRVl-2.
  • Figure 15 is a schematic representation of the alignment of two transcripts, A and B, of human sPRVl-2 (also called Band 10 herein).
  • Figure 16 represents an image of the results of an RTrPCR analysis of two transcripts of sPRVl-2 in multiple tissues (testis, leukocytes, and lymph nodes).
  • the left half of the gel represents Transcript A and the right half represents Transcript B.
  • the far right lane represent markers.
  • Figure 17 represents a signal peptide analysis of sPRVl-2 (Band 10). The ordinate represents the score and the abscissa represents the position.
  • Figure 18, represents the results of a TMpred Analysis to analyze possible transmembrane regions of sPRVl-2.
  • Fig. 18A indicates positions and "inside to outside” and “outside to inside” helices.
  • Fig. 18B graphically summarizes the TMpred output and indicates a transmembrane region from about amino acid residue position 86 to about position 105.
  • Figure 19 represents an image of an expression analysis of recombinant hsPRVl-2A in several expression strains of E. coli. Indicated above the gel are Nova Blue, BLR, BL21, and BL21 (lys). 25 kD and 15 kD migration rates are indicated.
  • Figure 20 comprising upper and lower panels (Figs. 2OA and 2OB, respectively), demonstrates schematics of various truncated hsPRVl-2 constructs
  • Fig. 2OA indicates the full parent construct, i.e., signal peptide region to transmembrane domain, to C- terminal tail.
  • Construct A as used encompassed the parent construct.
  • Truncated construct B lacked the signal peptide.
  • Truncated construct C lacked the signal peptide and the C-terrninal tail.
  • Truncated construct D lacked the signal peptide through and including the transmembrane domain region.
  • Figure 21 represents images of an analysis of Ni-NTA purified truncated hsPRVl-2 (construct E, see Figure 20).
  • the left three lanes of the gel indicate various amounts of BSA, and the right lanes indicate hsPRVl-2.
  • Bovine serum albumin BSA capacitating conditions or capacitated sperm (CAP) caveolin 1 (CAVl) detergent-resistant membrane (DRM) Hexokinase I (HKl) High density lipoprotein (HDL) Horseradish peroxidase (HRP) human sperm PRV-like protein (hsPRV) mouse sperm PRV-like protein (msPRV) non-capacitating conditions or non-capacitated sperm (NON) Polycythemia rubra vera (PRV) room temperature (RT) sperm PRV-like protein (sPRV)
  • an element means one element or more than one element.
  • a disease or disorder is "alleviated” if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, are reduced.
  • amino acids are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table:
  • amino acid as used herein is meant to include both natural and synthetic amino acids, and both D and L amino acids.
  • Standard amino acid means any of the twenty standard L-amino acids commonly found in naturally occurring peptides.
  • Nonstandard amino acid residue means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source.
  • synthetic amino acid also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and substitutions.
  • Amino acids contained within the peptides of the present invention can be modified by methylation, amidation, acetylation or substitution with other chemical groups which can change the peptide's circulating half-life without adversely affecting their activity. Additionally, a disulfide linkage may be present or absent in the peptides of the invention.
  • amino acid is used interchangeably with "amino acid residue,” and may refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide.
  • Amino acids have the following general structure:
  • NH 2 Amino acids may be classified into seven groups on the basis of the side chain
  • R (1) aliphatic side chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains containing sulfur atoms, (4) side chains containing an acidic or amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an imino acid in which the side chain is fused to the amino group.
  • the nomenclature used to describe the peptide compounds of the present invention follows the conventional practice wherein the amino group is presented to the left and the carboxy group to the right of each amino acid residue.
  • the amino-and carboxy-terminal groups although not specifically shown, will be understood to be in the form they would assume at physiologic pH values, unless otherwise specified.
  • an "analog" of a chemical compound is a compound that, by way of example, resembles another in structure but is not necessarily an isomer (e.g., 5- fluorouracil is an analog of thymine).
  • basic or “positively charged” amino acid refers to amino acids in which the R groups have a net positive charge at pH 7.0, and include, but are not limited to, the standard amino acids lysine, arginine, and histidine.
  • antibody refers to an immunoglobulin molecule which is able to specifically bind to a specific epitope on an antigen.
  • Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins.
  • Antibodies are typically tetramers of immunoglobulin molecules.
  • the antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies.
  • antisense oligonucleotide or antisense nucleic acid means a nucleic acid polymer, at least a portion of which is complementary to a nucleic acid which is present in a normal cell or in an affected cell.
  • Antisense refers particularly to the nucleic acid sequence of the non-coding strand, of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand.
  • an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule.
  • the antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences.
  • the antisense oligonucleotides of the invention include, but are not limited to, phosphorothioate oligonucleotides and other modifications of oligonucleotides.
  • antisense oligonucleotide or antisense nucleic acid means a nucleic acid polymer, at least a portion of which is complementary to a nucleic acid which is present in a normal cell or in an affected cell.
  • Antisense refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand.
  • an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule.
  • the antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences.
  • the antisense oligonucleotides of the invention include, but are not limited to, phosphorothioate oligonucleotides and other modifications of oligonucleotides.
  • the terms "complementary” or “complementarity" are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules.
  • Band 10 refers to band 10 of the electrophoretic profiles described herein and refers to proteins having SEQ ID NOs: 1 and 2 (mouse and human).
  • Band 10 and sPRVl-2 are used interchangeably herein.
  • biologically active fragments or “bioactive fragment” of the polypeptides of SEQ ID NOs: 1-4 encompasses natural or synthetic portions of the full-length protein that are capable of specific binding to their natural ligand.
  • “Complementary” refers to the broad concept of sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds ("base pairing") with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine.
  • a first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the first region is capable of base pairing with a residue of the second region.
  • the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. More preferably, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.
  • a “compound,” as used herein, refers to a polypeptide, an isolated nucleic acid, or other agent used in the method of the invention.
  • conservative amino acid substitution is defined herein as an amino acid exchange within one of the following five groups: I. Small aliphatic, nonpolar or slightly polar residues:
  • a "control" cell, tissue, sample, or subject is a cell, tissue, sample, or subject of the same type as a test cell, tissue, sample, or subject.
  • the control may, for example, be examined at precisely or nearly the same time the test cell, tissue, sample, or subject is examined.
  • the control may also, for example, be examined at a time distant from the time at which the test cell, tissue, sample, or subject is examined, and the results of the examination of the control may be recorded so that the recorded results may be compared with results obtained by examination of a test cell, tissue, sample, or subject.
  • the control may also be obtained from another source or similar source other than the test group or a test subject, where the test sample is obtained from a subject suspected of having a disease or disorder for which the test is being performed.
  • test cell tissue, sample, or subject is one being examined or treated.
  • a "pathoindicative" cell, tissue, or sample is one which, when present, is an indication that the animal in which the cell, tissue, or sample is located (or from which the tissue was obtained) is afflicted with a disease or disorder.
  • the presence of one or more breast cells in a lung tissue of an animal is an indication that the animal is afflicted with metastatic breast cancer.
  • a tissue normally comprises” a cell if one or more of the cell are present in the tissue in an animal not afflicted with a disease or disorder.
  • a “compound,” as used herein, refers to any type of substance or agent that is commonly considered a drug, or a candidate for use as a drug, combinations, and mixtures of the above, as well as polypeptides and antibodies of the invention.
  • detect and its grammatical variants is meant to refer to measurement of the species without quantification, whereas use of the word
  • a "detectable marker” or a “reporter molecule” is an atom or a molecule that permits the specific detection of a compound comprising the marker in the presence of similar compounds without a marker.
  • Detectable markers or reporter molecules include, e.g., radioactive isotopes, antigenic determinants, enzymes, nucleic acids available for hybridization, chromophores, fluorophores, chemiluminescent molecules, elecrrochemically detectable molecules, and molecules that provide for altered fluorescence-polarization or altered light-scattering.
  • a “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
  • a disorder in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
  • Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
  • a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
  • Both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
  • An “enhancer” is a DNA regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the start site of transcription.
  • a “fragment” or “segment” is a portion of an amino acid sequence, comprising at least one amino acid, or a portion of a nucleic acid sequence comprising at least one nucleotide. The terms “fragment” and “segment” are used interchangeably herein.
  • fragment or “segment” is a portion of an amino acid sequence, comprising at least one amino acid, or a portion of a nucleic acid sequence comprising at least one nucleotide.
  • fragment and “segment” are used interchangeably herein.
  • a “functional" biological molecule is a biological molecule in a form in which it exhibits a property or activity by which it is characterized.
  • a functional enzyme for example, is one which exhibits the characteristic catalytic activity by which the enzyme is characterized.
  • "Homologous” as used herein refers to the subunit sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, e.g., two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position hi both of the two molecules is occupied by the same monomelic subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position.
  • the homology between two sequences is a direct function of the number of matching or homologous positions, e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90% homology.
  • the DNA sequences 3 ⁇ TTGCC5' and 3'TATGGC share 50% homology.
  • homology is used synonymously with "identity.”
  • the determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm.
  • a mathematical algorithm useful for comparing two sequences is the algorithm of Karlin and Altschul (1990, Proc. Natl. Acad. Sci. USA 87:2264-2268), modified as in Karlin and Altschul (1993, Proc. Natl. Acad. Sci. USA 90:5873-5877).
  • This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul, et al. (1990, J. MoI. Biol. 215:403-410), and can be accessed, for example at the National Center for Biotechnology Information (NCBI) world wide web site.
  • NCBI National Center for Biotechnology Information
  • BLAST protein searches can be performed with the XBLAST program (designated "blastn" at the NCBI web site) or the NCBI “blastp” program, using the following parameters: expectation value 10.0, BLOSUM62 scoring matrix to obtain amino acid sequences homologous to a protein molecule described herein.
  • Gapped BLAST can be utilized as described in Altschul et al. (1997, Nucleic Acids Res. 25:3389-3402).
  • PSI-Blast or PHI-Blast can be used to perform an iterated search which detects distant relationships between molecules (Id.) and relationships between molecules which share a common pattern.
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • the percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically exact matches are counted.
  • inhibitor refers to the ability of a compound of the invention to reduce or impede a described function, such as capacitation or fertilization. Preferably, inhibition is by at least 10%, more preferably by at least 25%, even more preferably by at least 50%, and most preferably, the function is inhibited by at least 75%.
  • an "instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the peptide of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein.
  • the instructional material may describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal.
  • the instructional material of the kit of the invention may, for example, be affixed to a container which contains the identified compound invention or be shipped together with a container which contains the identified compound.
  • the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
  • isolated nucleic acid refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs.
  • nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell.
  • the term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of aprokaryote or eukaryote, or which exists as a separate molecule (e.g., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
  • a "ligand” is a compound that specifically binds to a target compound. A ligand (e.g., an antibody) "specifically binds to” or “is specifically immunoreactive with” a compound when the ligand functions in a binding reaction which is determinative of the presence of the compound in a sample of heterogeneous compounds.
  • the ligand binds preferentially to a particular compound and does not bind to a significant extent to other compounds present in the sample.
  • an antibody specifically binds under immunoassay conditions to an antigen bearing an epitope against which the antibody was raised.
  • immunoassay formats may be used to select antibodies specifically immunoreactive with a particular antigen.
  • solid- phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with an antigen. See Harlow and Lane, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
  • linkage refers to a connection between two groups.
  • the connection can be either covalent or non-covalent, including but not limited to ionic bonds, hydrogen bonding, and hydrophobic/hydrophilic interactions.
  • linker refers to a molecule that joins two other molecules either covalently or noncovalently, e.g., through ionic or hydrogen bonds or van der Waals interactions.
  • modulating fertility is meant reducing or increasing fertility. For example, inhibiting fertilization is a means of modulating fertility.
  • nucleic acid any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages.
  • phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged
  • nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).
  • bases other than the five biologically occurring bases
  • Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5'-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5 '-direction.
  • the direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction.
  • the DNA strand having the same sequence as an mRNA is referred to as the "coding strand”; sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as “upstream sequences”; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as "downstream sequences.”
  • oligonucleotide typically refers to short polynucleotides, generally no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T.”
  • operably linked refers to a juxtaposition wherein the components are configured so as to perform their usual function.
  • control sequences or promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
  • a single-stranded or double-stranded nucleic acid moiety comprises the two polynucleotides arranged within the nucleic acid moiety in such a manner that at least one of the two polynucleotides is able to exert a physiological effect by which it is characterized upon the other.
  • a promoter operably linked to the coding region of a gene is able to promote transcription of the coding region.
  • a "peptide” encompasses a sequence of 2 or more amino acid residues wherein the amino acids are naturally occurring or synthetic (non-naturally occurring) amino acids covalently linked by peptide bonds. No limitation is placed on the number of amino acid residues which can comprise a protein's or peptide's sequence.
  • the terms "peptide,” polypeptide,” and “protein” are used interchangeably.
  • Peptide mimetics include peptides having one or more of the following modifications: 1. peptides wherein one or more of the peptidyl -C(O)NR-- linkages (bonds) have been replaced by a non-peptidyl linkage such as a — CH2-carbamate linkage
  • Naturally occurring amino acid residues in peptides are abbreviated as recommended by the IUPAC-RJB Biochemical Nomenclature Commission as follows: Phenylalanine is Phe or F; Leucine is Leu or L; Isoleucine is He or I; Methionine is Met or M; Norleucine is NIe; Valine is VaI or V; Serine is Ser or S; Proline is Pro or P; Threonine is Thr or T; Alanine is Ala or A; Tyrosine is Tyr or Y; Histidine is His or H; Glutamine is GIn or Q; Asparagine is Asn or N; Lysine is Lys or K; Aspartic Acid is Asp or D; Glutamic Acid is GIu or E; Cysteine is Cys or C; Tryptophan is Trp or W; Arginine is Arg or R; Glycine is GIy or G, and X is any amino acid.
  • Other naturally occurring amino acids include, by way of example, 4-
  • Synthetic or non-naturally occurring amino acids refer to amino acids which do not naturally occur in vivo but which, nevertheless, can be incorporated into the peptide structures described herein.
  • the resulting "synthetic peptide" contains amino acids other than the 20 naturally occurring, genetically encoded amino acids at one, two, or more positions of the peptides. For instance, naphthylalanine can be substituted for tryptophan to facilitate synthesis.
  • Other synthetic amino acids that can be substituted into peptides include L-hydroxypropyl, L-3,4-dihydroxyphenylalanyl, alpha-amino acids such as L-alpha-hydroxylysyl and D-alpha-methylalanyl, L-alpha.-methylalanyl, beta.
  • the term "pharmaceutically acceptable carrier” includes any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents. The term also encompasses any of the agents approved by a regulatory agency of the US Federal government or listed in the US Pharmacopeia for use in animals, including humans.
  • a “polylinker” is a nucleic acid sequence that comprises a series of three or more different restriction endonuclease recognitions sequences closely spaced to one another (i.e. less than 10 nucleotides between each site).
  • a "polynucleotide” means a single strand or parallel and anti-parallel strands of a nucleic acid.
  • a polynucleotide may be either a single-stranded or a double- stranded nucleic acid.
  • promoter/regulatory sequence means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulator sequence.
  • this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product.
  • the promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
  • a "constitutive promoter” is a promoter which drives expression of a gene to which it is operably linked, in a constant manner in a cell.
  • promoters which drive expression of cellular housekeeping genes are considered to be constitutive promoters.
  • a “core promoter” contains essential nucleotide sequences for promoter function, including the TATA box and start of transcription. By this definition, a core promoter may or may not have detectable activity in the absence of specific sequences that enhance the activity or confer tissue specific activity.
  • An “inducible” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a living cell substantially only when an inducer which corresponds to the promoter is present in the cell.
  • non-native promoter refers to any promoter that has been operably linked to a coding sequence wherein the coding sequence and the promoter are not naturally associated (i.e. a recombinant promoter/coding sequence construct).
  • tissue-specific promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a living cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
  • nucleic acid As used herein, “nucleic acid,” “DNA,” and similar terms also include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone.
  • nucleic acid analogs i.e. analogs having other than a phosphodiester backbone.
  • peptide nucleic acids which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention.
  • fragment as applied to a nucleic acid, may ordinarily be at least about 20 nucleotides in length, typically, at least about 50 nucleotides, more typically, from about 50 to about 100 nucleotides, preferably, at least about 100 to about
  • nucleic acid fragment will be greater than about 650 nucleotides in length.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
  • protecting group with respect to a terminal amino group refers to a terminal amino group of a peptide, which terminal amino group is coupled with any of various amino-termirial protecting groups traditionally employed in peptide synthesis.
  • Such protecting groups include, for example, acyl protecting groups such as formyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; aromatic urethane protecting groups such as benzyloxycarbonyl; and aliphatic urethane protecting groups, for example, tert-butoxycarbonyl or adamantyloxycarbonyl. See Gross and Mienhofer, eds., The Peptides, vol. 3, pp. 3-88 (Academic Press, New York, 1981) for suitable protecting groups.
  • protecting group with respect to a terminal carboxy group refers to a terminal carboxyl group of a peptide, which terminal carboxyl group is coupled with any of various carboxyl-terminal protecting groups. Such protecting groups include, for example, tert-butyl, benzyl or other acceptable groups linked to the terminal carboxyl group through an ester or ether bond.
  • the term “purified” and like terms relate to an enrichment of a molecule or compound relative to other components normally associated with the molecule or compound in a native environment. The term “purified” does not necessarily indicate that complete purity of the particular molecule has been achieved during the process.
  • a “highly purified” compound as used herein refers to a compound that is greater than 90% pure.
  • purified sperm cell DNA refers to DNA that does not produce significant detectable levels of non-sperm cell DNA upon PCR amplification of the purified sperm cell DNA and subsequent analysis of that amplified DNA.
  • Recombinant polynucleotide refers to a polynucleotide having sequences that are not naturally joined together.
  • An amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell.
  • a recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribo some-binding site, etc.) as well.
  • a host cell that comprises a recombinant polynucleotide is referred to as a "recombinant host cell.”
  • a gene which is expressed in a recombinant host cell wherein the gene comprises a recombinant polynucleotide produces a "recombinant polypeptide.”
  • a “recombinant polypeptide” is one which is produced upon expression of a recombinant polynucleotide.
  • a “sample,” as used herein, refers preferably to a biological sample from a subject, including, but not limited to, normal tissue samples, diseased tissue samples, biopsies, blood, saliva, feces, semen, tears, and urine.
  • a sample can also be any other source of material obtained from a subject which contains cells, tissues, or fluid of interest.
  • a sample can also be obtained from cell or tissue culture.
  • the term “secondary antibody” refers to an antibody that binds to the constant region of another antibody (the primary antibody).
  • signal sequence is meant a polynucleotide sequence which encodes a peptide that directs the path a polypeptide takes within a cell, i.e., it directs the cellular processing of a polypeptide in a cell, including, but not limited to, eventual secretion of a polypeptide from a cell.
  • a signal sequence is a sequence of amino acids which are typically, but not exclusively, found at the amino terminus of a polypeptide which targets the synthesis of the polypeptide to the endoplasmic reticulum. In some instances, the signal peptide is proteolytically removed from the polypeptide and is thus absent from the mature protein.
  • solid support relates to a solvent insoluble substrate that is capable of forming linkages (preferably covalent bonds) with various compounds.
  • the support can be either biological in nature, such as, without limitation, a cell or bacteriophage particle, or synthetic, such as, without limitation, an acrylamide derivative, agarose, cellulose, nylon, silica, or magnetized particles.
  • specifically binds is meant an antibody or compound which recognizes and binds a molecule of interest (e.g., an antibody directed against a polypeptide of the invention), but does not substantially recognize or bind other molecules in a sample.
  • “Sperm-specific,” as used herein, refers to an antigen which is present at higher levels on sperm than other cells or is exclusively present in sperm.
  • Standard refers to something used for comparison.
  • a standard can be a known standard agent or compound which is administered or added to a control sample and used for comparing results when measuring said compound in a test sample.
  • Standard can also refer to an "internal standard,” such as an agent or compound which is added at known amounts to a sample and is useful in determining sueh things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured.
  • a “subject” of analysis, diagnosis, or treatment is an animal. Such animals include mammals, preferably a human.
  • the term “substantially pure” describes a compound, e.g., a protein or polypeptide which has been separated from components which naturally accompany it. Typically, a compound is substantially pure when at least 10%, more preferably at least 20%, more preferably at least 50%, more preferably at least 60%, more preferably at least 75%, more preferably at least 90%, and most preferably at least 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction) in a sample is the compound of interest.
  • Purity can be measured by any appropriate method, e.g., in the case of polypeptides by column chromatography, gel electrophoresis, or HPLC analysis.
  • a compound, e.g., a protein is also substantially purified when it is essentially free of naturally associated components or when it is separated from the native contaminants which accompany it in its natural state.
  • substantially pure nucleic acid refers to a nucleic acid sequence, segment, or fragment which has been purified from the sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs.
  • the term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins which naturally accompany it in the cell.
  • a “therapeutic” treatment is a treatment administered to a subject who exhibits signs of pathology for the purpose of diminishing or eliminating those signs.
  • a “therapeutically effective amount” of a compound is that amount of compound which is sufficient to provide a beneficial effect to the subject to which the compound is administered.
  • transgene means an exogenous nucleic acid sequence comprising a nucleic acid which encodes a promoter/regulatory sequence operably - linked to nucleic acid which encodes an amino acid sequence, which exogenous nucleic acid is encoded by a transgenic mammal.
  • transgenic mammal means a mammal, the germ cells of which comprise an exogenous nucleic acid.
  • a “transgenic cell” is any cell that comprises a nucleic acid sequence that has been introduced into the cell in a manner that allows expression of a gene encoded by the introduced nucleic acid sequence.
  • the term “treating” includes prophylaxis of the specific disorder or condition, or alleviation of the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms.
  • a “prophylactic” treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the disease.
  • the term “treating” includes alleviating the symptoms associated with a specific disease, disorder or condition and/or preventing or eliminating said symptoms.
  • vaccine as used herein is defined as material used to provoke an immune response after administration of the materials to a mammal and thus conferring immunity.
  • a "vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell.
  • vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphophilic compounds, plasmids, and viruses.
  • the term “vector” includes an autonomously replicating plasmid or a virus.
  • the term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like.
  • examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, plasmids, cosmids, lambda phage vectors, and the like.
  • “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
  • An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
  • Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses that incorporate the recombinant polynucleotide.
  • One embodiment of the present invention is directed to the mouse and human Band 10 (sPRVl-2) and/or TESlOl proteins that are testis abundant and expressed predominantly if not exclusively in the male germ cells of humans and mice. More particularly the present invention is directed to mouse and human Band 10 and/or
  • TESlOl and the use of that protein to prepare and isolate compounds that can be used as diagnostic and contraceptive agents.
  • one aspect of the present invention is directed to the isolation of human Band 10 and/or TESlOl and its use in isolating agents that inhibit capacitation-associated protein phosphorylation. Such inhibitors can then be used as contraceptive agents to inhibit fertilization.
  • the Band 10 and/or TESlOl proteins (selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4) will be used to screen for specific inhibitors of Band 10 and/or TESlOl activity and these inhibitors will be used either alone or in conjunction with other contraceptive agents to prevent unintended pregnancies.
  • a purified polypeptide, or a homolog, fragment, derivative, or modification thereof comprising the amino acid sequence of mouse or human Band 10 (SEQ ID NO:1 or 2, respectively) or TESlOl (SEQ ID NO: 3 or 4, respectively), or an amino acid sequence that differs from those sequences by one or more conservative amino acid substitutions.
  • the purified polypeptide comprises an amino acid sequence that differs from those of SEQ ID NOs: 1, 2, 3, and 4 by less than 5 conservative amino acid substitutions, and in a further embodiment, by 2 or less conservative amino acid substitutions.
  • the purified polypeptide comprises an amino acid of a polypeptide comprising a sequence selected from the group consisting of SEQ ID NOs: I 5 2, 3, and 4.
  • a homolog of a polypeptide of the invention has at least 70% sequence identity with an amino sequence selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4.
  • ahomolog of a polypeptide of the invention has at least 80% sequence identity with an amino sequence selected from the group consisting of SEQ ID NOs: 1 , 2, 3, and 4.
  • a homolog of a polypeptide of the invention has at least 90% sequence identity with an amino sequence selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4.
  • a homolog of a polypeptide of the invention has at least 95% sequence identity with an amino Sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, and 4.
  • Substantially pure protein obtained as described herein may be purified by following known procedures for protein purification, wherein an immunological, enzymatic or other assay is used to monitor purification at each stage in the procedure.
  • Protein purification methods are well known in the art, and are described, for example in Deutscher et al. (ed., 1990, Guide to Protein Purification, Harcourt Brace Jovanovich, San Diego).
  • the peptides of the present invention may be readily prepared by standard, well- established techniques, such as solid-phase peptide synthesis (SPPS) as described by Stewart et al. in Solid Phase Peptide Synthesis, 2nd Edition, 1984, Pierce Chemical Company, Rockford, Illinois; and as described by Bodanszky and Bodanszky in The Practice of Peptide Synthesis, 1984, Springer- Verlag, New York.
  • SPPS solid-phase peptide synthesis
  • a suitably protected amino acid residue is attached through its carboxyl group to a derivatized, insoluble polymeric support, such as cross-linked polystyrene or polyamide resin.
  • “Suitably protected” refers to the presence of protecting groups on both the ⁇ - amino group of the amino acid, and on any side chain functional groups.
  • Side chain protecting groups are generally stable to the solvents, reagents and reaction conditions used throughout the synthesis, and are removable under conditions which will not affect the final peptide product.
  • Stepwise synthesis of the oligopeptide is carried out by the removal of the N-protecting group from the initial amino acid, and couple thereto of the carboxyl end of the next amino acid in the sequence of the desired peptide. This amino acid is also suitably protected.
  • the carboxyl of the incoming amino acid can be activated to react with the N-terminus of the support-bound amino acid by formation into a reactive group such as formation into a carbodiimide, a symmetric acid anhydride or an "active ester" group such as hydroxybenzotriazole or pentafluorophenly esters.
  • solid phase peptide synthesis methods include the BOC method which utilized tert-butyloxcarbonyl as the ⁇ -amino protecting group, and the FMOC method which utilizes 9-fluorenylmethyloxcarbonyl to protect the ⁇ -amino of the amino acid residues, both methods of which are well-known by those of skill in the art.
  • Incorporation of N- and/or C- blocking groups can also be achieved using protocols conventional to solid phase peptide synthesis methods.
  • C-terminal blocking groups for example, synthesis of the desired peptide is typically performed using, as solid phase, a supporting resin that has been chemically modified so that cleavage from the resin results in a peptide having the desired C-terminal blocking group.
  • synthesis is performed using a p-memylbenzhydrylamine (MBHA) resin so that, when peptide synthesis is completed, treatment with hydrofluoric acid releases the desired C-terminally amidated peptide.
  • MBHA p-memylbenzhydrylamine
  • incorporation of an N-methylamine blocking group at the C-terminus is achieved using N-methylaminoethyl-derivatized DVB 5 resin, which upon HF treatment releases a peptide bearing an N-methylamidated C-terminus.
  • Blockage of the C-terminus by esterification can also be achieved using conventional procedures.
  • N-terminal blocking groups can be achieved while the synthesized peptide is still attached to the resin, for instance by treatment with a suitable anhydride and nitrile.
  • a suitable anhydride and nitrile for instance, the resin-coupled peptide can be treated with 20% acetic anhydride in acetonitrile. The N-blocked peptide product can then be cleaved from the resin, deprotected and subsequently isolated.
  • amino acid composition analysis may be conducted using high resolution mass spectrometry to determine the molecular weight of the peptide.
  • amino acid content of the peptide can be confirmed by hydrolyzing the peptide in aqueous acid, and separating, identifying and quantifying the components of the mixture using HPLC, or an amino acid analyzer. Protein sequenators, which sequentially degrade the peptide and identify the amino acids in order, may also be used to determine definitely the sequence of the peptide. Prior to its use, the peptide is purified to remove contaminants.
  • the peptide will be purified so as to meet the standards set out by the appropriate regulatory agencies.
  • Any one of a number of a conventional purification procedures may be used to attain the required level of purity including, for example, reversed-phase high-pressure liquid chromatography (HPLC) using an alkylated silica column such as C4 -,C8- or C 18- silica.
  • HPLC reversed-phase high-pressure liquid chromatography
  • a gradient mobile phase of increasing organic content is generally used to achieve purification, for example, acetonitrile in an aqueous buffer, usually containing a small amount of trifmoroacetic acid.
  • Ion-exchange chromatography can be also used to separate peptides based on their charge.
  • polypeptides of the present invention may include additional amino acid sequences to assist in the stabilization and/or purification of recombinantly produced polypeptides. These additional sequences may include intra- or inter-cellular targeting peptides or various peptide tags known to those skilled in the art.
  • the purified polypeptide comprises an amino acid sequence selected from SEQ ID NOs: 1, 2, 3, and 4 and a peptide tag. Suitable expression vectors for expressing such fusion proteins and suitable peptide tags are known to those skilled in the art and commercially available.
  • the tag comprises a His tag.
  • the present invention is directed to a purified bioactive polypeptide that comprises a portion of a polypeptide of SEQ ID NOs: 1, 2, 3, and 4, including antigenic fragments of SEQ ID NOs: 1, 2, 3, and 4.
  • the present invention also provides modified peptides.
  • the peptides may incorporate amino acid residues which are modified without affecting activity.
  • the termini may be derivatized to include blocking groups, i.e. chemical substituents suitable to protect and/or stabilize the N- and C-termini from "undesirable degradation", a term meant to encompass any type of enzymatic, chemical or biochemical breakdown of the compound at its termini which is likely to affect the function of the compound, i.e. sequential degradation of the compound at a terminal end thereof.
  • Blocking groups include protecting groups conventionally used in the art of peptide chemistry which will not adversely affect the in vivo activities of the peptide.
  • suitable N-terminal blocking groups can be introduced by alkylation or acylation of the N-terminus.
  • suitable N-terminal blocking groups include C1-C5 branched or unbranched alkyl groups, acyl groups such as formyl and acetyl groups, as well as substituted forms thereof, such as the acetamidomethyl (Acm) group.
  • Desamino analogs of amino acids are also useful N-terminal blocking groups, and can either be coupled to the N-terminus of the peptide or used in place of the N-terminal reside.
  • Suitable C-terminal blocking groups include esters, ketones or amides.
  • Ester or ketone-forming alkyl groups particularly lower alkyl groups such as methyl, ethyl and propyl, and amide-forming amino groups such as primary amines (-NH2), and mono- and di-alkylamino groups such as methylamino, ethylamino, dimethylamino, diethylamino, methylethylamino and the like are examples of C-terminal blocking groups.
  • Descaxboxylated amino acid analogues such as agmatine are also useful C- terminal blocking groups and can be either coupled to the peptide's C-terminal residue or used in place of it. Further, it will be appreciated that the free amino and carboxyl groups at the termini can be removed altogether from the peptide to yield desamino and descarboxylated forms thereof without affect on peptide activity.
  • polypeptide modifications can also be incorporated without adversely affecting the activity and these include, but are not limited to, substitution of one or more of the amino acids in the natural L-isomeric form with amino acids in the D- isomeric form.
  • the peptide may include one or more D-amino acid resides, or may comprise amino acids which are all in the D-form.
  • Retro-inverso forms of peptides in accordance with the present invention are also contemplated, for example, inverted peptides in which all amino acids are substituted with D-amino acid forms.
  • Acid addition salts of the present invention are also contemplated as functional equivalents.
  • an inorganic acid such as hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, and the like
  • an organic acid such as an acetic, propionic, glycolic, pyruvic, oxalic, malic, malonic, succinic, maleic, fumaric, tata
  • the present invention also provides for analogs of proteins or peptides encoded by L/STs.
  • Analogs can differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both. For example, conservative amino acid changes may be made, which although they alter the primary sequence of the protein or peptide, do not normally alter its function.
  • Conservative amino acid substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine.
  • Modifications include in vivo, or in vitro chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.
  • polypeptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent.
  • Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids.
  • the peptides of the invention are not limited to products of any of the specific exemplary processes listed herein.
  • the present invention also encompasses nucleic acid sequences that encode the polypeptides of SEQ ID NOs:l, 2, 3, and 4.
  • the nucleic acid sequences comprise sequences selected from the group consisting of SEQ ID NOs: 5 and 6.
  • the present invention is also directed to recombinant human Band 10 and/or TESlOl gene constructs.
  • the recombinant gene construct comprises a non-native promoter operably linked to a nucleic acid sequence encoding the polypeptide of SEQ ID NOs: 1-4.
  • the non-native promoter is preferably a strong constitutive promoter that allows for expression in a predetermined host cell.
  • transgenic cell lines that synthesize the Band 10 and/or TESlOl protein.
  • Host cells can be selected from a wide variety of eukaryotic and prokaryotic organisms, and two preferred host cells are E. coli and yeast cells.
  • the introduced nucleic acid is sufficiently stable in the transgenic cell (i.e. incorporated into the cell's genome, or present in a high copy plasmid) to be passed on to progeny cells.
  • the cells can be propagated in vitro using standard cell culture procedure, or in an alternative embodiment, the host cells are eukaryotic cells and are propagated as part of an animal, including for example, a transgenic animal.
  • the transgenic cell is a human cell and comprises a nucleic acid sequence encoding the human Band 10 and/or TESlOl protein.
  • the target nucleic acid may be native or synthesized nucleic acid.
  • the nucleic acid may be from a viral, bacterial, animal or plant source.
  • the nucleic acid may be DNA or RNA and may exist in a double-stranded, single-stranded or partially double-stranded form.
  • the nucleic acid may be found as part of a virus or other macromolecule. See, e.g., Fasbender et al., 1996, J. Biol. Chem. 272:6479-89 (polylysine condensation of DNA in the form of adenovirus).
  • Nucleic acids useful in the present invention include, by way of example and not limitation, oligonucleotides and polynucleotides such as antisense DNAs and/or RNAs; ribozymes; DNA for gene therapy; viral fragments including viral DNA and/or RNA; DNA and/or RNA chimeras; mRNA; plasmids; cosmids; genomic DNA; cDNA; gene fragments; various structural forms of DNA including single-stranded DNA, double- stranded DNA, supercoiled DNA and/or triple-helical DNA; Z-DNA; and the like.
  • the nucleic acids may be prepared by any conventional means typically used to prepare nucleic acids in. large quantity.
  • DNAs and RNAs may be chemically synthesized using commercially available reagents and synthesizers by methods that are well-known in the art (see, e.g., Gait, 1985, OLIGONUCLEOTIDE SYNTHESIS: A PRACTICAL APPROACH (TRL Press, Oxford, England)).
  • RNAs may be produce in high yield via in vitro transcription using plasmids such as SP65 (Promega Corporation, Madison, WI).
  • nucleic acids having modified internucleoside linkages may be preferred.
  • Nucleic acids containing modified internucleoside linkages may also be synthesized using reagents and methods that are well known in the art.
  • the nucleic acids may be purified by any suitable means, as are well known in the art.
  • the nucleic: acids can be purified by reverse phase or ion exchange HPLC, size exclusion chromatography or gel electrophoresis.
  • reverse phase or ion exchange HPLC size exclusion chromatography
  • gel electrophoresis the method of purification will depend in part on the size of the DNA to be purified.
  • nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, myrnine, cytosine and uracil).
  • Modified gene sequences i.e., genes having sequences that differ from the gene sequences encoding the naturally-occurring proteins, are also encompassed by the invention, so long as the modified gene still encodes a protein that functions to stimulate healing in any direct or indirect manner.
  • modified gene sequences include modifications caused by point mutations, modifications due to the degeneracy of the genetic code or naturally occurring allelic variants, and further modifications that have been introduced by genetic engineering, i.e., by the hand of man.
  • nucleotide sequences that are designed to alter the functional properties of the encoded proteins or polypeptides are well known in the art. Such modifications include the deletion, insertion, or substitution of bases, and thus, changes in the amino acid sequence. Changes may be made to increase the activity of a protein, to increase its biological stability or half-life, to change its glycosylation pattern, and the like. All such modifications to the nucleotide sequences encoding such proteins are encompassed by this invention. In one embodiment, antisense oligonucleotides are provided as are other oligonucleotides.
  • Antisense oligonucleotides complementary to nucleic acid sequences of the invention are provided as inhibitors of the nucleic acid sequences of the invention. hi some cases the oligonucleotides are modified. Oligonucleotides which contain at least one phosphorothioate modification are known to confer upon the oligonucleotide enhanced resistance to nucleases.
  • modified oligonucleotides include those which contain phosphorothioate, phosphotriester, methyl phosphonate, short chain alkyl or cycloalkyl intersugar linkages, or short chain heteroatomic or heterocyclic intersugar ("backbone") linkages, hi addition, oligonucleotides having morpholino backbone structures (U.S. Patent No: 5,034,506) or polyamide backbone structures (Nielsen et al., 1991, Science 254: 1497) may also be used.
  • oligonucleotide modifications described herein are not exhaustive and it is understood that the invention includes additional modifications of the antisense oligonucleotides of the invention which modifications serve to enhance the therapeutic properties of the antisense oligonucleotide without appreciable alteration of the basic sequence of the antisense oligonucleotide.
  • a first oligonucleotide anneals with a second oligonucleotide "with high stringency" if the two oligonucleotides anneal under conditions whereby only oligonucleotides which are at least about 75%, and preferably at least about 90% or at least about 95%, complementary anneal with one another.
  • the stringency of conditions used to anneal two oligonucleotides is a function of, among other factors, temperature, ionic strength of the annealing medium, the incubation period, the length of the oligonucleotides, the G-C content of the oligonucleotides, and the expected degree of non-homology between the two oligonucleotides, if known.
  • Methods of adjusting the stringency of annealing conditions are known (see, e.g. Sambrook et al., 1989,
  • the present invention also encompasses a method for producing human or mouse Band 10 and/or TESlOl.
  • the method comprises the steps of introducing a nucleic acid sequence comprising a sequence that encodes human or mouse Band 10 and/or TESlOl into a host cell, and culturing the host cell under conditions that allow for expression of the introduced human Band 10 and/or TESlOl gene.
  • the promoter is a conditional or inducible promoter, alternatively the promoter may be a tissue specific or temporal restricted promoter (i.e. operably linked genes are only expressed in a specific tissue or at a specific time).
  • the synthesized Band 10 and/or TESlOl proteins can be purified using standard techniques and used in high throughput screens to identify compounds that bind to Band 10 and/or TESlOl under physiological relevant conditions and/or that inhibit capacitation associated phosphorylation of tyrosine residues of sperm proteins.
  • the recombinantly produced Band 10 and/or TES 101 polypeptides, or fragments thereof are used to generate antibodies against the Band 10 and/or TESlOl polypeptides.
  • the recombinantly produced Band 10 and/or TESlOl proteins can also be used to obtain crystal structures. Such structures would allow for crystallography analysis that would lead to the design of specific drugs to inhibit Band 10 and/or TESlOl function.
  • a composition comprising a purified peptide of SEQ ID NOs: 1-4, or an antigenic fragment thereof.
  • the peptide consists of the sequence of SEQ ID NOs: 1-4.
  • compositions can be combined with a pharmaceutically acceptable carrier or adjuvants and administered to a mammalian species to induce an immune response.
  • Another embodiment of the present invention is directed to antibodies specific for human or mouse Band 10.
  • another embodiment of the invention is directed to antibodies specific for human or mouse TESlOl .
  • the antibody is a monoclonal antibody.
  • the antibodies or antibody fragments of the present invention can be combined with a carrier or diluent to form a composition.
  • the carrier is a pharmaceutically acceptable carrier.
  • Such carriers and diluents include sterile liquids such as water and oils, with or without the addition of a surfactant and other pharmaceutically and physiologically acceptable carrier, including adjuvants, excipients or stabilizers.
  • Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil. hi general, water, saline, aqueous dextrose, and related sugar solution, and glycols such as, propylene glycol or polyethylene glycol, are preferred liquid carriers, particularly for injectable solutions.
  • Antibodies to Band 10 and/or TESlOl polypeptides may be generated using methods that are well known in the art.
  • an antibody is provided that specifically binds to a polypeptide selected from SEQ ID NO: 1
  • antibodies may be used with or without modification, and may be labeled by joining them, either covalently or non-covalently, with a reporter molecule.
  • the antibodies can be formulated with standard carriers and optionally labeled to prepare therapeutic or diagnostic compositions.
  • the term "antibody,” as used herein, refers to an immunoglobulin molecule which is able to specifically bind to a specific epitope on an antigen.
  • Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules.
  • the antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies (Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
  • synthetic antibody an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein.
  • the term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
  • Monoclonal antibodies directed against full length or peptide fragments of a protein or peptide may be prepared using any well known monoclonal antibody preparation procedures, such as those described, for example, in Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, NY) and in Tuszynski et al. (1988, Blood, 72:109-115). Quantities of the desired peptide may also be synthesized using chemical synthesis technology. Alternatively, DNA encoding the desired peptide may be cloned and expressed from an appropriate promoter sequence in cells suitable for the generation of large quantities of peptide. Monoclonal antibodies directed against the peptide are generated from mice immunized with the peptide using standard procedures as referenced herein.
  • Nucleic acid encoding the monoclonal antibody obtained using the procedures described herein may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al. (1992, Critical Rev. in Immunol. 12(3,4):125-168) and the references cited therein. Further, the antibody of the invention may be "humanized” using the technology described in Wright et al., (supra) and in the references cited therein, and in Gu et al. (1997, Thrombosis and Hematocyst 77(4):755- 759).
  • a cDNA library is first obtained from mRNA which is isolated from cells, e.g., the hybridoma, which express the desired protein to be expressed on the phage surface, e.g., the desired antibody.
  • cDNA copies of the mRNA are produced using reverse transcriptase.
  • cDNA which specifies immunoglobulin fragments are obtained by PCR and the resulting DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising
  • DNA specifying immunoglobulin genes The procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY). Bacteriophage which encode the desired antibody, may be engineered such that the protein is displayed on the surface thereof in such a manner that it is available for binding to its corresponding binding protein, e.g., the antigen against which the antibody is directed. Thus, when bacteriophage which express a specific antibody are incubated in the presence of a cell which expresses the corresponding antigen, the bacteriophage will bind to the cell. Bacteriophage which do not express the antibody will not bind to the cell. Such panning techniques are well known in the art and are described for example, in Wright et al, (supra).
  • a cDNA library is generated from mRNA obtained from a population of antibody-producing cells.
  • the mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same.
  • Amplified cDNA is cloned into Ml 3 expression vectors creating a library of phage which express human Fab fragments on their surface. Phage which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human
  • Fab molecules comprise the entire Ig light chain, that is, they comprise both the variable and constant region of the light chain, but include only the variable region and first constant region domain (CHl) of the heavy chain.
  • Single chain antibody molecules comprise a single chain of protein comprising the Ig Fv fragment.
  • An Ig Fv fragment includes only the variable regions of the heavy and light chains of the antibody, having no constant region contained therein.
  • Phage libraries comprising scFv DNA may be generated following the procedures described in Marks et al., 1991, J. MoI. Biol. 222:581-597. Panning of phage so generated for the isolation of a desired antibody is conducted in a manner similar to that described for phage libraries comprising Fab DNA.
  • the invention should also be construed to include synthetic phage display libraries in which the heavy and light chain variable regions may be synthesized such that they include nearly all possible specificities (Barbas, 1995, Nature Medicine 1 :837- 839; de Kruif et al. 1995, J. MoI. Biol.248:97-105).
  • a ligand or a receptor e.g., an antibody "specifically binds to” or "is specifically immunoreactive with” a compound when the ligand or receptor functions in a binding reaction which is determinative of the presence of the compound in a sample of heterogeneous compounds.
  • the ligand or receptor binds preferentially to a particular compound and does not bind in a significant amount to other compounds present in the sample.
  • a polynucleotide specifically binds under hybridization conditions to a compound polynucleotide comprising a complementary sequence; an antibody specifically binds under immunoassay conditions to an antigen bearing an epitope against which the antibody was raised.
  • a variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein.
  • solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
  • Band 10 and/or TESlOl have been demonstrated herein to be highly testis abundant, this makes Band 10 and/or TESlOl an optimal target for the development of drugs that modulate their activity. Such compounds are useful for modulating fertility and contraception and to study Band 10 and/or TESl 01 's role in spermiogenesis.
  • the Band 10 and/or TESlOl protein is used as a target for the development of novel drugs.
  • Progress in the field of small molecule library generation, using combinatorial chemistry methods coupled to high- throughput screening, has accelerated the search for ideal cell-permeable inhibitors.
  • structural-based design using crystallographic methods has improved the ability to characterize in detail ligand-protein interaction sites that can be exploited for ligand design.
  • the present invention provides methods of screening for drugs, compounds, agents, small molecules, or proteins that interact with polypeptides comprising a sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, and 4 or bioactive homologs, fragments, derivatives, and modifications thereof.
  • the invention encompasses both in vivo and in vitro assays to screen small molecules, compounds, recombinant proteins, peptides, nucleic acids, antibodies, etc., which bind to or modulate the activity of Band 10 and/or TESlOl and are thus useful as therapeutic or diagnostic markers for fertility.
  • Band 10 and/or TESlOl polypeptides selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4 are used to isolate ligands that bind to Band 10 and/or TESlOl under physiological conditions.
  • the screening method comprises the steps of contacting a Band 10 and/or TESlOl polypeptide with a mixture of compounds under physiological conditions, removing unbound and non-specifically bound material, and isolating the compounds that remain bound to the polypeptide.
  • the BandlO and/or TESlOl polypeptide will be bound to a solid support, using standard techniques, to allow for rapid screening of compounds.
  • the solid support can be selected from any surface that has been used to immobilize biological compounds and includes but is not limited to polystyrene, agarose, silica or nitrocellulose.
  • the solid surface comprises functionalized silica or agarose beads. Screening for such compounds can be accomplished using libraries of pharmaceutical agents and standard techniques known to the skilled practitioner.
  • Band 10/sPRV 1-2 is a serine protease which is GPI-anchored.
  • Inhibitors of Band 10 and/or TESlOl associated activity have potential use as agents that prevent maturation/capacitation of sperm.
  • inhibitors of Band 10 and/or TESlOl are isolated as potential contraceptive agents. Such inhibitors can be formulated as pharmaceutical compositions and administered to a subject to block spermatogenesis and/or capacitation and provide a means for contraception or to reduce fertility.
  • a polypeptide of the invention may be administered to a subject to induce an immune response against said polypeptide.
  • a polypeptide of the • invention is useful as a contraceptive vaccine.
  • the polypeptide is administered in a pharmaceutical composition comprising a pharmaceutically- ' acceptable carrier, and optionally an adjuvant.
  • pharmaceutically-acceptable salt refers to salts which retain the biological effectiveness and properties of the compounds of the present invention and which are not biologically or otherwise undesirable.
  • the compounds of the present invention are capable of forming acid and/or base salts by virtue of the presence of amino and/or carboxyl groups or groups similar thereto.
  • Salts derived from inorganic bases include by way of example only, sodium, potassium, lithium, ammonium, calcium and magnesium salts.
  • Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, such as alkyl amines, dialkyl amines, trialkyl amines, substituted atkyl amines, di(substituted alkyl) amines, tri(substituted alkyl) amines, alkenyl amines, dialkenyl amines, trialkenyl amines, substituted alkenyl amines, di(substituted alkenyl) amines, tri(substituted alkenyl) amines, cycloalkyl amines, di(cycloalkyl) amines, tri(cycloalkyl) amines, substituted cycloalkyl amines, substituted cycloalkyl amines, substituted
  • amines where the two or three substituents, together with the amino nitrogen, form a heterocyclic or heteroaryl group.
  • suitable amines include, by way of example only, isopropylamine, trimethyl amine, diethyl amine, tri(iso-propyl) amine, tri(n-propyl) amine, ethanolamine, 2-dimethylaminoethanol, tromethamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, N- alkylglucamines, theobromine, purines, piperazine, piperidine, morpholine, N- ethylpiperidine, and the like.
  • carboxylic acid derivatives would be useful in the practice of this invention, for example, carboxylic acid amides, including carboxamides, lower alkyl carboxamides, dialkyl carboxamides, and the like.
  • Pharmaceutically acceptable acid addition salts may be prepared from inorganic and organic acids. Salts derived from inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like.
  • Salts derived from organic acids include acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluene-sulfonic acid, salicylic acid, and the like.
  • the compounds of the present invention can be formulated as pharmaceutical compositions by combining the compounds with one or more pharmaceutically acceptable carriers. These formulations can be administered by standard routes. In general, the combinations may be administered by the topical, transdermal, oral, rectal or parenteral (e.g., intravenous, subcutaneous or intramuscular) route.
  • parenteral e.g., intravenous, subcutaneous or intramuscular
  • the compounds When adrninistered orally, the compounds are administered as a liquid solution, powder, tablet, capsule or lozenge.
  • the compounds can be used in combination with one or more conventional pharmaceutical additives or excipients used in the preparation of tablets, capsules, lozenges and other orally administrable forms.
  • the derivatives of the present invention can be admixed with saline solutions and/or conventional IV solutions.
  • the combinations may be incorporated into biodegradable polymers allowing for sustained release of the compound, and in one embodiment the delivery vehicle is implanted in the vicinity of where drug delivery is desired, for example, at the site of a tumor.
  • Biodegradable polymers suitable for use with the present invention are known to the skilled practitioner and are described in detail, for example, inBrem et al., J. Neurosurg. 74:441-446 (1991).
  • the dosage of the active compound will depend on the condition being treated, the particular compound, and other clinical factors such as weight and condition of the human or animal and the route of administration of the compound. It is to be understood that the present invention has application for both human and veterinary use. In one embodiment relating to oral administration to humans, a dosage of between approximately 0.1 to 300 mg/kg/day, or between approximately 0.5 and 50 mg/kg/day, or between approximately 1 to 10 mg/kg/day, is generally sufficient.
  • the present invention is also directed to pharmaceutical compositions comprising the compounds of the present invention. More particularly, such compounds can be formulated as pharmaceutical compositions using standard pharmaceutically acceptable carriers, fillers, solubilizing agents and stabilizers known to those skilled in the art. For example, a pharmaceutical composition comprising a compound of the invention, or analog, derivative, or modification thereof, as described herein, is used to administer the appropriate compound to a subject.
  • compositions comprising the a compound of the invention are administered to a subject in need thereof by any number of routes and means including, but not limited to, topical, oral, buccal, intravenous, intramuscular, intra arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, vaginal, ophthalmic, pulmonary, or rectal means.
  • routes and means including, but not limited to, topical, oral, buccal, intravenous, intramuscular, intra arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, vaginal, ophthalmic, pulmonary, or rectal means.
  • the oral route is typically employed for most conditions requiring the compounds of the invention. Preference is given to intravenous injection or infusion for the acute treatments. For maintenance regimens, the oral or parenteral, e.g. intramuscular
  • a composition that comprises a compound of the invention, or a fragment, homolog, analog, derivative, or modification thereof, and albumin, more particularly, the composition comprises a compound of the present invention, a pharmaceutically acceptable carrier and 0.1-1.0% albumin.
  • Albumin functions as a buffer and improves the solubility of the compounds. . In one aspect, albumin is not added.
  • the pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of between 1 ng/kg/day and 100 mg/kg/day. In another embodiment, the pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of between 1 ng/kg/day and 100 g/kg/day.
  • Pharmaceutically acceptable carriers which are useful include, but are not limited to, glycerol, water, saline, ethanol, and other pharmaceutically acceptable salt solutions such as phosphates and salts of organic acids. Examples of these and. other pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (1991, Mack Publication Co., New Jersey).
  • compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution.
  • This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein.
  • Such sterile injectable formulations may be prepared using a non toxic parenterally acceptable diluent or solvent, such as water or 1,3 butane diol, for example.
  • Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides.
  • Compounds which are identified using any of the methods described herein may be formulated and administered to a subject for treatment of any of the diseases and disorders described herein.
  • the use of compounds of the invention should not be construed to include only the diseases and disorder described herein.
  • the subject is a human.
  • compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology.
  • preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi- dose unit.
  • compositions are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, and mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses.
  • a "unit dose" is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient.
  • the amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one- third of such a dosage.
  • compositions of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered.
  • the composition may comprise between 0.1% and 100% (w/w) active ingredient.
  • a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents.
  • additional agents include anti-emetics and scavengers such as cyanide and cyanate scavengers.
  • Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.
  • the dosage forms to be used can be provided as slow or controlled-release of one or more active ingredients therein using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes, or microspheres or a combination thereof to provide the desired release profile in varying proportions.
  • Suitable controlled-release formulations known to those of ordinary skill in the art, including those described herein, can be readily selected for use with the pharmaceutical compositions of the invention.
  • single unit dosage forms suitable for oral administration such as tablets, capsules, gelcaps, and caplets that are adapted for controlled-release are encompassed by the present invention.
  • controlled-release formulations are designed to initially release an amount of drug that promptly produces the desired therapeutic effect, and gradually and continually release of other amounts of drug to maintain this level of therapeutic effect over an extended period of time.
  • the drug In order to maintain this constant level of drug in the body, the drug must be released from the dosage form at a rate that will replace the amount of drug being metabolized and excreted from the body.
  • Controlled-release of an active ingredient can be stimulated by various inducers, for example pH, temperature, enzymes, water, or other physiological conditions or compounds.
  • Powdered and granular formulations of a pharmaceutical preparation of the invention may be prepared using known methods. Such formulations may be administered directly to a subject, used, for example, to form tablets, to fill capsules, or to prepare an aqueous or oily suspension or solution by addition of an aqueous or oily vehicle thereto. Each of these formulations may further comprise one or more of dispersing or wetting agent, a suspending agent, and a preservative. Additional excipients, such as fillers and sweetening, flavoring, or coloring agents, may also be included in these formulations.
  • an "oily" liquid is one which comprises a carbon-containing liquid molecule and which exhibits a less polar character than water.
  • a formulation of a pharmaceutical composition of the invention suitable for oral administration may be prepared, packaged, or sold in the form of a discrete solid dose unit including, but not limited to, a tablet, a hard or soft capsule, a cachet, a troche, or a lozenge, each containing a predetermined amount of the active ingredient.
  • Other formulations suitable for oral administration include, but are not limited to, a powdered or granular formulation, an aqueous or oily suspension, an aqueous or oily solution, a paste, a gel, a toothpaste, a mouthwash, a coating, an oral rinse, or an emulsion.
  • oral rinse and mouthwash are used interchangeably herein.
  • a tablet comprising the active ingredient may, for example, be made by compressing or molding the active ingredient, optionally with one or more additional ingredients.
  • Compressed tablets may be prepared by compressing, in a suitable device, the active ingredient in a free flowing form such as a powder or granular preparation, optionally mixed with one or more of a binder, a lubricant, an excipient, a surface- active agent, and a dispersing agent.
  • Molded tablets may be made by molding, in a suitable device, a mixture of the active ingredient, a pharmaceutically acceptable carrier, and at least sufficient liquid to moisten the mixture.
  • compositions used in the manufacture of tablets include, but are not limited to, inert diluents, granulating and disintegrating agents, binding agents, and lubricating agents.
  • Known dispersing agents include, but are not limited to, potato starch and sodium starch glycollate.
  • Known surface-active agents include, but are not limited to, sodium lauryl sulphate.
  • Known diluents include, but are not limited to, calcium carbonate, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate.
  • Known granulating and disintegrating agents include, but are not limited to, corn starch and alginic acid.
  • binding agents include, but are not limited to, gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, and hydroxypropyl methylcellulose.
  • Known lubricating agents include, but are not limited to, magnesium stearate, stearic acid, silica, and talc.
  • Tablets may be non-coated or they may be coated using known methods to achieve delayed disintegration in the gastrointestinal tract of a subject, thereby providing sustained release and absorption of the active ingredient.
  • a material such as glyceryl monostearate or glyceryl distearate may be used to coat tablets.
  • tablets may be coated using methods described in U.S. Patents numbers 4,256,108; 4,160,452; and 4,265,874 to form osmotically- controlled release tablets.
  • Tablets may further comprise a sweetening agent, a flavoring agent, a coloring agent, a preservative, or some combination of these in order to provide for pharmaceutically elegant and palatable preparation.
  • Hard capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such hard capsules comprise the active ingredient, and may farther comprise additional ingredients including, for example, an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin.
  • Soft gelatin capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such soft capsules comprise the active ingredient, which may be mixed with water or an oil medium such as peanut oil, liquid paraffin, or olive oil.
  • Liquid formulations of a pharmaceutical composition of the invention which are suitable for oral administration may be prepared, packaged, and sold either in liquid form or in the form of a dry product intended for reconstitution with water or another suitable vehicle prior to use.
  • Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi dose containers containing a preservative.
  • Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents.
  • the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (e.g., sterile pyrogen free water) prior to parenteral administration of the reconstituted composition.
  • a suitable vehicle e.g., sterile pyrogen free water
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for buccal administration.
  • Such formulations may, for example, be in the form of tablets or lozenges made using conventional methods, and may, for example, 0.1 to 20% (w/w) active ingredient, the balance comprising an orally dissolvable or degradable composition and, optionally, one or more of the additional ingredients described herein.
  • formulations suitable for buccal administration may comprise a powder or an aerosolized or atomized solution or suspension comprising the active ingredient.
  • Such powdered, aerosolized, or aerosolized formulations, when dispersed preferably have an average particle or droplet size in the range from about 0.1 to about 200 nanometers, and may further comprise one or more of the additional ingredients described herein.
  • additional ingredients include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials. See Genaro, ed., 1985, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, which is incorporated herein by reference.
  • the compound can be administered to a subject as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less.
  • the frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type, and age of the subject, etc.
  • the method of the invention includes a kit comprising a polypeptide, compound, or antibody of the invention and an instructional material which describes administering the polypeptide, compound, or antibody or a composition comprising the inhibitor to a cell or an animal.
  • a kit comprising a (preferably sterile) solvent suitable for dissolving or suspending the composition of the invention prior to administering the compound to a cell or an animal.
  • the animal is a human.
  • the pharmaceutical pack or kit may comprise one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. These pharmaceuticals can be packaged in a variety of containers, e.g., vials, tubes, microliter well plates, bottles, and the like. Other reagents can be included in separate containers and provided with the kit; e.g., positive control samples, negative control samples, buffers, cell culture media, etc.
  • AU chemicals were reagent grade or better and unless otherwise specified were purchased from Sigma or Fisher.
  • Reagents and buffers for SDS-PAGE including the molecular weight Precision standards were from Bio-Rad.
  • Protease inhibitors aprotinin, pefabloc, and pepstatin were from Roche/Boehringer-Mannheim Biochemicals; rabbit polyclonal IgG directed against a 20 ammo-terminal peptide from human CAVl was from Santa Cruz. This 20 amino acid domain is 84 % identical to the orthologous mouse CAVl domain.
  • Horseradish peroxidase (HRP) conjugated secondary antibodies from Sigma were visualized with either the NEN Lightning or KPL chemiluminescent reagents according to manufacturer's instructions.
  • TES 101 a monoclonal antibody against the testicular germ cell-specific antigen TEXlOl [39] and polyclonal antibody against Hexokinase I (HKl) were generously provided by Dr. Yoshihiko Araki (Yamagata University, Yamagata, Japan) and Dr. Wilson (Michigan State University) respectively.
  • Xomat-Blue and MS Kodak films were from NEN Life Sciences.
  • Fluorescent DiICl 6 lipid analog probe that targets liquid-ordered plasma membrane domains [37] was from Molecular Probes.
  • the mounting medium, Vectashield and the antigen unmasking solution were purchased from Vector Laboratories.
  • This WH medium prepared in the absence of BSA and NaHCO 3 , does not support capacitation.
  • Sperm released into the media during a 10 minute time period (between 5 and 8 million sperm per epididymis) were counted and collected by centrifugation at 800 x g for 10 minutes at room temperature (RT)( ⁇ 24°C).
  • RT room temperature
  • the centrifuged sperm were resuspended to a final concentration of 2 x 10 7 cells/ml.
  • sperm samples were treated for 30 minutes at 27 0 C in a standard Laemmli pH 6.8 reducing buffer or such HMW complexes were reduced by boiling for 5 minutes in pH 10 buffer as described [28, 29].
  • SDS-PAGE a sperm equivalent of 200,000 sperm was extracted in sample buffer as previously described [19] and loaded on a 4-16% linear gradient gel with a 3% stacking gel, to facilitate the entry of possible HMW caveolin oligomers. Gels were silver-stained [41] or electroblotted to
  • PVDF membrane (Millipore). Membranes were blocked with 4% BSA in Tris-Buffered Saline, pH 7.3, 0.1% Tween 20 (TBST) for one hour at RT. AU primary and secondary antibody incubations were in TBST plus 4% BSA. All membrane washes were at RT for 15 minutes with TBST. After incubation for 1 hour with a 1:1000 dilution of primary antibody, the PVDF membranes were washed 4 times, and then incubated at RT for one hour with HRP-conjugated secondary antibodies at a 1:10000 dilution. As control for anti CAVl, this antibody was pre-absorbed with 1.5 ⁇ g/ml of the antigenic peptide.
  • the membrane was washed as before, rinsed briefly with water and HRP activity visualized with chemiluminescence.
  • Western blots using antibodies directed against TEXlOl were performed on samples electrophoresed under non-reducing conditions (in the absence of ⁇ - mercaptoethanol) .
  • the sperm were collected by centrifugation at 700 x g for 10 minutes and the pellet resuspended in 400 ⁇ l of TEN buffer containing 0.5% TXlOO. The pellet was gently Dounce homogenized, sonicated with 5 brief bursts in a
  • Sonifier Cell Disrupter W-350 set at output 3 and 50% duty cycle. Samples were kept on ice and foaming was avoided. The sperm lysates were rotated at 4°C for 45 minutes to liberate the DRM fractions operationally defined as the lipid raft domains. Lysates were adjusted to 40% sucrose with the addition of 80% sucrose in TEN. To generate a discontinuous sucrose gradient the sperm lysate was placed in the bottom of a 2 ml Beckman centrifuge tube and gently overlaid with 800 ⁇ l 30% sucrose in TEN 3 followed by 400 ⁇ l 5 % sucrose in TEN. The same procedure was applied for all raft fraction isolations.
  • the samples were then centrifuged at 200,000 x g for 18 h in a TLS55 swinging bucket rotor in a Beckman OptimaTM -TLX ultracentrifuge.
  • the visible, opaque light buoyant density DRM fractions which float up the sucrose gradient, were apparent as a visible light scattering band following centrifugation.
  • Nine 200 ⁇ l fractions were carefully collected from the top to the bottom of the gradient and the position of the visible fractions was noted.
  • Fractions were prepared for SDS-PAGE with pH 6.8 SDS-reducing sample buffer and treated at 27°C for 30 minutes to preserve the HMW caveolin complexes as previously described [28, 29].
  • Fractions resolved on a 4-16% linear gradient SDS-PAGE gel with a 3 % stacking gel were silver-stained or prepared for Western blotting as previously described.
  • proteins that were silver stained from this fraction were excised from the gel and submitted for MS/MS. MS/MS analysis of raft proteins.
  • Mouse cauda epididymal sperm were treated under non-capacitating (NON) and capacitating (CAP) conditions as described above.
  • DiIC 16 was first dissolved in 100% ethanol at 2 mg/ml and vortexed vigorously for 5 min to ensure complete mixing of the lipid.
  • the probe was diluted in PBS to a final working concentration of 25 ⁇ g/ml, vortexed vigorously, and added to the sperm for 15 minutes at 37°C.
  • the sperm To label fixed sperm, the sperm first were fixed in solution with freshly prepared 4% parafbmaldehyde in PBS, pH 7.3 for 15 minutes at 37°C, and then spotted directly onto a microscope slide and subsequently labeled with DiICl 6. After incubation for 1 hour in the appropriate medium, live sperm were labeled for 15 minutes at 37° C with the probe in WH medium, briefly washed with PBS using gentle centrifugation and then spotted onto a slide, followed by fixation for 15 minutes at 37 0 C in paraformaldehyde/PBS. Labeled sperm were then washed 3 times with PBS at RT. The slides were mounted with Vectashield® . Fluorescence was detected as described above. The Alexa-fluor 568 labeled lipid analog probe DiICl 6 emits fluorescence when excited with a wavelength of 568 nM. Photos were taken with a digital camera as described [43].
  • High molecular weight caveolin oligomers are present in mouse sperm.
  • HMW caveolin oligomers ranging in size from 200-600 KDa have been proposed as the active scaffolding framework for signal transduction proteins [44] and have been demonstrated to be stabilized by cholesterol and/or long chain fatty acylation [45] .
  • HMW caveolin complexes were preserved as described above and three distinct immunoreactive bands were detected in non-capacitated sperm (Fig. 1 A). These bands migrated as a 24 kDa monomer, a 50 kDa dimer (forms noted previously in sperm) [34] and the novel observation of HMW caveolin complexes migrating at molecular weight greater than 250 kDa.
  • HMW caveolin oligomers are proposed to be linked by thioester bonds that are reduced only under basic conditions (pH 10) [28-30].
  • pH 10 basic conditions
  • the visible light buoyant density fraction from non-capacitated sperm contained multiple silver stained proteins ranging from 25 to 125 kDa.
  • the fraction just below the 5/30% interface, fraction # 4 did not contain a visible light scattering band and showed a significant decrease in total protein as determined by silver stain analysis (Fig. 2 A, lane 4, CAP, left lower panel).
  • fraction # 4 of non-capacitated sperm contained the HMW complexes as well as the 24 kDa caveolin monomer but not the 50 kDa dimer (Fig. 2, lane 4, right upper panel, NON).
  • the CAVl HMW oligomer was not detected in fraction # 4 from capacitated sperm and the 24 kDa caveolin monomer was significantly reduced (Fig 2, lane 4, right left panel, CAP).
  • DRM-associated proteins from sperm by MS/MS
  • proteins present in the light buoyant density DRM fractions of non-capacitated mouse sperm (Fig. 2, lane 4, upper left panel, NON) were cut and processed for MS/MS.
  • the proteins include enzymes implicated in glucose transport and metabolism, bicarbonate metabolism and putative cell receptors.
  • the majority of the identified proteins was membrane-associated and included transmembrane and GPI-linked proteins. A subset of these proteins appears to be testes specific as determined by a bioinformatic analysis of tissue distribution of ESTs.
  • proteins in band 5 and 10 are present in the database only as hypothetical proteins (e.g., Hypothetical polycythemia Rubra Vera-like # 1 and # 2, Table I).
  • NP_033327 6 Similar to CGI-49 (C330023F1 IRIK) NP_848768
  • CAR4 Carbonic Anhydrase IV
  • NP_031633 10 Pantophysin Isoform 1 (SYPl)
  • SYPl Pantophysin Isoform 1
  • Cysteine-Rich Secretory Protein 1 (CRISPl) NP_033768
  • Urinary Protein 1 MUPl
  • NP_112465 13
  • SSS7 Caltrin/seminal Vesicle Secretion 7
  • NP 064660 Proteins associated with the light buoyant density DRM fractions redistribute in sucrose gradients during capacitation.
  • sucrose gradient fractions As noted above, silver staining of sucrose gradient fractions indicated that during mouse sperm capacitation in vitro the protein content decreases in the light buoyant density DRM fraction.
  • two proteins, TEXlOl and HKl, identified by MS/MS were analyzed along the sucrose gradient by Western blot (Fig. 4). Both proteins were confirmed to be present in the light buoyant density DRM fractions isolated from non-capacitated sperm.
  • TEXlOl was exclusively located in the light buoyant density fractions (Fig. 4, lanes 4 & 5, left panel, NON)
  • HKl was found in the light density as well as in heavier fractions (Fig. 4, left upper panel, NON).
  • DiIC 16 is a lipid analog probe that has been shown to partition into relatively ordered regions of membrane in living cells with properties similar to DRMs [37]. Since a significant reduction of the proteins present in DRMs purified by discontinuous sucrose gradient had been noted, DiIC 16 binding to sperm incubated under non-capacitating or capacitating conditions was undertaken to monitor changes in liquid-ordered domains.
  • Non-capacitated sperm exhibited a strong DiIC 16 labeling in the flagellum mid-piece and lighter staining of the head as well as of other tail structures (Fig. 5, NON).
  • Fig. 5, NON When the sperm were incubated under capacitating conditions a significant reduction in DiIC 16 staining was observed hi both live and fixed sperm (Fig. 5, CAP).
  • lipid rafts as transient phase separations conferring ordered microdomains upon an otherwise fluid lipid bilayer. From this biophysical model, it has been proposed that biological membranes contain a minimum of two lipid phases: a typically, but not always, more abundant "liquid- disordered” phase and an usually less abundant “liquid-ordered phase” [48, 49].
  • CAVl has been previously reported in lipid rafts [50]; an important observation of the present study was that CAVl in mouse sperm forms HMW oligomers. In somatic cells, the presence of similar caveolin oligomers has been linked to caveolin's distribution in cholesterol rich domains in the plasma membrane [28, 29]. In sperm, these HMW CAVl- containing complexes are significantly decreased after one hour of in vitro capacitation, an observation consistent with previous reports of cholesterol release during the capacitation process [11, 12]. Accompanying the reduction in CAVl oligomers, the overall content of proteins from the lipid raft light buoyant density DRM fraction from sucrose gradients was reduced in capacitated sperm.
  • lipid rafts in sperm may induce the interaction of several raft resident proteins to initiate signaling pathways associated with the capacitation process. It is believed that not every sperm within a population capacitates in vitro, as determined from chlortetracycline fluorescence and the ZP-induced acrosome reaction [19]. Following these criteria, approximately 50 % of sperm are capacitated after 1.5 h. incubation in a complete media. This number is similar to the one obtained by single cell analysis of the capacitation-associated hyperpolarization [54]. In this respect, whether the whole sperm population or only a fraction undergoes disruption of lipid rafts is still an open question.
  • Proteomic analysis identified more than 25 resident raft proteins from non- capacitated mouse sperm. The majority are membrane-associated, either as transmembrane, integral membrane, GPI-linked, or acyl chain recruited proteins. Because of the methodology used, proteins in the light buoyant DRM could in theory belong to any sperm membrane fraction and not only to the plasma membrane. However, analysis of
  • the first group includes proteins that function in metabolic processes. Several proteins associated with glucose metabolism were found in lipid raft fractions; among them HKl 5 a testis specific lactate dehydrogenase, the facilitated glucose transporter Glut3 and pantophysin. This last protein is believed to form an active energy transport complex for glucose with Glut3 [55].
  • HKl in the raft fraction agrees with previous results demonstrating that HKl in sperm is tightly associated with membrane fractions [56].
  • the presence of metabolic enzymes in sperm lipid rafts suggests that cholesterol removal mediates some of the changes in energy metabolism observed during capacitation and warrants further investigation.
  • Carbonic Anhydrase IV (CAR4), a GPI-anchored carbonic anhydrase, has been linked in other systems to HCO3- transport [57].
  • CAR4 Carbonic Anhydrase IV
  • HEK293 human embryonic kidney
  • NBC Na+/HCO3 cotransporter
  • CRISP cysteine-rich inhibitory secretory protein
  • Ig Immunoglobulin superfamily.
  • PLAU cysteine-rich inhibitory secretory protein
  • Ig Immunoglobulin superfamily.
  • Tpx 1 and a series of snake venoms recently described [60].
  • sPRVl-2 also called BandlO herein
  • PRVl polycythemia rubra vera 1
  • TexlOl a testicular germ cell-specific antigen
  • sPRVl-2 In human testis, the major transcript of sPRVl-2 is 2.0 kb, however, RT-PCR only revealed the 1.0 kb transcript in human lymph node.
  • Human sPRVl-2A and sPRVl-2B genes encode proteins of 246, and 211 amino acids respectively, which differ at the N-terminus following an identical putative signal peptide. It also appears that sPRVl-2 can form multimers ( Figure 10).
  • hsPRVl-2 is localized to sperm, including the entire tail and also to a lesser extent in the head and equatorial segment (see Figure 11).
  • both proteins have two putative N-glycosylation sites, and 13 or 14 cysteines representing the canonical profile of the cysteine rich domain in the uPAR/Ly-6/Snake neurotoxin family (see Figure 12).
  • the best cleavage site is 224
  • This protein is GPI ⁇ anchored (signal, hydrophobic & hydrophilic tail present) .
  • Figure 9 illustrates the results of Northern analysis and RNA dot blot analysis of human sPRVl-2 expression.
  • Figure 9B demonstrates the results of an RNA dot blot analysis of 76 human tissues. HsPRVl -2 expression was detected in testis and lymph node.
  • Figure 9C depicts the results of a northern analysis of human sPRVl-2 expression in human testis and lymph node. Two major transcripts were detected in testis but not in lymph node or ovary. RT-PCR (data not shown) only revealed a small amount of 1.0 kb transcript in human lymph node.
  • In situ hybridization was also performed to localize sPRVl-2 expression in mouse testis, using radiolabeled mouse sPRVl-2 cRNA.
  • sPRVl-2 transcripts were expressed mainly in the post-meiotic spermatids, while labeling on primary spermatocytes was not much greater than background labeling (not shown).
  • Human sPRVl-2A has 14 cysteine residues representing the canonical profile of the cysteine rich domain in the uPAR/Ly-6/Snake neurotoxin family. Additionally, a 26 amino acid signal peptide is located at the N-terminus of hsPRVl-2A. A putative transmembrane domain is located from amino acid residue positions 88 to 107. Two putative glycosylation sites are located at amino acid residue positions 117 and 183.
  • HsPRVl -2A is a predicted GPI anchored protein, and amino acid residue position 224 is the putative cleavage site for this GPI-anchored protein (see below).
  • Recombinant human sPRVl-2A was expressed in E. coli and was then auto-cleaved into two parts. Edman sequencing defined the cleavage site (indicated above) which was the potential cleavage site to several serine proteinases, implying the super sensitivity of sPRVl-2 to proteolysis.
  • the schematic diagram of Figure 12 indicates the signal peptide domain, a uPAR/Ly6 module, putative glycosylation and cleavage sites, and a super-sensitive site for serine proteases.
  • Human sPRVl-2 is a GPI anchored protein.
  • FIG. 13A 2-D gel electrophoresis followed by Western blotting of the supefnatants from human sperm treated without PIPLC (Fig. 13A) or with PIPLC (Fig. 13B) using anti-sPRVl-2.
  • Figure 13C represents a 2-D blot of human sperm proteins probed with anti-sPRVl -2 antibody.
  • transcripts of sPRVl-2 see Figure 14 for a schematic comparison of the density of EST 5 the 6 exons of human sPRVl-2, and transcripts A and B of sPRVl-2).
  • the two transcripts are referred to as A and B herein and are as follows:
  • Transcript B of HSPRV1-2 (SEQ ID NO:6) (including corresponding amino acid sequence): hsPRVl-2B 1 cttttctgcgggtcttggcacctttcttggccacagatttctgggttacagagcatgtgt hsPRVl-2B 61 gtctgaggcattgcaggcagaaaagggtggccgacgtgacctctagctggactgctgggc hsPRVl-2B 121 aggggagctgtcctagataaaattggaaagcaccttgtccaatgggaggacctaagtggg hsPRVl-2B 181 agagtgagagtcctgctttgagaagctaagatggtggatggtgcagaaacagtgacccag hsPRVl-2B 241 agaca
  • the sPRVl-2 protein appears to be a GPI-anchored protein.
  • it also appears to have a 26 amino acid signal peptide at the N-terminal region (see Figure 17) and it also appears to have a possible trans ⁇ membrane domain (see Figure 18).
  • Table 3 summarizes predicted glycoprotein and phosphorylated protein by Prosite analysis.
  • TMpred Analysis results of a TMpred Analysis to analyze possible transmembrane regions of sPRVl-2 are summarized in Figure 18.
  • Fig. 18B graphically summarizes the TMpred output and indicates a transmembrane region from about amino acid residue position 86 to about position 105.
  • the sequence further suggests that sPRVl-2 (Band 10) may be a serine protease.
  • hsPRVl-2A from human testis cDNA was subjected to RT-PCR amplification of the full-length ORF.
  • Recombinant hsPRVl-2A was prepared and expressed in E. coli.
  • the expressed protein was found to be auto-cleaved into two parts, suggesting sPRVl-2 proteolytic activity (see Figure 19).
  • Figure 19 represents an image of an expression analysis of recombinant hsPRVl-2A in several expression strains of E. coli, including Nova Blue, BLR, BL21, and BL21 (lys). Expression of various truncated fragments of hsPRVl-2A was also examined.
  • Figure 20 demonstrates schematics of various truncated hsPRVl-2 constructs (left panel) and their expression (right panel). Five constructs were used. Construct A as used encompassed the parent construct (i.e., signal peptide region to transmembrane domain, and to and including C- terminal tail). Truncated construct B lacked the signal peptide. Truncated construct C lacked the signal peptide and the C-terminal tail. Truncated construct D was lacking the signal peptide through and including the transmembrane domain region. Truncated construct E was lacking the signal peptide through and including the transmembrane domain region as well as the C-terminal tail.
  • Figure 21 represents images of an analysis of Ni-NTA purified truncated hsPRVl-2 (construct E, see Figure 20).
  • the left three lanes of the gel indicate various amounts of BSA, and the right lanes indicate hsPRVl-2.
  • PRVl a novel flagella putative protease
  • Sampl4 SPlO
  • uPAR a novel flagella putative protease
  • CD-59 a novel flagella putative protease
  • sPRVl-2 BandlO
  • PRVl, Sampl4, SPlO, uPAR, CD-59, and sPRVl-2 all belong to a receptor superfamily.
  • the clusters of PRVl similar genes are located within 200 Kb of mouse chromosome 7A2, and within 500 Kb of human chromosome 19ql3.2.
  • Human sPRVl-2 mRNA is highly expressed in testis and at a low level in lymph node. In human testis, sPRVl-2 has two main spliced forms, sPRVl-2A and sPRVl- 2B, approximately 2.0 kb and 1.0 kb respectively.
  • Mouse sPRVl-2 transcripts are expressed mainly in the post-meiotic spermatids and testicular sperm.
  • the antiserum against sPRVl-2 stained the whole tail of human spermatozoa by immunofluorescence.
  • Human sPRVl-2A is a GPI anchored sperm surface protein.
  • the invention should not be construed to be limited solely to the assays and methods described herein, but should be construed to include other methods and assays as well.
  • One of skill in the art will know that other assays and methods are available to perform the procedures described herein. Headings are included herein for reference and to aid in locating certain sections. These headings are not intended to limit the scope of the concepts described therein under, and these concepts may have applicability in other sections throughout the entire specification.
  • Pantophysin is a phosphoprotein component of adipocyte transport vesicles and associates with GLUT4-containing vesicles. J Biol Chem 2000; 275: 2029-2036. 56. Visconti PE, Olds-Clarke P, Moss SB 3 Kalab P, Travis AJ, de las Heras M, Kopf GS. Properties and localization of a tyrosine phosphorylated form of hexokinase in mouse sperm. MoI Reprod Dev 1996; 43: 82-93.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention is directed to mouse and human Band 10 and/or TES101 sperm proteins and the use of these proteins to prepare and isolate compounds that can be used as diagnostic and contraceptive agents.

Description

SPERM SPECIFIC RAFT ASSOCIATED PROTEINS
Cross Reference to Related Applications
This application is entitled to priority pursuant to 35 U.S. C. § 119(e) to U.S. provisional patent application no. 60/604,617, filed August 25, 2004.
Statement Regarding Federally Sponsored Research or Development
This invention was made with United States Government support under Grant Nos. HD 38082, and U54 29099, awarded by National Institutes of Health. The United States Government may have certain rights in the invention.
Background
Lipid raft domains are regions of plasma membranes that have distinct lipid content and are enriched in cholesterol and sphingolipids. The unique content of these domains is believed to recruit specific proteins to the plasma membrane and these domains are implicated in signal transduction. If the protein caveolin is present then the membrane domain is defined as a caveola. Caveolins are cholesterol binding proteins that can potentially regulate a variety of signal transduction pathways (Smart et al., (1999) MoI. Cell. Biol. 19, 7289-7304; Kurzchalia & Parton, (1999) Curr. Opin. Cell. Biol. 11, 424-431). Additional uncharacterized proteins are believed to be associated with the lipid raft domains, and since the raft domain dissociates with capacitation these proteins may play key roles in the capacitation process. In accordance with one embodiment of the present invention proteins associated with the lipid raft domains of sperm cells are isolated and characterized. Following ejaculation, sperm are motile yet lack fertilizing competence which they gain in the female reproductive tract in a time-dependent process collectively called capacitation [1, 2]. Capacitation correlates in vitro with a cyclic AMP-dependent rise in tyrosine phosphorylation and is associated with changes in both the head and tail that prepare the sperm to undergo a regulated acrosome reaction (e.g., in response to the zona pellucida of the egg) and to be capable of hyperactivated motility [3].
Capacitation can be accomplished in vitro using cauda epididymal or ejaculated sperm incubated in a defined medium that reflects the electrolytic composition of the oviductal fluid [I].
Capacitation is associated with significant changes in the properties of sperm membranes, including an efflux of cholesterol. Bovine serum albumin (BSA), an essential component of in vitro capacitation medium, is believed to function as a cholesterol acceptor by removing it from the sperm plasma membrane [4-11]. Cholesterol and/or cholesterol analogues, if added to the capacitation medium inhibit sperm capacitation [12]. Additionally, other cholesterol-binding agents such as High density lipoprotein (HDL) [12-14] and β-cyclodextrins may substitute for BSA in capacitation media [15-18].
Previously, it was demonstrated that the efflux of cholesterol and other sterols from the plasma membrane precedes the cAMP-regulated tyrosine-phosphorylation cascade leading to capacitation [12, 19, 20]. However, the understanding of how sterol efflux couples to the regulation of signal transduction pathways intrinsic to capacitation remains rudimentary. One possibility is that before capacitation, cholesterol concentrates in specialized plasma membrane microdomains known as lipid rafts. By definition, rafts are highly enriched in cholesterol, gangliosides, and sphmgolipids. This lipid content contributes to the hydrophobic nature of raft domains and leads to two inherent biochemical properties: insolubility at 4°C in Triton XlOO detergent and light buoyant density after centrifugation in a sucrose density gradient. These properties can be used to isolate detergent-resistant membrane (DRM) as biochemical correlates of lipid rafts [21].
An additional property of lipid rafts, also due to their inherent hydrophobic nature, is the ability to recruit specific types of proteins including transmembrane proteins, membrane-bound, GPI-anchored, and saturated acyl chains lipid-modified proteins [22]. hi somatic cells, evidence is accumulating that lipid rafts, serve as centers for cholesterol traffic and for signal transduction pathways originating at the plasma membrane [23]. Signaling proteins in these domains are often cell-type and cell-state specific, and include receptor and non-receptor tyrosine kinases, G proteins, inositol phospholipids, GPI-anchored proteins, nitric oxide synthase and others congregate in lipid rafts [24-26]. A subset of lipid raft, called caveolae, are formed by polymerization of caveolins or caveolin-related integral membrane proteins (e.g. flotillin) which tightly bind cholesterol [27]. Caveolin forms high molecular weight (HMW) homo- and hetero-oligomers, ranging in size from 200-600 kDa [28-30]. Although the general functions of caveolae are still not completely defined, they are believed to be implicated in cholesterol transport [31], membrane trafficking [32] and signal transduction [33] in other systems. In mouse and guinea pig sperm, caveolin 1 (CAVl) is present in the plasma membrane overlying the acrosomal region and the flagellum [34, 35].
Several investigators have used cholesterol depletion as a method to evaluate whether a particular signaling pathway is regulated by changes in the properties of lipid rafts [36, 37]. In some cases, these studies have used β-cyclodextrins, a plant derivative with strong affinity for cholesterol, which drastically depletes cells from their cholesterol content in a non-physiologic manner. As noted above, not only is cholesterol efflux observed under capacitating conditions [7, 12] but cholesterol acceptors (e.g. BSA, β-cyclodextrins or HDL) present in the incubation media are required for capacitation [15, 17]. Together, these observations lead to the conclusion that cholesterol efflux is necessary for capacitation and to the primary hypothesis that cholesterol efflux alters the biophysical properties of the sperm plasma membrane by potentially reducing the extent of lipid raft domains. Supporting this hypothesis, a recent report found that two raft components, the GPI-linked protein CD59 and the sphingolipid GMl showed a partial, sterol loss-dependent, shift to the non-raft domain during human sperm capacitation [38]. A secondary hypothesis postulates that dissociation of the raft domains alters the composition or distribution of raft-associated proteins and in turn initiates signaling pathways that lead to capacitation. There is a long felt need in the art to identify proteins involved in fertilization and methods to regulate this process. The present invention satisfies these needs.
Summary of the Invention
Mammalian sperm acquire fertilization capacity after residing in the female tract in a process known as capacitation. The present disclosure addressed whether cholesterol efflux during capacitation alters the biophysical properties of the sperm plasma membrane by potentially reducing the extent of lipid raft domains as analyzed by the isolation- of detergent-resistant membrane fractions using sucrose gradients. In addition, this work investigated whether dissociation of the detergent resistant membrane fraction during capacitation alters resident sperm raft proteins. Mouse sperm proteins associated with such fractions were studied by silver staining, tandem mass spectrometry and Western blotting. Caveolin 1 was identified in sperm lipid rafts in multimeric states, including a high molecular weight oligomer sensitive to degradation under reducing conditions at high pH. Capacitation resulted in reduction of the light buoyant density detergent-resistant membrane fraction and decreased the array of proteins isolated within this fraction including loss of the high molecular weight caveolin 1 oligomers. Proteomic analysis of sperm proteins isolated in the light buoyant density fraction identified several proteins, including Hexokinase 1, testis serine protease 1 and 2, TEXlOl, Hyaluronidase (PH20, SPAMl), Facilitated glucose transporter 3, Lactate Dehydrogenase A, Carbonic Anhydrase IV, IZUMO, Pantophysin, Basigin and CRISPl . Capacitation also resulted in a significant reduction in sperm labeling by the fluorescent lipid analogue DiIC 16 indicating capacitation alters the liquid-ordered domains in the sperm plasma membrane. The observations that capacitation alters the protein composition of the detergent-resistant membrane fractions is consistent with the hypothesis that cholesterol efflux during capacitation dissociates lipid raft constituents initiating signaling events leading to sperm capacitation.
The present invention is directed to the human and mouse Band 10 (sPRVl-2) and TESlOl genes, their respective encoded proteins and antibodies against those proteins. More particularly, the present invention is directed to polypeptides comprising the amino acid sequences of the mouse Band 10 (SEQ ID NO: 1), human Band 10 (SEQ ID NO: 2), the mouse TESlOl (SEQ ID NO: 3), human TESlOl (SEQ ID NO: 4). The present invention provides antagonists of Band 10 and/or TESlOl activity with utility as contraceptive agents, and thus, one aspect of the present invention is directed to a method of screening for inhibitors of Band 10 and/or TESlOl. The present invention also encompasses antibodies specific for Band 10 and/or TES 101 and the use of such antibodies as therapeutic and diagnostic tools. The amino acid sequences of SEQ DD NOs: 1, 2, 4, and 4 are as follows: SEQ ID NO: 1
Mouse Band 10 (sPRVl-2) protein:
1 milqawrslq llylleaisl lpcteallcy eatasafrav slhnwkwlll rsmvcnqreg 61 ceetwfiet gtskgvlsfk gcssafsypp qisylvsppg vsiasysrvc rsylcnnltn
121 lepfvrlkas qpmstlpsak scpscvgkhd qeclpsfvtt encpfaassc ysstlkfqag 181 nlnttflimg cardshklla dfqhigsirv tevinvldks eavsaghcsq giswsvllcl 241 lillrd
SEQ ID NO: 2
Human Band 10 (sPRVl-2) protein: 1 mgpqhlrlvq lfcllgaipt lpragallcy eatasrfrav afhnwkwllm rnmvcklqeg
61 ceetlvfiet gtargwgfk gcsssssypa qisylvsppg vsiasysrvc rsylcnnltn
121 lepfvklkas tpksitsasc scptcvgehm kdclpnfvtt nscplaastc ysstlkfqag 181 flnttfllmg carehnqlla dfhhigsikv tevlnileks qivgaassrq dpawgwlgl
241 lfafrd
SEQ ID NO: 3
Mouse TESlOl protein: 1 mgacriqyvl liflliasrw tlvqntycqv sqtlsleddp grtfnwtska eqcnpgelcq
61 etvllikadg trtwlasks cvsqggeavt fiqytappgl vaisysnycn dslcrmkdsl
121 asvwrvpett atsnmsgtrh cptcvalgsc ssapsmpcan gttqcyqgrl efsgggmdat
181 vqvkgcttti gcrlmamids vgpmtvketc syqsflqprk aeigasqmpt slwvlellfp
241 llllplthfp
SEQ ID NO: 4
Human TESlOl protein: 1 mgarqiqtss sqtspeeamg tpriqhllil lvlgasllts glelycqkgl smtveadpan
61 mfhwtteeve tcdkgalcqe tiliikagte tailatkgci pegeeaitiv qhssppgliv 121 tsysnyceds fcndkdslsq fwefsettas tvsttlhcpt cvalgtcfsa pslpypngtt
181 rcyqgkleit gggiessvev kgctamigcr lmsgilavgp mfvreacphq Utqprkten 241 gatclpipvw glqlllplll psfihfs
In one embodiment, the invention comprises an isolated nucleic acid comprising a nucleic acid sequence encoding a human sPRVl-2. In one aspect, the nucleic acid sequence encodes a polypeptide having SEQ ID NO:2, or a fragment, derivative, or homolog thereof. In one embodiment, the invention comprises an isolated nucleic acid comprising a nucleic acid sequence having the sequence of SEQ ID NO:5: cttgtctttgtgtcggttgtgattttcctaatctctgattttccttttctctcggacgctctccctcttcggacccatω cgtgcttcatgccctgatagcctggccccttcccggcttccttcgctaccggggacgcctctagtttttctgaatttctggctggct ccaccctccgcgttcatcttcctcaagagttcgcccctctgggggctcctctgtgtaatcgtcgccttctctgggtatttctgtgaa ctccgtctcacaccatcccgccatcttctctgccttggccccttttctctgtacagccagctctgtgtccttttcttctccccctctaaa atcgactcctcttctccctgagagccccacctttgtgccccactcctcattttcctacgcctccctctctctgctggtcctctctctcc ctgcaaggttccattccatcaaittgtttgtcttttgtaggggtggcatcccctctgactactgctccatccLLLLtlLLtLUULLUULLLLL tgcttgaggatttcacttcaatcttttctggttgcgtctccacttgtactcagcttgttaggtccaggtccagttgttctgcatctgagg ctggcgtgtgctgtcttctctgattggcctaatctccctcacccccgtgagatctgttgtcagccttcgtttctctttcctgtgtccca gcttttctgcgggtcttggcacctttcttggccacagatttctgggttacagagcatgtgtgtctgaggcattgcaggcagaaaag ggtggccgacgtgacctctagctggactgctgggcaggggagctgtcctagataaaattggaaagaaacagtgacccagag acaggtggacaaagaattcggggactgatgggaactgagcttgggatccagactgaaactgattccagactgacctctagca cccaggacccagacacagggccatgggaccccagcatttgagacttgtgcagctgttctgccttctaggggccatccccactc tgcctcgggctggagctcttttgtgctatgaagcaacagcctcaagattcagagctgttgctttccataactggaagtggcttctg atgaggaacatggtgtgtaagctgcaagagggctgcgaggagacgctagtgttcattgagacagggactgcaaggggagtt gtgggctttaaaggctgcagctcgtcttcgtcttaccctgcgcaaatctcctaccttgtttccccacccggagtgtccattgcctcc tacagtcgcgtctgccggtcttatctctgcaacaacctcaccaatttggagccttttgtgaaactcaaggccagcactcctaagtc tatcacatctgcgtcctgtagctgcccgacctgtgtgggcgagcacatgaaggattgcctcccaaattttgtcaccactaattctt gccccttggctgcttctacgtgttacagttccaccttaaaatttcaggcagggtttctcaataccaccttcctcctcatggggtgtg ctcgtgaacataaccagcttttagcagattttcatcatattgggagcatcaaagtgactgaggtcctcaacatcttagagaagtct cagattgttggtgcagcatcctccaggcaagatcctgcttggggtgtcgtcttaggcctcctgtttgccttcagggactgaccatc tagctgcacccgacaagcacccagactctttcacataacaaataaaatagcagagttcccttaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaa. In one embodiment, the invention comprises an isolated nucleic acid comprising a nucleic acid sequence having the. sequence of SEQ ID NO:6: cttttctgcgggtcttggcacctttcttggccacagatttctgggttacagagcatgtgtgtctgaggcattgcaggca gaaaagggtggccgacgtgacctctagctggactgctgggcaggggagctgtcctagataaaattggaaagcaccttgtcca atgggaggacctaagtgggagagtgagagtcctgctttgagaagctaagatggtggatggtgcagaaacagtgacccagag acaggtggacaaagaattcggggactgatgggaactgagcttgggatccagactgaaactgattccagactgacctctagca cccaggacccagacacagggccatgggaccccagcatttgagacttgtgcagctgttctgccttctaggggccatctccactc tgcctcgtatgtcctgtggggctggatgctataagacccagaaagggactgcaaggggagtcgtgggctttaaaggctgcag ctcgtcttcgtcttaccctgcgcaaatctcctaccttgtttccccacccggagtgtccattgcctcctacagtcgcgtctgccggtc ttatctctgcaacaacctcaccaatttggagccttttgtgaaactcaaggccagcactcctaagtctatcacatctgcgtcctgtag ctgcccgacctgtgtgggcgagcacatgaaggattgcctcccaaattttgtcaccactaattcttgccccttggctgcttctacgt gttacagttccaccttaaaatttcaggcagggtttctcaataccaccttcctcctcatggggtgtgctcgtgaacataaccagctttt agcagattttcatcatattgggagcatcaaagtgactgaggtcctcaacatcttagagaagtctcagattgttggtgcagcatcct ccaggcaagatcctgcttggggtgtcgtcttaggcctcctgtttgccttcagggactgaccatctagctgcacccgacaagcac ccagactctttcacataacaaataaaatagcagagttccctttcaaaaaaaaaaaaaaaa.
In one embodiment, the invention provides an isolated nucleic acid comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence selected from the group of amino acid sequences consisting of SEQ ID NOs:3 and 4. One aspect of the present invention relates to signaling events in mammalian sperm that regulate the functions of this highly differentiated cell. More particularly, in one embodiment the invention relates to signal transduction that modulates the acquisition of sperm fertilizing capacity. After ejaculation, sperm are able to move actively but lack fertilizing competence. They acquire the ability to fertilize in the female genital tract in a time-dependent process called capacitation. Capacitation has been demonstrated to be accompanied by phosphorylation of several proteins on both serine/threonine and tyrosine residues, and that protein tyrosine phosphorylation is regulated downstream by a cAMP/PKA pathway that involves the crosstalk between these two signaling pathways. With the exception of PKA, the other kinase(s) involved in the regulation of capacitation are still unknown.
Raft fractions can be isolated with reproducibility from mouse caudal sperm using ultracentrifugation of membranes in a sucrose gradient according to standard techniques known to titiose skilled in the art (see Fig. 6). As shown in Fig. 7 the proteins present in sucrose fractions of the isolated lipid raft domains isolated from noncapacitated sperm differ from those isolated from capacitated sperm. Silver stained PAGE analysis reveals that a number of proteins present in the lipid raft domains of noncapacitated sperm are not present in those domains in capacitated sperm, thus raft domains are diminished in protein content (especially true for fraction 4) upon capacitation of the sperm (see Fig. 7).
In accordance with one embodiment of the present invention, a sperm raft domain associated protein is isolated and characterized.
In accordance with one embodiment, the human and mouse Band 10 (sPRVl-2) and/or TESlOl genes and proteins serve as targets for the development of novel drugs, including the identification of novel contraceptive agents. In one aspect, antibodies are developed which target polypeptides of the invention, hi one embodiment, the human and mouse Band 10 (sPRVl-2) and/or TESlOl genes and proteins serve as targets for identifying drugs, compounds, and antibodies which modulate fertility. hi one embodiment, compounds or antibodies of the invention directed against polypeptides of the invention are useful for modulating fertility. In one aspect, fertility is modulated by inhibiting or reducing sperm capacitation. hi one aspect, antisense oligonucleotides complementary to nucleic acid sequences of the invention are provided.
It will be appreciated that, although the present invention is discussed in terms of what is perhaps its most useful application, the compositions and methods of the invention may be employed using other samples, no matter how obtained, no matter the source, and no matter how treated.
The foregoing and other features, objects, and advantages of the present invention will be apparent from the following detailed description, the scope of the invention being set forth in the appended claims.
Brief Description of the Drawings
Figure 1, comprising Figures IA, IB, and 1C, represents images of gels summarizing that multiple electrophoretic isoforms of CAVl are present in mouse sperm.
The high molecular weight oligomer and monomer are reduced after capacitation. Figure IA: Sperm were prepared as described in the Examples; the extracts (200,000 sperm equivalent/lane) were separated using a 4-16% linear gradient SDS-PAGE, transferred to Immobilon P and CAVl visualized using specific antibodies (Fig IA, left lane). As a control for antibody specificity, identical blots were developed with the same antibody pre-absorbed with the antigenic peptide. Fig. IB, left panel: NON and CAP sperm proteins were prepared to maintain HMW caveolin complexes and analyzed as in Fig. IA. Fig. IB, right panel: parallel identical samples were boiled for 5 min at high pH to reduce the HMW oligomers and then analyzed as in Fig. IA. Fig. 1C: Sperm homogenates were sonicated in buffer containing 1 % TX 100 and incubated in the same buffer for 30 minutes on ice. Then sequential centrifugations were performed. First, a pellet (PlO) and supernatant were obtained after centrifugation at 10,000 x g for 10 min. Second, the supernatant was further centrifuged at 100,000 x g for 1 hour and the pellet (PlOO) and the supernatant (SlOO) were recovered. Each fraction was then prepared to maintain HMW CAVl complexes and separated in SDS- PAGE gels as before. The proteins were then transferred to PVDF membranes and the CAVl visualized with anti CAVl by Western Blot.
Figure 2. Biochemical isolation of DRM lipid rafts by sucrose gradient centrifugation from non-capacitated (NON) and capacitated sperm (CAP).
NON and CAP sperm (80-100 million) treated with 0.5% TXlOO in TEN buffer were adjusted to 40% sucrose. Samples were prepared for DRM isolation as described in Methods. In each condition, nine 200 μl fractions were then collected from Top to Bottom, divided in two and analyzed in a linear gradient SDS-PAGE. One set was analyzed by silver staining of the fractions from the Top to Bottom of the sucrose gradient. The light-scattering visible light buoyant density fraction (*) band was observed in the non-capacitated population but not in the capacitated one. The second set of aliquots was analyzed by linear gradient SDS-PAGE, transferred to Immobilon P and immunostained with the CAVl antibody. This experiment was repeated six times with similar results. Upper two panels- NON; Lower two panels- CAP; Left two panels- silverstain; Right two panels- α-Cavlα. Figure 3. MS/MS analysis of lipid rafts.
Proteins detected by silver stain in the light buoyant density DRM fraction (#4) of non-capacitated sperm were numbered, excised and submitted for peptide analysis and protein identification as described in Methods. For simplicity, every other protein band is numbered while every arrow represents an excised silver-stained band. The Sequest algorithmic program or manual EST database searches were used to match the peptides to known proteins. Proteins identified by this method are shown in Table I.
Two novel proteins belonging to the uPAR/Ly-6/Snake receptor family were detected ' from band 10,11 in this putative mouse sperm raft domain. They were designated as sPRVl-1, sPRVl-2 (also called BandlO herein) based on 30% similarity to human polycythemia rubra vera 1 (PRVl), which is a hematopoietic cell surface receptor, highly expressed in granulocytes from patients with polycythemia rubra vera (see Figure 3).
Figure 4 (four panels). Detection of TEXlOl and FfKl after sucrose gradient fractionation in non-capacitated and capacitated mouse sperm.
NON and CAP sperm (80-100 million) treated with 0.5% TXlOO in TEN buffer were adjusted to 40% sucrose and prepared for DRM isolation as described in Methods. In each condition, nine 200 μl fractions were then collected from Top to Bottom, divided in two and analyzed by linear gradient SDS-PAGE. The gels were then transferred to Immobilon P and Western blots conducted with antibodies against HKl and TEXlOl respectively. Upper two panels- αHKl; Lower two panels- αTES; Left two panels- NON; Right two panels- CAP. Molecular weight marker ranges are indicated on the left. The raft numbers are indicated across the top. non-capacitated (NON) and capacitated sperm (CAP)
Figure 5 (comprising Figures 5 A, 5B, 5C, and 5D). Detection of liquid-ordered plasma membrane domains in non- and capacitated sperm with the lipid analog probe DiICl 6.
NON (Top, Figs. 5A and 5B) and CAP (Bottom, Figs. 5C and 5D) sperm were labeled with the lipid analog probe DiIC 16 to detect Io domains as described in Experimental Procedures. Labeling with DiIC 16 of fixed (Left, 5 A and 5C) and live (Right, 5B and 5D) sperm was performed as described in Experimental Procedures in order to compare probe binding of liquid-ordered domains in both conditions. Magnification 40 X. non-capacitated (NON) and capacitated sperm (CAP). Figure 6. Comparison of the Mouse and Human Band 10 Proteins:
Score = 326 bits (836), Expect = 3e-88; Identities = 166/243 (68%), Positives = 196/243 (80%).
Figure 7. Comparison of the Mouse and Human TESlOl Proteins: Score = 239 bits (609), Expect = 6e-62; Identities = 123/234 (52%), Positives =
163/234 (69%), Gaps = 3/234 (1%).
Figure 8. Locations of the clusters of PRVl similar genes on mouse chromosome 7 and human chromosome 19.
Five mouse PRVl similar genes are located within 200 kb of mouse chromosome 7A2. While three human PRVl similar genes (with one pseudo gene) are located within 500 kb of human chromosome 19ql3.2. The broken lines show the homologous genes and the arrows indicate their direction of transcription. TexlOl and PRVl are the names from the GenBank assignment. msPRVl-1, msPRVl-2, msPRVl- 3, mPRVl, hsPRVl-2 and hPRVl-pseudo are designated in this study. The first letter "m" or "h" in these gene names represents either human or mouse genes. The following study is focused on sPRVl-2, which has 68% identity in human and mouse.
Figure 9, comprising Figures 9A, 9B, and 9C, illustrates the results of Northern blot analyses and RNA dot blot analysis of human sPRVl-2 expression.
Northern analysis of human sPRVl-2 expression in 8 human tissues (spleen, thymus, prostate, testis, ovary, small intestine, colon, and peripheral blood leukocytes). HsPRV 1-2 was found only expressed in testis, and two major transcripts, hsPRVl-2A, hsPRVl-2B, approximately 2.0 kb and 1.0 Kb were detected (see Figure 9A). Figure 9B demonstrates the results of an RNA dot blot analysis of 76 human tissues. Figure 9C depicts the results of a northern analysis of human sPRVl-2 expression in human testis and lymph node. Two major transcripts were detected in testis but not in lymph node or ovary. RT-PCR (data not shown) only revealed a small amount of 1.0 kb transcript in human lymph node.
Figure 10, comprising a left panel, Fig. 1OA (human sperm protein), and a right panel, Fig. 1OB (mouse sperm protein), represents images of a western blot analysis demonstrating that polyclonal antisera against hsPRVl-2 recognizes sPRVl-2 proteins in human and mouse. Human sperm protein extract was run on 1-D gel, then immunoblotted with anti-hsPRVl-2 rat serum (post) and preimmune-serum (pre). The left strip of each panel indicates incubation with preimmune serum and the right strip of each panel indicates incubation with postimmune serum. Molecular weight markers are indicated as are hsPRVl-2 and possible multimers of hsPRVl-2. Figure 11, comprising Figures 1 IA, B, C, D, E, F, G, and H, represents photomicrographs of immunofluorescence localization of hsPRVl-2 in human sperm.
In the first panel of four (Figures 1 IA, B, C, and D), immunofluorescent staining of capacitated (Fig. 1 IA) and non-capacitated human sperm (Fig. HC) was performed using anti-hsPRVl-2 rat serum. The corresponding phase contrast images (1 IB and HD) are adjacent to the immunofluorescent images. In the second panel, immunofluorescent staining of capacitated (Fig. HE) and non-capacitated (Fig. 11G) human sperm was performed using preimmune serum from the same rat. The corresponding phase contrast images (1 IF and 1 IH) are adjacent to the immunofluorescent images. Figure 12 is a schematic representation of the possible post-translation modifications of human sPRVl-2A. The schematic indicates the signal peptide domain, a uPAR/Ly6 module, putative glycosylation and cleavage sites, and a super-sensitive site for serine proteases.
Figure 13, comprising Figures 13A, 13B, and 13C, represents images of a 2-D gel electrophoretic analysis of sPRVl-2 isoforms in supernatants from live human sperm treated with PIPLC. Figures 13A and 13B demonstrate the results of 2-D gel electrophoresis followed by Western blotting of the supernatants from human sperm treated without PIPLC (13A) or with PIPLC (13B) using anti-sPRVl-2. Figure 13C represents the results of a 2-D blot of human sperm proteins probed with anti-sPRVl-2 antibody.
Figure 14, comprising Figures 14A, 14B, 14C, and 14D, represents a schematic comparison of the density of EST (Fig. 14A), the 6 exons of human sPRVl-2 (Fig. 14B), and transcripts A (Fig. 14C) and B (Fig. 14D) of sPRVl-2.
Figure 15 is a schematic representation of the alignment of two transcripts, A and B, of human sPRVl-2 (also called Band 10 herein).
Figure 16 represents an image of the results of an RTrPCR analysis of two transcripts of sPRVl-2 in multiple tissues (testis, leukocytes, and lymph nodes). The left half of the gel represents Transcript A and the right half represents Transcript B. The far right lane represent markers.
Figure 17 represents a signal peptide analysis of sPRVl-2 (Band 10). The ordinate represents the score and the abscissa represents the position.
Figure 18, comprising figures 18A and 18B, represents the results of a TMpred Analysis to analyze possible transmembrane regions of sPRVl-2. Fig. 18A indicates positions and "inside to outside" and "outside to inside" helices. Fig. 18B graphically summarizes the TMpred output and indicates a transmembrane region from about amino acid residue position 86 to about position 105.
Figure 19 represents an image of an expression analysis of recombinant hsPRVl-2A in several expression strains of E. coli. Indicated above the gel are Nova Blue, BLR, BL21, and BL21 (lys). 25 kD and 15 kD migration rates are indicated.
Figure 20, comprising upper and lower panels (Figs. 2OA and 2OB, respectively), demonstrates schematics of various truncated hsPRVl-2 constructs
(upper panel) and their expression (lower panel). The upper part of Fig. 2OA indicates the full parent construct, i.e., signal peptide region to transmembrane domain, to C- terminal tail. Construct A as used encompassed the parent construct. Truncated construct B lacked the signal peptide. Truncated construct C lacked the signal peptide and the C-terrninal tail. Truncated construct D lacked the signal peptide through and including the transmembrane domain region. Truncated construct E lacked the signal peptide, through and including the transmembrane domain region, as well as the C- terminal tail.
Figure 21 represents images of an analysis of Ni-NTA purified truncated hsPRVl-2 (construct E, see Figure 20). The left three lanes of the gel indicate various amounts of BSA, and the right lanes indicate hsPRVl-2.
Detailed Description of the Invention Abbreviations Bovine serum albumin (BSA) capacitating conditions or capacitated sperm (CAP) caveolin 1 (CAVl) detergent-resistant membrane (DRM) Hexokinase I (HKl) High density lipoprotein (HDL) Horseradish peroxidase (HRP) human sperm PRV-like protein (hsPRV) mouse sperm PRV-like protein (msPRV) non-capacitating conditions or non-capacitated sperm (NON) Polycythemia rubra vera (PRV) room temperature (RT) sperm PRV-like protein (sPRV)
Tris-Buffered Saline, pH 7.3, 0.1% Tween 20 (TBST)
Whitten's-HEPES buffered (WH)
Definitions
In describing and claiming the invention, the following terminology will be used in accordance with the definitions set forth below.
The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
A disease or disorder is "alleviated" if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, are reduced.
As used herein, "amino acids" are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table:
Full Name Three-Letter Code One-Letter Code
Aspartic Acid Asp D
Glutamic Acid GIu E
Lysine Lys K
Arginine Arg R Histidine His H
Tyrosine Tyr Y
Cysteine Cys C
Asparagine Asn N
Glutamine GIn Q
Serine Ser S
Threonine Thr T
Glycine GIy G
Alanine Ala A V Vaalliinnee V VaaII V
Leucine Leu L
Isoleucine lie I
Methionine Met M
Proline Pro P P Phheennyyllaallaanniinnee P Phhee F
Tryptophan Trp W
The expression "amino acid" as used herein is meant to include both natural and synthetic amino acids, and both D and L amino acids. "Standard amino acid" means any of the twenty standard L-amino acids commonly found in naturally occurring peptides. "Nonstandard amino acid residue" means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source. As used herein, "synthetic amino acid" also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and substitutions. Amino acids contained within the peptides of the present invention, and particularly at the carboxy- or amino-terminus, can be modified by methylation, amidation, acetylation or substitution with other chemical groups which can change the peptide's circulating half-life without adversely affecting their activity. Additionally, a disulfide linkage may be present or absent in the peptides of the invention. The term "amino acid" is used interchangeably with "amino acid residue," and may refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide. Amino acids have the following general structure:
H R C COOH
NH2 Amino acids may be classified into seven groups on the basis of the side chain
R: (1) aliphatic side chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains containing sulfur atoms, (4) side chains containing an acidic or amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an imino acid in which the side chain is fused to the amino group. The nomenclature used to describe the peptide compounds of the present invention follows the conventional practice wherein the amino group is presented to the left and the carboxy group to the right of each amino acid residue. In the formulae representing selected specific embodiments of the present invention, the amino-and carboxy-terminal groups, although not specifically shown, will be understood to be in the form they would assume at physiologic pH values, unless otherwise specified.
As used herein, an "analog" of a chemical compound is a compound that, by way of example, resembles another in structure but is not necessarily an isomer (e.g., 5- fluorouracil is an analog of thymine).
The term "basic" or "positively charged" amino acid as used herein, refers to amino acids in which the R groups have a net positive charge at pH 7.0, and include, but are not limited to, the standard amino acids lysine, arginine, and histidine.
The term "antibody," as used herein, refers to an immunoglobulin molecule which is able to specifically bind to a specific epitope on an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies.
As used herein, the term "antisense oligonucleotide" or antisense nucleic acid means a nucleic acid polymer, at least a portion of which is complementary to a nucleic acid which is present in a normal cell or in an affected cell. "Antisense" refers particularly to the nucleic acid sequence of the non-coding strand, of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand. As defined herein, an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule. The antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences. The antisense oligonucleotides of the invention include, but are not limited to, phosphorothioate oligonucleotides and other modifications of oligonucleotides.
As used herein, the term "antisense oligonucleotide" or antisense nucleic acid means a nucleic acid polymer, at least a portion of which is complementary to a nucleic acid which is present in a normal cell or in an affected cell. "Antisense" refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand. As defined herein, an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule. The antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences. The antisense oligonucleotides of the invention include, but are not limited to, phosphorothioate oligonucleotides and other modifications of oligonucleotides. As used herein, the terms "complementary" or "complementarity" are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, for the sequence "A-G-T," is complementary to the sequence "T-C-A." The term "Band 10" as used herein refers to band 10 of the electrophoretic profiles described herein and refers to proteins having SEQ ID NOs: 1 and 2 (mouse and human). The terms "Band 10" and "sPRVl-2" are used interchangeably herein.
As used herein, the term "biologically active fragments" or "bioactive fragment" of the polypeptides of SEQ ID NOs: 1-4 encompasses natural or synthetic portions of the full-length protein that are capable of specific binding to their natural ligand.
"Complementary" refers to the broad concept of sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds ("base pairing") with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine. A first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the first region is capable of base pairing with a residue of the second region. Preferably, the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. More preferably, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.
A "compound," as used herein, refers to a polypeptide, an isolated nucleic acid, or other agent used in the method of the invention. As used herein, the term "conservative amino acid substitution" is defined herein as an amino acid exchange within one of the following five groups: I. Small aliphatic, nonpolar or slightly polar residues:
Ala, Ser, Thr, Pro, GIy;
II. Polar, negatively charged residues and their amides:
Asp, Asn, GIu, GLa; III. Polar, positively charged residues:
His, Arg, Lys; rV. Large, aliphatic, nonpolar residues:
Met Leu, He, VaI, Cys V. Large, aromatic residues: Phe, Tyr, Trp
A "control" cell, tissue, sample, or subject is a cell, tissue, sample, or subject of the same type as a test cell, tissue, sample, or subject. The control may, for example, be examined at precisely or nearly the same time the test cell, tissue, sample, or subject is examined. The control may also, for example, be examined at a time distant from the time at which the test cell, tissue, sample, or subject is examined, and the results of the examination of the control may be recorded so that the recorded results may be compared with results obtained by examination of a test cell, tissue, sample, or subject. The control may also be obtained from another source or similar source other than the test group or a test subject, where the test sample is obtained from a subject suspected of having a disease or disorder for which the test is being performed.
A "test" cell, tissue, sample, or subject is one being examined or treated.
A "pathoindicative" cell, tissue, or sample is one which, when present, is an indication that the animal in which the cell, tissue, or sample is located (or from which the tissue was obtained) is afflicted with a disease or disorder. By way of example, the presence of one or more breast cells in a lung tissue of an animal is an indication that the animal is afflicted with metastatic breast cancer.
A tissue "normally comprises" a cell if one or more of the cell are present in the tissue in an animal not afflicted with a disease or disorder. A "compound," as used herein, refers to any type of substance or agent that is commonly considered a drug, or a candidate for use as a drug, combinations, and mixtures of the above, as well as polypeptides and antibodies of the invention.
The use of the word "detect" and its grammatical variants is meant to refer to measurement of the species without quantification, whereas use of the word
"determine" or "measure" with their grammatical variants are meant to refer to measurement of the species with quantification. The terms "detect" and "identify" are used interchangeably herein.
As used herein, a "detectable marker" or a "reporter molecule" is an atom or a molecule that permits the specific detection of a compound comprising the marker in the presence of similar compounds without a marker. Detectable markers or reporter molecules include, e.g., radioactive isotopes, antigenic determinants, enzymes, nucleic acids available for hybridization, chromophores, fluorophores, chemiluminescent molecules, elecrrochemically detectable molecules, and molecules that provide for altered fluorescence-polarization or altered light-scattering.
A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
"Encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
An "enhancer" is a DNA regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the start site of transcription. A "fragment" or "segment" is a portion of an amino acid sequence, comprising at least one amino acid, or a portion of a nucleic acid sequence comprising at least one nucleotide. The terms "fragment" and "segment" are used interchangeably herein.
A "fragment" or "segment" is a portion of an amino acid sequence, comprising at least one amino acid, or a portion of a nucleic acid sequence comprising at least one nucleotide. The terms "fragment" and "segment" are used interchangeably herein.
As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a property or activity by which it is characterized. A functional enzyme, for example, is one which exhibits the characteristic catalytic activity by which the enzyme is characterized. "Homologous" as used herein, refers to the subunit sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, e.g., two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position hi both of the two molecules is occupied by the same monomelic subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions, e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90% homology. By way of example, the DNA sequences 3ΑTTGCC5' and 3'TATGGC share 50% homology. As used herein, "homology" is used synonymously with "identity." The determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm. For example, a mathematical algorithm useful for comparing two sequences is the algorithm of Karlin and Altschul (1990, Proc. Natl. Acad. Sci. USA 87:2264-2268), modified as in Karlin and Altschul (1993, Proc. Natl. Acad. Sci. USA 90:5873-5877). This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul, et al. (1990, J. MoI. Biol. 215:403-410), and can be accessed, for example at the National Center for Biotechnology Information (NCBI) world wide web site. BLAST nucleotide searches can be performed with the NBLAST program (designated "blastn" at the NCBI web site), using the following parameters: gap penalty = 5; gap extension penalty = 2; mismatch penalty = 3; match reward = 1; expectation value 10.0; and word size = 11 to obtain nucleotide sequences homologous to a nucleic acid described herein. BLAST protein searches can be performed with the XBLAST program (designated "blastn" at the NCBI web site) or the NCBI "blastp" program, using the following parameters: expectation value 10.0, BLOSUM62 scoring matrix to obtain amino acid sequences homologous to a protein molecule described herein. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997, Nucleic Acids Res. 25:3389-3402). Alternatively, PSI-Blast or PHI-Blast can be used to perform an iterated search which detects distant relationships between molecules (Id.) and relationships between molecules which share a common pattern. When utilizing BLAST, Gapped BLAST, PSI-Blast, and PHI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically exact matches are counted.
The term "inhibit," as used herein, refers to the ability of a compound of the invention to reduce or impede a described function, such as capacitation or fertilization. Preferably, inhibition is by at least 10%, more preferably by at least 25%, even more preferably by at least 50%, and most preferably, the function is inhibited by at least 75%.
As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the peptide of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein. Optionally, or alternately, the instructional material may describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal. The instructional material of the kit of the invention may, for example, be affixed to a container which contains the identified compound invention or be shipped together with a container which contains the identified compound.
Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
An "isolated nucleic acid" refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs. The term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of aprokaryote or eukaryote, or which exists as a separate molecule (e.g., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns. As used herein, a "ligand" is a compound that specifically binds to a target compound. A ligand (e.g., an antibody) "specifically binds to" or "is specifically immunoreactive with" a compound when the ligand functions in a binding reaction which is determinative of the presence of the compound in a sample of heterogeneous compounds. Thus, under designated assay (e.g., immunoassay) conditions, the ligand binds preferentially to a particular compound and does not bind to a significant extent to other compounds present in the sample. For example, an antibody specifically binds under immunoassay conditions to an antigen bearing an epitope against which the antibody was raised. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular antigen. For example, solid- phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with an antigen. See Harlow and Lane, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
As used herein, the term "linkage" refers to a connection between two groups. The connection can be either covalent or non-covalent, including but not limited to ionic bonds, hydrogen bonding, and hydrophobic/hydrophilic interactions.
As used herein, the term "linker" refers to a molecule that joins two other molecules either covalently or noncovalently, e.g., through ionic or hydrogen bonds or van der Waals interactions.
By "modulating fertility" is meant reducing or increasing fertility. For example, inhibiting fertilization is a means of modulating fertility.
By "nucleic acid" is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil). Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5'-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5 '-direction. The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the "coding strand"; sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as "upstream sequences"; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as "downstream sequences."
The term "oligonucleotide" typically refers to short polynucleotides, generally no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T."
"Operably linked" refers to a juxtaposition wherein the components are configured so as to perform their usual function. Thus, control sequences or promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence. By describing two polynucleotides as "operably linked" is meant that a single-stranded or double-stranded nucleic acid moiety comprises the two polynucleotides arranged within the nucleic acid moiety in such a manner that at least one of the two polynucleotides is able to exert a physiological effect by which it is characterized upon the other. By way of example, a promoter operably linked to the coding region of a gene is able to promote transcription of the coding region. As used herein, a "peptide" encompasses a sequence of 2 or more amino acid residues wherein the amino acids are naturally occurring or synthetic (non-naturally occurring) amino acids covalently linked by peptide bonds. No limitation is placed on the number of amino acid residues which can comprise a protein's or peptide's sequence. As used herein, the terms "peptide," polypeptide," and "protein" are used interchangeably. Peptide mimetics include peptides having one or more of the following modifications: 1. peptides wherein one or more of the peptidyl -C(O)NR-- linkages (bonds) have been replaced by a non-peptidyl linkage such as a — CH2-carbamate linkage
(--CH2OC(O)NR-), a phosphonate linkage, a -CH2-Sulfonamide (-CH 2-S(O)2NR-) linkage, a urea (-NHC(O)NH-) linkage, a -CH2 -secondary amine linkage, or with an alkylated peptidyl linkage (--C(O)NR-) wherein R is C1.C4 alkyl;
2. peptides wherein the N-terrninus is derivatized to a --NRRi group, to a
- NRC(O)R group, to a -NRC(O)OR group, to a -NRS(O)2R group, to a -NHC(O)NHR group where R and R\ are hydrogen or C 1X4 alkyl with the proviso that R and Rj are not both hydrogen; 3. peptides wherein the C terminus is derivatized to -C(O)R2 where R 2 is selected from the group consisting of C 1X4 alkoxy, and — NR3R4 where R3 and R4 are independently selected from the group consisting of hydrogen and C \_C^. alkyl.
Naturally occurring amino acid residues in peptides are abbreviated as recommended by the IUPAC-RJB Biochemical Nomenclature Commission as follows: Phenylalanine is Phe or F; Leucine is Leu or L; Isoleucine is He or I; Methionine is Met or M; Norleucine is NIe; Valine is VaI or V; Serine is Ser or S; Proline is Pro or P; Threonine is Thr or T; Alanine is Ala or A; Tyrosine is Tyr or Y; Histidine is His or H; Glutamine is GIn or Q; Asparagine is Asn or N; Lysine is Lys or K; Aspartic Acid is Asp or D; Glutamic Acid is GIu or E; Cysteine is Cys or C; Tryptophan is Trp or W; Arginine is Arg or R; Glycine is GIy or G, and X is any amino acid. Other naturally occurring amino acids include, by way of example, 4-hydroxyproline, 5-hydroxylysine, and the like.
Synthetic or non-naturally occurring amino acids refer to amino acids which do not naturally occur in vivo but which, nevertheless, can be incorporated into the peptide structures described herein. The resulting "synthetic peptide" contains amino acids other than the 20 naturally occurring, genetically encoded amino acids at one, two, or more positions of the peptides. For instance, naphthylalanine can be substituted for tryptophan to facilitate synthesis. Other synthetic amino acids that can be substituted into peptides include L-hydroxypropyl, L-3,4-dihydroxyphenylalanyl, alpha-amino acids such as L-alpha-hydroxylysyl and D-alpha-methylalanyl, L-alpha.-methylalanyl, beta. -amino acids, and isoquinolyl. D amino acids and non-naturally occurring synthetic amino acids can also be incorporated into the peptides. Other derivatives include replacement of the naturally occurring side chains of the 20 genetically encoded amino acids (or any L or D amino acid) with other side chains. As used herein, the term "pharmaceutically acceptable carrier" includes any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents. The term also encompasses any of the agents approved by a regulatory agency of the US Federal government or listed in the US Pharmacopeia for use in animals, including humans.
A "polylinker" is a nucleic acid sequence that comprises a series of three or more different restriction endonuclease recognitions sequences closely spaced to one another (i.e. less than 10 nucleotides between each site).
A "polynucleotide" means a single strand or parallel and anti-parallel strands of a nucleic acid. Thus, a polynucleotide may be either a single-stranded or a double- stranded nucleic acid.
As used herein, the term "promoter/regulatory sequence" means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulator sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
A "constitutive promoter is a promoter which drives expression of a gene to which it is operably linked, in a constant manner in a cell. By way of example, promoters which drive expression of cellular housekeeping genes are considered to be constitutive promoters.
A "core promoter" contains essential nucleotide sequences for promoter function, including the TATA box and start of transcription. By this definition, a core promoter may or may not have detectable activity in the absence of specific sequences that enhance the activity or confer tissue specific activity. An "inducible" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a living cell substantially only when an inducer which corresponds to the promoter is present in the cell. The term "non-native promoter" as used herein refers to any promoter that has been operably linked to a coding sequence wherein the coding sequence and the promoter are not naturally associated (i.e. a recombinant promoter/coding sequence construct).
A "tissue-specific" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a living cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
As used herein, "nucleic acid," "DNA," and similar terms also include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone. For example, the so-called "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention.
As used herein, the term "fragment" as applied to a nucleic acid, may ordinarily be at least about 20 nucleotides in length, typically, at least about 50 nucleotides, more typically, from about 50 to about 100 nucleotides, preferably, at least about 100 to about
200 nucleotides, even more preferably, at least about 200 nucleotides to about 300 nucleotides, yet even more preferably, at least about 300 to about 350, even more preferably, at least about 350 nucleotides to about 500 nucleotides, yet even more preferably, at least about 500 to about 600, even more preferably, at least about 600 nucleotides to about 620 nucleotides, yet even more preferably, at least about 620 to about 650, and most preferably, the nucleic acid fragment will be greater than about 650 nucleotides in length.
Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns. As used herein, "protecting group" with respect to a terminal amino group refers to a terminal amino group of a peptide, which terminal amino group is coupled with any of various amino-termirial protecting groups traditionally employed in peptide synthesis. Such protecting groups include, for example, acyl protecting groups such as formyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; aromatic urethane protecting groups such as benzyloxycarbonyl; and aliphatic urethane protecting groups, for example, tert-butoxycarbonyl or adamantyloxycarbonyl. See Gross and Mienhofer, eds., The Peptides, vol. 3, pp. 3-88 (Academic Press, New York, 1981) for suitable protecting groups. As used herein, "protecting group" with respect to a terminal carboxy group refers to a terminal carboxyl group of a peptide, which terminal carboxyl group is coupled with any of various carboxyl-terminal protecting groups. Such protecting groups include, for example, tert-butyl, benzyl or other acceptable groups linked to the terminal carboxyl group through an ester or ether bond. As used herein, the term "purified" and like terms relate to an enrichment of a molecule or compound relative to other components normally associated with the molecule or compound in a native environment. The term "purified" does not necessarily indicate that complete purity of the particular molecule has been achieved during the process. A "highly purified" compound as used herein refers to a compound that is greater than 90% pure. In particular, purified sperm cell DNA refers to DNA that does not produce significant detectable levels of non-sperm cell DNA upon PCR amplification of the purified sperm cell DNA and subsequent analysis of that amplified DNA.
"Recombinant polynucleotide" refers to a polynucleotide having sequences that are not naturally joined together. An amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell. A recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribo some-binding site, etc.) as well. A host cell that comprises a recombinant polynucleotide is referred to as a "recombinant host cell." A gene which is expressed in a recombinant host cell wherein the gene comprises a recombinant polynucleotide, produces a "recombinant polypeptide."
A "recombinant polypeptide" is one which is produced upon expression of a recombinant polynucleotide. A "sample," as used herein, refers preferably to a biological sample from a subject, including, but not limited to, normal tissue samples, diseased tissue samples, biopsies, blood, saliva, feces, semen, tears, and urine. A sample can also be any other source of material obtained from a subject which contains cells, tissues, or fluid of interest. A sample can also be obtained from cell or tissue culture. As used herein, the term "secondary antibody" refers to an antibody that binds to the constant region of another antibody (the primary antibody).
By the term "signal sequence" is meant a polynucleotide sequence which encodes a peptide that directs the path a polypeptide takes within a cell, i.e., it directs the cellular processing of a polypeptide in a cell, including, but not limited to, eventual secretion of a polypeptide from a cell. A signal sequence is a sequence of amino acids which are typically, but not exclusively, found at the amino terminus of a polypeptide which targets the synthesis of the polypeptide to the endoplasmic reticulum. In some instances, the signal peptide is proteolytically removed from the polypeptide and is thus absent from the mature protein. As used herein, the term "solid support" relates to a solvent insoluble substrate that is capable of forming linkages (preferably covalent bonds) with various compounds. The support can be either biological in nature, such as, without limitation, a cell or bacteriophage particle, or synthetic, such as, without limitation, an acrylamide derivative, agarose, cellulose, nylon, silica, or magnetized particles. By the term "specifically binds," as used herein, is meant an antibody or compound which recognizes and binds a molecule of interest (e.g., an antibody directed against a polypeptide of the invention), but does not substantially recognize or bind other molecules in a sample.
"Sperm-specific," as used herein, refers to an antigen which is present at higher levels on sperm than other cells or is exclusively present in sperm.
The term "standard," as used herein, refers to something used for comparison. For example, a standard can be a known standard agent or compound which is administered or added to a control sample and used for comparing results when measuring said compound in a test sample. Standard can also refer to an "internal standard," such as an agent or compound which is added at known amounts to a sample and is useful in determining sueh things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured.
A "subject" of analysis, diagnosis, or treatment is an animal. Such animals include mammals, preferably a human. The term "substantially pure" describes a compound, e.g., a protein or polypeptide which has been separated from components which naturally accompany it. Typically, a compound is substantially pure when at least 10%, more preferably at least 20%, more preferably at least 50%, more preferably at least 60%, more preferably at least 75%, more preferably at least 90%, and most preferably at least 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction) in a sample is the compound of interest. Purity can be measured by any appropriate method, e.g., in the case of polypeptides by column chromatography, gel electrophoresis, or HPLC analysis. A compound, e.g., a protein, is also substantially purified when it is essentially free of naturally associated components or when it is separated from the native contaminants which accompany it in its natural state.
A "substantially pure nucleic acid", as used herein, refers to a nucleic acid sequence, segment, or fragment which has been purified from the sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs. The term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins which naturally accompany it in the cell.
A "therapeutic" treatment is a treatment administered to a subject who exhibits signs of pathology for the purpose of diminishing or eliminating those signs. A "therapeutically effective amount" of a compound is that amount of compound which is sufficient to provide a beneficial effect to the subject to which the compound is administered.
As used herein, the term "transgene" means an exogenous nucleic acid sequence comprising a nucleic acid which encodes a promoter/regulatory sequence operably - linked to nucleic acid which encodes an amino acid sequence, which exogenous nucleic acid is encoded by a transgenic mammal.
As used herein, the term "transgenic mammal" means a mammal, the germ cells of which comprise an exogenous nucleic acid. As used herein, a "transgenic cell" is any cell that comprises a nucleic acid sequence that has been introduced into the cell in a manner that allows expression of a gene encoded by the introduced nucleic acid sequence.
As used herein, the term "treating" includes prophylaxis of the specific disorder or condition, or alleviation of the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms. A "prophylactic" treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the disease. As used herein, the term "treating" includes alleviating the symptoms associated with a specific disease, disorder or condition and/or preventing or eliminating said symptoms.
The term "vaccine" as used herein is defined as material used to provoke an immune response after administration of the materials to a mammal and thus conferring immunity.
A "vector" is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphophilic compounds, plasmids, and viruses. Thus, the term "vector" includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, plasmids, cosmids, lambda phage vectors, and the like.
"Expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses that incorporate the recombinant polynucleotide.
Embodiments
One embodiment of the present invention is directed to the mouse and human Band 10 (sPRVl-2) and/or TESlOl proteins that are testis abundant and expressed predominantly if not exclusively in the male germ cells of humans and mice. More particularly the present invention is directed to mouse and human Band 10 and/or
TESlOl and the use of that protein to prepare and isolate compounds that can be used as diagnostic and contraceptive agents.
Because of the association of these unique proteins with the raft membrane domains, the Band 10 and/or TESlOl gene and protein products represent potential targets for of contraceptive agents. Accordingly, one aspect of the present invention is directed to the isolation of human Band 10 and/or TESlOl and its use in isolating agents that inhibit capacitation-associated protein phosphorylation. Such inhibitors can then be used as contraceptive agents to inhibit fertilization. In accordance with one embodiment, the Band 10 and/or TESlOl proteins (selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4) will be used to screen for specific inhibitors of Band 10 and/or TESlOl activity and these inhibitors will be used either alone or in conjunction with other contraceptive agents to prevent unintended pregnancies.
In accordance with one embodiment of the present invention, a purified polypeptide, or a homolog, fragment, derivative, or modification thereof, is provided comprising the amino acid sequence of mouse or human Band 10 (SEQ ID NO:1 or 2, respectively) or TESlOl (SEQ ID NO: 3 or 4, respectively), or an amino acid sequence that differs from those sequences by one or more conservative amino acid substitutions. In another embodiment the purified polypeptide comprises an amino acid sequence that differs from those of SEQ ID NOs: 1, 2, 3, and 4 by less than 5 conservative amino acid substitutions, and in a further embodiment, by 2 or less conservative amino acid substitutions. In one embodiment, the purified polypeptide comprises an amino acid of a polypeptide comprising a sequence selected from the group consisting of SEQ ID NOs: I5 2, 3, and 4.
In one embodiment, a homolog of a polypeptide of the invention has at least 70% sequence identity with an amino sequence selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4. In another embodiment, ahomolog of a polypeptide of the invention has at least 80% sequence identity with an amino sequence selected from the group consisting of SEQ ID NOs: 1 , 2, 3, and 4. In yet another embodiment, a homolog of a polypeptide of the invention has at least 90% sequence identity with an amino sequence selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4. In one embodiment, a homolog of a polypeptide of the invention has at least 95% sequence identity with an amino Sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, and 4.
Substantially pure protein obtained as described herein may be purified by following known procedures for protein purification, wherein an immunological, enzymatic or other assay is used to monitor purification at each stage in the procedure. Protein purification methods are well known in the art, and are described, for example in Deutscher et al. (ed., 1990, Guide to Protein Purification, Harcourt Brace Jovanovich, San Diego).
The peptides of the present invention may be readily prepared by standard, well- established techniques, such as solid-phase peptide synthesis (SPPS) as described by Stewart et al. in Solid Phase Peptide Synthesis, 2nd Edition, 1984, Pierce Chemical Company, Rockford, Illinois; and as described by Bodanszky and Bodanszky in The Practice of Peptide Synthesis, 1984, Springer- Verlag, New York. At the outset, a suitably protected amino acid residue is attached through its carboxyl group to a derivatized, insoluble polymeric support, such as cross-linked polystyrene or polyamide resin. "Suitably protected" refers to the presence of protecting groups on both the α- amino group of the amino acid, and on any side chain functional groups. Side chain protecting groups are generally stable to the solvents, reagents and reaction conditions used throughout the synthesis, and are removable under conditions which will not affect the final peptide product. Stepwise synthesis of the oligopeptide is carried out by the removal of the N-protecting group from the initial amino acid, and couple thereto of the carboxyl end of the next amino acid in the sequence of the desired peptide. This amino acid is also suitably protected. The carboxyl of the incoming amino acid can be activated to react with the N-terminus of the support-bound amino acid by formation into a reactive group such as formation into a carbodiimide, a symmetric acid anhydride or an "active ester" group such as hydroxybenzotriazole or pentafluorophenly esters. Examples of solid phase peptide synthesis methods include the BOC method which utilized tert-butyloxcarbonyl as the α-amino protecting group, and the FMOC method which utilizes 9-fluorenylmethyloxcarbonyl to protect the α-amino of the amino acid residues, both methods of which are well-known by those of skill in the art. Incorporation of N- and/or C- blocking groups can also be achieved using protocols conventional to solid phase peptide synthesis methods. For incorporation of C-terminal blocking groups, for example, synthesis of the desired peptide is typically performed using, as solid phase, a supporting resin that has been chemically modified so that cleavage from the resin results in a peptide having the desired C-terminal blocking group. To provide peptides in which the C-terminus bears a primary amino blocking group, for instance, synthesis is performed using a p-memylbenzhydrylamine (MBHA) resin so that, when peptide synthesis is completed, treatment with hydrofluoric acid releases the desired C-terminally amidated peptide. Similarly, incorporation of an N-methylamine blocking group at the C-terminus is achieved using N-methylaminoethyl-derivatized DVB5 resin, which upon HF treatment releases a peptide bearing an N-methylamidated C-terminus. Blockage of the C-terminus by esterification can also be achieved using conventional procedures. This entails use of resin/blocking group combination that permits release of side-chain peptide from the resin, to allow for subsequent reaction with the desired alcohol, to form the ester function. FMOC protecting group, iri combination with DVB resin derivatized with methoxyalkoxybenzyl alcohol or equivalent linker, can be used for this purpose, with cleavage from the support being effected by TFA in dicholoromethane. Esterification of the suitably activated carboxyl function e.g. with DCC, can then proceed by addition of the desired alcohol, followed by deprotection and isolation of the esterified peptide product. Incorporation of N-terminal blocking groups can be achieved while the synthesized peptide is still attached to the resin, for instance by treatment with a suitable anhydride and nitrile. To incorporate an acetyl blocking group at the N-terminus, for instance, the resin-coupled peptide can be treated with 20% acetic anhydride in acetonitrile. The N-blocked peptide product can then be cleaved from the resin, deprotected and subsequently isolated.
To ensure that the peptide obtained from either chemical or biological synthetic techniques is the desired peptide, analysis of the peptide composition should be conducted. Such amino acid composition analysis may be conducted using high resolution mass spectrometry to determine the molecular weight of the peptide. Alternatively, or additionally, the amino acid content of the peptide can be confirmed by hydrolyzing the peptide in aqueous acid, and separating, identifying and quantifying the components of the mixture using HPLC, or an amino acid analyzer. Protein sequenators, which sequentially degrade the peptide and identify the amino acids in order, may also be used to determine definitely the sequence of the peptide. Prior to its use, the peptide is purified to remove contaminants. In this regard, it will be appreciated that the peptide will be purified so as to meet the standards set out by the appropriate regulatory agencies. Any one of a number of a conventional purification procedures may be used to attain the required level of purity including, for example, reversed-phase high-pressure liquid chromatography (HPLC) using an alkylated silica column such as C4 -,C8- or C 18- silica. A gradient mobile phase of increasing organic content is generally used to achieve purification, for example, acetonitrile in an aqueous buffer, usually containing a small amount of trifmoroacetic acid. Ion-exchange chromatography can be also used to separate peptides based on their charge. The polypeptides of the present invention may include additional amino acid sequences to assist in the stabilization and/or purification of recombinantly produced polypeptides. These additional sequences may include intra- or inter-cellular targeting peptides or various peptide tags known to those skilled in the art. In one embodiment, the purified polypeptide comprises an amino acid sequence selected from SEQ ID NOs: 1, 2, 3, and 4 and a peptide tag. Suitable expression vectors for expressing such fusion proteins and suitable peptide tags are known to those skilled in the art and commercially available. In one embodiment, the tag comprises a His tag. In another embodiment, the present invention is directed to a purified bioactive polypeptide that comprises a portion of a polypeptide of SEQ ID NOs: 1, 2, 3, and 4, including antigenic fragments of SEQ ID NOs: 1, 2, 3, and 4. The present invention also provides modified peptides. It will be appreciated, of course, that the peptides may incorporate amino acid residues which are modified without affecting activity. For example, the termini may be derivatized to include blocking groups, i.e. chemical substituents suitable to protect and/or stabilize the N- and C-termini from "undesirable degradation", a term meant to encompass any type of enzymatic, chemical or biochemical breakdown of the compound at its termini which is likely to affect the function of the compound, i.e. sequential degradation of the compound at a terminal end thereof.
Blocking groups include protecting groups conventionally used in the art of peptide chemistry which will not adversely affect the in vivo activities of the peptide. For example, suitable N-terminal blocking groups can be introduced by alkylation or acylation of the N-terminus. Examples of suitable N-terminal blocking groups include C1-C5 branched or unbranched alkyl groups, acyl groups such as formyl and acetyl groups, as well as substituted forms thereof, such as the acetamidomethyl (Acm) group. Desamino analogs of amino acids are also useful N-terminal blocking groups, and can either be coupled to the N-terminus of the peptide or used in place of the N-terminal reside. Suitable C-terminal blocking groups, in which the carboxyl group of the C- terminus is either incorporated or not, include esters, ketones or amides. Ester or ketone-forming alkyl groups, particularly lower alkyl groups such as methyl, ethyl and propyl, and amide-forming amino groups such as primary amines (-NH2), and mono- and di-alkylamino groups such as methylamino, ethylamino, dimethylamino, diethylamino, methylethylamino and the like are examples of C-terminal blocking groups. Descaxboxylated amino acid analogues such as agmatine are also useful C- terminal blocking groups and can be either coupled to the peptide's C-terminal residue or used in place of it. Further, it will be appreciated that the free amino and carboxyl groups at the termini can be removed altogether from the peptide to yield desamino and descarboxylated forms thereof without affect on peptide activity.
Other polypeptide modifications can also be incorporated without adversely affecting the activity and these include, but are not limited to, substitution of one or more of the amino acids in the natural L-isomeric form with amino acids in the D- isomeric form. Thus, the peptide may include one or more D-amino acid resides, or may comprise amino acids which are all in the D-form. Retro-inverso forms of peptides in accordance with the present invention are also contemplated, for example, inverted peptides in which all amino acids are substituted with D-amino acid forms. Acid addition salts of the present invention are also contemplated as functional equivalents. Thus, a peptide in accordance with the present invention treated with an inorganic acid such as hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, and the like, or an organic acid such as an acetic, propionic, glycolic, pyruvic, oxalic, malic, malonic, succinic, maleic, fumaric, tataric, citric, benzoic, cinnamie, mandelic, methanesulfonic, ethanesulfonic, p-toluenesulfonic, salicyclic and the like, to provide a water soluble salt of the peptide is suitable for use in the invention. The present invention also provides for analogs of proteins or peptides encoded by L/STs. Analogs can differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both. For example, conservative amino acid changes may be made, which although they alter the primary sequence of the protein or peptide, do not normally alter its function.
Conservative amino acid substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine.
Modifications (which do not normally alter primary sequence) include in vivo, or in vitro chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.
Also included are polypeptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent. Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids. The peptides of the invention are not limited to products of any of the specific exemplary processes listed herein.
The present invention also encompasses nucleic acid sequences that encode the polypeptides of SEQ ID NOs:l, 2, 3, and 4. In one embodiment, the nucleic acid sequences comprise sequences selected from the group consisting of SEQ ID NOs: 5 and 6. The present invention is also directed to recombinant human Band 10 and/or TESlOl gene constructs. In one embodiment, the recombinant gene construct comprises a non-native promoter operably linked to a nucleic acid sequence encoding the polypeptide of SEQ ID NOs: 1-4. The non-native promoter is preferably a strong constitutive promoter that allows for expression in a predetermined host cell. These recombinant gene constructs can be introduced into host cells to produce transgenic cell lines that synthesize the Band 10 and/or TESlOl protein. Host cells can be selected from a wide variety of eukaryotic and prokaryotic organisms, and two preferred host cells are E. coli and yeast cells. In one embodiment the introduced nucleic acid is sufficiently stable in the transgenic cell (i.e. incorporated into the cell's genome, or present in a high copy plasmid) to be passed on to progeny cells. The cells can be propagated in vitro using standard cell culture procedure, or in an alternative embodiment, the host cells are eukaryotic cells and are propagated as part of an animal, including for example, a transgenic animal. In one embodiment, the transgenic cell is a human cell and comprises a nucleic acid sequence encoding the human Band 10 and/or TESlOl protein.
It is not intended that the present invention be limited by the nature of the nucleic acid employed. The target nucleic acid may be native or synthesized nucleic acid. The nucleic acid may be from a viral, bacterial, animal or plant source. The nucleic acid may be DNA or RNA and may exist in a double-stranded, single-stranded or partially double-stranded form. Furthermore, the nucleic acid may be found as part of a virus or other macromolecule. See, e.g., Fasbender et al., 1996, J. Biol. Chem. 272:6479-89 (polylysine condensation of DNA in the form of adenovirus). Nucleic acids useful in the present invention include, by way of example and not limitation, oligonucleotides and polynucleotides such as antisense DNAs and/or RNAs; ribozymes; DNA for gene therapy; viral fragments including viral DNA and/or RNA; DNA and/or RNA chimeras; mRNA; plasmids; cosmids; genomic DNA; cDNA; gene fragments; various structural forms of DNA including single-stranded DNA, double- stranded DNA, supercoiled DNA and/or triple-helical DNA; Z-DNA; and the like. The nucleic acids may be prepared by any conventional means typically used to prepare nucleic acids in. large quantity. For example, DNAs and RNAs may be chemically synthesized using commercially available reagents and synthesizers by methods that are well-known in the art (see, e.g., Gait, 1985, OLIGONUCLEOTIDE SYNTHESIS: A PRACTICAL APPROACH (TRL Press, Oxford, England)). RNAs may be produce in high yield via in vitro transcription using plasmids such as SP65 (Promega Corporation, Madison, WI).
In some circumstances, as where increased nuclease stability is desired, nucleic acids having modified internucleoside linkages may be preferred. Nucleic acids containing modified internucleoside linkages may also be synthesized using reagents and methods that are well known in the art. For example, methods for synthesizing nucleic acids containing phosphonate phosphorothioate, phosphorodithioate, phosphoramidate methoxyethyl phosphoramidate, formacetal, thioformacetal, diisopropylsilyl, acetamidate, carbamate, ditnethylene-sulfide (-CH2-S-CH2), diinethylene-sulfoxide (-CH2-SO-CH2), dimethylene-sulfone (-CH2-SO2-CH2), 2'-O- alkyl, and 2'-deoxy2'-fluoro phosphorothioate internucleoside linkages are well known in the art (see Uhhnanri et al., 1990, Chem. Rev. 90:543-584; Schneider et al., 1990, Tetrahedron Lett. 31:335 and references cited therein).
The nucleic acids may be purified by any suitable means, as are well known in the art. For example, the nucleic: acids can be purified by reverse phase or ion exchange HPLC, size exclusion chromatography or gel electrophoresis. Of course, the skilled artisan will recognize that the method of purification will depend in part on the size of the DNA to be purified.
The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, myrnine, cytosine and uracil).
Modified gene sequences, i.e., genes having sequences that differ from the gene sequences encoding the naturally-occurring proteins, are also encompassed by the invention, so long as the modified gene still encodes a protein that functions to stimulate healing in any direct or indirect manner. These modified gene sequences include modifications caused by point mutations, modifications due to the degeneracy of the genetic code or naturally occurring allelic variants, and further modifications that have been introduced by genetic engineering, i.e., by the hand of man.
Techniques for introducing changes in nucleotide sequences that are designed to alter the functional properties of the encoded proteins or polypeptides are well known in the art. Such modifications include the deletion, insertion, or substitution of bases, and thus, changes in the amino acid sequence. Changes may be made to increase the activity of a protein, to increase its biological stability or half-life, to change its glycosylation pattern, and the like. All such modifications to the nucleotide sequences encoding such proteins are encompassed by this invention. In one embodiment, antisense oligonucleotides are provided as are other oligonucleotides. Antisense oligonucleotides complementary to nucleic acid sequences of the invention are provided as inhibitors of the nucleic acid sequences of the invention. hi some cases the oligonucleotides are modified. Oligonucleotides which contain at least one phosphorothioate modification are known to confer upon the oligonucleotide enhanced resistance to nucleases. Specific examples of modified oligonucleotides include those which contain phosphorothioate, phosphotriester, methyl phosphonate, short chain alkyl or cycloalkyl intersugar linkages, or short chain heteroatomic or heterocyclic intersugar ("backbone") linkages, hi addition, oligonucleotides having morpholino backbone structures (U.S. Patent No: 5,034,506) or polyamide backbone structures (Nielsen et al., 1991, Science 254: 1497) may also be used.
The examples of oligonucleotide modifications described herein are not exhaustive and it is understood that the invention includes additional modifications of the antisense oligonucleotides of the invention which modifications serve to enhance the therapeutic properties of the antisense oligonucleotide without appreciable alteration of the basic sequence of the antisense oligonucleotide.
A first oligonucleotide anneals with a second oligonucleotide "with high stringency" if the two oligonucleotides anneal under conditions whereby only oligonucleotides which are at least about 75%, and preferably at least about 90% or at least about 95%, complementary anneal with one another. The stringency of conditions used to anneal two oligonucleotides is a function of, among other factors, temperature, ionic strength of the annealing medium, the incubation period, the length of the oligonucleotides, the G-C content of the oligonucleotides, and the expected degree of non-homology between the two oligonucleotides, if known. Methods of adjusting the stringency of annealing conditions are known (see, e.g. Sambrook et al., 1989,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).
The present invention also encompasses a method for producing human or mouse Band 10 and/or TESlOl. The method comprises the steps of introducing a nucleic acid sequence comprising a sequence that encodes human or mouse Band 10 and/or TESlOl into a host cell, and culturing the host cell under conditions that allow for expression of the introduced human Band 10 and/or TESlOl gene. In one embodiment the promoter is a conditional or inducible promoter, alternatively the promoter may be a tissue specific or temporal restricted promoter (i.e. operably linked genes are only expressed in a specific tissue or at a specific time). The synthesized Band 10 and/or TESlOl proteins can be purified using standard techniques and used in high throughput screens to identify compounds that bind to Band 10 and/or TESlOl under physiological relevant conditions and/or that inhibit capacitation associated phosphorylation of tyrosine residues of sperm proteins.
Alternatively, in one embodiment the recombinantly produced Band 10 and/or TES 101 polypeptides, or fragments thereof are used to generate antibodies against the Band 10 and/or TESlOl polypeptides. The recombinantly produced Band 10 and/or TESlOl proteins can also be used to obtain crystal structures. Such structures would allow for crystallography analysis that would lead to the design of specific drugs to inhibit Band 10 and/or TESlOl function. In accordance with one embodiment, a composition is provided comprising a purified peptide of SEQ ID NOs: 1-4, or an antigenic fragment thereof. In one embodiment the peptide consists of the sequence of SEQ ID NOs: 1-4. The compositions can be combined with a pharmaceutically acceptable carrier or adjuvants and administered to a mammalian species to induce an immune response. Another embodiment of the present invention is directed to antibodies specific for human or mouse Band 10. hi another embodiment of the invention is directed to antibodies specific for human or mouse TESlOl . In one embodiment the antibody is a monoclonal antibody. The antibodies or antibody fragments of the present invention can be combined with a carrier or diluent to form a composition. In one embodiment, the carrier is a pharmaceutically acceptable carrier. Such carriers and diluents include sterile liquids such as water and oils, with or without the addition of a surfactant and other pharmaceutically and physiologically acceptable carrier, including adjuvants, excipients or stabilizers. Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil. hi general, water, saline, aqueous dextrose, and related sugar solution, and glycols such as, propylene glycol or polyethylene glycol, are preferred liquid carriers, particularly for injectable solutions.
Antibodies to Band 10 and/or TESlOl polypeptides may be generated using methods that are well known in the art. In accordance with one embodiment an antibody is provided that specifically binds to a polypeptide selected from SEQ ID
NOs: 1-4 or an antigenic fragment thereof. The antibodies may be used with or without modification, and may be labeled by joining them, either covalently or non-covalently, with a reporter molecule. In addition, the antibodies can be formulated with standard carriers and optionally labeled to prepare therapeutic or diagnostic compositions. The term "antibody," as used herein, refers to an immunoglobulin molecule which is able to specifically bind to a specific epitope on an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies (Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
By the term "synthetic antibody" as used herein, is meant an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
Monoclonal antibodies directed against full length or peptide fragments of a protein or peptide may be prepared using any well known monoclonal antibody preparation procedures, such as those described, for example, in Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, NY) and in Tuszynski et al. (1988, Blood, 72:109-115). Quantities of the desired peptide may also be synthesized using chemical synthesis technology. Alternatively, DNA encoding the desired peptide may be cloned and expressed from an appropriate promoter sequence in cells suitable for the generation of large quantities of peptide. Monoclonal antibodies directed against the peptide are generated from mice immunized with the peptide using standard procedures as referenced herein.
Nucleic acid encoding the monoclonal antibody obtained using the procedures described herein may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al. (1992, Critical Rev. in Immunol. 12(3,4):125-168) and the references cited therein. Further, the antibody of the invention may be "humanized" using the technology described in Wright et al., (supra) and in the references cited therein, and in Gu et al. (1997, Thrombosis and Hematocyst 77(4):755- 759). To generate a phage antibody library, a cDNA library is first obtained from mRNA which is isolated from cells, e.g., the hybridoma, which express the desired protein to be expressed on the phage surface, e.g., the desired antibody. cDNA copies of the mRNA are produced using reverse transcriptase. cDNA which specifies immunoglobulin fragments are obtained by PCR and the resulting DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising
DNA specifying immunoglobulin genes. The procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY). Bacteriophage which encode the desired antibody, may be engineered such that the protein is displayed on the surface thereof in such a manner that it is available for binding to its corresponding binding protein, e.g., the antigen against which the antibody is directed. Thus, when bacteriophage which express a specific antibody are incubated in the presence of a cell which expresses the corresponding antigen, the bacteriophage will bind to the cell. Bacteriophage which do not express the antibody will not bind to the cell. Such panning techniques are well known in the art and are described for example, in Wright et al, (supra).
Processes such as those described above, have been developed for the production of human antibodies using Ml 3 bacteriophage display (Burton et al., 1994, Adv. Immunol. 57:191-280). Essentially, a cDNA library is generated from mRNA obtained from a population of antibody-producing cells. The mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same. Amplified cDNA is cloned into Ml 3 expression vectors creating a library of phage which express human Fab fragments on their surface. Phage which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human
Fab immunoglobulin. Thus, in contrast to conventional monoclonal antibody synthesis, this procedure immortalizes DNA encoding human immunoglobulin rather than cells which express human immunoglobulin.
The procedures just presented describe the generation of phage which encode the Fab portion of an antibody molecule. However, the invention should not be construed to be limited solely to the generation of phage encoding Fab antibodies. Rather, phage which encode single chain antibodies (scFv/phage antibody libraries) are also included in the invention. Fab molecules comprise the entire Ig light chain, that is, they comprise both the variable and constant region of the light chain, but include only the variable region and first constant region domain (CHl) of the heavy chain. Single chain antibody molecules comprise a single chain of protein comprising the Ig Fv fragment. An Ig Fv fragment includes only the variable regions of the heavy and light chains of the antibody, having no constant region contained therein. Phage libraries comprising scFv DNA may be generated following the procedures described in Marks et al., 1991, J. MoI. Biol. 222:581-597. Panning of phage so generated for the isolation of a desired antibody is conducted in a manner similar to that described for phage libraries comprising Fab DNA.
The invention should also be construed to include synthetic phage display libraries in which the heavy and light chain variable regions may be synthesized such that they include nearly all possible specificities (Barbas, 1995, Nature Medicine 1 :837- 839; de Kruif et al. 1995, J. MoI. Biol.248:97-105). A ligand or a receptor (e.g., an antibody) "specifically binds to" or "is specifically immunoreactive with" a compound when the ligand or receptor functions in a binding reaction which is determinative of the presence of the compound in a sample of heterogeneous compounds. Thus, under designated assay (e.g., immunoassay) conditions, the ligand or receptor binds preferentially to a particular compound and does not bind in a significant amount to other compounds present in the sample. For example, a polynucleotide specifically binds under hybridization conditions to a compound polynucleotide comprising a complementary sequence; an antibody specifically binds under immunoassay conditions to an antigen bearing an epitope against which the antibody was raised. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
Since Band 10 and/or TESlOl have been demonstrated herein to be highly testis abundant, this makes Band 10 and/or TESlOl an optimal target for the development of drugs that modulate their activity. Such compounds are useful for modulating fertility and contraception and to study Band 10 and/or TESl 01 's role in spermiogenesis. In accordance with one aspect of the present invention the Band 10 and/or TESlOl protein is used as a target for the development of novel drugs. Progress in the field of small molecule library generation, using combinatorial chemistry methods coupled to high- throughput screening, has accelerated the search for ideal cell-permeable inhibitors. In addition, structural-based design using crystallographic methods has improved the ability to characterize in detail ligand-protein interaction sites that can be exploited for ligand design.
In one embodiment, the present invention provides methods of screening for drugs, compounds, agents, small molecules, or proteins that interact with polypeptides comprising a sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, and 4 or bioactive homologs, fragments, derivatives, and modifications thereof. The invention encompasses both in vivo and in vitro assays to screen small molecules, compounds, recombinant proteins, peptides, nucleic acids, antibodies, etc., which bind to or modulate the activity of Band 10 and/or TESlOl and are thus useful as therapeutic or diagnostic markers for fertility. In one embodiment of the present invention, Band 10 and/or TESlOl polypeptides, selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4 are used to isolate ligands that bind to Band 10 and/or TESlOl under physiological conditions. The screening method comprises the steps of contacting a Band 10 and/or TESlOl polypeptide with a mixture of compounds under physiological conditions, removing unbound and non-specifically bound material, and isolating the compounds that remain bound to the polypeptide. Typically, the BandlO and/or TESlOl polypeptide will be bound to a solid support, using standard techniques, to allow for rapid screening of compounds. The solid support can be selected from any surface that has been used to immobilize biological compounds and includes but is not limited to polystyrene, agarose, silica or nitrocellulose. In one embodiment the solid surface comprises functionalized silica or agarose beads. Screening for such compounds can be accomplished using libraries of pharmaceutical agents and standard techniques known to the skilled practitioner.
Ligands that bind to the Band 10 and/or TESlOl polypeptides can then be further analyzed for agonist and antagonist activity through the use of an in vitro assay. As described herein, Band 10/sPRV 1-2 is a serine protease which is GPI-anchored. Inhibitors of Band 10 and/or TESlOl associated activity have potential use as agents that prevent maturation/capacitation of sperm. In accordance with one embodiment, inhibitors of Band 10 and/or TESlOl are isolated as potential contraceptive agents. Such inhibitors can be formulated as pharmaceutical compositions and administered to a subject to block spermatogenesis and/or capacitation and provide a means for contraception or to reduce fertility.
In one embodiment, a polypeptide of the invention, or a homolog, fragment, derivative, or modification thereof, may be administered to a subject to induce an immune response against said polypeptide. In one aspect, a polypeptide of the • invention is useful as a contraceptive vaccine. In one aspect, the polypeptide is administered in a pharmaceutical composition comprising a pharmaceutically- ' acceptable carrier, and optionally an adjuvant.
The term "pharmaceutically-acceptable salt" refers to salts which retain the biological effectiveness and properties of the compounds of the present invention and which are not biologically or otherwise undesirable. In many cases, the compounds of the present invention are capable of forming acid and/or base salts by virtue of the presence of amino and/or carboxyl groups or groups similar thereto.
Pharmaceutically-acceptable base addition salts can be prepared from inorganic and organic bases. Salts derived from inorganic bases, include by way of example only, sodium, potassium, lithium, ammonium, calcium and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, such as alkyl amines, dialkyl amines, trialkyl amines, substituted atkyl amines, di(substituted alkyl) amines, tri(substituted alkyl) amines, alkenyl amines, dialkenyl amines, trialkenyl amines, substituted alkenyl amines, di(substituted alkenyl) amines, tri(substituted alkenyl) amines, cycloalkyl amines, di(cycloalkyl) amines, tri(cycloalkyl) amines, substituted cycloalkyl amines, disubstituted cycloalkyl amine, trisubstituted cycloalkyl amines, cycloalkenyl amines, di(cycloalkenyl) amines, tri(cycloalkenyl) amines, substituted cycloalkenyl amines, disubstituted cycloalkenyl amine, trisubstituted cycloalkenyl amines, aryl amines, diaryl amines, triaryl amines, heteroaryl amines, diheteroaryl amines, triheteroaryl amines, heterocyclic amines, diheterocyclic amines, triheterocyclic amines, mixed di- and tri-arnines where at least two of the substituents on the amine are different and are selected from the group consisting of alkyl, substituted alkyl, alkenyl, substituted alkenyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, heteroaryl, heterocyclic, and the like. Also included are amines where the two or three substituents, together with the amino nitrogen, form a heterocyclic or heteroaryl group. Examples of suitable amines include, by way of example only, isopropylamine, trimethyl amine, diethyl amine, tri(iso-propyl) amine, tri(n-propyl) amine, ethanolamine, 2-dimethylaminoethanol, tromethamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, N- alkylglucamines, theobromine, purines, piperazine, piperidine, morpholine, N- ethylpiperidine, and the like. It should also be understood that other carboxylic acid derivatives would be useful in the practice of this invention, for example, carboxylic acid amides, including carboxamides, lower alkyl carboxamides, dialkyl carboxamides, and the like. Pharmaceutically acceptable acid addition salts may be prepared from inorganic and organic acids. Salts derived from inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like. Salts derived from organic acids include acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluene-sulfonic acid, salicylic acid, and the like.
In accordance with one embodiment, the compounds of the present invention can be formulated as pharmaceutical compositions by combining the compounds with one or more pharmaceutically acceptable carriers. These formulations can be administered by standard routes. In general, the combinations may be administered by the topical, transdermal, oral, rectal or parenteral (e.g., intravenous, subcutaneous or intramuscular) route.
When adrninistered orally, the compounds are administered as a liquid solution, powder, tablet, capsule or lozenge. The compounds can be used in combination with one or more conventional pharmaceutical additives or excipients used in the preparation of tablets, capsules, lozenges and other orally administrable forms.
When administered parenterally, and more preferably by intravenous injection, the derivatives of the present invention can be admixed with saline solutions and/or conventional IV solutions. In addition, the combinations may be incorporated into biodegradable polymers allowing for sustained release of the compound, and in one embodiment the delivery vehicle is implanted in the vicinity of where drug delivery is desired, for example, at the site of a tumor. Biodegradable polymers suitable for use with the present invention are known to the skilled practitioner and are described in detail, for example, inBrem et al., J. Neurosurg. 74:441-446 (1991). The dosage of the active compound will depend on the condition being treated, the particular compound, and other clinical factors such as weight and condition of the human or animal and the route of administration of the compound. It is to be understood that the present invention has application for both human and veterinary use. In one embodiment relating to oral administration to humans, a dosage of between approximately 0.1 to 300 mg/kg/day, or between approximately 0.5 and 50 mg/kg/day, or between approximately 1 to 10 mg/kg/day, is generally sufficient.
The present invention is also directed to pharmaceutical compositions comprising the compounds of the present invention. More particularly, such compounds can be formulated as pharmaceutical compositions using standard pharmaceutically acceptable carriers, fillers, solubilizing agents and stabilizers known to those skilled in the art. For example, a pharmaceutical composition comprising a compound of the invention, or analog, derivative, or modification thereof, as described herein, is used to administer the appropriate compound to a subject.
Pharmaceutical compositions comprising the a compound of the invention are administered to a subject in need thereof by any number of routes and means including, but not limited to, topical, oral, buccal, intravenous, intramuscular, intra arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, vaginal, ophthalmic, pulmonary, or rectal means. The oral route is typically employed for most conditions requiring the compounds of the invention. Preference is given to intravenous injection or infusion for the acute treatments. For maintenance regimens, the oral or parenteral, e.g. intramuscular or subcutaneous, route is preferred.
In accordance with one embodiment, a composition is provided that comprises a compound of the invention, or a fragment, homolog, analog, derivative, or modification thereof, and albumin, more particularly, the composition comprises a compound of the present invention, a pharmaceutically acceptable carrier and 0.1-1.0% albumin.
Albumin functions as a buffer and improves the solubility of the compounds.. In one aspect, albumin is not added.
In one embodiment, the pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of between 1 ng/kg/day and 100 mg/kg/day. In another embodiment, the pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of between 1 ng/kg/day and 100 g/kg/day.
Pharmaceutically acceptable carriers which are useful include, but are not limited to, glycerol, water, saline, ethanol, and other pharmaceutically acceptable salt solutions such as phosphates and salts of organic acids. Examples of these and. other pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (1991, Mack Publication Co., New Jersey).
The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non toxic parenterally acceptable diluent or solvent, such as water or 1,3 butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides.
Compounds which are identified using any of the methods described herein may be formulated and administered to a subject for treatment of any of the diseases and disorders described herein. However, the use of compounds of the invention should not be construed to include only the diseases and disorder described herein. Preferably, the subject is a human.
The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi- dose unit.
Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, and mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs.
A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a "unit dose" is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one- third of such a dosage.
The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w/w) active ingredient.
In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents. Particularly contemplated additional agents include anti-emetics and scavengers such as cyanide and cyanate scavengers.
Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.
In some cases, the dosage forms to be used can be provided as slow or controlled-release of one or more active ingredients therein using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes, or microspheres or a combination thereof to provide the desired release profile in varying proportions. Suitable controlled-release formulations known to those of ordinary skill in the art, including those described herein, can be readily selected for use with the pharmaceutical compositions of the invention. Thus, single unit dosage forms suitable for oral administration, such as tablets, capsules, gelcaps, and caplets that are adapted for controlled-release are encompassed by the present invention.
Most controlled-release formulations are designed to initially release an amount of drug that promptly produces the desired therapeutic effect, and gradually and continually release of other amounts of drug to maintain this level of therapeutic effect over an extended period of time. In order to maintain this constant level of drug in the body, the drug must be released from the dosage form at a rate that will replace the amount of drug being metabolized and excreted from the body.
Controlled-release of an active ingredient can be stimulated by various inducers, for example pH, temperature, enzymes, water, or other physiological conditions or compounds.
Powdered and granular formulations of a pharmaceutical preparation of the invention may be prepared using known methods. Such formulations may be administered directly to a subject, used, for example, to form tablets, to fill capsules, or to prepare an aqueous or oily suspension or solution by addition of an aqueous or oily vehicle thereto. Each of these formulations may further comprise one or more of dispersing or wetting agent, a suspending agent, and a preservative. Additional excipients, such as fillers and sweetening, flavoring, or coloring agents, may also be included in these formulations.
As used herein, an "oily" liquid is one which comprises a carbon-containing liquid molecule and which exhibits a less polar character than water.
A formulation of a pharmaceutical composition of the invention suitable for oral administration may be prepared, packaged, or sold in the form of a discrete solid dose unit including, but not limited to, a tablet, a hard or soft capsule, a cachet, a troche, or a lozenge, each containing a predetermined amount of the active ingredient. Other formulations suitable for oral administration include, but are not limited to, a powdered or granular formulation, an aqueous or oily suspension, an aqueous or oily solution, a paste, a gel, a toothpaste, a mouthwash, a coating, an oral rinse, or an emulsion. The terms oral rinse and mouthwash are used interchangeably herein.
A tablet comprising the active ingredient may, for example, be made by compressing or molding the active ingredient, optionally with one or more additional ingredients. Compressed tablets may be prepared by compressing, in a suitable device, the active ingredient in a free flowing form such as a powder or granular preparation, optionally mixed with one or more of a binder, a lubricant, an excipient, a surface- active agent, and a dispersing agent. Molded tablets may be made by molding, in a suitable device, a mixture of the active ingredient, a pharmaceutically acceptable carrier, and at least sufficient liquid to moisten the mixture. Pharmaceutically acceptable excipients used in the manufacture of tablets include, but are not limited to, inert diluents, granulating and disintegrating agents, binding agents, and lubricating agents. Known dispersing agents include, but are not limited to, potato starch and sodium starch glycollate. Known surface-active agents include, but are not limited to, sodium lauryl sulphate. Known diluents include, but are not limited to, calcium carbonate, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate. Known granulating and disintegrating agents include, but are not limited to, corn starch and alginic acid. Known binding agents include, but are not limited to, gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, and hydroxypropyl methylcellulose. Known lubricating agents include, but are not limited to, magnesium stearate, stearic acid, silica, and talc.
Tablets may be non-coated or they may be coated using known methods to achieve delayed disintegration in the gastrointestinal tract of a subject, thereby providing sustained release and absorption of the active ingredient. By way of example, a material such as glyceryl monostearate or glyceryl distearate may be used to coat tablets. Further by way of example, tablets may be coated using methods described in U.S. Patents numbers 4,256,108; 4,160,452; and 4,265,874 to form osmotically- controlled release tablets. Tablets may further comprise a sweetening agent, a flavoring agent, a coloring agent, a preservative, or some combination of these in order to provide for pharmaceutically elegant and palatable preparation. Hard capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such hard capsules comprise the active ingredient, and may farther comprise additional ingredients including, for example, an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin. Soft gelatin capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such soft capsules comprise the active ingredient, which may be mixed with water or an oil medium such as peanut oil, liquid paraffin, or olive oil.
Liquid formulations of a pharmaceutical composition of the invention which are suitable for oral administration may be prepared, packaged, and sold either in liquid form or in the form of a dry product intended for reconstitution with water or another suitable vehicle prior to use.
Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (e.g., sterile pyrogen free water) prior to parenteral administration of the reconstituted composition.
A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets or lozenges made using conventional methods, and may, for example, 0.1 to 20% (w/w) active ingredient, the balance comprising an orally dissolvable or degradable composition and, optionally, one or more of the additional ingredients described herein. Alternately, formulations suitable for buccal administration may comprise a powder or an aerosolized or atomized solution or suspension comprising the active ingredient. Such powdered, aerosolized, or aerosolized formulations, when dispersed, preferably have an average particle or droplet size in the range from about 0.1 to about 200 nanometers, and may further comprise one or more of the additional ingredients described herein.
As used herein, "additional ingredients" include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials. See Genaro, ed., 1985, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, which is incorporated herein by reference.
The compound can be administered to a subject as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type, and age of the subject, etc.
The method of the invention includes a kit comprising a polypeptide, compound, or antibody of the invention and an instructional material which describes administering the polypeptide, compound, or antibody or a composition comprising the inhibitor to a cell or an animal. This should be construed to include other embodiments of kits that are known to those skilled in the art, such as a kit comprising a (preferably sterile) solvent suitable for dissolving or suspending the composition of the invention prior to administering the compound to a cell or an animal. Preferably, the animal is a human.
The pharmaceutical pack or kit may comprise one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. These pharmaceuticals can be packaged in a variety of containers, e.g., vials, tubes, microliter well plates, bottles, and the like. Other reagents can be included in separate containers and provided with the kit; e.g., positive control samples, negative control samples, buffers, cell culture media, etc.
Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described herein.
One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof and, accordingly, reference should be made to the appended claims, rather than to the foregoing specification, as indicating the scope of the invention.
Examples
The invention is now described with reference to the following Examples and Embodiments. Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the present invention and practice the claimed methods. The following working examples therefore, are provided for the purpose of illustration only and specifically point out some embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure. Therefore, the examples should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
Example 1- Materials
AU chemicals were reagent grade or better and unless otherwise specified were purchased from Sigma or Fisher. Reagents and buffers for SDS-PAGE including the molecular weight Precision standards were from Bio-Rad. Protease inhibitors aprotinin, pefabloc, and pepstatin were from Roche/Boehringer-Mannheim Biochemicals; rabbit polyclonal IgG directed against a 20 ammo-terminal peptide from human CAVl was from Santa Cruz. This 20 amino acid domain is 84 % identical to the orthologous mouse CAVl domain. Horseradish peroxidase (HRP) conjugated secondary antibodies from Sigma were visualized with either the NEN Lightning or KPL chemiluminescent reagents according to manufacturer's instructions. TES 101, a monoclonal antibody against the testicular germ cell-specific antigen TEXlOl [39] and polyclonal antibody against Hexokinase I (HKl) were generously provided by Dr. Yoshihiko Araki (Yamagata University, Yamagata, Japan) and Dr. Wilson (Michigan State University) respectively. Xomat-Blue and MS Kodak films were from NEN Life Sciences. Fluorescent DiICl 6 lipid analog probe that targets liquid-ordered plasma membrane domains [37] was from Molecular Probes. The mounting medium, Vectashield and the antigen unmasking solution were purchased from Vector Laboratories.
Preparation of Mouse Sperm. Cauda epididymal sperm were collected from retired breeder males (Charles River Labs-strain) sacrificed in accordance with IACUC guidelines. Experimental protocols were approved by the University of Virginia Animal Care Committee. The cauda epididymis from each animal was placed in 1 ml of 37°C modified Krebs-Ringer medium (Whitten's-HEPES buffered) (WH) [40] containing 100 mM NaCl, 4.7 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4, 5.5 mM glucose, 1 mM pyruvic acid, 4.8 mM L(+)-lactic acid, hemicalcium salt in 20 mM HEPES, pH 7.3 (All reagents were Sigma ultra pure/cell culture tested). This WH medium, prepared in the absence of BSA and NaHCO3, does not support capacitation. Sperm released into the media during a 10 minute time period (between 5 and 8 million sperm per epididymis) were counted and collected by centrifugation at 800 x g for 10 minutes at room temperature (RT)(~24°C). For immunofluorescence and experiments involving the collection of non-capacitated and capacitated populations, the centrifuged sperm were resuspended to a final concentration of 2 x 107 cells/ml. Aliquots of 500 μl were placed in a round bottom borosilicate 4 ml glass tube and overlaid with either 1.5 ml of 37°C WH (non-capacitating conditions-NON), or in WH supplemented with 24 mM NaHCO3 and 3 mg/ml of fatty-acid free BSA (Sigma #A- 0281) (capacitating conditions-CAP). The total incubation time for all conditions was one hour at 37°C in a 5% CO2/ 95% O2 incubator. Sperm were then prepared for lysis in sample buffer (see below) and subsequent Western blot analysis, or for immunofluorescent localization.
SDS-PAGE and Western blotting. After incubation, sperm were concentrated by centrifugation, resuspended in buffer containing 50 mM Tris-HCl pH 7.3, 150 mM NaCl, ImM EDTA5 1 mM sodium ortho vanadate, 1 mMNaF and 10 μg/ml each of leupeptin, pepstatin, aprotinin, benzimidine and 3 μg/ml TLCK (TEN), vortexed and placed on ice for 5 minutes. To study HMW caveolin complexes sperm samples were treated for 30 minutes at 270C in a standard Laemmli pH 6.8 reducing buffer or such HMW complexes were reduced by boiling for 5 minutes in pH 10 buffer as described [28, 29]. For SDS-PAGE, a sperm equivalent of 200,000 sperm was extracted in sample buffer as previously described [19] and loaded on a 4-16% linear gradient gel with a 3% stacking gel, to facilitate the entry of possible HMW caveolin oligomers. Gels were silver-stained [41] or electroblotted to
PVDF membrane (Millipore). Membranes were blocked with 4% BSA in Tris-Buffered Saline, pH 7.3, 0.1% Tween 20 (TBST) for one hour at RT. AU primary and secondary antibody incubations were in TBST plus 4% BSA. All membrane washes were at RT for 15 minutes with TBST. After incubation for 1 hour with a 1:1000 dilution of primary antibody, the PVDF membranes were washed 4 times, and then incubated at RT for one hour with HRP-conjugated secondary antibodies at a 1:10000 dilution. As control for anti CAVl, this antibody was pre-absorbed with 1.5 μg/ml of the antigenic peptide. The membrane was washed as before, rinsed briefly with water and HRP activity visualized with chemiluminescence. Western blots using antibodies directed against TEXlOl were performed on samples electrophoresed under non-reducing conditions (in the absence of β- mercaptoethanol) .
Isolation of Light Buoyant Density DRM fractions.
Cauda epididymal sperm were collected in WH medium, centrifuged at 150 x g for 5 minutes to clear the sperm suspension. The sperm containing supernatant was removed and centrifuged at 700 x g for 10 minutes. The sperm pellet was divided into two aliquots, each containing 80 million sperm in a total of 2 ml WH medium. One aliquot was incubated in WH (NON) and the other in WH media containing 3 mg/ml of BSA and 24 mM NaHCO3 (CAP). After 1 h incubation, the sperm were collected by centrifugation at 700 x g for 10 minutes and the pellet resuspended in 400 μl of TEN buffer containing 0.5% TXlOO. The pellet was gently Dounce homogenized, sonicated with 5 brief bursts in a
Sonifier Cell Disrupter W-350 set at output 3 and 50% duty cycle. Samples were kept on ice and foaming was avoided. The sperm lysates were rotated at 4°C for 45 minutes to liberate the DRM fractions operationally defined as the lipid raft domains. Lysates were adjusted to 40% sucrose with the addition of 80% sucrose in TEN. To generate a discontinuous sucrose gradient the sperm lysate was placed in the bottom of a 2 ml Beckman centrifuge tube and gently overlaid with 800 μl 30% sucrose in TEN3 followed by 400 μl 5 % sucrose in TEN. The same procedure was applied for all raft fraction isolations. The samples were then centrifuged at 200,000 x g for 18 h in a TLS55 swinging bucket rotor in a Beckman Optima™ -TLX ultracentrifuge. The visible, opaque light buoyant density DRM fractions, which float up the sucrose gradient, were apparent as a visible light scattering band following centrifugation. Nine 200 μl fractions were carefully collected from the top to the bottom of the gradient and the position of the visible fractions was noted.
Fractions were prepared for SDS-PAGE with pH 6.8 SDS-reducing sample buffer and treated at 27°C for 30 minutes to preserve the HMW caveolin complexes as previously described [28, 29]. Fractions resolved on a 4-16% linear gradient SDS-PAGE gel with a 3 % stacking gel were silver-stained or prepared for Western blotting as previously described. To obtain peptide sequences from the visible light buoyant density DRM fraction, proteins that were silver stained from this fraction were excised from the gel and submitted for MS/MS. MS/MS analysis of raft proteins.
The proteins visualized by silver stain in the visible RAFT fraction were numbered and excised from the gel. Numbered bands were then submitted to the W.M. Keck Biomedical Mass Spectrometry Laboratory facility from the University of Virginia for peptide sequencing. Samples were prepared as described before [42]. Detection of liquid-ordered domains using DiICl 6 probe.
Mouse cauda epididymal sperm were treated under non-capacitating (NON) and capacitating (CAP) conditions as described above. DiIC 16 was first dissolved in 100% ethanol at 2 mg/ml and vortexed vigorously for 5 min to ensure complete mixing of the lipid. Just prior to sperm labeling, for either fixed or living sperm, the probe was diluted in PBS to a final working concentration of 25 μg/ml, vortexed vigorously, and added to the sperm for 15 minutes at 37°C. To label fixed sperm, the sperm first were fixed in solution with freshly prepared 4% parafbmaldehyde in PBS, pH 7.3 for 15 minutes at 37°C, and then spotted directly onto a microscope slide and subsequently labeled with DiICl 6. After incubation for 1 hour in the appropriate medium, live sperm were labeled for 15 minutes at 37° C with the probe in WH medium, briefly washed with PBS using gentle centrifugation and then spotted onto a slide, followed by fixation for 15 minutes at 370C in paraformaldehyde/PBS. Labeled sperm were then washed 3 times with PBS at RT. The slides were mounted with Vectashield® . Fluorescence was detected as described above. The Alexa-fluor 568 labeled lipid analog probe DiICl 6 emits fluorescence when excited with a wavelength of 568 nM. Photos were taken with a digital camera as described [43].
Results
High molecular weight caveolin oligomers are present in mouse sperm.
HMW caveolin oligomers ranging in size from 200-600 KDa have been proposed as the active scaffolding framework for signal transduction proteins [44] and have been demonstrated to be stabilized by cholesterol and/or long chain fatty acylation [45] .
Although CAVl has been reported in mammalian sperm [34, 35], these works have not shown the presence of HMW oligomers. As disclosed herein, HMW caveolin complexes were preserved as described above and three distinct immunoreactive bands were detected in non-capacitated sperm (Fig. 1 A). These bands migrated as a 24 kDa monomer, a 50 kDa dimer (forms noted previously in sperm) [34] and the novel observation of HMW caveolin complexes migrating at molecular weight greater than 250 kDa.
Two lines of evidence support the authenticity of these HMW CAVl -containing oligomers. First, they were not detected when the antibody against CAVl was pre- incubated with an excess of the N-20 immunogenic CAVl peptide (1 μg/ml). Second, HMW caveolin oligomers are proposed to be linked by thioester bonds that are reduced only under basic conditions (pH 10) [28-30]. When protein extracts were boiled for 5 minutes at pH 10 to reduce the thioester bonds, the HMW caveolin complexes were lost (Fig. IB, right panel) indicating that the HMW oligomers in sperm behave similarly to caveolin oligomers previously reported [28-30]. More importantly, the pattern of immunoreactive CAVl proteins from capacitated sperm differed from CAVl proteins from non-capacitated sperm. In capacitated sperm the HMW caveolin oligomers were virtually absent while the 24 kDa monomer was reduced (Fig. IB, left panel). Little or no change was present in the 50 kDa dimer. This is the first evidence documenting capacitation- associated reduction in HMW caveolin oligomers. Initially, to evaluate whether caveolin monomers or oligomers associate with sperm membrane fractions, sequential centrifugation of sperm extracts obtained in the presence of 1 % Triton X 100 (TXlOO) was performed. Western blot analysis of the subcellular fractions was performed using antibodies against CAVl (Fig. 1C). Although the 24 kDa CAVl monomer was partially extracted with TXlOO, the HMW oligomers remained associated with the pellet obtained after ultracentrifdgation (PlOO) indicating that the HMW caveolin oligomers are present in detergent insoluble domains.
Proteins associated with the DRM fraction were reduced after capacitation. The presence of CAVl oligomers and monomers in light buoyant density DRM fractions (Fig. 1C) was consistent with previous reports suggesting the existence of lipid raft microdomains in mouse sperm [46]. Because capacitation is associated with the release of cholesterol from the sperm plasma membrane, the fate of sperm DRM fractions during capacitation was further investigated (Fig. 2). DRM fractions were prepared from non-capacitated and capacitated mouse sperm as described in Methods. In non-capacitated sperm a visible light scattering band was observed in the sucrose gradient just below the 5/30 % sucrose interface. This light buoyant density visible band was recovered as fraction # 4 (* in Fig. 2, lane 4, NON, left upper panel). The visible light buoyant density fraction from non-capacitated sperm contained multiple silver stained proteins ranging from 25 to 125 kDa. In contrast, in capacitated sperm the fraction just below the 5/30% interface, fraction # 4, did not contain a visible light scattering band and showed a significant decrease in total protein as determined by silver stain analysis (Fig. 2 A, lane 4, CAP, left lower panel).
When the same fractions were analyzed for the presence of CAVl by Western blot, fraction # 4 of non-capacitated sperm contained the HMW complexes as well as the 24 kDa caveolin monomer but not the 50 kDa dimer (Fig. 2, lane 4, right upper panel, NON). In contrast, the CAVl HMW oligomer was not detected in fraction # 4 from capacitated sperm and the 24 kDa caveolin monomer was significantly reduced (Fig 2, lane 4, right left panel, CAP). Thus, the process of in vitro capacitation alters the protein composition of sperm DRM and supports the hypothesis that the protein composition of lipid rafts is altered during capacitation.
Identification of DRM-associated proteins from sperm by MS/MS To further analyze the hypothesis that sperm capacitation perturbs lipid rafts, proteins present in the light buoyant density DRM fractions of non-capacitated mouse sperm (Fig. 2, lane 4, upper left panel, NON) were cut and processed for MS/MS. Using this methodology, it was possible to identify more than 25 DRM-associated proteins (Fig. 3, Table 1). The proteins include enzymes implicated in glucose transport and metabolism, bicarbonate metabolism and putative cell receptors. The majority of the identified proteins was membrane-associated and included transmembrane and GPI-linked proteins. A subset of these proteins appears to be testes specific as determined by a bioinformatic analysis of tissue distribution of ESTs. Interestingly, some of the proteins (e.g. pantophysin, vacuolar ATPase D, Carbonic Anhydrase IV) found using this approach were known but never identified in sperm while others (e.g., proteins in band 5 and 10) are present in the database only as hypothetical proteins (e.g., Hypothetical polycythemia Rubra Vera-like # 1 and # 2, Table I).
Table I. Proteins identified by MS/MS with their respective NCBI #. Abbreviations between parentheses refer to UniGene nomenclature.
Band # Protein Ided from MSPA NCBI#-Protein
I Hexokinase I (HKl) AAH72628 2 Mouse Keratin Complex 2 (KRT2) NPJB2499
5 Izumo BAD91011
5 Similar to PH-20/Hyal5 (4933439A12RIK) BAC55071
6 Mouse Serum Albumin (ALBl) CAA09617
6 Seminal Vesicle Secretion 5 (SVS5) NP_033327 6 Similar to CGI-49 (C330023F1 IRIK) NP_848768
7 PH-20/Sperm Adhesion Molecule (SPAMl) AAP49832 7,8 Testis Serine Protease 1 (TESPl) NP_033381
7,8 Testis Specific TESlOlRP (TEXlOl) NP_064365
7,8 GLUT3/Solute Carrier Family 2 (SLC2A3) NP_035531 8 L-Lactate Dehydrogenase A-like (LDHAL6B) NP_780558
8 SCP/TPX-1/Crisp-Like #1 (492150801 IRIK) NP_080499 8 Testis Serine Protease 2 (TESSP2) BAB78735
8 Vacuolar ATPase D (ATP6V0D 1) NPJB8505
8,9, 10 Carbonic Anhydrase IV (CAR4) NP_031633 10 Pantophysin Isoform 1 (SYPl) NP_038663
10,11 Polycythemia Rubra Vera-like # 1 (4933400F01RIK) NP_877586
I 1 Polycythemia Rubra Vera-like # 2 (BC049730) XP_355991 11,12, 13 Basigin (BSG) NPJB3898
11 Serine Protease-Like 1 (1700036D21RIK) BAB63919 12 SCP/TPX-l/Crisp-Like # 2 (170001 lE04Rik) BAB24280
13 Ig Light Chain (IGK-V8) AAA51141
13 Ig Gamma2b (IGH-3) AAB59659
13 Cysteine-Rich Secretory Protein 1 (CRISPl) NP_033768
13 Major Urinary Protein 1 (MUPl) NP_112465 13 Caltrin/seminal Vesicle Secretion 7 (SVS7) NP 064660 Proteins associated with the light buoyant density DRM fractions redistribute in sucrose gradients during capacitation.
As noted above, silver staining of sucrose gradient fractions indicated that during mouse sperm capacitation in vitro the protein content decreases in the light buoyant density DRM fraction. To further investigate changes in specific proteins with capacitation, two proteins, TEXlOl and HKl, identified by MS/MS were analyzed along the sucrose gradient by Western blot (Fig. 4). Both proteins were confirmed to be present in the light buoyant density DRM fractions isolated from non-capacitated sperm. However, while TEXlOl was exclusively located in the light buoyant density fractions (Fig. 4, lanes 4 & 5, left panel, NON), HKl was found in the light density as well as in heavier fractions (Fig. 4, left upper panel, NON). After capacitation, TEXlOl appeared in heavier fractions of the sucrose gradient while HKl was diminished in the light buoyant density fraction and appeared in the heavier fractions (Fig. 4, right panels) confirming results presented in Fig. 2. Thus, in vitro capacitation changes the distribution of selected proteins contained in light buoyant density DRM fractions suggesting redistribution of raft proteins may occur as a result of cholesterol removal.
Sperm liquid-ordered domains are reduced during capacitation. Studies of model membranes containing cholesterol and other lipid components have indicated that the lipid properties in DRMs purified by sucrose gradients are similar to liquid-ordered domains, which are characterized by tightly packed hydrocarbon tails.
Cholesterol is thought to contribute to the tight packing of lipids in liquid-ordered domains by filling interstitial spaces between lipid molecules, and the formation of liquid-ordered domains is seen only within certain ranges of cholesterol concentration. DiIC 16 is a lipid analog probe that has been shown to partition into relatively ordered regions of membrane in living cells with properties similar to DRMs [37]. Since a significant reduction of the proteins present in DRMs purified by discontinuous sucrose gradient had been noted, DiIC 16 binding to sperm incubated under non-capacitating or capacitating conditions was undertaken to monitor changes in liquid-ordered domains. Non-capacitated sperm exhibited a strong DiIC 16 labeling in the flagellum mid-piece and lighter staining of the head as well as of other tail structures (Fig. 5, NON). When the sperm were incubated under capacitating conditions a significant reduction in DiIC 16 staining was observed hi both live and fixed sperm (Fig. 5, CAP). These observations suggest that during capacitation, the sperm membrane undergoes reorganization with reduction of liquid- ordered domains. These data are consistent with the capacitation-associated increase in membrane fluidity measured by fluorescence recovery after photobleaching [47]. Example 1 Discussion-
One current representation using model membranes envisions lipid rafts as transient phase separations conferring ordered microdomains upon an otherwise fluid lipid bilayer. From this biophysical model, it has been proposed that biological membranes contain a minimum of two lipid phases: a typically, but not always, more abundant "liquid- disordered" phase and an usually less abundant "liquid-ordered phase" [48, 49].
The distribution of liquid-ordered versus liquid-disordered is dependent on the type and the state of each cell. Also proposed is that lateral diffusion of proteins in liquid- ordered domains is restricted and hence function with localized and discrete effects within the field of the plasma membrane. Without wishing to be bound by any particular theory, the disclosure provided herein examined the hypotheses that 1) capacitation-associated cholesterol efflux alters the biophysical properties of the sperm plasma membrane by reducing the extent of lipid raft domains and 2) that dissociation of lipid raft domains during capacitation alters resident sperm raft proteins. These steps may represent early events of capacitation in which cholesterol removal from the sperm plasma membrane initiates signaling pathways.
CAVl has been previously reported in lipid rafts [50]; an important observation of the present study was that CAVl in mouse sperm forms HMW oligomers. In somatic cells, the presence of similar caveolin oligomers has been linked to caveolin's distribution in cholesterol rich domains in the plasma membrane [28, 29]. In sperm, these HMW CAVl- containing complexes are significantly decreased after one hour of in vitro capacitation, an observation consistent with previous reports of cholesterol release during the capacitation process [11, 12]. Accompanying the reduction in CAVl oligomers, the overall content of proteins from the lipid raft light buoyant density DRM fraction from sucrose gradients was reduced in capacitated sperm. In addition, binding of DiIC 16, a lipid probe shown to partition into relatively liquid-ordered regions of membrane [37], was significantly decreased in both head and tail regions of capacitated sperm when compared with a non- capacitated population. These results are consistent with recent reports in boar [51] and human sperm [38] showing evidences that cholesterol efflux alters lipid raft stability and distribution during capacitation. Together these results indicate that in vitro capacitation disrupts lipid raft domains and causes a shift in the overall membrane fluidity of the sperm plasma membrane. Because raft membrane domains typically are considered to be of small diameter [52], individual rafts will contain a limited array of signaling components, an organization that may be important for maintaining the "off' state of certain signaling pathways [53]. Disruption of lipid rafts in sperm may induce the interaction of several raft resident proteins to initiate signaling pathways associated with the capacitation process. It is believed that not every sperm within a population capacitates in vitro, as determined from chlortetracycline fluorescence and the ZP-induced acrosome reaction [19]. Following these criteria, approximately 50 % of sperm are capacitated after 1.5 h. incubation in a complete media. This number is similar to the one obtained by single cell analysis of the capacitation-associated hyperpolarization [54]. In this respect, whether the whole sperm population or only a fraction undergoes disruption of lipid rafts is still an open question.
Proteomic analysis identified more than 25 resident raft proteins from non- capacitated mouse sperm. The majority are membrane-associated, either as transmembrane, integral membrane, GPI-linked, or acyl chain recruited proteins. Because of the methodology used, proteins in the light buoyant DRM could in theory belong to any sperm membrane fraction and not only to the plasma membrane. However, analysis of
Table I does not show mitochondria or nuclear protein markers, suggesting that presence of mitochondrial or nuclear membranes in the DRM preparation is unlikely. At present, the possibility that some of the identified proteins localized to the inner or outer acrosomal membranes cannot be discarded. In terms of enzymatic activity and function, these proteins fall into several categories. The first group includes proteins that function in metabolic processes. Several proteins associated with glucose metabolism were found in lipid raft fractions; among them HKl5 a testis specific lactate dehydrogenase, the facilitated glucose transporter Glut3 and pantophysin. This last protein is believed to form an active energy transport complex for glucose with Glut3 [55]. The present finding of HKl in the raft fraction agrees with previous results demonstrating that HKl in sperm is tightly associated with membrane fractions [56]. The presence of metabolic enzymes in sperm lipid rafts suggests that cholesterol removal mediates some of the changes in energy metabolism observed during capacitation and warrants further investigation.
Carbonic Anhydrase IV (CAR4), a GPI-anchored carbonic anhydrase, has been linked in other systems to HCO3- transport [57]. Recent work in human embryonic kidney (HEK293) cells showed a direct interaction between CAR4 and the Na+/HCO3 cotransporter (NBC). This interaction appears to be necessary for full NBC activity [58]. In context, our recent finding of an electrogenic NBC in mouse sperm [59], added to the present identification of CAR4 in mouse sperm lipid raft, suggest that similar mechanisms might play a role in the transmembrane movement of HCO3- anions into sperm. Three other groups of proteins identified are novel members of the urokinase plasminogen activator receptor PLAU/Polycythemia Rubra Vera 1 family, proteins belonging to the cysteine-rich inhibitory secretory protein (CRISP) family and members of the Immunoglobulin (Ig) superfamily. Members of the PLAU family are receptors that fulfill a diverse set of functions ranging from proteolytic inhibition to interaction with signaling complexes. Members of the CRISP protein family include Tpx 1 and a series of snake venoms recently described [60]. Although very little is known about the function of this protein family in sperm, one of its members, CRISPl (also known as DE), has been proposed to mediate sperm-egg fusion [61]. Finally, recent attention has been given to the Ig superfamily in sperm; in particular to IZUMO, a protein recently shown to be required for sperm to fuse with eggs [62]. It might be speculated that the capacitation-associated changes in sperm lipid rafts plays a role in positioning IZUMO for fusion events during fertilization.
Several of the proteins identified herein were not described before and in many cases their sequences have been theoretically composed by analysis of genomic sequences. Thus, little is known about their tissue distribution; to initiate the investigation of tissue expression of the sperm lipid raft proteins, their sequences were blasted to EST databases and both mouse and human ESTs were evaluated. The EST analysis indicates that several of the sperm raft proteins have a testis specific expression both in the mouse and in the human. Among these proteins are TEXlOl, IZUMO, the hypothetical Polycythemia Rubra Vera-like proteins, serine proteases and some of the members of the CRISP protein family. Identification of proteins that have a restricted testis expression suggests functions related exclusively with this tissue. In some cases, this unique distribution might make them suitable targets for novel contraceptive strategies.
In summary, in this work, we have identified over 25 lipid-raft associated proteins in sperm and showed that these proteins change their migration properties in sucrose gradients when sperm are incubated under capacitating conditions. Although the function of these proteins in sperm is not known, because of the established function of cholesterol efflux in sperm capacitation, it is tempting to speculate that proteins present in raft microdomains might play a role in the regulation of sperm signaling. Understanding how cholesterol efflux affects the activity of lipid raft resident proteins will improve our knowledge of capacitation in mammalian sperm.
Example 2- Further Analysis of BandlO
Microsequencing of a mouse sperm detergent-resistant light buoyant density membrane fraction [lipid raft fraction], revealed a novel protein, which was designated sPRVl-2 (also called BandlO herein) based on 30% similarity to human polycythemia rubra vera 1 (PRVl), a cell surface receptor highly expressed in granulocytes from patients with polycythemia rubra. In amino acids, sPRVl-2 was 28% identical to a testicular germ cell-specific antigen, TexlOl, a lipid raft associated glycoprotein. Bioinformatics analysis then revealed PRVl, TexlOl and sPRVl-2 all belong to the gene clusters in mouse and human genome. Five mouse PRVl similar genes are located within 200 kb of mouse chromosome 7A2, while three human PRVl similar genes (with one pseudo gene) are located within 500 kb of human chromosome 19ql3.2 (Figure 8). Cloning of human and mouse sPRVl-2 revealed proteins about 68% identical and 80% similar. Human sPRVl-2 mRNA was highly expressed in testis and at a low level in lymph node. Northern analysis indicated sPRVl-2 has two main spliced forms, sPRVl-2A and sPRVl-2B, approximately 2.0 kb and 1.0 kb respectively (Figure 9). In human testis, the major transcript of sPRVl-2 is 2.0 kb, however, RT-PCR only revealed the 1.0 kb transcript in human lymph node. Human sPRVl-2A and sPRVl-2B genes encode proteins of 246, and 211 amino acids respectively, which differ at the N-terminus following an identical putative signal peptide. It also appears that sPRVl-2 can form multimers (Figure 10). hsPRVl-2 is localized to sperm, including the entire tail and also to a lesser extent in the head and equatorial segment (see Figure 11). In addition, both proteins have two putative N-glycosylation sites, and 13 or 14 cysteines representing the canonical profile of the cysteine rich domain in the uPAR/Ly-6/Snake neurotoxin family (see Figure 12).
When live human sperm were treated with PIPLC, sPRVl-2 isoforms were detected in the supernatants, demonstrating that they are GPI-anchored proteins (see Figure 13 and Table 2). The E. coli expressed recombinant human sPRVl-2A was always cleaved into two parts, the supersensitive site of sPRVl-2 to the serine proteases was mapped by Edman sequencing. Antiserum against sPRVl-2 stained the whole tail of human spermatozoa by immunofluorescence, and localized very weakly on the sperm head and the equatorial segment. After in-vitro capacitation, the localization pattern on sperm did not change significantly.
Table 2-
GPI site predicted by DGPI
Η-term Signal :
; there is a N-term signal (l. . 16 in violet)
, maximal soore=S. 87 jC-term Hydrophobic! ty profile : hydrophobe length (low-pass filter)=18 I hydrophile length (low-pass filter) =7 ; hydrophobe length (median filter) =11 J hydrophile length (median filter) =15 \ average hydrophobe length = 14. 5 (in blue) bata from' average hydrophile length = 11. 0 ;DGPI
Cleavage site (ω) :
There' s a GPI-anchor near 224 (7 aa after hydrophobic tail)
There' s a potential cleavage site at 227 (score=0. 24939999) detected by ω, co+2 rule.
There' s a potential cleavage site at 224 (score=0. 64800006) detected by CD, ω+2 rule.
The best cleavage site is 224
Conclusion :
This protein is GPI~anchored (signal, hydrophobic & hydrophilic tail present) . There is a potential cleavage site at 224 (ω, ω+1, ω+2 in red)
Mouse sperm detergent-resistant buoyant density membrane fraction. Two novel proteins belonging to the uPAR/Ly-6/Snake receptor family were detected from bandl 0,11 in this putative mouse sperm raft domain. They were designated as sPRVl-1, sPRVl-2 based on 30% similarity to human polycythemia rubra vera 1 (PRVl), which is a hematopoietic cell surface receptor, highly expressed in granulocytes from patients with polycythemia rubra vera (see Figure 3).
Five murine PRVl genes with varying amounts of sequence identity are located within 200 kb of mouse chromosome 7A2. While three homologous human PRVl similar genes (with one pseudo gene) with varying amounts of sequence identity are located within 500 kb of human chromosome 19ql3.2. The broken lines show the homologous genes and the arrows indicate their direction of transcription. TexlOl and PRVl are the names from the GenBank assignment. msPRVl-1, msPRVl-2, msPRVl- 3, mPRVl, hsPRVl-2, and hPRVl-pseudo are designated in this study. The letters "m" and "h" in these names indicate either mouse or human, respectively. The following study is focused on sPRVl-2, which has 68% identity in human and mouse.
Figure 9 illustrates the results of Northern analysis and RNA dot blot analysis of human sPRVl-2 expression. Northern analysis of human sPRVl-2 expression in 8 human tissues. HsPRVl-2 was found only expressed in testis, and two major transcripts, hsPRVl -2A, hsPRVl -2B, approximately 2.0 kb and 1.0 kb were detected (see Figure 9A). Figure 9B demonstrates the results of an RNA dot blot analysis of 76 human tissues. HsPRVl -2 expression was detected in testis and lymph node. Figure 9C depicts the results of a northern analysis of human sPRVl-2 expression in human testis and lymph node. Two major transcripts were detected in testis but not in lymph node or ovary. RT-PCR (data not shown) only revealed a small amount of 1.0 kb transcript in human lymph node.
In situ hybridization was also performed to localize sPRVl-2 expression in mouse testis, using radiolabeled mouse sPRVl-2 cRNA. sPRVl-2 transcripts were expressed mainly in the post-meiotic spermatids, while labeling on primary spermatocytes was not much greater than background labeling (not shown).
Polyclonal antisera recognize sPRVl-2 proteins in human and mouse sperm Next it was found that polyclonal could be prepared that recognize PRV 1-2 proteins in human and mouse sperm. The western blot analyses demonstrate that anti- hsPRVl-2 rat serum (post) and preimmune serum (pre) detect human and mouse proteins (see Figure 10). At least four bands were detected in the human sperm protein, and the molecular weights suggest the existence of multimers of hsPRV 1 -2. Immunofluorescence localization of hsPRVl-2 inhuman sperm
Methods- Experiments were performed using capacitated and non-capacitated human sperm. In the first panel of four micrographs (Figures 1 IA, B, C, and D), immunofluorescent staining of capacitated (Fig. 1 IA) and non-capacitated human sperm (Fig. HC) was performed using anti-hsPRVl-2 rat serum. The corresponding phase contrast images (1 IB and 1 ID) are adjacent to the immunofluorescent images. In the second panel of four micrographs, immunofluorescent staining of capacitated (Fig. 1 IE) and non-capacitated (Fig. 1 IG) human sperm was performed using preimmune serum from the same rat. The corresponding phase contrast images (HF and 1 IH) are adjacent to the immunofluorescent images.
Results- It was found that hsPRVl-2 was localized to the entire tail of human spermatozoa and localized very weakly on the sperm head and the equatorial segment. After in-vitro capacitation, the localization pattern on the human sperm did not change significantly (See Figure 11). Possible post-translation modifications of human sPRVl-2A.
Human sPRVl-2A has 14 cysteine residues representing the canonical profile of the cysteine rich domain in the uPAR/Ly-6/Snake neurotoxin family. Additionally, a 26 amino acid signal peptide is located at the N-terminus of hsPRVl-2A. A putative transmembrane domain is located from amino acid residue positions 88 to 107. Two putative glycosylation sites are located at amino acid residue positions 117 and 183.
HsPRVl -2A is a predicted GPI anchored protein, and amino acid residue position 224 is the putative cleavage site for this GPI-anchored protein (see below). Recombinant human sPRVl-2A was expressed in E. coli and was then auto-cleaved into two parts. Edman sequencing defined the cleavage site (indicated above) which was the potential cleavage site to several serine proteinases, implying the super sensitivity of sPRVl-2 to proteolysis.
The schematic diagram of Figure 12 indicates the signal peptide domain, a uPAR/Ly6 module, putative glycosylation and cleavage sites, and a super-sensitive site for serine proteases. Human sPRVl-2 is a GPI anchored protein.
Detection of sPRVl -2 isoforms in the supernatants from live human sperm treated with PIPLC-
A and B, 2-D gel electrophoresis followed by Western blotting of the supefnatants from human sperm treated without PIPLC (Fig. 13A) or with PIPLC (Fig. 13B) using anti-sPRVl-2. Figure 13C represents a 2-D blot of human sperm proteins probed with anti-sPRVl -2 antibody. When live human sperm were treated with PIPLC, sPRVl-2 isoforms were detected in the supernatants, demonstrating that they are GPI- anchored proteins.
Sperm PRVl -2 Transcripts
As discussed above there appears to be two major transcripts of sPRVl-2 (see Figure 14 for a schematic comparison of the density of EST5 the 6 exons of human sPRVl-2, and transcripts A and B of sPRVl-2). The two transcripts are referred to as A and B herein and are as follows:
Transcript A of HSPRVl -2 (SEQ ID NO:5) (including corresponding amino acid sequence): hsPRVl-2A 1 cttgtctttgtgtcggttgtgattttcctaatctctgattttccttttctctcggacgct hsPRVl-2 A 61 ctccctcttcggacccattttctcccgtgcttcatgccctgatagcctggccccttcccg hsPRVl-2 A 121 gcttccttcgctaccggggacgcctctagtttttctgaatttctggctggctccaccctc hsPRVl-2 A 181 cgcgttcatcttcctcaagagttcgcccctctgggggctcctctgtgtaatcgtcgcctt hsPRVl-2A 241 ctctgggtatttctgtgaactccgtctcacaccatcccgccatcttctctgccttggccc hsPRVl-2A 301 cttttctctgtacagccagctctgtgtccttttcttctccccctctaaaatcgactcctc hsPRVl-2 A 361 ttctccctgagagccccacctttgtgccccactcctcattttcctacgcctccctctctc hsPRVl-2A 421 tgctggtcctctctctccctgcaaggttccattccatcaatttgtttgtcttttgtaggg hsPRVl-2A 481 gtggcatcccctctgactactgctccatccLiαLLLLLLLLLUtLLLLLLlUlgctt hsPRVl-2A 541 gaggatttcacttcaatcttttctggttgcgtctccacttgtactcagcttgttaggtcc hsPRVl-2 A 601 aggtccagttgttctgcatctgaggctggcgtgtgctgtcttctctgattggcctaatct hsPRVl-2A 661 ccctcacccccgtgagatctgttgtcagccttcgtttctctttcctgtgtcccagctttt hsPRVl-2A 721 ctgcgggtcttggcacctttcttggccacagatttctgggttacagagcatgtgtgtctg hsPRVl-2A 781 aggcattgcaggcagaaaagggtggccgacgtgacctctagctggactgctgggcagggg hsPRVl-2A 841 agctgtcctagataaaattggaaagaaacagtgacccagagacaggtggacaaagaattc hsPRVl-2 A 901 ggggactgatgggaactgagcttgggatccagactgaaactgattccagactgacctcta hsPRVl-2A 961 gcacccaggacccagacacagggccatgggaccccagcatttgagacttgtgcagctgtt
M G P Q H L R L V Q L F hsPRVl-2 A 1021 ctgccttctaggggccatccccactctgcctcgggctggagctcttttgtgctatgaagc
C L L G A I P T L P R A G A L L C Y E A . hsPRVl-2A 1081 aacagcctcaagattcagagctgttgctttccataactggaagtggcttctgatgaggaa
T A S RF RAV A F H N W K W L L M RN hsPRVl-2A 1141 catggtgtgtaagctgcaagagggctgcgaggagacgctagtgttcattgagacagggac
M V C K L Q E G C E E T L V F I E T G T hsPRVl-2 A 1201 tgcaaggggagttgtgggctttaaaggctgcagctcgtcttcgtcttaccctgcgcaaat A R G V V G F K G C S S S S S Y P A Q I hsPRVl-2A 1261 ctcctaccttgtttccccacccggagtgtccattgcctcctacagtcgcgtctgccggtc
S Y L V S P P G V S I A S Y S R V C R S hsPRVl-2 A 1321 ttatctctgcaacaacctcaccaatttggagccttttgtgaaactcaaggccagcactcc
Y L C N N L T N L E P F V K L K A S T P hsPRVl-2A 1381 taagtctatcacatctgcgtcctgtagctgcccgacctgtgtgggcgagcacatgaagga
K S I T S A S C S C P T C V G E H M K D hsPRVl-2A 1441 ttgcctcccaaattttgtcaccactaattcttgccccttggctgcttctacgtgttacag
C L P N F V T TN S C P L A A S T C Y S hsPRVl-2A 1501 ttccaccttaaaatttcaggcagggtttctcaataccaccttcctcctcatggggtgtgc S T L K F Q A G F LN T T F L L M G C A hsPRVl-2A 1561 tcgtgaacataaccagcttttagcagattttcatcatattgggagcatcaaagtgactga
RE HN Q L L A D F H H I G S I KV T E hsPRVl-2 A 1621 ggtcctcaacatcttagagaagtctcagattgttggtgcagcatcctccaggcaagatcc
V L N I L E K S Q I V G A A S S R Q D P hsPRVl-2A 1681 tgcttggggtgtcgtcttaggcctcctgtttgccttcagggactgaccatctagctgcac
A W G V V L G L L F A F R D * hsPRVl-2 A 1741 ccgacaagcacccagactctttcacataacaaataaaatagcagagttcccttaaaaaaa hsPRVl-2A 1801 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Transcript B of HSPRV1-2 (SEQ ID NO:6) (including corresponding amino acid sequence): hsPRVl-2B 1 cttttctgcgggtcttggcacctttcttggccacagatttctgggttacagagcatgtgt hsPRVl-2B 61 gtctgaggcattgcaggcagaaaagggtggccgacgtgacctctagctggactgctgggc hsPRVl-2B 121 aggggagctgtcctagataaaattggaaagcaccttgtccaatgggaggacctaagtggg hsPRVl-2B 181 agagtgagagtcctgctttgagaagctaagatggtggatggtgcagaaacagtgacccag hsPRVl-2B 241 agacaggtggacaaagaattcggggactgatgggaactgagcttgggatccagactgaaa hsPRVl-2B 301 ctgattccagactgacctctagcacccaggacccagacacagggccatgggaccccagca
M G P Q H hsPRVl-2B 361 tttgagacttgtgcagctgttctgccttctaggggccatctccactctgcctcgtatgtc
L R L V Q L F C L L G A I S T L P R M S hsPRVl-2B 421 ctgtggggctggatgctataagacccagaaagggactgcaaggggagtcgtgggctttaa
C G A G C Y K T Q K G T A R G V V G F K hsPRVl-2B 481 aggctgcagctcgtcttcgtcttaccctgcgcaaatctcctaccttgtttccccacccgg
G C S S S S S Y P A Q I S Y L V S P P G hsPRVl-2B 541 agtgtccattgcctcctacagtcgcgtctgccggtcttatctctgcaacaacctcaccaa . V S I A S Y S RV C R S Y L C NN L T N hsPRVl-2B 601 tttggagccttttgtgaaactcaaggccagcactcctaagtctatcacatctgcgtcctg
L E P F V K L K A S T P K S I T S A S C hsPRVl-2B 661 tagctgcccgacctgtgtgggcgagcacatgaaggattgcctcccaaattttgtcaccac
S C P T C V G E H M K D C L P N F V T T hsPRVl-2B 721 taattcttgccccttggctgcttctacgtgttacagttccaccttaaaatttcaggcagg
N S C P L A A S T C Y S S T L K F Q A G hsPRVl-2B 781 gtttctcaataccaccttcctcctcatggggtgtgctcgtgaacataaccagcttttagc
F L N T T F L L M G C A R E H N Q L L A hsPRVl-2B 841 agattttcatcatattgggagcatcaaagtgactgaggtcctcaacatcttagagaagtc D F H H I G S I K V T E V L N I L E K S hsPRVl-2B 901 tcagattgttggtgcagcatcctccaggcaagatcctgcttggggtgtcgtcttaggcct
Q I V G A A S S R Q D P A W G V V L G L hsPRVl-2B 961 cctgtttgccttcagggactgaccatctagctgcacccgacaagcacccagactctttca
L F A F R D * hsPRVl-2B 1021 cataacaaataaaatagcagagttccctttcaaaaaaaaaaaaaaaa. The alignment of the two human sPRVl-2 transcripts (A and B) is provided in Figure 15. An RT-PCR analysis was performed on the two transcripts (see Figure 16) of sPRVl-2 in multiple tissues (testis, leukocytes, and lymph nodes). Human sPRVl-2 was highly expressed in testis and at a very low level in lymph node. The 2.0 kb transcript appears to be more highly expressed in testis than the 1.0 kb transcript. RT- PCR only revealed the 1.0 kb transcript B in human lymph node (see Northern blot results of Figure 9).
As described above, the sPRVl-2 protein appears to be a GPI-anchored protein. In addition, as described herein, it also appears to have a 26 amino acid signal peptide at the N-terminal region (see Figure 17) and it also appears to have a possible trans¬ membrane domain (see Figure 18). The analysis provided in Table 3 below summarizes predicted glycoprotein and phosphorylated protein by Prosite analysis.
The results of a TMpred Analysis to analyze possible transmembrane regions of sPRVl-2 are summarized in Figure 18. Fig. 18B graphically summarizes the TMpred output and indicates a transmembrane region from about amino acid residue position 86 to about position 105. The sequence further suggests that sPRVl-2 (Band 10) may be a serine protease.
Table 3. Predicted Glycoprotein and Phosphoryϊated Protein
>PDOC00001 PSOOOOl ASN QLYCOSYLATIONN-glvcosvlation site [pattern] [Warning: pattern with ahigh probability of occurrence].
117 - 120 WLTN 183 - IB6 NTTF
>PDOC00005 PS00005 PKCJPHOSPHO_SITE Protein kinase C phosphorylation site [pattern] [Warning: pattern with ε high probability of occurrence].
72 - 74 TaR
131 - 133 TpK
174 - 176 TlK
207 - 209 SiK
227 - 229 SsR
>PDOC00006 PS00006 CSΩJPHOSHHOjSITE Casein kinase π phosphorylation site [pattern] [Warning: pattern with a high probability of occurrence].
119 - 122 TnIB
228 - 231 ScqD
>PDOC00008 PS00QQ8 MYRISTYL N-πiyristoylation site [pattern] [Warning: pattern with a high probability of occurrence].
16 - 21 GAipTL
25 - 30 GAHCY
6 D - 65 GCeeTL
71 - 76 GTarGV
81 - 86 GCSSSS
100 - 105 GVsiAS
224 - 229 GAasSR
235 - 240 GVvIGL
239 - 244 GLIfAF
Recombinant Expression of hsPRVl-2A from Human Testis cDNA
First, hsPRVl-2A from human testis cDNA was subjected to RT-PCR amplification of the full-length ORF. Recombinant hsPRVl-2A was prepared and expressed in E. coli. The expressed protein was found to be auto-cleaved into two parts, suggesting sPRVl-2 proteolytic activity (see Figure 19). Figure 19 represents an image of an expression analysis of recombinant hsPRVl-2A in several expression strains of E. coli, including Nova Blue, BLR, BL21, and BL21 (lys). Expression of various truncated fragments of hsPRVl-2A was also examined. Figure 20 demonstrates schematics of various truncated hsPRVl-2 constructs (left panel) and their expression (right panel). Five constructs were used. Construct A as used encompassed the parent construct (i.e., signal peptide region to transmembrane domain, and to and including C- terminal tail). Truncated construct B lacked the signal peptide. Truncated construct C lacked the signal peptide and the C-terminal tail. Truncated construct D was lacking the signal peptide through and including the transmembrane domain region. Truncated construct E was lacking the signal peptide through and including the transmembrane domain region as well as the C-terminal tail.
Figure 21 represents images of an analysis of Ni-NTA purified truncated hsPRVl-2 (construct E, see Figure 20). The left three lanes of the gel indicate various amounts of BSA, and the right lanes indicate hsPRVl-2.
Summary-
Disclosed herein is a novel flagella putative protease, sPRVl-2 (BandlO). PRVl, Sampl4, SPlO, uPAR, CD-59, and sPRVl-2 all belong to a receptor superfamily. The clusters of PRVl similar genes are located within 200 Kb of mouse chromosome 7A2, and within 500 Kb of human chromosome 19ql3.2.
Human sPRVl-2 mRNA is highly expressed in testis and at a low level in lymph node. In human testis, sPRVl-2 has two main spliced forms, sPRVl-2A and sPRVl- 2B, approximately 2.0 kb and 1.0 kb respectively.
Mouse sPRVl-2 transcripts are expressed mainly in the post-meiotic spermatids and testicular sperm.
The antiserum against sPRVl-2 stained the whole tail of human spermatozoa by immunofluorescence.
The E. coli expressed recombinant human sPRVl-2A was always cleaved into two parts, the supersensitive site of sPRVl-2 to the serine proteases was mapped by Edman sequencing. Human sPRVl -2 is a GPI anchored sperm surface protein.
The invention should not be construed to be limited solely to the assays and methods described herein, but should be construed to include other methods and assays as well. One of skill in the art will know that other assays and methods are available to perform the procedures described herein. Headings are included herein for reference and to aid in locating certain sections. These headings are not intended to limit the scope of the concepts described therein under, and these concepts may have applicability in other sections throughout the entire specification.
The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety.
While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by the previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations. Accordingly, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein. REFERENCES
1. Yanagimachi R. Mammalian fertilization. In: Knobil E3 Neill JD (eds.)3 The Physiology of Reproduction, vol. 1. New York: Raven Press, Ltd.; 1994: 189-317.
2. Visconti PE, Kopf GS. Regulation of protein phosphorylation during sperm capacitation. Biol Reprod 1998; 59: 1-6.
3. Suarez SS. Hyperactivated motility in sperm. J Androl 1996; 17: 331-335.
4. Davis BK, Byrne R, Hungund B. Studies on the mechanism of capacitation. II. Evidence for lipid transfer between plasma membrane of rat sperm and serum albumin during capacitation in vitro. Biochim Biophys Acta 1979; 558: 257-266. 5. Davis BK, Byrne R, Bedigian K. Studies on the mechanism of capacitation: albumin-mediated changes in plasma membrane lipids during in vitro incubation of rat sperm cells. ProcNatl Acad Sci USA 1980; 77: 1546-1550.
6. Davis BK. Timing of fertilization in mammals: sperm cholesterol/phospholipid ratio as a determinant of the capacitation interval. Proc Natl Acad Sci U S A 1981; 78: 7560-7564.
7. Go KJ3 WoIfDP. Albumin-mediated changes in sperm sterol content during capacitation. Biol Reprod 1985; 32: 145-153.
8. Langlais J, Roberts JD. A molecular membrane model of sperm capacitation and the acrosome reaction of mammalian spermatozoa. Gamete Res. 1985; 12: 183-224. 9. Suzuki F, Yanagimachi R. Changes in the distribution of intramembranous particles and filipin-reactive membrane sterols during in vitro capacitation of golden hamster spermatozoa. Gamete Res 1989; 23: 335-347.
10. Cross NL. Effect of cholesterol and other sterols on human sperm acrosomal responsiveness. MoI Reprod Dev 1996; 45: 212-217. 11. Cross NL. Role of cholesterol in sperm capacitation. Biol Reprod 1998; 59:7-11.
12. Visconti PE, Ning X, Fornes MW, Alvarez JG, Stein P, Connors SA3 Kopf GS.
Cholesterol efflux-mediated signal transduction in mammalian sperm: cholesterol release signals an increase in protein tyrosine phosphorylation during mouse sperm capacitation. Dev Biol 1999; 214: 429-443. 13. Therien I, Soubeyrand S5 Manjunath P. Major proteins of bovine seminal plasma modulate sperm capacitation by high-density lipoprotein. Biol Reprod 1997; 57: 1080- 1088.
14. Therien I, Bousquet D5 Manjunath P. Effect of seminal phospholipid-binding proteins and follicular fluid on bovine sperm capacitation. Biol Reprod 2001 ; 65 : 41 -51.
15. Visconti PE, Galantino-Homer H, Ning X, Moore GD3 Valenzuela JP, Jorgez CJ5 Alvarez JG5 Kopf GS. Cholesterol efflux-mediated signal transduction in mammalian sperm, beta-cyclodextrins initiate transmembrane signaling leading to an increase in protein tyrosine phosphorylation and capacitation. J Biol Chem 1999; 274: 3235-3242.
16.. Choi YH, Toyoda Y. Cyclodextrin removes cholesterol from mouse sperm and induces capacitation in a protein-free medium. Biol Reprod 1998; 59: 1328-1333. 17. Cross NL. Effect of methyl-beta-cyclodextrin on the acrosomal responsiveness of human sperm. MoI Reprod Dev 1999; 53: 92-98. 18. OsheroffJE, Visconti PE5 Valenzuela JP, Travis AJ, Alvarez J, Kopf GS. Regulation of human sperm capacitation by a cholesterol efflux- stimulated signal transduction pathway leading to protein kinase A- mediated up-regulation of protein tyrosine phosphorylation. MoI Hum Reprod 1999; 5: 1017-1026.
19. Visconti PE, Bailey JL, Moore GD, Pan D, Olds-Clarke P, Kopf GS. Capacitation of mouse spermatozoa. I. Correlation between the capacitation state and protein tyrosine phosphorylation. Development 1995; 121: 1129-1137.
20. Visconti PE, Moore GD, Bailey JL5 Leclerc P, Connors SA, Pan D5 Olds-Clarke P, Kopf GS. Capacitation of mouse spermatozoa. II. Protein tyrosine phosphorylation and capacitation are regulated by a cAMP-dependent pathway. Development 1995; 121: 1139-1150.
21. Brown DA5 Rose JK. Sorting of GPI-anchored proteins to glycolipid-enriched membrane subdomains during transport to the apical cell surface. Cell 1992; 68: 533- 544.
22. ' Anderson RG. The caveolae membrane system. Annu Rev Biochem 1998; 67: 199-225.
23. Pike LJ. Lipid rafts: bringing order to chaos. J Lipid Res 2003 ; 44: 655-667. 24. Brown DA, London E. Functions of lipid rafts in biological membranes. Annu Rev Cell Dev Biol 1998; 14: 111-136.
25. Kabouridis PS, Magee AI, Ley SC. S-acylation of LCK protein tyrosine kinase is essential for its signalling function in T lymphocytes. Embo J 1997; 16: 4983-4998. 26. Roy S, Luetterforst R, Harding A, Apolloni A, Etheridge M, Stang E, Rolls B, Hancock JF, Parton RG. Dominant-negative caveolin inhibits H-Ras function by disrupting cholesterol-rich plasma membrane domains [see comments]. Nat Cell Biol 1999; 1: 98-105.
27. Murata M, Peranen J, Schreiner R, Wieland F, Kurzchalia TV, Simons K. VIP21/caveolin is a cholesterol-binding protein. Proc Natl Acad Sci U S A 1995; 92: 10339-10343.
28. Sargiacomo M, Scherer PE, Tang Z, Kubler E, Song KS, Sanders MC, Lisanti MP. Oligomeric structure of caveolin: implications for caveolae membrane organization. Proc Natl Acad Sci U S A 1995; 92: 9407-9411. 29. Monier S, Parton RG, Vogel F, Behlke J, Henske A, Kurzchalia TV. VIP21 - caveolin, a membrane protein constituent of the caveolar coat, oligomerizes in vivo and in vitro. MoI Biol Cell 1995; 6: 911-927.
30. Scheiffele P, Verkade P, Fra AM, Virta H, Simons K, Ikonen E. Caveolin-1 and -2 in the exocytic pathway of MDCK cells. J Cell Biol 1998; 140: 795-806. 31. Simons K, Ikonen E. How cells handle cholesterol. Science 2000; 290 : 1721 - 1726.
32. Nelson WJ, Rodriguez-Boulan E. Unravelling protein sorting. Nat Cell Biol 2004; 6: 282-284.
33. Ostrom RS, Bundey RA, Insel PA. Nitric oxide inhibition of adenylyl cyclase type 6 activity is dependent upon lipid rafts and caveolin signaling complexes. J Biol
Chem 2004; 279: 19846-19853.
34. Travis AJ, Merdiushev T, Vargas LA, Jones BH3 Purdon MA, Nipper RW, Galatioto J, Moss SB, Hunnicutt GR, Kopf GS. Expression and localization of caveolin- 1, and the presence of membrane rafts, in mouse and Guinea pig spermatozoa. Dev Biol 2001; 240: 599-610. 35. Trevino CL, Serrano CJ5 Beltran C, Felix R, Darszon A. Identification of mouse trp homologs and lipid rafts from spermatogenic cells and sperm. FEBS Lett 2001; 509: 119-125.
36. Mendez AJ, Lin G, Wade DP, Lawn RM5 Oram JF. Membrane lipid domains distinct from cholesterol/sphingomyelin-rich rafts are involved in the ABCAl-mediated lipid secretory pathway. J Biol Chem 2001; 276: 3158-3166.
37. Hao M, Mufcherjee S, Maxfield FR. Cholesterol depletion induces large scale domain segregation in living cell membranes. Proc Natl Acad Sci U S A 2001; 98: 13072-13077. 38. Cross NL. Reorganization of lipid rafts during capacitation of human sperm. Biol Reprod 2004; 71: 1367-1373.
39. Kurita A, Takizawa T5 Takayama T, Totsukawa K, Matsubara S, Shibahara H, Orgebin-Crist MC5 Sendo F, Shinkai Y, Araki Y. Identification, cloning, and initial characterization of a novel mouse testicular germ cell-specific antigen. Biol Reprod 2001; 64: 935-945.
40. Moore GD5 Ayabe T5 Visconti PE5 Schultz RM, Kopf GS. Roles of heterotrimeric and monomeric G proteins in sperm-induced activation of mouse eggs. Development 1994; 120: 3313-3323.
41. Naaby-Hansen S5 Flickinger CJ, Herr JC. Two-dimensional gel electrophoretic analysis of vectorially labeled surface proteins of human spermatozoa. Biol Reprod
1997; 56: 771-787.
42. Ficarro S, Chertihin O5 Westbrook VA5 White F5 Jayes F, Kalab P5 Marto JA5 Shabanowitz J5 Herr JC5 Hunt D, Visconti PE. Phosphoproteome analysis of human sperm. Evidence of tyrosine phosphorylation of AKAP 3 and valosin containing protein/P97 during capacitation. J Biol Chem 2003; 278: 11579-11589.
43. Maier B5 Medrano S5 Sleight SB, Visconti PE5 Scrable H. Developmental association of the synaptic activity-regulated protein arc with the mouse acrosomal organelle and the sperm tail. Biol Reprod 2003; 68: 67-76.
44. Okamoto T5 Schlegel A5 Scherer PE5 Lisanti MP. Caveolins, a family of scaffolding proteins for organizing "preassembled signaling complexes" at the plasma membrane. J Biol Chem 1998; 273: 5419-5422. 45. Monier S, Dietzen DJ, Hastings WR3 Lublin DM5 Kurzchalia TV. Oligomerization of VIP21-caveolin in vitro is stabilized by long chain fatty acylation or cholesterol. FEBS Lett 1996; 388: 143-149.
46. Travis AJ, Kopf GS. The role of cholesterol efflux in regulating the fertilization potential of mammalian spermatozoa. J Clin Invest 2002; 110: 731-736.
47. WoIfDE, Hagopian SS, Ishijima S. Changes in sperm plasma membrane lipid divisibility after hyperactivation during in vitro capacitation in the mouse. J Cell Biol 1986; 102: 1372-1377.
48. London E, Brown DA. Insolubility of lipids in triton X-IOO: physical origin and relationship to sphingolipid/cholesterol membrane domains (rafts) [In Process Citation].
Biochim Biophys Acta 2000; 1508: 182-195.
49. Brown DA, London E. Structure and function of sphingolipid- and cholesterol- rich membrane rafts. J Biol Chem 2000; 275: 17221-17224.
50. Smart EJ5 Graf GA5 McNiven MA5 Sessa WC5 Engelman JA5 Scherer PE5 Okamoto T5 Lisanti MP. Caveolins, liquid-ordered domains, and signal transduction. MoI Cell Biol 1999; 19: 7289-7304.
51. Shadan S5 James PS5 Howes EA, Jones R. Cholesterol efflux alters lipid raft stability and distribution during capacitation of boar spermatozoa. Biol Reprod 2004; 71: 253-265. 52. Pralle A, Florin EL. Cellular membranes studied by photonic force microscopy. Methods Cell Biol 2002; 68: 193-212.
53. Simons K5 Toomre D. Lipid rafts and signal transduction. Nat Rev MoI Cell Biol 2000; 1: 31-39.
54. Arnoult C5 Kazam IG5 Visconti PE5 Kopf GS5 Villaz M, Florman HM. Control of the low voltage-activated calcium channel of mouse sperm by egg ZP3 and by membrane hyperpolarization during capacitation. Proc Natl Acad Sci U S A 1999; 96: 6757-6762.
55. Brooks CC5 Scherer PE5 Cleveland K5 Whittemore JL, Lodish HF, Cheatham B. Pantophysin is a phosphoprotein component of adipocyte transport vesicles and associates with GLUT4-containing vesicles. J Biol Chem 2000; 275: 2029-2036. 56. Visconti PE, Olds-Clarke P, Moss SB3 Kalab P, Travis AJ, de las Heras M, Kopf GS. Properties and localization of a tyrosine phosphorylated form of hexokinase in mouse sperm. MoI Reprod Dev 1996; 43: 82-93.
57. Breton S. The cellular physiology of carbonic anhydrases. Jop 2001; 2: 159-164. 58. Alvarez BV, Loiselle FB, Supuran CT, Schwartz GJ, Casey JR. Direct extracellular interaction between carbonic anhydrase IV and the human NBCl sodium/bicarbonate co-transporter. Biochemistry 2003; 42: 12321-12329.
59. Demarco IA, Espinosa F, Edwards J, Sosnik J, De La Vega-Beltran JL, Hockensmith JW, Kopf GS, Darszon A, Visconti PE. Involvement of aNa+/HCO-3 Cotransporter in Mouse Sperm Capacitation. J Biol Chem 2003; 278: 7001-7009.
60. Yamazaki Y, Hyodo F, Morita T. Wide distribution of cysteine-rich secretory proteins in snake venoms: isolation and cloning of novel snake venom cysteine-rich secretory proteins. Arch Biochem Biophys 2003; 412: 133-141.
61. Rochwerger L, Cohen DJ, Cuasnicu PS. Mammalian sperm-egg fusion: the rat egg has complementary sites for a sperm protein that mediates gamete fusion. Dev Biol 1992; 153: 83-90.
62. Inoue N, Ikawa M, Isotani A, Okabe M. The immunoglobulin superfamily protein Izumo is required for sperm to fuse with eggs. Nature 2005; 434: 234-238.

Claims

CLAIMSWhat is claimed is:
1. A purified polypeptide, and homologs, fragments, derivatives, and modifications thereof, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, and 4.
2. The polypeptide of claim 1, wherein said homolog has at least 70% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4.
3. The polypeptide of claim 1, wherein said homolog has at least 80% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4.
4. The polypeptide of claim 1, wherein said homolog has at least 90% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4.
5. The polypeptide of claim 1, wherein said homolog has at least 95% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4.
6. The polypeptide of claim 1, wherein said polypeptide comprises an amino acid sequence that differs by one or more conservative amino acid substitutions from an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, and 4.
7. The polypeptide of claim 1, wherein said polypeptide comprises an amino acid sequence that differs by a single mutation from an amino acid sequence selected from fhe group consisting of SEQ ID NOs:l, 2, 3, and 4, wherein said mutation represents a single amino acid deletion, insertion or substitution.
8. A pharmaceutical composition comprising at least one polypeptide of claim 1 and a pharmaceutically-acceptable carrier.
9. The polypeptide of claim 1, wherein said polypeptide is a recombinant polypeptide.
10. An isolated nucleic acid comprising a nucleic acid sequence encoding a polypeptide of claim 1.
11. The isolated nucleic acid of claim 10, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NOs:5 and 6.
12. An expression vector comprising the isolated nucleic acid of claim 10.
13. A transgenic cell comprising the expression vector of claim 12.
14. A method of screening for modulators of fertility, said method comprising contacting a polypeptide of claim 1 with a candidate compound under physiological conditions, washing said polypeptide to remove unbound and non-specific binding material; and measuring whether said compound binds to said polypeptide.
15. A method of screening for modulators of fertility, said method comprising contacting a polypeptide of claim 1 with a test compound, and measuring whether said compound regulates activity of said polypeptide.
16. The method of claim 15, wherein said activity is sperm capacitation.
17. The method of claim 16, wherein said compound is an antibody.
18. The method of claim 14, wherein said polypeptide is immobilized on a solid support.
19. The method of claim 14, wherein said test compound is labeled.
20. A method of decreasing fertility in a subject, said method comprising administering to said subject a pharmaceutical composition comprising a therapeutically effective amount of a regulator of a polypeptide of claim 1, thereby decreasing fertility in said subject.
21. The method of claim 20, wherein said regulator inhibits capacitation.
22. The method of claim 21, wherein said regulator is an antibody.
23. The method of claim 22, wherein said antibody is a monoclonal antibody.
24. A compound which specifically binds to a polypeptide of claim 1.
25. The compound of claim 24, wherein said binding of said compound to said polypeptide modulates fertility.
26. The compound of claim 25, wherein said modulation of fertility is inhibition of sperm capacitation.
27. The compound of claim 24, wherein said compound is an antibody.
28. The compound of claim 27, wherein said antibody is a monoclonal antibody.
29. An isolated nucleic acid comprising a nucleic acid sequence encoding a polypeptide comprising the amino acid sequence of the monoclonal antibody of claim 28.
30. A polypeptide comprising the amino acid sequence of the monoclonal antibody of claim 28.
31. A contraceptive vaccine formulation, said formulation comprising a polypeptide, or a fragment, homolog, derivative, or modification thereof, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:l, 2, 3, and 4.
32. A composition for inducing an immune response, said composition comprising a purified polypeptide of claim 1 , and a pharmaceutically acceptable carrier.
33. The composition of claim 31, further comprising an adjuvant.
PCT/US2005/030261 2004-08-25 2005-08-25 Sperm specific raft associated proteins Ceased WO2006026358A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US60461704P 2004-08-25 2004-08-25
US60/604,617 2004-08-25

Publications (2)

Publication Number Publication Date
WO2006026358A2 true WO2006026358A2 (en) 2006-03-09
WO2006026358A3 WO2006026358A3 (en) 2009-05-07

Family

ID=36000577

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/030261 Ceased WO2006026358A2 (en) 2004-08-25 2005-08-25 Sperm specific raft associated proteins

Country Status (1)

Country Link
WO (1) WO2006026358A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118598971A (en) * 2024-07-01 2024-09-06 华南农业大学 Preparation method and application of porcine IZUMO2 eukaryotic protein and monoclonal antibody thereof
CN120441677A (en) * 2025-07-10 2025-08-08 深圳普迪特生命科技有限公司 A TEX101 recombinant protein-specific antibody, encoding gene, and use thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002534972A (en) * 1999-01-19 2002-10-22 ヒューマン ジノーム サイエンシーズ, インコーポレイテッド 33 human secreted proteins

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118598971A (en) * 2024-07-01 2024-09-06 华南农业大学 Preparation method and application of porcine IZUMO2 eukaryotic protein and monoclonal antibody thereof
CN120441677A (en) * 2025-07-10 2025-08-08 深圳普迪特生命科技有限公司 A TEX101 recombinant protein-specific antibody, encoding gene, and use thereof
CN120441677B (en) * 2025-07-10 2025-09-12 深圳普迪特生命科技有限公司 A TEX101 recombinant protein-specific antibody, encoding gene, and use thereof

Also Published As

Publication number Publication date
WO2006026358A3 (en) 2009-05-07

Similar Documents

Publication Publication Date Title
US20200407424A1 (en) Novel complexes of types of mhc class ii that bind to collagen type ii peptides and their use on diagnosis and treatment
US8012748B2 (en) Peripheral nervous system specific sodium channel nucleic acids
CA2182299A1 (en) Wd-40-derived peptides and uses thereof
JP2011102326A (en) Molecular interaction in haematopoietic cell
US20100105625A1 (en) Product and Methods for Diagnosis and Therapy for Cardiac and Skeletal Muscle Disorders
KR20080059449A (en) Therapeutic Agents
ES2254151T3 (en) GOODPASTURE ANTIGEN UNION PROTEIN.
WO2006012621A2 (en) Compositions and methods for regulating the alternative pathway of complement
US8492347B2 (en) Peptide for induction of immune tolerance as treatment for systemic lupus erythematosus
JP2008522162A (en) Mer diagnostic and therapeutic agents
KR20160020554A (en) A method of increasing gipcr signalization in the cells of a scoliotic subject
WO2006026358A2 (en) Sperm specific raft associated proteins
US20090280110A1 (en) Cell Model for Alzheimer's Disease Pathology
UA110119C2 (en) TOMM34 peptides and vaccines containing them
US7838490B2 (en) Methods and compositions for inhibition of vascular permeability
JPH10502252A (en) Assay for inhibitors of DP-1 and other DP proteins
US20040235722A1 (en) Epf receptor assays, compounds and therapeutic compositions
WO2005056770A2 (en) Band 5: a human testis specific protein
KR20080085923A (en) Compositions and Methods for Inhibiting Leukocyte Function
WO2006070804A1 (en) Method of inhibiting telomerase activity and inhibitor
US20070218048A1 (en) Sfec, a Sperm Flagellar Energy Carrier Protein
EP1602666A1 (en) Novel protein and its dna
WO2012116210A2 (en) Peptide for the induction of immune tolerance as treatment for systemic lupus erythematosus
WO2006058043A2 (en) Contraceptive vaccines for dogs and cats based on egg membrane antigens
WO2002020047A9 (en) Chlamydial peptides and their mimics in demyelinating disease

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase