WO2006024851A2 - Method for identifying compact and/or open chromatin in a sample - Google Patents

Method for identifying compact and/or open chromatin in a sample Download PDF

Info

Publication number
WO2006024851A2
WO2006024851A2 PCT/GB2005/003374 GB2005003374W WO2006024851A2 WO 2006024851 A2 WO2006024851 A2 WO 2006024851A2 GB 2005003374 W GB2005003374 W GB 2005003374W WO 2006024851 A2 WO2006024851 A2 WO 2006024851A2
Authority
WO
WIPO (PCT)
Prior art keywords
chromatin
dna
array
compact
probe
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2005/003374
Other languages
French (fr)
Other versions
WO2006024851A3 (en
Inventor
Wendy Bickmore
Nick Gilbert
Shelagh Boyle
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Medical Research Council
Original Assignee
Medical Research Council
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medical Research Council filed Critical Medical Research Council
Publication of WO2006024851A2 publication Critical patent/WO2006024851A2/en
Publication of WO2006024851A3 publication Critical patent/WO2006024851A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809Methods for determination or identification of nucleic acids involving differential detection

Definitions

  • Cellular DNA generally exists in the form of chromatin, a complex comprising nucleic acid and protein.
  • chromosomal DNA is packaged into nucleosomes which comprises a core and a linker.
  • the nucleosome core comprises an octamer of core histones (two each of H2A, H2B, H3 and H4) around which is wrapped approximately 150 base pairs of chromosomal DNA.
  • a linker DNA segment of approximately 50 base pairs is associated with linker histone Hl (or a related linker histone in certain specialised cells).
  • the present invention seeks to overcome the problems of the prior art.
  • a compact chromatin probe obtainable or obtained by the method according to the second aspect of the present invention.
  • a method for preparing an open chromatin probe comprising the steps of: (a) preparing a plurality of chromatin fragments; (b) sedimenting the chromatin fragments into one or more fractions; (c) resolving at least one of the fractions into chromatin fragments of different lengths; (d) isolating DNA fragments that are longer than bulk chromatin; and (e) digesting the DNA fragments into one or more probes.
  • a vector obtained or obtainable by the method according to the sixth aspect of the present invention in an eighth aspect, there is provided a vector obtained or obtainable by the method according to the sixth aspect of the present invention.
  • a host cell comprising the vector according to the seventh aspect of the present invention.
  • a method for identifying one or more agents that modulate chromatin structure comprising the steps of: (a) preparing a compact chromatin probe according to the fourth aspect of the present invention and/or an open chromatin probe according to the eighth aspect of the present invention from a sample; (b) preparing a compact chromatin probe according to the fourth aspect of the present invention and/or an open chromatin probe according to the eighth aspect of the present invention from a sample that has been contacted with one or more agents; and (c) comparing the distribution and/or expression of the compact and/or open chromatin probes in each of the samples; wherein steps (a) and (b) can be performed in either order; and wherein a difference between (i) the distribution and/or expression of the compact and/or open chromatin probes in the sample and (ii) the distribution and/or expression of the compact and/or open chromatin probes in the diseased sample is indicative that the one or more agents modulate chromatin structure.
  • an array comprising one or more compact chromatin probes according to the fourth aspect of the present invention and/or an open chromatin probe according to the eighth aspect of the present invention hybridised thereto.
  • a method for preparing an array comprising the step of hybridising one or more compact chromatin probes according to the second aspect of the present invention and/or one or more open chromatin probes according to the sixth aspect of the present invention to the array.
  • a method for identifying changes (eg. alterations) in specific chromatin regions comprising the steps of: (i) providing a sample comprising one or more chromatin fragments; (ii) determining the total amount of DNA in the sample; and (iii) determining the abundance of the specific chromatin region of interest in the sample; wherein a difference between (ii) and (iii) is indicative that the chromatin structure of the specific region of interest has changed.
  • the chromatin fragments are at least about 10-30 kb in length.
  • the chromatin fragments are sedimented through a sucrose gradient.
  • the probe is annealed to a linker.
  • the quality and integrity of the probe is assessed by FISH.
  • the method according to the fourth aspect of the present invention comprises the additional step of ligating the nucleotide sequence(s) encoding the one or more probes into a vector.
  • the array is a microarray.
  • the array is a 1 Mb or 22q tiling path array.
  • the specific region of the genome is a single gene.
  • the total amount of DNA is measured using DOP-PCR.
  • references herein to compact chromatin probe(s) and/or open chromatin probe(s) may also include libraries of compact chromatin probe(s) and/or open chromatin probe(s).
  • host cell refers to any cell that comprises nucleotide sequences that are of use in the present invention.
  • E. coli The gram-negative bacterium E. coli is widely used as a host for cloning nucleotide sequences. This organism is also widely used for heterologous nucleotide sequence expression. However, large amounts of heterologous protein tend to accumulate inside the cell. Subsequent purification of the desired protein from the bulk of E. coli intracellular proteins can sometimes be difficult.
  • the present invention also relate to host cells comprising the vectors of the present invention.
  • the vector may comprise a nucleotide sequence for replication and expression of the sequence.
  • the cells will be chosen to be compatible with the vector and. may, for example, be prokaryotic (for example bacterial), fungal, yeast or plant cells.
  • a host cell may be transformed with a nucleotide sequence.
  • Host cells transformed with the nucleotide sequence may be cultured under conditions suitable for the replication or expression of the nucleotide sequence.
  • this method is conducted using an array - such as a DNA microarray.
  • array technology overcomes the disadvantages with traditional methods in molecular biology, which generally work on a "one gene in one experiment” basis, resulting in low throughput and the inability to appreciate the "whole picture” of gene function.
  • the major applications for array technology include the identification of sequence (gene / gene mutation) and the determination of expression level (abundance) of genes.
  • Gene expression profiling may also make use of array technology, optionally in combination with proteomics techniques (Celis et al, 2000, FEBS Lett, 480(l):2-16; Lockhart and Winzeler, 2000, Nature 405(6788):827-836; Khan et al., 1999, 20(2):223-9).
  • array technology also known in the art; for example, gene discovery, cancer research (Marx, 2000, Science 289: 1670-1672; Scherf, et al, 2000, Nat Genet;24(3):236-44; Ross et al, 2000, Nat Genet.
  • the solid substrate may be a membrane, such as a nitrocellulose or nylon membrane (for example, membranes used in blotting experiments).
  • Alternative substrates include glass, or silica based substrates.
  • the members are immobilised by any suitable method known in the art, for example, by charge interactions, or by chemical coupling to the walls or bottom of the wells, or the surface of the membrane.
  • Other means of arranging and fixing may be used, for example, pipetting, drop-touch, piezoelectric means, ink-jet and bubblejet technology, electrostatic application, etc.
  • photolithography may be utilised to arrange and fix the members on the chip.
  • oligonucleotide (20 ⁇ 25-mer oligos) or peptide nucleic acid (PNA) probes is synthesized either in situ (on-chip) or by conventional synthesis followed by on-chip immobilization.
  • the array is exposed to labeled sample DNA, hybridized, and the identity/abundance of complementary sequences are determined.
  • a DNA chip is sold by Affymetrix, Inc., under the GeneChip® trademark.
  • arrays may be used in the present invention as follows. Test and control DNAs labelled with different labels are combined, precipitated together and resuspended in a suitable hybridisation buffer. To prehybridise the arrays, suitable blocking DNA — such as herring sperm DNA and/or Cotl DNA - are resuspended in a suitable hybridisation buffer and incubated with the array. Following washing, the hybridisation buffer is replaced with a prehybridisation solution comprising a denatured hybridisation mix. Following hybridisation, the slides are washed before being dried and then stored until scanning.
  • suitable blocking DNA such as herring sperm DNA and/or Cotl DNA
  • input chromatin ie. total chromatin
  • input chromatin ie. total chromatin
  • samples may be isolated from compact to open chromatin.
  • samples which will typically be in the form of gel slices
  • it is necessary to isolate only a single sample if for example, the specific confirmation of chromatin to be analysed is known.
  • specific regions of open chromatin are to be analysed then it may be necessary to use a single open chroamtin sample only.
  • it is preferred to use more than one sample - such as at least 3 samples, at least 7 samples, at least 10 samples, at least 14 samples, at least 16 samples or even at least 20 samples from compact to open chroamtin.
  • DNA - is prepared and diluted for standards (eg. 1:300, 1:1000, 1:3000, 1:10000, 1:30000, and 1:100000).
  • a real time PCR mix may be prepared as follows on ice - containing, for example, a master PCR mix, MgCl2, a 1:1000 dilution of Sybr green,
  • DOP-Primer (6MW - CCGACTCGAGNNNNNNATGTGG or DOPl - CCGACTCGAGNNNNCTAGAA) and water.
  • the PCR mix is aliquoted into aliquots.
  • a 1:10 dilution of DNA from each of the gel slices is added in addition to the standards.
  • the samples are then analysed on a light cycler (Roche).
  • the baseline adjustment is set and standard curves created to determine concentration of samples.
  • the methods of the present invention facilitate the generation of a substantial amount of information on chromatin structure, preferably, compact and/or open chromatin structure.
  • chromatin structure preferably, compact and/or open chromatin structure.
  • chromatin may be modified using agents that act in a more general fashion to cut and reshape chromatin without necessarily altering individual nucleotides.
  • the present invention also enables the identification and characterisation of such chromatin modulating agents. More particularly, the ability of the methods of the invention to provide information on chromatin structure facilitates the screening of potential new chromatin modulating agents and enables known agents to be better characterised.
  • the methods of the present invention may be used to identify one or more agents that modulate chromatin, compositions for use in medicine comprising at least one chromatin modulating agent of the present invention and methods of using chromatin modulating agents of the present invention in the preparation of a medicament for the treatment of diseases.
  • a method for identifying one or more agents that modulate chromatin structure comprising the steps of: (a) preparing compact chromatin probe(s) and/or open chromatin probe(s) as described herein from a sample; (b) preparing compact chromatin probe(s) and/or open chromatin probe(s) as described herein from a sample that has been contacted with one or more agents; and (c) comparing the distribution of the compact and/or open chromatin probes in each of the samples; wherein steps (a) and (b) can be performed in either order; and wherein a difference between (i) the distribution of the compact and/or open chromatin probes in the sample and (ii) the distribution of the compact and/or open chromatin probes in the diseased sample is indicative that the one or more agents modulate chromatin structure.
  • the chromatin modulating agent may be designed or obtained from a library of compounds, which may comprise peptides, as well as other compounds, such as small organic molecules.
  • chromatin modulating agent may contain halo groups.
  • halo means halogen compounds eg. halides and includes fluoro, chloro, bromo or iodo groups.
  • the chromatin modulating agent may contain one or more of alkyl, alkoxy, alkenyl, alkylene and alkenylene groups - which may be unbranched- or branched-chain.
  • the chromatin modulating agent may be in the form of a pharmaceutically acceptable salt - such as an acid addition salt or a base salt - or a solvate thereof, including a hydrate thereof.
  • a pharmaceutically acceptable salt - such as an acid addition salt or a base salt - or a solvate thereof, including a hydrate thereof.
  • the chromatin modulating agent may be administered in the form of a pharmaceutically acceptable salt.
  • a chromatin modulating agent may contain one or more asymmetric carbon atoms and therefore exist in two or more stereoisomeric forms. Where a chromatin modulating agent contains an alkenyl or alkenylene group, cis (E) and trans (Z) isomerism may also occur.
  • the present invention includes the individual stereoisomers of a chromatin modulating agent and, where appropriate, the individual tautomeric forms thereof, together with mixtures thereof.
  • the present invention also encompasses all suitable isotopic variations of a chromatin modulating agent or a pharmaceutically acceptable salt thereof.
  • An isotopic variation of a chromatin modulating agent or a pharmaceutically acceptable salt thereof is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually found in nature.
  • isotopes that may be incorporated into a chromatin modulating agent and pharmaceutically acceptable salts thereof include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine and chlorine such as H, H, 13 C, 14 C, 15 N, 17 O, 18 O, 31 P, 32 P, 35 S, 18 F and 36 Cl, respectively.
  • pro-moieties for example as described in "Design of Prodrugs” by H. Bundgaard, Elsevier, 1985 (the disclosured of which is hereby incorporated by reference), may be placed on appropriate functionalities of chromatin modulating agents. Such prodrugs are also included within the scope of the invention.
  • the present invention also includes the use of zwitterionic forms of a chromatin modulating agent of the present invention.
  • the terms used in the claims encompass one or more of the forms just mentioned.
  • the compounds and salts may be separated and purified by conventional methods.
  • the chromatin modulating agent may be produced using chemical methods to synthesise the chromatin modulating agent in whole or in part.
  • the chromatin modulating agent is a peptide
  • the peptide can be synthesised by solid phase techniques, cleaved from the resin, and purified by preparative high performance liquid chromatography (e.g., Creighton (1983) Proteins Structures And Molecular
  • the chromatin modulating agent may be a chemically modified agent.
  • the chromatin modulating agent may act as a model (for example, a template) for the development of other compounds.
  • compositions useful in the present invention may be formulated to be administered using a mini-pump or by a mucosal route, for example, as a nasal spray or aerosol for inhalation or ingestable solution, or parenterally in which the composition is formulated by an injectable form, for delivery, by, for example, an intravenous, intramuscular or subcutaneous route.
  • the formulation may be designed to be administered by a number of routes.
  • the present invention provides a method of modulating chromatin structure in a subject comprising administering to the subject an effective amount of one or more chromatin modulating agents identified according to the methods of the present invention.
  • the components may be administered (e.g. orally) in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release applications.
  • the tablet may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.
  • excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine
  • disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates
  • the routes for administration include, but are not limited to, one or more of: oral (e.g. as a tablet, capsule, or as an ingestable solution), topical, mucosal (e.g. as a nasal spray or aerosol for inhalation), nasal, parenteral (e.g. by an injectable form), gastrointestinal, intraspinal, intraperitoneal, intramuscular, intravenous, intrauterine, intraocular, intradermal, intracranial, intratracheal, intravaginal, intracerebroventricular, intracerebral, subcutaneous, ophthalmic (including intravitreal or intracameral), transdermal, rectal, buccal, vaginal, epidural, sublingual.
  • oral e.g. as a tablet, capsule, or as an ingestable solution
  • mucosal e.g. as a nasal spray or aerosol for inhalation
  • nasal parenteral (e.g. by an injectable form)
  • gastrointestinal intraspinal, intraperitoneal
  • a component is administered parenterally
  • examples of such administration include one or more of: intravenously, intra-arterially, intraperitoneally, intrathecally, intraventricularly, intrauretbrally, intrasternally, intracranially, intramuscularly or s ⁇ bcutaneously administering the component; and/or by using infusion techniques.
  • the component(s) useful in the present invention may be administered intranasally or by inhalation and is conveniently delivered in the form of a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray or nebuliser with the use of a suitable propellant, e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, a hydrofluoroalkane such as 1,1,1,2-tetrafluoroethane (HFA 134ATM) or 1,1,1,2,3,3,3-heptafluoropropane (HFA 227EATM), carbon dioxide or other suitable gas.
  • a suitable propellant e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, a hydrofluoroalkane such as 1,1,1,2-tetrafluoroethane (HFA 134ATM
  • the component(s) may be administered in the form of a suppository or pessary, or it may be applied topically in the form of a gel, hydrogel, lotion, solution, cream, ointment or dusting powder.
  • the component(s) may also be dermally or transdermally administered, for example, by the use of a skin patch. They may also be administered by the pulmonary or rectal routes. They may also be administered by the ocular route.
  • the compounds may be formulated as micronised suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzylalkonium chloride.
  • a preservative such as a benzylalkonium chloride.
  • they may be formulated in an ointment such as petrolatum.
  • the component(s) may be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water.
  • it may be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
  • the term "administered” also includes delivery by viral or non- viral techniques.
  • Viral delivery mechanisms include but are not limited to adenoviral vectors, adeno- associated viral (AAV) vectos, herpes viral vectors, retroviral vectors, lentiviral vectors, and baculoviral vectors.
  • Non-viral delivery mechanisms include lipid mediated transfection, liposomes, immunoliposomes, lipofectin, cationic facial amphiphiles (CFAs) and combinations thereof.
  • a physician will determine the actual dosage which will be most suitable for an individual subject.
  • the specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of adrninistration, rate of excretion, drug combination, the severity of the particular condition, and the individual undergoing therapy.
  • Any one or more appropriate targets - such as compact and/or open chromatin that is amplified in, for example, a diseased cell as compared to a non-diseased cell - may be used for identifying a chromatin modulating agent.
  • the target employed in such a test may be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly.
  • the abolition of target activity or the formation of binding complexes between the target and the chromatin modulating agent being tested may be measured.
  • Techniques for drug screening may be based on the method described in Geysen, European Patent Application 84/03564, published on September 13, 1984.
  • large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface.
  • the peptide test compounds are reacted with a suitable target or fragment thereof and washed. Bound entities are then detected - such as by appropriately adapting methods well known in the art.
  • a purified target may also be coated directly onto plates for use in a drug screening techniques.
  • non-neutralising antibodies may be used to capture the peptide and immobilise it on a solid support.
  • An immune modulator - such as a vaccine - may be identified using the methods of the present invention that is used for inoculation against a disease.
  • the immune modulator may be isolated from a suitable source, or it may be made synthetically or it may be prepared by the use of recombinant DNA techniques.
  • the immune modulator may be administered in combination with an adjuvant to provide a generalised stimulation of the immune system.
  • treatment includes one or more of curative, palliative and prophylactic treatments.
  • treatment includes at least curative treatment and/or palliative treatment.
  • the treatment may be combined with other treatments - such as radiotherapy.
  • the term “therapy” includes curative effects, alleviation effects, and prophylactic effects.
  • the therapy may be on humans or animals.
  • In vivo models may be used to investigate and/or design therapies or therapeutic chromatin modulating agents to treat a disease - such as cancer.
  • the models could be used to investigate the effect of various tools/lead compounds on a variety of parameters, which are implicated in the development of or treatment of a disease.
  • the animal test model will be a non-human animal test model.
  • disease may include those diseased listed in WO-A- 98/09985.
  • the disease involves mental retardation — such as ATR-X syndrome, Rett syndrome, ICF syndrome, FSHD, Coffin-Lowry syndrome, Rubinstein-Taybi syndrome, Juberg Marsidi syndrome, Sutherland Haan syndrome, Smith Fineman
  • a disease associated with altered (eg. modified) chromatin structure may be diagnosed in a sample taken from a subject - such as a mammalian subject (eg. a human or an animal).
  • a convenient way to diagnose the disease may be to compare the chromatin structure that is obtained from the sample from the subject with the chromatin structure obtained from one or diseased samples.
  • a correlation between the chromatin structure of the sample and the chromatin structure of one or more of the diseased samples is indicative that the sample (and hence the subject from which the sample was taken) is suffering from that disease.
  • a method for diagnosing the presence of a disease in a sample comprising the steps of: (a) preparing compact chromatin probe(s) and/or open chromatin probe(s) using the methods described herein from a sample; (b) preparing compact chromatin probe(s) and/or open chromatin probe(s) (or libraries thereof) using the methods described herein from one or more diseased samples; and comparing the distribution of the compact and/or open chromatin probes in each of the samples; wherein steps (a) and (b) can be performed in either order; and wherein a correlation between (i) the distribution of the compact and/or open chromatin probe(s) in the sample and (ii) the distribution of the compact and/or open chromatin probe(s) in one or more of the diseased cells is indicative that the sample suffers from the same disease.
  • the methods of the present invention may be used to diagnose a particular form or type of disease - such as a particular form or type of cancer.
  • a particular form or type of disease afflicting a subject may be determined by determining the chromatin structure in the sample from the subject and comparing this with one or more chromatin structures that are indicative of particular forms or types of a disease.
  • the detailed and accurate diagnosis of disease forms may facilitate the correct choice of therapeutic treatment for the disease and thus increases the chances of successfully treating the disease.
  • Disease progression may be associated with changes in chromatin structure in affected cells.
  • the present invention may also be used to monitor the progress or stage of a disease in a subject.
  • the progression of a particular type of a disease (eg. cancer) afflicting a subject may be determined by detenmning the chromatin structure in the subject's diseased cells and comparing them with chromatin structures indicative of the progression of a particular type of disease.
  • the particular type or stage of disease afflicting a subject may be determined by determining the chromatin structure in the sample from the subject and comparing this with one or more chromatin structures that are indicative of the type or stage of the disease.
  • the detailed and accurate diagnosis of the stage of the disease may facilitate the correct choice of therapeutic treatment for the disease and thus increases the chances of successfully treating the disease.
  • a method for determining the stage of cellular development in a cell comprising the steps of: (a) preparing a compact chromatin probe and/or an open chromatin probe as described herein from the cell; and (b) comparing the distribution of the compact and/or open chromatin probes in the cell with the distribution of the compact and/or open chromatin probes in one or more cell(s) that are at a particular stage of development; wherein a correlation between (i) the distribution of the compact and/or open chromatin probes in the cell and (ii) the distribution of the compact and/or open chromatin probes in one or more cell(s) that are at a particular stage of development is indicative that the cell is at a particular stage of development.
  • agents identified, using the method of the present invention may be used for diagnostic purposes (i.e. a diagnostic agent) and/or for therapeutic purposes (i.e. a therapeutic agent).
  • the present invention relates to a method for identifying one or more agents that modulate a disease comprising the steps of: (a) providing a first diseased cell that has been contacted with an agent and a second diseased cell that has not been contacted with the agent; (b) preparing a plurality of chromatin fragments; (c) sedimenting the chromatin fragments into one or more fractions; (d) resolving at least one of the fractions into chromatin fragments of different lengths; and (e) comparing the chromatin structure of the chromatin fragments of step (d); wherein a difference in chromatin structure is indicative that the agent modulates the disease.
  • a method for identifying changes (eg. alterations) in specific chromatin regions comprising the steps of: (i) providing a sample comprising one or more chromatin fragments; (ii) determining the total amount of DNA in the sample; and (iii) determining the abundance of the specific chromatin region of interest in the sample; wherein a difference between (ii) and (iii) is indicative that the chromatin structure of the specific region of interest has changed.
  • This method is particularly suitable for identifying specific regions of the genome that have altered between different samples - such as between different cell types, hi a particularly preferred embodiment, this method is used for identifying specific regions of the genome that have altered during the development of cancerous cells.
  • the quantity of total DNA in a sample is determined by a novel PCR method that we have called quantitative degenerative oligo-PCR
  • DOP-PCR This method is performed by preparing a dilution series of the DNA to be analysed for standards.
  • a typical dilution series may be as follows: 1:300, 1:1000,
  • a realtime PCR mix is prepared using methods that are routine to a skilled person. Typically, this mix will comprise a master mix, MgCl 2 , a dilution of a fluorescent label - such as Sybr green - and water in addition to the DOP-Primer, which can be either:
  • a dilution (eg. a 1:10 dilution) of the DNA in the sample and each of the standards to are added to reactions.
  • the samples are run on, for example, a light cycler (Roche) and a standard curve is created to determine the DNA concentration of the sample.
  • the above method is repeated but the DOP-PCR primer is replaced with sequence-specific primers and diluted genomic DNA samples as standards (eg. at dilutions of 1:100, 1:000 and 1:10,000).
  • the PCR program is optimised for each sequence specific primer. Standard curves are again created to determine the concentration of samples.
  • the total amount of DNA can be compared to the amount of sequence-specific DNA in each fraction. A difference between the amounts is indicative that the chromatin structure of the specific region of interest has been altered.
  • the nucleotide sequence may be DNA of genomic or synthetic or recombinant origin.
  • the nucleotide sequence may be double-stranded or single-stranded whether representing the sense or antisense strand or combinations thereof.
  • the nucleotide sequence may be prepared by use of recombinant DNA techniques (e.g. recombinant DNA).
  • the nucleotide sequence may be the same as the naturally occurring form, or may be derived therefrom.
  • the nucleotide sequences may include within them synthetic or modified nucleotides.
  • a number of different types of modification to oligonucleotides are known hi the art. These include methylphosphonate and phosphorothioate backbones and/or the addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule.
  • the nucleotide sequences may be modified by any method available in the art. Such modifications may be carried out to enhance the in vivo activity or life span of nucleotide sequences.
  • the present invention also encompasses gene therapy whereby nucleotide sequences that encode chromatin modulating agents are expressed in vivo..
  • a nucleotide sequence encoding a chromatin modulating agent may be under the control of an expression regulatory element - such as a promoter or a promoter and enhancer.
  • the enhancer and/or promoter may even be active in particular tissues, such that the nucleotide sequence coding for the chromatin modulating agent is preferentially expressed.
  • the enhancer element or other elements conferring regulated expression may be present in multiple copies.
  • the enhancer and/or promoter may be preferentially active in one or more specific cell types.
  • the level of expression of the nucleotide sequence coding for the chromatin modulating agent may be modulated by manipulating the promoter region. For example, different domains within a promoter region may possess different gene regulatory activities.
  • Soluble chromatin was fractionated using sucrose gradient sedimentation (Noll and Noll, 1989) in TEEP80 (TEEP containing 8OmM NaCl). 400ml soluble chromatin was loaded on to a 6-40% isokinetic sucrose gradient and centrifuged at 4°C (41,000 rpm for 2.5hrs in a SW41 rotor). 500ml tractions were collected from the gradient by upward displacement and the DNA was purified from them by SDS/proteinase K digestion, phenol-chloroform, chloroform extraction and ethanol precipitation.
  • DNA from gradient fractions was analysed by electrophoresis through 0.7% agarose in 1 ⁇ TPE buffer (9OmM Tris-phosphate, 2mM EDTA) with buffer circulation.
  • Preparative fractionation of DNA from gradient fractions was carried out by pulsed- field gel electrophoresis (PFGE) (CHEF system, Biorad) through 1% low melting point agarose in 0.5 ⁇ TBE, at 180V, for 40hrs, with a 0.1 -2s switching time. Size markers were lkb (Promega) and 2.5kb (Biorad) DNA ladders.
  • EtBr-stained gels were scanned using a 473nm laser and a 580nm band-pass filter on a Fuji FLA-2000.
  • DNA from transverse gel slices was isolated by b-agarase (NEB) digestion, followed by phenol-chloroform, chloroform extraction and ethanol precipitation.
  • DNA purified from gel slices was either sonicated or digested with Sau3AI. After sonication the ends of the DNA were made blunt using mung bean nuclease (NEB).
  • NEB mung bean nuclease
  • the DNAs were ligated to annealed un-phosphorylated catch-linkers with either
  • DNA samples were labelled for FISH by nick-translation with either biotin- or digoxigenin-dUTP, or dCTP. DNA samples for micro-array hybridisation were labelled by random-prime labelling as previously described (Shaw- Smith et al., 2004).
  • FISH 200ng of labelled DNA and the required amount of human Cotl DNA (Gibco) were hybridised to human metaphase chromosomes as previously described but using 2 days of hybridisation (Fantes et al., 1992). Non-specific hybridisation was removed by washing (Gilbert et al., 2003).
  • Co-hybridisation of cosmid probes from 1 Ipl5.5 and a chromosome lip paint to nuclei prepared from FATO cells was as previously described (Mahy et al., 2002). Biotinylated probes were detected using sequential layers of avidin-FITC and biotinylated anti-avidin.
  • Digoxigenin-labelled probes were detected using rhodamine anti-dig sheep antibody and Texas Red-anti-sheep antibody (Vector). Slides were counterstained with 0.5mg/ml DAPI and imaged as previously described (Mahy et al., 2002).
  • Hybridisation to the 1 Mb and 22q tiling path arrays was performed as described previously (Fiegler et al., 2003), but with slight modification. Cy3 and Cy5 labelled test and control DNAs were combined, precipitated together with 135 ⁇ g of human Cotl DNA (Roche) and 600 ⁇ g yeast tRNA (Invitrogen) and resuspended in 30 ⁇ l of hybridisation buffer. To prehybridise the arrays, 800 ⁇ g of herring sperm DNA (Sigma) and 135 ⁇ g of Cotl DNA were resuspended in 45 ⁇ l of hybridisation buffer and incubated with the array for 1 hour at 37 0 C under a coverslip.
  • Hybridisation was performed under a coverslip for 24 hours at 37 0 C in hybridisation chambers humidified with 20 % formamide and 2 ⁇ SSC.
  • Arrays were scanned using an Agilent scanner (Agilent Technologies). Fluorescent intensities were extracted after subtraction of local background using SPOT (Jain et al., 2002). Signal intensities were normalised by dividing the ratio of each data point by the median ratio of all autosomal clones on the array.
  • Chromatin fibre structures can be separated by sucrose gradient sedimentation (Kimura et al., 1983; Fisher and Felsenfeld, 1986; Gilbert and Allan, 2001; Kim and
  • DNA will sediment faster than bulk chromatin if it is packaged into a more compact regular structure (Gilbert and Allan, 2001), and slower if it is packaged in fibres whose structure is interrupted by discontinuities that increase the frictional coefficient
  • Each fraction will contain fibres of the same sedimentation rate, but will consist of both DNA fragments of equal length with the same chromatin structure/ compaction, as well as shorter and longer fragments in more rigid/ compact, or more disordered/ open chromatin fibres, respectively.
  • the peak of ethidium bromide (EtBr) staining corresponds to sequences that were packaged within fibres characteristic of the bulk genome. However, in each fraction there are smears of DNA fragments that are shorter or longer than those in the EtBr peak, and these should respectively contain sequences packaged in fibres that are more, or less, compact than those of the bulk genome ( Figure 1C).
  • Ip31, Iq31 and q41, 3p24 and q24, 5q34, 7p21 and q21, 9q31, 12q21, 16pl2) corresponded with intensely staining G-bands that are depleted of genes (Furey and Haussler, 2003; http://www.ensembl.org/Homo_sapiens/).
  • We conclude that Vietnamese regions of the human genome with a very low gene-density are packaged in chromatin fibres with a similar level of compaction to heterochromatin.
  • FISH gives an immediate visual impression of the gross distribution of open chromatin fibres in the human genome, but is limited by the resolution of chromosomes bands
  • the FISH and microarray data also correspond at chromosome band level. For example, there is enriched open chromatin at clusters of BACs at the distal end of Ip (Ip34-p36; 0 45Mb), and at Iq21 (144-153Mb), regions that also hybridises strongly to open chromatin by FISH ( Figure 4A). Likewise the major domains of FISH signal from open chromatin on HSAI l at Ilpl5, Ilql3 and Ilq23-q25, correspond with peaks of hybridisation on the microarray (0-20Mb, 63-76Mb and 110-134Mb) ( Figure 4A). Microarray analysis affords higher resolution analysis than FISH.
  • ⁇ qter is a late replicating region that is enriched in open chromatin.
  • the correlation between chromatin structure and replication timing on 22q breaks down (r2 0.05).
  • the regions of 22q most enriched in chromatin fibres are also early replicating, but there are many places that are depleted of open chromatin but still replicate early. This suggests that replication timing and 30nm chromatin fibre are not functionally linked.
  • Woodfine et al (2004) noticed that in distal 22q (43-47Mb) there is a GC-rich R-band that unusually is gene-poor region. This region is generally depleted of open chromatin and is late replicating (Figure 6). Is the correlation between the presence of open chromatin fibres in the human genome and gene density, simply due to gene expression? The gene expression profile of lymphoblasts has been determined on a gene expression microarray (Woodfine et al., 2004).
  • Open chromatin fibre domains are cytologically decondensed and locate outside of chromosome territories
  • Probes from regions of high gene density have previously been shown to have a distinctive nuclear organisation — they locate outside of chromosome territories. All of the regions that have so far been identified outside of chromosome territories in lymphoblastoid cells, correspond with regions of open chromatin fibres These include; the MHC class II at 6p21.3 (32.6-33.4Mb) (Volpi et al., 2000), Ilpl5.5 (0-2Mb) ( Figure 7C), Ilql3 and distal 16pl3 (0.17-0.2Mb) (Mahy et al., 2002). In comparison, probes from the more cytologically condensed region of Ilpl3-pl4 locate inside of the lip territory ( Figure 7C).
  • Cells are grown in RPMI medium supplemented with 10% foetal calf serum, 1 X MEM non-essential amino acids (Sigma), 2mM L-Glutamine, 0.5rnM Sodium Pyruvate, ImM Oxaloacetic acid, 0.2 units/ml human insulin, 1 x penicillin/streptomycin (Sigma) and 3mM MOPS .
  • Peripheral blood is collected into syringes containing Sodium EDTA. Blood is diluted 1:2 in RPMI medium and spun over a Ficoll-Paque PLUS (Amersham) cushion for 30 min at 40Og in a benchtop centrifuge at room temperature. Lymphocytes are removed from the interphase and washed in PBS.
  • Arrays are scanned using an Agilent scanner (Agilent Technologies). Fluorescent intensities were extracted after subtraction of local background using SPOT. Signal intensities are normalised by dividing the ratio of each data point by the median ratio of all autosomal clones on the array. Hybridisations of Cy3 input chromatin vs Cy5 input chromatin, and Cy3 bulk chromatin vs Cy5 bulk chromatin are performed to confirm the consistency of hybridisation and the absence of random scatter. Any data points falling > 2 standard deviations from the mean of colour reversal experiments are removed from subsequent analysis. Cytogenetic and map position of clones on the microarrays are established using the NCBI assembly of the human genome in ENSEMBL.
  • the nuclei pellet is resuspended in a small volume of NBR (85mM KCl, 1OmM Tris-HCl pH 7.6, 1.5mM CaCl 2 , 3mM MgCl 2 , 250 ⁇ M PMSF).
  • the concentration of the nuclei is determined by measuring the absorbance at 260nm. Take a 1:20 dilution of nuclei into NBR add a small aliquot of DNasel, incubate 5 min at RT, and dilute 1:5 into sonication buffer (2M NaCl, 5M Urea). The concentration of the nuclei is adjusted to 20 A260 with NBR (approx. lmg/ml).
  • nicks in the top strand (5 '-3') are translated using the strand displacement activity of Klenow exo- (NEB).
  • the ligation reaction is adjusted to 40 ⁇ l in 1 x NEB2 buffer and 33 ⁇ M each dNTP and 5u Klenow exo- .
  • the DNA is purified by phenol-chloroform, chloroform extraction and ethanol precipitation and resuspended in lO ⁇ l water.
  • DNA samples for micro-array hybridisation are labelled by random-prime labelling using a Bioprime labelling kit (Invitrogen).
  • a 130.5 ⁇ l reaction is set up containing
  • Slides are treated with RNaseI (lOO ⁇ g/ml) in 2 x SSC for lhr at 37°C. Slides are rinsed in 2 X SSC and dehydrated through an alcohol series of 70, 90, 100% ethanol and air dried. Slides are denatured in 70% formamide/2 x SSC at 7O 0 C for 90 s, transferred to ice-cold 70% ettianol, and then into 90 and 100% ethanol and air dried. 200ng of labelled DNA, 50 ⁇ g of human Cotl DNA (Invitrogen) and 5 ⁇ g sonicated salmon sperm DNA are precipitated together with two volumes ethanol and dried in a spin- vac. The DNA is resuspended in lO ⁇ l hybridisation mix consisting of
  • Biotinylated probes are detected using FITC-conjugated avidin, followed by biotinylated anti-avidin and a final layer of FITC-conjugated avidin. Slides are mounted in Vectashield, counter-stained with 1 mg/ml DAPI and examined on a Zeiss axiophot microscope equipped with a CCD camera and IPlab software.
  • each fraction repeats the above but replacing the DOP-PCR primer with 17.5 ⁇ l lO ⁇ M each sequence-specific primer and using diluted genomic DNA samples as standards (1:100, 1:000, 1:10,000).
  • the PCR program is optimised for each sequence specific primer. After PCR set baseline adjustment and create standard curve to determine concentration of samples. The total amount of DNA can be compared to the amount of sequence-specific DNA in each fraction.
  • the cells are centrifuged [850g, 4 min, 4°C] and resuspended in NBR [1OmM Tris pH 7.6, 5.5% Sucrose, 85mM KCL, 3mM MgC12, 1.5mM CaC12, 250 ⁇ M PMSF].
  • the cells are centrifuged [850g rpm, 4 min, 4°C] and resuspended in a small volume of NBR.
  • the concentration of the nuclei are determined by spectroscopy at 260nm.
  • the nuclei concentration is adjusted and digested with an optimal concentration of micrococcal nuclease (approx 10-12 U per ml nuclei for 10 min at RT in the presence of lOO ⁇ g/ml RNase A.
  • the reaction is stopped by adding EDTA to 1OmM.
  • the nuclei are centrifuged at 300Og, 30 sec in a microfuge and resuspended in 400 ⁇ l TEEP20 [10 mM Tris pH 8.0, O.lmM EDTA, O.lmM EGTA, 20 mM NaCl, 250 ⁇ M PMSF].
  • the nuclei are left to stand overnight on ice for the chromatin to release.
  • the debris is removed by centrifugation (20,00Og, 5 min 4°C) in a microcentrifuge.
  • the sample is loaded on a 6-40% isokinetic sucrose gradient in TEEP80 [1OmM Tris, O.lmM EDTA, O.lmM EGTA, 8OmM NaCl, 250 ⁇ M PMSF].
  • the gradients are centrifuged for 3 hrs at 200,00Og in a SW41 rotor.
  • the chromatin is isolated from the gradient by upward displacement with 50% sucrose in TEEP80 ( Figure 14). Chromatin fractions are stored frozen at -20 0 C.
  • the integrity of the chromatin is investigated by purifying the DNA from the chromatin fractions by SDS, Proteinase K treatment followed by phenol/chloroform extraction, chloroform extraction and ethanol precipitation.
  • the DNA is fractionated on a 0.7% TPE gel overnight ( Figure 18).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to inter alia a method for identifying compact and/or open chromatin in a sample comprising the steps of: (a) preparing a plurality of chromatin fragments; (b) sedimenting the chromatin fragments into one or more fractions; (c) resolving at least one of the fractions into chromatin fragments of different lengths; and (d) isolating one or more DNA fragments that are shorter and/or longer than bulk chromatin; wherein DNA fragments that are shorter than bulk chromatin correspond to compact chromatin and wherein DNA fragments that are longer than bulk chromatin correspond to open chromatin.

Description

METHOD
FIELD OF INVENTION
The present invention relates to a method.
In particular, the present invention relates to inter alia a method for identifying compact and/or open chromatin in a sample.
BACKGROUND TO THE INVENTION
Cellular DNA generally exists in the form of chromatin, a complex comprising nucleic acid and protein. In general, chromosomal DNA is packaged into nucleosomes which comprises a core and a linker. The nucleosome core comprises an octamer of core histones (two each of H2A, H2B, H3 and H4) around which is wrapped approximately 150 base pairs of chromosomal DNA. In addition, a linker DNA segment of approximately 50 base pairs is associated with linker histone Hl (or a related linker histone in certain specialised cells). Nucleosomes are organised into a higher-order chromatin fibre (sometimes denoted a "solenoid" or a 30 nm fibre) and chromatin fibres are organised into chromosomes. For general teachings on chromatin, reference can be made to Romberg et al. (1999) Cell 98 : 285-294.
Chromatin structure is not static, but is subject to modification by processes collectively known as chromatin remodeling. Chromatin remodeling can serve, for example, to remove nucleosomes from a region of DNA, move nucleosomes from one region of DNA to another, change the spacing between nucleosomes or add nucleosomes to a region of DNA in the chromosome. Chromatin remodeling can also result in changes in higher order structure, thereby influencing the balance between transcriptionally active chromatin (open chromatin or euchromatin) and transcriptionally inactive chromatin (closed chromatin or heterochromatin). Modulation of chromatin structure is central to the regulation of gene expression. This is best understood at the level of the nucleosome and its modifications. For example, acetylation and methylation of lysine residues in histones H3 and H4 has been correlated to either active transcription or gene repression, depending on the nature of the modification (Fischle et al., 2003). Variant histones also impact on nucleosome structure and function (Fan et al., 2002; McKittrick et al., 2004). However, beyond the nucleosome itself, there are other structural states of chromatin that will influence how the underlying DNA sequence is read. Active and silent regions are often considered to have "open" and "closed" chromatin structures, respectively (Felsenfeld and Groudme, 2003; Vermaak et al., 2003). However, biophysical evidence for different chromatin fibre structures, which might equate with these concepts has been lacking.
At low salt concentrations nucleosome arrays can form IOnm fibres (Thoma et al., 1979; Wolffe, 1998), that undergo a conformational change to a 30nm fibre with increasing salt (Greulich et al., 1987). However, it is not understood how nucleosome arrays are arranged into the 30nm fibre (Thoma et al., 1979; McGhee et al., 1983; Woodcock et al., 1984; van Holde and, Zlatanova, 1996; Wolffe, 1998). 30nm chromatin fibres are detected in cells by low angle X-ray diffraction (Langmore and Paulson, 1983), but by electron microscopy a large proportion of mammalian chromatin appears packaged into levels beyond this, visualised as 60 to 130nm "chromonema" fibres (Belmont and Bruce, 1994). Unfolding and decondensation of chromatin fibres is seen by light microscopy when transcriptional regulators are artificially targeted to the mammalian genome (Tumbar et al., 1999; Tsukamoto et al., 2000; Muller et al., 2001; Ye et al., 2001; Nye et al., 2002). Recently, decondensation of the endogenous murine HoxB locus has been shown to accompany the induction of transcription (Chambeyron and Bickmore, 2004).
It is known that chromatin fibre structures can be separated by sucrose gradient sedimentation. Kimura et al., (1983) have described a method in which isolated nuclei were digested, followed by sucrose gradient fractionation of the chromatin fragments followed by the analysis of DNA by electrophoresis through an agarose gel. The distribution of specific gene fragments is determined using Southern blotting. A similar method was used by Fisher and Felsenfeld (1986) to compare the folding of β- globin and ovalbumin gene containing chromatin. Gilbert and Allan (2001) have applied this method to examine the structure of chromatin fibres released from centromeric heterochromatin. Kim and Clark (2002) have used this method to compare the native chromatin structure of a small yeast plasmid containing the HIS3 gene purified from induced and uninduced cells.
Prior art methods for investigating chromatin fibre structure have been limited to the analysis of only a few genes using a Southern blotting based method. Chromatin fibre structure has never previously been investigated at a genomic level. Therefore the global relationships between chromatin fibre structures, genes, and gene expression, are unknown. Moreover, biophysical evidence for different chromatin fibre structures is lacking.
The present invention seeks to overcome the problems of the prior art.
SUMMARY OF THE INVENTION
A method is described herein which overcomes the necessity to use Southern blotting to investigate the chromatin structure of an individual gene. Accordingly, a prior assumption of which sequences the chromatin fragments may contain is no longer required. For the first time, it is possible to analyse compact and/όr open chromatin structure on a genome wide scale.
Aspects of the present invention are presented in the accompanying claims.
In a first aspect, there is provided a method for identifying compact and/or open chromatin in a sample comprising the steps of: (a) preparing a plurality of chromatin fragments; (b) sedimenting the chromatin fragments into one or more fractions; (c) resolving at least one of the fractions into chromatin fragments of different lengths; and (d) isolating one or more DNA fragments that are shorter and/or longer than bulk chromatin; wherein DNA fragments that are shorter than bulk chromatin correspond to compact chromatin and wherein DNA fragments that are longer than bulk chromatin correspond to open chromatin.
In a second aspect, there is provided a method for preparing a compact chromatin probe comprising the steps of: (a) preparing a plurality of chromatin fragments; (b) sedimenting the chromatin fragments into one or more fractions; (c) resolving at least one of the fractions into chromatin fragments of different lengths; (d) isolating one or more DNA fragment(s) that are shorter than bulk chromatin; and (f) digesting the DNA fragments into one or more probes.
In a third aspect, there is provided a compact chromatin probe obtainable or obtained by the method according to the second aspect of the present invention.
In a fourth aspect, there is provided a vector obtained or obtainable by the method according to the second aspect of the present invention.
In a fifilh aspect, there is provided a host cell comprising the vector according to the fourth aspect of the present invention.
In a sixth seventh aspect, there is provided a method for preparing an open chromatin probe comprising the steps of: (a) preparing a plurality of chromatin fragments; (b) sedimenting the chromatin fragments into one or more fractions; (c) resolving at least one of the fractions into chromatin fragments of different lengths; (d) isolating DNA fragments that are longer than bulk chromatin; and (e) digesting the DNA fragments into one or more probes.
In a seventh aspect, there is provided an open chromatin probe obtainable or obtained by the method according to the fifth aspect of the present invention.
In an eighth aspect, there is provided a vector obtained or obtainable by the method according to the sixth aspect of the present invention. In a ninth aspect, there is provided a host cell comprising the vector according to the seventh aspect of the present invention.
In a tenth aspect, there is provided a method for identifying one or more changes in chromatin structure and/or expression in a sample that can be correlated wilii a disease comprising the steps of: (a) preparing a compact chromatin probe according to the fourth aspect of the present invention and/or an open chromatin probe according to the eighth aspect of the present invention from a non-diseased sample; (b) preparing a compact chromatin probe according to the fourth aspect of the present invention and/or an open chromatin probe according to the eighth aspect of the present invention from a diseased sample; and (c) comparing the distribution of the compact and/or open chromatin probes in each of the samples; wherein steps (a) and (b) can be performed in either order; and wherein a difference between (i) the distribution of the compact and/or open chromatin probes in the sample and (ii) the distribution of the compact and/or open chromatin probes in the diseased sample is indicative of one or more changes in chromatin structure and/or expression that can be correlated with a disease.
In an eleventh aspect, there is provided a method for identifying one or more agents that modulate chromatin structure comprising the steps of: (a) preparing a compact chromatin probe according to the fourth aspect of the present invention and/or an open chromatin probe according to the eighth aspect of the present invention from a sample; (b) preparing a compact chromatin probe according to the fourth aspect of the present invention and/or an open chromatin probe according to the eighth aspect of the present invention from a sample that has been contacted with one or more agents; and (c) comparing the distribution and/or expression of the compact and/or open chromatin probes in each of the samples; wherein steps (a) and (b) can be performed in either order; and wherein a difference between (i) the distribution and/or expression of the compact and/or open chromatin probes in the sample and (ii) the distribution and/or expression of the compact and/or open chromatin probes in the diseased sample is indicative that the one or more agents modulate chromatin structure. In a twelfth aspect, there is provided an agent identified or identifiable by the method according to the tenth aspect of the present invention.
In a thirteenth aspect, there is provided a method for identifying one or more changes in a specific region of chromatin structure that can be correlated with a disease comprising the steps of: (a) preparing a plurality of chromatin fragments from a diseased and a non-diseased sample; (b) sedimenting the chromatin fragments from each of the samples into one or more fractions; (c) resolving at least one of the fractions into chromatin fragments of different lengths; and (d) isolating DNA fragments that are shorter or longer than bulk chromatin; (e) optionally digesting the DNA fragments into one or more probes; (f) determining the total amount of DNA in the DNA fragments isolated in step (d); (g) determining the abundance of the specific region of the genome in the DNA fragments isolated in step (d); and (h) comparing the results from steps (f) and (g) for each of the diseased and non-diseased samples to determine if the chromatin structure of the specific region has been altered.
Ih a fourteenth aspect, there is provided an array comprising one or more compact chromatin probes according to the fourth aspect of the present invention and/or an open chromatin probe according to the eighth aspect of the present invention hybridised thereto.
hi a fifteenth aspect, there is provided a method for preparing an array comprising the step of hybridising one or more compact chromatin probes according to the second aspect of the present invention and/or one or more open chromatin probes according to the sixth aspect of the present invention to the array.
hi an sixteenth aspect, there is provided an array obtained or obtainable by the method according to the fourteenth aspect of the present invention.
m a seventeenth aspect, there is provided the use of one or more compact chromatin probes according to the second aspect of the present invention or a library thereof and/or one or more open chromatin probes according to the sixth aspect of the present invention or a library thereof in the preparation of an array.
In an eighteenth aspect, there is provided the use of one or more compact chromatin probes according to the second aspect of the present invention or a library thereof and/or one or more open chromatin probes according to the sixth aspect of the present invention or a library thereof for determining the structure of chromatin in a sample.
hi an nineteenth aspect, there is provided the use of one or more compact chromatin probes according to the second aspect of the present invention or a library thereof and/or one or more open chromatin probes according to the sixth aspect of the present invention or a library thereof in a method for identifying one or more changes in chromatin structure and/or expression in a sample that can be correlated with a disease.
hi a twentieth aspect, there is provided a method for identifying changes (eg. alterations) in specific chromatin regions comprising the steps of: (i) providing a sample comprising one or more chromatin fragments; (ii) determining the total amount of DNA in the sample; and (iii) determining the abundance of the specific chromatin region of interest in the sample; wherein a difference between (ii) and (iii) is indicative that the chromatin structure of the specific region of interest has changed.
Other aspects of the present invention are presented in the accompanying claims and in the following description and discussion. These aspects are presented under separate section headings. However, it is to be understood that the teachings under each section heading are not necessarily limited to that particular section heading.
PREFERRED EMBODIMENTS
Preferably, the one or more chromatin fragments are resolved using pulsed field gel electrophoresis.
Preferably, the chromatin fragments are at least about 10-30 kb in length. Preferably, the chromatin fragments are sedimented through a sucrose gradient.
Preferably, the sucrose gradient is a 6-40% sucrose gradient.
Preferably, the sucrose gradient is fractionated from top to bottom.
Preferably, the DNA fragments that are isolated are at least about 5 kb shorter than bulk chromatin.
Preferably, the DNA fragments that are isolated are at least about 10 kb shorter than bulk chromatin.
Preferably, the DNA fragments that are isolated are at least about 5 kb longer than bulk chromatin.
Preferably, the DNA fragments that are isolated are at least about 10 kb longer than bulk chromatin.
Preferably, the DNA fragments are digested into one or more probes using a restriction enzyme or sonication.
Preferably, the restriction enzyme is Sau3 AI.
Preferably, the probe is annealed to a linker.
Preferably, the linker is a Sau3 A linker.
Preferably, nicks in the top strand (5 '-3) of the probe are translated using the strand displacement activity of Klenow DNA polymerase (exo-).
Preferably, the probe is amplified by PCR. Preferably, the probe is labelled.
Preferably, the label is selected from a biotin label, a digoxigenin label and a fluorescent label.
Preferably, the quality and integrity of the probe is assessed by FISH.
Preferably, the probe is hybridised to an array.
Preferably, the method according to the fourth aspect of the present invention comprises the additional step of ligating the nucleotide sequence(s) encoding the one or more probes into a vector.
Preferably, the distribution of the compact and/or open chromatin probes in each of the samples is determined using an array.
Preferably, the array is a microarray.
Preferably, the microarray is a tiling path array, more preferably a whole genome tiling path array.
Preferably, the array is a 1 Mb or 22q tiling path array.
Preferably, the array is an expression array (eg. an expression microarray).
Preferably, the array is a human genomic array.
Preferably, the distribution of the compact and/or open chromatin probes in each of the samples is determined for one or more specific regions of the genome. Preferably, the method according to the twelfth aspect of the present invention comprises the steps of: (a) determining the total amount of DNA in each of the compact chromatin probes and/or the open chromatin probes from the non-diseased and diseased samples; (b) measuring the abundance of the specific region(s) of interest; and (c) comparing the results from step (a) and (b) to determine if the chromatin structure of the specific region(s) has altered between the non-diseased and diseased samples.
Preferably, the specific region of the genome is a single gene.
Preferably, the total amount of DNA is measured using DOP-PCR.
Preferably, the abundance of the specific region of the genome is determined using real time PCR.
Preferably, input chromatin is hybridised to the array.
DESCRIPTION OF THE FIGURES
Figure 1
Sucrose gradient fractionation of human chromatin. (A) MNase digestion of nuclei was used to produce chromatin fragments with a size of ~ 20 kb. The soluble chromatin from the digest marked by an asterisk, was run on a 6 - 40% isokinetic sucrose gradient. For two chromatin fragments of equal length (kb) the more open/ disordered fragment (top) will sediment slower than the more compact/ rigid one (bottom) (B) The gradient was fractionated from top to bottom and the DNA purified from each fraction examined by agarose gel electrophoresis. (C) To isolate DNA fragments from the same fraction (sedimentation rate), but with different lengths (and thus different chromatin fibre conformations), DNA from a gradient fraction (asterisked in B) was size selected by PFGE. DNA was purified from a gel slice corresponding to the peak of EtBr staining (bulk chromatin). To represent "compact" chromatin, DNA was purified from a gel slice containing fragments ~ 10kb shorter than the EtBr peak. DNA from "open" chromatin was purified from a gel slice containing fragments ~10kb longer than bulk chromatin.
Figure 2 Compact human chromatin fibres originate from heterochromatin and a subset of G- bands. FISH to human metaphase chromosomes with blunt-end linkered "compact" chromatin. (A) In the absence of suppression by human Cotl, hybridisation (green) is predominantly to centromeres and the juxtacentromeric heterochromatin at IqI 2, and 9ql2. Note the absence of hybridisation to the heterochromatin at 16qll and Yq. (B) After Cotl suppression, hybridisation (green) on the chromosome arms is to G-bands. The reversed DAPI signal was used to identify the chromosomes (middle panel), and the strongest (thresholded) sites of hybridisation were superimposed on the banded chromosomes (right panel).
Figure 3
Open human chromatin fibres hybridise to the most gene-dense parts of the genome. (A) FISH onto metaphase chromosomes, with Sau3AI linkered "bulk" biotin-labelled (red) and "open" digoxigenin-labelled (green) chromatin probes, in the presence of suppression with 50mg Cotl. (B) Hybridisation signal from "open" chromatin on DAPI stained (blue) chromosomes - left panel. The reverse DAPI signal was used to identify the chromosomes (middle panel) and the strongest (thresholded) sites of open chromatin hybridisation (green) are superimposed on the banded chromosomes (right panel). (C) HSA7 hybridised with open chromatin fraction, either Sau3Al or blunt-end linkered, in the presence of increasing amounts of human Cotl DNA. (D) HSA9 hybridised with blunt-ended open chromatin fraction in the absence or presence of 50mg of Cotl DNA. When the compact chromatin fraction was digested with Sau3 Al prior to linker-ligation the 9q satellite was not detected since it lacks Sau3AI recognition sites (data not shown).
Figure 4
Comparing FISH and microarray analysis of open chromatin. Sau3AI linker-ligated open chromatin fraction was hybridised to a whole genome 1Mb microarray using an input chromatin control. (A) Log2 openrinput hybridisation ratio for HSAl, 11 and 16 is shown aligned with metaphase chromosomes hybridised with open chromatin by FISH. The gene density for Ensembl genes is shown for a 500kb window. Replication timing (S:G1 ratio) of these chromosomes, established using the same 1Mb genomic array, is shown (Woodfϊne et al., 2004). (B) Mean Iog2 ratio (±S.E.M. for 4 replicate experiments) of open:input hybridisation signal for individual BACs from 16pl3 aligned to the DNA sequence (Mb), gene density for a 100kb window, and the proportion of expressed genes in each BAC.
Figure 5
Correlation between the abundance of open chromatin fibres and genedensity. Linear regression analysis between the gene density (Ensembl genes/Mb) and the mean Iog2 of open: input chromatin per chromosome, averaged between two independent hybridisations to the array, and performed with colour reversal. Each chromosome is indicated in parentheses next to each data point. r2=0.88.
Figure 6
High resolution analysis of of open chromatin on 22q. (A) Sau3AI linkerligated open chromatin fraction was hybridised to a a high resolution contiguous tiling path array of 22q. Log2 ratio of open:input hybridisation signal for each clone aligned to the DNA sequence (Mb), gene density for a 200kb window, and the replication timing S:G1 for this array (Woodfϊne et al., 2004). The proportion of genes expressed in a 200kb window is also shown. The Iog2 open: input chromatin, tile path, genes and their expression level are aligned for; (B) 400kb of 22qll.21, (C) 1.5Mb of 22ql2.1. (D) Mean (±SEM) nuclear position (as a proportion of the territory radius) of clones with respect to the 22q chromosome territory (n= 50). Data taken from Mahy et al. (2002).
Figure 7
Chromatin fibre structure, chromatin condensation and nuclear organisation of lip. (A) Log2 open: input chromatin ratio for BACs in 1 Ipl5.5, and pl4.1- pl3, aligned to
DNA sequence (Mb) and gene density for a 100kb window. (B) Graphs of mean square interphase distance (d2) (±SEM) between FISH signals for pairs of probes (asterisked in A) from Ilpl5.5 (top) and pl4.1-pl3 (bottom) (n=50). Representative images for probe pairs (red and green) at different Mb separations is shown to the right of each graph. DNA is counterstained with DAPI (blue). (C) Representative FISH images for individual probes (red) and the lip territory (green) for (top panel) an Ilpl5.5 probe (cIllpl5-25) and (bottom panel) PAX6 in Ilρl3. For Ilpl5.5 the probes (red) often (80%) localised outside the chromosome territory (green) whilst for Ilpl4.1 / Ilpl3 the probes were normally (89%) located inside the territory. Nuclei are counterstained using DAPI. Bar=5mm.
Figure 8
FISH with total DNA and input chromatin probes. Hybridisation of metaphase chromosome spreads, in the absence (-Cotl) or presence (+Cotl) of 50mg human Cotl, with biotin-dUTP labelled probes prepared from total human genomic DNA (A) or from input chromatin labelled with biotin-dUTP (B) or biotin-dCTP (C). Chromosomes were identified from the reverse DAPI banding (middle panels) Uniform labelling of chromosome arms is seen with each probe in the presence of suppression by Cotl, but dCTP-labelled probe fails to hybridise strongly to constitutive heterochromatin, even in the absence of Cotl suppression.
Figure 9
Distribution of open chromatin across chromosome 1 by microarray. The Iog2 ratio for open: input chromatin after hybridisation to a whole human genome microarray assembled from clones at 1Mb intervals (Fielgler et al., 2003; Woodfme et al., 2004). The data for chromosome 1 from two independent experiments with colour reversal is shown. The dotted line indicates a 1:1 ratio of open: input hybridisation signal (Iog2=0).
Figure 10
Colour reversals for hybridisation of open: input chromatin to whole genome microarray. To exclude erroneous points from analysis the correlation between individual spots on the microarray for colour reversal hybridisations was determined. For each correlation the colour-reversed data sets were normalised to each other and points falling outwith 2 S.D. were excluded from further analysis.
Figure 11 Distribution of open chromatin across the whole human genome by hybridisation to a whole genome microarray. The Iog2 ratio for openrinput chromatin, averaged from two experiments, each with colour reversal, after hybridisation to a whole human genome microarray assembled from clones at 1Mb intervals (Fielgler et al., 2003; Woodfme et al., 2004). The dotted line indicates a 1:1 ratio of tesfccontrol hybridisation signal (Iog2=0). Ideograms of each chromosome are aligned to each graph with T bands highlighted in red. G bands are black and C-bands yellow.
Figure 12
Colour reversals for hybridisation of open: input chromatin to 22q tiling path microarray. To exclude erroneous points from analysis the correlation between individual spots on the microarray for colour reversal hybridisations was determined. For each correlation the colour-reversed data sets were normalised to each other and points falling outwith 2 S.D. were excluded from further analysis.
Figure IS
Chromosome-wide average open:input chromatin ratios and correlations to other genomic features. The ratio of open:input chromatin was calculated from the average of two independent fractionations of open chromatin, each hybridised twice with colour reversal to the 1Mb microarray. These values were averaged across each chromosome. Genomic DNA (female) :input chromatin (male) hybridisation ratios per chromosome demonstrate that there is not preferential release of chromatin from gene- rich chromosomes, since ratios for autosomes approximate to 1, compared with the sex chromosomes (*). Gene density per chromosome was calculated from ENSEMBL, and the GC content of each chromosome was taken from Venter et al. (2001). The mean replication time for each chromosome was determined using the same whole genome microarray (Woodfme et ah, 2004). Gene expression data for lymphoblasts (Woodfme et ah, 2004) was expressed both as average expression level (arbitrary units) or probability of expression for all genes assayed per chromosome.
Figure 14 (fig 1 ): Chromatin isolated from total human leukocytes fractionated on a sucrose gradient.
Figure 15 (2): Analysis of the integrity of DNA isolated from total human leukocyte chromatin agarose gel stained with Eithidium Bromide.
Figure 16 (3): B lymphocyte flow analysis in a patient with chronic lymphocytic leukemia. The B-cell percentage (CD 19+) is 90%.
Figure 17 (4): Chromatin separated from B-lymphocytes from a patient with chronic lymphocytic leukemia.
Figure 18 (5): Analysis of the integrity of DNA purified from chromatin isolated from a patient with CLL. Agarose gel stained with ethidium bromide.
Figure 19 (6): PCR amplification of DNA purified from the chromatin isolated from a patient with CLL. Agarose gel stained with ethidium bromide.
Figure 20 (7): Analysis of imput chromatin isolated from B lymphocytes from a patient with CLL. DNA purified from a chromatin gradient is catch-linkered, labelled and hybridised to human metaphase chromosomes.
DETAILED DESCRIPTION OF THE INVENTION
CHROMATIN
As used herein the term "chromatin" encompasses all types of cellular nucleoprotein, both prokaryotic and eukaryotic. Cellular chromatin includes both chromosomal and episomal chromatin. Chromatin is the nucleoprotein structure comprising the cellular genome. Cellular chromatin comprises nucleic acid, primarily DNA, and protein, including histones and non-histone chromosomal proteins. The majority of eukaryotic cellular chromatin exists in the form of nucleosomes, wherein a nucleosome core comprises approximately 150 base pairs of DNA associated with an octamer comprising two each of histones H2A, H2B, H3 and H4; and linker DNA (of variable length depending on the organism) extends between nucleosome cores. A molecule of histone Hl is generally associated with the linker DNA.
CHROMATIN FRAGMENTS
As described herein, a plurality (eg. more than one) of chromatin fragments are used. Typically, this is achieved by contacting the sample to be treated with an entity to fragment the chromatin contained therein.
The aim of the fragmentation step is to produce a suitable number of chromatin fragments for sedimentation (eg. fractionation). Thus, it will be appreciated that the degree to which the chromatin is fragmented depends, at least partly, on the nature of the starting chromatin sample and how many genes are contained therein. Some starting material may require more stringent fragmentation than others.
The chromatin may be fragmented by any means apparent to one skilled in the art.
Preferably, the chromatin is fragmented by exposing the sample to at least one fragmenting means capable of fragmenting the chromatin therein.
The cells may be permeabilised or otherwise treated to enable the fragmenting means to pass through the cell membrane and come into contact with the chromatin inside the cell. Chromatin fragments may be prepared using any entity that is capable of fragmenting chromatin.
The entity may be a chemical or physical agent - such as bleomycin, bromoacetaldehyde, chloracetaldehyde, cobalt chiral complex, copper phenanthroline, diethyl pyrocarbonate, dimethyl sulfate, iron(II)— EDTA, methidiumpropyl-EDTA, neocarzinostatin, psoralen and ultraviolet light.
The entity may be an enzyme - such as a sequence specific nuclease, a non-sequence specific nuclease, Bal-31, DNase I, DNase II, an endogenous nuclease, exonuclease III, lambda exonuclease, micrococcal nuclease, mung bean nuclease, Neurospora crassa nuclease, a restriction enzyme including type I, II and III restriction enzymes, Sl nuclease or a topoisomerases such as topoisomerase I or II.
Preferably, the entity that is used results in chromatin fragments that are about 10- 30 kb in average length. More preferably, the entity is a micrococcal nuclease (Mnase).
Thus, by way of example, if the sample comprises nuclei, these may be digested with, for example, MNase and optionally RNaseA. Digestion can be stopped by adding
EDTA. The nuclei are then washed, resuspended in a small volume of buffer — such as
TEEP20 (1OmM Tris-HCl pH 8.0, ImM EDTA, ImM EGTA, 25OmM PMSF, 2OmM
NaCl) - and then incubated for a suitable period of time - such as at 40C overnight.
Nuclear debris may be removed by centrifugation leaving fragmented soluble chromatin in the supernatant.
One or more such entities may be used to fragment the chromatin.
SAMPLE
As used herein, the term "sample" is used in its broadest sense, as referring to any entity which comprises chromatin. The sample may be or may be derived from biological material.
Preferably, the sample may be or may be derived from one of more entities selected from one or more nuclei, one or more cells, or one or more tissue samples.
The nuclei, cells, or tissues may be or may be derived from any nuclei, cells, or tissues in which chromatin is present.
More preferably, the sample may be or may be derived from one of more entities selected from one or more isolated or purified nuclei, one or more isolated or purified cells, or one or more isolated or purified tissue samples.
The isolated or purified nuclei, cells, or tissues may be or may be derived from any isolated or purified nuclei, cells, or tissues in which chromatin is present.
Preferably, the one or more nuclei, one or more cells, one or more tissues, or one more nucleic acids are isolated or purified.
Preferably, the sample comprises chromatin that is or is derived from the nuclei, cells, or tissues described above.
The nucleic acid in the form of chromatin may be isolated or purified.
As used herein, the term "isolated" and "purified" means that the nuclei, cells, or tissues are removed from their natural environment.
The chromatin may be prepared by various methods that are apparent to a skilled person.
By way of example, if the sample is a cell then nuclei may be prepared as described in Gilbert et al, (2003) or Gilbert & Allan (2001). Briefly, cell cultures are harvested and washed and the cell pellet resuspended in a small volume of buffer. Detergetents to lyse the cell membrane are added and nuclei then collected by centrifugation. Soluble chromatin is prepared by digesting the nuclei with, for example, micrococcal nuclease or a restriction enzyme - such as Mval or AhA.
The sample comprising chromatin may also be or may also be derived from diseased nuclei, cells, or tissues.
The sample comprising chromatin may also be or may also be derived from nuclei, cells, or tissues that are suffering from a particular form of a disease.
The sample comprising chromatin may also be or may also be derived from nuclei, cells, or tissues that are at a particular stage of development.
SEDMENTING
Chromatin fragments may be sedimented into two or more fractions using any method that can be used for the separation of chromatin based upon their mass (DNA length and protein composition) and hydrodynamic shape (compaction).
Using a sedimentation based method, a given length of DNA will sediment faster then bulk chromatin if it is packaged into a more compact regular chromatin structure and slower if it is packaged in fibres whose chromatin structure is interrupted by discontinuities that increase the frictional coefficient.
The sedimentation method may be or may comprise gel filtration using a suitable matrix.
Preferably, the sedimentation method that is used is or is based upon gradient sedimentation, preferably, sucrose gradient sedimentation.
Preferably, the sucrose gradient is an isokinetic sucrose gradient. Typically, the type of gradient that is used will depend upon the degree of separation that is desired and/or the sizes of the chromatin fragments that have been prepared. By way of example, if the chromatin has been fragmented into fragments of from about 10-30kb average length, then a suitable sucrose gradient will be 6-40 %.
Thus, in a preferred embodiment, the sucrose gradient is a 6-40 % gradient. More preferably, the sucrose gradient is a 6-40 % isokintetic gradient.
Preferably, the gradient is fractionated from top to bottom so that the fractions contain chromatin fibres with progressively increased sedimentation rate. Each fraction will contain fibres of the same sedimentation rate, but will consist of both DNA fragments of equal length with the same chromatin structure/compaction, as well as shorter and longer fragments in more rigid/compact, or more disordered/open chromatin fibres, respectively.
Typically, the sucrose gradient sedimentation is prepared as described by Noll and Noll, 1989. Briefly, soluble chromatin is loaded on to a suitable gradient and centrifuged. Fractions are collected from the gradient by upward displacement and the DNA is then purified from each fraction, using for example, SDS/proteinase K digestion, phenol-chloroform, chloroform extraction and ethanol precipitation.
SEPARATINGTHEFRACTIONS
Optionally, the one or more fractions that are obtained from the sedimentation step of the method described herein may be separated on the basis of their size before they are resolved. Advantageously, this allows the quality/integrity of the DNA from the one or more fractions to be assessed.
The method that is used to separate the fractions may include any method that provides for the separation of the chromatin fragments according to their size. Typically, the methods will be based on nucleic acid electrophoresis. In this method, DNA which has a negative charge in solution will migrate to the positive pole in an electric field.
Preferably, agarose gel electrophoresis or the like is used in which the DNA is forced to move through an agarose gel. One or more of the fractions will be loaded on to the gel and subject to electrophoresis for enough time to achieve an adequate separation of the fractions.
In a preferred embodiment, the DNA from the gradient fractions is separated by electrophoresis through about 0.7% agarose in a buffer - such as TPE buffer (9OmM Tris-phosphate, 2mM EDTA).
The peak of ethidium bromide (EtBr) staining corresponds to sequences that are packaged within fibres characteristic of the bulk genome.
RESOLVING THE FRACTIONS
DNA from at least one of the sedimented fractions is resolved in to chromatin fragments of different lengths. Advantageously, this step can be used to resolve chromatin fragments from the same fraction but with different lengths (and thus different chromatin fibre conformations).
When at least one of the sedimented fractions is resolved in to chromatin fragments of different lengths an electrophoresis method will generally be used that is capable of resolving larger sized chromatin fragments.
Typically, the size of the chromatin fragments to be resolved may be at least about 1 kb, at least about 5kb, at least about 10 kb, at least about 15 kb, at least about 0 kb, at least about 25 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 45 kb, at least about 50 kb, or even at least about 50-100 kb. Preferably, the size of the chromatin fragments to be resolved is at least about 10- 20 kb in size.
If the size of the chromatin fragments to be resolved is at least about 10 kb then it is preferred that an electrophoresis method that is capable of resolving these larger fragments is used.
Typically, the chromatin fragments are separated into compact chromatin (about 10kb), bulk chromatin (about 20kb) and open chromatin (about 30kb).
In a highly preferred embodiment, this electrophoresis method is pulsed field gel electrophoresis (PFGE).
Routine procedures and several commercial pulsed field units are currently available for performing PFGE. Typically, PFGE instrumentation falls into two categories. The simplest equipment is designed for field inversion gel electrophoresis (FIGE) (Carle, et ah, 1986 Science 232, pp. 65-68). FIGE works by periodically inverting the polarity of the electrodes during electrophoresis. Because FIGE subjects DNA to a 180ø reorientation, the DNA spends a certain amount of time moving backwards. Only an electrical field-switching module is needed; any standard vertical or horizontal gel box that has temperature control can be used to run the gel. Although more complex in its approach, zero integrated field electrophoresis (ZIFE) (Turmel et. al, (1990) Current
Communication in Cell & Molecular Biology Vol. l, pp. 101-131. Cold Spring Harbor
Laboratory Press, New York) also falls into this first category. Compared with simple FIGE, ZIFE is slower. However, ZIFE is capable of resolving larger DNA and giving a larger useful portion of the gel.
The other category contains instruments that reorient the DNA at smaller oblique angle, generally between 96 and 120ø. This causes DNA to always move forward in a zigzag pattern down the gel. For a similar size range under optimal conditions, these separations are faster, resolve a wider size range, and give a larger useful portion of the gel compared to FIGE. Contour-clamped homogeneous electric field (CHEF) (Chu, et al., 1986, Science 234, 1582-1585) transverse alternating field electrophoresis (TAFE) (Gardiner, et al., 1986 Somatic Cell Molec. Genet. 12, pp. 185-195) and its relative ST/RIDEtm (Stratagene); and rotating gel electrophoresis (RGE) (Southern, et al., 1987 Nucleic Acids Res. 15, 5925- 5943) are all examples of commonly used transverse angle reorientation techniques for which instrumentation is available. In a further elaboration of the above procedures, Lai and coworkers developed the programmable autonomously controlled electrophoresis (PACE) unit which allows complete control over reorientation angle, voltage, and switch time (Birren, et al., 1989 Electrophoresis 10, pp. 302-309). hi contrast with FIGE, these systems require both a special gel box with a specific electrode and gel geometry, and the associated electronic control for switching and programming the electrophoresis run.
Ideally, the DNA should separate in straight lanes to simplify lane-to-lane comparisons.
Li a preferred embodiment, preparative fractionation of DNA from gradient fractions is carried out using the CHEF system (eg. the CHEF system supplied by Biorad) through 1% low melting point agarose in a buffer - such as TBE - at 180V, for 40hrs, with a 0.1 -2s switching time.
Each fraction that is analysed will comprise smears of DNA fragments that are shorter or longer than those in the EtBr peak. These respectively contain sequences packaged in fibres that are more, or less, compact than those of the bulk genome.
In particular, to identify regions of the human genome that are packaged into the most compact chromatin fibres, DNA fragments from a sedimentation fraction that are shorter than those of the EtBr peak can be isolated.
In particular, to identify regions of the human genome that are packaged into the least compact chromatin fibres, DNA fragments from a sedimentation fraction that are longer than those of the EtBr peak can be isolated. Preferably, the fractions are resolved into at least open chromatin.
Preferably, the fractions are resolved into at least compact chromatin.
Preferably, the fractions are resolved into at least compact chromatin and/or open chromatin.
Preferably, the fractions are resolved into compact chromatin and/or bulk chromatin and/or open chromatin.
Preferably, the fractions are resolved into compact chromatin, bulk chromatin, and open chromatin.
Accordingly, in a further aspect, there is provided a method for identifying compact and/or open chromatin in a sample comprising the steps of: (a) preparing a plurality of chromatin fragments; (b) sedimenting the chromatin fragments into one or more fractions; (c) resolving at least one of the fractions into chromatin fragments of different lengths; and (d) isolating one or more DNA fragments that are shorter and/or longer than bulk chromatin; wherein DNA fragments that are shorter than bulk chromatin correspond to compact chromatin and wherein DNA fragments that are longer than bulk chromatin correspond to open chromatin.
Preferably, for compact chromatin, the DNA fragments that are isolated are at least about 5 kb shorter than bulk chromatin. More preferably, the DNA fragments that are isolated are at least about 10 kb shorter than bulk chromatin.
Preferably, for open chromatin, the DNA fragments that are isolated are at least about 5 kb longer than bulk chromatin. More preferably, the DNA fragments that are isolated are at least about 10 kb longer than bulk chromatin. It is a particular feature of the present invention that the methods described herein can be applied genome wide rather than to individual genes. Accordingly, the methods of the present can be applied to a plurality of genes/loci.
As used herein, the term "plurality of genes/loci" refers to at least 10 genes/loci, preferably, at least 10-100 genes/loci; preferably, at least 10-1000 genes/loci; preferably, at least 10 to 5000 genes/loci; preferably, at least 10 to 10000 genes/loci; preferably, at least 10 to 50000 genes/loci; preferably, at least 10 to 100,000 genes/loci, preferably, at least 101-1000 genes/loci; preferably, at least 1001 to 5000 genes/loci; preferably, at least 5001 to 10000 genes/loci; preferably, at least 10001 to 50000 genes/loci; or preferably, at least 50001 to 100,000 genes/loci.
A person skilled in the art will also appreciate that DNA from at least one of the sedimented fractions may also be resolved in to chromatin fragments of different lengths using other methods that are known in the art. By way of example, a further sedimentation step may be performed to resolve the DNA in to chromatin fragments of different lengths. Such a method may be based upon that described in Gilbert & Allan (2001).
ISOLATING ONE OR MORE DNA FRAGMENTS
When at least one of the fractions has been resolved into chromatin fragments of different lengths, one or more DNA fragments that are shorter and/or longer than bulk chromatin are isolated.
If the DNA fragment(s) have been resolved on an agarose gel then the fragments will typically be isolated by cutting one or more slices from the gel on which the DNA fragment(s) were resolved.
The DNA contained in the gel slices can be obtained using various methods that are known to a skilled person - such as by using β-agarase (NEB) digestion. Generally, the isolated DNA fragments will be further purified, using methods - such as phenol-chloroform, chloroform extraction and ethanol precipitation.
COMPACT AND OPEN CHROMATIN PROBES
In a further aspect, there is provided a method for preparing a compact chromatin probe comprising the steps of: (a) preparing a plurality of chromatin fragments; (b) sedimenting the chromatin fragments into one or more fractions; (c) resolving at least one of the fractions into chromatin fragments of different lengths; (d) isolating one or more DNA fragments that are shorter than bulk chromatin; and (e) digesting the DNA fragment(s) into one or more probes.
When at least one of the fractions has been resolved into chromatin fragments of different lengths - using, for example, PFGE - the peak of ethidium bromide (EtBr) staining corresponds to sequences that are packaged within fibres that are characteristic of bulk chromatin. However, in each fraction there are smears of DNA fragments that are shorter than those in the EtBr peak, and these respectively contain sequences packaged in fibres that represent compact chromatin.
Preferably, the DNA fragments that are isolated are at least 1, more preferably, at least 2, more preferably, at least 3, more preferably at least 4, or more preferably, at least about 5 kb shorter than bulk chromatin.
More preferably, the DNA fragments that are isolated are at least 6, more preferably, at least 7, more preferably, at least 8, more preferably at least 9 or most preferably at least about 10 kb shorter than bulk chromatin.
In still a further aspect, there is provided a method for preparing an open chromatin probe comprising the steps of: (a) preparing a plurality of chromatin fragments; (b) sedimenting the chromatin fragments into one or more fractions; (c) resolving at least one of the fractions into chromatin fragments of different lengths; (d) isolating one or more DNA fragments that are longer than bulk chromatin; and (e) digesting the DNA fragment(s) into one or more probes.
The peak of ethidium bromide (EtBr) staining corresponds to sequences that are packaged within fibres that are characteristic of bulk chromatin. However, in each fraction there are smears of DNA fragments that are longer than those in the EtBr peak, and these respectively contain sequences packaged in fibres that represent open chromatin.
Preferably, the DNA fragments that are isolated are at least 1, more preferably, at least 2, more preferably, at least 3, more preferably at least 4, or more preferably, at least about 5 kb longer than bulk chromatin.
More preferably, the DNA fragments that are isolated are at least about 6, more preferably, at least about 7, more preferably, at least about 8, more preferably at least about 9 or most preferably at least about 10 kb longer than bulk chromatin.
Isolated DNA - such as DNA purified from gel slices - is further fragmented into a plurality of probes using methods that include, but are not limited to sonication or restriction enzyme digestion.
Preferably, if restriction enzyme digestion is used then the enzyme is Sau3AI.
If sonication is used then the ends of the DNA are typically made blunt using a nuclease - such as mung bean nuclease (NEB) - or a polymerase - such as T4 polymerase.
Preferably, the probes are annealed to a linker - such as a linker with either Sau3 AI or blunt compatible ends. The Sau3Al linkers have been described previously (Fantes et al., 1995). Blunt-end linkers are the same but with the Sau3AI overhang removed.
Typically, the linkers are un-phosphorylated catch-linkers. Following ligation, nicks in the top strand (5 '-3') of the probe(s) is translated using the strand displacement activity of Klenow exo- (NEB).
The samples are then amplified. Various methods are available in the art for amplifying DNA sequences. One preferred method is that of PCR in which one of the catch linker oligonucleotides is used as a primer. PCR is described in US-A-4683195, US-A-4800195 and US-A-4965188.
Preferably, the probe(s) are labelled.
A wide variety of labelling techniques are known by those skilled in the art and can be used herein. Means for producing labelled probes include oligolabelling, nick translation, end-labelling or PCR amplification using radiolabelled or a biotinylated nucleotide. Preferably, the probes are labelled using nick-translation or random prime labelling (Shaw-Smith et al., 2004). A number of companies - such as Amersham- Pharmacia Biosciences (NJ), Promega (Madison, WI), Ambion (Austin, Texas) and US Biochemical Corp (Cleveland, OH) - supply commercial kits and protocols for these procedures.
Suitable labels include radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles and the like. Patents teaching the use of such labels include US-A-3817837; US-A- 3850752; US-A-3939350; US-A-3996345; US-A-4277437; US-A-4275149 and US-A- 4366241.
Preferably, the probe(s) are labelled using, for example, a biotin label, a digoxigenin label or a fluorescent label.
The quality and integrity of the probe(s) may be assessed using FISH prior to their use. When using FISH, the labelled DNA (eg. biotin labelled DNA) and a required amount of blocking DNA - such as human Cotl DNA - is hybridised to human metaphase chromosomes as previously described (Fantes et al., 1992). Non-specific hybridisation can be removed by washing (Gilbert et al., 2003). Biotinylated probes may be detected using, for example, sequential layers of avidin-FITC and biotinylated anti- avidin. Digoxigenin-labelled probes may be detected using, for example, rhodamine anti-dig sheep antibody and Texas Red-anti-sheep antibody (Vector). Slides may be counterstained with 0.5mg/ml DAPI and imaged as previously described (Mahy et al., 2002).
Advantageously, the probe(s) described herein are hybridised to an array.
By way of example only, hybridisation to arrays may be performed using methods that are based upon those described previously by Fiegler et ah, 2003. Briefly, labelled test and control DNAs are combined, precipitated together with blocking DNA - such as human Cotl DNA and/or yeast tRNA - and resuspended in hybridisation buffer. To prehybridise the arrays, DNA - such as herring sperm DNA and Cotl DNA - are resuspended in hybridisation buffer and incubated with the array under a coverslip. Slides are washed in buffer and spun dry before replacing the prehybridisation solution with the hybridisation mix. Hybridisation is typically performed under a coverslip in humidified hybridisation chambers.
LIBRARY
The present invention also encompasses libraries (eg. physical libraries) of sequences encoding compact and/or open chromatin - such as sequences encoding compact and/or open chromatin probes - that are ligated in to one or more vectors.
Accordingly, references herein to compact chromatin probe(s) and/or open chromatin probe(s) may also include libraries of compact chromatin probe(s) and/or open chromatin probe(s).
The term "vector" includes expression vectors, transformation vectors, shuttle vectors and cloning vectors. The term "transformation vector" means a construct capable of being transferred from one entity to another entity - which may be of the species or may be of a different species. If the construct is capable of being transferred from one species to another e.g. from an E. coli plasmid to a bacterium, such as of the genus Bacillus, then the transformation vector is sometimes called a "shuttle vector". It may even be a construct capable of being transferred from an E. coli plasmid to an Agrobacterium to a plant.
The vectors may be transformed into a suitable host cell as described below to provide for expression of a polypeptide.
The vectors may be for example, plasmid, virus or phage vectors provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter.
The vectors may contain one or more selectable marker nucleotide sequences. The most suitable selection systems for industrial micro-organisms are those formed by the group of selection markers which do not require a mutation in the host organism. Examples of fungal selection markers are the nucleotide sequences for acetamidase (amdS), ATP synthetase, subunit 9 (oliC), orotidine-S'-phosphate-decarboxylase (pvrA), phleomycin and benomyl resistance (benA). Examples of non-fungal selection markers are the bacterial G418 resistance nucleotide sequence (this may also be used in yeast, but not in filamentous fungi), the ampicillin resistance nucleotide sequence (E. coli), the neomycin resistance nucleotide sequence (Bacillus) and the E. coli uidA nucleotide sequence, coding for β-glucuronidase (GUS).
Vectors may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell. Thus, polynucleotides may be incorporated into a recombinant vector (typically a replicable vector), for example, a cloning or expression vector. The vector may be used to replicate the nucleic acid in a compatible host cell.
The physical library of compact and/or open chromatin may be prepared by ligating the chromatin fragments that are longer and/or shorter than the bulk chromatin in to a vector - such as a cloning vector - using methods well know in the art.
Optionally, the method for preparing the library of compact and/or open probes comprises the additional step of transforming the vector to provide a library of cells - such as host cells - using methods well known in the art.
As used herein, the term "host cell" refers to any cell that comprises nucleotide sequences that are of use in the present invention.
Host cells may be transformed or transfected with a nucleotide sequence contained in a vector e.g. a cloning vector. Preferably said nucleotide sequence is carried in a vector for the replication of the nucleotide sequence. The cells will be chosen to be compatible with the said vector and may, for example, be prokaryotic (for example bacterial), fungal, yeast or plant cells.
The gram-negative bacterium E. coli is widely used as a host for cloning nucleotide sequences. This organism is also widely used for heterologous nucleotide sequence expression. However, large amounts of heterologous protein tend to accumulate inside the cell. Subsequent purification of the desired protein from the bulk of E. coli intracellular proteins can sometimes be difficult.
In contrast to E. coli, bacteria from the genus Bacillus are very suitable as heterologous hosts because of their capability to secrete proteins into the culture medium. Other bacteria suitable as hosts are those from the genera Streptomyces and Pseudomonas. Depending on the nature of the polynucleotide and/or the desirability for further processing of the expressed protein, eukaryotic hosts including yeasts or other fungi may be preferred. In general, yeast cells are preferred over fungal cells because yeast cells are easier to manipulate. However, some proteins are either poorly secreted from the yeast cell, or in some cases are not processed properly (e.g. hyperglycosylation in yeast). In these instances, a different fungal host organism should be selected.
Examples of expression hosts are fungi - such as Aspergillus species (such as those described in EP-A-0184438 and EP-A-0284603) and Trichoderma species; bacteria - such as Bacillus species (such as those described in EP-A-0134048 and EP-A- 0253455), Streptomyces species and Pseudomonas species; and yeasts - such as Kluyveromyces species (such as those described in EP-A-0096430 and EP-A- 0301670) and Saccharomyces species. By way of example, typical expression hosts may be selected from Aspergillus niger, Aspergillus niger var. tubigenis, Aspergillus niger var. awamori, Aspergillus aculeatis, Aspergillus nidulans, Aspergillus orvzae, Trichoderma reesei, Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens, Kluyveromyces lactis and Saccharomyces cerevisiae.
The use of host cells - such as yeast, fungal and plant host cells - may provide for post- translational modifications (e.g. myristoylation, glycosylation, truncation, lapidation and. tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the present invention.
Aspects of the present invention also relate to host cells comprising the vectors of the present invention. The vector may comprise a nucleotide sequence for replication and expression of the sequence. The cells will be chosen to be compatible with the vector and. may, for example, be prokaryotic (for example bacterial), fungal, yeast or plant cells.
Introduction of a vector into a host cell can be effected by various methods. For example, calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction or infection may be used. Such methods are described in many standard laboratory manuals - such as Sambrook et ah, Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.
Host cells containing me expression vector can be selected by using, for example, G418 for cells transfected with an expression vector carrying a neomycin resistance selectable marker.
Teachings on the transformation of cells are well documented in the art, for example see Sambrook et al (Molecular Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor Laboratory Press) and Ausubel et ah, Current Protocols in Molecular Biology (1995), John Wiley & Sons, Inc.
If a prokaryotic host is used then the nucleotide sequence may need to be suitably modified before transformation - such as by removal of introns.
A host cell may be transformed with a nucleotide sequence. Host cells transformed with the nucleotide sequence may be cultured under conditions suitable for the replication or expression of the nucleotide sequence.
The present invention may be used, for example, to prepare libraries of compact and/or open chromatin (eg. libraries of compact and/or open chromatin probes) from one or more diseased cells; libraries of compact and/or open chromatin (eg. libraries of compact and/or open chromatin probes) from cells that are suffering from a particular form or a particular stage of a disease; and/or libraries of compact and/or open chromatin (eg. libraries of compact and/or open chromatin probes) from cells that are at a particular stage of development for example.
Advantageously, these libraries may then be used to compare the distribution of compact and/or open chromatin probes with a sample to be tested. Accordingly, a further aspect of the present invention relates to a method for preparing a library of compact chromatin (eg. compact chromatin probes) comprising the steps of: (a) preparing a plurality of chromatin fragments; (b) sedimenting the chromatin fragments into one or more fractions; (c) resolving the chromatin fragments into different lengths; (d) isolating one or more DNA fragment(s) that are shorter than bulk chromatin; (f) digesting the DNA fragments into one or more probes; and (g) cloning the DNA fragments into one or more vectors.
In still a further aspect, there is provided a method for preparing a library of open chromatin (eg. open chromatin probes) comprising the steps of: (a) preparing a plurality of chromatin fragments; (b) sedimenting the chromatin fragments into one or more fractions; (c) resolving the chromatin fragments into different lengths; (d) isolating DNA fragments that are longer than bulk chromatin; (f) digesting the DNA fragments into one or more probes; and (g) cloning the DNA fragments into one or more vectors.
In yet a further aspect there is provided a library that is obtained or obtainable by the methods described herein.
In yet a further aspect there is provided a vector that is obtained or obtainable by the methods described herein.
In still a further aspect there is also provided a host cell comprising the vector.
CHROMATIN STRUCTURE
In a further aspect of the present invention, there is provided a method for identifying one or more changes in chromatin structure and/or expression in a sample that can be correlated with a disease comprising the steps of: (a) preparing compact chromatin probe(s) and/or open chromatin probe(s) as described herein from a non-diseased sample; (b) preparing compact chromatin probe(s) and/or open chromatin probe(s) as described herein from a diseased sample; and (c) comparing the distribution of the compact and/or open chromatin probes in each of the samples; wherein steps (a) and Qo) can be performed in either order; and wherein a difference between (i) the distribution of the compact and/or open chromatin probes in the sample and (ii) the distribution of the compact and/or open chromatin probes in the diseased sample is indicative of one or more changes in chromatin structure and/or expression that can be correlated with a disease.
Advantageously, it is not only possible to understand the molecular basis of a disease, but also the molecular diagnosis and prognosis of the underlying defects.
Advantageously, a comparison of the chromatin structure between the diseased and non-diseased cells can be used to correlate these changes with a disease. By identifying those regions of chromatin that are different in structure between the diseased and non-diseased cells will lead to the identification of one or more targets (eg, genes or sequences) that can then be used to assess the impact of this difference on disease progression and survival.
Preferably, this method is conducted using an array - such as a DNA microarray. Array technology overcomes the disadvantages with traditional methods in molecular biology, which generally work on a "one gene in one experiment" basis, resulting in low throughput and the inability to appreciate the "whole picture" of gene function. Currently, the major applications for array technology include the identification of sequence (gene / gene mutation) and the determination of expression level (abundance) of genes.
Array technology and the various techniques and applications associated with it is described generally in numerous textbooks and documents. These include Lemieux et al., 1998, Molecular Breeding 4, 277-289, Schena and Davis. Parallel Analysis with Biological Chips, in PCR Methods Manual (eds. M. Innis, D. Gelfand, J. Sninsky), Schena and Davis, 1999, Genes, Genomes and Chips. In DNA Microarrays: A Practical Approach (ed. M. Schena), Oxford University Press, Oxford, UK, 1999), Tlie Chipping Forecast {Nature Genetics special issue; January 1999 Supplement), Mark Schena (Ed.), Microarray Biochip Technology, (Eaton Publishing Company), Cortes, 2000, The Scientist 14[17]:25, Gwynne and Page, Microarray analysis: the next revolution in molecular biology, Science, 1999 August 6 and Eakins and Chu, 1999, Trends in Biotechnology, 17, 217-218.
Gene expression profiling may also make use of array technology.
Gene expression profiling may also make use of array technology, optionally in combination with proteomics techniques (Celis et al, 2000, FEBS Lett, 480(l):2-16; Lockhart and Winzeler, 2000, Nature 405(6788):827-836; Khan et al., 1999, 20(2):223-9). Other applications of array technology are also known in the art; for example, gene discovery, cancer research (Marx, 2000, Science 289: 1670-1672; Scherf, et al, 2000, Nat Genet;24(3):236-44; Ross et al, 2000, Nat Genet. 2000 Mar;24(3):227-35), SNP analysis (Wang et al, 1998, Science, 280(5366):1077-82), drug discovery, pharmacogenomics, and disease diagnosis (for example, utilising microfluidics devices: Chemical & Engineering News, February 22, 1999, 77(8):27- 36).
In general, any library may be arranged in an orderly manner into an array, by spatially separating the members of the library. Examples of suitable libraries for arraying include nucleic acid libraries (including DNA, cDNA, oligonucleotide, etc libraries), peptide, polypeptide and protein libraries, as well as libraries comprising any molecules, such as ligand libraries, among others.
The members of a library are generally fixed or immobilised onto a solid phase, preferably a solid substrate, to limit diffusion and admixing of the members. In particular, the libraries may be immobilised to a substantially planar solid phase, including membranes and non-porous substrates such as plastic and glass. Furthermore, the members are preferably arranged in such a way that indexing (i.e., reference or access to a particular sample) is facilitated. Typically the members are applied as spots in a grid formation. Common assay systems may be adapted for this purpose. For example, an array may be immobilised on the surface of a microplate, either with multiple members in a well, or with a single member in each well. Furthermore, the solid substrate may be a membrane, such as a nitrocellulose or nylon membrane (for example, membranes used in blotting experiments). Alternative substrates include glass, or silica based substrates. Thus, the members are immobilised by any suitable method known in the art, for example, by charge interactions, or by chemical coupling to the walls or bottom of the wells, or the surface of the membrane. Other means of arranging and fixing may be used, for example, pipetting, drop-touch, piezoelectric means, ink-jet and bubblejet technology, electrostatic application, etc. In the case of silicon-based chips, photolithography may be utilised to arrange and fix the members on the chip.
The members may be arranged by being "spotted" onto the solid substrate; this may be done by hand or by making use of robotics to deposit the member. In general, arrays may be described as macroarrays or microarrays, the difference being the size of the spots. Macroarrays typically contain spot sizes of about 300 microns or larger and may be easily imaged by existing gel and blot scanners. The spot sizes in microarrays are typically less than 200 microns in diameter and these arrays usually contain thousands of spots. Thus, microarrays may require specialised robotics and imaging equipment, which may need to be custom made. Instrumentation is described generally in a review by Cortese, 2000, The Scientist 14[11]:26
Techniques for producing immobilised libraries of DNA molecules have been described in title art. Generally, most prior art methods described how to synthesise single-stranded nucleic acid molecule libraries, using for example masking techniques to build up various permutations of sequences at the various discrete positions on the solid substrate. US 5,837,832 describes an improved method for producing DNA arrays immobilised to silicon substrates based on very large scale integration technology. In particular, US 5,837,832 describes a strategy called "tiling" to synthesise specific sets of probes at spatially-defined locations on a substrate which may be used to produced the immobilised DNA libraries. To optimise a given array format a skilled person can determine the sensitivity of the detection (eg. fluorescence detection) for different combinations of membrane type, fluorochrome, excitation and emission bands, spot size and the like, hi addition, low fluorescence background membranes have been described (Chu et al. (1992) Electrophoresis 13:105-114).
Arrays of peptides (or peptidomimetics) may also be synthesised on a surface in a manner that places each distinct library member (e.g., unique peptide sequence) at a discrete, predefined location in the array. The identity of each library member is determined by its spatial location in the array. The locations in the array where binding interactions between a predetermined molecule (e.g., a target or probe) and reactive library members occur is determined, thereby identifying the sequences of the reactive library members on the basis of spatial location. These methods are described in U.S. Patent No. 5,143,854; WO90/15070 and WO92/10092; Fodor et al. (1991) Science, 251: 767; Dower and Fodor (1991) Ann. Rep. Med. Chem., 26: 271.
Specific examples of DNA arrays are as follow:
Format I: probe cDNA (500-5,000 bases long) is immobilized to a solid surface such as glass using robot spotting and exposed to a set of targets either separately or in a mixture. This method is widely considered as having been developed at Stanford University (Ekins and Chu, 1999, Trends in Biotechnology, 1999, 17, 217-218).
Format II: an array of oligonucleotide (20~25-mer oligos) or peptide nucleic acid (PNA) probes is synthesized either in situ (on-chip) or by conventional synthesis followed by on-chip immobilization. The array is exposed to labeled sample DNA, hybridized, and the identity/abundance of complementary sequences are determined. Such a DNA chip is sold by Affymetrix, Inc., under the GeneChip® trademark.
Examples of some commercially available microarray formats are set out in Table 1 below (see also Marshall and Hodgson, 1998, Nature Biotechnology, 16(1), 27-31.
Figure imgf000040_0001
Figure imgf000041_0001
Table 1. Examples of currently available hybridization microarray formats
Data analysis is also an important part of an experiment involving arrays. The raw data from a microarray experiment typically are images, which need to be transformed into matrices (eg. gene expression matrices) - tables where rows represent for example genes, columns represent for example various samples such as tissues or experimental conditions, and numbers in each cell for example characterise the expression level of the particular gene in the particular sample. These matrices have to be analysed further, if any knowledge about the underlying biological processes is to be extracted. Methods of data analysis (including supervised and unsupervised data analysis as well as bioinformatics approaches) are disclosed in Brazma & ViIo J (2000) FEBS Lett 480(1): 17-24.
As disclosed above, proteins, polypeptides, etc may also be immobilised in arrays. For example, antibodies have been used in microarray analysis of the proteome using protein chips (Borrebaeck CA, 2000, Immunol Today 21(8):379-82). Polypeptide arrays are reviewed in, for example, MacBeath and Schreiber, 2000, Science, 289(5485): p. 1760-1763. For most array based applications it is typical to block the hybridisation capacity of repetitive sequences. In this case, human genomic DNA or Cot-1 DNA, may be used as an agent to block such hybridisation. The preferred size range is from about 200 bp to about 1000 bases, more preferably between about 400 to about 800 bp for double stranded, nick translated nucleic acids.
By way of example only, arrays (preferably genomic microarrays) may be used in the present invention as follows. Test and control DNAs labelled with different labels are combined, precipitated together and resuspended in a suitable hybridisation buffer. To prehybridise the arrays, suitable blocking DNA — such as herring sperm DNA and/or Cotl DNA - are resuspended in a suitable hybridisation buffer and incubated with the array. Following washing, the hybridisation buffer is replaced with a prehybridisation solution comprising a denatured hybridisation mix. Following hybridisation, the slides are washed before being dried and then stored until scanning.
Arrays may be scanned using various methods in the art - such as an Agilent scanner (Agilent Technologies). Fluorescent intensities are extracted after subtraction of local background. Signal intensities are typically normalised by dividing the ratio of each data point by the median ratio of all autosomal clones on the array. Hybridisations of the test and control input chromatin, and differently labelled bulk chromatins bulk are performed to confirm the consistency of hybridisation and the absence of random scatter. Any data points falling > 2 standard deviations from the mean of colour reversal experiments will typically be removed from subsequent analysis. Cytogenetic and map position of the clones on the microarrays may be established using, for example, the NCBI assembly of the human genome in ENSEMBL.
The differences in hybridisation signals on the array can be used to detect changes - such as amplifications, deletions and/or duplications and the like. To control for this, the hybridisations to the arrays use input chromatin from the disease sample and open and/or closed chromatin from the disease sample. This will provide an internal control. Hybridisation of input chromatin from the diseased sample to input chromatin from a non-diseased sample may then be used to detect changes in the diseased sample.
In a further aspect of the present invention, there is provide an array comprising one or more compact chromatin probes and/or one or more open chromatin probes as described herein that are hybridised to the array.
Preferably, the microarray is a 1 Mb or 22q tiling microarray. Most preferably, the microarray is a human genomic 1 Mb or 22q tiling microarray.
Preferably, the array is an expression array.
In a further aspect, there is also provided a method for preparing an array comprising the step of hybridising one or more compact chromatin probes and/or one or more open chromatin probes to the array.
Preferably, input chromatin (ie. total chromatin) is also hybridised to the array.
It will be appreciated that the present invention has many applications in biotechnology and medicine. The present invention is broadly applicable to all eukaryotic genomes and allow for the determination of chromatin structure of one or more cells, one or more nuclei or one or more tissue samples and the like based on their chromatin structure. The methods of the present invention are also broadly applicable to all eukaryotic genomes and allow for the profiling of chromatin structure of one or more isolated cells, one or more isolated nuclei or one or more isolated tissue samples and the like based on their chromatin structure. In particular, the methods of the present invention can be used to determine the chromatin structure from certain diseased cells, nuclei, or tissues, which have an altered chromatin structure relative to the chromatin from otherwise healthy cells. In a preferred embodiment, the distribution of the compact and/or open chromatin (eg. the compact and/or open chromatin probes) in each of the samples is determined for a specific region of the genome - such as one or more specific genes in the genome.
Advantageously, this approach may be used to study the chromatin structure of very small discrete portions of the genome.
The method for identifying one or more changes in chromatin structure in a sample that can be correlated with a disease is modified such that the distribution of the compact and/or open chromatin probes in each of the samples is determined for one or more specific regions of the genome.
Accordingly, in this embodiment, method comprises the steps of: (a) determining the total amount of DNA in each of the compact chromatin probes and/or the open chromatin probes from the non-diseased and diseased samples; (b) measuring the abundance of the specific region(s) of interest; and (c) comparing the results from step (a) and (b) to determine if the chromatin structure of the specific region(s) has altered between the non-diseased and diseased samples.
To analyse one or more specific regions of the genome at high resolution, samples (which will typically be in the form of gel slices) may be isolated from compact to open chromatin. For some embodiments of the invention, it is necessary to isolate only a single sample if for example, the specific confirmation of chromatin to be analysed is known. By way of example, if specific regions of open chromatin are to be analysed then it may be necessary to use a single open chroamtin sample only. For other embodiments, it is preferred to use more than one sample - such as at least 3 samples, at least 7 samples, at least 10 samples, at least 14 samples, at least 16 samples or even at least 20 samples from compact to open chroamtin. The total quantity of DNA in each of the samples is determined using the methods described herein or any other suitable method - such as radio-labeling or a spectrophotometer etc. To measure the abundance of the one or more specific regions - such as one or more specific gene sequence - real time PCR is then used with region or gene specific primers. Preferably, the specific region of the genome is a single gene or loci.
Preferably, the abundance of the specific region of the genome is determined using real time PCR.
Real-time (or quantitative) PCR is an existing research technique that can be used to detect and quantify target sequences of DNA. Typically, real-time PCR is performed using a LightCycler. Preferably, a fluorescent dye - such as Sybr green - is used which binds to the minor groove of the DNA double helix, hi solution, the unbound dye exhibits very little fluorescence, however, fluorescence is greatly enhanced upon DNA-binding. Since Sybr Green dye is very stable (only 6% of the activity is lost during 30 amplification cycles) and the LightCycler instrument's optical filter set typically matches the wavelengths of excitation and emission, it is the reagent of choice when measuring total DNA. This method results in direct detection and quantification of a DNA sequence with a high degree of specificity (no false positives), accuracy, and sensitivity.
Advantageously, this aspect of the present invention can be used, for example, to identify specific regions of the genome which are likely to change during the development of a diseased cell — such as a cancerous cell.
Preferably, the quantity of total DNA is measured using quantitative DOP-PCR.
DOP-PCR has been described previously by Telenius et al. (1992) in Genomics 13, 718-725 and Genes Chromosomes Cancer 4, 257-263.
Briefly, the method may be performed as follows. DNA - such as human genomic
DNA - is prepared and diluted for standards (eg. 1:300, 1:1000, 1:3000, 1:10000, 1:30000, and 1:100000). A real time PCR mix may be prepared as follows on ice - containing, for example, a master PCR mix, MgCl2, a 1:1000 dilution of Sybr green,
DOP-Primer (6MW - CCGACTCGAGNNNNNNATGTGG or DOPl - CCGACTCGAGNNNNNNCTAGAA) and water. The PCR mix is aliquoted into aliquots. In duplicate, a 1:10 dilution of DNA from each of the gel slices is added in addition to the standards. The samples are then analysed on a light cycler (Roche). The baseline adjustment is set and standard curves created to determine concentration of samples.
To determine the amount of a specific DNA sequence in each fraction, the above is repeated but the DOP-PCR primer is replaced with a sequence-specific primer and diluted genomic DNA samples are used as standards (eg. 1:100, 1:000, 1:10,000). The PCR program is optimised for each sequence specific primer. After PCR the baseline adjustment is set and a standard curve prepared to determine concentration of samples. The total amount of DNA can be compared to the amount of sequence-specific DNA in each fraction.
In a further aspect, there is also provided a method for identifying one or more changes in a specific region of chromatin structure that can be correlated with a disease comprising the steps of: (a) preparing a plurality of chromatin fragments from a diseased and a non-diseased sample; (b) sedimenting the chromatin fragments from each of the samples into one or more fractions; (c) resolving at least one of the fractions into chromatin fragments of different lengths; (d) isolating DNA fragments that are shorter or longer than bulk chromatin; (e) digesting the DNA fragments into one or more probes; (f) determining the total amount of DNA in the DNA fragments isolated in step (d); (g) determining the abundance of the specific region of the genome in the DNA fragments isolated in step (d); and (h) comparing the results from steps (f) and (g) for each of the diseased and non-diseased samples to determine if the chromatin structure of the specific region has been altered.
CHROMATIN MODULATING AGENT
The methods of the present invention facilitate the generation of a substantial amount of information on chromatin structure, preferably, compact and/or open chromatin structure. Once the chromatin structure has been determined for a particular cell, a particular disease state, or a particular developmental state for example, the chromatin structure may be modified to alter the expression of the genetic information from chromatin.
A person skilled in the art will appreciate that the nucleic acid sequences in chromatin may be modified using standard techniques - such as site directed mutagenesis - to modulate the chromatin structure. These modifications to the nucleic acid sequence will affect chromatin structure and the expression of the genetic information therein.
As an alternative to modulating chromatin structure by altering the nucleic acid sequence, chromatin may be modified using agents that act in a more general fashion to cut and reshape chromatin without necessarily altering individual nucleotides. In this regard, the present invention also enables the identification and characterisation of such chromatin modulating agents. More particularly, the ability of the methods of the invention to provide information on chromatin structure facilitates the screening of potential new chromatin modulating agents and enables known agents to be better characterised.
Thus, the methods of the present invention may be used to identify one or more agents that modulate chromatin, compositions for use in medicine comprising at least one chromatin modulating agent of the present invention and methods of using chromatin modulating agents of the present invention in the preparation of a medicament for the treatment of diseases.
Accordingly, in a further aspect, there is provided a method for identifying one or more agents that modulate chromatin structure comprising the steps of: (a) preparing compact chromatin probe(s) and/or open chromatin probe(s) as described herein from a sample; (b) preparing compact chromatin probe(s) and/or open chromatin probe(s) as described herein from a sample that has been contacted with one or more agents; and (c) comparing the distribution of the compact and/or open chromatin probes in each of the samples; wherein steps (a) and (b) can be performed in either order; and wherein a difference between (i) the distribution of the compact and/or open chromatin probes in the sample and (ii) the distribution of the compact and/or open chromatin probes in the diseased sample is indicative that the one or more agents modulate chromatin structure.
As used herein, the term "modulating", in the context of the chromatin modulating agent may refer to preventing, decreasing, suppressing, alleviating, restoring, elevating, increasing or otherwise affecting chromatin structure.
The "chromatin modulating agent" may refer to a single entity or a combination of entities.
The chromatin modulating agent may be an organic compound or other chemical. The chromatin modulating agent may be a compound, which is obtainable from or produced by any suitable source, whether natural or artificial. The chromatin modulating agent may be an amino acid molecule, a polypeptide, or a chemical derivative thereof, or a combination thereof. The chromatin modulating agent may even be a polynucleotide molecule - which may be a sense or an anti-sense molecule. The chromatin modulating agent may even be an antibody.
The chromatin modulating agent may be designed or obtained from a library of compounds, which may comprise peptides, as well as other compounds, such as small organic molecules.
By way of example, the chromatin modulating agent may be a natural substance, a biological macromolecule, or an extract made from biological materials such as bacteria, fungi, or animal (particularly mammalian) cells or tissues, an organic or an inorganic molecule, a synthetic agent, a semi-synthetic agent, a structural or functional mimetic, a peptide, a peptidomimetics, a derivatised agent, a peptide cleaved from a whole protein, a peptide synthesised synthetically (such as, by way of example, either using a peptide synthesizer or by recombinant techniques) or combinations thereof, a recombinant agent, an antibody, a natural or a non-natural agent, a fusion protein or equivalent thereof and mutants, derivatives or combinations thereof. The chromatin modulating agent may be an organic compound. Typically the organic compounds may comprise two or more hydrocarbyl groups. Here, the term "hydrocarbyl group" means a group comprising at least C and H and may optionally comprise one or more other suitable substituents. Examples of such substituents may include halo-, alkoxy-, nitro-, an alkyl group, a cyclic group etc. In addition to the possibility of the substituents being a cyclic group, a combination of substituents may form a cyclic group. If the hydrocarbyl group comprises more than one C then those carbons need not necessarily be linked to each other. For example, at least two of the carbons may be linked via a suitable element or group. Thus, the hydrocarbyl group may contain hetero atoms. Suitable hetero atoms will be apparent to those skilled in the art and include, for instance, sulphur, nitrogen and oxygen. The chromatin modulating agent may comprise at least one cyclic group. The cyclic group may be a polycyclic group, such as a non-fused polycyclic group. The chromatin modulating agent may comprise at least one of said cyclic groups linked to another hydrocarbyl group.
The chromatin modulating agent may contain halo groups. Here, "halo" means halogen compounds eg. halides and includes fluoro, chloro, bromo or iodo groups.
The chromatin modulating agent may contain one or more of alkyl, alkoxy, alkenyl, alkylene and alkenylene groups - which may be unbranched- or branched-chain.
The chromatin modulating agent may be in the form of a pharmaceutically acceptable salt - such as an acid addition salt or a base salt - or a solvate thereof, including a hydrate thereof. For a review on suitable salts see Berge et al, J. Pharm. ScL, 1977, 66, 1-19.
The chromatin modulating agent may be capable of displaying other therapeutic properties. The chromatin modulating agent may be used in combination with one or more other pharmaceutically active agents.
If combinations of active agents are administered, then they may be administered simultaneously, separately or sequentially.
STEREO AND GEOMETRIC ISOMERS
The chromatin modulating agents may exist as stereoisomers and/or geometric isomers — e.g. they may possess one or more asymmetric and/or geometric centres and so may exist in two or more stereoisomeric and/or geometric forms. The present invention contemplates the use of the entire individual stereoisomers and geometric isomers of those chromatin modulating agents, and mixtures thereof. The terms used in the claims encompass these forms, provided said forms retain the appropriate functional activity (though not necessarily to the same degree).
PHARMACEUTICAL SALT
The chromatin modulating agent may be administered in the form of a pharmaceutically acceptable salt.
Pharmaceutically-acceptable salts are well known to those skilled in the art, and for example include those mentioned by Berge et al, in J. Pharm. Sd., 66, 1-19 (1977). Suitable acid addition salts are formed from acids which form non-toxic salts and include the hydrochloride, hydrobromide, hydroiodide, nitrate, sulphate, bisulphate, phosphate, hydrogenphosphate, acetate, trifluoroacetate, gluconate, lactate, salicylate, citrate, tartrate, ascorbate, succinate, maleate, fumarate, gluconate, formate, benzoate, methanesulphonate, ethanesulphonate, benzenesulphonate and p-toluenesulphonate salts.
When one or more acidic moieties are present, suitable pharmaceutically acceptable base addition salts can be formed from bases which form non-toxic salts and include the aluminium, calcium, lithium, magnesium, potassium, sodium, zinc, and pharmaceutically-active amines such as diethanolamήie, salts.
A pharmaceutically acceptable salt of a chromatin modulating agent may be readily prepared by mixing together solutions of a chromatin modulating agent and the desired acid or base, as appropriate. The salt may precipitate from solution and be collected by filtration or may be recovered by evaporation of the solvent.
A chromatin modulating agent may exist in polymorphic form.
A chromatin modulating agent may contain one or more asymmetric carbon atoms and therefore exist in two or more stereoisomeric forms. Where a chromatin modulating agent contains an alkenyl or alkenylene group, cis (E) and trans (Z) isomerism may also occur. The present invention includes the individual stereoisomers of a chromatin modulating agent and, where appropriate, the individual tautomeric forms thereof, together with mixtures thereof.
Separation of diastereoisomers or cis- and trans-isomeτs may be achieved by conventional techniques, e.g. by fractional crystallisation, chromatography or H.P.L.C. of a stereoisomeric mixture of an agent or a suitable salt or derivative thereof. An individual enantiomer of a chromatin modulating agent may also be prepared from a corresponding optically pure intermediate or by resolution, such as by H.P.L.C. of the corresponding racemate using a suitable chiral support or by fractional crystallisation of the diastereoisomeric salts formed by reaction of the corresponding racemate with a suitable optically active acid or base, as appropriate.
The present invention also encompasses all suitable isotopic variations of a chromatin modulating agent or a pharmaceutically acceptable salt thereof. An isotopic variation of a chromatin modulating agent or a pharmaceutically acceptable salt thereof is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually found in nature. Examples of isotopes that may be incorporated into a chromatin modulating agent and pharmaceutically acceptable salts thereof include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine and chlorine such as H, H, 13C, 14C, 15N, 17O, 18O, 31P, 32P, 35S, 18F and 36Cl, respectively. Certain isotopic variations of a chromatin modulating agent and pharmaceutically acceptable salts thereof, for example, those in which a radioactive isotope such as 3H or 14C is incorporated are useful in drug and/or substrate tissue distribution studies. Tritiated, i.e., 3H, and carbon- 14, i.e., 14C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium, i.e., 2H, may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence may be preferred in some circumstances. Isotopic variations of chromatin modulating agents and pharmaceutically acceptable salts thereof can generally be prepared by conventional procedures using appropriate isotopic variations of suitable reagents.
It will be appreciated by those skilled in the art that a chromatin modulating agent may be derived from a prodrug. Examples of prodrugs include entities that have certain protected group(s) and which may not possess pharmacological activity as such, but may, in certain instances, be administered (such as orally or parenterally) and thereafter metabolised in the body to form an agent of the present invention which are pharmacologically active.
It will be further appreciated that certain moieties known as "pro-moieties", for example as described in "Design of Prodrugs" by H. Bundgaard, Elsevier, 1985 (the disclosured of which is hereby incorporated by reference), may be placed on appropriate functionalities of chromatin modulating agents. Such prodrugs are also included within the scope of the invention.
The present invention also includes the use of zwitterionic forms of a chromatin modulating agent of the present invention. The terms used in the claims encompass one or more of the forms just mentioned. PHARMACEUTICALLY ACTIVE SALT
A chromatin modulating agent may be administered as a pharmaceutically acceptable salt. Typically, a pharmaceutically acceptable salt may be readily prepared by using a desired acid or base, as appropriate. The salt may precipitate from solution and be collected by filtration or may be recovered by evaporation of the solvent.
CHEMICAL SYNTHESIS METHODS
The chromatin modulating agent may be prepared by chemical synthesis techniques.
It will be apparent to those skilled in the art that sensitive functional groups may need to be protected and deprotected during synthesis of a chromatin modulating agent. This may be achieved by conventional techniques, for example as described in "Protective Groups in Organic Synthesis" by T W Greene and P G M Wuts, John Wiley and Sons Inc. (1991), and by P J.Kocienski, in "Protecting Groups", Georg Thieme Verlag (1994).
It is possible during some of the reactions that any stereocentres present could, under certain conditions, be racemised, for example if a base is used in a reaction with a substrate having an having an optical centre comprising a base-sensitive group. This is possible during e.g. a guanylation step. It should be possible to circumvent potential problems such as this by choice of reaction sequence, conditions, reagents, protection/deprotection regimes etc. as is well-known in the art.
The compounds and salts may be separated and purified by conventional methods.
Separation of diastereomers may be achieved by conventional techniques, e.g. by fractional crystallisation, chromatography or H.P.L.C. of a stereoisomeric mixture of a compound or a suitable salt or derivative thereof. An individual enantiomer of a compound may also be prepared from a corresponding optically pure intermediate or by resolution, such as by H.P.L.C. of the corresponding racemate using a suitable chiral support or by fractional crystallisation of the diastereomeric salts formed by reaction of the corresponding racemate with a suitably optically active acid or base.
The chromatin modulating agent may be produced using chemical methods to synthesise the chromatin modulating agent in whole or in part. For example, if the chromatin modulating agent is a peptide, then the peptide can be synthesised by solid phase techniques, cleaved from the resin, and purified by preparative high performance liquid chromatography (e.g., Creighton (1983) Proteins Structures And Molecular
Principles, WH Freeman and Co, New York NY). The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; Creighton, supra).
CHEMICAL DERIVATIVE
The term "derivative" or "derivatised" as used herein includes chemical modification of an chromatin modulating agent. Illustrative of such chemical modifications would be replacement of hydrogen by a halo group, an alkyl group, an acyl group or an amino group.
CHEMICAL MODIFICATION
The chromatin modulating agent may be a chemically modified agent.
The chemical modification of a chromatin modulating agent may either enhance or reduce hydrogen bonding interaction, charge interaction, hydrophobic interaction, Van Der Waals interaction or dipole interaction.
In one aspect, the chromatin modulating agent may act as a model (for example, a template) for the development of other compounds.
PHARMACEUTICAL COMPOSITIONS In a further aspect, there is provided a pharmaceutical composition comprising a chromatin modulating agent identified by the methods described herein admixed with a pharmaceutically acceptable carrier, diluent, excipient or adjuvant and/or combinations thereof.
Pharmaceutical compositions may be for human or animal usage in human and veterinary medicine and will typically comprise any one or more of a pharmaceutically acceptable diluent, carrier, or excipient. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985). The choice of pharmaceutical carrier, excipient or diluent may be selected with regard to the intended route of administration and standard pharmaceutical practice. Pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s) or solubilising agent(s).
Preservatives, stabilizers, dyes and even flavoring agents may be provided in pharmaceutical compositions. Examples of preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used.
There may be different composition/formulation requirements dependent on the different delivery systems. By way of example, pharmaceutical compositions useful in the present invention may be formulated to be administered using a mini-pump or by a mucosal route, for example, as a nasal spray or aerosol for inhalation or ingestable solution, or parenterally in which the composition is formulated by an injectable form, for delivery, by, for example, an intravenous, intramuscular or subcutaneous route. Alternatively, the formulation may be designed to be administered by a number of routes.
Chromatin modulating agents may also be used in combination with a cyclodextrin. Cyclodextrins are known to form inclusion and non-inclusion complexes with drug molecules. Formation of a drug-cyclodextrin complex may modify the solubility, dissolution rate, bioavailability and/or stability property of a drug molecule. Drug- cyclodextrin complexes are generally useful for most dosage forms and administration routes. As an alternative to direct complexation with the drug the cyclodextrin may be used as an auxiliary additive, e.g. as a carrier, diluent or solubiliser. Alpha-, beta- and gamma-cyclodextrins are most commonly used and suitable examples are described in WO-A-91/11172, WO-A-94/02518 and WO-A-98/55148.
If the chromatin modulating agent is a protein, then said protein may be prepared in situ in the subject being treated. In this respect, nucleotide sequences encoding said protein may be delivered by use of non- viral techniques (e.g. by use of liposomes) and/or viral techniques (e.g. by use of retroviral vectors) such that the said protein is expressed from said nucleotide sequence.
ADMINISTRATION
The present invention provides a method of modulating chromatin structure in a subject comprising administering to the subject an effective amount of one or more chromatin modulating agents identified according to the methods of the present invention.
The chromatin modulating agents of the present invention may be administered alone but will generally be administered as a pharmaceutical composition comprising one or more components — e.g. when the components are in admixture with a suitable pharmaceutical excipient, diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice.
For example, the components may be administered (e.g. orally) in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release applications. If the pharmaceutical is a tablet, then the tablet may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.
Solid compositions of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols. For aqueous suspensions and/or elixirs, the chromatin modulating agent may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
The routes for administration (delivery) include, but are not limited to, one or more of: oral (e.g. as a tablet, capsule, or as an ingestable solution), topical, mucosal (e.g. as a nasal spray or aerosol for inhalation), nasal, parenteral (e.g. by an injectable form), gastrointestinal, intraspinal, intraperitoneal, intramuscular, intravenous, intrauterine, intraocular, intradermal, intracranial, intratracheal, intravaginal, intracerebroventricular, intracerebral, subcutaneous, ophthalmic (including intravitreal or intracameral), transdermal, rectal, buccal, vaginal, epidural, sublingual.
It is to be understood that not all of the components of the pharmaceutical need be administered by the same route. Likewise, if the composition comprises more than one active component, then those components may be administered by different routes.
If a component is administered parenterally, then examples of such administration include one or more of: intravenously, intra-arterially, intraperitoneally, intrathecally, intraventricularly, intrauretbrally, intrasternally, intracranially, intramuscularly or sύbcutaneously administering the component; and/or by using infusion techniques.
For parenteral administration, the component is best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood. The aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary. The preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well-known to those skilled in the art.
As indicated, the component(s) useful in the present invention may be administered intranasally or by inhalation and is conveniently delivered in the form of a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray or nebuliser with the use of a suitable propellant, e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, a hydrofluoroalkane such as 1,1,1,2-tetrafluoroethane (HFA 134A™) or 1,1,1,2,3,3,3-heptafluoropropane (HFA 227EA™), carbon dioxide or other suitable gas. In the case of a pressurised aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. The pressurised container, pump, spray or nebuliser may contain a solution or suspension of the active compound, e.g. using a mixture of ethanol and the propellant as the solvent, which may additionally contain a lubricant, e.g. sorbitan trioleate. Capsules and cartridges (made, for example, from gelatin) for use in an inhaler or insufflator may be formulated to contain a powder mix of the agent and a suitable powder base such as lactose or starch.
Alternatively, the component(s) may be administered in the form of a suppository or pessary, or it may be applied topically in the form of a gel, hydrogel, lotion, solution, cream, ointment or dusting powder. The component(s) may also be dermally or transdermally administered, for example, by the use of a skin patch. They may also be administered by the pulmonary or rectal routes. They may also be administered by the ocular route. For ophthalmic use, the compounds may be formulated as micronised suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzylalkonium chloride. Alternatively, they may be formulated in an ointment such as petrolatum.
For application topically to the skin, the component(s) may be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water. Alternatively, it may be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
The term "administered" also includes delivery by viral or non- viral techniques. Viral delivery mechanisms include but are not limited to adenoviral vectors, adeno- associated viral (AAV) vectos, herpes viral vectors, retroviral vectors, lentiviral vectors, and baculoviral vectors. Non-viral delivery mechanisms include lipid mediated transfection, liposomes, immunoliposomes, lipofectin, cationic facial amphiphiles (CFAs) and combinations thereof.
DOSE LEVELS
Typically, a physician will determine the actual dosage which will be most suitable for an individual subject. The specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of adrninistration, rate of excretion, drug combination, the severity of the particular condition, and the individual undergoing therapy.
FORMULATION The component(s) may be formulated into a pharmaceutical composition, such as by mixing with one or more of a suitable carrier, diluent or excipient, by using techniques that are known in the art.
GENERAL ASSAY TECHNIQUES
Any one or more appropriate targets - such as compact and/or open chromatin that is amplified in, for example, a diseased cell as compared to a non-diseased cell - may be used for identifying a chromatin modulating agent.
The target employed in such a test may be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly. The abolition of target activity or the formation of binding complexes between the target and the chromatin modulating agent being tested may be measured.
The methods of the present invention may be a screen, whereby a number of chromatin modulating agents are tested.
Techniques for drug screening may be based on the method described in Geysen, European Patent Application 84/03564, published on September 13, 1984. In summary, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with a suitable target or fragment thereof and washed. Bound entities are then detected - such as by appropriately adapting methods well known in the art. A purified target may also be coated directly onto plates for use in a drug screening techniques. Alternatively, non-neutralising antibodies may be used to capture the peptide and immobilise it on a solid support.
It is expected that the methods of the present invention will be suitable for both small and large-scale screening of test compounds as well as in quantitative assays. IMMUNE MODULATOR
An immune modulator - such as a vaccine - may be identified using the methods of the present invention that is used for inoculation against a disease.
The immune modulator may be isolated from a suitable source, or it may be made synthetically or it may be prepared by the use of recombinant DNA techniques. The immune modulator may be administered in combination with an adjuvant to provide a generalised stimulation of the immune system.
TREATMENT
It is to be appreciated that all references herein to treatment include one or more of curative, palliative and prophylactic treatments. Preferably, the term treatment includes at least curative treatment and/or palliative treatment.
The treatment may be combined with other treatments - such as radiotherapy.
THERAPY
The agents may be used as therapeutic agents - i.e. in therapy applications.
As with the term "treatment", the term "therapy" includes curative effects, alleviation effects, and prophylactic effects.
The therapy may be on humans or animals.
ANIMAL TEST MODELS
In vivo models may be used to investigate and/or design therapies or therapeutic chromatin modulating agents to treat a disease - such as cancer. The models could be used to investigate the effect of various tools/lead compounds on a variety of parameters, which are implicated in the development of or treatment of a disease. The animal test model will be a non-human animal test model.
DISEASES
As used herein, the term "disease" may include those diseased listed in WO-A- 98/09985.
Preferably, the disease involves mental retardation — such as ATR-X syndrome, Rett syndrome, ICF syndrome, FSHD, Coffin-Lowry syndrome, Rubinstein-Taybi syndrome, Juberg Marsidi syndrome, Sutherland Haan syndrome, Smith Fineman
Myers syndrome, Schimke immunoosseous dysplasia, Sotos syndrome, Atrichia, X- linked Emery Dreifuss, muscular dystrophy, Autosomal EDMD, CMT2B1, mandibuloacral dysplasia, limb-girdle muscular dystrophy type IB, familial partial lipodystrophy, dilated cardiomyopathy IA, Hutchinson Gilford progeria syndrome,
Pelger Huet anomaly and Charge syndrome.
Preferably, the disease is cancer. More preferably, the disease is any cancer which involves chromosomal translocations, deletions or duplications that affect or modulate chromatin proteins and/or chromatin structure, or involve the mis-regulation of genes due to any alteration in chromatin proteins and/or chromatin structure. Specific examples of such cancers include, but are not limited to, non-hodgkins lymphoma including: acute leukemia, Chronic B malignancies (small lymphocytic lymphoma/chronic lymphocytic leukemia, follicular lymphoma, marginal zone lymphoma), large B-cell lymphoma, mantle cell lymphoma, chronic myeloid leukemia, myelo dysplasia and myelodysplasia which can give rise to myeloid leukemia.
DIAGNOSIS
According to the present invention, a disease associated with altered (eg. modified) chromatin structure may be diagnosed in a sample taken from a subject - such as a mammalian subject (eg. a human or an animal). A convenient way to diagnose the disease may be to compare the chromatin structure that is obtained from the sample from the subject with the chromatin structure obtained from one or diseased samples.
A correlation between the chromatin structure of the sample and the chromatin structure of one or more of the diseased samples is indicative that the sample (and hence the subject from which the sample was taken) is suffering from that disease.
By way of example, the genome wide chromatin structure of a diseased sample may be compared to the chromatin structure of a non-diseased sample (ie. a sample that is not suffering from the same disease as the diseased sample). DNA from input chromatin, preferably, open and/or bulk chromatin structures, may be hybridised to an array, preferably a genomic microarray, and the differences in hybridisation signals on the array can then be used to detect changes - such as changes in DNA sequence copy number - such as amplifications and deletions. Thus, it may be advantageous to use the methods of the present invention to determine the chromatin structure of different samples suffering from different disease states. Using this approach it is then possible to correlate the chromatin structure in the subject to be diagnosed with that of the chromatin structure of a known disease.
Thus, in a further aspect there is provided a method for diagnosing the presence of a disease in a sample comprising the steps of: (a) preparing compact chromatin probe(s) and/or open chromatin probe(s) using the methods described herein from a sample; (b) preparing compact chromatin probe(s) and/or open chromatin probe(s) (or libraries thereof) using the methods described herein from one or more diseased samples; and comparing the distribution of the compact and/or open chromatin probes in each of the samples; wherein steps (a) and (b) can be performed in either order; and wherein a correlation between (i) the distribution of the compact and/or open chromatin probe(s) in the sample and (ii) the distribution of the compact and/or open chromatin probe(s) in one or more of the diseased cells is indicative that the sample suffers from the same disease. Furthermore, when particular diseases have characteristic chromatin structures the methods of the present invention may be used to diagnose a particular form or type of disease - such as a particular form or type of cancer. For example, the particular form or type of disease afflicting a subject may be determined by determining the chromatin structure in the sample from the subject and comparing this with one or more chromatin structures that are indicative of particular forms or types of a disease. The detailed and accurate diagnosis of disease forms may facilitate the correct choice of therapeutic treatment for the disease and thus increases the chances of successfully treating the disease.
Thus, in a further aspect there is provided a method for diagnosing a particular form or type of a disease in a sample comprising the steps of: (a) preparing compact chromatin probe(s) and/or open chromatin probe(s) (or libraries thereof) using the methods described herein from the diseased sample; (b) preparing compact chromatin probe(s) and/or open chromatin probe(s) (or libraries thereof) using the methods described herein from one or more diseased samples suffering from a particular form or type of a disease; and comparing the distribution of the compact and/or open chromatin probes in the samples; wherein steps (a) and (b) can be performed in either order; and wherein a correlation between (i) the distribution of the compact and/or open chromatin probes in the diseased sample and (ii) the distribution of the compact and/or open chromatin probes in one or more of the diseased cells suffering from a particular form or type of a disease is indicative that the sample is suffering from that form or type of the disease.
DISEASE PROGRESSION
Disease progression may be associated with changes in chromatin structure in affected cells. Thus, in addition to diagnosing a disease, the present invention may also be used to monitor the progress or stage of a disease in a subject. For example, the progression of a particular type of a disease (eg. cancer) afflicting a subject may be determined by detenmning the chromatin structure in the subject's diseased cells and comparing them with chromatin structures indicative of the progression of a particular type of disease. For example, the particular type or stage of disease afflicting a subject may be determined by determining the chromatin structure in the sample from the subject and comparing this with one or more chromatin structures that are indicative of the type or stage of the disease. The detailed and accurate diagnosis of the stage of the disease may facilitate the correct choice of therapeutic treatment for the disease and thus increases the chances of successfully treating the disease.
Thus, in still a further aspect, there is provided a method for diagnosing the progression of a particular form of a disease comprising the steps of: (a) preparing compact chromatin probe(s) and/or open chromatin probe(s) as described herein from the sample; and (b) comparing the distribution of the compact and/or open chromatin probe(s) m the sample with the distribution of the compact and/or open chromatin probe(s) in one or more samples that are indicative of the progression of a particular type of disease; wherein a correlation between (i) the distribution of the compact and/or open chromatin probes in the sample and (ii) the distribution of the compact and/or open chromatin probes in one or more samples suffering from a particular type or stage of disease is indicative that the diseased sample is at that particular stage or is that particular type of the disease.
CELLULAR DEVELOPMENT
Chromatin structure may also be an indicator of cellular development. Ih this regard, cells at different stages of development may have unique chromatin structures. Thus, the present invention may be used to monitor cell development in a cell population.
Accordingly, in still a further aspect there is provided a method for determining the stage of cellular development in a cell comprising the steps of: (a) preparing a compact chromatin probe and/or an open chromatin probe as described herein from the cell; and (b) comparing the distribution of the compact and/or open chromatin probes in the cell with the distribution of the compact and/or open chromatin probes in one or more cell(s) that are at a particular stage of development; wherein a correlation between (i) the distribution of the compact and/or open chromatin probes in the cell and (ii) the distribution of the compact and/or open chromatin probes in one or more cell(s) that are at a particular stage of development is indicative that the cell is at a particular stage of development.
MODULATING A DISEASE
The agents identified, using the method of the present invention may be used for diagnostic purposes (i.e. a diagnostic agent) and/or for therapeutic purposes (i.e. a therapeutic agent).
hi a further aspect the present invention relates to a method for identifying one or more agents that modulate a disease comprising the steps of: (a) providing a first diseased cell that has been contacted with an agent and a second diseased cell that has not been contacted with the agent; (b) preparing a plurality of chromatin fragments; (c) sedimenting the chromatin fragments into one or more fractions; (d) resolving at least one of the fractions into chromatin fragments of different lengths; and (e) comparing the chromatin structure of the chromatin fragments of step (d); wherein a difference in chromatin structure is indicative that the agent modulates the disease.
According to this aspect of the present invention, a comparison of the chromatin structure between the diseased and non-diseased cells is indicative that the agent modulates the disease. By identifying those regions of chromatin structure that are different will lead to the identification of a panel of novel targets that can then be used to assess the impact of this difference on disease progression and survival.
IDENTIFYING CHANGES IN SPECIFIC CHROMATIN REGIONS
In a further aspect of the present invention, there is provided a method for identifying changes (eg. alterations) in specific chromatin regions comprising the steps of: (i) providing a sample comprising one or more chromatin fragments; (ii) determining the total amount of DNA in the sample; and (iii) determining the abundance of the specific chromatin region of interest in the sample; wherein a difference between (ii) and (iii) is indicative that the chromatin structure of the specific region of interest has changed.
This method is particularly suitable for identifying specific regions of the genome that have altered between different samples - such as between different cell types, hi a particularly preferred embodiment, this method is used for identifying specific regions of the genome that have altered during the development of cancerous cells.
The quantity of total DNA in a sample (eg. recovered from a gel slice) is determined by a novel PCR method that we have called quantitative degenerative oligo-PCR
(DOP-PCR). This method is performed by preparing a dilution series of the DNA to be analysed for standards. A typical dilution series may be as follows: 1:300, 1:1000,
1:3000, 1:10000, 1:30000 and 1:100000). A realtime PCR mix is prepared using methods that are routine to a skilled person. Typically, this mix will comprise a master mix, MgCl2, a dilution of a fluorescent label - such as Sybr green - and water in addition to the DOP-Primer, which can be either:
CCGACTCGAGNNNNNNATGTGG(6MW);or
CCGACTCGAGNNNNNNCTAGAA(DOPl)
A dilution (eg. a 1:10 dilution) of the DNA in the sample and each of the standards to are added to reactions. The samples are run on, for example, a light cycler (Roche) and a standard curve is created to determine the DNA concentration of the sample. To determine the amount of the specific chromatin region of interest in the sample, the above method is repeated but the DOP-PCR primer is replaced with sequence-specific primers and diluted genomic DNA samples as standards (eg. at dilutions of 1:100, 1:000 and 1:10,000). The PCR program is optimised for each sequence specific primer. Standard curves are again created to determine the concentration of samples. The total amount of DNA can be compared to the amount of sequence-specific DNA in each fraction. A difference between the amounts is indicative that the chromatin structure of the specific region of interest has been altered.
NUCLEOTIDE SEQUENCE
As used herein, the term "nucleotide sequence" is synonymous with the term "polynucleotide".
The nucleotide sequence may be DNA of genomic or synthetic or recombinant origin. The nucleotide sequence may be double-stranded or single-stranded whether representing the sense or antisense strand or combinations thereof.
The nucleotide sequence may be prepared by use of recombinant DNA techniques (e.g. recombinant DNA).
The nucleotide sequence may be the same as the naturally occurring form, or may be derived therefrom.
Preferably, the DNA is of genomic origin, preferably, human genomic origin.
The nucleotide sequences may include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known hi the art. These include methylphosphonate and phosphorothioate backbones and/or the addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. For the purposes of the present invention, it is to be understood that the nucleotide sequences may be modified by any method available in the art. Such modifications may be carried out to enhance the in vivo activity or life span of nucleotide sequences.
GENE THERAPY The present invention also encompasses gene therapy whereby nucleotide sequences that encode chromatin modulating agents are expressed in vivo..
By way of example, a nucleotide sequence encoding a chromatin modulating agent may be under the control of an expression regulatory element - such as a promoter or a promoter and enhancer. The enhancer and/or promoter may even be active in particular tissues, such that the nucleotide sequence coding for the chromatin modulating agent is preferentially expressed. The enhancer element or other elements conferring regulated expression may be present in multiple copies. Likewise, or in addition, the enhancer and/or promoter may be preferentially active in one or more specific cell types.
The level of expression of the nucleotide sequence coding for the chromatin modulating agent, may be modulated by manipulating the promoter region. For example, different domains within a promoter region may possess different gene regulatory activities.
GENERAL RECOMBINANT DNA METHODOLOGY TECHNIQUES
The present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N. Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, M Press; and, D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Each of these general texts is herein incorporated by reference. The invention will now be further described by way of Examples, which are meant to serve to assist one of ordinary skill in the art in carrying out the invention and are not intended in any way to limit the scope of the invention.
EXAMPLES
Example 1
Experimental procedures
Chromatin preparation and nuclease digestion
A normal human male lymphoblastoid cell line (FATO) was grown in RPMI medium (Gibco) supplemented with 10% foetal calf serum (FCS), MEM non-essential amino acids (Sigma), 2mM L-Glutamine, 0.5mM pyruvate, ImM oxaloacetic acid, 0.2 units/ml human insulin, penicillin/streptomycin and 3mM MOPS. Cell nuclei were prepared as described (Gilbert et al, 2003) and resuspended in NB-R (85mM KCl,
1OmM Tris-HCl (ρH7.6), 5.5% (w/v) sucrose, 1.5mM CaC12, 3mM MgC12, 25OmM PMSF). They were digested with 8-14units of MNase OVorthington), per 20 A260 units nuclei, for 10 minutes at room temperature in the presence of 100mg/ml RNaseA.
Digestion was stopped by adding EDTA to 1OmM. The nuclei were washed, resuspended in a small volume of TEEP20 (1OmM Tris-HCl pH 8.0, ImM EDTA,
ImM EGTA, 25OmM PMSF, 2OmM NaCl), and then incubated at 4°C overnight. Nuclear debris was removed by centrifugation leaving soluble chromatin in the supernatant.
Sucrose gradient sedimentation
Soluble chromatin was fractionated using sucrose gradient sedimentation (Noll and Noll, 1989) in TEEP80 (TEEP containing 8OmM NaCl). 400ml soluble chromatin was loaded on to a 6-40% isokinetic sucrose gradient and centrifuged at 4°C (41,000 rpm for 2.5hrs in a SW41 rotor). 500ml tractions were collected from the gradient by upward displacement and the DNA was purified from them by SDS/proteinase K digestion, phenol-chloroform, chloroform extraction and ethanol precipitation.
Agarose gel electrophoresis
DNA from gradient fractions was analysed by electrophoresis through 0.7% agarose in 1 ¥ TPE buffer (9OmM Tris-phosphate, 2mM EDTA) with buffer circulation. Preparative fractionation of DNA from gradient fractions was carried out by pulsed- field gel electrophoresis (PFGE) (CHEF system, Biorad) through 1% low melting point agarose in 0.5 ¥ TBE, at 180V, for 40hrs, with a 0.1 -2s switching time. Size markers were lkb (Promega) and 2.5kb (Biorad) DNA ladders. EtBr-stained gels were scanned using a 473nm laser and a 580nm band-pass filter on a Fuji FLA-2000. DNA from transverse gel slices was isolated by b-agarase (NEB) digestion, followed by phenol-chloroform, chloroform extraction and ethanol precipitation.
Labelling of DNA fractions
DNA purified from gel slices was either sonicated or digested with Sau3AI. After sonication the ends of the DNA were made blunt using mung bean nuclease (NEB).
The DNAs were ligated to annealed un-phosphorylated catch-linkers with either
Sau3AI or blunt compatible ends. The Sau3Al linkers are described previously
(Fantes et aL, 1995). Blunt-end linkers were the same but with the Sau3AI overhang removed. After ligation, nicks in the top strand (5 '-3') were translated using the strand displacement activity of Klenow exo- (NEB). The samples were then amplified by
PCR using one of the catchlinker oligonucleotides as primer (30 cycles of 94°C 1 min,
58°C 1 min , 720C 2 min). DNA samples were labelled for FISH by nick-translation with either biotin- or digoxigenin-dUTP, or dCTP. DNA samples for micro-array hybridisation were labelled by random-prime labelling as previously described (Shaw- Smith et al., 2004).
FISH 200ng of labelled DNA and the required amount of human Cotl DNA (Gibco) were hybridised to human metaphase chromosomes as previously described but using 2 days of hybridisation (Fantes et al., 1992). Non-specific hybridisation was removed by washing (Gilbert et al., 2003). Co-hybridisation of cosmid probes from 1 Ipl5.5 and a chromosome lip paint to nuclei prepared from FATO cells, was as previously described (Mahy et al., 2002). Biotinylated probes were detected using sequential layers of avidin-FITC and biotinylated anti-avidin. Digoxigenin-labelled probes were detected using rhodamine anti-dig sheep antibody and Texas Red-anti-sheep antibody (Vector). Slides were counterstained with 0.5mg/ml DAPI and imaged as previously described (Mahy et al., 2002).
Microarray hybridisation
Hybridisation to the 1 Mb and 22q tiling path arrays was performed as described previously (Fiegler et al., 2003), but with slight modification. Cy3 and Cy5 labelled test and control DNAs were combined, precipitated together with 135 μg of human Cotl DNA (Roche) and 600 μg yeast tRNA (Invitrogen) and resuspended in 30 μl of hybridisation buffer. To prehybridise the arrays, 800 μg of herring sperm DNA (Sigma) and 135 μg of Cotl DNA were resuspended in 45 μl of hybridisation buffer and incubated with the array for 1 hour at 370C under a coverslip. Slides were washed in PBS and spun dry (800 g, 1 rnin) before replacing the prehybridisation solution with the hybridisation mix. Hybridisation was performed under a coverslip for 24 hours at 370C in hybridisation chambers humidified with 20 % formamide and 2 ¥ SSC. Arrays were scanned using an Agilent scanner (Agilent Technologies). Fluorescent intensities were extracted after subtraction of local background using SPOT (Jain et al., 2002). Signal intensities were normalised by dividing the ratio of each data point by the median ratio of all autosomal clones on the array. Hybridisations of Cy3 input chromatin vs Cy5 input chromatin, and Cy3 bulk chromatin vs Cy5 bulk chromatin gave mean hybridisations ratios of 1.003 (s.d = 0.051) and 0.998 (s.d. = 0.031) respectively, confirming the consistency of hybridisation and the absence of random scatter. Any data points falling > 2 standard deviations from the mean of colour reversal experiments were removed from subsequent analysis. Cytogenetic and map position of BACs on the microarray was established using the NCBI build 34 assembly of the human genome.
Example 2
Sucrose gradient sedimentation of chromatin fibres from the human genome
Chromatin fibre structures can be separated by sucrose gradient sedimentation (Kimura et al., 1983; Fisher and Felsenfeld, 1986; Gilbert and Allan, 2001; Kim and
Clark, 2002). Sedimentation rate is determined by the mass (DNA length and protein composition), and hydrodynamic shape (compaction) of the fibre. A given length of
DNA will sediment faster than bulk chromatin if it is packaged into a more compact regular structure (Gilbert and Allan, 2001), and slower if it is packaged in fibres whose structure is interrupted by discontinuities that increase the frictional coefficient
(Kimura et al., 1983; Fisher and Felsenfeld, 1986; Caplan et al., 1987) (Figure IA).
To investigate human chromatin fibre structure we digested nuclei from lymphoblastoid cells with micrococcal nuclease (MNase), which cuts chromatin in the linker between nucleosomes. In the solenoid model of the 30nm fibre, there are 6 nucleosomes per helical turn (~1.2kb) (Thoma et al., 1979; McGhee et al., 1983; Wolffe, 1998), so to analyse structure that is propagated over extensive regions (50- 150 nucleosomes), we used digestion conditions which gave fragments of 10-30kb average length (Figure IA). Transcriptionally active regions are commonly considered to be more sensitive to nuclease digestion than inactive regions, but this is generally seen with DNaseI not MNase (Weintraub and Groudine, 1976; Bellard et al., 1978; Sun et al., 2001). To ensure that we were not preferentially releasing particular parts of the genome before loading onto the gradient, total genomic DNA and DNA from the digested soluble (input) chromatin were hybridised by fluorescence in situ hybridisation (FISH) to metaphase chromosomes, hi the presence of suppression of repeat hybridisation by human Cotl DNA, input chromatin and total genomic DNA hybridisation signals along the euchromatic part of chromosome arms were indistinguishable (Figure 8). Without Cotl suppression, biotin-dUTP labelled genomic DNA and input chromatin both hybridise strongly to centromeric and juxtacentromeric heterochromatin, showing that it is not refractory to digestion and solύbilisation (Figure 8A, B). Probes labelled with biotin-dCTP detect these satellites poorly because of their AT-richness (60%) (Tagarro et al., 1994) (Figure 8C). Therefore, all subsequent FISH data are from DNAs labelled with dUTP. Digested chromatin was sedimented through an isokinetic sucrose gradient (6-40%) (Noll and Noll, 1989). The gradient was fractionated from top to bottom so that fractions contain chromatin fibres with progressively increased sedimentation rate. Each fraction will contain fibres of the same sedimentation rate, but will consist of both DNA fragments of equal length with the same chromatin structure/ compaction, as well as shorter and longer fragments in more rigid/ compact, or more disordered/ open chromatin fibres, respectively. To separate these we resolved the DNA fragments from a fraction according to their size, by agarose gel electrophoresis (Figure IB). The peak of ethidium bromide (EtBr) staining corresponds to sequences that were packaged within fibres characteristic of the bulk genome. However, in each fraction there are smears of DNA fragments that are shorter or longer than those in the EtBr peak, and these should respectively contain sequences packaged in fibres that are more, or less, compact than those of the bulk genome (Figure 1C).
Example 3
Some human satellites are packaged into compact chromatin fibres
Mouse major and minor satellites are packaged into 30nm fibres that are more compact and regularly folded than those of bulk chromatin (Gilbert and Allan, 2001). The human genome contains a complex set of satellite repeats, a-satellite is present at each centromere, blocks of satellites 1, 2 and 3 and the b-satellite are present in juxtacentromeric blocks of heterochromatin (Tagarro et al., 1994; Shiels et al., 1997). To identify regions of the human genome that are packaged into the most compact chromatin fibres, we isolated DNA fragments from a sucrose gradient fraction that were 5 - 10kb shorter than those of the EtBr peak (Figure 1C). This DNA was hybridised to metaphase chromosome spreads (Figure 2). Without Cotl suppression most hybridisation signal was at sites of constitutive heterochromatin (C-bands); each of the centromeres, and juxtacentromeric heterochromatin at IqI 2 and 9ql2. Hybridisation to C-bands at 16qll and Yq was less apparent (Figure 2A). Therefore we conclude that some, but not all, human satellite repeats are enriched in compact chromatin fibres. When compact chromatin was hybridised in the presence of excess Cotl, to suppress the signal from repetitive sequences, the signal was enriched in some euchromatic regions (Figure 2B). Many of these sites (e.g. Ip31, Iq31 and q41, 3p24 and q24, 5q34, 7p21 and q21, 9q31, 12q21, 16pl2) corresponded with intensely staining G-bands that are depleted of genes (Furey and Haussler, 2003; http://www.ensembl.org/Homo_sapiens/). We conclude that euchromatic regions of the human genome with a very low gene-density are packaged in chromatin fibres with a similar level of compaction to heterochromatin.
Example 4
Gene-dense regions are enriched in open chromatin fibres
To identify what sequences are in slowly sedimenting ("open") chromatin fibres, DNA was purified from the EtBr peak of a gradient fraction - to represent bulk chromatin structure, and from the smear of fragments that are ~10kb longer than this (open chromatin) (Figure 1C). Co-hybridising bulk (red) and open (green) fractions to metaphase chromosomes did not give a uniform yellow signal, as would be expected if these chromatin structures were interspersed throughout the genome. Instead, distinct regions of the karyotype were enriched in open chromatin, and so appear more green
(Figure 3A). The most gene-rich human chromosomes (HSA) are HSAl 6, 17, 19, and
22 (Craig and Bickmore, 1994; Venter et al, 2001) and these all hybridise strongly to open chromatin (Figure 3B). Ih contrast, gene-poor HSA4, 13, and 18 hybridise poorly. At a sub-chromosome level, gene-rich T-bands (Holmquist, 1992; Craig and Bickmore, 1994), for example at the distal end of Ip (Ip34-p36), and at Ilql3 and q23, are also enriched in open chromatin (Figure 3B and 4A). These regions are also enriched in AIu repeats (Holmquist, 1992) but our conditions for Cotl suppression prevent their detection (data not shown). Since the sites of hybridisation to open chromatin, e.g. 7qll.2 and q22 and q36 in Figure 3C, are not suppressed even by very large amounts of Cotl, we are detecting single (or low) copy sequences in the open chromatin fraction. We conclude that regions of highest gene-density have a more open chromatin fibre conformation than the rest of the human genome. Without Cotl, there was strong hybridisation of open chromatin to gene- and Alu-rich parts of the genome (e.g. 9q34, in Figure 3D) as expected, but no hybridisation to centromeric a- satellite (Figure 3 C and D) or satellite 2 at IqI 2 (data not shown). This suggests that no part of these heterochromatic regions is packaged into open chromatin fibres. However, there was strong hybridisation to the satellite 3 at 9ql2 (Tagarro et al., 1994) (Figure 3D). This C-band also hybridises to compact chromatin (Figure 2) and so, despite its apparently simple sequence composition, it appears to have a heterogeneous chromatin fibre structure.
Example 5
Analysis of open chromatin fibres using genomic microarrays
FISH gives an immediate visual impression of the gross distribution of open chromatin fibres in the human genome, but is limited by the resolution of chromosomes bands
(-5-1 OMb). To analyse the distribution of open chromatin at higher resolution, and to relate it directly to the genome sequence, we co-hybridised differentially labelled
"open" and input chromatin fractions to a genomic DNA microarray. The array was assembled from clones, spaced at ~lMb intervals, from the 'golden path' used in the sequencing of the human genome (Fiegler et al., 2003). Hybridisation of total (female) genomic DNA: (male) input chromatin gave an average hybridisation ratio close to 1 for each autosome suggesting that there is no preferential release of chromatin from, for example, gene-rich domains (Figure 14), consistent with FISH results (Figure 8).
Two separate isolations of open chromatin were each hybridised twice vs input chromatin, using colour reversal. There was a strong correlation between the results of replicate microarray hybridisations performed with colour reversal (Figures 9 and 10).
In comparison with the amounts of input control, only small amounts of open chromatin fraction could be prepared for labelling, so we are only able to give comparative, not absolute, levels of its enrichment across the genome. Domains enriched in open chromatin (Iog2 ratio > 0) (Figure 11) correspond with the results obtained by FISH. Chromosomes with the highest overall ratio of open:input chromatin are the gene-rich HSAl 7, 19 and 22 which hybridised strongly to open chromatin by FISH (Figure 3). The autosomes most depleted in open chromatin fibres are gene-poor HSA4, and 13 (Figure 14). The correlation between enrichment of open chromatin and gene-density was quantified by linear regression (r2=0.88) (Figure 5). The FISH and microarray data also correspond at chromosome band level. For example, there is enriched open chromatin at clusters of BACs at the distal end of Ip (Ip34-p36; 0 45Mb), and at Iq21 (144-153Mb), regions that also hybridises strongly to open chromatin by FISH (Figure 4A). Likewise the major domains of FISH signal from open chromatin on HSAI l at Ilpl5, Ilql3 and Ilq23-q25, correspond with peaks of hybridisation on the microarray (0-20Mb, 63-76Mb and 110-134Mb) (Figure 4A). Microarray analysis affords higher resolution analysis than FISH. For example, by FISH open chromatin appears to hybridise to almost all of 16p, whereas there are peaks and troughs in the microarray hybridisation pattern (Figure 4A). To analyse this in more detail we examined the distal part of 16p BAC by BAC. BACs in distal 16pl3.3 (0-1Mb) and the proximal part of this band (3.5-5.5Mb) show a consistent enrichment of open chromatin fibres in replicate experiments (Fig. 4B). Open chromatin fibres are depleted in the intervening region (2Mb), and also in the adjacent chromosome band 16pl3.2 (8-10Mb). Enrichment of open chromatin then recurs in 16pl3.1 (10.5Mb). This mirrors the transition between chromosome bands 16pl3.3 - pi 3.1, and the gene density profile of 16p (Fig. 4B). To analyse open chromatin distribution at even higher resolution, and on contiguous sequence, we hybridised it to a chromosome 22q array consisting of overlapping sequencing tiling path clones (Woodfme et al., 2004). The average size of the clones is 78kb but there are regions where the clones are even smaller than the size of the chromatin fibres being examined. There is a very strong correspondence between the open:rnput hybridisation ratio and gene density. On this generally gene rich chromosome arm, domains depleted of open chromatin fibres correspond with the gene-poor regions of 22ql2.1 (26-27.3 Mb), ql2.3 (30.7-32.2Mb) and ql3.31-ql3.32 (45.5-47.4Mb) (Figure 6A). Clones with enriched hybridisation to open chromatin tended to be clustered in contiguous regions, as did clones depleted of open chromatin (variance in Iog2 value across the whole array = 0.4, average variance between Iog2 of a clone and that of its flanking contiguous clones = 0.28). Transitions between regions of open and more closed chromatin structure are generally sharp not gradual, suggesting that there may be distinct boundaries between them.
Example 6
Correlations of open chromatin structure to replication and gene expression
Replication timing in lyrnphoblastoid cells has been analysed on the same 1Mb whole genome and 22q high resolution arrays as used here (Woodfine et al., 2004). There is a good correlation between the presence of open chromatin fibres and early replication at 1Mb resolution (r2=0.85) (Table Sl). However, there are also places where replication time and chromatin fibre structure differ. These are generally telomeric regions. Many telomeric regions are gene-rich T-bands and are both early replicating and in open chromatin fibres. However some chromosome ends do not correspond with T-bands, are not enriched in open chromatin fibres, yet are early replicating (e.g. 18qter) (Figure S4). Conversely, όqter is a late replicating region that is enriched in open chromatin. On 22q there appears to be a gross similarity between replication time and chromatin structure (Figure 6A). However, at high resolution the correlation between chromatin structure and replication timing on 22q breaks down (r2=0.05). In general, the regions of 22q most enriched in chromatin fibres are also early replicating, but there are many places that are depleted of open chromatin but still replicate early. This suggests that replication timing and 30nm chromatin fibre are not functionally linked. Gene-rich regions also generally have a high GC base composition (Saccone et al., 1993), and therefore not surprisingly there is also a correlation between open chromatin fibre structure and base composition at the whole genome level (r2=0.94) (Figure 14). However, Woodfine et al (2004) noticed that in distal 22q (43-47Mb) there is a GC-rich R-band that unusually is gene-poor region. This region is generally depleted of open chromatin and is late replicating (Figure 6). Is the correlation between the presence of open chromatin fibres in the human genome and gene density, simply due to gene expression? The gene expression profile of lymphoblasts has been determined on a gene expression microarray (Woodfine et al., 2004). There is not a simple relationship between gene expression and enrichment of open chromatin fibres. At a whole chromosome level there is no correlation between the chromosome average open:input hybridisation level and either the average expression level (r2=0.06), or the probability of expression (r2<0.01) of genes assayed on each chromosome (Figure 14). There is also no correlation between the probability of gene expression, or the gene expression level at an individual BAC level in the 1Mb array (Figure 4B), or in the high resolution 22q analysis (Figure 6A). To examine chromatin fibres of individual genes we identified contiguous high resolution clones in 22ql l.21 and ql2.1. 22qll.21 is gene rich and in the 400kb region analysed we identified 8 genes. However, only one of them (UFDlL) is transcriptionally active and it is found in a region of compact chromatin whilst the adjacent inactive genes are located in regions of open chromatin (Figure 6B). Conversely, 22ql2.1 is gene poor but in the 1.5Mb region examined there is a small cluster of three genes. One of them (PITPNB) is transcriptionally active but is still found in a region of compact chromatin (Figure 6C). Since there is open chromatin present in the absence of gene transcription we conclude that it is not transcription per se which is opening the chromatin fibre. In addition, transcription can occur in regions of compact chromatin indicating that open chromatin is not an absolute requirement for transcription.
Example 7
Open chromatin fibre domains are cytologically decondensed and locate outside of chromosome territories
A slowed chromatin fibre sedimentation rate could result from reduced mass (loss of protein), but is highly unlikely. To account for the difference in sedimentation rate between open and bulk chromatin, we calculate that an open fibre would have to lose either 76kDa of protein per nucleosome, or 2/3rds of the nucleosomes themselves. Therefore, we argue that slowed sedimentation is due to a change in the shape and structure of the "open" fibres, which increases their frictional coefficient. An inactive repetitive fragment of the chicken genome has been shown to have hydrodynamic properties consistent with a rod-like particle (Ghirlando et al., 2004), and the structure of mouse satellite-containing chromatin has been interpreted as more regularly folded 30nm fibres, with less discontinuities, than bulk chromatin (Gilbert and Allan, 2001). Therefore the "open" human chromatin fibres that we identify here could be packaged into 30nm chromatin fibres peppered with frequent or large deformations. Could open 30nm fibre structure be transmitted through to higher-order chromatin and nuclear structure? There is a linear relationship between the meansquare interphase separations (d2) of FISH probe signals and their genomic separation (van den Engh et al., 1992). This has been used to show that regions of the human genome can have different levels of higher-order chromatin compaction (Yokota et al., 1997). To determine if regions enriched in open fibres are also cytologically more decondensed than regions on the same chromosome that are depleted of "open" chromatin, we analysed the interphase distances between probes for two regions of lip in lymphoblast nuclei. In distal Ilpl5.5 (1-2.5Mb) all BACS analysed are enriched in open chromatin fibres (Iog2>0). Further down the chromosome arm (Ilpl4.1 - pl3; 27.5-32.0 Mb) all BACs assayed are depleted of open chromatin (Iog2 <0) (Fig. 7A). For both regions there is a linear relationship between d2 and genomic separations of 0.25 - 2.0 Mb (Fig. 7B). However, the slopes of the lines indicates that lip 15.5 is less cytologically condensed (d2 = I.lmm2/Mb) than Ilρl4.1-ρl3 (d2 = 0.30 mm2/Mb) (Fig. 7B). We conclude that regions of open chromatin fibres exist in a physically decondensed higher-order chromatin state in the nucleus. Probes from regions of high gene density have previously been shown to have a distinctive nuclear organisation — they locate outside of chromosome territories. All of the regions that have so far been identified outside of chromosome territories in lymphoblastoid cells, correspond with regions of open chromatin fibres These include; the MHC class II at 6p21.3 (32.6-33.4Mb) (Volpi et al., 2000), Ilpl5.5 (0-2Mb) (Figure 7C), Ilql3 and distal 16pl3 (0.17-0.2Mb) (Mahy et al., 2002). In comparison, probes from the more cytologically condensed region of Ilpl3-pl4 locate inside of the lip territory (Figure 7C). There is also a correspondence between the regions that are known to locate outside of the 22q territory (Mahy et al., 2002) and our high resolution analysis of open chromatin fibres (Figure 6D). Therefore the structure of the 30nm fibre may even affect this level of nuclear organisation.
Example 8
Biophysical profiling of chromatin structure in cancer cells on a genome wide scale
Cell culture
(i) Normal lymphoblastoid cell line
Cells are grown in RPMI medium supplemented with 10% foetal calf serum, 1 X MEM non-essential amino acids (Sigma), 2mM L-Glutamine, 0.5rnM Sodium Pyruvate, ImM Oxaloacetic acid, 0.2 units/ml human insulin, 1 x penicillin/streptomycin (Sigma) and 3mM MOPS .
(ii) Human peripheral lymphocytes from CLL patients
Peripheral blood is collected into syringes containing Sodium EDTA. Blood is diluted 1:2 in RPMI medium and spun over a Ficoll-Paque PLUS (Amersham) cushion for 30 min at 40Og in a benchtop centrifuge at room temperature. Lymphocytes are removed from the interphase and washed in PBS.
(iii) Human peripheral lymphocytes from normal patients
Peripheral blood is collected into syringes containing heparin. The blood is diluted 1:10 into RPMI media supplemented with phytohaemaglutinin (PHA) and 1 x penicillin/streptomycin. The cells are cultured for 4 days. The cells are washed into RPMI and the lymphocytes are purified by spinning over a Ficoll-Paque PLUS (Amersham) cushion for 30 min at 400g in a benchtop centrifuge at room temperature. Lymphocytes are removed from the interphase and washed in PBS. Nuclei preparation
Lymphocytes and lymphoblastoid cells are washed in PBS and collected by centrifugation (5 min, 30Og, RT) in a benchtop centrifuge. The cell pellet is resuspended in cold buffer NBA (85mM KCl, 5.5% (w/v) sucrose, 1 OmM Tris-HCl pH 7.6, 0.5mM spermidine, 250μM PMSF) and held on ice. Add an equal volume of cold buffer NBB (NBA supplemented with 0.1% NP40 (USB) and incubate on ice for 3 min with gentle mixing. The nuclei are collected by centrifugation (4 min, 800g, 4°C). The nuclei pellet is washed in NBA and collected by centrifugation. The nuclei pellet is resuspended in a small volume of NBR (85mM KCl, 1OmM Tris-HCl pH 7.6, 1.5mM CaCl2, 3mM MgCl2, 250μM PMSF). The concentration of the nuclei is determined by measuring the absorbance at 260nm. Take a 1 :20 dilution of nuclei into NBR add a small aliquot of DNasel, incubate 5 min at RT, and dilute 1:5 into sonication buffer (2M NaCl, 5M Urea). The concentration of the nuclei is adjusted to 20 A260 with NBR (approx. lmg/ml).
Chromatin preparation
The nuclei are digested with 8-14 units of MNase (Worthington) per 20 A260 units of nuclei for 10 min at RT in the presence of lOOμg/ml RNaseA. Digestion is stopped by adding EDTA to 1OmM. The nuclei are washed, resuspended in a small volume of TEEP20 (1OmM Tris-HCl pH 8.0, ImM EDTA, ImM EGTA, 250μM PMSF, 2OmM NaCl, 0.05% NP40) and then incubated at 4°C overnight. Nuclear debris is removed by centrifugation leaving soluble chromatin in the supernatant.
Sucrose gradient sedimentation
Soluble chromatin is fractionated using sucrose gradient sedimentation in TEEP80
(1OmM Tris-HCl pH 8.0, ImM EDTA, ImM EGTA, 250μM PMSF, 8OmM NaCl, 0.05% NP40). 400μl soluble chromatin is loaded on to a 6-40% isokinetic sucrose gradient and centrifuged at 4°C (41,000 rpm for 2.5hrs in a SW41 rotor). 500μl fractions are collected from the gradient by upward displacement and the DNA is purified from them by SDS/proteinase K digestion, phenol-chloroform, chloroform extraction and ethanol precipitation.
Agarose gel electrophoresis
To assess the quality of the DNA from gradient fractions it is analysed by electrophoresis through 0.7% agarose in 1 X TPE buffer (9OmM Tris-phosphate, 2mM EDTA) with buffer circulation. Preparative fractionation of DNA from gradient fractions is carried out by pulsed-field gel electrophoresis (PFGE) (CHEF system, Biorad) through 1% low melting point agarose in 0.5 x TBE, at 180V, for 40hrs, with a 0.1 -2s switching time. Size markers are lkb (Promega) and 2.5kb (Biorad) DNA ladders. EtBr-stained gels are scanned using a 473nm laser and a 580nm band-pass filter on a Fuji FLA-2000. DNA from transverse gel slices is isolated by β-agarase (NEB) digestion, followed by phenol-chloroform, chloroform extraction and ethanol precipitation.
Labelling of DNA fractions
DNA purified from gel slices is digested with Sau3AI and purified by phenol- chloroform, chloroform extraction and ethanol precipitation. Half the material is ligated to 200ng annealed un-phosphόrylated catch-linkers with Sau3AI compatible ends in lOμl.
The Sau3Al linkers are
L1371GTCAAGAATTCGGTACCGTCGAC
Ll372GATCGTCGACGGTACCGAATTCT. After ligation, nicks in the top strand (5 '-3') are translated using the strand displacement activity of Klenow exo- (NEB). The ligation reaction is adjusted to 40μl in 1 x NEB2 buffer and 33μM each dNTP and 5u Klenow exo- . The DNA is purified by phenol-chloroform, chloroform extraction and ethanol precipitation and resuspended in 1 Oμl water.
The samples are amplified by PCR using one of the catch-linker oligonucleotides as primer (L1371) (30 cycles of 94°C 1 min, 580C 1 min , 720C 2 min).
Amplified DNA samples are labelled for FISH by nick-translation with either biotin- or digoxigenin-dUTP. For nick-translation take 2μl 10 x NTS (0.5M Tris ρH7.5, 0.1M MgSO4, ImM DTT, 0.5mg/ml BSA fraction V Sigma), 2.5μl each of 0.5mM dATP, dCTP, dGTP and 2.5μl ImM biotin-16 dUTP (Roche) or 1.5μl 0.5mM dTTP plus lμl ImM digoxigenin-11 dUTP (Roche). Add 0.5-lμg DNA, lμl of 1:500 dilution of DNaseI (lOu/μl) (Roche) plus lμl DNA polymerase I (lOu/μl) (rnvitrogen).
DNA samples for micro-array hybridisation are labelled by random-prime labelling using a Bioprime labelling kit (Invitrogen). A 130.5μl reaction is set up containing 450ng DNA and 60μl 2.5 x random primer solution. The DNA is denatured at 1000C for 10 min. On ice add 15μl 10 x dNTP mix (ImM dCTP, 2mM dATP, 2mM dGTP and 2mM dTTP in TE buffer), 1.5μl ImM Cy5-dCTP or Cy3-dCTP (NEN) and 3μl klenow polymerase). The reaction is incubated at 37°C overnight and stopped by adding 15μl stop buffer (supplied in kit). Unincorporated nucleotides are removed using a microspin G50 column (Amersham).
FISH (Flourescence in-situ hybridisation)
The quality and general integrity of the probes is assessed by metaphase FISH. 3:1 fixed metaphase preparations are dropped onto alcohol cleaned slides and aged for 24- 48hrs. Slides are treated with RNaseI (lOOμg/ml) in 2 x SSC for lhr at 37°C. Slides are rinsed in 2 X SSC and dehydrated through an alcohol series of 70, 90, 100% ethanol and air dried. Slides are denatured in 70% formamide/2 x SSC at 700C for 90 s, transferred to ice-cold 70% ethanol, and then into 90 and 100% ethanol and air dried. 200ng of labelled DNA, 50μg of human Cotl DNA (Invitrogen) and 5μg sonicated salmon sperm DNA are precipitated together with two volumes ethanol and dried in a spin- vac. The DNA is resuspended in lOμl hybridisation mix consisting of 50% deionised formamide, 2 x SSC, 1% Tween 20, and 10% Dextran sulphate for lhr at RT. The probe is denatured at 700C for 5 min, re-annealed at 370C for 15 rnin and hybridized on the slide under a sealed coverslip for 36 hrs at 37°C in a humidified chamber. The slides are washed 4 x 3 min in 2 x SSC at 45°C, 4 x 3 min in 0.1 x SSC at 600C and then placed in 4 x SSC 0.1 % Tween-20 at room temperature.
Biotinylated probes are detected using FITC-conjugated avidin, followed by biotinylated anti-avidin and a final layer of FITC-conjugated avidin. Slides are mounted in Vectashield, counter-stained with 1 mg/ml DAPI and examined on a Zeiss axiophot microscope equipped with a CCD camera and EPlab software.
Genome- wide chromatin structure analysis by microarray hybridisation
Hybridisation to genomic microarrays is performed as follows. Cy3 and Cy5 labelled test and control DNAs are combined, precipitated together with 135 μg of human Cotl
DNA (Roche) and 600 μg yeast tRNA (Invitrogen) and resuspended in 30 μl of hybridisation buffer (50% formamide, 10% dextran sulphate, 0.1% Tween 20, 2 X
SSC, 1OmM Tris-HCl pH 7.4). To prehybridise the arrays, 800 μg of herring sperm
DNA (Sigma) and 135 μg of Cotl DNA are resuspended in 45 μl of hybridisation buffer and incubated with the array for 1 hour at 370C under a coverslip. Slides are washed in PBS and spun dry (800 g, 1 min) before replacing the prehybridisation solution with denatured (10 min at 72°C) hybridisation mix. Hybridisation is performed under a coverslip for 24 hours at 370C in hybridisation chambers humidified with 20 % formamide and 2 x SSC. Slides are washed for 10 min at RT in PBS/0.05% Tween 20, 30 min at 42°C in 50% formamide/2 x SSC, and 10 min at RT in PBS/0.05% Tween 20, before being dried by spinning in a centrifuge for 5 min at 150 g and stored until scanning.
Arrays are scanned using an Agilent scanner (Agilent Technologies). Fluorescent intensities were extracted after subtraction of local background using SPOT. Signal intensities are normalised by dividing the ratio of each data point by the median ratio of all autosomal clones on the array. Hybridisations of Cy3 input chromatin vs Cy5 input chromatin, and Cy3 bulk chromatin vs Cy5 bulk chromatin are performed to confirm the consistency of hybridisation and the absence of random scatter. Any data points falling > 2 standard deviations from the mean of colour reversal experiments are removed from subsequent analysis. Cytogenetic and map position of clones on the microarrays are established using the NCBI assembly of the human genome in ENSEMBL.
Example 9
Biophysical profiling of chromatin structure in cancer cells at high resolution
Cell culture
(i) Normal lymphoblastoid cell line
Cells are grown in RPMI medium supplemented with 10% foetal calf serum, 1 X MEM non-essential amino acids (Sigma), 2mM L-Glutamine, 0.5mM Sodium Pyruvate, ImM Oxaloacetic acid, 0.2 units/ml human insulin, 1 x penicillin/streptomycin (Sigma) and 3mM MOPS.
(ii) Human peripheral lymphocytes from CLL patients
Peripheral blood is collected into syringes containing Sodium EDTA. Blood is diluted 1 :2 in RPMI medium and spun over a Ficoll-Paque PLUS (Amersham) cushion for 30 min at 40Og in a benchtop centrifuge at room temperature. Lymphocytes are removed from the interphase and washed in PBS.
(iii) Human peripheral lymphocytes from normal patients
Peripheral blood is collected into syringes containing heparin. The blood is diluted 1:10 into RPMI media supplemented with phytohaemaglutinin (PHA) and 1 x penicillin/streptomycin. The cells are cultured for 4 days. The cells are washed into RPMI and the lymphocytes are purified by spinning over a Ficoll-Paque PLUS (Amersham) cushion for 30 min at 40Og in a benchtop centrifuge at room temperature. Lymphocytes are removed from the interphase and washed in PBS.
Nuclei preparation
Lymphocytes and lymphoblastoid cells are washed in PBS and collected by centrifugation (5 min, 300g, RT) in a benchtop centrifuge. The cell pellet is resuspended in cold buffer NBA (85mM KCl, 5.5% (w/v) sucrose, 1OmM Tris-HCl pH 7.6, 0.5mM spermidine, 250μM PMSF) and held on ice. Add an equal volume of cold buffer NBB (NBA supplemented with 0.1% NP40 (USB) and incubate on ice for 3 min with gentle mixing. The nuclei are collected by centrifugation (4 min, 800g, 4°C). The nuclei pellet is washed in NBA and collected by centrifugation. The nuclei pellet is resuspended in a small volume of NBR (85mM KCl, 1OmM Tris-HCl pH 7.6, 1.5mM CaCl2, 3mM MgCl2, 250μM PMSF). The concentration of the nuclei is determined by measuring the absorbance at 260nm. Take a 1:20 dilution of nuclei into NBR add a small aliquot of DNasel, incubate 5 min at RT, and dilute 1:5 into sonication buffer (2M NaCl, 5M Urea). The concentration of the nuclei is adjusted to 20 A260 with NBR (approx. lmg/ml).
Chromatin preparation The nuclei are digested with 8-14 units of MNase (Worthington) per 20 A260 units of nuclei for 10 min at RT in the presence of 100μg/ml RNaseA. Digestion is stopped by adding EDTA to 1OmM. The nuclei are washed, resuspended in a small volume of TEEP20 (1OmM Tris-HCl pH 8.0, ImM EDTA, ImM EGTA, 250μM PMSF, 2OmM NaCl, 0.05% NP40) and then incubated at 4°C overnight. Nuclear debris is removed by centrifugation leaving soluble chromatin in the supernatant.
Sucrose gradient sedimentation
Soluble chromatin is fractionated using sucrose gradient sedimentation in TEEP80 (1OmM Tris-HCl pH 8.0, ImM EDTA, ImM EGTA, 250μM PMSF, 8OmM NaCl, 0.05% NP40). 400μl soluble chromatin is loaded on to a 6-40% isokinetic sucrose gradient and centrifuged at 4°C (41,000 rpm for 2.5hrs in a SW41 rotor). 500μl fractions are collected from the gradient by upward displacement and the DNA is purified from them by SDS/proteinase K digestion, phenol-chloroform, chloroform extraction and ethanol precipitation.
Agarose gel electrophoresis
To assess the quality of the DNA from gradient fractions it is analysed by electrophoresis through 0.7% agarose in 1 X TPE buffer (9OmM Tris-phosphate, 2mM EDTA) with buffer circulation. Preparative fractionation of DNA from gradient fractions is carried out by pulsed-field gel electrophoresis (PFGE) (CHEF system, Biorad) through 1% low melting point agarose in 0.5 X TBE, at 180V, for 40hrs, with a 0.1-2s switching time. Size markers are lkb (Promega) and 2.5kb (Biorad) DNA ladders. EtBr-stained gels are scanned using a 473nm laser and a 580nm band-pass filter on a Fuji FLA-2000. DNA from transverse gel slices is isolated by β-agarase (NEB) digestion, followed by phenol-chloroform, chloroform extraction and ethanol precipitation.
Labelling of DNA fractions DNA purified from gel slices is digested with Sau3AI and purified by phenol- chloroform, chloroform extraction and ethanol precipitation. Half the material is ligated to 200ng annealed un-phosphorylated catch-linkers with Sau3AI compatible ends in lOμl.
The Sau3Al linkers are
L1371GTCAAGAATTCGGTACCGTCGAC
Ll372GATCGTCGACGGTACCGAATTCT.
After ligation, nicks in the top strand (5 '-3') are translated using the strand displacement activity of Klenow exo- (NEB). The ligation reaction is adjusted to 40μl in 1 x NEB2 buffer and 33μM each dNTP and 5u Klenow exo- . The DNA is purified by phenol-chloroform, chloroform extraction and ethanol precipitation and resuspended in lOμl water.
The samples are amplified by PCR using one of the catch-linker oligonucleotides as primer (L1371) (30 cycles of 94°C 1 min, 580C 1 min , 72°C 2 min).
Amplified DNA samples are labelled for FISH by nick-translation with either biotin- or digoxigenin-dUTP. For nick-translation take 2μl 10 x NTS (0.5M Tris pH7.5, 0.1 M MgSO4, ImM DTT, 0.5mg/ml BSA fraction V Sigma), 2.5μl each of 0.5mM dATP, dCTP, dGTP and 2.5μl ImM biotin-16 dUTP (Roche) or 1.5μl 0.5mM dTTP plus lμl ImM digoxigerώi-11 dUTP (Roche). Add 0.5-lμg DNA, lμl of 1:500 dilution of DNaseI (lOu/μl) (Roche) plus lμl DNA polymerase I (lOu/μl) (Invitrogen).
DNA samples for micro-array hybridisation are labelled by random-prime labelling using a Bioprime labelling kit (Invitrogen). A 130.5μl reaction is set up containing
450ng DNA and 60μl 2.5 x random primer solution. The DNA is denatured at 1000C for 10 min. On ice add 15μl 10 x dNTP mix (ImM dCTP, 2mM dATP, 2mM dGTP and 2mM dTTP in TE buffer), 1.5μl ImM Cy5-dCTP or Cy3-dCTP (NEN) and 3μl klenow polymerase). The reaction is incubated at 37°C overnight and stopped by adding 15μl stop buffer (supplied in kit). Unincorporated nucleotides are removed using a microspin G50 column (Amersham).
FISH (Flourescence in-situ hybridisation)
The quality and general integrity of the probes is assessed by metaphase FISH. 3:1 fixed metaphase preparations are dropped onto alcohol cleaned slides and aged for 24-
48hrs. Slides are treated with RNaseI (lOOμg/ml) in 2 x SSC for lhr at 37°C. Slides are rinsed in 2 X SSC and dehydrated through an alcohol series of 70, 90, 100% ethanol and air dried. Slides are denatured in 70% formamide/2 x SSC at 7O0C for 90 s, transferred to ice-cold 70% ettianol, and then into 90 and 100% ethanol and air dried. 200ng of labelled DNA, 50μg of human Cotl DNA (Invitrogen) and 5μg sonicated salmon sperm DNA are precipitated together with two volumes ethanol and dried in a spin- vac. The DNA is resuspended in lOμl hybridisation mix consisting of
50% deionised formamide, 2 x SSC, 1% Tween 20, and 10% Dextran sulphate for lhr at RT. The probe is denatured at 700C for 5 min, re-annealed at 37°C for 15 min and hybridized on the slide under a sealed coverslip for 36 hrs at 37°C in a humidified chamber. The slides are washed 4 x 3 min in 2 X SSC at 45°C, 4 x 3 min in 0.1 X SSC at 600C and then placed in 4 x SSC 0.1% Tween-20 at room temperature.
Biotinylated probes are detected using FITC-conjugated avidin, followed by biotinylated anti-avidin and a final layer of FITC-conjugated avidin. Slides are mounted in Vectashield, counter-stained with 1 mg/ml DAPI and examined on a Zeiss axiophot microscope equipped with a CCD camera and IPlab software.
High-resolution chromatin structure analysis by quantitative PCR The quantity of total DNA recovered from each gel slice is determined by quantitative DOP-PCR. Take human genomic DNA (lmg/ml) and prepare dilution series for standards (1:300, 1:1000, 1:3000, 1:10000, 1:30000, 1:100000). Setup realtime PCR mix as follows on ice 175μl 2 x master mix, 28 μl 25mM MgCl2, 14μl 1 :1000 dilution Sybr green, 14μl lmg/ml DOP-Primer
6MW-CCGACTCGAGNNNNNNATGTGGor
DOPl-CCGACTCGAGNNNNNNCTAGAA
and 84μl water. Aliquot PCR mix into 9μl aliquots. In duplicate, add lμl of 1:10 dilution of DNA from each gel slice and lμl of standards to reactions. Run samples on light cycler (Roche) with the following program. 95°C, 60s; 950C, 5s; 300C, 10s; ramp at 0.1°C/s to 72°C, 80s; 76°C, 7s, aquire data; cycle 55 times of the following 95°C, 5s; 62°C, 10s; ramp to 72°C at 5°C/s, 80s; 76°C, 7s, aquire data. One cycle of 95°C; 62°C, 2s; 72°C, 30s; 700C; ramp to 95°C at O.TC/s with continuous data acquisition; 500C, 20s. Set baseline adjustment and create standard curve to determine concentration of samples.
To determine the amount of a specific DNA sequence in each fraction repeat the above but replacing the DOP-PCR primer with 17.5μl lOμM each sequence-specific primer and using diluted genomic DNA samples as standards (1:100, 1:000, 1:10,000). The PCR program is optimised for each sequence specific primer. After PCR set baseline adjustment and create standard curve to determine concentration of samples. The total amount of DNA can be compared to the amount of sequence-specific DNA in each fraction.
Example 10.
Isolating Chromatin From Total Human Leukocytes We have demonstrated that we can isolate and fractionate chromatin from total human lymphocytes.
To prepare total human leukocytes (70% Granulocytes, 30% Lymphocytes) 50-100 ml of blood is isolated from an individual. The blood is diluted 1:2 in RPMI culture medium and the leukocytes are purified on a ficoll step gradient. The leukocytes are washed in PBS and counted.
To prepare chromatin see Gilbert and Allan, 2001 and Gilbert et al., 2004. Essentially, the cells (3 x 107) are resuspended in 2 ml buffer NBA [1OmM Tris pH 7.6, 5.5% Sucrose, 85mM KCL, 0.5mM Spermidine, 0.2 mM EDTA, 250μM PMSF]. 2ml of buffer NB-B 0.1 [NBA supplemented with 0.1% NP40] is added and incubated on ice for 3 min. The cells are centrifuged [850g, 4 min, 4°C] and resuspended in NBR [1OmM Tris pH 7.6, 5.5% Sucrose, 85mM KCL, 3mM MgC12, 1.5mM CaC12, 250μM PMSF]. The cells are centrifuged [850g rpm, 4 min, 4°C] and resuspended in a small volume of NBR. The concentration of the nuclei are determined by spectroscopy at 260nm. The nuclei concentration is adjusted and digested with an optimal concentration of micrococcal nuclease (approx 10-12 U per ml nuclei for 10 min at RT in the presence of lOOμg/ml RNase A. The reaction is stopped by adding EDTA to 1OmM. The nuclei are centrifuged at 300Og, 30 sec in a microfuge and resuspended in 400μl TEEP20 [10 mM Tris pH 8.0, O.lmM EDTA, O.lmM EGTA, 20 mM NaCl, 250μM PMSF]. The nuclei are left to stand overnight on ice for the chromatin to release. The debris is removed by centrifugation (20,00Og, 5 min 4°C) in a microcentrifuge. The sample is loaded on a 6-40% isokinetic sucrose gradient in TEEP80 [1OmM Tris, O.lmM EDTA, O.lmM EGTA, 8OmM NaCl, 250μM PMSF]. The gradients are centrifuged for 3 hrs at 200,00Og in a SW41 rotor. The chromatin is isolated from the gradient by upward displacement with 50% sucrose in TEEP80 (Figure 14). Chromatin fractions are stored frozen at -200C.
The integrity of the chromatin is investigated by purifying the DNA from the chromatin fractions by SDS, Proteinase K treatment followed by phenol/chloroform extraction, chloroform extraction and ethanol precipitation. The DNA is fractionated on a 0.7% TPE gel overnight (Figure 15).
To analyse input chromatin, a single fraction is taken from the sucrose gradient, DNA is purified and digested with Sau3A. Sau3A linkers are ligated to the free ends and the nick is translated by klenow exo. After purification the material is amplified by PCR and labelled by nick-translation with biotin-11-dUTP. The labelled DNA is hybridised to human metaphase spreads.
Example 10.
Isolating Chromatin From B-lymphocytes from patients with chronic lymphocytic leukaemia
We have shown that we can isolate and fractionate chromatin from malignant B-cells isolated from patients with CLL
To prepare total human leukocytes 50 ml of blood is isolated from a patient. The blood is diluted 1 :2 in RPMI culture medium and the leukocytes are purified on a ficoll step gradient. The leukocytes are washed in PBS and counted. The number of B-cells in the sample is determined by flow analysis using markers CD25 for B-lymphocytes and CD45 for total leukocytes (Figure 16)
To prepare chromatin see Gilbert and Allan, 2001 and Gilbert et al., 2004. Essentially, the cells (1 x 108) are resuspended in 5 ml buffer NBA [1OmM Tris pH 7.6, 5.5% Sucrose, 85mM KCL, 0.5mM Spermidine, 0.2 mM EDTA, 250μM PMSF]. 5ml of buffer NB-B 0.1 [NBA supplemented with 0.1% NP40] is added and incubated on ice for 3 min. The cells are centrifuged [850g, 4 min, 40C] and resuspended in NBR [1OmM Tris pH 7.6, 5.5% Sucrose, 85mM KCL, 3mM MgC12, 1.5mM CaC12, 250μM PMSF]. The cells are centrifuged [850g, 4 min, 40C] and resuspended in a small volume of NBR. The concentration of the nuclei are determined by spectroscopy at 260nm. The nuclei concentration is adjusted and digested with an optimal concentration of micrococcal nuclease (approx 10-12 U per ml nuclei for 10 min at RT in the presence of lOOμg/ml RNase A. The reaction is stopped by adding EDTA to 1OmM. The nuclei are centrifuged at 3000g, 30 sec in a microfuge and resuspended in 400μl TEEP20 [10 mM Tris pH 8.0, O.lmM EDTA, O.lmM EGTA, 20 mM NaCl, 250μM PMSF]. The nuclei are left to stand overnight on ice for the chromatin to release. The debris is removed by centrifugation (20,00Og, 5 min 40C) in a microcentrifuge. The sample is loaded on a 6-40% isokinetic sucrose gradient in TEEP80 [1OmM Tris, O.lmM EDTA, O.lmM EGTA, 8OmM NaCl, 250μM PMSF]. The gradients are centrifuged for 3 hrs at 200,00Og in a SW41 rotor. The chromatin is isolated from the gradient by upward displacement with 50% sucrose in TEEP80 (Figure 17). Chromatin fractions are stored frozen at -200C.
The integrity of the chromatin is investigated by purifying the DNA from the chromatin fractions by SDS, Proteinase K treatment followed by phenol/chloroform extraction, chloroform extraction and ethanol precipitation. The DNA is fractionated on a 0.7% TPE gel overnight (Figure 18).
To analyse input chromatin a single fraction is taken from the sucrose gradient, DNA is purified and digested with Sau3A. Sau3A linkers are ligated to the free ends and the nick is translated by klenow exo-. After purification the material is amplified by PCR (Figure 6) and labelled by nick-translation with biotin-11-dUTP. The labelled DNA is hybridised to human metaphase spreads (Figure 20).
Figure imgf000095_0001
REFERENCES
Bellard, M., Gannon, F., Chambon, P. (1978) Nucleosome structure III: The structure and transcriptional activity of the chromatin containing the ovalbumin and globin genes in chick oviduct nuclei. Cold Spring Harb. Symp. Quant. Biol. 42, 779-791.
Belmont, A. S., and Bruce, K. (1994) Visualization of Gl chromosomes: A folded, twisted, supercoiled chromonema model of interphase chromatid structure. J. Cell Biol. 127, 287-302.
Caplan, A., Kimura, T., Gould, H., Allan, J. (1987) Perturbation of chromatin structure in the region of the adult b-globin gene in chicken erythrocyte chromatin. J. MoI. Biol. 193, 57-70.
Caron, H., van Schaik, B., van der Mee, M., Baas, F., Riggins, G., van Sluis, P., Hermus, M. C, van Asperen, R., Boon, K., Voute, P. A., Heisterkamp, S., van Kampen, A., Versteeg, R. (2001) The human transcriptome map: Clustering of highly expressed genes in chromosomal domains. Science. 291, 1289-1292.
Chambeyron, S. and Bickmore, W. A. (2004) Chromatin decondensation and nuclear reorganization of the Hoxb locus upon induction of transcription. Genes Develop 18: 1119-1130.
Craig, J.M., and Bickmore, W. A. (1994) The distribution of CpG islands in mammalian chromosomes. Nature Genet. 7, 376-382. 26
Croft, J.A., Bridger, J. M., Perry, P., Boyle, S., Teague, P. and Bickmore, W. A. (1999) Differences in the localization and morphology of chromosomes in the human nucleus. J. Cell Biol. 145, 1119-1131 Fan, J. Y., Gordon, F., Luger, K., Hansen, J. C, Tremethick, D. J. (2002) The essential histone variant H2A.Z regulates the equilibrium between different chromatin conformational states. Nat. Struct. Biol. P, 172-176.
Fantes, J. A., Bickmore, W. A., Fletcher, J. M., Ballesta, F., Hanson, I. M., van Heyningen, V. (1992) Submicroscopic deletions at the WAGR locus, revealed by nonradioactive in situ hybridization. Am. J. Hum. Genet. 51, 1286-1294.
Fantes, J. A., Redeker, B., Breen, M., Boyle, S., Brown, J., Fletcher, J., Jones, S., Bickmore, W., Fukushima, Y., Mannens, M., et al. (1995) Aniridia-associated cytogenetic rearrangements suggest that a position effect may cause the mutant phenotype. Hum. MoI. Genet. 4, 415-422.
Felsenfeld, G., and Groudine, M. (2003) Controlling the double helix. Nature. 421, 448- 453.
Fiegler, H., Carr, P., Douglas, E. J., Burford, D. C, Hunt, S., Scott, C. E., Smith, J., Vetrie, D., Gorman, P., Tomlinson, I. P., Carter, N. P. (2003) DNA microarrays for comparative genomic hybridization based on DOP-PCR amplification of BAC and PAC clones. Genes Chromosomes Cancer. 36, 361-374.
Fischle, W., Wang, Y. Allis, CD. (2003). Histone and chromatin cross-talk. Curr. Opin. Cell Biol. 15, 172-183
Fisher, E. A., and Felsenfeld, G. (1986) Comparison of the folding of beta-globin and ovalbumin gene containing chromatin isolated from chicken oviduct and erythrocytes. Biochemistry. 25, 8010-8016.
Furey, T. S., and Haussler, D. (2003) Integration of the cytogenetic map with the draft human genome sequence. Hum. MoI. Genet. 12, 1037-1044 Ghirlando, R., Litt, M.D., Prioleau, M-N., Recillas-Targa, F. and Felsenfeld, G. (2004). Physical properties of a genomic condensed chromatin fragment. J. MoI. Biol. 336, 597-605.
Gilbert, N. and Allan, J. (2001). Distinctive higher-order chromatin structure at mammalian centromeres. Proc. Natl Acad. Sci. USA 98, 11949-11954.
Gilbert, N., Boyle, S., Sutherland, H., de Las Heras, J., Allan, J., Jenuwein, T., Bickmore, W. A. (2003) Formation of facultative heterochromatin in the absence of HPl. EMBO J. 22, 5540-5550.
Greulich, K. O., Wachtel, E., Ausio, J., Seger, D., Eisenberg, H. (1987) Transition of chromatin from the "10 nm" lower order structure, to the "30 nm" higher order structure as followed by small angle X-ray scattering. J. MoI. Biol. 193, 709-721.
Holmquist, G.P. (1992) Chromosome bands, their chromatin flavors, and their functional features. Am. J. Hum. Genet. 51, 17-37.
Jain, A.N., Tokuyasu, T.A., Snijders, A.M., Segraves, R., Albertson, D.G., Pinkel, D. (2002) Fully automatic quantification of microarray image data. Genome Res. 12, 325- 332.
Jolly, C, Metz, A., Govin, J., Vigneron, M., Turner, B. M., Khochbin, S., Vourc'h, C. (2003) Stress-induced transcription of satellite III repeats. J. Cell Biol. 164, 25-33.
Kim, Y. and Clark, D. J. (2002) SWI/SNF-dependent long-range remodeling of yeast HIS3 chromatin. Proc. Natl. Acad. Sci. U. S. A. 99, 15381-15386.
Kimura, T., Mills, F. C, Allan, J., Gould, H. (1983) Selective unfolding of erythroid chromatin in the region of the active b-globin gene. Nature. 306, 709-712. Langmore, J. P. and Paulson, J. R. (1983) Low angle x-ray diffraction studies of chromatin structure in vivo and in isolated nuclei and metaphase chromosomes. J. Cell Biol. 95, 1120-1131.
Lercher, M. J., Urrutia, A. O., Hurst, L. D. (2002) Clustering of housekeeping genes provides a unified model of gene order in the human genome. Nature Genet. 31, 180- 183.
Mahy, N. L., Perry, P. E., Bickmore, W. A. (2002) Gene density and transcription influence the localisation of chromatin outside of chromosome territories detectable by FISH. J. Cell Biol. 159, 753-763.
McGhee, J. D., Nickol, J. M., Felsenfeld, G., Rau, D. C. (1983) Higher order structure of chromatin: Orientation of nucleosomes within the 30nm chromatin solenoid is independent of species and spacer length. Cell. 33, 831-841.
McKittrick, E., Gafken, P. R., Ahmad, K., Henikoff, S. (2004) Histone H3.3 is enriched in covalent modifications assocaited with active chromatin. Proc. Natl. Acad. Sci. U. S. A. hi Process Citation.
Muller, W. G., Walker, D., Hager, G. L., McNaIIy, J. G. (2001) Large-scale chromatin decondensation and recondensation regulated by transcription from a natural promoter. J. Cell Biol. 154, 33-48.
Noll, H. and Noll, M. (1989) Sucrose gradient techniques and applications to nucleosome structure. Methods Enzymol. 170, 55-116.
Nye, A.C., Rajendran, R.R., Stenoien, D.L., Mancini, M.A., Katzenellenbogen, B. S., Behnont, A.S. (2002) Alteration of large-scale chromatin structure by estrogen receptor. MoI. Cell. Biol. 22, 3437-3449. Rizzi, N., Denegri, M., Chiodi, L, Corioni, M., Valgardsdottir, R., Cobianchi, F., Riva, S., Biamonti, G. (2004)Transcriptional activation of a constitutive heterochromatic domain of the human genome in response to heat shock. MoI. Biol Cell.15, 543-551.
Saccone, S., De Sario, A., Wiegant, J., Raap, A.K., Delia Valle, G., Bemardi, G. (1993) Correlations between isochores and chromosomal bands in the human genome. Proc. Natl. Acad. Sci. U S A. 90, 11929-11933.
Schroder, A.R.W., Shim, P., Chen, H., Berry, C, Ecker, J.R., Bushman, F. (2002) HIV-I integration in the human genome favors active genes and local hotspots. Cell 110, 521-529.
Shaw-Smith, C, Redon, R., Rickman, L., Rio, M., Willatt, L., Fiegler, H., Firth, H., Sanlaville, D., Winter, R., Colleaux, L., Bobrow, M., Carter, N.P. (2004) Microarray based comparative genomic hybridisation (array-CGH) detects submicroscopic chromosomal deletions and duplications in patients with learning disability/mental retardation and dysmorphic features. J. Med. Genet. 41, 241-8.
Shiels, C, Coutelle, C, Huxley, C. (1997) Contiguous arrays of satellites 1, 3, and beta form a 1.5-Mb domain on chromosome 22p. Genomics. 44, 35-44.
Sun, F.L., Cuaycong, M.H., Elgin, S. C. (2001) Long-range nucleosome ordering is associated with gene silencing in Drosophila melanogaster pericentric heterochromatin. MoI. Cell. Biol. 21, 2867-2879.
Tagarro, L, Fernandez-Peralta, A.M., Gonzalez-Aguilera, JJ. (1994) Chromosomal localization of human satellites 2 and 3 by a FISH method using oligonucleotides as probes. Hum. Genet. 93, 383-388.
Thoma, F., Koller, T., Klug, A. (1979) Involvement of histone Hl in the organization of the nucleosome and of the salt-dependent superstructures of chromatin. J. Cell Biol. 83, 403-427. Tsukamoto, T., Hashiguchi, N., Janicki, S.M., Tumbar, T., Belmont, A.S., Spector, DX. (2000) Visualization of gene activity in living cells. Nat. Cell Biol. 2, 871-878.
Tumbar, T., Sudlow, G., Belmont, A.S. (1999) Large-scale chromatin unfolding and remodeling induced by VP16 acidic activation domain. J. Cell Biol. 145, 1341-1354.
Van den Engh, G., Sachs, R., Trask, BJ. (1992) Estimating genomic distance from DNA sequence location in cell nuclei by a random walk. Science 257, 1410-1412.
van Holde, K. and Zlatanova, J. (1996) What determines the folding of the chromatin fiber? Proc. Natl. Acad. Sci. U S A. 93, 10548-10555.
Venter, J.C., et al., (2001) The sequence of the human genome. Science 291, 1304- 1351.
Vermaak, D., Ahmad, K., Henikoff, S. (2003) Maintenance of chromatin states: an open-and-shut case. Curr. Opin. Cell Biol. 15, 266-21 A.
Versteeg, R., van Schaik, B.D., van Batenburg, M.F., Roos, M., Monajemi, R., Caron, H., Bussemaker, H.J., van Kampen, A.H. (2003) The human transcriptome map reveals extremes in gene density, intron length, GC content, and repeat pattern for domains of highly and weakly expressed genes. Genome Res. 13, 1998-2004.
Volpi, E.V., Chevret, E., Jones, T., Vatcheva, R., Williamson, J., Beck, S., Campbell, R.D., Goldsworthy, M., Powis, S.H., Ragoussis, J., Trowsdale, J., Sheer, D. (2000). Large-scale chromatin organisation of the major histocompatibility complex and other regions of human chromosome 6 and its response to interferon in interphase nuclei. J. Cell Sci. 113, 1565-1576.
Weintraub, H., and Groudine, M. (1976) Chromosomal subunits in active genes have an altered conformation. Science. 193, 848-856. Wolffe, A.P. (1998) Chromatin structure and function. (San Diego: Academic press). Woodcock, C.L., Frado, L.L., Rattner, J.B. (1984) The higher-order structure of chromatin: evidence for a helical ribbon arrangement. J. Cell Biol. 99, 42-52.
Woodfine, K., Fiegler, H., Beare, D.M., Collins, J.E., McCann, O.T., Young, B.D., Debernardi, S., Mott, R., Dunham, L, Carter, N.P. (2004) Replication timing of the human genome. Hum. MoI. Genet. 13, 191-202.
Ye, Q., Hu, Y.F., Zhong, H., Nye, A.C., Belmont, A.S., Li, R. (2001) BRCAl-induced large-scale chromatin unfolding and allele-specific effects of cancer-predisposing mutations. J. Cell Biol. 155, 911-921.
Yokota, H., Singer, MJ., van den Engh, G. J., Trask, BJ. (1997) Regional differences in the compaction of chromatin in human G0/G1 interphase nuclei. Chromosome Res. 5, 157-166.
All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.

Claims

1. A method for identifying compact and/or open chromatin in a sample comprising the steps of:
(a) preparing a plurality of chromatin fragments;
(b) sedimenting the chromatin fragments into one or more fractions;
(c) resolving at least one of the fractions into chromatin fragments of different lengths; and
(d) isolating one or more DNA fragments that are shorter and/or longer than bulk chromatin;
wherein DNA fragments that are shorter than bulk chromatin correspond to compact chromatin and wherein DNA fragments that are longer than bulk chromatin correspond to open chromatin.
2. A method according to claim 1 wherein at least one of the fractions is resolved using pulsed field gel electrophoresis.
3. A method according to claim 1 or claim 2, wherein the chromatin fragments are at least about 10-3 Okb in length.
4. A method according to any of the preceding claims, wherein the chromatin fragments are sedimented through a sucrose gradient.
5. A method according to claim 4, wherein the sucrose gradient is a 6-40% sucrose gradient.
6. A method according to claim 4 or claim 5, wherein the sucrose gradient is fractionated from top to bottom.
7. A method according to any of the preceding claims, wherein the compact chromatin is at least about 5 kb shorter than bulk chromatin.
8. A method according to claim 7, wherein the compact chromatin is at least about 10 kb shorter than bulk chromatin.
9. A method according to any of claims 1-6, wherein the open chromatin is at least about 5 kb longer than bulk chromatin.
10. A method according to any of claims 1-6 and 9, wherein the open chromatin is at least about 10 kb longer than bulk chromatin.
11. A method for preparing a compact chromatin probe comprising the steps of:
(a) preparing a plurality of chromatin fragments;
(b) sedimenting the chromatin fragments into one or more fractions;
(c) resolving at least one of the fractions into chromatin fragments of different lengths;
(d) isolating one or more DNA fragments that are shorter than bulk chromatin; and
(e) digesting the DNA fragment(s) into one or more probes.
12. A method according to claim 11, wherein the DNA fragments that are isolated are at least about 5 kb shorter than bulk chromatin.
13. A method according to claim 11, wherein the DNA fragments that are isolated are at least about 10 kb shorter than bulk chromatin.
14. A method according to any of claims 11-13, wherein the DNA fragments are digested into one or more probes using a restriction enzyme or sonication.
15. A method according to claim 14, wherein the restriction enzyme is Sau3 AI.
16. A method according to any of claims 11-15, wherein the probe is annealed to a linker.
17. A method according to claim 16, wherein the linker is a Sau3 A linker.
18. A method according to claim 16 or claim 17, wherein nicks in the top strand (5 '-3') of the probe are translated using the strand displacement activity of Klenow DNA polymerase (exo-).
19. A method according to any of claims 11-18, wherein the probe is amplified by PCR.
20. A method according to any of claims 11-19, wherein the probe is labelled.
21. A method according to claim 20, wherein the label is selected from a biotin label, a digoxigenin label and a fluorescent label.
22. A method according to any of claims 11-21, wherein the quality and integrity of the probe is assessed by FISH.
23. A method according to any of claims 11-22, wherein the probe is hybridised to an array.
24. A method according to any of claims 11-23, comprising the additional step of ligating the nucleotide sequence(s) encoding the one or more probes into a vector.
25. A compact chromatin probe obtainable or obtained by the method according to any of claims 11 -24.
26. A library of compact chromatin probes obtained or obtainable by the method according to claim 24.
27. A vector obtained or obtainable by the method according to claim 24.
28. A host cell comprising the vector according to claim 27.
29. A method for preparing an open chromatin probe comprising the steps of:
(a) preparing a plurality of chromatin fragments;
(b) sedimenting the chromatin fragments into one or more fractions;
(c) resolving at least one of the fractions into chromatin fragments of different lengths;
(d) isolating one or more DNA fragments that are longer than bulk chromatin; and
(e) digesting the DNA fragment(s) into one or more probes.
30. A method according to claim 29, wherein the DNA fragments that are isolated are at least about 5 kb longer than bulk chromatin.
31. A method according to claim 29, wherein the DNA fragments that are isolated are at least about 10 kb longer than bulk chromatin.
32. A method according to any of claims 29-31, wherein the DNA fragments are digested into one or more probes using a restriction enzyme or sonication.
33. A method according to claim 32, wherein the restriction enzyme is Sau3AI.
34. A method according to any of claims 29-33, wherein the probe is annealed to a linker.
35. A method according to claim 34, wherein the linker is a Sau3 A linker.
36. A method according to claim 34 or claim 35, wherein nicks in the top strand (5 '-3') of the probe are translated using the strand displacement activity of Klenow DNA polymerase (exo-).
37. A method according to any of claims 29-36, wherein the probe is amplified by PCR.
38. A method according to any of claims 29-37, wherein the probe is labelled
39. A method according to claim 38, wherein the label is selected from a biotin label, a digoxigenin label and a fluorescent label.
40. A method according to any of claims 29-39, wherein the quality and integrity of the probe is assessed by FISH.
41. A method according to any of claims 29-40, wherein the probe is hybridised to an array.
42. A method according to any of claims 29-41, comprising the additional step of ligating the nucleotide sequence(s) encoding the one or more probes into a vector.
43. An open chromatin probe obtainable or obtained by the method according to any of claims 29-42.
44. A library of open chromatin probes obtained or obtainable by the method according to claim 42. 74
108
45. A vector obtained or obtainable by the method according to claim 42.
46. A host cell comprising the vector according to claim 45.
47. A method for identifying one or more changes in chromatin structure and/or expression in a sample that can be correlated with a disease comprising the steps of:
(a) preparing a compact chromatin probe according to any of claims 11-24 and/or an open chromatin probe according to any of claims 29-42 from a non-diseased sample;
(b) preparing a compact chromatin probe according to any of claims 11-24-29 and/or an open chromatin probe according to any of claims 29-42 from a diseased sample; and
(c) comparing the distribution of the compact and/or open chromatin probes in each of the samples;
wherein steps (a) and (b) can be performed in either order; and
wherein a difference between (i) the distribution of the compact and/or open chromatin probes in the sample and (ii) the distribution of the compact and/or open chromatin probes in the diseased sample is indicative of one or more changes in chromatin structure and/or expression that can be correlated with a disease.
48. A method according to claim 47, wherein the distribution of the compact and/or open chromatin probes in each of the samples is determined using an array.
49. A method according to claim 48, wherein the array is a microarray.
50. A method according to claim 48 or claim 49, wherein the array is a tiling path array, preferably a whole genome tiling path array.
51. A method according to claim 50, wherein the array is a 1 Mb or 22q tiling path array.
52. A method according to any of claims 47-51 , wherein the array is an expression array.
53. A method according to any of claims 47-52, wherein the array is a human genomic array.
54. A method according to any of claims 47-53 wherein the distribution of the compact and/or open chromatin probes in each of the samples is determined for one or more specific regions of the genome.
55. A method according to claim 54 wherein the method comprises the steps of:
(a) determining the total amount of DNA in each of the compact chromatin probes and/or the open chromatin probes from the non-diseased and diseased samples;
(b) measuring the abundance of the specific region(s) of interest; and
(c) comparing the results from step (a) and (b) to determine if the chromatin structure of the specific region(s) has altered between the non-diseased and diseased samples.
56. A method according to claim 54 or claim 55, wherein the specific region of the genome is a single gene.
57. A method according to any of claims 54-56, wherein the total amount of DNA is measured using DOP-PCR.
58. A method according to any of claims 54-57, wherein the abundance of the specific region of the genome is determined using real time PCR.
59. A method for identifying one or more agents that modulate chromatin structure comprising the steps of:
(a) preparing compact chromatin probe(s) according to any of claims 11-24 and/or open chromatin probe(s) according to any of claims 29-42 from a sample;
(b) preparing compact chromatin probe(s) according to any of claims 11-24 and/or open chromatin probe(s) according to any of claims 29-42 from a sample that has been contacted with one or more agents; and
(c) comparing the distribution and/or expression of the compact and/or open chromatin probes in each of the samples;
wherein steps (a) and (b) can be performed in either order; and
wherein a difference between (i) the distribution and/or expression of the compact and/or open chromatin probes in the sample and (ii) the distribution and/or expression of the compact and/or open chromatin probes in the diseased sample is indicative that the one or more agents modulate chromatin structure.
60. An agent identified or identifiable by the method according to claim 59.
61. A method for identifying one or more changes in a specific region of chromatin structure that can be correlated with a disease comprising the steps of:
(a) preparing a plurality of chromatin fragments from a diseased and a non-diseased sample; (b) sedimenting the chromatin fragments from each of the samples into one or more fractions;
(c) resolving the chromatin fragments into different lengths;
(d) isolating one or more DNA fragments that are shorter or longer than bulk chromatin;
(e) optionally digesting the DNA fragment(s) into one or more probes;
(f) determining the total amount of DNA in the DNA fragments isolated in step (e);
(g) determining the abundance of the specific region of the genome in the DNA fragments isolated in step (e); and
(h) comparing the results from steps (g) and (h) for each of the diseased and non- diseased samples to determine if the chromatin structure of the specific region has been altered.
62. A method according to claim 61 , wherein the total amount of DNA is measured using DOP-PCR.
63. A method according to claim 60 or claim 61, wherein the abundance of the specific region of the genome is determined using real time PCR.
64. An array comprising one or more compact chromatin probes according to any of claims 11-24 and/or an open chromatin probe according to any of claims 29-42 hybridised thereto.
65. An array according to claim 64, wherein the array is a microarray.
66. An array according to claim 64 or claim 65, wherein the array is tiling path array, preferably a whole genome tiling path array.
67. An array according to claim 66, wherein the array is a 1 Mb or 22q tiling path array.
68. An array according to claim 66 or claim 67, wherein the array is an expression array.
69. An array according to any of claims 64-68, wherein the array is a human genomic array.
70. A method for preparing an array comprising the step of hybridising one or more compact chromatin probes according to any of claims 11-24 and/or hybridising one or more open chromatin probes according to any of claims 29-42 to the array.
71. A method according to claim 70, wherein input chromatin is hybridised to the array.
72. An array obtained or obtainable by the method according to claim 70 or claim 71.
73. Use of one or more compact chromatin probes according to claim 25 or a library thereof according to claim 26 and/or one or more open chromatin probes according to claim 43 or a library thereof according to claim 44 in the preparation of an array.
74. Use of compact chromatin probe(s) according to claim 25 or a library thereof according to claim 26 and/or open chromatin probe(s) according to claim 43 or a library thereof according to claim 44 in a method for determining the structure of chromatin in a sample.
75. Use of compact chromatin probe(s) according to claim 25 or a library thereof according to claim 26 and/or open chromatin probe(s) according to claim 43 or a library thereof according to claim 44 in a method for identifying one or more changes in chromatin structure and/or expression in a sample that can be correlated with a disease.
76. A method for identifying changes (eg. alterations) in specific chromatin regions comprising the steps of: (i) providing a sample comprising one or more chromatin fragments; (ii) determining the total amount of DNA hi the sample; and (iii) determining the abundance of the specific chromatin region of interest in the sample; wherein a difference between (ii) and (iii) is indicative that the chromatin structure of the specific region of interest has changed.
PCT/GB2005/003374 2004-09-01 2005-09-01 Method for identifying compact and/or open chromatin in a sample Ceased WO2006024851A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0419419A GB0419419D0 (en) 2004-09-01 2004-09-01 Method
GB0419419.7 2004-09-01

Publications (2)

Publication Number Publication Date
WO2006024851A2 true WO2006024851A2 (en) 2006-03-09
WO2006024851A3 WO2006024851A3 (en) 2006-05-11

Family

ID=33155860

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2005/003374 Ceased WO2006024851A2 (en) 2004-09-01 2005-09-01 Method for identifying compact and/or open chromatin in a sample

Country Status (2)

Country Link
GB (1) GB0419419D0 (en)
WO (1) WO2006024851A2 (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009154984A1 (en) * 2008-05-27 2009-12-23 Perkinelmer Health Sciences, Inc. Chromatography systems and methods using them
EP2373795A4 (en) * 2008-12-03 2012-10-17 Integrated Nano Technologies Llc Universal biological sample processing
US8388736B2 (en) 2009-10-02 2013-03-05 Perkinelmer Health Sciences, Inc. Sorbent devices and methods of using them
US8562837B2 (en) 2010-09-22 2013-10-22 Perkinelmer Health Sciences, Inc. Backflush methods and devices for chromatography
US8561484B2 (en) 2009-03-24 2013-10-22 Perkinelmer Health Sciences, Inc. Sorbent devices with longitudinal diffusion paths and methods of using them
US8663918B2 (en) 2009-05-22 2014-03-04 Integrated Nano-Technologies, Inc. Method and system for sample preparation
US8794053B2 (en) 2010-06-14 2014-08-05 Perkinelmer Health Sciences, Inc. Fluidic devices and methods using them
US9347086B2 (en) 2009-04-03 2016-05-24 Integrated Nano-Technologies, Llc Method and system for sample preparation
CN108197431A (en) * 2018-01-24 2018-06-22 清华大学 The analysis method and system of chromatin interaction difference
US10753913B2 (en) 2015-06-30 2020-08-25 Perkinelmer Health Sciences, Inc. Chromatography systems with mobile phase generators

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040014086A1 (en) * 2001-05-11 2004-01-22 Regulome Corporation Regulome arrays
JP2005519635A (en) * 2001-05-11 2005-07-07 レギュローム コーポレーション DNA microarray containing active chromatin elements and comprehensive profiling using the same

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8303694B2 (en) 2008-05-27 2012-11-06 Perkinelmer Health Sciences, Inc. Chromatography systems and methods using them
WO2009154984A1 (en) * 2008-05-27 2009-12-23 Perkinelmer Health Sciences, Inc. Chromatography systems and methods using them
US8721768B2 (en) 2008-05-27 2014-05-13 Perkinelmer Health Sciences, Inc. Chromatography systems and methods using them
US10309939B2 (en) 2008-05-27 2019-06-04 Perkinelmer Health Sciences, Inc. Chromatography systems and methods using them
EP2373795A4 (en) * 2008-12-03 2012-10-17 Integrated Nano Technologies Llc Universal biological sample processing
US8561484B2 (en) 2009-03-24 2013-10-22 Perkinelmer Health Sciences, Inc. Sorbent devices with longitudinal diffusion paths and methods of using them
US9347086B2 (en) 2009-04-03 2016-05-24 Integrated Nano-Technologies, Llc Method and system for sample preparation
US10378045B2 (en) 2009-04-03 2019-08-13 Integrated Nano-Technologies, Llc Method and system for sample preparation
US9644200B2 (en) 2009-04-03 2017-05-09 Integrated Nano-Technologies, Llc Method and system for sample preparation
US8663918B2 (en) 2009-05-22 2014-03-04 Integrated Nano-Technologies, Inc. Method and system for sample preparation
US8388736B2 (en) 2009-10-02 2013-03-05 Perkinelmer Health Sciences, Inc. Sorbent devices and methods of using them
US9186613B2 (en) 2009-10-02 2015-11-17 Perkinelmer Health Sciences, Inc. Sorbent devices and methods of using them
US10399030B2 (en) 2010-06-14 2019-09-03 Perkinelmer Health Sciences, Inc. Fluidic devices and methods for modulating flow of fluid in chromatography system to provide tree way switching
US8794053B2 (en) 2010-06-14 2014-08-05 Perkinelmer Health Sciences, Inc. Fluidic devices and methods using them
US8562837B2 (en) 2010-09-22 2013-10-22 Perkinelmer Health Sciences, Inc. Backflush methods and devices for chromatography
US10753913B2 (en) 2015-06-30 2020-08-25 Perkinelmer Health Sciences, Inc. Chromatography systems with mobile phase generators
CN108197431A (en) * 2018-01-24 2018-06-22 清华大学 The analysis method and system of chromatin interaction difference

Also Published As

Publication number Publication date
WO2006024851A3 (en) 2006-05-11
GB0419419D0 (en) 2004-10-06

Similar Documents

Publication Publication Date Title
EP2121977B1 (en) Circular chromosome conformation capture (4c)
Giresi et al. Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde‐Assisted isolation of regulatory elements)
Gilbert et al. Chromatin architecture of the human genome: gene-rich domains are enriched in open chromatin fibers
RU2668164C2 (en) Urine biomarker cohorts, gene expression signatures and methods of use thereof
AU2006264564B2 (en) Chromosome conformation capture-on-chip (4c) assay
EP2505666B1 (en) Methods and compositions for enriching either target polynucleotides or non-target polynucleotides from a mixture of target and non-target polynucleotides
US20160153039A1 (en) Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation
EP3402896B1 (en) Deep sequencing profiling of tumors
EP3990920B1 (en) Methods and compositions for proximity ligation
CA2956925A1 (en) Tagging nucleic acids for sequence assembly
JP2014507164A (en) Method and system for haplotype determination
US20160194713A1 (en) Chromosome conformation capture method including selection and enrichment steps
WO2006024851A2 (en) Method for identifying compact and/or open chromatin in a sample
EP3270964A1 (en) Methods of treating inflammatory bowel disease with ifn-gamma therapy
US20210155972A1 (en) Targeted rare allele crispr enrichment
WO2011146788A2 (en) Methods of assessing a risk of developing necrotizing meningoencephalitis
Do et al. Genome-wide examination of chromosomal aberrations in neuroblastoma SH-SY5Y cells by array-based comparative genomic hybridization
EP1501949A2 (en) Ssh based methods for identifying and isolating unique nucleic acid sequences
RU2225612C2 (en) Method for prognosis of multiple myeoloma course
RU2585519C2 (en) Method of selective screening of target sections of dna
HK40010078A (en) Urine biomarker cohorts, gene expression signatures, and methods of use thereof
Class et al. Patent application title: CIRCULAR CHROMOSOME CONFORMATION CAPTURE (4C) Inventors: Wouter De Laat (Rotterdam, NL) Frank Grosveld (Rotterdam, NL) Assignees: Erasmus University Medical Center
JP2008514213A (en) Improved electrophoretic separation method for gene expression analysis
BR112018014349B1 (en) TARGETED REPRESENTATIONAL SEQUENCING METHOD

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase