WO2006024640A2 - Triazolophthalazines - Google Patents

Triazolophthalazines Download PDF

Info

Publication number
WO2006024640A2
WO2006024640A2 PCT/EP2005/054266 EP2005054266W WO2006024640A2 WO 2006024640 A2 WO2006024640 A2 WO 2006024640A2 EP 2005054266 W EP2005054266 W EP 2005054266W WO 2006024640 A2 WO2006024640 A2 WO 2006024640A2
Authority
WO
WIPO (PCT)
Prior art keywords
phenyl
methoxy
alkyl
compounds
alkoxy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2005/054266
Other languages
French (fr)
Other versions
WO2006024640A3 (en
Inventor
Beate Schmidt
Steffen Weinbrenner
Dieter Flockerzi
Raimund Kuelzer
Hermann Tenor
Hans-Peter Kley
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Takeda GmbH
Original Assignee
Altana Pharma AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to DE602005021894T priority Critical patent/DE602005021894D1/en
Priority to AT05784647T priority patent/ATE471324T1/en
Priority to BRPI0514586-4A priority patent/BRPI0514586A/en
Priority to AU2005279221A priority patent/AU2005279221C9/en
Priority to EA200700537A priority patent/EA014324B1/en
Priority to US11/660,748 priority patent/US7851472B2/en
Priority to NZ553160A priority patent/NZ553160A/en
Priority to CN200580038057XA priority patent/CN101133057B/en
Priority to KR1020077006869A priority patent/KR101368093B1/en
Priority to EP05784647A priority patent/EP1791543B1/en
Priority to JP2007528875A priority patent/JP5140427B2/en
Priority to CA2578368A priority patent/CA2578368C/en
Application filed by Altana Pharma AG filed Critical Altana Pharma AG
Priority to HK08106059.7A priority patent/HK1115590B/en
Publication of WO2006024640A2 publication Critical patent/WO2006024640A2/en
Priority to IL181271A priority patent/IL181271A/en
Priority to NO20071127A priority patent/NO20071127L/en
Anticipated expiration legal-status Critical
Publication of WO2006024640A3 publication Critical patent/WO2006024640A3/en
Priority to US12/766,478 priority patent/US20100286140A1/en
Ceased legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/424—Oxazoles condensed with heterocyclic ring systems, e.g. clavulanic acid
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/10—Antioedematous agents; Diuretics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/06—Antiarrhythmics

Definitions

  • the invention relates to novel triazolophthalazine derivatives, which can be used in the pharmaceutical industry for the production of pharmaceutical compositions.
  • Triazolophthalazines are known from prior art. For example, EP85840, WO98/04559, WO98/50385,
  • the invention thus relates in a first aspect (aspect a) to compounds of formula I
  • R1 is -U-A, in which
  • U is a direct bond, or methylene (-CH 2 -),
  • A is phenyl, pyridinyl, thiophenyl, or R11- and/or R111 -substituted phenyl, in which R11 is 1-4C-alkyl, halogen, trifluoromethyl, hydroxyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, phenoxy, 1-4C-alkoxycarbonyl, morpholino, or di-1-4C- alkylamino,
  • R111 is 1-4C-alkoxy, halogen, hydroxyl, or 1-4C-alkyl
  • R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
  • R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31- and/or R311- substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)- piperidinyl, in which
  • R31 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
  • R311 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R31 and R311 together are a 1-2C-alkylenedioxy group
  • R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321- and/or R3211 -substituted phenyl, mono- or di-1-4C-alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
  • R3211 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R321 and R3211 together are a 1-2C-alkylenedioxy group, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
  • R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42- and/or R421 -substituted phenyl, or pyridinyl, in which
  • R41 is hydroxyl, 1-4C-alkoxy, mono- or di-1-4C-alkylamino, or morpholino
  • R42 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
  • R421 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R42 and R421 together are a 1-2C-alkylenedioxy group
  • R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
  • 1-4C-Alkyl is a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, and, particularly, the ethyl and methyl radicals.
  • 2-4C-Alkyl is a straight-chain or branched alkyl radical having 2 to 4 carbon atoms. Examples are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl and ethyl radicals.
  • 3-7C-Cycloalkyl stands for cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl, of which cyclopropyl, cyclopentyl and cyclohexyl are in particular to be mentioned.
  • 2-4C-Alkenyl is a straight chain or branched alkenyl radical having 2 to 4 carbon atoms. Examples are the ethenyl (vinyl), 2-butenyl, 3-butenyl, 1-propenyl and the 2-propenyl (allyl) radicals.
  • Halogen within the meaning of the present invention is iodine or, in particular, bromine, chlorine or fluorine.
  • 1-4C-Alkoxy represents radicals which, in addition to the oxygen atom, contain a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, isopropoxy and preferably the ethoxy and methoxy radicals.
  • 1-4C-Alkoxycarbonyl is a carbonyl group to which one of the abovementioned 1-4C-alkoxy radicals is bonded.
  • Examples are the methoxycarbonyl (CH 3 O-C(O)-) and the ethoxycarbonyl (CH 3 CH 2 O-C(O)-) radical.
  • 3-7C-Cycloalkylmethoxy stands for cyclopropylmethoxy, cyclobutylmethoxy, cyclopentylmethoxy, cyclohexylmethoxy or cycloheptylmethoxy, of which cyclopropylmethoxy and cyclopentylmethoxy are to be emphasized.
  • 1-2C-Alkylenedioxy stands, for example, for the methylenedioxy (-0-CH 2 -O-) or the ethylenedioxy radical (-0-CH 2 -CH 2 -O-).
  • Completely or predominantly fluorine-substituted 1-4C-alkoxy is, for example, the 2,2,3,3,3- pentafluoropropoxy, the perfluoroethoxy, the 1 ,2,2-trifluoroethoxy and in particular the 1 ,1 ,2,2- tetrafluoroethoxy, the 2,2,2-trifluoroethoxy, the trifluoromethoxy and the difluoromethoxy radical, of which the difluoromethoxy radical is preferred.
  • "Predominantly” in this connection means that more than half of the hydrogen atoms of the 1-4C-alkoxy groups are replaced by fluorine atoms.
  • Di-1-4C-alkylamino stands for an amino group, which is substituted by two different or two identical of the abovementioned 1-4C-alkyl radicals. Examples are the dimethylamino, the diethylamino and the diisopropyl radical.
  • Di-(I -4C-alkoxy)-phenyl stands for a phenyl radical, which is substituted at any possible positions by two of the abovementioned 1-4C-alkoxy radicals, which may be the same or different.
  • Mono- or Di-1-4C-alkylamino radicals contain in addition to the nitrogen atom, one or two of the abovementioned 1-4C-alkyl radicals.
  • Phenyl-1-4C-alkoxy stands for one of the abovementioned 1-4C-alkoxy radicals, which is substituted by the phenyl radical. Examples which may be mentioned are the benzyloxy and the phenethoxy radical.
  • 1-4C-Alkylcarbonyl is a carbonyl group to which one of the abovementioned 1-4C-alkyl radicals is bonded.
  • An example is the acetyl radical (CH 3 CO-).
  • heterocyclic groups mentioned herein refer, unless otherwise mentioned, to all of the possible isomeric forms thereof.
  • heterocyclic groups mentioned herein refer, unless otherwise noted, in particular to all of the possible positional isomers thereof.
  • pyridyl or pyridinyl alone or as part of another group, includes pyridin-
  • 1 N-(R33)-piperidinyl includes 1 N-(R33)-piperidin-2-yl, 1 N-(R33)- piperidin-3-yl and 1 N-(R33)-piperidin-4-yl.
  • N-(R33)-Piperidinyl stands for a piperidinyl radical which is substituted by R33 at the nitrogen atom, such as, for example, any radical, which is selected from the group consisting of piperidin-2-yl, piperidin-3-yl and piperidin-4-yl, and which is substituted by R33 at its nitrogen atom.
  • 4N-(R322)-Piperazin-1-yl stands for a piperazin-1-yl radical which is substituted at its nitrogen atom in the 4-position by R322.
  • 4N-(1-4C-Alkyl)-piperazin-1-yl stands for a piperazin-1-yl radical which is substituted at its nitrogen atom in the 4-position by one of the abovementioned 1-4C-alkyl radicals, such as e.g. 4N-methyl- piperazin-1-yl.
  • each definition is independent.
  • Suitable salts for compounds according to this invention - depending on substitution - are all acid addi ⁇ tion salts or all salts with bases. Particular mention may be made of the pharmacologically tolerable inorganic and organic acids and bases customarily used in pharmacy.
  • Those suitable are, on the one hand, water-insoluble and, particularly, water-soluble acid addition salts with acids such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulphuric acid, acetic acid, citric acid, D-gluconic acid, benzoic acid, 2-(4-hydroxybenzoyl)benzoic acid, butyric acid, sulphosalicylic acid, maleic acid, lauric acid, malic acid, fumaric acid, succinic acid, oxalic acid, tartaric acid, embonic acid, stearic acid, toluenesulphonic acid, methanesulphonic acid or 3-hydroxy-2- naphthoic acid, the acids being employed in salt preparation - depending on whether a mono- or polybasic acid is concerned and depending on which salt is desired - in an equimolar quantitative ratio or one differing therefrom.
  • acids such as, for example, hydrochloric acid, hydrobromic acid
  • salts with bases are - depending on substitution - also suitable.
  • salts with bases are mentioned the lithium, sodium, potassium, calcium, aluminium, magnesium, titanium, ammonium, meglumine or guanidinium salts, here, too, the bases being employed in salt preparation in an equimolar quantitative ratio or one differing therefrom.
  • Pharmacologically intolerable salts which can be obtained, for example, as process products during the preparation of the compounds according to this invention on an industrial scale, are converted into pharmacologically tolerable salts by processes known to the person skilled in the art.
  • the compounds according to this invention as well as their salts may contain, e.g. when isolated in crystalline form, varying amounts of solvents. Included within the scope of the invention are therefore all solvates and in particular all hydrates of the compounds according to this invention as well as all solvates and in particular all hydrates of the salts of the compounds according to this invention.
  • R1 is -U-A, in which
  • U is a direct bond, or methylene (-CH 2 -),
  • A is phenyl, pyridinyl, thiophenyl, di-(1-4C-alkoxy)-phenyl, or R11 -substituted phenyl, in which R11 is 1-4C-alkyl, halogen, trifluoromethyl, hydroxyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, phenoxy, 1-4C-alkoxycarbonyl, morpholino, or di-1-4C- alkylamino,
  • R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)-piperidinyl, in which
  • R31 is 1-4C-alkoxy, morpholino, or di-1-4C-alkylamino
  • R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321 -substituted phenyl, di-1-4C- alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
  • R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
  • R41 is hydroxyl, 1-4C-alkoxy, di-1-4C-alkylamino, or morpholino
  • R42 is 1-4C-alkoxy, or di-1-4C-alkylamino
  • R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
  • R1 is -U-A, in which
  • U is a direct bond, or methylene (-CH 2 -),
  • A is phenyl, pyridinyl, thiophenyl, dimethoxyphenyl, or R11 -substituted phenyl, in which
  • R11 is methyl, tertbutyl, chlorine, fluorine, bromine, trifluoromethyl, hydroxyl, methoxy, ethoxy, trifluoromethoxy, phenoxy, methoxycarbonyl, morpholino, or dimethylamino,
  • R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)-piperidinyl, in which R31 is 1-4C-alkoxy, morpholino, or di-1-4C-alkylamino,
  • R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321 -substituted phenyl, di-1-4C- alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
  • R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
  • R41 is hydroxyl, 1-4C-alkoxy, di-1-4C-alkylamino, or morpholino
  • R42 is 1 -4C-alkoxy, or di-1 -4C-alkylamino
  • R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
  • A is phenyl, or R11 -substituted phenyl, in which
  • R11 is methyl, chlorine, fluorine, bromine, trifluoromethyl, hydroxyl, methoxy, phenoxy, methoxycarbonyl, or dimethylamino,
  • R2 is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
  • R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
  • R31 is methoxy, morpholino, or dimethylamino
  • R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
  • R33 is hydrogen, methyl, or acetyl
  • R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which R41 is hydroxyl, methoxy, dimethylamino, or morpholino, R42 is methoxy, or dimethylamino,
  • R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-methyl-piperazin-1-yl,
  • A is phenyl, or R11 -substituted phenyl, in which
  • R11 is fluorine, bromine, trifluoromethyl, or methoxy, whereby in particular
  • R1 is 4-methoxy-phenyl, 2-methoxy-phenyl, 2-bromo-phenyl, 2-fluoro-phenyl, or 2- (trifluoromethyl)-phenyl;
  • R2 is attached in the meta or para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
  • R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
  • R31 is methoxy, morpholino, or dimethylamino
  • R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
  • R33 is hydrogen, methyl, or acetyl
  • R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
  • R41 is hydroxyl, methoxy, dimethylamino, or morpholino
  • R42 is methoxy, or dimethylamino
  • R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-methyl-piperazin-1-yl, and the salts of these compounds.
  • R1 is -U-A, in which
  • A is phenyl, or R11 -substituted phenyl, in which
  • R11 is fluorine, bromine, chlorine, trifluoromethyl, methyl or methoxy
  • R2 is attached in the meta or para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
  • R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
  • R31 is methoxy, morpholino, or dimethylamino
  • R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
  • R33 is hydrogen, methyl, or acetyl
  • R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
  • R41 is hydroxyl, methoxy, dimethylamino or morpholino
  • R42 is methoxy, or dimethylamino
  • R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, 4N-methyl-piperazin-1-yl, or 4N-ethyl-piperazin-1-yl
  • a special interest in the compounds according to this invention refers to those compounds of formula I which are included -within the scope of this invention- by one or, when possible, by more of the following special embodiments:
  • a special embodiment (embodiment 1 ) of the compounds according to the present invention refers to those compounds of formula I, in which
  • A is phenyl, or R11 -substituted phenyl.
  • Another special embodiment (embodiment 2) of the compounds according to the present invention refers to those compounds of formula I, in which
  • A is pyridinyl or thiophenyl, such as e.g. pyridin-4-yl.
  • A is phenyl, or R11 -substituted phenyl.
  • R1 is -U-A, in which
  • U is methylene (-CH 2 -),
  • A is phenyl, or R11 -substituted phenyl
  • Another special embodiment (embodiment 3-1-1) of the compounds according to the present invention refers to those compounds of formula I, in which R1 is (4-methoxy-phenyl)-methyl; and the salts of these compounds.
  • A is pyridinyl or thiophenyl, such as e.g. thiophen-2-yl.
  • Another special embodiment (embodiment 5) of the compounds according to the present invention refers to those compounds of formula I, in which R2 is -N(H)-C(O)R3.
  • Another special embodiment (embodiment 6) of the compounds according to the present invention refers to those compounds of formula I, in which R2 is -C(O)-N(R4)R5.
  • R1 is (4-methoxy-phenyl)-methyl, or 4-methoxy-phenyl.
  • Another special embodiment (embodiment 8) of the compounds according to the present invention refers to those compounds of formula I, in which R1 is 4-methoxy-phenyl.
  • R1 is (4-methoxy-phenyl)-methyl, 2-hydroxy-phenyl, phenyl, 3-methoxycarbonyl-phenyl, or
  • R1 is 4-methoxy-phenyl, 2-methoxy-phenyl, 2-bromo-phenyl, 2-fluoro-phenyl, or 2- (trifluoromethyl)-phenyl.
  • Another special embodiment (embodiment 11) of the compounds according to the present invention refers to those compounds of formula I, in which R1 is 2-bromo-phenyl.
  • R2 is -N(H)-C(O)R3, in which
  • R3 is 1 N-H-piperidinyl, especially 1 N-H-piperidin-2-yl or 1 N-H-piperidin-3-yl.
  • R2 is attached in the meta position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold.
  • R2 is attached in the para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold.
  • R2 is attached in the para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold; and R2 is -N(H)-C(O)R3, in which
  • R3 is 1 N-H-piperidinyl; and the salts of these compounds.
  • a special group of the compounds according to the present invention refers to those compounds of formula I, in which
  • R1 is 4-methoxy-phenyl, or 2-bromo-phenyl,
  • R2 is attached in the para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is -N(H)-C(O)R3, in which R3 is 1 N-H-piperidinyl, especially 1 N-H-piperidin-2-yl or 1 N-H-piperidin-3-yl.
  • the compounds according to the invention can be prepared e.g. as described exemplarily as follows and according to the following specified reaction steps, or, particularly, in a manner as described by way of example in the following examples, or analogously or similarly thereto according to preparation procedures or synthesis strategies known to the person skilled in the art.
  • Said nucleophilic substitution reaction can be carried out as described in the following examples or as known to the skilled person; thus, depending on the reactivity of the reactants, it can be carried out by melting the reaction partners without solvent together or by reacting the reaction partners in a suitable solvent, such as e.g. N,N-dimethylformamide, in the presence of a suitable base, such as e.g. sodium hydride or potassium carbonate, at a temperature to allow the reaction to proceede (this may be e.g., depending on the reactants, ambient temperature, elevated temperature, or reflux temperature of the solvent used or, under appropriate conditions, beyond it), optionally under microwave irradiation.
  • a suitable solvent such as e.g. N,N-dimethylformamide
  • a suitable base such as e.g. sodium hydride or potassium carbonate
  • compounds of the formula Ia' can also be prepared from the corresponding compounds of formula Ia and corresponding compounds of formula R3-C(O)Y, in which Y is hydroxyl, by reaction with amide bond linking reagents known to the person skilled in the art under conditions customary to the skilled person.
  • amide bond linking reagents known to the person skilled in the art which may be mentioned are, for example, the carbodiimides (e.g. dicyclohexylcarbodiimide or, preferably, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride), azodicarboxylic acid derivatives (e.g.
  • uronium salts e.g. O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium tetrafluoroborate or O-(benzotriazol-1yl)-N,N,N',N'-tetramthyl-uronium-hexafluorophosphate] and N 1 N'- carbonyldiimidazole.
  • 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC or EDCI) is particularly to be mentioned.
  • This amidification reaction can be carried out in the presence of suitable amide bond linking reagents, such as e.g. those mentioned above, particularly 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC or EDCI).
  • suitable amide bond linking reagents such as e.g. those mentioned above, particularly 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC or EDCI).
  • Benzoic acids of formula Ib in which R1 has the meanings given above, can be prepared by saponification of corresponding ester compounds of formula I, in which R2 is 1-4C-alkoxycarbonyl, particularly methoxycarbonyl.
  • Said reactions can be carried out as described in the following examples, or under conditions known to the skilled person or analogously to art-known reactions similar thereto.
  • the aforementioned one-step cyclization reaction can be carried out similarly as described in J. Med. Chem. Vol. 31 , 1988, p. 1115, in a suitable solvent, such as e.g. toluene, pyridine or dioxane, in the presence of a suitable base (e.g. triethylamine) at elevated temperature or the reflux temperature of the solvent used.
  • a suitable solvent such as e.g. toluene, pyridine or dioxane
  • a suitable base e.g. triethylamine
  • Compounds of formula IV can be obtained by nucleophilic substitution of compounds of formula V, in which X and X' can be the same and are suitable leaving groups, particularly X and X' are both chlorine, and hydrazine.
  • the substances of formula I according to the invention are isolated and purified in a manner known per se, for example by distilling off the solvent under reduced pressure and recrystallizing the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as, for example, column chromatography on a suitable support material.
  • Salts are obtained by dissolving the free compound in a suitable solvent (e.g. a ketone, such as aceto ⁇ ne, methyl ethyl ketone or methyl isobutyl ketone, an ether, such as diethyl ether, tetrahydrofuran or dioxane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or a low-molecular- weight aliphatic alcohol, such as ethanol or isopropanol) which contains the desired acid or base, or to which the desired acid or base is then added.
  • a suitable solvent e.g. a ketone, such as aceto ⁇ ne, methyl ethyl ketone or methyl isobutyl ketone, an ether, such as diethyl ether, tetrahydrofuran or dioxane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or
  • the salts are obtained by filtering, reprecipitating, preci ⁇ pitating with a nonsolvent for the addition salt or by evaporating the solvent. Salts obtained can be converted into the free compounds, which can in turn be converted into salts, by alkalization or by aci ⁇ dification. In this manner, pharmacologically unacceptable salts can be converted into pharmacologically acceptable salts.
  • MS mass spectrum
  • the product is purified by column chromatography via silica gel.
  • Furan-3-carboxy lie acid ⁇ 4-[3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl ⁇ -amide
  • the following compounds 113 and 114 can be obtained by reduction reaction analogously as described for compound 74a; or, alternatively, starting from B8 (for 113) or B9 (for 114) the following compounds 113 and 114 can be obtained analogously as described for compound 1.
  • the products can be purified by column chromatography via silica gel.
  • the compounds according to the invention have useful pharmacological properties which make them industrially utilizable.
  • selective inhibitors of cyclic GMP-hydrolysing phosphodiesterases (cGMP- PDE inhibitors) - prefentially of type 2 - they are suitable on the one hand as therapeutics for conditions of pathologically enhanced endothelial activity and impaired endothelial barrier function such as septic shock, vascular edema, or diseases associated with unwanted neoangiogenesis.
  • cGMP- PDE inhibitors cyclic GMP-hydrolysing phosphodiesterases
  • the compounds according to the invention can be employed in human and veterinary medicine as therapeutics, where they can be used, for example, for the treatment and prophylaxis of the following illnesses: (1) all conditions of pathologically enhanced endothelial activity/impaired endothelial barrier function such as multi-organ failure in particular acute respiratory distress syndrome (ARDS) in septic shock, pneumonia, acute and chronic airway disorders of varying origin (rhinitis, bronchitis, bronchial asthma, emphysema, COPD), angioedema, peripheral edema, cerebral edema for example traumatic or following stroke; (2) all conditions associated with pathologically enhanced neoangiogenesis such as all kinds of tumors (benign or malignant) which are associated with neoangiogenesis and all kinds of inflammatory diseases associated with neoangiogenesis for example disorders of the arthritis type (rheumatoid arthritis, r
  • the invention further relates to a method for the treatment of mammals, including humans, which are suffering from one of the above mentioned illnesses.
  • the method is characterized in that a therapeuti ⁇ cally active and pharmacologically effective and tolerable amount of one or more of the compounds according to the invention is administered to the ill mammal.
  • the invention further relates to a method for inhibiting PDE, particularly PDE2, comprising contacting said PDE with an effective amount of a compound according to the invention.
  • the invention further relates to a method for inhibiting PDE, particularly PDE2, comprising administering a pharmacologically active and therapeutically effective and tolerable amount of at least one compound according to the invention to a mammal in need of such inhibition.
  • the invention further relates to the compounds according to the invention for use in the treatment and/or prophylaxis of illnesses, especially the illnesses mentioned.
  • the invention further relates to the compounds according to the invention having PDE, particularly PDE2, inhibitory activity.
  • the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of the illnesses mentioned.
  • the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of PDE-, particularly PDE2-, associated diseases.
  • the invention furthermore relates to pharmaceutical compositions for the treatment and/or prophylaxis of the illnesses mentioned, which contain one or more of the compounds according to the invention.
  • the invention moreover relates to pharmaceutical compositions having PDE, particularly PDE2, inhibitory activity.
  • the invention relates to an article of manufacture, which comprises packaging material and a pharmaceutical agent contained within said packaging material, wherein the pharmaceutical agent is therapeutically effective for antagonizing the effects of the cyclic nucleotide phosphodiesterase of type 2 (PDE2), ameliorating the symptoms of an PDE2-mediated disorder, and wherein the packaging material comprises a label or package insert which indicates that the pharmaceutical agent is useful for preventing or treating PDE2-mediated disorders, and wherein said pharmaceutical agent comprises one or more compounds of formula 1 according to the invention.
  • the packaging material, label and package insert otherwise parallel or resemble what is generally regarded as standard packaging material, labels and package inserts for pharmaceuticals having related utilities.
  • compositions according to the invention may be performed in any of the generally accepted modes of administration available in the art.
  • suitable modes of administration include intravenous, oral, nasal, parenteral, topical, transdermal and rectal delivery. Intravenous and oral delivery is preferred.
  • compositions are prepared by processes which are known per se and familiar to the person skilled in the art.
  • the compounds according to the invention are either employed as such, or preferably in combination with suitable pharmaceutical auxiliaries and/or excipients, e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between 0.1 and 95% and where, by the appropriate choice of the auxiliaries and/or excipients, a pharmaceutical administration form (e.g. a delayed release form or an enteric form) exactly suited to the active compound and/or to the desired onset of action can be achieved.
  • suitable pharmaceutical auxiliaries and/or excipients e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between
  • auxiliaries or excipients which are suitable for the desired pharmaceutical formulations on account of his/her expert knowledge.
  • gel for ⁇ mers, ointment bases and other active compound excipients for example antioxidants, dispersants, emulsifiers, preservatives, solubilizers, colorants, complexing agents or permeation promoters, can be used.
  • the compounds according to the invention are preferably also administered by inhalation in the form of an aerosol; the aerosol particles of solid, liquid or mixed composition preferably having a diameter of 0.5 to 10 ⁇ m, advantageously of 2 to 6 ⁇ m.
  • Aerosol generation can be carried out, for example, by pressure-driven jet atomizers or ultrasonic atomizers, but advantageously by propellant-driven metered aerosols or propellant-free administration of micronized active compounds from inhalation capsules.
  • the administration forms additionally contain the required excipients, such as, for example, propellants (e.g. Frigen in the case of metered aerosols), surface-active substances, emulsifiers, stabilizers, preservatives, flavorings, fillers (e.g. lactose in the case of powder inhalers) or, if appropriate, further active compounds.
  • propellants e.g. Frigen in the case of metered aerosols
  • surface-active substances e.g. Frigen in the case of metered aerosols
  • emulsifiers emulsifiers
  • stabilizers emulsifiers
  • preservatives e.g., emulsifiers, stabilizers, preservatives
  • flavorings e.g. lactose in the case of powder inhalers
  • fillers e.g. lactose in the case of powder inhalers
  • the compounds according to the invention are in particular admi ⁇ nistered in the form of those pharmaceutical compositions which are suitable for topical application.
  • suitable pharmaceutical formulations are, for example, powders, emulsions, suspensions, sprays, oils, ointments, fatty ointments, creams, pastes, gels or solutions.
  • compositions according to the invention are prepared by processes known per se.
  • the dosage of the active compounds is carried out in the order of magnitude customary for PDE inhibitors.
  • Topical application forms (such as ointments) for the treatment of dermatoses thus contain the active compounds in a concentration of, for example, 0.1-99%.
  • the dose for administration by inhalation is customarly between 0.1 and 3 mg per day.
  • the customary dose in the case of systemic therapy (p.o. or i.v.) is between 0.03 and 3 mg/kg per day.
  • PDE phosphodiesterase
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription- polymerase chain reaction
  • dNTPs deoxynucleoside triphosphates
  • RNA ribonucleic acid
  • cDNA complementary deoxyribonucleic acid
  • bp basepairs
  • (dT) 15 pentadecathymidylic acid
  • ORF open reading frame
  • GB no. GenBank database accession number
  • rBV recombinant baculovirus
  • wt wild type
  • aa aminoacid
  • UCR upstream conserved region
  • PAA polyacrylamide.
  • Aminoacids are abbreviated with the 1 -character symbol: A for alanine, C for cysteine, D for aspartic acid, E for glutamic acid, F for phenylalanine, G for glycine, H for histidine, I for isoleucine, K for lysine , L for leucine, M for methionine, N for asparagine, P for proline, Q for glutamine, R for arginine, S for serine, T for threonine, V for valine , W for tryptophane, Y for tyrosine.
  • PCR was carried out in a Stratagene Robocycler 40 or in a MWG Primus 96 plus thermocycler. Typically, PCR was carried out with the Expand Lond Template PCR System from Roche in buffer 3 plus 0.75 mM MgCI 2 , 0.3 ⁇ M each primer, 500 ⁇ M dNTPs.
  • PCR products were purified with the High Pure PCR Product Purification Kit (Roche) or from agarose gel with the QIAquick Gel Extraction kit from Qiagen, and cloned into the pCR2.1-TOPO vector from Invitrogen.
  • the ORFs were subcloned in baculovirus expression vectors (transfer plasmids).
  • the pCR- Bac and pVL vectors were from Invitrogen.
  • the pBacPak vectors (pBP8 or pBP9) were from Clontech. Restriction endonucleases were from Roche and MBI Fermentas. Modifying enzymes and T4 DNA ligase were from New England Biolabs.
  • the PDE2A3 (GB no. U67733) was amplified in 2 steps using PCR from brain cDNA.
  • a N-terminal fragment was isolated using primers CP1 PD2AS (5'- GAGGAGTGATGGGGCAGGC -3') and PR9PD2AA ( 5'- GCGAAGTGGGAGACAGAAAAG -3'), a C-terminal fragment was isolated using primers PR7PD2AS (5'- GATCCTGAACATCCCTGACG -3') and CP3PD2AA (5'- GGGATCACTCAGCATCAAGGC-3').
  • the PCR products were cloned into the vector pCR2.1-Topo.
  • the N-terminal fragment was first subcloned with EcoRI into pBluescript Il KS (-), afterwards a Bst1107l/EcoRV fragment was exchanged with the corresponding restriction fragment from the C- terminal clone, to obtain a complete ORF.
  • the ORF for the PDE2A3 was subcloned into pBP8 using Xbal and Kpnl.
  • the rBV was prepared by means of homologous recombination in Sf9 insect cells.
  • the expression plasmids were cotransfected with Bac-N-Blue (Invitrogen) or Baculo-Gold DNA (Pharmingen) using a standard protocol (Pharmingen).
  • Wt virus-free recombinant virus supernatants were selected using plaque assay methods. After that, high-titre virus supernatants were prepared by amplifying 3 times.
  • PDE2 was expressed in Sf21 cells by infecting 2x10 6 cells/ml with an MOI (multiplicity of infection) between 1 and 10 in serum-free SF900 medium (Life Technologies).
  • Cells were cultured at 28°C , typically for 48 hours, after which they were pelleted for 5-10 min at 1000 g and 4°C. In spinner flasks, cells were cultured at a rotational speed of 75 rpm. The SF21 insect cells were resuspended, at a concentration of approx.
  • the test volume is 100 ⁇ l and contains 20 mM Tris buffer (pH 7.4), 0.1 mg of BSA (bovine serum albumin)/ml, 5 mM Mg 2+ , 0.5 ⁇ M cAMP (including about 50,000 cpm of [3H]CAMP), 5 ⁇ M cGMP (to activate PDE2A3), 2 ⁇ l of the respective substance dilution in DMSO and sufficient recombinant PDE (1000xg supernatant, see above) to ensure that 15-20% of the cAMP is converted under the said experimental conditions.
  • Tris buffer pH 7.4
  • BSA bovine serum albumin
  • 5 mM Mg 2+ 0.5 ⁇ M cAMP (including about 50,000 cpm of [3H]CAMP)
  • 5 ⁇ M cGMP to activate PDE2A3
  • the reaction is started by adding the substrate (cAMP) and the assays are incubated for a further 15 min; after that, they are stopped by adding SPA beads (50 ⁇ l).
  • the SPA beads had previously been resuspended in water and then diluted 1 :3 (v/v); the diluted solution also contains 3 mM IBMX.
  • the MTP's are analyzed in commercially available measuring appliances and the corresponding IC 50 values of the compounds for the inhibition of PDE activities are determined from the concentration-effect curves by means of non-linear regression.
  • EBM endothelial cell basal medium
  • FCS fetal calf serum
  • HUVECs were cultured in EGM2 (100 ⁇ l in the upper wells and 600 ⁇ l in the lower wells) over four days prior the experiments and medium was changed every other day. At the day of the experiment culture medium was replaced by M199 with 1 % human serum albumin.
  • Endothelial cells were preincubated with cyclic nucleotide modifiers (the selective PDE3 inhibitor motapizone, the selective PDE4 inhibitor RP73401 , the cGMP generators ANP or SNP and PDE2 inhibitors) for 15 min.
  • HUVECs were then stimulated with Thrombin (1 U ml "1 ) (Sigma, Taufkichen, Germany) and horsh radish peroxidase (5 ⁇ g/ml) (Sigma, Taufmün, Germany) as the macromolecule marker protein was added to the upper wells.
  • compounds according to the invention can inhibit Thrombin-induced permeability of HUVEC monolayers for horsh radish peroxidase (HRP) as a macromolecule marker. Therefore, PDE2 inhibitors are suggested to improve the endothelial barrier function, which is impaired in numerous conditions such as acute respiratory distress syndrome (ARDS) or severe pneumonia.
  • ARDS acute respiratory distress syndrome
  • the system to measure these cellular effects of the PDE2 inhibitors observed the enzymological characteristics of PDE2 which exhibits a rather high Km for cAMP and the activity of which is activated by cGMP.
  • the Thrombin-induced increase of HRP permeability was completely abolished by complete inhibition of PDE3 (10 ⁇ M Motapizone) and PDE4 (1 ⁇ M RP73401).
  • HUVEC cells on 3 ⁇ m polycarbonate filters were preincubated with 1 ⁇ M RP73401 (to block PDE4) and 10 ⁇ M Motapizone (to block PDE3), 1mM SNP or 10OnM ANP and 1 ⁇ M of test sample over 15 min and then stimulated with 1 U/ml thrombin.
  • HRP passage into the lower wells was assessed after 60 min.
  • RP73401 and Motapizone completely blocked thrombin-induced hyperpermeability, which was partially reversed by SNP and ANP.
  • Compounds according to this invention can inhibit the SNP- or ANP-induced permeability increase in a concentration-dependent fashion.
  • Representative inhibitory values [measured as -log IC 50 (mol/l)] determined in the aforementioned assay follow from the following table B, in which the numbers of the compounds correspond to the numbers of the examples.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Rheumatology (AREA)
  • Cardiology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Hematology (AREA)
  • Pain & Pain Management (AREA)
  • Communicable Diseases (AREA)
  • Biomedical Technology (AREA)
  • Oncology (AREA)
  • Diabetes (AREA)
  • Immunology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pulmonology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Compositions Of Macromolecular Compounds (AREA)

Abstract

The compounds of formula (I) in which R1 and R2 have the meanings as given in the description are novel effective PDE2 inhibitors.

Description

Triazolophthalazines
Field of application of the invention
The invention relates to novel triazolophthalazine derivatives, which can be used in the pharmaceutical industry for the production of pharmaceutical compositions.
Known technical background
Triazolophthalazines are known from prior art. For example, EP85840, WO98/04559, WO98/50385,
WO99/06407 (US6313125), WO02/083140, US6525055, EP0728759 (US 6001830); J. Med. Chem.,
(1988), 31 , 1115-1123; J. Med. Chem., (2004), 47, 1807-1822, and J. Med. Chem., (2004), 47, 2176-
2179 describe triazolophthalazines with various substitution patterns.
But, however, anilino-substituted triazolophthalazine derivatives in the meaning of the present invention have never been disclosed therein.
Yet however, triazolophthalazine derivatives have never been described as PDE2-inhibitors.
Description of the invention
It has now been found that the novel triazolophthalazine derivatives, which are described in greater details below, have surprising and particularly advantageous properties.
The invention thus relates in a first aspect (aspect a) to compounds of formula I
Figure imgf000002_0001
in which
R1 is -U-A, in which
U is a direct bond, or methylene (-CH2-),
A is phenyl, pyridinyl, thiophenyl, or R11- and/or R111 -substituted phenyl, in which R11 is 1-4C-alkyl, halogen, trifluoromethyl, hydroxyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, phenoxy, 1-4C-alkoxycarbonyl, morpholino, or di-1-4C- alkylamino,
R111 is 1-4C-alkoxy, halogen, hydroxyl, or 1-4C-alkyl,
R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31- and/or R311- substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)- piperidinyl, in which
R31 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
7C-cyloalkylmethoxy, morpholino, or mono- or di-1-4C-alkylamino, R311 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R31 and R311 together are a 1-2C-alkylenedioxy group, R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321- and/or R3211 -substituted phenyl, mono- or di-1-4C-alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
7C-cyloalkylmethoxy, or mono- or di-1-4C-alkylamino,
R3211 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R321 and R3211 together are a 1-2C-alkylenedioxy group, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42- and/or R421 -substituted phenyl, or pyridinyl, in which
R41 is hydroxyl, 1-4C-alkoxy, mono- or di-1-4C-alkylamino, or morpholino, R42 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
7C-cyloalkylmethoxy, or mono- or di-1-4C-alkylamino,
R421 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R42 and R421 together are a 1-2C-alkylenedioxy group, R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
and the salts of these compounds.
1-4C-Alkyl is a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, and, particularly, the ethyl and methyl radicals. 2-4C-Alkyl is a straight-chain or branched alkyl radical having 2 to 4 carbon atoms. Examples are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl and ethyl radicals.
3-7C-Cycloalkyl stands for cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl, of which cyclopropyl, cyclopentyl and cyclohexyl are in particular to be mentioned.
2-4C-Alkenyl is a straight chain or branched alkenyl radical having 2 to 4 carbon atoms. Examples are the ethenyl (vinyl), 2-butenyl, 3-butenyl, 1-propenyl and the 2-propenyl (allyl) radicals.
Halogen within the meaning of the present invention is iodine or, in particular, bromine, chlorine or fluorine.
1-4C-Alkoxy represents radicals which, in addition to the oxygen atom, contain a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, isopropoxy and preferably the ethoxy and methoxy radicals.
1-4C-Alkoxycarbonyl is a carbonyl group to which one of the abovementioned 1-4C-alkoxy radicals is bonded. Examples are the methoxycarbonyl (CH3O-C(O)-) and the ethoxycarbonyl (CH3CH2O-C(O)-) radical.
3-7C-Cycloalkylmethoxy stands for cyclopropylmethoxy, cyclobutylmethoxy, cyclopentylmethoxy, cyclohexylmethoxy or cycloheptylmethoxy, of which cyclopropylmethoxy and cyclopentylmethoxy are to be emphasized.
1-2C-Alkylenedioxy stands, for example, for the methylenedioxy (-0-CH2-O-) or the ethylenedioxy radical (-0-CH2-CH2-O-).
Completely or predominantly fluorine-substituted 1-4C-alkoxy is, for example, the 2,2,3,3,3- pentafluoropropoxy, the perfluoroethoxy, the 1 ,2,2-trifluoroethoxy and in particular the 1 ,1 ,2,2- tetrafluoroethoxy, the 2,2,2-trifluoroethoxy, the trifluoromethoxy and the difluoromethoxy radical, of which the difluoromethoxy radical is preferred. "Predominantly" in this connection means that more than half of the hydrogen atoms of the 1-4C-alkoxy groups are replaced by fluorine atoms.
Di-1-4C-alkylamino stands for an amino group, which is substituted by two different or two identical of the abovementioned 1-4C-alkyl radicals. Examples are the dimethylamino, the diethylamino and the diisopropyl radical.
Di-(I -4C-alkoxy)-phenyl stands for a phenyl radical, which is substituted at any possible positions by two of the abovementioned 1-4C-alkoxy radicals, which may be the same or different. Mono- or Di-1-4C-alkylamino radicals contain in addition to the nitrogen atom, one or two of the abovementioned 1-4C-alkyl radicals. Preferred are the di-1-4C-alkylamino radicals, especially the dimethylamino, the diethylamino and the diisopropylamino radical.
Phenyl-1-4C-alkoxy stands for one of the abovementioned 1-4C-alkoxy radicals, which is substituted by the phenyl radical. Examples which may be mentioned are the benzyloxy and the phenethoxy radical.
1-4C-Alkylcarbonyl is a carbonyl group to which one of the abovementioned 1-4C-alkyl radicals is bonded. An example is the acetyl radical (CH3CO-).
The heterocyclic groups mentioned herein refer, unless otherwise mentioned, to all of the possible isomeric forms thereof.
The heterocyclic groups mentioned herein refer, unless otherwise noted, in particular to all of the possible positional isomers thereof.
Such as, for example, the term pyridyl or pyridinyl, alone or as part of another group, includes pyridin-
2-yl, pyridin-3-yl and pyridin-4-yl; or 1 N-(R33)-piperidinyl includes 1 N-(R33)-piperidin-2-yl, 1 N-(R33)- piperidin-3-yl and 1 N-(R33)-piperidin-4-yl.
1 N-(R33)-Piperidinyl stands for a piperidinyl radical which is substituted by R33 at the nitrogen atom, such as, for example, any radical, which is selected from the group consisting of piperidin-2-yl, piperidin-3-yl and piperidin-4-yl, and which is substituted by R33 at its nitrogen atom.
4N-(R322)-Piperazin-1-yl stands for a piperazin-1-yl radical which is substituted at its nitrogen atom in the 4-position by R322.
4N-(1-4C-Alkyl)-piperazin-1-yl stands for a piperazin-1-yl radical which is substituted at its nitrogen atom in the 4-position by one of the abovementioned 1-4C-alkyl radicals, such as e.g. 4N-methyl- piperazin-1-yl.
2-(R41)-Ethyl stands for an ethyl radical substituted in 2-position by R41.
In the meaning of the present invention, it is to be understood, that, when two structural portions of the compounds according to this invention are linked via a constituent which has the meaning "bond", then said two portions are directly attached to another via a single bond.
Constituents which are substituted as stated herein, may be substituted, unless otherwise noted, at any possible position. The substituent R2 of compounds of formula I can be attached in the ortho, meta or para position with respect to the binding position in which the phenyl ring is bonded to the amino group, whereby preference is given to the attachement in the meta or, particularly, para position.
When any variable occurs more than one time in any constituent, each definition is independent.
Suitable salts for compounds according to this invention - depending on substitution - are all acid addi¬ tion salts or all salts with bases. Particular mention may be made of the pharmacologically tolerable inorganic and organic acids and bases customarily used in pharmacy. Those suitable are, on the one hand, water-insoluble and, particularly, water-soluble acid addition salts with acids such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulphuric acid, acetic acid, citric acid, D-gluconic acid, benzoic acid, 2-(4-hydroxybenzoyl)benzoic acid, butyric acid, sulphosalicylic acid, maleic acid, lauric acid, malic acid, fumaric acid, succinic acid, oxalic acid, tartaric acid, embonic acid, stearic acid, toluenesulphonic acid, methanesulphonic acid or 3-hydroxy-2- naphthoic acid, the acids being employed in salt preparation - depending on whether a mono- or polybasic acid is concerned and depending on which salt is desired - in an equimolar quantitative ratio or one differing therefrom.
On the other hand, salts with bases are - depending on substitution - also suitable. As examples of salts with bases are mentioned the lithium, sodium, potassium, calcium, aluminium, magnesium, titanium, ammonium, meglumine or guanidinium salts, here, too, the bases being employed in salt preparation in an equimolar quantitative ratio or one differing therefrom.
Pharmacologically intolerable salts, which can be obtained, for example, as process products during the preparation of the compounds according to this invention on an industrial scale, are converted into pharmacologically tolerable salts by processes known to the person skilled in the art.
According to expert's knowledge the compounds according to this invention as well as their salts may contain, e.g. when isolated in crystalline form, varying amounts of solvents. Included within the scope of the invention are therefore all solvates and in particular all hydrates of the compounds according to this invention as well as all solvates and in particular all hydrates of the salts of the compounds according to this invention.
Compounds according to this invention worthy to be mentioned are those compounds of formula I, in which
R1 is -U-A, in which
U is a direct bond, or methylene (-CH2-),
A is phenyl, pyridinyl, thiophenyl, di-(1-4C-alkoxy)-phenyl, or R11 -substituted phenyl, in which R11 is 1-4C-alkyl, halogen, trifluoromethyl, hydroxyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, phenoxy, 1-4C-alkoxycarbonyl, morpholino, or di-1-4C- alkylamino,
R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)-piperidinyl, in which
R31 is 1-4C-alkoxy, morpholino, or di-1-4C-alkylamino,
R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321 -substituted phenyl, di-1-4C- alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
R41 is hydroxyl, 1-4C-alkoxy, di-1-4C-alkylamino, or morpholino, R42 is 1-4C-alkoxy, or di-1-4C-alkylamino, R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
and the salts of these compounds.
Compounds according to this invention more worthy to be mentioned are those compounds of formula
I, in which
R1 is -U-A, in which
U is a direct bond, or methylene (-CH2-),
A is phenyl, pyridinyl, thiophenyl, dimethoxyphenyl, or R11 -substituted phenyl, in which
R11 is methyl, tertbutyl, chlorine, fluorine, bromine, trifluoromethyl, hydroxyl, methoxy, ethoxy, trifluoromethoxy, phenoxy, methoxycarbonyl, morpholino, or dimethylamino,
R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)-piperidinyl, in which R31 is 1-4C-alkoxy, morpholino, or di-1-4C-alkylamino,
R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321 -substituted phenyl, di-1-4C- alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
R41 is hydroxyl, 1-4C-alkoxy, di-1-4C-alkylamino, or morpholino, R42 is 1 -4C-alkoxy, or di-1 -4C-alkylamino, R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
and the salts of these compounds.
Compounds according to this invention in particular worthy to be mentioned are those compounds of formula I, in which R1 is -U-A, in which U is a direct bond, or methylene (-CH2-),
A is phenyl, or R11 -substituted phenyl, in which
R11 is methyl, chlorine, fluorine, bromine, trifluoromethyl, hydroxyl, methoxy, phenoxy, methoxycarbonyl, or dimethylamino,
R2 is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
R31 is methoxy, morpholino, or dimethylamino,
R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
R33 is hydrogen, methyl, or acetyl,
R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which R41 is hydroxyl, methoxy, dimethylamino, or morpholino, R42 is methoxy, or dimethylamino,
R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-methyl-piperazin-1-yl,
and the salts of these compounds.
Compounds according to this invention in more particular worthy to be mentioned are those compounds of formula I, in which R1 is -U-A, in which U is a direct bond,
A is phenyl, or R11 -substituted phenyl, in which
R11 is fluorine, bromine, trifluoromethyl, or methoxy, whereby in particular
R1 is 4-methoxy-phenyl, 2-methoxy-phenyl, 2-bromo-phenyl, 2-fluoro-phenyl, or 2- (trifluoromethyl)-phenyl;
R2 is attached in the meta or para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
R31 is methoxy, morpholino, or dimethylamino,
R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
R33 is hydrogen, methyl, or acetyl,
R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
R41 is hydroxyl, methoxy, dimethylamino, or morpholino,
R42 is methoxy, or dimethylamino,
R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-methyl-piperazin-1-yl, and the salts of these compounds.
Emphasis is given to compounds of formula I, in which
R1 is -U-A, in which
U is a direct bond,
A is phenyl, or R11 -substituted phenyl, in which
R11 is fluorine, bromine, chlorine, trifluoromethyl, methyl or methoxy,
R2 is attached in the meta or para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
R31 is methoxy, morpholino, or dimethylamino,
R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
R33 is hydrogen, methyl, or acetyl,
R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
R41 is hydroxyl, methoxy, dimethylamino or morpholino,
R42 is methoxy, or dimethylamino,
R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, 4N-methyl-piperazin-1-yl, or 4N-ethyl-piperazin-1-yl
and the salts of these compounds.
A special interest in the compounds according to this invention refers to those compounds of formula I which are included -within the scope of this invention- by one or, when possible, by more of the following special embodiments:
A special embodiment (embodiment 1 ) of the compounds according to the present invention refers to those compounds of formula I, in which
U is a direct bond, and
A is phenyl, or R11 -substituted phenyl. Another special embodiment (embodiment 2) of the compounds according to the present invention refers to those compounds of formula I, in which
U is a direct bond, and
A is pyridinyl or thiophenyl, such as e.g. pyridin-4-yl.
Another special embodiment (embodiment 3) of the compounds according to the present invention refers to those compounds of formula I, in which
U is methylene, and
A is phenyl, or R11 -substituted phenyl.
Another special embodiment (embodiment 3-1) of the compounds according to the present invention refers to those compounds of formula I, in which
R1 is -U-A, in which
U is methylene (-CH2-),
A is phenyl, or R11 -substituted phenyl;
Another special embodiment (embodiment 3-1-1) of the compounds according to the present invention refers to those compounds of formula I, in which R1 is (4-methoxy-phenyl)-methyl; and the salts of these compounds.
Another special embodiment (embodiment 4) of the compounds according to the present invention refers to those compounds of formula I, in which
U is methylene, and
A is pyridinyl or thiophenyl, such as e.g. thiophen-2-yl.
Another special embodiment (embodiment 5) of the compounds according to the present invention refers to those compounds of formula I, in which R2 is -N(H)-C(O)R3.
Another special embodiment (embodiment 6) of the compounds according to the present invention refers to those compounds of formula I, in which R2 is -C(O)-N(R4)R5.
Another special embodiment (embodiment 7) of the compounds according to the present invention refers to those compounds of formula I, in which
R1 is (4-methoxy-phenyl)-methyl, or 4-methoxy-phenyl. Another special embodiment (embodiment 8) of the compounds according to the present invention refers to those compounds of formula I, in which R1 is 4-methoxy-phenyl.
Another special embodiment (embodiment 9) of the compounds according to the present invention refers to those compounds of formula I, in which
R1 is (4-methoxy-phenyl)-methyl, 2-hydroxy-phenyl, phenyl, 3-methoxycarbonyl-phenyl, or
4-methoxy-phenyl, 2-methoxy-phenyl, 2-bromo-phenyl, 2-fluoro-phenyl, or 2-(trifluoromethyl)- phenyl, or
2-chloro-phenyl, 4-bromo-phenyl, 2-methyl-phenyl.
Another special embodiment (embodiment 10) of the compounds according to the present invention refers to those compounds of formula I, in which
R1 is 4-methoxy-phenyl, 2-methoxy-phenyl, 2-bromo-phenyl, 2-fluoro-phenyl, or 2- (trifluoromethyl)-phenyl.
Another special embodiment (embodiment 11) of the compounds according to the present invention refers to those compounds of formula I, in which R1 is 2-bromo-phenyl.
Another special embodiment (embodiment 12) of the compounds according to the present invention refers to those compounds of formula I, in which
R2 is -N(H)-C(O)R3, in which
R3 is 1 N-H-piperidinyl, especially 1 N-H-piperidin-2-yl or 1 N-H-piperidin-3-yl.
Another special embodiment (embodiment 13) of the compounds according to the present invention refers to those compounds of formula I, in which
R2 is attached in the meta position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold.
Another special embodiment (embodiment 14) of the compounds according to the present invention refers to those compounds of formula I, in which
R2 is attached in the para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold.
Another special embodiment (embodiment 15) of the compounds according to the present invention refers to those compounds of formula I comprising one or more of the following: R1 is 4-methoxy-phenyl;
R2 is attached in the para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold; and R2 is -N(H)-C(O)R3, in which
R3 is 1 N-H-piperidinyl; and the salts of these compounds.
A special group of the compounds according to the present invention refers to those compounds of formula I, in which
R1 is 4-methoxy-phenyl, or 2-bromo-phenyl,
R2 is attached in the para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is -N(H)-C(O)R3, in which R3 is 1 N-H-piperidinyl, especially 1 N-H-piperidin-2-yl or 1 N-H-piperidin-3-yl.
The compounds according to the invention can be prepared e.g. as described exemplarily as follows and according to the following specified reaction steps, or, particularly, in a manner as described by way of example in the following examples, or analogously or similarly thereto according to preparation procedures or synthesis strategies known to the person skilled in the art.
As shown in reaction scheme 1 below, compounds of formula I, in which R1 and R2 have those of the abovementioned meanings which are suitable for the conditions of the nucleophilic substitution reaction in which they are built, can be obtained from corresponding compounds of formula II, in which X is a suitable leaving group, particularly chlorine, by reaction with corresponding aniline derivatives of formula III.
Said nucleophilic substitution reaction can be carried out as described in the following examples or as known to the skilled person; thus, depending on the reactivity of the reactants, it can be carried out by melting the reaction partners without solvent together or by reacting the reaction partners in a suitable solvent, such as e.g. N,N-dimethylformamide, in the presence of a suitable base, such as e.g. sodium hydride or potassium carbonate, at a temperature to allow the reaction to procede (this may be e.g., depending on the reactants, ambient temperature, elevated temperature, or reflux temperature of the solvent used or, under appropriate conditions, beyond it), optionally under microwave irradiation. Compounds of formula III are known or can be obtained in a known manner. Compounds of formula Il can be obtained as described later herein.
Reaction scheme 1
Figure imgf000013_0001
nucleophilic substitution
Figure imgf000013_0002
Figure imgf000013_0003
lsoamides of formula Ia' as shown below, in which R1 and R3 have the abovementioned meanings, especially those, which are not accessible by the synthesis strategy shown in reaction scheme 1 above, can be obtained as shown in reaction scheme 2 below by acylation of compounds of formula Ia, in which R1 has the meanings given above, with compounds of formula R3-C(O)Y, in which Y is a suitable leaving group, such as e.g. chlorine, under conditions habitual per se to the skilled person.
Alternatively, compounds of the formula Ia' can also be prepared from the corresponding compounds of formula Ia and corresponding compounds of formula R3-C(O)Y, in which Y is hydroxyl, by reaction with amide bond linking reagents known to the person skilled in the art under conditions customary to the skilled person. Exemplary amide bond linking reagents known to the person skilled in the art which may be mentioned are, for example, the carbodiimides (e.g. dicyclohexylcarbodiimide or, preferably, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride), azodicarboxylic acid derivatives (e.g. diethyl azodicarboxylate), uronium salts [e.g. O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium tetrafluoroborate or O-(benzotriazol-1yl)-N,N,N',N'-tetramthyl-uronium-hexafluorophosphate] and N1N'- carbonyldiimidazole. In the scope of this invention 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC or EDCI) is particularly to be mentioned.
Reaction scheme 2
Figure imgf000014_0001
Compounds of formula R3-C(O)Y are known or can be obtained in a known manner.
Compounds of formula Ia can be obtained directly as shown in reaction scheme 1 and described above by using diaminobenzene; or they are accessible by reduction of the nitro group of compounds of formula I, in which R1 has the meanings mentioned above and R2 is nitro, with the aid of an appropriate reducing agent, such as e.g. tin dichloride.
Compounds of formula I, in which R1 has the meanings mentioned above and R2 is nitro, can be obtained according to reaction scheme 1.
Amides of formula Ib' as shown below, in which R1 , R4 and R5 have the abovementioned meanings, especially those, which are not accessible by the synthesis strategy shown in reaction scheme 1 above, can be obtained as shown in reaction scheme 3 below by amidification of benzoic acids of formula Ib, in which R1 has the meanings given above, with corresponding amines of formula HN(R4)R5 under conditions customary per se to the skilled person.
This amidification reaction can be carried out in the presence of suitable amide bond linking reagents, such as e.g. those mentioned above, particularly 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC or EDCI).
Reaction scheme 3
Figure imgf000015_0001
Compounds of formula HN(R4)R5 are known or can be obtained in a known manner.
Benzoic acids of formula Ib, in which R1 has the meanings given above, can be prepared by saponification of corresponding ester compounds of formula I, in which R2 is 1-4C-alkoxycarbonyl, particularly methoxycarbonyl.
Compounds of formula I, in which R1 has the meanings mentioned above and R2 is 1-4C- alkoxycarbonyl, particularly methoxycarbonyl, can be obtained according to reaction scheme 1.
Starting compounds of formula Il can be obtained as shown in reaction scheme 4 or as specified in the following examples; or they are art-known, such as e.g. from R. W. Carling et al., J. Med. Chem. Vol. 47, No. 7, 1807-1822 (2004), or they can be prepared according to known procedures or analogously or similarly to art-described compounds.
Reaction scheme 4 condensation
Figure imgf000016_0001
Figure imgf000016_0002
Compounds of formula II, in which R1 has the meanings mentioned above and X is a suitable leaving group, particularly chlorine, can be obtained from corresponding compounds of formula IV either in one step by cyclization reaction with corresponding compounds of formula RI-C(O)Z, in which Z is a suitable leaving group, such as e.g. chlorine; or in two steps via the isolatable intermediate of formula III, which is accessible by acylation of compounds of formula IV and which can be further reacted to desired compounds of formula Il by condensation reaction.
Said reactions can be carried out as described in the following examples, or under conditions known to the skilled person or analogously to art-known reactions similar thereto. Thus, the aforementioned one-step cyclization reaction can be carried out similarly as described in J. Med. Chem. Vol. 31 , 1988, p. 1115, in a suitable solvent, such as e.g. toluene, pyridine or dioxane, in the presence of a suitable base (e.g. triethylamine) at elevated temperature or the reflux temperature of the solvent used.
Compounds of formula IV can be obtained by nucleophilic substitution of compounds of formula V, in which X and X' can be the same and are suitable leaving groups, particularly X and X' are both chlorine, and hydrazine.
Compounds of formulae RI-C(O)Z and V are known or can be obtained in a known manner.
It is to be understood for the skilled worker, that certain compounds of formula I according to this invention can be converted into further compounds of formula I by art-known synthesis strategies and reactions habitual per se to a person of ordinary skill in the art, like e.g. as described above.
It is moreover known to the person skilled in the art that if there are a number of reactive centers on a starting or intermediate compound it may be necessary to block one or more reactive centers temporarily by protective groups in order to allow a reaction to proceed specifically at the desired reaction center. A detailed description for the use of a large number of proven protective groups is found, for example, in "Protective Groups in Organic Synthesis" by T. Greene and P. Wuts (John Wiley & Sons, Inc. 1999, 3rd Ed.) or in "Protecting Groups (Thieme Foundations Organic Chemistry Series N Group" by P. Kocienski (Thieme Medical Publishers, 2000).
The substances of formula I according to the invention are isolated and purified in a manner known per se, for example by distilling off the solvent under reduced pressure and recrystallizing the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as, for example, column chromatography on a suitable support material.
Salts are obtained by dissolving the free compound in a suitable solvent (e.g. a ketone, such as aceto¬ ne, methyl ethyl ketone or methyl isobutyl ketone, an ether, such as diethyl ether, tetrahydrofuran or dioxane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or a low-molecular- weight aliphatic alcohol, such as ethanol or isopropanol) which contains the desired acid or base, or to which the desired acid or base is then added. The salts are obtained by filtering, reprecipitating, preci¬ pitating with a nonsolvent for the addition salt or by evaporating the solvent. Salts obtained can be converted into the free compounds, which can in turn be converted into salts, by alkalization or by aci¬ dification. In this manner, pharmacologically unacceptable salts can be converted into pharmacologically acceptable salts.
Suitably, the conversions mentioned in this invention can be carried out analogously or similarly to methods which are familiar per se to the person skilled in the art.
The person skilled in the art knows on the basis of his/her knowledge and on the basis of those synthesis routes, which are shown and described within the description of this invention, how to find other possible synthesis routes for compounds of formula I. All these other possible synthesis routes are also part of this invention.
Having described the invention in detail, the scope of the present invention is not limited only to those described characteristics or embodiments. As will be apparent to persons skilled in the art, modifications, analogies, variations, derivations, homologisations and adaptations to the described invention can be made on the base of art-known knowledge and/or, particularly, on the base of the disclosure (e.g. the explicite, implicite or inherent disclosure) of the present invention without departing from the spirit and scope of this invention as defined by the appended claims.
The following examples serve to illustrate the invention further without restricting it. Likewise, further compounds of formula I, whose preparation is not explicitly described, can be prepared in an analogous or similar manner or in a manner familiar per se to the person skilled in the art using customary process techniques. The compounds of formula I according to the present invention which are mentioned in the following examples, particularly which are mentioned as final compounds, as well as their salts are a preferred subject of the present invention.
In the examples, MS stands for mass spectrum, calc. for calculated, fnd. for found, and other abbreviations have their meanings customary per se to the skilled person.
Examples
Final Compounds:
1. N-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,4-diamine
1.0 g 6-chloro-3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazine (compound A1) and 2.7 g p- phenylene-diamine are stirred at 170 0C for 5 h. The reaction mixture is diluted with 6 ml ethanol and the precipitate is filtered with suction. The solid is recrystallized from N,N-dimethylformamide to yield
1.04 g of the title compound (m.p.: 295 0C).
EF: C22 H18 N6 O (382.43) found: [M+1] 383.3
Alternative reaction procedure I:
100 mg 6-chloro-3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazine (compound A1), 1-3 mmol of the appropriate aniline derivative and 30 mg potassium carbonate are stirred in 2,5 ml N1N- dimethylformamide at 140 0C for 4 h or at 200 0C for 10 min under microwave irradiation. The reaction mixture is diluted with dichloromethane / water or sodium hydroxide solution, the precipitate is filtered with suction, washed with water and recrystallized from N,N-dimethylformamide.
Alternative reaction procedure II:
2.5 mmol of the appropriate aniline derivative and 2.5 mmol sodium hydride (60 %) in 2.5 ml N1N- dimethylformamide are treated with 100 mg 6-chloro-3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4- a]phthalazine (compound A1) at ambient temperature. After 10 min the reaction mixture is added to water, the precipitate is filtered with suction and the solid is recrystallized from N1N- dimethylformamide.
Alternative work up procedure:
The product is purified by column chromatography via silica gel.
2. N-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,3-diamine
Starting from 6-chloro-3-(4-methoxy-phenyl)-[1 ,2l4]triazolo[3,4-a]phthalazine (compound A1) and m- phenylene-diamine, the title compound can be obtained analogously to one of the procedures as described for compound 1. m.p.: 295 0C
EF: C22 H18 N6 O (382.43) found: [M+1] 383.3
Starting from N-[3-(4-methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1 ,4-diamine (compound 1 ) and the appropriate carboxylic acid derivatives the following compounds 3 to 26 can be obtained analogously as described for compound 22. 3. C-Dimethylamino-N-{4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-acetamide
C26 H25 N7 02 MS: calc. C26 H25 N7 02 (467.53) found [M+1] 467.9
4. 2-Methoxy-N-{4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- acetamide
C25 H22 N6 03 MS: calc. C25 H22 N6 03 (454.49) found [M+1] 454.8
5. 3-Methoxy-N-{4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- propionamide
C26 H24 N6 03 MS: calc. C26 H24 N6 03 (468.52) found [M+1] 469.0
6. 3-Methoxy-N-{4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- benzamide
C30 H24 N6 03 MS: calc. C30 H24 N6 03 (516.56) found [M+1] 516.9
7. Dimethylamino-N-{4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-benzam ide
C31 H27 N7 02 MS: calc. C31 H27 N7 02 (529.61) found [M+1] 529.7
8. Dimethylamino-N-{4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-benzam ide
C31 H27 N7 02 MS: calc. C31 H27 N7 02 (529.61) found [M+1] 530.0
9. N-{4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- isonicotinamide
C28 H21 N7 02 MS: calc. C28 H21 N7 02 (487.53) found [M+1] 487.8
10. N-{4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- nicotinamide
C28 H21 N7 02 MS: calc. C28 H21 N7 02 (487.53) found [M+1] 487.9
11. 1 H-lmidazole-4-carboxy lie acid {4-[3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C26 H20 N8 02 MS: calc. C26 H20 N8 02 (476.50) found [M+1] 476.7
12. Piperidine-2-carboxylic acid {4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C28 H27 N7 02 MS: calc. C28 H27 N7 02 (493.57) found [M+1] 493.8 13. Piperidine-3-carboxylic acid {4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C28 H27 N7 02 MS: calc. C28 H27 N7 02 (493.57) found [M+1] 493.8
14. i-Acetyl-piperidine^-carboxylic acid {4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4- a]phthalazin-6-ylamino]-phenyl}-amide
C30 H29 N7 03 MS: calc. C30 H29 N7 03 (535.61) found [M+1] 535.9
15. N-{4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-2-phenyl- acetamide
C30 H24 N6 02 MS: calc. C30 H24 N6 02 (500.56) found [M+1] 500.9
16. 2-(4-Methoxy-phenyl)-N-{4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-acetamide
C31 H26 N6 03 MS: calc. C31 H26 N6 03 (530.59) found [M+1] 531.0
17. 2,2,2-Trifluoro-N-{4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-acetamide
C24 H17 F3 N6 02 MS: calc. C24 H17 F3 N6 02 (478.44) found [M+1] 478.8
18. Cyclopropanecarboxylic acid {4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C26 H22 N6 02 MS: calc. C26 H22 N6 02 (450.50) found [M+1] 450.8
19. Cyclohexanecarboxylic acid {4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C29 H28 N6 02 MS: calc. C29 H28 N6 02 (492.59) found [M+1] 492.8
20. 2-Benzyloxy-N-{4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-acetamide
C31 H26 N6 03 MS: calc. C31 H26 N6 03 (530.59) found [M+1] 530.9
21. Furan-3-carboxy lie acid {4-[3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C27 H20 N6 03 MS: calc. C27 H20 N6 03 (476.50) found [M+1] 476.8
22. Pyridine-2-carboxylic acid {4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide To a solution of picolinic acid (0.27 mmol) and 1-hydroxybenzotriazole hydrate (0.27 mmol) in DMF (5 mL) is added 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.27 mmol) followed by N- [3-(4-methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1 ,4-diamine (compound 1 ) (0.26 mmol). The reaction mixture is stirred at room temperature overnight and concentrated in vacuum. Water (10 mL) is added to the residue and the resulting precipitate is filtered and washed with ethyl acetate and diethylether. The solid is dried azeotropically with toluene to yield 103 mg of the title compound as light brown solid. m.p.: 301 °C - 305°C C28 H21 N7 02 MS: calc. C28 H21 N7 02 (487.53) found [M+1] 487.9
23. Piperidine-4-carboxylic acid {4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C28 H27 N7 02 MS: calc. C28 H27 N7 02 (493.57) found [M+1] 494.2
24. Piperidine-4-carboxylic acid {4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide hydrochloride
C28 H28 Cl N7 02 MS: calc. C28 H27 N7 02 (493.57) found [M+1] 493.8
25. N-{4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-2- morpholin-4-yl-acetamide
C28 H27 N7 03 MS: calc. C28 H27 N7 03 (509.57) found [M+1] 509.9
26. N-{4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-2-(4- methyl-piperazin-1-yl)-acetamide
C29 H30 N8 02 MS: calc. C29 H30 N8 02 (522.61) found [M+1] 522.8
Starting from the appropriate amino compounds selected from compounds 67 to 70 and the appropriate carboxylic acid derivatives the following compounds 27 to 31 can be obtained analogously as described for compound 22.
27. Piperidine-2 -carboxylic acid {4-[3-(2-trifluoromethyl-phenyl)-[1,2,4]triazolo[3,4- a]phthalazin-6-ylamino]-phenyl}-amide
C28 H24 F3 N7 O MS: calc. C28 H24 F3 N7 0(531.54) found [M+1] 532.1
28. Piperidine-3-carboxylic acid {4-[3-(2-bromo-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C27 H24 Br N7 O MS: calc. C27 H24 Br N7 O (542.44) found [M+1] 542.2
29. Piperidine-3-carboxylic acid {4-[3-(2-trifluoromethyl-phenyl)-[1,2,4]triazolo[3,4- a]phthalazin-6-ylamino]-phenyl}-amide C28 H24 F3 N7 O MS: calc. C28 H24 F3 N7 O (531.54) found [M+1] 532.6
30. Piperidine-2-carboxylic acid {4-[3-(2-bromo-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C27 H24 Br N7 O MS: calc. C27 H24 Br N7 O (542.44) found [M+1] 544.1
31. Piperidine-2-carboxylic acid {4-[3-(2-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C28 H27 N7 02 MS: calc. C28 H27 N7 02 (493.57) found [M+1] 494.1
Starting from 6-chloro-3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazine (compound A1) and the appropriate aniline derivatives, the following compounds 32 to 34 can be obtained analogously to one of the procedures as described for compound 1.
32. N-{4-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-acetamide C24 H20 N6 02 (424,47) found: [M+1] 425.3
33. N-{4-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-benzamide
C29 H22 N6 02 (486,54) m.p.: 323 0C
34. Furan-2-carboxylic acid {4-[3-(4-methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C27 H20 N6 03 (476,5) m.p.: 303 0C
Starting from N-[3-(4-methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1 ,3-diamine (compound 2) and the appropriate carboxylic acid derivatives the following compounds 35 to 63 can be obtained analogously as described for compound 22.
35. Cyclohexanecarboxylic acid {3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C29 H28 N6 02 MS: calc. C29 H28 N6 02 (492.59) found [M+1] 492.9
36. N-{3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-benzamide
C29 H22 N6 02 MS: calc. C29 H22 N6 02 (486.54) found [M+1] 486.9
37. 2-Benzyloxy-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-acetamide
C31 H26 N6 03 MS: calc. C31 H26 N6 03 (530.59) found [M+1] 530.9
38. Cyclopropanecarboxylic acid {3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C26 H22 N6 02 MS: calc. C26 H22 N6 02 (450.50) found [M+1] 451.0 39. 2,2,2-Trifluoro-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-acetamide
C24 H17 F3 N6 02 MS: calc. C24 H17 F3 N6 02 (478.44) found [M+1] 478.7
40. Furan-2-carboxylic acid {3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C27 H20 N6 03 MS: calc. C27 H20 N6 03 (476.50) found [M+1] 476.8
41. Furan-3-carboxylic acid {3-[3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C27 H20 N6 03 MS: calc. C27 H20 N6 03 (476.50) found [M+1] 476.9
42. 1 H-lmidazole-4-carboxy lie acid {3-[3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C26 H20 N8 02 MS: calc. C26 H20 N8 02 (476.50) found [M+1] 476.8
43. C-Dimethylamino-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-benzam ide
C31 H27 N7 02 MS: calc. C31 H27 N7 02 (529.61) found [M+1] 529.9
44. N-{3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- isonicotinamide
C28 H21 N7 02 MS: calc. C28 H21 N7 02 (487.53) found [M+1] 487.8
45. 2-Methoxy-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- acetamide
C25 H22 N6 03 MS: calc. C25 H22 N6 03 (454.49) found [M+1] 454.8
46. 4-Methoxy-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- benzamide
C30 H24 N6 03 MS: calc. C30 H24 N6 03 (516.56) found [M+1] 516.9
47. 3-Methoxy-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- benzamide
C30 H24 N6 03 MS: calc. C30 H24 N6 03 (516.56) found [M+1] 516.8
48. 2-(4-Methoxy-phenyl)-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-acetamide C31 H26 N6 03 MS: calc. C31 H26 N6 03 (530.59) found [M+1] 531.0
49. N-{3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-2-phenyl- acetamide
C30 H24 N6 02 MS: calc. C30 H24 N6 02 (500.56) found [M+1] 500.9
50. N-{3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- nicotinamide
C28 H21 N7 02 MS: calc. C28 H21 N7 02 (487.53) found [M+1] 487.7
51. Dimethylamino-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-benzam ide
C31 H27 N7 02 MS: calc. C31 H27 N7 02 (529.61) found [M+1] 529.9
52. C-Dimethylamino-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-acetamide
C26 H25 N7 02 MS: calc. C26 H25 N7 02 (467.53) found [M+1] 467.9
53. 3-Methoxy-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- propionamide
C26 H24 N6 03 MS: calc. C26 H24 N6 03 (468.52) found [M+1] 469.0
54. 1-Acetyl-piperidine-4-carboxylic acid {3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4- a]phthalazin-6-ylamino]-phenyl}-amide
C30 H29 N7 03 MS: calc. C30 H29 N7 03 (535.61) found [M+1] 535.9
55. Pyridine-2-carboxylic acid {3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C28 H21 N7 02 MS: calc. C28 H21 N7 02 (487.53) found [M+1] 487.8
56. Dimethylamino-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-benzam ide
C31 H27 N7 02 MS: calc. C31 H27 N7 02 (529.61) found [M+1] 529.9
57. Piperidine-4-carboxylic acid {3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C28 H27 N7 02 MS: calc. C28 H27 N7 02 (493.57) found [M+1] 493.8 58. Piperidine-3-carboxylic acid {3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C28 H27 N7 02 MS: calc. C28 H27 N7 02 (493.57) found [M+1] 493.8
59. Piperidine-2-carboxylic acid {3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C28 H27 N7 02 MS: calc. C28 H27 N7 02 (493.57) found [M+1] 493.8
60. 2-Hydroxy-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- acetamide
C24 H20 N6 03 MS: calc. C24 H20 N6 03 (440.47) found [M+1] 440.9
61. N-{3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-acrylamide
C25 H20 N6 02 MS: calc. C25 H20 N6 02 (436.48) found [M+1] 436.8
62. 1-Methyl-piperidine-4-carboxylic acid {3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4- a]phthalazin-6-ylamino]-phenyl}-amide
C29 H29 N7 02 MS: calc. C29 H29 N7 02 (507.60) found [M+1] 507.9
63. Dimethylamino-N-{3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-butyram ide
C28 H29 N7 02 MS: calc. C28 H29 N7 02 (495.59) found [M+1] 495.9
Starting from the appropriate amino compounds selected from compounds 71 to 74 and the appropriate carboxylic acid derivatives the following compounds 64 to 65 can be obtained analogously as described for compound 22.
64. Cyclopropanecarboxylic acid {3-[3-(2-fluoro-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C25 H19 F N6 O MS: calc. C25 H19 F N6 O (438.47) found [M+1] 439.1
65. Cyclopropanecarboxylic acid {3-[3-(2-methoxy-phenyl)-[1,2,4]triazolo [3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C26 H22 N6 02 MS: calc. C26 H22 N6 02 (450.50) found [M+1] 451.1
Starting from 6-chloro-3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazine (compound A1) and the appropriate aniline derivative, the following compound 66 can be obtained analogously to one of the procedures as described for compound 1.
66. N-{3-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-acetamide C24 H20 N6 02 424,47 m.p.: 295 0C Starting from the appropriate starting compound selected from A2 to A9 the following compounds 67 to 74 can be obtained by reduction reaction analogously as described for compound 74a; or, alternatively, the following compounds 67 to 74a can be obtained analogously as described for compound 1.
67. N-[3-(2-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,4-diamine C22 H18 N6 O MS: calc. C22 H18 N6 O (382.43) found [M+1] 383.1
68. N-[3-(2-Fluorophenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,4-diamine
69. N-[3-(2-Bromophenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,4-diamine
C21 H15 Br N6 MS: calc. C21 H15 Br N6 (431.30) found [M+1] 431.0
70. N-[3-(2-Trifluoromethyl-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,4-diamine
C22 H15 F3 N6 MS: calc. C22 H15 F3 N6 (420.40) found [M+1] 421.0
71. N-[3-(2-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,3-diamine
C22 H18 N6 O MS: calc. C22 H18 N6 O (382.43) found [M+1] 383.1
72. N-[3-(2-Fluorophenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,3-diamine
73. N-[3-(2-Bromophenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,3-diamine
C21 H15 Br N6 MS: calc. C21 H15 Br N6 (431.30) found [M+1] 433.1
74. N-[3-(2-Trifluoromethyl-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,3-diamine
74a. N-[3-(2-Methyl-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,3-diamine
To a suspension of (3-nitro-phenyl)-(3-o-tolyl-[1 ,2,4]triazolo[3,4-a]-phthalazin-6-yl)-amine (compound A10) (263 mg, 0.66 mmol) in a 2:1 mixture of glacial acetic acid and 37% hydrochloric acid (18ml) is added tin chloride dihydrate (450 mg, 1.99 mmol). The mixture is stirred at 900C for 2 days. Upon cooling, the precipitate is filtered and the filtrate concentrated. Purification of residue by column chromatography (CH2CI2/Me0H, 95:5) gives 205 mg of an off-white solid which is triturated with a 1 :1 mixture of isopropanol and petroleum ether to yield 77 mg of the title compound as off-white needles.
Starting from 6-chloro-3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazine (compound A1) and the appropriate aniline derivatives, the following compounds 75 and 76 can be obtained analogously to one of the procedures as described for compound 1.
75. 4-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid methyl ester
C24 H19 N5 03 425,45 found: [M+1] 426.4 76. 3-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid methyl ester
C24 H19 N5 03 425,45 found: [M+1] 426.3
77. 4-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid
40 mg 4-[3-(4-methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid methyl ester (compound 75), 25 mg potassium hydroxide and 150 μl water are stirred in 2 ml methanol at 100 0C for 1 h. The reaction mixture is filtered with suction, the filtrate is diluted with 10 ml water and acidified to pH2-3 with 2M hydrochloric acid. The precipitate is filtered with suction, washed with water and dried to yield 23 mg of the title compound. EF: C23 H17 N5 O3 (411.42) found: [M+1] 412.3
Alternative reaction procedure:
In a sealed tube, to a solution of sodium methoxide in methanol, prepared by addition of sodium (590 mg, 25.4 mmol) in anhydrous methanol (20 ml) under argon, are added 4-[3-(4-methoxyphenyl)-
[1 ,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid methyl ester (compound 75) (4.Og, 9.40 mmol) and diisopropylamine (32 ml). The mixture is stirred at 1000C for 3 days and evaporated. The residue is washed with ethyl acetate and a minimum of methanol to yield 3.78g of the title compound as light yellow powder. m.p.: 309 0C (decomp.)
78. 3-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid
Starting from 3-[3-(4-methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid methyl ester (compound 76) the title compound can be obtained analogously as described for compound 77. EF: C23 H17 N5 O3 (411.42) found: [M+1] 411.8
Starting from 4-[3-(4-methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid (compound 77) and the appropriate amine derivatives, the following compounds 79 to 89 can be obtained analogously as described for compound 103.
79. 4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N-(2-morpholin-4-yl- ethyl)-benzamide
C29 H29 N7 03 MS: calc. C29 H29 N7 03 (523.60) found [M+1] 524.0
80. N-(3-Methoxy-phenyl)-4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- benzamide
C30 H24 N6 03 MS: calc. C30 H24 N6 03 (516.56) found [M+1] 516.8 81. N-(4-Methoxy-phenyl)-4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- benzamide
C30 H24 N6 03 MS: calc. C30 H24 N6 03 (516.56) found [M+1] 516.9
82. 4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N-phenyl-benzamide
C29 H22 N6 02 MS: calc. C29 H22 N6 02 (486.54) found [M+1] 486.9
83. N-(4-Dimethylamino-phenyl)-4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-benzamide
C31 H27 N7 02 MS: calc. C31 H27 N7 02 (529.61) found [M+1] 529.8
84. N-(2-Methoxy-phenyl)-4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- benzamide
C30 H24 N6 03 MS: calc. C30 H24 N6 03 (516.56) found [M+1] 516.9
85. 4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N-methyl-benzamide
C24 H20 N6 02 MS: calc. C24 H20 N6 02 (424.47) found [M+1] 424.9
86. N-(2-Dimethylamino-ethyl)-4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-benzamide
C27 H27 N7 02 MS: calc. C27 H27 N7 02 (481.56) found [M+1] 481.7
87. N-(2-Methoxy-ethyl)-4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- benzamide
C26 H24 N6 03 MS: calc. C26 H24 N6 03 (468.52) found [M+1] 468.7
88. 1-{4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-1-(4-methyl- piperazin-1 -yl)-methanone
C28 H27 N7 02 MS: calc. C28 H27 N7 02 (493.57) found [M+1] 494.0
89. 4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N,N-dimethyl- benzamide
C25 H22 N6 02 MS: calc. C25 H22 N6 02 (438.49) found [M+1] 439.0
Starting from 6-chloro-3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazine (compound A1) and the appropriate aniline derivatives, the following compounds 91 and 92 can be obtained analogously to one of the procedures as described for compound 1.
91. 4-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzamide C23 H18 N6 O2 410,44 found: [M+1] 411.3 92. 1-{4-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-1- morpholin-4-yl methanone
C27 H24 N6 03 480,53 m.p.: 295 0C
Starting from 3-[3-(4-methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid
(compound 78) and the appropriate amine derivatives, the following compounds 90 and 93 to 108 can be obtained analogously as described for compound 103.
90. N-(2-Dimethylamino-ethyl)-3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-benzamide hydrochloride
C27 H28 Cl N7 02 MS: calc. C27 H27 N7 02 (481.56) found [M+1] 481.8
93. 1-{3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-1-(4-methyl- piperazin-1 -yl)-methanone
C28 H27 N7 02 MS: calc. C28 H27 N7 02 (493.57) found [M+1] 493.9
94. 1-{3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-1- morpholin-4-yl-methanone
C27 H24 N6 03 MS: calc. C27 H24 N6 03 (480.53) found [M+1] 480.9
95. 3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N-(2-morpholin-4-yl- ethyl)-benzamide
C29 H29 N7 03 MS: calc. C29 H29 N7 03 (523.60) found [M+1] 523.8
96. N-(2-Dimethylamino-ethyl)-3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-benzamide
C27 H27 N7 02 MS: calc. C27 H27 N7 02 (481.56) found [M+1] 481.9
97. 3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N-pyridin-3-yl- benzamide
C28 H21 N7 02 MS: calc. C28 H21 N7 02 (487.53) found [M+1] 487.8
98. N-(2-Hydroxy-ethyl)-3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- benzamide
C25 H22 N6 03 MS: calc. C25 H22 N6 03 (454.49) found [M+1] 454.8
99. 3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N-pyridin-4-yl- benzamide
C28 H21 N7 02 MS: calc. C28 H21 N7 02 (487.53) found [M+1] 487.8 100. N-(4-Methoxy-phenyl)-3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- benzamide
C30 H24 N6 03 MS: calc. C30 H24 N6 03 (516.56) found [M+1] 516.9
101. N-(3-Methoxy-phenyl)-3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- benzamide
C30 H24 N6 03 MS: calc. C30 H24 N6 03 (516.56) found [M+1] 516.9
102. N-(2-Methoxy-phenyl)-3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- benzamide
C30 H24 N6 03 MS: calc. C30 H24 N6 03 (516.56) found [M+1] 516.9
103. N-(4-Dimethylamino-phenyl)-3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-benzamide
To a solution of 3-[3-(4-methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid (compound 78) (100 mg, 0.24 mmol) and 1-hydroxybenzotriazole hydrate (35 mg, 0.26 mmol) in DMF (5 mL) is added 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (43mg, 0.26 mmol) followed by N,N-dimethyl-phenylene diamine (35 mg, 0.26 mmol). The reaction mixture is stirred at room temperature for 2 days and concentrated in vacuum. Water (20 mL) is added to the residue and the resulting precipitate is filtered and washed with methanol and dichloromethane. The solid is dried azeotropically with toluene to yield 79 mg of the title compound as grey powder. m.p.: 314°C - 318°C C31 H27 N7 02 MS: calc. C31 H27 N7 02 (529.61) found [M+1] 530.0
104. 3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N-phenyl-benzamide
C29 H22 N6 02 MS: calc. C29 H22 N6 02 (486.54) found [M+1] 486.8
105. 3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N,N-dimethyl- benzamide
C25 H22 N6 02 MS: calc. C25 H22 N6 02 (438.49) found [M+1] 438.8
106. N-(2-Methoxy-ethyl)-3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- benzamide
C26 H24 N6 03 MS: calc. C26 H24 N6 03 (468.52) found [M+1] 468.8
107. 3-[3-(4-Methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N-(2-morpholin-4-yl- ethyl)-benzamide hydrochloride
C29 H30 Cl N7 03 MS: calc. C29 H29 N7 03 (523.60) found [M+1] 523.8 108. N-(2-Dimethylamino-ethyl)-3-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-benzamide hydrochloride
C27 H28 Cl N7 02 MS: calc. C27 H27 N7 02 (481.56) found [M+1] 481.8
Starting from 6-chloro-3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazine (compound A1) and the appropriate aniline derivatives, the following compounds 109 and 110 can be obtained analogously to one of the procedures as described for compound 1.
109. 3-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzamide C23 H18 N6 O2 410,44 m.p.: 296 0C
110. 3-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-N-methylbenzamide
C24 H20 N6 O2 424,47 m.p.: 316 0C
111. N-{4-[3-(4-Methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-4- morpholin-4-yl-benzamide
100 mg N-[3-(4-Methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1 ,4-diamine (compound 1), 10 mg dimethylaminopyridine and 145 mg 4-morpholin-4-yl-benzoyl chloride are stirred in 12 ml toluene for 1-3 h at boiling temperature. After cooling to ambient temperature, the precipitate is filtered with suction and the solid is recrystallized from N,N-dimethylformamide to yield 15 mg of the title compound (m.p.: 313 0C). EF: C33 H29 N7 O3 (571.64) found: [M+1] 572.4
Starting from N-[3-(4-methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1 ,4-diamine (compound 1) and the appropriate carboxylic acid derivative the following compound 112 can be obtained analogously as compounds 3-26, as described for compound 22.
112. 4-Methoxy-N-{4-[3-(4-methoxyphenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}- benzamide
C30 H24 N6 03 MS: calc. C30 H24 N6 03 (516.56) found [M+1] 517.3
Starting from the appropriate starting nitro compounds A11 (for 113) or A12 (for 114), the following compounds 113 and 114 can be obtained by reduction reaction analogously as described for compound 74a; or, alternatively, starting from B8 (for 113) or B9 (for 114) the following compounds 113 and 114 can be obtained analogously as described for compound 1.
113. N-[3-(4-Bromo-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,3-diamine C21 H15 Br N6 MS: calc. C21 H15 Br N6 (431.30) found [M+1] 431.1
114. N-[3-(2-Chloro-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1,3-diamine
C21 H15 Cl N6 MS: calc. C21 H15 Cl N6 (386.85) found [M+H] 387.0 Starting from N-[3-(4-Bromo-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-yl]-benzene-1 ,3-diamine (compound 113) and the appropriate carboxylic acid derivative the following compound 115 can be obtained analogously as compounds 3-26, as described for compound 22.
115. Cyclopropanecarboxylic acid {3-[3-(4-bromo-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-amide
C25 H19 Br N6 O MS: calc. C25 H19 Br N6 O (499.37) found [M+H] 499.0
Starting from compound 74a (for 116) or compound 74 (for 117) and the appropriate carboxylic acid derivatives, the following compounds N6 and N7 can be obtained analogously as compounds 64 / 65, as described for compound 22.
116. Cyclopropanecarboxylic acid [3-(3-o-tolyl-[1,2,4]triazolo[3,4-a]phthalazin-6-ylamino)- phenyl]-amide
C26 H22 N6 O MS: calculated C26 H22 N6 O (434.5) found (M+1 ) 435.2
117. Cyclopropanecarboxylic acid {3-[3-(2-trifluoromethyl-phenyl)-[1,2,4]triazolo[3,4- a]phthalazin-6-ylamino]-phenyl}-amide
C26 H19 F3 N6 O MS: calculated C26 H19 F3 N6 O (488.48) found
(M+1 )489.1
Starting from 4-[3-(4-Methoxyphenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-benzoic acid (compound 77) and the appropriate amine derivative, the following compounds 118 can be obtained analogously as compounds 79 - 89, as described for compound 103.
118. 1-(4-Ethyl-piperazin-1-yl)-1-{4-[3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazin-6- ylamino]-phenyl}-methanone
C29 H29 N7 02 MS: C29 H29 N7 02 calculated 507.60 found (M+H) 508.1
Starting compounds
A1. 6-Chloro-3-(4-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazine
6,0 g (4-chloro-phthalazin-1-yl)-hydrazine (compound B1) are suspended in a mixture of 160 ml toluene and 18 ml triethylamine at 60 0C and treated with a solution of 6,0 g 4-methoxy-benzoyl chloride in 48 ml toluene. The mixture is stirred at 110 0C for 6 h, cooled to ambient temperature, filtered with suction and rinsed with toluene. The solid is recrystallized from N,N-dimethylformamide, the precipitate is washed with water and dried to yield 5.2 g of the title compound (m.p.: 192-193 0C). EF: Ci6 H11 Cl N4 O (310.75) found: [M+1] 311.2
Alternative work up procedure: The products can be purified by column chromatography via silica gel.
Starting from the appropriate starting compound B2 to B9 and the appropriate aniline derivative, the following compounds A2 to A12 may be obtained analogously to one of the procedures as described for compound 1.
A2. (3-Nitro-phenyl)-{3-(2-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]-phthalazin-6-yl}-amine
A3. (3-Nitro-phenyl)-{3-(2-fluoro-phenyl)-[1,2,4]triazolo[3,4-a]-phthalazin-6-yl}-amine
A4. (3-Nitro-phenyl)-{3-(2-bromo-phenyl)-[1,2,4]triazolo[3,4-a]-phthalazin-6-yl}-amine
A5. (3-Nitro-phenyl)-{3-(2-trifluoromethyl-phenyl)-[1,2,4]triazolo[3,4-a]-phthalazin-6-yl}- amine
A6. (4-Nitro-phenyl)-{3-(2-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]-phthalazin-6-yl}-amine
A7. (4-Nitro-phenyl)-{3-(2-fluoro-phenyl)-[1,2,4]triazolo[3,4-a]-phthalazin-6-yl}-amine
A8. (4-Nitro-phenyl)-{3-(2-bromo-phenyl)-[1,2,4]triazolo[3,4-a]-phthalazin-6-yl}-amine
A9. (4-Nitro-phenyl)-{3-(2-trifluoromethyl-phenyl)-[1,2,4]triazolo[3,4-a]-phthalazin-6-yl}- amine
A10. (3-Nitro-phenyl)-(3-o-tolyl-[1,2,4]triazolo[3,4-a]-phthalazin-6-yl)-amine
A11. (3-Nitro-phenyl)-(3-(4-bromo-phenyl)-[[1,2,4]triazolo[3,4-a]-phthalazin-6-yl)-amine
A12. (3-Nitro-phenyl)-(3-(2-chloro-phenyl)-[[1,2,4]triazolo[3,4-a]-phthalazin-6-yl)-amine
B1. (4-Chloro-phthalazin-1-yl)-hydrazine
10 g commercially available dichlorophthalazine are added portionwise at 90 °C to a solution of 50 ml ethanol and 20 ml hydrazine hydrate. After 10 min the reaction mixture is cooled to ambient temperature, the precipitate is filtered with suction and rinsed with ethanol to yield 8,4 g of the title compound.
EF: C8 H7 Cl N4 (194.62) found: [M+1] 195.0
Starting from (4-chloro-phthalazin-1-yl)-hydrazine (compound B1) and the appropriate benzoic acid derivatives, the following compounds B2 to B9 can be obtained analogously to the procedure as described for compound A1 or B7. B2. 6-Chloro-3-(2-methoxy-phenyl)-[1,2,4]triazolo[3,4-a]phthalazine
B3. 6-Chloro-3-(2-fluoro-phenyl)-[1,2,4]triazolo[3,4-a]phthalazine
B4. 6-Chloro-3-(2-bromo-phenyl)-[1,2,4]triazolo[3,4-a]phthalazine
B5. 6-Chloro-3-(2-trifluoromethyl-phenyl)-[1,2,4]triazolo[3,4-a]phthalazine
B6. 6-Chloro-3-(2-methyl-phenyl)-[1,2,4]triazolo[3,4-a]phthalazine
B7. 6-Chloro-3-phenyl-[1,2,4]triazolo[3,4-a]phthalazine
Stepi :
2.5 g (4-chloro-phthalazin-1-yl)-hydrazine (compound B1) are suspended in 250 ml toluene and treated with a solution of 1.7 ml benzoic acid chloride in 50 ml toluene at reflux temperature. After 2 h the reaction mixture is cooled to ambient temperature and filtered with suction. The filtrate is concentrated under reduced pressure and the residue is recrystallized from N,N-dimethylformamide to yield 1.2 g of benzoic acid (4-chloro-2/-/-phthalazin-1-ylidene)-hydrazide.
EF: Ci5 H11 Cl N4 O (298.73) found: [M+1] 299.1
Step 2:
2.5 g benzoic acid (4-chloro-2/-/-phthalazin-1-ylidene)-hydrazide and 1 g triethylamine hydrochloride are suspended in 60 ml ethylene glycol and stirred at 130 0C for 3 h. The reaction mixture is cooled to ambient temperature and added to 600 ml water. The product is extracted with dichloromethane, the organic layer is dried with sodium sulphate and concentrated under reduced pressure. The residue is recrystallized from N,N-dimethylformamide to give the title compound.
EF: C15 H9 Cl N4 (280.72) found: [M+1] 281.2
Alternative work up procedure:
The products can be purified by column chromatography via silica gel.
B8. 3-(4-Bromo-phenyl)-6-chloro-[1,2,4]triazolo[3,4-a]phthalazine
C15 H8 Br Cl N4 MS: calc. C15 H8 Br Cl N4 (359.61) found [M+1] 358.8
B9. 6-Chloro-3-(2-chloro-phenyl)-[1,2,4]triazolo[3,4-a]phthalazine
C15 H8 CI2 N4 MS: calc. C15 H8 CI2 N4 (315.16) found [M+H] 314.8
Commercial applicability
The compounds according to the invention have useful pharmacological properties which make them industrially utilizable. As selective inhibitors of cyclic GMP-hydrolysing phosphodiesterases (cGMP- PDE inhibitors) - prefentially of type 2 -, they are suitable on the one hand as therapeutics for conditions of pathologically enhanced endothelial activity and impaired endothelial barrier function such as septic shock, vascular edema, or diseases associated with unwanted neoangiogenesis. On the other hand, given the expression of PDE2 in neuronal tissue the compounds may also be useful in neurodegenerative conditions. In addition, PDE2 is expressed in human platelets and PDE2 inhibitors were shown to suppress platelet functions. In consequence, the compounds may be used as anti- thrombotics/platelet aggregation inhibitors. Furthermore, since PDE2 was shown in myocardium the compounds may afford a potential to protect against arrhythmias.
On account of their cGMP-PDE (preferentially PDE2) inhibiting properties, the compounds according to the invention can be employed in human and veterinary medicine as therapeutics, where they can be used, for example, for the treatment and prophylaxis of the following illnesses: (1) all conditions of pathologically enhanced endothelial activity/impaired endothelial barrier function such as multi-organ failure in particular acute respiratory distress syndrome (ARDS) in septic shock, pneumonia, acute and chronic airway disorders of varying origin (rhinitis, bronchitis, bronchial asthma, emphysema, COPD), angioedema, peripheral edema, cerebral edema for example traumatic or following stroke; (2) all conditions associated with pathologically enhanced neoangiogenesis such as all kinds of tumors (benign or malignant) which are associated with neoangiogenesis and all kinds of inflammatory diseases associated with neoangiogenesis for example disorders of the arthritis type (rheumatoid arthritis, rheumatoid spondylitis, osteoarthritis and other arthritic conditions), all forms of psoriasis, retinal blindness, bronchial asthma, inflammatory bowel disease, transplant rejection, allograft rejections, atherosclerosis; (3) all conditions for which platelet aggregation inhibition in conjunction with reduction of enhanced endothelial activation is desireable such as thrombembolic disorders and ischaemias covering myocardial infarct, cerebral infarct, transitory ischaemic attacks, angina pectoris, peripheral circulatory disorders, prevention of restenosis after thrombolysis therapy, percutaneous translumial angioplasty (PTA), percutaneous transluminal coronary angioplasty (PTCA) and bypass; (4) all types of impaired cognition in particular cognitive disorders such as mild cognitive disorder (MCI), Alzheimer's disease, Lewy-Body dementia, Parkinson's disease and cerebrovascular dementia; and (5) in cardiac arrhythmias.
The invention further relates to a method for the treatment of mammals, including humans, which are suffering from one of the above mentioned illnesses. The method is characterized in that a therapeuti¬ cally active and pharmacologically effective and tolerable amount of one or more of the compounds according to the invention is administered to the ill mammal. The invention further relates to a method for inhibiting PDE, particularly PDE2, comprising contacting said PDE with an effective amount of a compound according to the invention.
The invention further relates to a method for inhibiting PDE, particularly PDE2, comprising administering a pharmacologically active and therapeutically effective and tolerable amount of at least one compound according to the invention to a mammal in need of such inhibition.
The invention further relates to the compounds according to the invention for use in the treatment and/or prophylaxis of illnesses, especially the illnesses mentioned.
The invention further relates to the compounds according to the invention having PDE, particularly PDE2, inhibitory activity.
The invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of the illnesses mentioned.
The invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of PDE-, particularly PDE2-, associated diseases.
The invention furthermore relates to pharmaceutical compositions for the treatment and/or prophylaxis of the illnesses mentioned, which contain one or more of the compounds according to the invention.
The invention moreover relates to pharmaceutical compositions having PDE, particularly PDE2, inhibitory activity.
Additionally, the invention relates to an article of manufacture, which comprises packaging material and a pharmaceutical agent contained within said packaging material, wherein the pharmaceutical agent is therapeutically effective for antagonizing the effects of the cyclic nucleotide phosphodiesterase of type 2 (PDE2), ameliorating the symptoms of an PDE2-mediated disorder, and wherein the packaging material comprises a label or package insert which indicates that the pharmaceutical agent is useful for preventing or treating PDE2-mediated disorders, and wherein said pharmaceutical agent comprises one or more compounds of formula 1 according to the invention. The packaging material, label and package insert otherwise parallel or resemble what is generally regarded as standard packaging material, labels and package inserts for pharmaceuticals having related utilities.
The administration of the pharmaceutical compositions according to the invention may be performed in any of the generally accepted modes of administration available in the art. Illustrative examples of suitable modes of administration include intravenous, oral, nasal, parenteral, topical, transdermal and rectal delivery. Intravenous and oral delivery is preferred.
The pharmaceutical compositions are prepared by processes which are known per se and familiar to the person skilled in the art. As pharmaceutical compositions, the compounds according to the invention (= active compounds) are either employed as such, or preferably in combination with suitable pharmaceutical auxiliaries and/or excipients, e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between 0.1 and 95% and where, by the appropriate choice of the auxiliaries and/or excipients, a pharmaceutical administration form (e.g. a delayed release form or an enteric form) exactly suited to the active compound and/or to the desired onset of action can be achieved.
The person skilled in the art is familiar with auxiliaries or excipients which are suitable for the desired pharmaceutical formulations on account of his/her expert knowledge. In addition to solvents, gel for¬ mers, ointment bases and other active compound excipients, for example antioxidants, dispersants, emulsifiers, preservatives, solubilizers, colorants, complexing agents or permeation promoters, can be used.
For the treatment of disorders of the respiratory tract, the compounds according to the invention are preferably also administered by inhalation in the form of an aerosol; the aerosol particles of solid, liquid or mixed composition preferably having a diameter of 0.5 to 10 μm, advantageously of 2 to 6 μm.
Aerosol generation can be carried out, for example, by pressure-driven jet atomizers or ultrasonic atomizers, but advantageously by propellant-driven metered aerosols or propellant-free administration of micronized active compounds from inhalation capsules.
Depending on the inhaler system used, in addition to the active compounds the administration forms additionally contain the required excipients, such as, for example, propellants (e.g. Frigen in the case of metered aerosols), surface-active substances, emulsifiers, stabilizers, preservatives, flavorings, fillers (e.g. lactose in the case of powder inhalers) or, if appropriate, further active compounds.
For the purposes of inhalation, a large number of apparatuses are available with which aerosols of optimum particle size can be generated and administered, using an inhalation technique which is as right as possible for the patient. In addition to the use of adaptors (spacers, expanders) and pear- shaped containers (e.g. Nebulator®, Volumatic®), and automatic devices emitting a puffer spray (Autohaler®), for metered aerosols, in particular in the case of powder inhalers, a number of technical solutions are available (e.g. Diskhaler®, Rotadisk®, Turbohaler® or the inhaler described in European Patent Application EP 0 505 321), using which an optimal administration of active compound can be achieved.
For the treatment of skin diseases, the compounds according to the invention are in particular admi¬ nistered in the form of those pharmaceutical compositions which are suitable for topical application. For the production of the pharmaceutical compositions, the compounds according to the invention (= active compounds) are preferably mixed with suitable pharmaceutical auxiliaries and further processed to give suitable pharmaceutical formulations. Suitable pharmaceutical formulations are, for example, powders, emulsions, suspensions, sprays, oils, ointments, fatty ointments, creams, pastes, gels or solutions.
The pharmaceutical compositions according to the invention are prepared by processes known per se. The dosage of the active compounds is carried out in the order of magnitude customary for PDE inhibitors. Topical application forms (such as ointments) for the treatment of dermatoses thus contain the active compounds in a concentration of, for example, 0.1-99%. The dose for administration by inhalation is customarly between 0.1 and 3 mg per day. The customary dose in the case of systemic therapy (p.o. or i.v.) is between 0.03 and 3 mg/kg per day.
Biological investigations
Method for measuring inhibition of PDEs activities
Abbreviations:
PDE: phosphodiesterase, PCR: polymerase chain reaction, RT-PCR: reverse transcription- polymerase chain reaction, dNTPs: deoxynucleoside triphosphates, RNA: ribonucleic acid , cDNA: complementary deoxyribonucleic acid, bp: basepairs, (dT)15: pentadecathymidylic acid, ORF: open reading frame, GB no.: GenBank database accession number, rBV: recombinant baculovirus, wt: wild type, aa : aminoacid, UCR : upstream conserved region, PAA : polyacrylamide.
Aminoacids are abbreviated with the 1 -character symbol: A for alanine, C for cysteine, D for aspartic acid, E for glutamic acid, F for phenylalanine, G for glycine, H for histidine, I for isoleucine, K for lysine , L for leucine, M for methionine, N for asparagine, P for proline, Q for glutamine, R for arginine, S for serine, T for threonine, V for valine , W for tryptophane, Y for tyrosine.
General methods for cloning recombinant PDEs
RNA was purified from cell lines using the RNeasy Mini Kit from Qiagen. 1 μg RNA was reverse transcribed into single-stranded cDNA in a 20 μl reaction using Expand Reverse Transcriptase (Roche) with 5OpM of primer (dT)15 and 1 mM dNTPs (both from Roche). 5 μl of cDNA were used as template for the subsequent PCR reaction. Human cDNAs from tissues were purchased from Clontech or Invitrogen. 1 μl was used for PCR reaction.
PCR was carried out in a Stratagene Robocycler 40 or in a MWG Primus 96 plus thermocycler. Typically, PCR was carried out with the Expand Lond Template PCR System from Roche in buffer 3 plus 0.75 mM MgCI2, 0.3 μM each primer, 500 μM dNTPs.
PCR products were purified with the High Pure PCR Product Purification Kit (Roche) or from agarose gel with the QIAquick Gel Extraction kit from Qiagen, and cloned into the pCR2.1-TOPO vector from Invitrogen. The ORFs were subcloned in baculovirus expression vectors (transfer plasmids). The pCR- Bac and pVL vectors were from Invitrogen. The pBacPak vectors (pBP8 or pBP9) were from Clontech. Restriction endonucleases were from Roche and MBI Fermentas. Modifying enzymes and T4 DNA ligase were from New England Biolabs. DNA was sequenced by the company GATC GmbH (Konstanz, Germany, www.gatc.de) or in ALTANA Pharma's lab using an ABI PRISM 310 and the Big dye terminator cycle sequencing v2 chemistry (Applied Biosystem). Sequence analysis was performed with Hitachi Software DNASIS Version 2.5 or with Vector NTI 7. When necessary, in vitro mutagenesis was eventually performed with the QuickChange Site-Directed Mutagenesis Kit from Stratagene. Cloning of human PDE 2A3
The PDE2A3 (GB no. U67733) was amplified in 2 steps using PCR from brain cDNA. A N-terminal fragment was isolated using primers CP1 PD2AS (5'- GAGGAGTGATGGGGCAGGC -3') and PR9PD2AA ( 5'- GCGAAGTGGGAGACAGAAAAG -3'), a C-terminal fragment was isolated using primers PR7PD2AS (5'- GATCCTGAACATCCCTGACG -3') and CP3PD2AA (5'- GGGATCACTCAGCATCAAGGC-3'). The PCR products were cloned into the vector pCR2.1-Topo. The N-terminal fragment was first subcloned with EcoRI into pBluescript Il KS (-), afterwards a Bst1107l/EcoRV fragment was exchanged with the corresponding restriction fragment from the C- terminal clone, to obtain a complete ORF. The ORF for the PDE2A3 was subcloned into pBP8 using Xbal and Kpnl.
Expression of recombinant PDE2
The rBV was prepared by means of homologous recombination in Sf9 insect cells. The expression plasmids were cotransfected with Bac-N-Blue (Invitrogen) or Baculo-Gold DNA (Pharmingen) using a standard protocol (Pharmingen). Wt virus-free recombinant virus supernatants were selected using plaque assay methods. After that, high-titre virus supernatants were prepared by amplifying 3 times. PDE2 was expressed in Sf21 cells by infecting 2x106 cells/ml with an MOI (multiplicity of infection) between 1 and 10 in serum-free SF900 medium (Life Technologies). Cells were cultured at 28°C , typically for 48 hours, after which they were pelleted for 5-10 min at 1000 g and 4°C. In spinner flasks, cells were cultured at a rotational speed of 75 rpm. The SF21 insect cells were resuspended, at a concentration of approx. 107 cells/ml, in ice-cold (4°C) homogenization buffer (20 mM Tris, pH 8.2, containing the following additions: 140 mM NaCI, 3.8 mM KCI, 1 mM EGTA, 1 mM MgCI2, 1 mM β-mercaptoethanol, 2 mM benzamidine, 0.4 mM Pefablock, 10 μM leupeptin, 10 μM pepstatin A, 5 μM trypsin inhibitor) and disrupted by ultrasonication. The homogenate was then centrifuged for 10 min at 1000xg and the supernatant was stored at -800C until subsequent use (see below). The protein content was determined by the Bradford method (BioRad, Munich) using BSA as standard. Integrity and size of recombinant proteins were analysed by western blot.
Measurement of recombinant human PDE2A3 inhibition by SPA technology
Recombinant human PDE2A3 activities were inhibited by the test samples in a modified SPA (scintillation proximity assay) test, supplied by Amersham Pharmacia Biotech (see procedural instructions "phosphodiesterase [3H]cAMP SPA enzyme assay, code TRKQ 7090"), carried out in 96-well microtitre plates (MTP's). The test volume is 100 μl and contains 20 mM Tris buffer (pH 7.4), 0.1 mg of BSA (bovine serum albumin)/ml, 5 mM Mg2+, 0.5 μM cAMP (including about 50,000 cpm of [3H]CAMP), 5μM cGMP (to activate PDE2A3), 2 μl of the respective substance dilution in DMSO and sufficient recombinant PDE (1000xg supernatant, see above) to ensure that 15-20% of the cAMP is converted under the said experimental conditions. After a preincubation of 5 min at 37°C, the reaction is started by adding the substrate (cAMP) and the assays are incubated for a further 15 min; after that, they are stopped by adding SPA beads (50 μl). In accordance with the manufacturer's instructions, the SPA beads had previously been resuspended in water and then diluted 1 :3 (v/v); the diluted solution also contains 3 mM IBMX. After the beads have been sedimented (> 30 min), the MTP's are analyzed in commercially available measuring appliances and the corresponding IC50 values of the compounds for the inhibition of PDE activities are determined from the concentration-effect curves by means of non-linear regression.
Method to assess inhibition of macromolecule permeability of HUVEC monolayers
The procedure to measure macromolecule permeability of endothelial cell monolayers followed the method described by Langeler & van Hinsbergh (1988) with modifications. Human umbilical vein endothelial cells were isolated from umbilical cords according to standard procedures (Jaffe et al. 1973) and cultured in endothelial cell basal medium (EBM) supplemented with 2% FCS, 0.5ng/ml VEGF, 10ng/ml bFGF, 5ng/ml EGF, 20ng/ml Long R3 IGF-1 , 0.2μg/ml hydrocortisone, 1 μg/ml ascorbic acid, 22.5μg/ml heparin, 50μg/ml gentamicin, 50ng/ml amphotericin B (EGM2 purchased from Promocell GmbH, Heidelberg, Germany). At confluency, cells were trypsinized and replated at 73000 cells per well on 3μm polycarbonate filter Transwell inserts (Costar GmbH, Bodenheim, Germany) precoated with 10μg cm2 "1 Fibronectin (Sigma, Taufkirchen, Germany). HUVECs were cultured in EGM2 (100μl in the upper wells and 600μl in the lower wells) over four days prior the experiments and medium was changed every other day. At the day of the experiment culture medium was replaced by M199 with 1 % human serum albumin. Endothelial cells were preincubated with cyclic nucleotide modifiers (the selective PDE3 inhibitor motapizone, the selective PDE4 inhibitor RP73401 , the cGMP generators ANP or SNP and PDE2 inhibitors) for 15 min. HUVECs were then stimulated with Thrombin (1 U ml"1) (Sigma, Taufkichen, Germany) and horsh radish peroxidase (5μg/ml) (Sigma, Taufkirchen, Germany) as the macromolecule marker protein was added to the upper wells. Following 1 h incubation time Transwells were removed and the activity of horsh radish peroxidase that penetrated the endothelial cell monolayer was measured in the lower wells with the 3,3\ 5,5*- tetramethylbenzidine liquid substrate system from Sigma (Taufkirchen, Germany).
Results
Representative inhibitory values [measured as -log IC50 (mol/l)] determined in the aforementioned assay follow from the following table A, in which the numbers of the compounds correspond to the numbers of the examples. Table A
Inhibition of PDE2 activity
Figure imgf000043_0001
In parallel, compounds according to the invention can inhibit Thrombin-induced permeability of HUVEC monolayers for horsh radish peroxidase (HRP) as a macromolecule marker. Therefore, PDE2 inhibitors are suggested to improve the endothelial barrier function, which is impaired in numerous conditions such as acute respiratory distress syndrome (ARDS) or severe pneumonia. The system to measure these cellular effects of the PDE2 inhibitors observed the enzymological characteristics of PDE2 which exhibits a rather high Km for cAMP and the activity of which is activated by cGMP. The Thrombin-induced increase of HRP permeability was completely abolished by complete inhibition of PDE3 (10μM Motapizone) and PDE4 (1 μM RP73401). However, in the additional presence of ANP (10OnM) or SNP (1mM) to augment cGMP the inhibition by PDE3 and 4 inhibition of permeability was partially reversed. PDE2 inhibitors blocked the thrombin-stimulated HRP-permeability if 1 μM RP73401 , 10μM Motapizone, 10OnM ANP or 1mM SNP were present indicating that ANP or SNP by generating cGMP activate PDE2. The concentration-dependent inhibition of HRP permeability at different concentrations was assessed from the percent inhibition in the presence and absence of the PDE2 inhibitors and in the presence of 1 μM RP73401 , 10μM Motapizone and 10OnM ANP. In the absence of PDE3 and 4 inhibition, ANP or SNP the PDE2 inhibitors showed very little effect in Thrombin-induced macromolecule hyperpermeability.
Inhibition of SNP- or ANP-induced permeability of HUVEC monolayers:
HUVEC cells on 3μm polycarbonate filters (Transwells) were preincubated with 1 μM RP73401 (to block PDE4) and 10μM Motapizone (to block PDE3), 1mM SNP or 10OnM ANP and 1 μM of test sample over 15 min and then stimulated with 1 U/ml thrombin. HRP passage into the lower wells was assessed after 60 min. RP73401 and Motapizone completely blocked thrombin-induced hyperpermeability, which was partially reversed by SNP and ANP.
Compounds according to this invention can inhibit the SNP- or ANP-induced permeability increase in a concentration-dependent fashion. Representative inhibitory values [measured as -log IC50 (mol/l)] determined in the aforementioned assay follow from the following table B, in which the numbers of the compounds correspond to the numbers of the examples.
Table B
Inhibition of SNP- or ANP-induced permeability
Figure imgf000044_0001

Claims

Patent Claims
1. Compounds of formula I
Figure imgf000045_0001
in which
R1 is -U-A, in which
U is a direct bond, or methylene (-CH2-),
A is phenyl, pyridinyl, thiophenyl, or R11- and/or R111 -substituted phenyl, in which
R11 is 1-4C-alkyl, halogen, trifluoromethyl, hydroxyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, phenoxy, 1-4C-alkoxycarbonyl, morpholino, or di-1-4C- alkylamino,
R111 is 1-4C-alkoxy, halogen, hydroxyl, or 1-4C-alkyl,
R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31- and/or R311- substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)- piperidinyl, in which
R31 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
7C-cyloalkylmethoxy, morpholino, or mono- or di-1-4C-alkylamino, R311 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R31 and R311 together are a 1-2C-alkylenedioxy group, R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321- and/or R3211 -substituted phenyl, mono- or di-1-4C-alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
7C-cyloalkylmethoxy, or mono- or di-1-4C-alkylamino,
R3211 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R321 and R3211 together are a 1-2C-alkylenedioxy group, R322 is 1-4C-alkyl,
R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42- and/or R421 -substituted phenyl, or pyridinyl, in which
R41 is hydroxyl, 1-4C-alkoxy, mono- or di-1-4C-alkylamino, or morpholino, R42 is 1-4C-alkoxy, halogen, nitro, 1-4C-alkyl, trifluoromethyl, hydroxyl, 1-4C-alkoxycarbonyl, 3-
7C-cyloalkylmethoxy, or mono- or di-1-4C-alkylamino,
R421 is 1-4C-alkoxy, halogen, 1-4C-alkyl, hydroxyl, or 3-7C-cyloalkylmethoxy, or R42 and R421 together are a 1-2C-alkylenedioxy group, R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
and the salts of these compounds.
2. Compounds of formula I according to claim 1 , in which
R1 is -U-A, in which
U is a direct bond, or methylene (-CH2-),
A is phenyl, pyridinyl, thiophenyl, di-(1-4C-alkoxy)-phenyl, or R11 -substituted phenyl, in which
R11 is 1-4C-alkyl, halogen, trifluoromethyl, hydroxyl, 1-4C-alkoxy, completely or predominantly fluorine-substituted 1-4C-alkoxy, phenoxy, 1-4C-alkoxycarbonyl, morpholino, or di-1-4C- alkylamino,
R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)-piperidinyl, in which
R31 is 1-4C-alkoxy, morpholino, or di-1-4C-alkylamino,
R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321 -substituted phenyl, di-1-4C- alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42-substituted phenyl, or pyridinyl, in which R41 is hydroxyl, 1-4C-alkoxy, di-1-4C-alkylamino, or morpholino,
R42 is 1-4C-alkoxy, or di-1-4C-alkylamino,
R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
and the salts of these compounds.
3. Compounds of formula I according to claim 1 , in which
R1 is -U-A, in which
U is a direct bond, or methylene (-CH2-),
A is phenyl, pyridinyl, thiophenyl, dimethoxyphenyl, or R11 -substituted phenyl, in which
R11 is methyl, tertbutyl, chlorine, fluorine, bromine, trifluoromethyl, hydroxyl, methoxy, ethoxy, trifluoromethoxy, phenoxy, methoxycarbonyl, morpholino, or dimethylamino,
R2 is amino, carboxyl, 1-4C-alkoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which R3 is 1-4C-alkyl, 2-4C-alkenyl, 3-7C-cycloalkyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-4C-alkyl, or 1 N-(R33)-piperidinyl, in which
R31 is 1-4C-alkoxy, morpholino, or di-1-4C-alkylamino,
R32 is hydroxyl, phenyl-1-4C-alkoxy, 1-4C-alkoxy, phenyl, R321 -substituted phenyl, di-1-4C- alkylamino, morpholino, or 4N-(R322)-piperazin-1-yl, in which R321 is 1-4C-alkoxy, R322 is 1-4C-alkyl, R33 is hydrogen, 1-4C-alkyl, or 1-4C-alkylcarbonyl,
R4 is hydrogen, 1-4C-alkyl, R41 -substituted 2-4C-alkyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
R41 is hydroxyl, 1-4C-alkoxy, di-1-4C-alkylamino, or morpholino, R42 is 1-4C-alkoxy, or di-1-4C-alkylamino, R5 is hydrogen, or 1-4C-alkyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-(1-4C-alkyl)-piperazin-1-yl,
and the salts of these compounds.
4. Compounds of formula I according to claim 1 , in which R1 is -U-A, in which U is a direct bond, or methylene (-CH2-),
A is phenyl, or R11 -substituted phenyl, in which
R11 is methyl, chlorine, fluorine, bromine, trifluoromethyl, hydroxyl, methoxy, phenoxy, methoxycarbonyl, or dimethylamino,
R2 is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
R31 is methoxy, morpholino, or dimethylamino,
R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
R33 is hydrogen, methyl, or acetyl,
R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
R41 is hydroxyl, methoxy, dimethylamino, or morpholino,
R42 is methoxy, or dimethylamino,
R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-methyl-piperazin-1-yl,
and the salts of these compounds.
5. Compounds of formula I according to claim 1 , in which
R1 is -U-A, in which
U is a direct bond,
A is phenyl, or R11 -substituted phenyl, in which
R11 is fluorine, bromine, trifluoromethyl, or methoxy,
R2 is attached in the meta or para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
R31 is methoxy, morpholino, or dimethylamino,
R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
R33 is hydrogen, methyl, or acetyl,
R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which
R41 is hydroxyl, methoxy, dimethylamino, or morpholino,
R42 is methoxy, or dimethylamino,
R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, or 4N-methyl-piperazin-1-yl,
and the salts of these compounds.
6. Compounds of formula I according to claim 1 , in which
R1 is -U-A, in which
U is a direct bond,
A is phenyl, or R11 -substituted phenyl, in which
R11 is fluorine, bromine, chlorine, trifluoromethyl, methyl or methoxy,
R2 is attached in the meta or para position with respect to the binding position in which the phenyl ring is bonded to the amino group of the triazolophthalazine scaffold, and is amino, carboxyl, methoxycarbonyl, -N(H)-C(O)R3, or -C(O)-N(R4)R5, in which
R3 is methyl, vinyl, cyclopropyl, cyclohexyl, trifluoromethyl, phenyl, R31 -substituted phenyl, furanyl, imidazol-4-yl, pyridinyl, R32-substituted 1-2C-alkyl, or 1 N-(R33)-piperidinyl, in which
R31 is methoxy, morpholino, or dimethylamino,
R32 is hydroxyl, benzyloxy, methoxy, phenyl, R321 -substituted phenyl, dimethylamino, morpholino, or 4N-methyl-piperazin-1-yl, in which R321 is methoxy,
R33 is hydrogen, methyl, or acetyl,
R4 is hydrogen, methyl, 2-(R41)-ethyl, phenyl, R42-substituted phenyl, or pyridinyl, in which R41 is hydroxyl, methoxy, dimethylamino or morpholino,
R42 is methoxy, or dimethylamino,
R5 is hydrogen, or methyl, or R4 and R5 together and with inclusion of the nitrogen atom, to which they are bonded, form a heterocyclic ring radical Het, in which Het is morpholino, 4N-methyl-piperazin-1-yl, or 4N-ethyl-piperazin-1-yl
and the salts of these compounds.
7. Compounds of formula I according to any of the claims 1 to 6, in which
R1 is 4-methoxy-phenyl, 2-methoxy-phenyl, 2-bromo-phenyl, 2-fluoro-phenyl, 2-(trifluoromethyl)- phenyl, 2-chloro-phenyl, 4-bromo-phenyl or 2-methyl-phenyl and the salts of these compounds.
8. Compounds of formula I selected from the following group:
Cyclopropanecarboxylic acid {4-[3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-amide,
Cyclopropanecarboxylic acid {3-[3-(4-methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-ylamino]- phenyl}-amide, or
1 -{4-[3-(4-Methoxy-phenyl)-[1 ,2,4]triazolo[3,4-a]phthalazin-6-ylamino]-phenyl}-1 -(4-methyl-piperazin-1 - yl)-methanone
9. Compounds of formula I according to claim 1 for use in the treatment of diseases.
10. A pharmaceutical composition comprising one or more compounds of formula I according to claim 1 together with customary pharmaceutical excipients and/or auxiliaries.
11. Use of compounds of formula I according to claim 1 for the production of pharmaceutical compositions for the treatment of diseases associated with PDE2 activity, such as, for example, conditions of pathologically enhanced endothelial activity and impaired endothelial barrier function such as septic shock and vascular edema.
12. Use of compounds of formula I according to claim 1 for the production of pharmaceutical compositions for the treatment of (1) conditions associated with pathologically enhanced neoangiogenesis such as all kinds of tumors (benign or malignant) or (2) all kinds of inflammatory diseases associated with neoangiogenesis such as disorders of the arthritis type.
13. A method for treating conditions of pathologically enhanced endothelial activity and impaired endothelial barrier function such as septic shock and vascular edema in a patient in need therof, comprising administering to said patient a therapeutically effective amount of a compound of formula I as claimed in claim 1.
14. A method for treating (1) conditions associated with pathologically enhanced neoangiogenesis such as all kinds of tumors (benign or malignant) or (2) all kinds of inflammatory diseases associated with neoangiogenesis such as disorders of the arthritis type in a patient in need therof, comprising administering to said patient a therapeutically effective amount of a compound of formula I as claimed in claim 1.
PCT/EP2005/054266 2004-09-02 2005-08-31 Triazolophthalazines Ceased WO2006024640A2 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
JP2007528875A JP5140427B2 (en) 2004-09-02 2005-08-31 Triazolophthalazine
BRPI0514586-4A BRPI0514586A (en) 2004-09-02 2005-08-31 triazolphtalazine
AU2005279221A AU2005279221C9 (en) 2004-09-02 2005-08-31 Triazolophthalazines
EA200700537A EA014324B1 (en) 2004-09-02 2005-08-31 Triazolophthalazines
US11/660,748 US7851472B2 (en) 2004-09-02 2005-08-31 Triazolophthalazines
NZ553160A NZ553160A (en) 2004-09-02 2005-08-31 Anilino-substituted triazolophthalazine derivatives having PDE2 inhibitory activity
CN200580038057XA CN101133057B (en) 2004-09-02 2005-08-31 Triazolophthalazines
KR1020077006869A KR101368093B1 (en) 2004-09-02 2005-08-31 Triazolophthalazines
EP05784647A EP1791543B1 (en) 2004-09-02 2005-08-31 Triazolophthalazines
DE602005021894T DE602005021894D1 (en) 2004-09-02 2005-08-31 TRIAZOLOPHTHALAZINE
AT05784647T ATE471324T1 (en) 2004-09-02 2005-08-31 TRIAZOLOPHTHALAZINES
CA2578368A CA2578368C (en) 2004-09-02 2005-08-31 Triazolophthalazines
HK08106059.7A HK1115590B (en) 2004-09-02 2005-08-31 Triazolophthalazines
IL181271A IL181271A (en) 2004-09-02 2007-02-11 Anilino-substituted triazolophthalazine derivatives and pharmaceutical compositions comprising them for treating septic shock, edema, arthritis and airway disorders
NO20071127A NO20071127L (en) 2004-09-02 2007-02-28 Triazoloftalaziner
US12/766,478 US20100286140A1 (en) 2004-09-02 2010-04-23 Triazolophthalazines

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP04104221 2004-09-02
EP04104221.9 2004-09-02

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/766,478 Continuation US20100286140A1 (en) 2004-09-02 2010-04-23 Triazolophthalazines

Publications (2)

Publication Number Publication Date
WO2006024640A2 true WO2006024640A2 (en) 2006-03-09
WO2006024640A3 WO2006024640A3 (en) 2007-06-07

Family

ID=34929521

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2005/054266 Ceased WO2006024640A2 (en) 2004-09-02 2005-08-31 Triazolophthalazines

Country Status (17)

Country Link
US (2) US7851472B2 (en)
EP (1) EP1791543B1 (en)
JP (1) JP5140427B2 (en)
KR (1) KR101368093B1 (en)
CN (1) CN101133057B (en)
AT (1) ATE471324T1 (en)
AU (1) AU2005279221C9 (en)
BR (1) BRPI0514586A (en)
CA (1) CA2578368C (en)
DE (1) DE602005021894D1 (en)
EA (1) EA014324B1 (en)
ES (1) ES2347337T3 (en)
IL (1) IL181271A (en)
NO (1) NO20071127L (en)
NZ (1) NZ553160A (en)
WO (1) WO2006024640A2 (en)
ZA (1) ZA200701137B (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006072615A3 (en) * 2005-01-05 2007-01-04 Altana Pharma Ag Triazolophthalazines as pde2-inhibitors
WO2006072612A3 (en) * 2005-01-05 2007-11-29 Nycomed Gmbh Triazolophthalazines as pde2- inhibitors
WO2014019979A1 (en) 2012-07-31 2014-02-06 Boehringer Ingelheim International Gmbh 4-methyl-2,3,5,9,9b-pentaaza-cyclopenta[a]naphthalenes
WO2015096651A1 (en) 2013-12-23 2015-07-02 Merck Sharp & Dohme Corp. Pyrimidone carboxamide compounds as pde2 inhibitors
WO2015106032A1 (en) 2014-01-08 2015-07-16 Intra-Cellular Therapies, Inc. Products and pharmaceutical compositions
WO2016149058A1 (en) 2015-03-17 2016-09-22 Merck Sharp & Dohme Corp. Triazolyl pyrimidinone compounds as pde2 inhibitors
WO2016154081A1 (en) 2015-03-26 2016-09-29 Merck Sharp & Dohme Corp. Pyrazolyl pyrimidinone compounds as pde2 inhibitors
WO2016209749A1 (en) 2015-06-25 2016-12-29 Merck Sharp & Dohme Corp. Substituted pyrazolo/imidazolo bicyclic compounds as pde2 inhibitors
US9540379B2 (en) 2011-01-31 2017-01-10 Boehringer Ingelheim International Gmbh (1,2,4)triazolo[4,3-A]quinoxaline derivatives as inhibitors of phosphodiesterases
EP3156405A1 (en) 2015-10-13 2017-04-19 Boehringer Ingelheim International GmbH Spirocyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxamide
US9682991B2 (en) 2009-12-31 2017-06-20 Fundación Centro Nacional De Investigaciones Oncologicas Carlos Iii Tricyclic compounds for use as kinase inhibitors
EP3328840A1 (en) 2015-07-01 2018-06-06 Merck Sharp & Dohme Corp. Substituted triazolo bicyclic compounds as pde2 inhibitors
US10105349B2 (en) 2014-12-06 2018-10-23 Intra-Cellular Therapies, Inc. Organic compounds
US10160762B2 (en) 2015-05-29 2018-12-25 Merck Sharp & Dohme Corp. 6-alkyl dihydropyrazolopyrimidinone compounds as PDE2 inhibitors
US10174037B2 (en) 2015-06-04 2019-01-08 Merck Sharp & Dohme Corp. Dihydropyrazolopyrimidinone compounds as PDE2 inhibitors
US10195201B2 (en) 2015-05-05 2019-02-05 Merck Sharp & Dohme Corp. Heteroaryl-pyrimidinone compounds as PDE2 inhibitors
US10285989B2 (en) 2015-05-15 2019-05-14 Merck Sharp & Dohme Corp. Pyrimidinone amide compounds as PDE2 inhibitors
US10287293B2 (en) 2015-07-01 2019-05-14 Merck Sharp & Dohme Corp. Bicyclic heterocyclic compounds as PDE2 inhibitors
US10300064B2 (en) 2014-12-06 2019-05-28 Intra-Cellular Therapies, Inc. Organic compounds
WO2019101970A1 (en) 2017-11-23 2019-05-31 Oslo University Hospital Hf Treatment of tachycardia

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3134413B1 (en) 2014-04-23 2019-09-11 Dart NeuroScience (Cayman) Ltd. Substituted [1,2,4]triazolo[1,5-a]pyrimidin-7-yl compounds as pde2 inhibitors
WO2016073424A1 (en) 2014-11-05 2016-05-12 Dart Neuroscience, Llc Substituted 5-methyl-[1, 2, 4] triazolo [1,5-a) pyrimidin-2-amine compounds as pde2 inhibitors

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PH21834A (en) * 1982-01-18 1988-03-17 Lepetit Spa New 6-substituted-s-triazolo(3,4-a)phthalazine derivatives
RU2128175C1 (en) * 1994-08-09 1999-03-27 Эйсай Ко., Лтд. Condensed pyridazine or its pharmaceutically acceptable salt, an agent showing inhibitory activity with respect to cyclic gmp-phosphodiesterase
WO1996008496A1 (en) * 1994-09-16 1996-03-21 Takeda Chemical Industries, Ltd. Triazolopyridazines process and intermediates for their preparation and their use as medicaments
US5869486A (en) * 1995-02-24 1999-02-09 Ono Pharmaceutical Co., Ltd. Fused pyrimidines and pyriazines as pharmaceutical compounds
AU723098B2 (en) 1996-07-25 2000-08-17 Merck Sharp & Dohme Limited Substituted triazolo-pyridazine derivatives as ligands for GABA receptors
ES2179490T3 (en) 1997-05-08 2003-01-16 Merck Sharp & Dohme DERIVATIVES OF 1,2,4-TRIAZOLO (3,4-A) FTALAZINA SUBSTITUTED AS LIGANDOS DE GABA ALFA 5.
US6235741B1 (en) * 1997-05-30 2001-05-22 Merck & Co., Inc. Angiogenesis inhibitors
GB9715977D0 (en) 1997-07-29 1997-10-01 Merck Sharp & Dohme Therapeutic agents
GB9801208D0 (en) * 1998-01-21 1998-03-18 Merck Sharp & Dohme Therapeutic agents
IT1303272B1 (en) 1998-10-29 2000-11-06 Zambon Spa TRICYCLIC DERIVATIVES INHIBITORS OF PHOSPHODIESTERASE 4
GB0028583D0 (en) 2000-11-23 2001-01-10 Merck Sharp & Dohme Therapeutic compounds
GB0108475D0 (en) * 2001-04-04 2001-05-23 Merck Sharp & Dohme New compounds
WO2002083140A1 (en) * 2001-04-10 2002-10-24 Merck & Co., Inc. Inhibitors of akt activity
MX2007008137A (en) * 2005-01-05 2007-07-19 Altana Pharma Ag Triazolophthalazines.
CA2591991C (en) * 2005-01-05 2013-11-19 Altana Pharma Ag Triazolophthalazines

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006072615A3 (en) * 2005-01-05 2007-01-04 Altana Pharma Ag Triazolophthalazines as pde2-inhibitors
WO2006072612A3 (en) * 2005-01-05 2007-11-29 Nycomed Gmbh Triazolophthalazines as pde2- inhibitors
EA012505B1 (en) * 2005-01-05 2009-10-30 Никомед Гмбх Triazolophthalazines as pde2-inhibitors
US7671050B2 (en) 2005-01-05 2010-03-02 Nycomed Gmbh Triazolophthalazines
AU2006204454B2 (en) * 2005-01-05 2011-11-10 Takeda Gmbh Triazolophthalazines as PDE2-inhibitors
US8106047B2 (en) 2005-01-05 2012-01-31 Nycomed Gmbh Triazolophthalazines
US9682991B2 (en) 2009-12-31 2017-06-20 Fundación Centro Nacional De Investigaciones Oncologicas Carlos Iii Tricyclic compounds for use as kinase inhibitors
US9540379B2 (en) 2011-01-31 2017-01-10 Boehringer Ingelheim International Gmbh (1,2,4)triazolo[4,3-A]quinoxaline derivatives as inhibitors of phosphodiesterases
WO2014019979A1 (en) 2012-07-31 2014-02-06 Boehringer Ingelheim International Gmbh 4-methyl-2,3,5,9,9b-pentaaza-cyclopenta[a]naphthalenes
US9085584B2 (en) 2012-07-31 2015-07-21 Boehringer Ingelheim International Gmbh Substituted pyrido[3,2-E][1,2,4]-triazolo[4,3-A]pyrazines for the treatment of central nervous system disorders
WO2015096651A1 (en) 2013-12-23 2015-07-02 Merck Sharp & Dohme Corp. Pyrimidone carboxamide compounds as pde2 inhibitors
US9815796B2 (en) 2013-12-23 2017-11-14 Merck Sharp & Dohme Corp. Pyrimidone carboxamide compounds as PDE2 inhibitors
WO2015106032A1 (en) 2014-01-08 2015-07-16 Intra-Cellular Therapies, Inc. Products and pharmaceutical compositions
US10543194B2 (en) 2014-12-06 2020-01-28 Intra-Cellular Therapies, Inc. Organic compounds
US10105349B2 (en) 2014-12-06 2018-10-23 Intra-Cellular Therapies, Inc. Organic compounds
US10300064B2 (en) 2014-12-06 2019-05-28 Intra-Cellular Therapies, Inc. Organic compounds
WO2016149058A1 (en) 2015-03-17 2016-09-22 Merck Sharp & Dohme Corp. Triazolyl pyrimidinone compounds as pde2 inhibitors
US10358435B2 (en) 2015-03-17 2019-07-23 Merck Sharp & Dohme Corp. Triazolyl pyrimidinone compounds as PDE2 inhibitors
WO2016154081A1 (en) 2015-03-26 2016-09-29 Merck Sharp & Dohme Corp. Pyrazolyl pyrimidinone compounds as pde2 inhibitors
US10287269B2 (en) 2015-03-26 2019-05-14 Merck Sharp & Dohme Corp. Pyrazolyl pyrimidinone compounds as PDE2 inhibitors
US10195201B2 (en) 2015-05-05 2019-02-05 Merck Sharp & Dohme Corp. Heteroaryl-pyrimidinone compounds as PDE2 inhibitors
US10285989B2 (en) 2015-05-15 2019-05-14 Merck Sharp & Dohme Corp. Pyrimidinone amide compounds as PDE2 inhibitors
US10160762B2 (en) 2015-05-29 2018-12-25 Merck Sharp & Dohme Corp. 6-alkyl dihydropyrazolopyrimidinone compounds as PDE2 inhibitors
US10174037B2 (en) 2015-06-04 2019-01-08 Merck Sharp & Dohme Corp. Dihydropyrazolopyrimidinone compounds as PDE2 inhibitors
US10647727B2 (en) 2015-06-25 2020-05-12 Merck Sharp & Dohme Corp. Substituted pyrazolo/imidazolo bicyclic compounds as PDE2 inhibitors
WO2016209749A1 (en) 2015-06-25 2016-12-29 Merck Sharp & Dohme Corp. Substituted pyrazolo/imidazolo bicyclic compounds as pde2 inhibitors
US10287293B2 (en) 2015-07-01 2019-05-14 Merck Sharp & Dohme Corp. Bicyclic heterocyclic compounds as PDE2 inhibitors
US10357481B2 (en) 2015-07-01 2019-07-23 Merck Sharp & Dohme Corp. Substituted triazolo bicyclic compounds as PDE2 inhibitors
EP3328840A1 (en) 2015-07-01 2018-06-06 Merck Sharp & Dohme Corp. Substituted triazolo bicyclic compounds as pde2 inhibitors
US10023575B2 (en) 2015-10-13 2018-07-17 Boehringer Ingelheim International Gmbh Cyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxyamide
US10479794B2 (en) 2015-10-13 2019-11-19 Boehringer Ingelheim International Gmbh Cyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxyamide
EP3156405A1 (en) 2015-10-13 2017-04-19 Boehringer Ingelheim International GmbH Spirocyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxamide
US10875867B2 (en) 2015-10-13 2020-12-29 Boehringer Ingelheim International Gmbh Cyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxyamide
US11691977B2 (en) 2015-10-13 2023-07-04 Boehringer Ingelheim International Gmbh Cyclic ether derivatives of pyrazolo[1,5-A]pyrimidine-3-carboxyamide
US12351584B2 (en) 2015-10-13 2025-07-08 Boehringer Ingelheim International Gmbh Cyclic ether derivatives of pyrazolo[1,5-a]pyrimidine-3-carboxyamide
WO2019101970A1 (en) 2017-11-23 2019-05-31 Oslo University Hospital Hf Treatment of tachycardia
US11419874B2 (en) 2017-11-23 2022-08-23 Oslo University Hospital Hf Treatment of tachycardia
AU2018371216B2 (en) * 2017-11-23 2024-09-19 Oslo University Hospital Hf Treatment of tachycardia

Also Published As

Publication number Publication date
BRPI0514586A (en) 2008-06-17
KR101368093B1 (en) 2014-03-14
NZ553160A (en) 2010-08-27
ATE471324T1 (en) 2010-07-15
EA014324B1 (en) 2010-10-29
JP2008511586A (en) 2008-04-17
AU2005279221B2 (en) 2011-10-13
IL181271A (en) 2013-11-28
CA2578368C (en) 2013-07-02
EP1791543B1 (en) 2010-06-16
DE602005021894D1 (en) 2010-07-29
AU2005279221C1 (en) 2012-05-24
US20100286140A1 (en) 2010-11-11
EP1791543A2 (en) 2007-06-06
ZA200701137B (en) 2008-11-26
AU2005279221A1 (en) 2006-03-09
KR20070047834A (en) 2007-05-07
CN101133057B (en) 2011-03-09
AU2005279221C9 (en) 2012-08-23
EA200700537A1 (en) 2007-10-26
IL181271A0 (en) 2007-07-04
US7851472B2 (en) 2010-12-14
CA2578368A1 (en) 2006-03-09
ES2347337T3 (en) 2010-10-28
JP5140427B2 (en) 2013-02-06
US20090005372A1 (en) 2009-01-01
NO20071127L (en) 2007-02-28
WO2006024640A3 (en) 2007-06-07
HK1115590A1 (en) 2008-12-05
CN101133057A (en) 2008-02-27

Similar Documents

Publication Publication Date Title
US20100286140A1 (en) Triazolophthalazines
EP1836207B1 (en) Triazolophthalazines as pde2-inhibitors
US20110136803A1 (en) Triazolophthalazines
US20060106037A1 (en) Purin-6-one-derivatives
HK1115590B (en) Triazolophthalazines

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 553160

Country of ref document: NZ

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 200701137

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 181271

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2578368

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2007528875

Country of ref document: JP

Ref document number: MX/a/2007/002266

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2005784647

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 434/MUMNP/2007

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 11660748

Country of ref document: US

Ref document number: 2005279221

Country of ref document: AU

Ref document number: 1020077006869

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 200700537

Country of ref document: EA

ENP Entry into the national phase

Ref document number: 2005279221

Country of ref document: AU

Date of ref document: 20050831

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2005279221

Country of ref document: AU

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 200580038057.X

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005784647

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0514586

Country of ref document: BR