WO2006018243A1 - Method for the analysis of methylated dna - Google Patents

Method for the analysis of methylated dna Download PDF

Info

Publication number
WO2006018243A1
WO2006018243A1 PCT/EP2005/008792 EP2005008792W WO2006018243A1 WO 2006018243 A1 WO2006018243 A1 WO 2006018243A1 EP 2005008792 W EP2005008792 W EP 2005008792W WO 2006018243 A1 WO2006018243 A1 WO 2006018243A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
oligonucleotide
methylation
further characterized
extended
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2005/008792
Other languages
French (fr)
Inventor
David GÜTIG
Matthias Schuster
Jürgen Distler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Epigenomics AG filed Critical Epigenomics AG
Priority to US11/660,804 priority Critical patent/US20070254293A1/en
Publication of WO2006018243A1 publication Critical patent/WO2006018243A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification

Definitions

  • the present invention relates to a method for the analy ⁇ sis of methylated cytosines in DNA.
  • 5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays an important biological role, e.g. in the regulation of the transcription, in ge- netic imprinting, and in tumorigenesis (for review: Mil ⁇ lar et al . : Five not four: History and significance of the fifth base.
  • the Epigenome, S. Beck and A. Olek (eds.), Wiley-VCH Verlag Weinheim 2003, p. 3-20) There ⁇ fore, the identification of 5-methylcytosine as a compo- nent of genetic information is of considerable interest.
  • 5-methylcytosine has the same base pairing behavior as cytosine.
  • the usual methods for identifying nucleic acids are not applicable.
  • the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
  • methylation-specific restriction enzymes are utilized, and in the second case, a selective chemical conversion of unmethylated cytosines to uracil is con ⁇ ducted (bisulfite treatment; for review: European Patent Application 103 47 400.5, filing date: Oct. 9th 2003, ap- plicant: Epigenomics AG) .
  • a second step the enzymati- cally or chemically pretreated DNA is amplified and ana ⁇ lyzed in different ways (for review: Fraga and Esteller: DNA methylation: a profile of methods and applications. Biotechniques. 2002 Sep;33 (3) :632, 634, 636-49; WO 02/072880 pp. 1 ff) .
  • a particularly important application of methylation analysis is the cancer diagnosis out of bodily fluids.
  • Cancer cell DNA in bodily fluids has the property to be uniformly methylated over stretches of several 100 base pairs, while DNA of normal cells like blood shows a ran- dom mosaic methylation.
  • a reliable diagnosis by detecting specially methylated cytosines in body fluids is difficult, because very small amounts of aberrant me ⁇ thylation patterns have to be found within a large amount of background DNA, which is methylated differently, but which has the same base sequence.
  • methylation specific primers are known as "MSP" (Herman et al . : Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A. 1996 Sep 3 ; 93 (18) ':9821-6) .
  • methylation specific blockers The application of methylation specific blockers is known as "Heavy Methyl” (WO 02/072880; Cottrell et al . A real-time PCR assay for DNA-methylation using methylation-specific blockers. Nucl . Acids. Res. 2004 32: elO) . Both methods can be used as a real time PCR (,,MethyLight"
  • the present invention allows a sensitive and specific de ⁇ tection of cytosine methylation.
  • the chemically converted DNA is amplified using specially designed oli ⁇ gonucleotides.
  • the oligonucleotides carry a me ⁇ thylation specific nucleotide at the 3' end.
  • a mismatch free binding of the oligonucleotides only takes place with the DNA of a defined methylation status.
  • the DNA of the of the opposite me ⁇ thylation status forms a mismatch with the 3' end of the oligonucleotides.
  • the nucleotide at the 3' end of the oligonucleotides is chemically modified in a way that the extension of the oligonucleotides is blocked.
  • the blocker nucleo- tide is removed by the exonuclease activity of the DNA polymerase.
  • an extension of the oligonu ⁇ cleotide can occur.
  • the blocked 3' ends of the matched oligonucleotides are not digested. As a re- suit an extension cannot take place. In this way it is possible to selectively amplify DNA of a certain methyla- tion state while the amplification of the background DNA is inhibited. This method allows a very sensitive and specific methylation analysis.
  • a similiar method for the detection of mutations is al- ready described as ,,PAP" (pyrophosphorolysis-activated polymerization; e.g. : Liu and Sommer: Pyrophosphorolysis- activatable oligonucleotides may facilitate detection of rare alleles, mutation scanning and analysis of chromatin structures.
  • the present invention provides a novel method for the analysis of cytosine methylation in DNA.
  • the invention is characterised in that the following steps are conducted: a) a genomic DNA sample is chemically or enzymatically treated in such a way that all of the unmethylated cytosine bases are converted to uracil or another base which is dissimilar to cytosine in terms of base pairing behaviour, while the 5-methylcytosine bases remain unchanged, b) at least one methylation specific oligonucleotide carrying a non-extendable 3' end is annealed to the converted DNA, c) the non-extendable 3' terminus of the oligonucleo ⁇ tide is removed in case the oligonucleotide is bound to the DNA with the methylation status to be detected, d) the unblocked oligonucleotide is extended, e) the methylation status is concluded from the ab ⁇ sence or presence of an extended oligonucleotide product .
  • a genomic DNA sample is chemically treated in such a way that all of the unmethylated cytosine bases are converted to uracil, or another base which is dissimilar to cytosine in terms of base pairing behaviour, while the 5-methylcytosine bases remain unchanged.
  • the genomic DNA sample can be obtained from various sources, e.g. from cell lines, biopsies or tissue embedded in paraffin. According to the above mentioned advantages it is particularly pre ⁇ ferred to analyse bodily fluids like plasma, serum, stool or urine.
  • the genomic DNA is isolated by standard meth ⁇ ods, as found in references such as Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, CSH
  • the conversion is conducted in presence of a reagent that denatures the DNA duplex and of a radical scavenger (DE 100 29 915; German patent ap ⁇ plications 10347397.1; 10347396.3; 10347400.5; 10347399.8; filing date: Oct. 9 2003, applicant: Epige- nomics AG) .
  • At least one methylation specific oligonucleotide carrying a non- extendable 3' end is annealed to the converted DNA.
  • a me ⁇ thylation specific oligonucleotide is an oligonucleotide hybridising specifically to chemically or enzymatically converted DNA which was prior to the conversion either methylated or unmethylated.
  • the converted DNA contains at a specific methylation position either a C (methylated cytosine) or an T/U (unmethylated DNA, first strand) or an A (unmethy- lated, opposing strand) . Therefore, a methylation spe ⁇ cific oligonucleotide contains at least one methylation specific C, T or A nucleotide, i.e. an nucleotide corre ⁇ sponding either to a methylated or unmethylated cytosine in the original, unconverted DNA.
  • the oligonucleotide is extended in case it is bound without a mismatch to the DNA to be detected.
  • the 3" end of the methylation specific oligonucleotide contains at least one C nucleotide or one methylation specific T or A nucleotide.
  • the methylation specific nu ⁇ cleotide allows a mismatch free binding of the oligonu ⁇ cleotide to the DNA to be detected.
  • hybridi ⁇ zation to the background DNA only takes place under mis- match formation.
  • the methylation specific dinucleotide is located at the 3' terminus. The specificity of the ampli ⁇ fication is also affected by other factors.
  • the influence of the length, the structure and design of the oligonu ⁇ cleotide, of the sequence to be detected, of the reaction compounds and the reaction conditions to the specificity of the PAP reaction is described in detail elsewhere (US Patent Application 20040009515, incorporated by refer ⁇ ence) .
  • the methylation specific oligonucleotide carries a non- extendable 3' end being activatable by pyrophosphoroly- sis.
  • the non-extendible 3 1 terminus is a nucleotide or nucleotide analogue which has the capacity to form a Wat- son-Crick base pair with a complementary nucleotide and which lacks a 3 ' OH capable of being extended by a nu ⁇ cleic acid polymerase.
  • the non- extendible 3 ' terminus may be a non-extendible 3 ' de- oxynucleotide, such as a dideoxynucleotide.
  • the non-extendible 3' terminus may be a chemically modified nucleotide lacking the 3 ' hydroxyl group, such as an acyclonucleotide. Acyclonucleotides substitute a 2-hydroxyethoxymethyl group for the 2'- deoxyribofuranosyl sugar normally present in dNMPs.
  • the non-extendible 3' terminus may be other blockers as described elsewhere (US Patent Applica ⁇ tion 20040009515, incorporated by reference) .
  • Examples of a non-extendible 3' termini include, but are not limited to, a 2 ' 3 ' -dideoxynucleotide, 3 ' -deoxyadenosine (cordy- cepin) , 3 ' -azido-3 ' -deoxythymidine (AZT) , 2 ' , 3 ' -dideoxy- inosine (ddl) , 2 • , 3 ' -dideoxy-3 ' -thiacytidine (3TC) and 2 ' , 3 ' -didehydro-2 ' , 3 ' -dide- oxythymidine (d4T) .
  • the oligonucleotide is extended only in case it is bound with a mismatch to the DNA to be detected.
  • the 3' end of the methylation specific oligonu ⁇ cleotide contains at least one non-extendible C nucleo ⁇ tide or one methylation specific T or A nucleotide.
  • the methylation specific nucleotide forms a mismatch with the DNA to be detected.
  • hybridization to the background DNA takes place without mismatch formation.
  • the methylation specific dinucleotide is located at the 3" terminus.
  • the non- extendable 3' terminus of the oligonucleotide is removed in case the oligonucleotide is bound to the DNA with the methylation status to be detected.
  • the 3' end of the oli ⁇ gonucleotides is activatable by pyrophosphorolysis. This means that the blocked 3' end can be removed by an enzyme that has pyrophosphorolysis activity in the presence of pyrophosphate (PP. sub. i) generating a nucleotide triphos ⁇ phate. This activation specifically takes place when the 3' end of the oligonucleotide is bound to the DNA without mismatch, which means only the DNA of a certain methyla ⁇ tion status will be activated.
  • DNA polymerases are used to ac ⁇ tivate the 3' termini of the oligonucleotides.
  • Preferred DNA polymerases having pyrophosphorolysis activity are thermostable TfI, Taq, and genetically engineered DNA po ⁇ lymerases, such as AmpliTaqFs and ThermoSequenase.TM.. These genetically engineered DNA polymerases have the mu ⁇ tation F667Y or an equivalent mutation in their active sites.
  • the activation of the 3' end of the oligonucleotide may also occur by another mechanism, such as a 3 ' exonucle- ase.
  • oligonu- cleotide e.g. helicases, topoisomerases, telomerases
  • helicases e.g. helicases, topoisomerases, telomerases
  • the unblocked oli ⁇ gonucleotide is extended.
  • the extension is preferably conducted by a nucleic acid polymerase in the presence of nucleoside triphosphates (see above, US patent applica ⁇ tion 20040009515, incorporated by reference) .
  • the methyla- tion status is concluded form the absence or presence of an extended oligonucleotide product.
  • the detection of the nucleic acid is performed by detect- ing the unblocking of oligonucleotide, e.g. by detecting the loss of a label contained in the 3 ' terminal residue of the oligonucleotide.
  • the unblock ⁇ ing is detected by detecting the presence of a 3 ' OH on the 3 ' terminal residue that is capable of extension or ligation.
  • the detection is determined by extending the unblocked oligonucleotide or by ligating the unblocked oligonucleotide to a further oligonucleo ⁇ tide.
  • the detection of the nu- cleic acid is performed by detecting the extended oli ⁇ gonucleotide, e.g. by means of an incorporated labelled nucleotide.
  • the extended oligonucleo ⁇ tide is detected by gel electrophoresis.
  • the extended oligonucleotide is detected by the binding or incorporation of a dye or spectral material .
  • real time probes are used to detect the presence of the extension product.
  • Several versions of real time probes are known, e.g. Lightcycler, Taqman, Scorpio, Sunrise, Molecular Beacon or Eclipse probes. Details concerning structure or detection of these probes are known in the state of the art (e.g. US Patent 6,331,393 with further references) .
  • Taqman probes can be designed by the ,,PrimerExpress" Software (Applied Biosystems) .
  • the PAP method described above can be performed bidirection- ally (Bi-PAP) .
  • Bi-PAP uses two opposing pyrophosphoroly- sis activatable oligonucleotides with one nucleotide overlap at their 3' termini.
  • PAP is per ⁇ formed with a pair of opposing activatable oligonucleo- tides.
  • Both the downstream and upstream oligonucleotides are specific for the nucleotide of interest at the 3 ' termini (e.g., an C:G base pair) .
  • the initial round of amplification segments of undefined size are generated.
  • oligonucleo ⁇ tides may be 30-60 nucleotides for most efficient ampli ⁇ fication (US patent application 20040009515, incorporated by reference) .
  • Amplification by the PAP method can be linear or exponen ⁇ tial.
  • Linear amplification is obtained when the activat- able oligonucleotide is the only complementary oligonu ⁇ cleotide used.
  • Exponential amplification is obtained when a second opposing oligonucleotide, which may be a second activatable oligonucleotide, is present that is comple ⁇ mentary to the desired nucleic acid strand.
  • the activat ⁇ able oligonucleotide and the second oligonucleotide flank the region that is targeted for amplification.
  • the second oligonucleotide anneals to the separated desired nucleic acid strand product.
  • the methylation analysis is conducted with two methylation specific oli ⁇ gonucleotides in combination with a methylation specific real time probe system.
  • the present invention also includes other modifications of PAP which are, e.g., described in detail in the US patent application 20040009515 (incorporated by refer ⁇ ence) . These modifications are - as far as they are ap- plicable for analysis of bisulfite treated DNA - part of this invention.
  • the US patent application discloses ways of performing a massively parallel analysis of DNA by using microarrays .
  • a methylation analysis by using these high throughput methods is also part of the present invention, as far as said methods are applicable for bisulfite treated DNA.
  • the methods disclosed here are preferably used for the diagnosis and/or prognosis of adverse events for patients or individuals, whereby these adverse events belong to at least one of the following categories: undesired drug in ⁇ teractions, cancer diseases, CNS malfunctions, damage or disease, symptoms of aggression or behavioural distur ⁇ nadoes; clinical, psychological and social consequences of brain damage, psychotic disturbances and personality disorders, dementia and/or associated syndromes, cardio ⁇ vascular disease, malfunction and damage, malfunction, damage or disease of the gastrointestinal tract, malfunc ⁇ tion, damage or disease of the respiratory system, le ⁇ sion, inflammation, infection, immunity and/or convales ⁇ cence, malfunction, damage or disease of the body as an abnormality in the development process, malfunction, dam- age or disease of the skin, of the muscles, of the con ⁇ nective tissue or of the bones, endocrine and metabolic malfunction, damage or disease, headaches or sexual mal ⁇ function
  • This new method also serves in a particularly preferred manner for distinguishing cell types and tis- sues or for investigating cell differentiation
  • Part of the present invention is also a kit, which con ⁇ sists of methylation specific activatable oligonucleo ⁇ tides and optionally contains a polymerase, probes for the detection of the amplificate and/or a bisulfite re- agent.
  • Example 1 Selective amplification of unmethylated con- nexin 26 fragments with 3"amino modified oligonucleotides using polymerases with proofreading activity.
  • the LightCycler (Roche) is a device for conducting PCR and simultaneous detection and analysis of the PCR prod- ucts.
  • the device was modified according to the manufac ⁇ turer' s instructions using SybrGreen for the detection of dsDNA.
  • the quantitative and qualitative analyses of the PCR were conducted with LightCycler Software Version 3.5.
  • the connexin 26 fragment (accession number AF 144321.1 , nt 748-905) was amplified from bisulfite treated methy ⁇ lated and unmethylated DNA.
  • the selective amplification of the unmethylated connexin 26 gene fragment was conducted in 20 ⁇ l of reaction vol- ume ( 5 U of Pful polymerase (Stratgen) ; Ix Pful reaction buffer (Stratgene) , 2mM MgCl2, 200 ⁇ M of each dNTP, 300 nM of each oligonucleotide, 3"modified by C3-amino resi ⁇ due (oligonucleotide FlC- 3NH,GGTATATTGTTGAAAGTAATTGAATAAAATC-NH2, SEQ ID 1 ; oli- gonucleotide R1G-3NH, AAACAATACCCTCTAAAATAAAAATTAACG-NH2, SEQ ID 2) , 0.25 ⁇ g/ ⁇ l BSA (Sigma, Munich) , 0.25 ⁇ l of 1:1000 dilution of SybrGreen (Molecular Dynamics) , Ing of template DNA) with the following cycler program: 95°C - 10 min; 50 cycles: denaturation
  • the amplification of the connexin fragment wasomme ⁇ gated on Ing methylated and unmethylated bisulfite treated DNA. Only with unmethylated DNA or mixtures of unmethylated and methylated bisulfite treated template DNA a amplification product was generated in the real time PCR. The melting point of the product was identical to that obtained with the unmodified primers (primerF2-T, GGTATATTGTTGAAAGTAATTGAATAAAATT; SEQ ID 4; primer R2-A AAACAATACCCTCTAAAATAAAAATTAACA, SEQ ID 5) with unmethy ⁇ lated bisulfite treated template DNA .
  • the oligonucleo ⁇ tide F1C-3NH and R1-G-3NH will not be extended by poly ⁇ merase without proofreading activity.
  • Pful shows 3"- 5'exonuclease proofreading activity on primers that do not match at their 3'position with the template.
  • the oli ⁇ gonucleotides F1C-3NH and R1-G-3NH show such mismatches with unmethylated bisulfite treated template and there- fore the 3'-base, including the amino modification is re ⁇ moved. Subsequently, the remaining primer, shortened by- one nucleotide acts as a primer for the PCR. Therefore, only the unmethylated connexin fragment is amplified.
  • Example 2 Selective amplification of methylated connexin 26 fragments with 3' modified oligonucleotide using pyro- phosphorolysis-activated exonuclease activity of poly- merases.
  • the LightCycler (Roche) is a device for conducting PCR and simultaneous detection and analysis of the PCR prod ⁇ ucts.
  • the device was modified according to the manufac- turer's instructions using SybrGreen for the detection of dsDNA.
  • the quantitative and qualitative analyses of the PCR were conducted with LightCycler Software Version 3.5.
  • the connexin 26 fragment (accession number AF 144321.1 , nt 748-905) was amplified from bisulfite treated methy- lated and unmethylated DNA.
  • the oligonucleotide FlC-ddC will not be extended by Fast- StartTaq polymerase without PPi in the PCR reaction. How ⁇ ever, under PCR condition with 300 ⁇ M PPi the ddC- modified oligonucleotide gets activated by pyrophosphoro- lysis if the oligonucleotide matches at its 3 ⁇ position with the template.
  • the primer FlC-ddC matches to the me ⁇ thylated bisulfite treated template and therefore, the 3"-didesoxynucleotide is removed. Subsequently, the re ⁇ maining oligonucleotide, shortened by one nucleotide, acts as a primer for the PCR. Therefore, only the methy- lated connexin fragment is exponentially amplified.
  • Example 3 Preferred amplification of non methylated bi ⁇ sulfite treated DNA in contrast to methylated DNA
  • Human genomic lymphocyte DNA methylated with Sssl methyl- transferase (Chemicon) and human genomic lymphocyte DNA were bisulfite treated as described above.
  • PCRs of a con- nexin promoter fragment (Accession number AL138688.27.1.127794; nt 119055 to ntll9197) was per ⁇ formed on a Lightcycler device (Roche Diagnostics) in a total volume of 20 ⁇ l using Ing methylated bisulfite DNA and 1 ng unmethylated bisulfite DNA, respectively.
  • the cycling condition were 2 min 95 C and 50 cycles of dena- turation 95°C 10s, annealing 56°C 30s and extension 72°C 30s.
  • the SybrGreen fluorescence was monitored in each cy- cle after the extension step.
  • the PCR conditions were as follows:
  • PCR C 0.6 ⁇ M forward primer (GGTATATTGTTGAAAGTAATTGAATAAAATC- 3NH) (Seq ID 13) ; 0.3 reverse primer (AAACAATACCCTCTAAAATAAAAATTAAC) (Seq ID 12) , 0,25 mg/ml bovine serum albumin, 0.2 mM dNTPs each, 2 U PfuTurbo Cx polymerase, Ix PfuTurbo reaction buffer, 3.5 mM MgCl 2 , Sybrgreen 1:80000
  • Methylated and unmethylated bisulfite DNA were amplified with the same efficiency when PCR was performed according condition PCR A.
  • non methylated bisulfite DNA was more efficiently amplified thn methylated bisul- fite DNA using the ddC or amino 3'modified primer (PCR B, PCR C conditions) .
  • the differences of the cycle thresholds are shown in table 1.
  • PCR with DNA polymerase lacking proof reading activity failed to amplify the connexine promoter fragment with the ddC or NH2 modified forward primer (data not shown) .

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method for the analysis of methylated cytosines in DNA. In the first step of the invention unmethylated cytosines in the DNA to be analysed are chemically converted into uracil while 5-methylcytosines remain unchanged. In a second step a methylation specific oligonucleotide carrying a non-extendable 3’ end is annealed to the converted DNA. Sub-sequently, the non-extendable 3’ terminus of the oligonucleotide is removed in case the oligonucleotide is bound to the DNA with the methylation status to be detected. Finally the unblocked oligonucleotide is extended, and the methylation status is concluded form the absence or presence of an extended oligonucleotide product. The method is preferably used for diagnosis and/or prognosis of adverse events for individuals, for distinguishing cell types and tissues, or for investigating cell differentiation.

Description

Method for the analysis of methylated DNA
Background of the invention The present invention relates to a method for the analy¬ sis of methylated cytosines in DNA. 5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays an important biological role, e.g. in the regulation of the transcription, in ge- netic imprinting, and in tumorigenesis (for review: Mil¬ lar et al . : Five not four: History and significance of the fifth base. In: The Epigenome, S. Beck and A. Olek (eds.), Wiley-VCH Verlag Weinheim 2003, p. 3-20) . There¬ fore, the identification of 5-methylcytosine as a compo- nent of genetic information is of considerable interest. However, a detection of 5-methylcytosine is difficult be¬ cause 5-methylcytosine has the same base pairing behavior as cytosine. As a consequence, the usual methods for identifying nucleic acids are not applicable. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
The usual methods for methylation analysis operate essen¬ tially according to two different principles. In the first case, methylation-specific restriction enzymes are utilized, and in the second case, a selective chemical conversion of unmethylated cytosines to uracil is con¬ ducted (bisulfite treatment; for review: European Patent Application 103 47 400.5, filing date: Oct. 9th 2003, ap- plicant: Epigenomics AG) . In a second step the enzymati- cally or chemically pretreated DNA is amplified and ana¬ lyzed in different ways (for review: Fraga and Esteller: DNA methylation: a profile of methods and applications. Biotechniques. 2002 Sep;33 (3) :632, 634, 636-49; WO 02/072880 pp. 1 ff) .
A particularly important application of methylation analysis is the cancer diagnosis out of bodily fluids. Cancer cell DNA in bodily fluids has the property to be uniformly methylated over stretches of several 100 base pairs, while DNA of normal cells like blood shows a ran- dom mosaic methylation. However, a reliable diagnosis by detecting specially methylated cytosines in body fluids is difficult, because very small amounts of aberrant me¬ thylation patterns have to be found within a large amount of background DNA, which is methylated differently, but which has the same base sequence.
The methods known in the state of the art meet these re¬ quirements only to a certain extend. For sensitive detec¬ tion the DNA is usually bisulfite treated and subse- quently amplified in a methylation specific way by using either methylation specific primer or blocker oligonu¬ cleotides. The use of methylation specific primers is known as "MSP" (Herman et al . : Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A. 1996 Sep 3 ; 93 (18) ':9821-6) . The application of methylation specific blockers is known as "Heavy Methyl" (WO 02/072880; Cottrell et al . A real-time PCR assay for DNA-methylation using methylation-specific blockers. Nucl . Acids. Res. 2004 32: elO) . Both methods can be used as a real time PCR (,,MethyLight"
WO00/70090; US 6,331,393; Trinh et al. : DNA methylation analysis by MethyLight technology. Methods. 2001 Dec;25 (4) :456-62) .
However, the applicability of these methods for the sen- sitive and specific detection of methylated DNA is lim¬ ited. Due to the fact that an unspecific amplification of the background DNA would cause false positive results, it is necessary to increase the specificity of the amplifi¬ cation by using primer or blocker sequences which contain several methylation specific positions. In return, only those sequences can be analysed that comprise several CpG position. In addition, these positions have to be co- methylated.
Due to these restrictions and due to the great importance of cytosine methylation there is a special technical need for methods enabling a high performance methylation analysis. In the following such a method is described.
The present invention allows a sensitive and specific de¬ tection of cytosine methylation. Herein the chemically converted DNA is amplified using specially designed oli¬ gonucleotides. Firstly, the oligonucleotides carry a me¬ thylation specific nucleotide at the 3' end. Conse- quently, a mismatch free binding of the oligonucleotides only takes place with the DNA of a defined methylation status. In contrast, the DNA of the of the opposite me¬ thylation status forms a mismatch with the 3' end of the oligonucleotides. Secondly, the nucleotide at the 3' end of the oligonucleotides is chemically modified in a way that the extension of the oligonucleotides is blocked. In case of mismatch binding, however, the blocker nucleo- tide is removed by the exonuclease activity of the DNA polymerase. Subsequently, an extension of the oligonu¬ cleotide can occur. In contrast, the blocked 3' ends of the matched oligonucleotides are not digested. As a re- suit an extension cannot take place. In this way it is possible to selectively amplify DNA of a certain methyla- tion state while the amplification of the background DNA is inhibited. This method allows a very sensitive and specific methylation analysis.
At the same time the scope of the present invention is different than that of the already known "MSP"- and "Heavy Methyl" methods which require comethylation of several adjacent CpG position for achieving sufficient sensitivity. Here only 1 or 2 methylation specific posi¬ tions in the sequences to be analysed are targeted in a very focused manner.
A similiar method for the detection of mutations is al- ready described as ,,PAP" (pyrophosphorolysis-activated polymerization; e.g. : Liu and Sommer: Pyrophosphorolysis- activatable oligonucleotides may facilitate detection of rare alleles, mutation scanning and analysis of chromatin structures. Nucleic Acids Res. 2002 Jan 15;30 (2) :598-604 m.w.N. ; Liu and Sommer: Detection of extremely rare al¬ leles by bidirectional pyrophosphorolysis-activated po¬ lymerization allele-specific amplification (Bi-PAP-A) : measurement of mutation load in mammalian tissues. Bio- techniques. 2004 Jan;36 (1) :156-66 with further refer- ences. ; US Patent Application 20040009515; US Patent 6,534,269) . The use of a special embodiment of the PAP technology, the litigation-mediated PAP (LM-PAP) for methylation analysis is mentioned in the US patent application 20040009515 (paragraph 0048 and 0179) . However, the method described therein involves using methylation spe¬ cific restriction enzymes. Therefore the applicability of this method is limited to certain sequences containing recognition sites of the restriction enzymes.
Here the combination of bisulfite conversion and PAP is described for the first time. This combination allows a sensitive and specific detection of cytosine methylation without the sequence dependency of LM-PAP. Since specific CpG positions are targeted rather than comethylated ar- eas, the design of PAP-based methylation assays is compa¬ rably straightforward. The described method can be imple¬ mented to be highly sensitive to the methylation state of individual cytosines as opposed to the co-methylation re¬ quirement of MSP and Heavy Methyl. On the other hand, the described invention is also flexible enough to be adapt¬ able to situations, were the detection of co-methylation is required. Due to the great importance of cytosine me¬ thylation and due to the above mentioned disadvantages in the prior art the present invention marks a significant technical progress.
Description
The present invention provides a novel method for the analysis of cytosine methylation in DNA. The invention is characterised in that the following steps are conducted: a) a genomic DNA sample is chemically or enzymatically treated in such a way that all of the unmethylated cytosine bases are converted to uracil or another base which is dissimilar to cytosine in terms of base pairing behaviour, while the 5-methylcytosine bases remain unchanged, b) at least one methylation specific oligonucleotide carrying a non-extendable 3' end is annealed to the converted DNA, c) the non-extendable 3' terminus of the oligonucleo¬ tide is removed in case the oligonucleotide is bound to the DNA with the methylation status to be detected, d) the unblocked oligonucleotide is extended, e) the methylation status is concluded from the ab¬ sence or presence of an extended oligonucleotide product .
In the first step of the present invention a genomic DNA sample is chemically treated in such a way that all of the unmethylated cytosine bases are converted to uracil, or another base which is dissimilar to cytosine in terms of base pairing behaviour, while the 5-methylcytosine bases remain unchanged. Depending on the diagnostic or scientific question to be analysed the genomic DNA sample can be obtained from various sources, e.g. from cell lines, biopsies or tissue embedded in paraffin. According to the above mentioned advantages it is particularly pre¬ ferred to analyse bodily fluids like plasma, serum, stool or urine. The genomic DNA is isolated by standard meth¬ ods, as found in references such as Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, CSH
Press, 2nd edition, 1989: Isolation of genomic DNA from mammalian cells, Protocol I, p. 9.16 - 9.19 and in the commonly used QIAamp DNA mini kit protocol by Qiagen. The conversion of unmethylated, but not methylated, cytosine bases within the DNA sample is conducted with a convert¬ ing agent, preferably a bisulfite such as disulfite or hydrogen sulfite. The reaction is performed according to standard procedures (e.g. : Frommer et al. : A genomic se¬ quencing protocol that yields a positive display of 5- methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A. 1992 Mar 1;89 (5) :1827-31; Olek, A modified and improved method for bisulphite based cyto¬ sine methylation analysis. Nucleic Acids Res. 1996 Dec 15;24 (24) :5064-6. ; DE 100 29 915; DE 100 54 317) . In a preferred embodiment, the conversion is conducted in presence of a reagent that denatures the DNA duplex and of a radical scavenger (DE 100 29 915; German patent ap¬ plications 10347397.1; 10347396.3; 10347400.5; 10347399.8; filing date: Oct. 9 2003, applicant: Epige- nomics AG) . It is also possible to conduct the conversion enzymatically, e.g., by use of methylation specific cytidine deaminases (German patent application 103 31 107.6, filing date: July 4 2003, applicant: Epigenomics AG) .
In the second step of the present invention at least one methylation specific oligonucleotide carrying a non- extendable 3' end is annealed to the converted DNA. A me¬ thylation specific oligonucleotide is an oligonucleotide hybridising specifically to chemically or enzymatically converted DNA which was prior to the conversion either methylated or unmethylated. As a consequence, e.g., of the bisulfite conversion unmethylated cytosine are trans- ferred into uracil, while methylated cytosines remain un¬ changed. Thus, the converted DNA contains at a specific methylation position either a C (methylated cytosine) or an T/U (unmethylated DNA, first strand) or an A (unmethy- lated, opposing strand) . Therefore, a methylation spe¬ cific oligonucleotide contains at least one methylation specific C, T or A nucleotide, i.e. an nucleotide corre¬ sponding either to a methylated or unmethylated cytosine in the original, unconverted DNA.
In one preferred embodiment of the present invention the oligonucleotide is extended in case it is bound without a mismatch to the DNA to be detected. In this embodiment the 3" end of the methylation specific oligonucleotide contains at least one C nucleotide or one methylation specific T or A nucleotide. The methylation specific nu¬ cleotide allows a mismatch free binding of the oligonu¬ cleotide to the DNA to be detected. In contrast, hybridi¬ zation to the background DNA only takes place under mis- match formation. The methylation specific dinucleotide is located at the 3' terminus. The specificity of the ampli¬ fication is also affected by other factors. The influence of the length, the structure and design of the oligonu¬ cleotide, of the sequence to be detected, of the reaction compounds and the reaction conditions to the specificity of the PAP reaction is described in detail elsewhere (US Patent Application 20040009515, incorporated by refer¬ ence) . The methylation specific oligonucleotide carries a non- extendable 3' end being activatable by pyrophosphoroly- sis. The non-extendible 31 terminus is a nucleotide or nucleotide analogue which has the capacity to form a Wat- son-Crick base pair with a complementary nucleotide and which lacks a 3 ' OH capable of being extended by a nu¬ cleic acid polymerase. In one embodiment, the non- extendible 3 ' terminus may be a non-extendible 3 ' de- oxynucleotide, such as a dideoxynucleotide. In a second embodiment, the non-extendible 3' terminus may be a chemically modified nucleotide lacking the 3 ' hydroxyl group, such as an acyclonucleotide. Acyclonucleotides substitute a 2-hydroxyethoxymethyl group for the 2'- deoxyribofuranosyl sugar normally present in dNMPs. In other embodiments, the non-extendible 3' terminus may be other blockers as described elsewhere (US Patent Applica¬ tion 20040009515, incorporated by reference) . Examples of a non-extendible 3' termini include, but are not limited to, a 2 ' 3 ' -dideoxynucleotide, 3 ' -deoxyadenosine (cordy- cepin) , 3 ' -azido-3 ' -deoxythymidine (AZT) , 2 ' , 3 ' -dideoxy- inosine (ddl) , 2 • , 3 ' -dideoxy-3 ' -thiacytidine (3TC) and 2 ' , 3 ' -didehydro-2 ' , 3 ' -dide- oxythymidine (d4T) .
In another preferred embodiment of the present invention the oligonucleotide is extended only in case it is bound with a mismatch to the DNA to be detected. In this em¬ bodiment the 3' end of the methylation specific oligonu¬ cleotide contains at least one non-extendible C nucleo¬ tide or one methylation specific T or A nucleotide. The methylation specific nucleotide forms a mismatch with the DNA to be detected. In contrast, hybridization to the background DNA takes place without mismatch formation. The methylation specific dinucleotide is located at the 3" terminus.
In the third step of the present invention the non- extendable 3' terminus of the oligonucleotide is removed in case the oligonucleotide is bound to the DNA with the methylation status to be detected. The 3' end of the oli¬ gonucleotides is activatable by pyrophosphorolysis. This means that the blocked 3' end can be removed by an enzyme that has pyrophosphorolysis activity in the presence of pyrophosphate (PP. sub. i) generating a nucleotide triphos¬ phate. This activation specifically takes place when the 3' end of the oligonucleotide is bound to the DNA without mismatch, which means only the DNA of a certain methyla¬ tion status will be activated.
In a preferred embodiment DNA polymerases are used to ac¬ tivate the 3' termini of the oligonucleotides. Preferred DNA polymerases having pyrophosphorolysis activity are thermostable TfI, Taq, and genetically engineered DNA po¬ lymerases, such as AmpliTaqFs and ThermoSequenase.TM.. These genetically engineered DNA polymerases have the mu¬ tation F667Y or an equivalent mutation in their active sites. The use of genetically engineered DNA polymerases, such as AmpliTaqFs and ThermoSequenase.TM. , greatly im¬ proves the efficiency of PAP (Liu and Sommer 2002, loc cit) . These Family I DNA polymerases can be used when the activatable oligonucleotide is a 3 ' dideoxynucleotide or an acyclonucleotide. When the activatable oligonucleotide is an acyclonucleotide, Family II archaeon DNA poly¬ merases can also be used. Examples of such polymerases include, but are not limited to, Vent (exo-) and Pfu (exo-) . These polymerases efficiently amplify 3' acyclonucleotide blocked Oligonucleotides. Two or more polymerases can also be used in one reaction.
The activation of the 3' end of the oligonucleotide may also occur by another mechanism, such as a 3 ' exonucle- ase.
Other enzymes usable for the activation of the oligonu- cleotide (e.g. helicases, topoisomerases, telomerases) are described in detail elsewhere (US patent application 20040009515, incorporated by reference) .
In the fourth step of the invention the unblocked oli¬ gonucleotide is extended. The extension is preferably conducted by a nucleic acid polymerase in the presence of nucleoside triphosphates (see above, US patent applica¬ tion 20040009515, incorporated by reference) .
In the fifth step of the present invention the methyla- tion status is concluded form the absence or presence of an extended oligonucleotide product. In one embodiment, the detection of the nucleic acid is performed by detect- ing the unblocking of oligonucleotide, e.g. by detecting the loss of a label contained in the 3 ' terminal residue of the oligonucleotide. In a second aspect, the unblock¬ ing is detected by detecting the presence of a 3 ' OH on the 3 ' terminal residue that is capable of extension or ligation. In this aspect, the detection is determined by extending the unblocked oligonucleotide or by ligating the unblocked oligonucleotide to a further oligonucleo¬ tide. In a second embodiment, the detection of the nu- cleic acid is performed by detecting the extended oli¬ gonucleotide, e.g. by means of an incorporated labelled nucleotide. In a second aspect, the extended oligonucleo¬ tide is detected by gel electrophoresis. In a third as- pect, the extended oligonucleotide is detected by the binding or incorporation of a dye or spectral material . The person skilled in the art knows further methods for the detection of the extended oligonucleotide. In a par¬ ticularly preferred embodiment real time probes are used to detect the presence of the extension product. Several versions of real time probes are known, e.g. Lightcycler, Taqman, Scorpio, Sunrise, Molecular Beacon or Eclipse probes. Details concerning structure or detection of these probes are known in the state of the art (e.g. US Patent 6,331,393 with further references) . For example Taqman probes can be designed by the ,,PrimerExpress" Software (Applied Biosystems) .
In a preferred embodiment of the present invention, the PAP method described above can be performed bidirection- ally (Bi-PAP) . Bi-PAP uses two opposing pyrophosphoroly- sis activatable oligonucleotides with one nucleotide overlap at their 3' termini. Thus, in Bi-PAP, PAP is per¬ formed with a pair of opposing activatable oligonucleo- tides. Both the downstream and upstream oligonucleotides are specific for the nucleotide of interest at the 3 ' termini (e.g., an C:G base pair) . In the initial round of amplification segments of undefined size are generated. In subsequent rounds, a segment equal to the combined lengths of the oligonucleotides minus one is amplified exponentially. Nonspecific amplification occurs at lower frequencies because this design eliminates misincorpora- tion error from an unblocked upstream. The oligonucleo¬ tides may be 30-60 nucleotides for most efficient ampli¬ fication (US patent application 20040009515, incorporated by reference) .
Amplification by the PAP method can be linear or exponen¬ tial. Linear amplification is obtained when the activat- able oligonucleotide is the only complementary oligonu¬ cleotide used. Exponential amplification is obtained when a second opposing oligonucleotide, which may be a second activatable oligonucleotide, is present that is comple¬ mentary to the desired nucleic acid strand. The activat¬ able oligonucleotide and the second oligonucleotide flank the region that is targeted for amplification. The second oligonucleotide anneals to the separated desired nucleic acid strand product. Subsequently polymerization extends the second oligonucleotide on the desired nucleic acid strand to synthesize a copy of the nucleic acid template strand. Afterwards the synthesized nucleic acid template strand is separated from the desired nucleic acid strand.
By repeating the above mentioned steps an exponential am¬ plification can be achieved.
In a particular preferred embodiment the methylation analysis is conducted with two methylation specific oli¬ gonucleotides in combination with a methylation specific real time probe system.
The present invention also includes other modifications of PAP which are, e.g., described in detail in the US patent application 20040009515 (incorporated by refer¬ ence) . These modifications are - as far as they are ap- plicable for analysis of bisulfite treated DNA - part of this invention.
The US patent application discloses ways of performing a massively parallel analysis of DNA by using microarrays . A methylation analysis by using these high throughput methods is also part of the present invention, as far as said methods are applicable for bisulfite treated DNA.
The methods disclosed here are preferably used for the diagnosis and/or prognosis of adverse events for patients or individuals, whereby these adverse events belong to at least one of the following categories: undesired drug in¬ teractions, cancer diseases, CNS malfunctions, damage or disease, symptoms of aggression or behavioural distur¬ bances; clinical, psychological and social consequences of brain damage, psychotic disturbances and personality disorders, dementia and/or associated syndromes, cardio¬ vascular disease, malfunction and damage, malfunction, damage or disease of the gastrointestinal tract, malfunc¬ tion, damage or disease of the respiratory system, le¬ sion, inflammation, infection, immunity and/or convales¬ cence, malfunction, damage or disease of the body as an abnormality in the development process, malfunction, dam- age or disease of the skin, of the muscles, of the con¬ nective tissue or of the bones, endocrine and metabolic malfunction, damage or disease, headaches or sexual mal¬ function This new method also serves in a particularly preferred manner for distinguishing cell types and tis- sues or for investigating cell differentiation. "Part of the present invention is also a kit, which con¬ sists of methylation specific activatable oligonucleo¬ tides and optionally contains a polymerase, probes for the detection of the amplificate and/or a bisulfite re- agent.
Examples
Example 1 : Selective amplification of unmethylated con- nexin 26 fragments with 3"amino modified oligonucleotides using polymerases with proofreading activity.
The LightCycler (Roche) is a device for conducting PCR and simultaneous detection and analysis of the PCR prod- ucts. The device was modified according to the manufac¬ turer' s instructions using SybrGreen for the detection of dsDNA. The quantitative and qualitative analyses of the PCR were conducted with LightCycler Software Version 3.5. The connexin 26 fragment (accession number AF 144321.1 , nt 748-905) was amplified from bisulfite treated methy¬ lated and unmethylated DNA.
The selective amplification of the unmethylated connexin 26 gene fragment was conducted in 20 μl of reaction vol- ume ( 5 U of Pful polymerase (Stratgen) ; Ix Pful reaction buffer (Stratgene) , 2mM MgCl2, 200 μM of each dNTP, 300 nM of each oligonucleotide, 3"modified by C3-amino resi¬ due (oligonucleotide FlC- 3NH,GGTATATTGTTGAAAGTAATTGAATAAAATC-NH2, SEQ ID 1 ; oli- gonucleotide R1G-3NH, AAACAATACCCTCTAAAATAAAAATTAACG-NH2, SEQ ID 2) , 0.25 μg/μl BSA (Sigma, Munich) , 0.25 μl of 1:1000 dilution of SybrGreen (Molecular Dynamics) , Ing of template DNA) with the following cycler program: 95°C - 10 min; 50 cycles: denaturation 96°C -10 s, annealing
560C - 30 s; extension 720C - 10 s. Detection was con¬ ducted at each amplification cycle by SybrGreen in the extension step after 10 s. The connexin 26-PCR fragment was detected monitoring the Fl channel
(GGtAtATTGTTGAAAGTAATTGAATAAAATTGGAAATTTGAGAAGGTGTTTGTTTG GATTGGTGAGATTTTGAGGGGAGAAAGAAGTGGGGAtTTTGtTGGtAttAGTGGTGt ttttTttTTGGttAtTGTTAAtttttATTttAGAGGGtAtTGttt; Seq ID 3) . Due to the identical base pair behavior of uracile and thymine the positions which correspond to the converted, originally unmethylated, cytosines are marked with a small "t" (resp. small λXa" in. the complementary strand) . In contrast, capital "T" (resp. "A") describe thymines already existing prior to bisulfite treatment.
The amplification of the connexin fragment was investi¬ gated on Ing methylated and unmethylated bisulfite treated DNA. Only with unmethylated DNA or mixtures of unmethylated and methylated bisulfite treated template DNA a amplification product was generated in the real time PCR. The melting point of the product was identical to that obtained with the unmodified primers (primerF2-T, GGTATATTGTTGAAAGTAATTGAATAAAATT; SEQ ID 4; primer R2-A AAACAATACCCTCTAAAATAAAAATTAACA, SEQ ID 5) with unmethy¬ lated bisulfite treated template DNA . The oligonucleo¬ tide F1C-3NH and R1-G-3NH will not be extended by poly¬ merase without proofreading activity. Pful shows 3"- 5'exonuclease proofreading activity on primers that do not match at their 3'position with the template. The oli¬ gonucleotides F1C-3NH and R1-G-3NH show such mismatches with unmethylated bisulfite treated template and there- fore the 3'-base, including the amino modification is re¬ moved. Subsequently, the remaining primer, shortened by- one nucleotide acts as a primer for the PCR. Therefore, only the unmethylated connexin fragment is amplified.
Example 2 : Selective amplification of methylated connexin 26 fragments with 3' modified oligonucleotide using pyro- phosphorolysis-activated exonuclease activity of poly- merases.
The LightCycler (Roche) is a device for conducting PCR and simultaneous detection and analysis of the PCR prod¬ ucts. The device was modified according to the manufac- turer's instructions using SybrGreen for the detection of dsDNA. The quantitative and qualitative analyses of the PCR were conducted with LightCycler Software Version 3.5. The connexin 26 fragment (accession number AF 144321.1 , nt 748-905) was amplified from bisulfite treated methy- lated and unmethylated DNA.
The selective amplification of methylated connexin 26 gene fragments was conducted in 20 μl of reaction volume (5 U of FastStart Taq polymerase (Roche, Penzberg) ; Ix FastStart reaction buffer (Roche, Penzberg) , 300 nM of each oligonucleotide, 3'modified by C3-amino residue (oligonucleotide FlC-ddC, GGTATATTGTTGAAAGTAATTGAATAAAAT- ddC, SEQ ID 6; oligonucleotide RlG-A, AAACAATACCCTCTAAAATAAAAATTAACddg, SEQ ID 7) , 0.25 μg/μl BSA (Sigma, Munich) , 300 μM Na4P2O7 (Fluka) , 0.25 μl of
1:1000 dilution of SybrGreen (Molecular Dynamics), Ing of template DNA) with the following cycler program: 950C - 10 min; 50 cycles: denaturation 960C -10 s, annealing 56°C - 30 s; extension 720C - 10 s. Detection was con¬ ducted at each amplification cycle by SybrGreen in the extension step after 10 s. The connexin 26-PCR fragment was detected monitoring the Fl channel
(GGtAtATTGTTGAAAGTAATTGAATAAAATCGGAAATTCGAGAAGGCGTTCGTTCG GATTGGTGAGATTTTGAGGGGAGAAAGAAGCGGGGAtTTCGtCGGtAttAGCGGCGt ttttTttTCGGttAtCGTTAAtttttATTttAGAGGGtAtTGttt; SEQ ID 8) . The amplification of the connexin fragment was investi- gated on Ing methylated and unmethylated bisulfite treated DNA. Only with methylated DNA or mixtures of me¬ thylated and unmethylated bisulfite treated template DNA a exponential amplification of connexin was found in the real time PCR. The melting point of the product was iden- tical to that obtained with the unmodified primers
(primerF2-T, GGTATATTGTTGAAAGTAATTGAATAAAATC, SEQ ID 9; primer R2-A AAACAATACCCTCTAAAATAAAAATTAACG, SEQ ID 10) with methylated bisulfite treated template DNA.
The oligonucleotide FlC-ddC will not be extended by Fast- StartTaq polymerase without PPi in the PCR reaction. How¬ ever, under PCR condition with 300 μM PPi the ddC- modified oligonucleotide gets activated by pyrophosphoro- lysis if the oligonucleotide matches at its 3^position with the template. The primer FlC-ddC matches to the me¬ thylated bisulfite treated template and therefore, the 3"-didesoxynucleotide is removed. Subsequently, the re¬ maining oligonucleotide, shortened by one nucleotide, acts as a primer for the PCR. Therefore, only the methy- lated connexin fragment is exponentially amplified. Example 3 : Preferred amplification of non methylated bi¬ sulfite treated DNA in contrast to methylated DNA
Human genomic lymphocyte DNA methylated with Sssl methyl- transferase (Chemicon) and human genomic lymphocyte DNA were bisulfite treated as described above. PCRs of a con- nexin promoter fragment (Accession number AL138688.27.1.127794; nt 119055 to ntll9197) was per¬ formed on a Lightcycler device (Roche Diagnostics) in a total volume of 20μl using Ing methylated bisulfite DNA and 1 ng unmethylated bisulfite DNA, respectively. The cycling condition were 2 min 95 C and 50 cycles of dena- turation 95°C 10s, annealing 56°C 30s and extension 72°C 30s. The SybrGreen fluorescence was monitored in each cy- cle after the extension step.
The PCR conditions were as follows:
PCR A
0.6 μM forward primer (GGTATATTGTTGAAAGTAATTGAATAAAAT) (Seq ID 11), 0.3 reverse primer
(AAACAATACCCTCTAAAATAAAAATTAAC) (Seq ID 12) , 0,25 mg/ml bovine serum albumin, 0.2 mM dNTPs each, 2 U PfuTurbo Cx polymerase, Ix PfuTurbo reaction buffer, 3.5 mM MgCl2,
Sybrgreen 1:80000
PCR B
0.6 μM forward primer (GGTATATTGTTGAAAGTAATTGAATAAAAT- ddC) (Seq ID 11) ; 0.3 reverse primer
(AAACAATACCCTCTAAAATAAAAATTAAC) (Seq ID 12) , 0,25 mg/ml bovine serum albumin, 0.2 mM dNTPs each, 2 U PfuTurbo Cx polymerase, Ix PfuTurbo reaction buffer, 3.5 mM MgCl2,
Sybrgreen 1:80000
PCR C 0.6 μM forward primer (GGTATATTGTTGAAAGTAATTGAATAAAATC- 3NH) (Seq ID 13) ; 0.3 reverse primer (AAACAATACCCTCTAAAATAAAAATTAAC) (Seq ID 12) , 0,25 mg/ml bovine serum albumin, 0.2 mM dNTPs each, 2 U PfuTurbo Cx polymerase, Ix PfuTurbo reaction buffer, 3.5 mM MgCl2, Sybrgreen 1:80000
Methylated and unmethylated bisulfite DNA were amplified with the same efficiency when PCR was performed according condition PCR A. In contrast, non methylated bisulfite DNA was more efficiently amplified thn methylated bisul- fite DNA using the ddC or amino 3'modified primer (PCR B, PCR C conditions) . The differences of the cycle thresholds are shown in table 1.
Table 1: Cycle threshold differences of methylated and unmethylated template DNA amplified by different PCR con¬ ditions
PCR condition 3"modification ΔCt of forward primer
(Ct methyl. - Ct unmethy. DNA)
A no -1.3
B ddC 7.8
C NH2 6.2
PCR with DNA polymerase lacking proof reading activity failed to amplify the connexine promoter fragment with the ddC or NH2 modified forward primer (data not shown) .
Sequence
Genomic sequence: 158bp
Gggcagtgccctctggaatgggggttaacggtggccgaggagggggcgccgctggtg ccggcgaagtccccgcttctttctcccctcaaaatctcaccaatccgaacgaacgcc ttctcgaatttccgattttattcaattactttcaacaatgtgcc (Seq ID 14) Bisulfite converted sequence
Gggtagtgttttttggaatgggggttaacggtggtcgaggagggggcgtcgttggtg tcggcgaagttttcgtttttttttttttttaaaattttattaattcgaacgaacgtt ttttcgaattttcgattttatttaattatttttaataatgtgtt (Seq ID 15)

Claims

Claims
1) Method for the analysis of cytosine methylation in DNA, characterised in that the following steps are conducted: a) a genomic DNA sample is chemically or enzymati- cally treated in such a way that all of the unmethy- lated cytosine bases are converted to uracil or an¬ other base which is dissimilar to cytosine in terms of base pairing behaviour, while the 5-methylcytosine bases remain unchanged, b) at least one methylation specific oligonucleo¬ tide carrying a non-extendable 3' end is annealed to the converted DNA, c) the non-extendable 3' terminus of the oligonu¬ cleotide is removed in case the oligonucleotide is bound to the DNA with the methylation status to be detected, d) the unblocked oligonucleotide is extended, e) the methylation status is concluded from the absence or presence of an extended oligonucleotide product.
2) A method according to claim 1, wherein the non- extendable 3' terminus of the oligonucleotide is me¬ thylation specific.
3) A method according to one of the preceding claims, further characterized in that the 3 'non-extendable terminus of the oligonucleotide is a nucleotide or nucleotide analogue which cannot be extended by a nu¬ cleic acid polymerase, but which can be removed by pyrophosphorolysis.
4) A method according to claim 3, further characterized in that the nucleotide or nucleotide analogue is se- lected from the group consisting of a 3 'deoxynucleotide, a 2 ' , 3 ' -dideoxynucleotide, an acyclonucleotide, 3 ' -deoxyadenosine (cordycepin) , 3'- azido-3 ' -deoxythymidine (AZT) , 2 ' , 3 ' -dideoxyinosine (ddl) , 2' ,3' -dideoxy-3 ' -thiacytidine (3TC) and 2 ' ,3'- didehydro-2 ' , 3 ' -dide- oxythymidine (d4T) .
5) A method according to one of the preceding claims, further characterized in that the removal in step c) is performed with a DNA polymerase.
6) A method according to one of the preceding claims, further characterized in that the extension in step d) is performed with a DNA polymerase.
7) A method according to one of the preceding claims, further characterized in that in step e) the presence of an extended oligonucleotide product is detected by a label introduced by a nucleotide or nucleotide a- nalogue present in the extension step.
8) A method according to one of the preceding claims, further characterized in that in step e) the presence of an extended oligonucleotide product is detected by the binding or incorporation of a dye or spectral ma¬ terial .
9) A method according to claim 8, further characterized in that in step e) the presence of an extended oli- gonucleotide product is detected by real time probes.
10) A method according to one of the preceding claims, further characterized in that the steps b) to d) are performed bidirectionally. 11) A method according to one of the preceding claims, further characterized in that a exponential amplifi¬ cation is performed by repeating the steps b) to d) for several times.
12) Use of a method according to one of the preceding claims for the diagnosis and/or prognosis of adverse events for patients or individuals, whereby these ad¬ verse events belong to at least one of the following categories: undesired drug interactions, cancer dis¬ eases, CNS malfunctions, damage or disease, symptoms of aggression or behavioural disturbances; clinical, psychological and social consequences of brain dam¬ age, psychotic disturbances and personality disor- ders, dementia and/or associated syndromes, cardio¬ vascular disease, malfunction and damage, malfunc¬ tion, damage or disease of the gastrointestinal tract, malfunction, damage or disease of the respira¬ tory system, lesion, inflammation, infection, immu- nity and/or convalescence, malfunction, damage or disease of the body as an abnormality in the develop¬ ment process, malfunction, damage or disease of the skin, of the muscles, of the connective tissue or of the bones, endocrine and metabolic malfunction, dam- age or disease, headaches or sexual malfunction.
13) Use of a method according to one of the preceding claims for predicting undesired drug effects, distin¬ guishing cell types or tissues or for investigating cell differentiation.
14) A kit, which consists of methylation specific acti- vatable oligonucleotides and optionally contains a polymerase, probes for the detection of the amplifi- cate and/or a bisulfite reagent.
PCT/EP2005/008792 2004-08-19 2005-08-09 Method for the analysis of methylated dna Ceased WO2006018243A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/660,804 US20070254293A1 (en) 2004-08-19 2005-08-09 Method for the Analysis of Methylated Dna

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP04090321.3 2004-08-19
EP04090321A EP1627924B1 (en) 2004-08-19 2004-08-19 Method for the analysis of methylated DNA

Publications (1)

Publication Number Publication Date
WO2006018243A1 true WO2006018243A1 (en) 2006-02-23

Family

ID=34928817

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2005/008792 Ceased WO2006018243A1 (en) 2004-08-19 2005-08-09 Method for the analysis of methylated dna

Country Status (5)

Country Link
US (1) US20070254293A1 (en)
EP (1) EP1627924B1 (en)
AT (1) ATE504661T1 (en)
DE (1) DE602004032126D1 (en)
WO (1) WO2006018243A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2189538A1 (en) * 2008-11-21 2010-05-26 Epigenomics AG An analysis molecule and method for the analysis of a nucleotide position in a nucleic acid
KR20150089987A (en) * 2013-04-01 2015-08-05 (주)지노믹트리 Method for Amplification Nucleic Acid Using Aelle-Specific Reaction Primers

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6947464B2 (en) 2018-07-19 2021-10-13 バイオフィデリティ・リミテッド Improved polynucleotide sequence detection method
GB201919186D0 (en) 2019-12-23 2020-02-05 Biofidelity Ltd Simplified polynucleotide sequence detection method
GB201919235D0 (en) * 2019-12-23 2020-02-05 Biofidelity Ltd Methylation detection method
WO2025124705A1 (en) * 2023-12-13 2025-06-19 Universität Konstanz Dna polymerases for the detection of epigenetic dna marks

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5786146A (en) * 1996-06-03 1998-07-28 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US20030082600A1 (en) * 2001-03-09 2003-05-01 Alexander Olek Highly sensitive method for the detection of cytosine methylation patters
US20040009515A1 (en) * 2000-02-23 2004-01-15 Qiang Liu Pyrophosphorolysis activated polymerization (PAP)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPR050700A0 (en) * 2000-10-03 2000-10-26 Id+Plus Ltd Detection method

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5786146A (en) * 1996-06-03 1998-07-28 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US20040009515A1 (en) * 2000-02-23 2004-01-15 Qiang Liu Pyrophosphorolysis activated polymerization (PAP)
US20030082600A1 (en) * 2001-03-09 2003-05-01 Alexander Olek Highly sensitive method for the detection of cytosine methylation patters

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FRAGA M F ET AL: "DNA METHYLATION: A PROFILE OF METHODS AND APPLICATIONS", BIOTECHNIQUES, EATON PUBLISHING, NATICK, US, vol. 33, no. 3, September 2002 (2002-09-01), pages 632,634,636 - 649, XP001107174, ISSN: 0736-6205 *
HERMAN J G ET AL: "METHYLATION-SPECIFIC PCR: A NOVEL PCR ASSAY FOR METHYLATION STATUS OF CPG ISLANDS", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 93, 1 September 1996 (1996-09-01), pages 9821 - 9826, XP002910406, ISSN: 0027-8424 *
LIU QIANG ET AL: "Detection of extremely rare alleles by bidirectional pyrophosphorolysis-activated polymerization allele-specific amplification (Bi-PAP-A): measurement of mutation load in mammalian tissues.", BIOTECHNIQUES. JAN 2004, vol. 36, no. 1, January 2004 (2004-01-01), pages 156 - 166, XP001207019, ISSN: 0736-6205 *
LIU QIANG ET AL: "Pyrophosphorolysis-activatable oligonucleotides may facilitate detection of rare alleles, mutation scanning and analysis of chromatin structures.", NUCLEIC ACIDS RESEARCH. 15 JAN 2002, vol. 30, no. 2, 15 January 2002 (2002-01-15), pages 598 - 604, XP002336292, ISSN: 1362-4962 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2189538A1 (en) * 2008-11-21 2010-05-26 Epigenomics AG An analysis molecule and method for the analysis of a nucleotide position in a nucleic acid
KR20150089987A (en) * 2013-04-01 2015-08-05 (주)지노믹트리 Method for Amplification Nucleic Acid Using Aelle-Specific Reaction Primers
KR101557975B1 (en) * 2013-04-01 2015-10-15 (주)지노믹트리 Method for Amplification Nucleic Acid Using Aelle-Specific Reaction Primers
KR101600039B1 (en) * 2013-04-01 2016-03-08 (주)지노믹트리 Method for Amplification Nucleic Acid Using Aelle-Specific Reaction Primers

Also Published As

Publication number Publication date
US20070254293A1 (en) 2007-11-01
EP1627924A1 (en) 2006-02-22
DE602004032126D1 (en) 2011-05-19
EP1627924B1 (en) 2011-04-06
ATE504661T1 (en) 2011-04-15

Similar Documents

Publication Publication Date Title
EP1322782B1 (en) Method of nucleic acid typing or sequencing
EP0843735B2 (en) Glycosylase mediated detection of known nucleotide sequences
JP2807202B2 (en) Highly sensitive nucleic acid detection method
CN101370945B (en) Methods for identifying multiple DNA alteration markers in a large background of wild-type DNA
AU2329497A (en) Target nucleic acid sequence amplification
JP2005523700A (en) Amplification of DNA to produce a single-stranded product of a given sequence and length
WO2015083001A2 (en) Nucleic acid probe and method of detecting genomic fragments
WO2007083766A1 (en) Method for detecting nucleic acid sequence using intramolecular probe
KR20080005188A (en) Screening Probe Amplification
JP2005518216A (en) Melting temperature dependent DNA amplification
CN101932731A (en) Amplification of bisulfite nucleic acids
CA2485596A1 (en) Pyrophosphorolysis activated polymerization (pap)
WO2006018243A1 (en) Method for the analysis of methylated dna
US5599696A (en) Method of preparing nucleic acids having an undefined nucleotide sequence amplification
WO2004001015A2 (en) Method for sequencing nucleic acids
EP1590484B1 (en) Method for the detection of cytosine methylation patterns with high sensitivity
JP4601830B2 (en) Coupled polymerase chain reaction-restriction endonuclease digestion-ligase detection reaction method
US20070160991A1 (en) Method for the methylation analysis of dna
US20080286778A1 (en) Method for Investigating Cytosine Methylations in Dna
RU2858659C2 (en) Determination of methylation status
US20250346955A1 (en) Detection of methylation status
RU2264468C2 (en) Method for determination of nucleic acid molecule sequence characteristics via detection and characterization of said sequence variations
EP2143807A1 (en) Method for methylation-selective amplification
WO2025133584A1 (en) Tail sequence guided addition of adaptor
Yao et al. A quantitative DNA methylation assay using mismatch hybridization and chemiluminescence

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 11660804

Country of ref document: US

122 Ep: pct application non-entry in european phase
WWP Wipo information: published in national office

Ref document number: 11660804

Country of ref document: US