WO2006004914A2 - Systeme biologique de transfert de genes pour cellules eucaryotes - Google Patents

Systeme biologique de transfert de genes pour cellules eucaryotes Download PDF

Info

Publication number
WO2006004914A2
WO2006004914A2 PCT/US2005/023250 US2005023250W WO2006004914A2 WO 2006004914 A2 WO2006004914 A2 WO 2006004914A2 US 2005023250 W US2005023250 W US 2005023250W WO 2006004914 A2 WO2006004914 A2 WO 2006004914A2
Authority
WO
WIPO (PCT)
Prior art keywords
plasmid
bacteria
plant
transfer
agrobacterium
Prior art date
Application number
PCT/US2005/023250
Other languages
English (en)
Other versions
WO2006004914A3 (fr
Inventor
Richard A. Jefferson
Original Assignee
Cambia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/954,147 external-priority patent/US20050289672A1/en
Priority claimed from US10/953,392 external-priority patent/US20050289667A1/en
Application filed by Cambia filed Critical Cambia
Priority to BRPI0512791-2A priority Critical patent/BRPI0512791A/pt
Priority to EP05764395A priority patent/EP1781082A4/fr
Publication of WO2006004914A2 publication Critical patent/WO2006004914A2/fr
Publication of WO2006004914A3 publication Critical patent/WO2006004914A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector

Definitions

  • This invention relates generally to technologies for the transfer of nucleic acids molecules to eukaryotic cells and in particular technologies using non-pathogenic bacteria to transfer nucleic acid sequences to eukaryotic cells, e.g. to plant cells.
  • Physical methods for introducing DNA include particle bombardment, electroporation and direct DNA uptake by or injection into protoplasts. These methods - in their currently practiced forms - have substantial drawbacks.
  • the structure of the introduced DNAs tends to be complex and difficult to control, and the stresses associated with the introduction or the types of regeneration necessary to use these methods are often mutagenic.
  • the patent landscape around these methods varies dramatically, but none are unencumbered.
  • Agrobacterium tumefaciens is a common soil bacterium that naturally inserts some of its genes into plants and uses the machinery of plants to express those genes in the form of compounds that the bacterium uses as nutrients. In the process, some of the transferred genes also cause the formation of plant tumors commonly seen near the junction of the root and the stem, deriving from it the name of crown gall disease. The disease afflicts a great range of dicotyledonous plants (dicots), which constitute one of the major groups of flowering plants.
  • So-called disarmed strains of Agrobacterium are used for plant transformation, which have lost the capacity to form tumors and display a reduced pathogenesis phenotype on plants.
  • Agrobacterium-mediated transformation of plants has been widely used for transformation of plant cells.
  • Other shortcomings of using Agrobacterium include a limited host range, and it can only infect a limited number of cell types in that range. Of particular importance, whereas Agrobacterium can infect many dicots, monocotyledonous plants (monocots) are more resistant to infection. Monocotyledonous plants (monocots) however, constitute most of the important food crops in the world (e.g., rice, corn). Monocots are only able to be transformed by Agrobacterium under special conditions and using a special type of cell, the callus cells or other dedifferentiated tissue (e.g., United States Patent No. 5,591,616; No.
  • Agrobacterium is widely known as the only bacterial genus that has the capacity for trans-kingdom gene transfer. While some reports allegedly demonstrated that the tumor-inducing ability of Agrobacterium could be transferred to other related genera, including rhizobia (Klein and Klein, Arch Microbiol.66:220-22&, 1953; Kern, Arch. Microbiol. 52:325-344, 1965), the results were not uniformly repeatable nor was there any physical proof of gene transfer.
  • Hooykaas, Schilperoort and their colleagues in the mid to late 70' s reported that some bacterial species, Rhizobium trifolii and R. leguminosarum in particular, were capable of tumor formation on plants after introduction of a Ti plasmid from a virulent Agrobacterium (Hooykaas et al., Gen. Microbiol. 98:477-484, 1977; Hooykaas et al., Gen. Microbiol.
  • Rhizobium meliloti now called Sinorhizobium meliloti
  • van Veen et al. Plant-Microbe Interactions 1:231- 234, 1988
  • rhizobia Only very recently has a root-inducing Ri plasmid been found in environmental isolates of Ochrobactrium, Rhizobium, and Sinorhizobium from root mat-infected cucumber and tomatoes (Weller et al., Appl. and Environ. Microbiol.
  • a system for transforming eukaryotic cells comprises transformation competent bacteria that are non-pathogenic for plants and contain a first nucleic acid molecule comprising genes required for transfer and a second nucleic acid molecule comprising one or more sequences that enable transfer of a DNA sequence of interest
  • the genes required for transfer are vir genes of a Ti plasmid from Agrobacterium or homologues of vir genes, such as tra genes from plasmids like RK2 or RK4.
  • the sequence enabling transfer is a T-border sequence of a Ti plasmid from Agrobacterium.
  • the DNA sequence of interest is located between two T-border sequences.
  • the sequence enabling transfer is an ori ⁇ sequence from any mobilizable bacterial plasmid.
  • the bacteria contain a first plasmid comprising a vir gene region of a Ti plasmid, such as a disarmed Ti plasmid from Agrobacterium, and a second plasmid comprising one or more T-border or ori ⁇ sequences and a DNA sequence of interest, hi yet another aspect, the bacteria contain a single plasmid comprising a vir gene region of a Ti plasmid and one or more T- border or ori ⁇ sequences operatively linked to a DNA sequence of interest.
  • a first plasmid comprising a vir gene region of a Ti plasmid, such as a disarmed Ti plasmid from Agrobacterium
  • a second plasmid comprising one or more T-border or ori ⁇ sequences and a DNA sequence of interest
  • the bacteria contain a single plasmid comprising a vir gene region of a Ti plasmid and one or more T- border or ori ⁇ sequences operatively linked to a DNA sequence of interest.
  • the plasmids and nucleic acid molecules are designed to transfer DNA sequences of interest to eukaryotic cells
  • the plasmid that is introduced in the bacteria to induce the transfer of the DNA sequences of interest to the eukaryotic cells may be the Ti plasmid of A. tumefaciens, or a derivative thereof, containing all or at least part of the vir genes.
  • the plasmid generally does not contain a T-DNA region.
  • the vir genes are inducible, in other cases, the vir genes are constitutively expressed.
  • the plasmid has one or more virG sequences
  • the helper plasmid has a broad-host range origin of replication, such as the origin of replication from RK2 plasmid.
  • the helper vector has one or more ori ⁇ sequences, such as the oriT from RP4.
  • the vector has a selectable marker.
  • the second nucleic acid molecule or plasmid can be a T-DNA plasmid or T-DNA-like plasmid, which has sequences that serve the same function as T-DNA borders.
  • the homologue of T-DNA border sequence is an origin of transfer (o ⁇ ' T).
  • the second plasmid is a T-DNA plasmid, it has at least one T-DNA border sequence.
  • sequences that enable transfer are operatively linked to the DNA sequence of interest, such that the DNA sequence of interest is transferred to the recipient eukaryotic cell.
  • the nucleic acid molecules may contain genes encoding selectable products to allow selection in the bacteria or in the eukaryotic cell.
  • non-pathogenic bacteria that interact with plants or plant cells are obtained and transfected with the above nucleic acid molecules or plasmids by conjugation, electroporation, or other means.
  • Suitable bacteria include, but are not limited to, non-pathogenic Rhizobium, Sinorhizobium, Mesorhizobium, Bradyrhizobium, Pseudomonas, Azospirillum, Rhodococcus, Phyllobacterium, Xanthomonas, Burkholderia, Erwinia, and Bacillus.
  • the bacteria containing these plasmids are contacted with suitably prepared plants, plant cells, or plant tissues for a time sufficient to allow transfer of the DNA sequence of interest to the cells.
  • the plant or cells or tissue that is transformed is selected for. When plant cells or tissues are used, the transformed cells are regenerated into a plant.
  • Figures IA and B show the current taxonomical hierarchy of bacteria in the Rhizobiales order.
  • Figure 2 displays a map of exemplary binary vectors.
  • Figures 3A-F show partial nucleotide sequences of 16S rDNA, atpD and recA genes for Rhizobium spp. NGR234 (streptomycin-resistant strain ANU240) (SEQ ID NOS: 1-3), Sinorhizobium meliloti 1021 (SEQ ID NOS:4-6), Mesorhizobium loti MAFF303099 (SEQ ID NOS: 7-9), Phyllobacterium myrsinacearum CAMBIA isolate WBl (SEQ ID NOS: 10- 11), Bradyrhizobium japonicum USDAIlO (SEQ ID NOS:12-14), and 16S rDNA, atpD genes for Agrobacterium tumefaciens EHA105 (SEQ ID NOS:15-16).
  • Figure 4 shows partial nucleotide sequence of recA gene from Agrobacterium tumefaciens EHAl 05 (SEQ ID NO: 17).
  • Figure 5 shows the results of an amplification analysis of transformants of Ti plasmid-cured LBA288 cells electroporated with Ti plasmid DNA isolated from EHAlOl.
  • the following primers were used: lane a, Atul ⁇ S (SEQ ID NOS:21-22); lane b, attScirc (SEQ ID NOS:23-24); lane c, attSpAT (SEQ ID NOS:25-26); lane d, AtuvirG (SEQ ID NOS:27-28); lane e, nptl (SEQ ID NO:29-30); lane f, virB (SEQ ID NOS :31-32).
  • LBA288 Ti plasmid-cured Agrobacterium strain; EHAlOl, donor strain for Ti plasmid DNA; transformant 1 and 2, independent transformants of LBA288.
  • Figure 6 illustrates a strategy for integration of the oriT from RP4 in the Ti plasmid of EHAl 05, utilizing a suicide vector (pWBE58) harboring a homologous sequence of the Ti plasmid (virG).
  • pWBE58 a suicide vector harboring a homologous sequence of the Ti plasmid
  • Figure 7 is a Southern blot analysis on genomic DNA from two A. tumefaciens Ti plasmid:: suicide vector integrants showing duplication of the virG region (EHAl 05 pTil) and the accA region (EHAl 05 pTi2) respectively.
  • Figure 8 shows a vector map for binary vector pCAMBIAl 105.1.
  • GUSPlusTM (US Patent No. 6391547) gene; HYG(R), hygromycin resistance gene; MCS, multi-cloning site.
  • Figure 9 shows a vector map for binary vector pCAMBIA1105.1R. GUSPlusTM gene (US Patent No. 6391547); HYG(R), hygromycin resistance gene; MCS, multi-cloning site (note that the MCS differs from the one in pC AMBIAl 105.1.
  • Figure 10 is an electrophoresis gel showing the result of amplification analysis on DNA from a strain of Rhizobium spp. NGR234 (upper panel) and a strain of S. meliloti 1021 (middle panel), harboring the A. tumefaciens modified Ti plasmids pTil and pTi3 respectively, and the binary vector pCAMBIA1105.1R.
  • lane a Smel ⁇ SrDNA (SEQ ID NOS:33-34); lane b, NodDlNGR234 (SEQ ID NOS:35-36); lane c, SmeNodQ+NodQ2 (SEQ ID NOS:37-39); lane d, VirB (SEQ ID NOS:31-32); lane e, VirBl lFW2+M13REV (identifies pTil; SEQ ID NOS:40-41); lane f, M13FW+MoaAREV2 (identifies pTi3; SEQ ID NOS:42-43); lane g, HygR510 (SEQ ID NOS:44-45); lane h and h ⁇ 1405.1FW+M13FW (SEQ ID NOS:46+42; identifies the specific MCS in the binary vector; positive control in lane h is pCAMBIA1105.1R, and in h ⁇ pCAMBIAl 10
  • Figures HA-C provide images of rice calli stained for GUS ( ⁇ - glucuronidase) activity (arrows point to some of the blue regions) following co- cultivation with A. tumefaciens (panel A), S. meliloti (panel B) and Rhizobium spp. (panel C) respectively, each harboring a Ti plasmid and binary vector.
  • GUS ⁇ - glucuronidase
  • Figure 12 provides images of tobacco leaf discs stained for GUS activity following co-cultivation with A. tumefaciens, S. meliloti and Rhizobium spp. respectively, each harboring a Ti plasmid and binary vector; arrows point to some of the blue GUS regions.
  • Figure 13 shows Arabidopsis seedlings germinating on hygromycin-containing medium following floral dip transformation with Rhizobium spp. NGR234 harboring pTil and pCAMBIAl 105. IR; the arrow points to a growing, hygromycin- resistant seedling.
  • Figure 14 shows GUS stained leaf tips from regenerated tobacco shoots following co-cultivation with gene transfer competent strains of A. tumefaciens, and S. meliloti respectively.
  • Figure 15 provides amplification data for the HygR gene using primers Hyg700 (SEQ ID NOS: 82-83) (upper panel) and MCS (SEQ ID NOS :46 and 79) (lower panel) on tobacco shoots (genotype Wisconsin38) regenerated following co-cultivation with gene transfer competent S. meliloti (2-1, 6, 7-1, 11-1) and A. tumefaciens (1, 2, 3) respectively.
  • Figure 16 provides a picture of rooted tobacco shoots regenerated after co-cultivation with S. meliloti harboring pTi3 and pCAMBIA1105.1R.
  • Figures 17A-B provide images of Sinorhizobium meliloti- mediated, genetically transformed rice calli with GUS activity (blue) and non- transformed rice calli (white) (panel A) and Sinorhizobium meliloti-mediated, genetically transformed rice shoot with GUS activity (blue) visible in the roots, callus at the base of developing shoot and in the tip of the shoot (panel B).
  • Figure 18 provides Southern blot data for independent transformed tobacco (Tob), Ar ⁇ bidopsis ⁇ Arab), and rice plants and their respective untransformed controls (wt). Transgenic plants shown here result from S. meliloi- mediated transformation. (*) denotes an empty lane.
  • Bacterial species useful in this invention are bacteria that can interact with plants and that are non-pathogenic.
  • the bacteria are made gene transfer competent by transfection with a nucleic acid molecule, such as a Ti helper plasmid from Agrobacterium or a derivative thereof, comprising all or part of the vir gene region or functional equivalents, and a second nucleic acid molecule or plasmid that comprises a DNA sequence of interest operatively linked to one or more sequences enabling transfer of the sequence of interest to the eukaryotic plant cell.
  • the bacteria are made gene transfer competent by transfection with a single nucleic acid molecule that comprises the vir genes or homologues and the DNA sequence of interest operatively linked to the sequence(s) enabling transfer.
  • the bacteria for use in this invention are those that can interact with plants, without being harmful for the plant or plant cells, i.e. they are non ⁇ pathogenic.
  • Non-pathogenic bacteria are those that are benign or beneficial to plants.
  • Non-pathogenic bacteria are those that do not cause a disease state. Symptoms of a disease state include death of cells of plant tissues that are invaded, progressive invasion of vascular elements and necrosis of adjacent tissues, maceration of tissues (e.g., soft-rot), and abnormal cell division. (For more information on plant pathogenic bacteria, see "Kado, CI, "Plant Pathogenic Bacteria" in M.
  • the bacteria for use in this invention interact with plant tissues. While root-associating bacteria, rhizobia, are probably best known, the bacteria useful in this invention may associate with any plant tissue, such as roots, leaves, meristems, sexual organs, and stems. They may also be endophytic. Such bacteria include, but are not limited to, species of Sinorhizobium, Mesorhizobium, Bradyrhizobium, Pseudomonas, Azospirillum, Rhodococcus, Phyllobacterium, Xanthomonas, Burkholderia, Ochrobacter, Erwinia, and Bacillus.
  • Rhizobia bacteria that fix nitrogen.
  • Rhizobia comprise a group of Gram negative bacteria, which have the ability to produce nodules on roots or, in some cases, on stems of leguminous plants (e.g., beans, peas, lentils, and peanuts).
  • leguminous plants e.g., beans, peas, lentils, and peanuts.
  • rhizobia distinguished and nearly 40 species, some of which are presented in Figure 1. These genera represent different families within subgroup 2 of the ⁇ -Proteobacteria (Gaunt et al., IJSEM 51:2037- 2048, 2001). This includes species in the genera Rhizobium, Sinorhizobium, Allorhizobium, Mesorhizobium, Bradyrhizobium, Azorhizobium, Methylobacterium, and others.
  • Rhizobium radiobacter For example, by comparison of rDNA genes, Agrobacterium tumefaciens was discovered to be the same species as Rhizobium radiobacter and is now known by that name. "What's in a name? That which we call a rose/By any other word would smell as sweet.” (William Shakespeare, Romeo and Juliet, act 2, sc. 1, 1. 75-8 1599).
  • Bacteria can be obtained from soil samples, plant tissues, germplasm banks, strain collections, and commercial sources, among other places. Conditions for culturing different bacteria are well known. The bacteria can be screened for antibiotic sensitivities to find a suitable antibiotic that allows growth under selective conditions that prevent the growth of other bacteria. Antibiotic resistances and sensitivities are determined by plating the test bacteria on solid medium containing different concentrations of antibiotics and counting the number of colonies. Alternatively, the rate of growth in the presence of different antibiotics and different concentrations can be determined by assaying the number of bacteria in the medium at time intervals. Numbers of bacteria and growth curves are readily determined by plating on permissive solid medium and counting colonies or by spectrophotometric absorbance measurements.
  • the species of the bacteria of this invention are conveniently determined by molecular techniques.
  • An accepted method in the art is comparison of rDNA sequence obtained from the bacteria to rDNA sequences determined from known bacteria genera or species, although other gene sequences can be used instead of or in addition to rDNA sequences.
  • the bacteria employed in the protocols are identified by comparisons of 16S rDNA, recA, and atpD nucleotide sequences to a database of sequences; all of these gene sequences have been used previously for phylo genetic studies in bacteria (Gaunt et al., IJSEM 51:2-37-2048, 2001).
  • the sequences are generally obtained by sequencing of amplified fragments of genomic DNA.
  • Consensus primers for amplification of these genes can be found in the literature (e.g. (Tan et al., Appl. Environm. Microbiol. 8:1273-1284, 2001); (Gaunt et al., IJSEM 51:2037-2048, 2001)) or can be designed based on the alignment of sequences from related species. Identification is based on a match between sequences that is best if at least 90%, at least 95%, or at least 99%.
  • bacterial species may also be identified by amplification using species-specific or genus-specific primer sequences. These may include primers that specifically amplify at least part of the 16S rDNA region, other chromosomal regions, and plasmid-born sequences. Primers are tested against a broad collection of bacterial strains (e.g., those used in the lab), and only those that amplify the correct product from the expected species, and not from the other species, are used in subsequent identification assessments.
  • species-specific or genus-specific primer sequences may include primers that specifically amplify at least part of the 16S rDNA region, other chromosomal regions, and plasmid-born sequences. Primers are tested against a broad collection of bacterial strains (e.g., those used in the lab), and only those that amplify the correct product from the expected species, and not from the other species, are used in subsequent identification assessments.
  • the Ti plasmid obtained and maintained by the bacteria of this invention may be modified in order to increase its uptake or stability or both in certain species.
  • the Ti plasmid can be modified by insertion of a replication origin that is recognized in these bacteria species, or an origin of transfer (oriT) that make the plasmid mobilizable, or by removal or mutation of genes that are either not essential for gene transfer or of which the removal or mutation improves the stability of the Ti plasmid or its mobilization to other bacteria.
  • oriT origin of transfer
  • the bacteria should also be capable of inducing or constitutively expressing the genes that are involved in transfer of the DNA sequence of interest.
  • These genes are the virulence genes encoded by the vir operons or homologues of the virulence genes, such as the tra genes.
  • induction is generally achieved through the action of phenolic compounds that are naturally released by wounded plant cells or compounds, e.g. acetosyringone, which are added to the medium in which the bacteria are growing before explant infection. Any means to show that the vir genes, tra genes or other homologues are expressed can be used to establish functionality.
  • Exemplary means include Western blot analysis of the proteins using specific antibodies, analysis of expression of a reporter gene linked to the promoter of any of the genes (e.g. employing a vir promoter-lacZ fusion), or microscopic visualization of the cellular localization of the proteins (e.g. virD4 or virE2), that are fused to a reporter gene such as green fluorescent protein.
  • a reporter gene such as green fluorescent protein.
  • the formation of a single stranded transfer intermediate such as a T- DNA molecule, can be directly visualized, such as on a Southern blot with undigested genomic DNA following acetosyringone induction of bacterial cultures.
  • the bacteria that are found to maintain a first nucleic acid molecule should be capable of expressing the genes that are involved in transfer of DNA sequences of interest to plant cells, hi one embodiment, the DNA sequences of interest are provided on a T-DNA plasmid on which these genes are flanked by one or two T-DNA borders.
  • the T-DNA borders are the sites of nicking of the T-DNA plasmid by the virDl protein, leading to the formation of the relaxosome (T-complex), which is then transferred to the plant cell through the virB transmembrane complex.
  • the DNA sequences of interest are provided on a plasmid that has no T-DNA borders, but instead contains one or two sequences that serve the same function as T-DNA borders, i.e. sites for nicking and excision of the single stranded DNA region containing the DNA sequences of interest (Waters et al, Proc. Natl. Acad. ScL USA 88:1456-1460, 1991; Ward et al., Proc. Natl. Acad. Sd. USA 88:9350-9354, 1991).
  • nicking sites can be composed of the origin of transfer regions (oriT) of plasmids such as RSFlOlO or CIoDFl 3, both of which have been shown to be transported by the vz>B transmembrane complex (Buchanan- Wollastan et al., 1987; Escudero et al., 2003).
  • oriT origin of transfer regions
  • the T-DNA borders there may be one or more oriT regions. If two oriT regions are present, one oriT region will generally be located at either side of the DNA sequence of interest.
  • the bacteria of this invention attach to plant tissue or make contact to cells in one or another way in order to transfer the DNA of interest to plant cells.
  • verification of attachment or contact may be assessed by any number of methods.
  • bacteria can be labeled with fluorescein and incubated with plant tissue; attachment can then be visualized by fluorescence microscopy.
  • the transfer of bacterial proteins involved in T-DNA transfer or integration e.g. virD2, virE2, virF
  • induction of plant genes involved in T-DNA integration e.g. RAT5
  • the bacteria are transfected with nucleic acid molecules, described above and herein.
  • preparation of the nucleic acid molecules is described in terms of plasmids.
  • bacteria that contain nucleic acid molecules that are not plasmids e.g., integrated into the bacterial genome
  • generally plasmids are used as the starting material.
  • the first plasmid contains the DNA sequence(s) of interest operatively linked with the left and right T-DNA borders (or at least the right T- border).
  • the DNA sequence of interest is located in between the border sequences.
  • the DNA sequence of interest is located close enough and in a position to be transferred into the target eukaryotic cells.
  • the sequence is under control of a promoter.
  • a schematic of exemplary plasmids is shown in Figure 2. hi certain embodiments, the plasmid has a sequence that is capable of forming a relaxosome (US 2003/0087439A1).
  • the second plasmid is typically a broad-host range plasmid, and comprises at least part of the vir genes of the Ti plasmid or homologous genes, such as tra genes. While the entire vir gene or tra gene region (or other functional homologues) is generally used, one or more of the genes may be deleted or replaced by another homologue as long as the remaining genes are sufficient to cause transfer of the DNA sequence of interest.
  • the vector may also contain an oriY and a selectable marker for maintenance in bacteria. When the nucleic acid molecule is integrated into the bacterial chromosome or other self-replicating bacterial DNA molecule, an oriV is not necessary.
  • the vector containing the DNA of interest also contains a selectable or a screenable marker for identifying transformants.
  • the marker may confer a growth advantage under appropriate conditions.
  • Some well- known selectable markers are drug resistance genes, such as neomycin phosphotransferase, hygromycin phosphotransferase, herbicide resistance genes, and the like.
  • Other selection systems including genes encoding resistance to other toxic compounds, genes encoding products required for growth of the cells, such as in positive selection, can alternatively be used. Examples of these "positive selection" systems are abundant (see for example, United States Patent No: 5,994,629).
  • a screenable marker may be employed that allows the selection of transformed cells based on a visual phenotype, e.g. ⁇ -glucuronidase or green fluorescent protein (GFP) expression.
  • the selectable marker also typically has operably linked regulatory elements necessary for transcription of the genes, e.g., constitutive or inducible promoter and a termination sequence, including a polyadenylation signal sequence. Elements that enhance efficiency of transcription are optionally included.
  • An exemplary small replicon vector suitable for use in the present invention is based on pCAMBIA1305.2.
  • Other vectors have been described (U.S. Patent Nos. 4,536,475; 5,733,744; 4,940,838; 5,464,763; 5,501,967; 5,731,179) or may be constructed based on the guidelines presented herein.
  • the pCAMB IAl 305.2 plasmid contains a left and right border sequence for integration into a plant host chromosome and also contains a bacterial origin of replication and selectable marker. These border sequences flank two genes.
  • hygromycin resistance gene hygromycin phosphotransferase or HYG
  • the second is the ⁇ -glucuronidase (GUS) gene (reporter gene) from any of a variety of organisms, such as E. coli, Staphyloccocus, Thermatoga maritima and the like, under control of the CaMV 35S promoter and nopaline synthase polyadenylation site.
  • GUS ⁇ -glucuronidase
  • the CaMV 35S promoter is replaced by a different promoter. Either one of the expression units described above is additionally inserted or is inserted in place of the GUS or HYG gene cassettes.
  • the Ti plasmid which contains genes necessary for transferring DNA from Agrobacterium to plant cells, can also replicate in other genera of bacteria.
  • the Ti plasmid can replicate in rhizobia and, moreover, is stable (i.e. is not readily cured from bacteria).
  • Exemplary rhizobia used in the context of this invention include Rhizobium leguminosarum bv. trifolii (former R. trifolii), Rhizobium spp. NGR234, Mesorhizobium loti, Phyllobacterium myrsinacearum, and Sinorhizobium meliloti (former R. meliloti), all of which are capable of supporting and expressing the genes of the Ti plasmid.
  • the helper Ti plasmid that is harbored in the bacteria of this invention lacks the entire T-DNA region but contains a vir region.
  • the Ti plasmid may contain a selectable marker, compatible origins of replication, and multiple virG sequences. Although the selectable marker can be the same on both plasmids, more typically the markers are different so as to facilitate confirmation that both plasmids are present.
  • the helper plasmid or the small replicon or mobilizable vector can optionally contain at least one additional virG gene, and optionally a modified virG gene.
  • the additional virG gene(s) can be inserted into the Ti plasmid by any of a variety of methods, including the use of transposons and homologous recombination (Kalogeraki and Winans, Gene 188:69-75, 1997). Homologous recombination can be induced by any method, including the use of a suicide plasmid carrying a cloned fragment of the Ti plasmid (e.g. the virG gene), or a stable replicon that is forced to recombine with the Ti plasmid, e.g. by incompatibility. In addition a gene encoding antibiotic resistance can be included on the fragment with virG.
  • sequences of the Ti plasmid may similarly be (completely or partly) duplicated or removed, including large regions that tend to be unimportant for the purposes of this application.
  • an origin of transfer such as the ori ⁇ of RK2/RP4 may be included (Stabb and Ruby, Enzymol. 358:413-426, 2002). This type of transfer origin allows the mobilization of the Ti plasmid to other bacteria, e.g. to rhizobia, with the help of the transfer functions of RK2/RP4 or similar vectors, including derivatives.
  • helper plasmid is pTiBo542. This highly virulent plasmid is also completely sequenced (P. Oger, unpublished data). Disarmed derivatives pEHAlOl and pEHA105 have been widely used (Hood et al., J. Bacteriol. 168:1291-1301, 1986; Hood et al., Transgenic Research 2:208-218, 1993). Other helper plasmids include those of LBA4404, the pGA series, pCG series and others (see, Hellens and Mullineaux, A guide to Agrobacterium binary Ti-vectors. Trends Plant ScL 5: 446-451, 2000).
  • the plasmids are transferred via conjugation or through a direct transfer method to the bacteria of this invention.
  • a suitably disarmed Ti 'helper' plasmid from highly transformation-competent Agrobacterium e.g. pEHA105 from EHAl 05
  • modified gene transfer T-DNA vectors e.g. pCAMB IA 1305.1
  • mobilizable plasmid transformation competent bacteria are generated. These bacteria can be used to transform plants and plant cells.
  • the first plasmid e.g., Ti plasmid can be transferred from Agrobacterium (or other rhizobia) containing the Ti plasmid by biological methods, such as conjugation, or by physical methods, such as electroporation or mediated by PEG (polyethylene glycol).
  • Agrobacterium or other rhizobia
  • PEG polyethylene glycol
  • Constitutive conjugation ability of the Ti plasmid can be achieved by deletion of accR and/or traM genes on the plasmid (Teyssier-Cuvelle et al., Molec. Ecol. 8:1273-1284, 1999). Otherwise, induction of conjugation can be achieved by use of specific opines, naturally produced in crown galls, or utilizing a self-transmissible R plasmid (e.g. R772 or RP4) which may (temporarily) form a co- integrate with the Ti plasmid. If the Ti plasmid has been engineered by insertion of a foreign o ⁇ ' T, e.g.
  • conjugation from one bacterium to another bacterium can be achieved with the help of bacterial strains, e.g. E. coli, containing compatible transfer functions on a plasmid or on their chromosomes. This may be done in a triparental mating between donor, acceptor and helper strain, or in a biparental mating between a donor containing the transfer genes and an acceptor. Bacteria are transferred to selective medium and putative transconjugants are plated out to isolate single cell colonies. Following transconjugation, the Agrobacterium may be selected against.
  • E. coli e.g. E. coli
  • the Agrobacterium is sensitive to an antibiotic that the recipient bacteria are resistant to, either naturally resistant or resistant as a result of having the small replicon plasmid, then that antibiotic may be used to select for the recipient bacterial strain.
  • a helper strain was used, it may be selected against by using the same or a different antibiotic to which the recipient bacteria are resistant. They may also be made antibiotic resistant by integration of a foreign gene conferring antibiotic resistance, e.g. mediated by a transposon vector.
  • bacteria that have not taken up the Ti plasmid may be eliminated by selection for the Ti plasmid. Generally this selection will be an antibiotic selection as well, but will depend on the selectable markers in the Ti plasmid.
  • Ti plasmid The presence of the Ti plasmid can be verified by any suitable method, although for ease, amplification of the vir genes or any other Ti plasmid sequence is commonly employed.
  • Vir gene expression in the new host can be checked after induction with acetosyringone using any of a variety of assays, such as Northern blotting, RT-PCR, real-time amplification, hybridization on microarrays, Western blots, analysis of gene expression from a reporter gene linked to the promoter of a vir gene and the like.
  • the Ti plasmid may also be transferred to other bacteria without the use of Agrobacterium as a donor strain.
  • a rhizobial strain that has acquired the Ti plasmid by one or another means may act as the donor of the Ti plasmid to other bacterial acceptor strains. This may in some cases avoid the interference of restriction endonuclease systems that exist in many if not all bacteria.
  • the Ti plasmid may be electroporated into the recipient bacteria. Isolation of the Ti plasmid and electroporation to other Agrobacterium strains, e.g. to the Ti plasmid cured strain LBA288, has been described (Mozo et al., Plant MoL Biol. 16:617-918, 1990). Similarly, electroporation may be performed to other bacterial species.
  • the small plasmid or mobilizable binary vector which is generally a small plasmid
  • electroporation is conveniently used.
  • the binary vector should be compatible with the Ti plasmid, and both are selected for. Presence of the binary vector may be confirmed by amplification or by re-isolating the plasmid from the bacteria and analysis of the plasmid DNA by restriction digestion.
  • Eukaryotic cells may be transformed within the context of this invention. Moreover, either individual cells or aggregations of cells, such as organs or tissues or parts of organs or tissues may be used. Generally, the cells or tissues to be transformed are cultured before transformation, or cells or tissues may be transformed in situ. In some embodiments, the cells or tissues are cultured in the presence of additives to render them more susceptible to transformation. In other embodiments, the cells or tissues are excised from an organism and transformed without prior culturing.
  • Suitable eukaryotic organisms as sources for cells or tissues to be transformed include plants, fungi, and yeast.
  • Yeast cells can be transformed with Agrobacterium and so can be used in the context of this invention to measure efficiency of transformation and for optimization of conditions.
  • the advantage of using yeast is the fast growth of yeast and the ability to grow it in laboratory conditions.
  • Transformants can be easily detected by their changed phenotype, e.g. growth on a medium lacking an essential growth component on which the untransformed cells cannot grow. Quantization of transformation efficiency is then achieved by counting the number of colonies growing on this selective medium.
  • Yeast cell transformation by Agrobacterium occurs independent of the expression of attachment genes necessary for plant transformation, and, by the use of autonomously replicating DNA units (mini-chromosomes), can avoid the need for gene integration if desired.
  • the uncoupling of attachment and DNA integration from the overall gene transfer processes may simplify the optimization of transformation by other bacteria. For example, following Ti/T-DNA plasmid transfer to these bacteria, the system may be optimized by genetic complementation using an A. tumefaciens genomic library transferred to the pTi-bearing bacteria. The bacterial library is then used to transform yeast cells and the bacterial clones that transform most efficiently are selected.
  • Agrobacterium tumefaciens and some of the bacterial species have been fully sequenced and can be compared, missing genes in the latter bacteria that are important for transformation by Agrobacterium may be individually picked from the Agrobacterium genome and inserted into the bacterial genome by any means or expressed on a plasmid.
  • the bacteria can be used to transform yeast cells under a variety of test conditions, such as temperature, pH, nutrient additives and the like. The best conditions can be quickly determined and then tested in transformation of plant cells or other eukaryotic cells.
  • plant cells are transformed by co-cultivation of a culture of bacteria containing the Ti plasmid and the binary vector with leaf disks, protoplasts, meristematic tissue, or calli to generate transformed plants (Bevan, Nucl. Acids. Res. 12:8711, 1984; U.S. Patent No. 5,591,616).
  • bacteria are removed, for example by washing and treatment with antibiotics, and plant cells are transferred to post- cultivation medium plates generally containing an antibiotic to inhibit or kill bacterial growth ⁇ e.g., cefotaxime) and optionally a selective agent, such as described in U.S. Patent No. 5,994,629.
  • Plant cells are further incubated for several days. The expression of the transgene may be tested for at this time. After further incubation for several weeks in selecting medium, calli or plant cells are transferred to regeneration medium and placed in the light. Shoots are transferred to rooting medium and resulting plants are transferred into the glass house.
  • Alternative methods of plant cell transformation include dipping whole flowers into a suspension of bacteria, growing the plants further into seed formation, harvesting the seeds and germinating them in the presence of a selection agent that allows the growth of the transformed seedlings only.
  • germinated seeds may be treated with a herbicide that only the transformed plants tolerate.
  • the bacterial species that are used in this invention may naturally interact in specific ways with a number of plants. These bacterial-plant interactions are very different from the way Agrobacterium naturally interacts with plants. Thus, the tissues and cells that have are transformable by Agrobacterium may be different in the case of the employment of other bacteria.
  • Some plant cell types that are especially desirable to transform include meristem, pollen and pollen tubes, seed embryos, flowers, ovules, and leaves. Plants that are especially desirable to transform include corn, rice, wheat, soybean, alfalfa and other leguminous plants, potato, tomato, and so on.
  • the biological transformation system described here can be used to introduce one or more DNA sequences of interest (transgene) into eukaryotic cells and especially into plant cells.
  • the sequence of interest although often a gene sequence, can actually be any nucleic acid sequence whether or not it produces a protein, an RNA, an antisense molecule or regulatory sequence or the like.
  • Transgenes for introduction into plants may encode proteins that affect fertility, including male sterility, female fecundity, and apomixis; plant protection genes, including proteins that confer resistance to diseases, bacteria, fungus, nematodes, herbicides, viruses and insects; genes and proteins that affect developmental processes or confer new phenotypes, such as genes that control meristem development, timing of flowering, cell division or senescence ⁇ e.g., telomerase), toxicity ⁇ e.g., diphtheria toxin, saporin), affect membrane permeability ⁇ e.g., glucuronide permease (U.S. Patent No.
  • Bisect and disease resistance genes are well known. Some of these genes are present in the genome of plants and have been genetically identified. Others of these genes have been found in bacteria and are used to confer resistance. Particularly well known insect resistance genes are the genes encoding the crystal proteins of Bacillus thuringiensis. The crystal proteins are active against various insects, such as lepidopterans, Diptera, Hemiptera and Coleoptera. Many of these genes have been cloned. For examples, see, GenBank; U.S. Patent Nos.
  • transgenes that are useful for transforming plants include sequences to make edible vaccines (e.g. United States Patent No: US 6136320, US 6395964) for humans or animals, alter fatty acid content, change amino acid composition of food crops (e.g. United States Patent No. 6,664,445), introduce enzymes in pathways to synthesize vitamins such as vitamin A and vitamin E, increase iron concentration, control fruit ripening, reduce allergenic properties of e.g., wheat and nuts, absorb and store toxic and hazardous substances to assist in cleanup of contaminated soils, alter fiber content of woods, increase salt tolerance and drought resistance, amongst others.
  • edible vaccines e.g. United States Patent No: US 6136320, US 6395964
  • alter fatty acid content e.g. United States Patent No. 6,664,445
  • introduce enzymes in pathways to synthesize vitamins such as vitamin A and vitamin E, increase iron concentration, control fruit ripening, reduce allergenic properties of e.g., wheat and nuts, absorb and store toxic and hazardous
  • the product of the DNA sequence of interest may be produced constitutively, after induction, in selective tissues or at certain stages of development. Regulatory elements to effect such expression are well known in the art. Many examples of regulatory elements may be found in the CAMBIA IP Resource document “Promoters used to regulate gene expression” version 1.0, October 2003.
  • suitable bacterial species naturally interact with plants in one or another way. These include endophytic bacteria that live in association with plants, such as rhizobia, which are known to fix nitrogen and make it available to plants. Also included are bacteria that could attach to plants, i.e. epiphytic bacteria, and which have beneficial or neutral interactions with them.
  • Rhizobium spp. NGR234 (a streptomycin-resistant strain ANU240), Sinorhizobium meliloti strain 1021, Mesorhizobium loti MAFF303099, Phyllobacterium myrsinacearum, Bradyrhizobium japonicum USDAI lO, Erwinia herbicola (accession no. WAC 1664), and Pseudomonas fluorescens (accession no. WAC 1650). All strains are obtained from a public germplasm bank (WAC, Plant Research Division Culture Collection, Western Australian Department of Agriculture Baron-May Court, South Perth, WA 6151 Australia), except for the P. myrsinacearum strain, which is a spontaneous lab isolate.
  • WAC Plant Research Division Culture Collection, Western Australian Department of Agriculture Baron-May Court, South Perth, WA 6151 Australia
  • the bacterial species are identified by amplification and sequencing of the 16S rDNA genes and the atpD and recA genes, encoding the beta subunit of the membrane ATP synthase and part of the DNA recombination and repair system respectively (Gaunt et al., IJSEM 51 :2037-2048, 2001).
  • the primer sequences that are used to amplify and sequence the partial 16S rDNA genes are SEQ ID NOS:47-50, those for the atpD gene are SEQ ID NOS:51-52, and those for the recA gene are SEQ ID NOS:53-54.
  • Additional strain identification is done by amplification of informative gene targets on the chromosomal and on the megaplasmid part of the genome and scoring of the presence or absence of the expected amplification product by gel electrophoresis.
  • Such amplification can rapidly confirm the strain genotype during procedures and confirm gain, loss or maintenance of plasmids, such as one or more megaplasmids, often called symbiotic plasmids (pSym) in rhizobia, or a Ti plasmid and a megaplasmid, called the pAT plasmid, in Agrobacterium.
  • pSym symbiotic plasmids
  • the templates used for amplification are boiled colonies, obtained by picking some cells from a colony on a plate with a pipet tip, resuspending these into a tube with 100 ⁇ L of sterile water, boiling for 3 min and cooling down the crude DNA preparation at room temperature. Then 4 ⁇ L of this preparation is used in a 20 ⁇ L amplification reaction.
  • purified or more highly enriched DNA can be isolated by any of known methods.
  • japonicum USDAI lO is resistant to gentamycin (25 mg/L), rifampicin (100 mg/L) and moderately to streptomycin (200 mg/L).
  • M. loti MAFF303099 is sensitive to all antibiotics tested.
  • S. meliloti 1021 and Rhizobium sp. NGR234 (strain ANU240) are resistant to streptomycin (200 mg/L) and slightly to gentamycin (25 mg/L) and rifampicin (100 mg/L).
  • the P. myrsinacearum strain is resistant to kanamycin (50 mg/L), ampicillin (100 mg/L), chloramphenicol (100 mg/L) and streptomycin (200 mg/L).
  • the bacterial strains are also tested for growth on LB agar plates. All bacteria tested can grow on LB medium, although the speed of growth and colony morphology varies. Similarly, other media, e.g. synthetic minimal media, can be tested and other antibiotics or growth media components such as different sugars or vitamins can be examined. Preferentially, and to avoid culturing any contaminating microbes, the bacteria are grown under conditions that are selective for the particular strain used. Hence, Rhizobium spp. and S. meliloti are grown on YM+strep200, P. myrsinacearum on YM+Km50, B. japonicum on YM+RiflOO and M. loti on plain YM plates.
  • Agrobacterium of known concentration is added to rhizobia cultures (Rhizobium sp., S. meliloti, or M. loti) also of known concentration as determined by colony counts after serial dilutions.
  • rhizobia cultures Rosp., S. meliloti, or M. loti
  • concentration determined by colony counts after serial dilutions.
  • One ml of mixtures containing 10 9 cm per mL of a rhizobia species with from 10 6 to 10° cfu Agrobacterium are spread on LB media and cultured at 28°C for 2 to 3 days.
  • Agrobacterium grows at a faster rate than the rhizobial species.
  • Transformation experiments using the rhizobia species can utilize this differential growth rate by culturing 1 mL of the incubation media (which typically containe 10 9 cfu of rhizobia) on LB medium to monitor for Agrobacterium contamination.
  • the co-culture plates are washed with sterile liquid, which is then cultured on LB to monitor for Agrobacterium contamination.
  • the Agrobacterium strain that is used as a source of the Ti plasmid is the hypervirulent strain EHAl 05, which contains the Ti plasmid pEHA105, a disarmed derivative of pTiBo542 (Hood et al., Transgenic Research 2:208-218, 1993).
  • Agrobacterium-specific genotyping primers are designed for the 16S rDNA genes (SEQ ID NOS:22-23) and for the attS genes on either the circular chromosome (SEQ ID NOS:23-24) or on the pAT megaplasmid (SEQ ID NOS:25-26). Primers are also designed to amplify sequences on the Ti plasmid, i.e.
  • virG SEQ ID NOS:27-28
  • virB genes SEQ ID NOS:31-32
  • These primers are tested for the specific and efficient amplification of Agrobacterium DNA. They are also tested on DNA templates prepared from all the other bacterial species that are assayed for gene transfer. The results show specific amplification of Agrobacterium DNA, but no detectable amplification from other bacterial templates.
  • primer sets can be used to confirm absence of Agrobacterium cells in bacterial cultures, suspensions or any other preparations used during plant transformation.
  • a culture of Rhizobium leguminosarum biovar trifolii strain ANU843
  • strain ANU843 a close relative of Agrobacterium
  • O.D. 6 oo 1.0, corresponding to 10 8 -10 9 cells/mL
  • TY Teryptone-Yeast Extract
  • tumefaciens EHAlOl is grown in LB medium with kanamycin (50 mg/L) at 29 0 C and diluted in 10-fold steps.
  • the number of cells in each of the dilutions is determined by plating an aliquot onto LB agar plates and counting the number of cells. From these calculations, the number of cells per mL is determined and serial dilutions containing 20, 200, 2000 and 20.000 cells in a volume of 10 ⁇ L are prepared.
  • each tube contains 2, 20, 200 and 2000 Agrobacterium cells respectively.
  • a fifth tube is made by addition of 2000 Agrobacterium cells in a total volume of 100 ⁇ L of water, without Rhizobium cells. AU tubes are held in a boiling water bath for 3 minutes to lyse the cells and release the DNA.
  • Amplification is performed using 10 ⁇ L of template DNA from tubes 1 to 5 in a total volume of 20 ⁇ l.
  • the amplification mixtures contain two sets of primers (duplex amplification), one specific for the R. leguminosarum 16S rDNA genes (SEQ ID NOS:18-19) and one specific for the A. tumefaciens 16S rDNA genes (SEQ ID NOS:20-21), which amplify the partial 16S rDNA genes in R. leguminosarum and A. tumefaciens respectively and yield products of a different size upon gel electrophoresis (approx. 700 and 410 bp respectively).
  • the amplification reactions are carried out using an initial denaturation temperature at 94C during 1 min, then 40 cycles of 30 sec at 94 0 C, 30 sec at 58C, 1 min at 72°C, and a final extension at 72 0 C during 2 min.
  • the reaction products are separated by electrophoresis and visualized by ethidium bromide staining.
  • EHAlOl is very similar to EHAl 05, but contains the Nptl gene which confers kanamycin resistance to this strain (Hood et al, J Bacteriol. 168:1291-1301, 1986). Plasmid DNA is isolated by a modified alkaline lysis method that is adapted for isolation of large plasmids. The culture is diluted 2Ox into fresh medium and grown for another 2 to 3h.
  • the chromosomal DNA is then precipitated by adding 240 ⁇ L of 5M NaCl and incubating the tubes on ice for 1 to 4 hr. After centrifugation for 10 min at 16000 x g, the supernatant is poured into a new tube, and 550 ⁇ L of isopropanol is added to precipitate the plasmid DNA. The tube is placed at -2O 0 C for 30 min, then centrifuged at 16000 x g for 3 min. The supernatant is removed, and the pellet dried at room temperature. The pellet is resuspended in 10 ⁇ L TE by overnight incubation at 4 0 C. [0091] The Ti plasmid is transferred to other bacteria by electroporation.
  • Electrocompetent cells are prepared from exponentially grown cells according to standard procedures for A. tumefaciens. 40 ⁇ l of thawed competent cells are added to the tube containing 10 ⁇ l of resuspended EHAlOl plasmid DNA, slowly mixed, and transferred to a chilled microcuvette (Bio-Rad, 0.1 cm electrode distance). A single electric pulse of 5 min at a field strength of 13 kV/cm is applied by means of the Gene Pulser and Pulse Controller of Bio-Rad.
  • Putative transformants with vector integrants are selected on LB plates supplemented with kanamycin (50 mg/L) and carbenicillin (100 mg/L) (both selection markers are present on the suicide vectors).
  • Candidate colonies that have integrated the suicide vector into the Ti plasmid by homologous recombination at the virG, accA or moaA locus are obtained in 3 days and assayed by amplification for the presence of the modified Ti plasmid.
  • Primers used to verify integration of the whole suicide plasmid into the Ti plasmid are as follows: virBHFW2 (SEQ ID NO:40) and M13REV (SEQ ID NO:41) for the pTi::pWBE58 integrant, now called pTil, accAFW2 (SEQ ID NO:74) and M13REV (SEQ ID NO:41) for the pTi::pWBE60 integrant, now called pTi2, and M13FW (SEQ ID NO:42) and moaAREV2 (SEQ ID NO:75) for the pTi::pWBE62 integrant, now called pTi3.
  • the M 13 primer anneals to the suicide vector sequence and the second primer anneals to a sequence outside the region cloned in the respective suicide vectors.
  • Amplification is carried out using an initial denaturation at 94°C for 1 min, then 35 cycles of 30 sec at 94°C, 30 sec at 58 0 C and 2 min at 72 0 C, and a final extension for 2 min at 72°C.
  • the amplified products are separated by agarose gel electrophoresis.
  • the results ( Figure 7) show the presence of the expected amplification products for each of the vector integrations: a 1496 bp product for pTil, 2080 bp for pTi2, and 1627 bp for pTi3, respectively. No amplification product is obtained for the wildtype EHAl 05 strain containing an unmodified Ti plasmid.
  • Genomic DNA is isolated from the wildtype EHA105 strain, from the Ti plasmid-cured Agrohacterium strain LBA288, and from the EHAl 05 strains containing modified Ti plasmids pTil and pTi2. The genomic DNA is digested by the restriction endonuclease Xbal and separated by gel electrophoresis run overnight.
  • Xbal cuts the suicide vectors twice, once at each side of the ori ⁇ sequence, hi the modified Ti plasmid sequence, this should result in the cleavage of the DNA inside the duplicated virG and accA region respectively, resulting in two fragments each containing a virG or accA fragment.
  • the digested genomic DNA is then blotted onto a membrane, fixed and hybridized to a DNA probe. Li a separate lane, the Z& ⁇ l-digested suicide vector DNA is loaded.
  • the DNA probe is prepared by DIG labeling (HighPrime DIG labeling kit, Roche diagnostics, Mannheim, Germany) of an amplified product corresponding to the virG gene and the ace A gene amplified from the corresponding suicide vectors by using the Ml 3 primers (SEQ ID NOS:41-42) and the accAFW+accAREV primers (SEQ ID NOS:70-71) respectively.
  • DIG labeling HighPrime DIG labeling kit, Roche diagnostics, Mannheim, Germany
  • Ml 3 primers SEQ ID NOS:41-42
  • accAFW+accAREV primers SEQ ID NOS:70-71
  • the LBA288 strain which does not have a Ti plasmid shows no bands for either of the probes, indicating that the probes bind to a region of the Ti plasmid.
  • the result confirms that the whole suicide vectors have integrated into the homologous region of the Ti plasmid by a single cross-over event, thereby duplicating the region that was cloned in the vectors (virG and accA respectively).
  • This is shown in Figure 7.
  • hi pTil this results in the duplication of the whole virG gene, while in pTi2, a second truncated copy of the AccA gene is inserted, hi Agrobacterium, strains with duplicated virG genes or enhanced virG activity have been shown to have increased gene transfer competence.
  • the unmodified Ti plasmid is unstable in some bacterial species.
  • the Ti plasmid is modified by insertion of a broad-host range origin of replication, thereby making it more stable and replicative in other bacterial species, including but not limited to E. coli.
  • the modified Ti plasmid is then conjugated to non-Agrobacterium species, for example to Bradyrhizobium japonicum or Azospirillum brasilense. Any replication origin or stabilization protein gene that is stably maintained in a species can be employed for stabilizing the Ti plasmid.
  • the Ti plasmid is first modified by insertion of a replicative origin that is active in E. coli.
  • the broad-host range plasmid pRK404 a smaller derivative of RK2 (Scott et al., Plasmid 50:74-79, 2003; GenBank accession AY204475), is modified by replacing the tetracycline resistance genes (tetA and tetR) by the kanamycin resistance gene from Topo vector PCR2.1 (hivitrogen, Carlsbad, CA).
  • pRK404 is digested with BseRI, and the large fragment blunted with T4 DNA polymerase and ligated to the EcoRY/Xmnl fragment containing kan R and the Fl ori from PCR2.1.
  • the resulting 10.5 kb vector is kanamycin resistant and is called pRK404km.
  • a sequence of the Ti plasmid is cloned into the pRK404km vector.
  • the whole virG gene and part of the moaA gene with flanking DNA are amplified using primers virBHFW and virC2REV (for virG; SEQ TD NOS: 66-67), and primers moaAFW and moaAREV (for moaA; SEQ ID NOS:68-69), all of which carry restriction sites.
  • the amplified products are digested with HindIII (virG) or BaniHI (moaA) and ligated to the similarly digested pRK404km plasmids.
  • the binary vector system is employed for gene transfer to plants.
  • the bacterial vehicle to transfer a DNA sequence of interest to plants therefore contains a disarmed Ti plasmid without T-DNA and a vector that contains the gene(s) of interest between T-DNA borders.
  • the vector that is used here is derived from the pCAMBIA series of vectors, i.e. from pC AMBLA 1305.1 (GenBank Accession: AF354045).
  • the vector is modified by replacement of the kanamycin resistance marker, nptl, by the spectinomycin/streptomycin resistance marker (Spec ⁇ ) from pPZP200 (Hajdukiewicz et al., Plant Molec. Biol.
  • the Spec ⁇ gene is amplified from pPZP200 by primers SpecFWNsiI (SEQ ID NO. 76) and SpecREVSacII (SEQ ID NO. 77), digested with Nsil and Sac ⁇ l and ligated to both large fragments from a p C AMBIA 1305.1 NsiVSacTL digest, leaving out the 988 bp fragment that contains the Kan R gene.
  • the resulting vector after checking the correct orientation of the ligated fragments, has the Spec ⁇ gene replacing the Kan R gene and is called pCAMBIAl 105.1. A map of this vector is shown in Figure 8.
  • pCAMBIA1305.1 contains all the features of pCAMBIA1305.1, including the hygromycin resistance cassette and the GusPlus (United States Patent No: 6,391,547) reporter gene cassette within the left and right T-DNA borders.
  • the GusPlus gene contains an intron, preventing it from being expressed in the bacteria. Following X-GLcA staining of a bacterial suspension, no blue spots are detected.
  • pCAMBIA1405.1 is constructed by amplification of the Spec R gene from ⁇ PZP200 with SpecfwSacII and SpecrevSacII (SEQ ID NOS:78+77) and ligation into the unique SacTL site of pCAMBIA1305.1.
  • This vector, pCAMBIA1405.1 has a combined Kan and Spec resistance and contains exactly the same T-DNA region as its parental vector and pCAMBIAl 105.1.
  • a slightly different binary vector is transformed to the bacteria of this invention compared to the one transformed to Agrobacteriwn strains that are used as a positive control during transformation.
  • a small part of the T-DNA region is modified, e.g., a slightly different multi-cloning site is used in both vectors or small deletions or insertions are created in any region within the border sequences.
  • MBV binary vector
  • BV binary vector
  • Transformed plant tissues can be analysed for the type of T-DNA sequence that has integrated into the genome by amplification across the marker sequence and determining the DNA sequence of the product. Any T-DNA integration can thus be examined by amplification and alternatively or in addition by sequencing. Thus, the origin of the T-DNA can be identified as being derived from either the target bacterium strain or from Agrobacteriwn.
  • the pC AMBIAl 105.1 vector is marked by replacing its multi-cloning site by the slightly different one from Topo vector PCR2.1 (Invitrogen, Carlsbad, CA).
  • the multi-cloning site from the Topo vector is cut out as a PVMII fragment and ligated into PvwII-digested pCAMBIAl 105.1.
  • the resulting vector is analysed by amplification across the multi-cloning site sequence and by sequence analysis of the whole multi-cloning site.
  • the marked vector is called pCAMBIAl 105.
  • IR Figure 9 and is electroporated only to the bacteria of this invention.
  • the original vector, pCAMBIAl 105.1, or the related vectors pCAMBIA1305.1 and 1405.1 are only electroporated to Agrobacterium, and the resulting strains are used as a positive control for gene transfer.
  • the different MCS sequences in the marked binary vector compared to the original vector is confirmed by amplification of the MCS with primers 1405.1 (SEQ E) NO. 46) and P35S5'rev (SEQ ID NO. 79), yielding a 491 bp product for the 1105.1/1305.1/1405.1 series of vectors and a 572 bp product for the marked binary vector pCAMBIAl 105. IR. This is shown in Figure 15.
  • bacterial strains are engineered for DNA transfer by incorporation of the Agrobacterium Ti plasmid and a T-DNA binary vector.
  • the Ti plasmid is first transferred from Agrobacterium to a bacterial strain of this invention by conjugation.
  • the pTi helper plasmid has strong virulence functions, e.g. pEHA105 from EHA105, and bears a positive selection marker(s).
  • the mobilization of the Ti plasmid is accomplished by the help of the conjugation machinery of RP4/RK2 plasmids.
  • IncP plasmids are able to mobilize a plasmid that carries the origin of transfer (o ⁇ T) of RP4/RK2 (see Example 3). If the bacterial strain of this invention strain has no useful selection marker, a selection marker is first inserted in its genome by transposon-mediated mutagenesis or by any recombination approach.
  • EHA105 carrying pTil and EHA105 carrying pTi3 are used as donor strains.
  • E. coli carrying RP4-4 (a kanamycin-sensitive derivative of RP4) or E. coli carrying pRK2073 (a spectinomycin-resistant RP4 derivative containing the RP4 transfer functions on a limited host range replicon that is not active in Agrobacterium or the strains of this invention) are used as a helper strain, Rhizobium spp. NGR234 (streptomycin-resistant strain ANU240) and Sinorhizobium meliloti strain 1021 (streptomycin resistant) are used as acceptor strains.
  • Conjugation is brought about by combining actively growing cultures of the donor Agrobacterium strain containing the Ti plasmid, the rhizobial acceptor strain and the helper RP4/RK2 (derivative) strain in a triparental mating. Bacterial mixes are transferred to a nitrocellulose filter placed on a nonselective YM growth medium and incubated for few hours or overnight at 29 0 C.
  • Cells on the filter are then resuspended and plated onto selective plates (YM with streptomycin (100 mg/L), kanamycin (50 mg/L) and carbenicillin (50 mg/L)) that favor the growth of the transconjugants, that is the rhizobia containing the Ti plasmid.
  • the candidate transconjugants are plated out as single cell colonies and checked by amplification for the presence of the pTi (e.g. vir genes) and confirmed as the rhizobial strain. The results of the amplification analysis for one strain of each bacterial species are shown in Figure 10.
  • the transconjugant strains are additionally analysed for the presence of the RP4-derived helper plasmid (using primers RP4FW and REV; SEQ ID NOS: 80-81). A strain is chosen for further use that lacks this plasmid.
  • the rhizobial strains containing the Ti plasmid are then transformed with pCAMBIA1105.1R (see Example 4) by electroporation.
  • the putative transformants are selected on YM media containing kanamycin (50 mg/L) (to select for the pTi) and streptomycin (100 mg/L) (to select for the binary vector).
  • plasmid DNA is prepared from cultures grown for 2 days at 28°C with or without selection (kanamycin (50 mg/L) + spectinomycin (100 mg/L)).
  • the plasmid DNA typically digested with one or more restriction enzymes, is separated byl.2% agarose gel electrophoresis.
  • the binary vector is detectable in all extractions.
  • the Ti plasmid pTil is mobilized from the Agrobacterium strain EHA105 containing pTil and RP4-4 to the Bradyrhizobium japonicum strain USDAI lO in a biparental mating, followed by selection on YM with RiflOO (for B. japonicum) and kananiycin (50 mg/L) and carbenicillin (100 mg/L) (for pTil). A colony of B. japonicum is obtained that contained pTil. This strain is then electroporated with pCAMBIA1105.1R.
  • rice calli are transformed with the Rhizobium spp. NGR234 and S. meliloti 1021, both harboring pTi3 and ⁇ CAMBIA1105.1R (see Examples 4 and 5 for the construction of these strains).
  • Control strains include the Agrobacterium strain EHA105 that harbors the pCAMBIA1405.1 vector.
  • the vir helper Ti plasmid in strain EHA105 (Hood et al., Transgenic Res. 2:208-218, 1993) is derived from succinamopine type supervirulent Ti plasmid pTiBo542.
  • Rhizobia strains are streaked on YTVI medium with appropriate antibiotics (kanamycin (40 mg/L) and spectinomycin (80 mg/L) and incubated at 29 0 C for three days. At this time, the cells form a lawn on the plates.
  • Agrobacterium strains are streaked on AB medium containing kanamycin (50 mg/L) and spectinomycin (100 mg/L), and grown for two days at 29 0 C. Care is taken not to contaminate the rhizobial cultures with Agrobacterium.
  • the bacteria are collected from the plates and resuspended in AAM or minA medium containing 100 ⁇ M acetosyringone (AS).
  • the O.D. 6 oo of the bacterial suspension is adjusted to 1.0 for Agrobacterium and 1.5 for the rhizobia (these figures are chosen to correspond to mid-exponential growth phase).
  • the suspensions are held at room temperature for 2-3 hours.
  • 20 mL of the bacterial suspension is transferred into a petri dish or other suitable sterile container.
  • Four to seven-day dedifferentiated calli are added to the bacterial suspension, swirled and left for 30 min. The calli are then blotted dry on sterile Whatman No. 1 filter papers and transferred to 2N6-AS plates.
  • calli co-cultivated with bacteria are washed with water containing 250 mg/L cefotaxime to remove the bacteria; calli are transferred to plates containing 25 mL of water supplemented with 250 mg/L cefotaxime, swirled, and incubated for 20 min. During this period most of the bacteria are released from the calli. The calli are blotted dry on sterile Whatman No. 1 filter paper and then transferred to 2N6-CH plates containing cefotaxime at 250 mg/L (to kill bacteria left attached to the calli) and hygromycin at 50 mg/L (to select for transgenic calli).
  • the calli are then transferred to light and grown for a 4-6 weeks. After five to ten days calli start turning green, and, in two to three weeks, shoots start differentiating. These shoots are transferred onto rooting medium (one-half strength MSH) and when roots are formed, plants are transferred to the glass house.
  • rooting medium one-half strength MSH
  • Transient GUS expression is tested by staining a few washed calli with X-GIcA (5-Bromo-4-chloro-3-indolyl ⁇ -D glucuronide).
  • Figure 11 shows calli assayed for GUS activity following a five-day co-cultivation with Agrobacterium, Sinorhizobium or Rhizobium spp. strains. Blue stained zones are observed on the calli following co-cultivation with rhizobia, though at a lower frequency compared to those observed following co- cultivation with Agrobacterium.
  • FIG 17 shows a GUS stained rice plantlet obtained after co- cultivation with S. meliloti containing pTi3 and pCAMBIA1105.1R. GUS activity is observed in the root, at the base of the shoot, and in the leaf tip. Amplification analysis revealed the presence of the pCAMBIA1105.1R-specific MCS, confirming that the T-DNA integrated in this plant originated from the S. meliloti strain.
  • Wetting agents are examined for effects on transformation. Wetting agents include a variety of detergents (e.g., Triton) and other agents, such as Silwet L77. The effect of Silwet L77 on S. meliloti-media ⁇ ed transformation of rice is also examined.
  • Rice calli are co-cultured with & meliloti (pTi3)pCAMBIA1105.1R in media containing Silwet L77 ranging from 0.005% to 0.1% (w/v). After 7 days of co-culture at 22°C, the calli are assayed for GUS activity using X-GIcA.
  • Different tissues e.g. seed, germinated seedlings, calli, are examined for ability to be transformed.
  • rice seeds, seeds cultured for callus development for 7 days, and freshly harvested calli from cultured seeds are used.
  • the tissues are treated as indicated in the table with S. meliloti (pTi3)pCAMBIA1105.1R and then assayed for GUS activity after 8 days of co-culture.
  • the S. meliloti (pTi3)pCAMBIA1105.1R is prepared by culturing and re-suspension in AAMAS to an O.D. 6QO of about 1.0 as described elsewhere herein.
  • Rice tissues are incubated in the suspension of S. meliloti (pTi3)pCAMBIA1105.1R for 40 min or, for rice seed, with about 60 ⁇ L of the bacterial culture that is placed on top of the rice seeds.
  • Rice calli are transformed using Sinorhizobium in the presence of PEG (MW 3350).
  • S. meliloti (pTi3)pCAMBIA1105.1R is cultured on YM media (with appropriate antibiotic selection) for 3-4 days, then re-suspended in AAMAS media and cultured at room temp 22-26°C for 2-3 hours.
  • the re- suspended S. meliloti (pTi3)pCAMBIA1105.1R is mixed with AAMAS media containing PEG to a final O.D. 600 of about 1.0 and concentrations of PEG ranging from 0 to 20% (w/v).
  • Rice calli are incubated for 40 to 50 minutes, drained and dried on sterile filter paper for 20- 30 min and then co-cultured for 7 days on 2N6AS media (pH5.2) at 22 0 C. After co-culture, calli are assayed for GUS activity using X-GIcA (0.5 mg/ml X-GIcA, 5 min vacuum infiltration and overnight incubation at 37°C).
  • X-GIcA 0.5 mg/ml X-GIcA, 5 min vacuum infiltration and overnight incubation at 37°C.
  • Table 6 shows the result of several transformation experiments using S. meliloti with pTi3 and pCAMBIA1105.1R.
  • the bacterial suspensions used for leaf treatment are plated out on media that favor the growth of Agrobacterium colonies in comparison with that of the non-Agrobacteria.
  • Tobacco leaf disks are incubated in a mixture of Sinorhizobium meliloti and Agrobacterium tumefaciens, EHA105(pCAMBIA1305.2), at various ratios (see tables below), co-cultured for 3 days and then the disks were assayed for GUS activity.
  • Concentrations of the two bacterial cultures are determined separately by plating serial dilutions on appropriate media and counting colonies to determine cfu per ml of culture. Because S. meliloti contained no binary vector, any transformation of leaf disks would have to be the result of transformation by EHAl 05. These results indicate that after 3 days co-culture, as little as 10 cfu of Agrobacterium in 10 9 cfu/ml of Sinorhizobium can result in transformation of tobacco at very low frequency. The presence of even 1000 Agrobacterium cells harboring pCAMBIA1305.1 in a 20 ⁇ L suspension of S. meliloti containing pTi3 but without binary vector (Sme pTi3) does result in only a few blue spots in an add-back experiment, the results of which are shown in the tables below.
  • Plants are regenerated from the leaf discs and analyzed by amplification of the T-DNA markers. Genomic DNA is isolated from a leaf piece and used for amplification of the hygromycin gene (SEQ ID NOS: 82-83) and the MCS sequence (SEQ ID NO:46 and 79). The results are shown in Figure 15 and are summarized in Table 9. AU four plants co-cultivated with S. meliloti and all three plants co-cultivated with A. tumefaciens show the presence of the hygromycin band and are thus confirmed to be transformed.
  • Figure 18 shows the hybridization pattern of restricted genomic DNA from tobacco, Arabidopsis, and rice plant transformants.
  • genomic DNA approx. equal to 3 x 10 genomic copies (3 ⁇ g for rice, 27 ⁇ g for tobacco and 0.75 ⁇ g for Arabidopsis) is digested with EcaRI restriction enzyme, resolved on a 1% agarose gel and transferred to Hybond N+ membrane using NaOH (Sambrook et al., 1989 Molecular cloning: a laboratory manual. Cold Spring Harbor, NY. Cold Spring Harbor Press).
  • DNA probes are labeled with ⁇ -32P-dCTP using Ready-to-Go labeling beads (Pharmacia, Uppsala Sweden) and purified through NICK columns (Pharmacia).
  • Membranes are pre-hybridised at 65°C with rotation in SDS-PreHyb buffer (7% (w/v) SDS, 1% (w/v) BSA, 0.5 M NaHPO, ⁇ H7.2, 1 mM EDTA). After approximately 4 h, the labeled probe is added to the buffer and incubation continues for 16 hours. The membrane is washed twice for 10 min each at 65°C with 2X SSC + 0.1% SDS then twice for 10 min each with 0.2X SSC + 0.1% SDS.
  • RP4-4 The presence or absence of RP4-4 in the strains is confirmed by amplification in the presence of primers for part of the RP4 plasmid (SEQ ID NOS:80-81), using an annealing temperature of 62°C to prevent nonspecific binding, hi this example, the gene transfer capacity is assessed for Agrobacterium strain EHA105 containing pCAMBIA1405.1 with and without RP4-4.
  • the results are summarized in Table 10. In the absence of RP4-4, approximately 3000 GUS- expressing GUS foci are detected on 10 tobacco leaf disks assayed.
  • Bacteria are plated out onto YM plates with kanamycin (40 mg/L) and spectinomycin (80 mg/L) (rhizobi ⁇ ) or minA plates with kanamycin (50 mg/L) and spectinomycin (100 mg/L) (Agrobacterium). Plates are incubated at 28°C for two to three days. Bacteria are resuspended from the plates in Infiltration Medium (Ix MS salts, 5% sucrose, 50 mM MES-KOH pH 5.7, 0.1% Silwet L-77) to O.D. 600 nm of 1.0.
  • Ix MS salts 5% sucrose, 50 mM MES-KOH pH 5.7, 0.1% Silwet L-77
  • FIG. 13 shows the results of a transformation experiment using the Rhizobium spp. strain. In this experiment, one out of 300 seeds was hygromycin-resistant. The result shows that Rhizobium spp. NGR234 can transform Arabidopsis germline by floral dip transformation, hi a similar experiment, the S.
  • meliloti strain containing pTi3 and pCAMBIA1105.1R yielded 3 hygromycin-resistant Arabidopsis seedlings that expressed GUS and had the integrated pCAMBIAllOS.lR-specific MCS and Hyg R marker as revealed by amplification and confirmed by Southern blotting.
  • Floral dip transformation of Arabidopsis is further performed as described above except using modified infiltration media.
  • the infiltration media is varied by altering pH, sucrose concentration and, Silwet concentration.
  • the resultant transformants are confirmed by positive GUS staining and amplification using mcs-specific primers as described herein.
  • the different types of media used include: (i) low sucrose media (IX MS salts, 1% sucrose, 50 mM MES-KOH pH5.7, 0.1% Silwet L-77); (ii) low Silwet media (IX MS salts, 5% sucrose, 5OmM MES-KOH ⁇ H5.7, 0.02% Silwet L-77); (iii) pH7 media (IX MS salts, 5% sucrose, 50 mM MES-KOH pH7, 0.1% Silwet L-77); and combination media (IX MS salts, 1% sucrose, 5OmM MES-KOH pH7, 0.02% Silwet L-77).
  • low sucrose media IX MS salts, 1% sucrose, 50 mM MES-KOH pH5.7, 0.1% Silwet L-77
  • low Silwet media IX MS salts, 5% sucrose, 5OmM MES-KOH ⁇ H5.7, 0.02% Silwet L-77
  • pH7 media
  • Plant transformation protocols have largely been developed for Agrobacterium-mediatQd transformation.
  • bacteria of this invention which interact with plants and plant tissues in a different way, both the protocols and the tissues that are used for transformation are modified in order to accommodate the specific characteristics of the bacteria-plant interactions.
  • rhizobial species containing a pTi and binary vector are used for whole plant transformation of the common bean (Ph ⁇ seolus s ⁇ tiv ⁇ ).
  • the bacteria used in this example are the strains Rhizobium spp. NGR234 (ANU240) and S. meliloti 1021, both containing pTi3 and pCAMBIA1105.1R.
  • Cells growing in liquid TY medium with kanamycin (40 mg/L) and spectinomycin (80 mg/L) up to an OD at 600 nm of 1.5 are pelleted, resuspended in AAM medium with 100 ⁇ M acetosyringone and used for plant co-cultivation.
  • Beans are surface sterilized and germinated on wet filter paper in a petri dish. The seedlings are incubated in the bacterial suspension for 30 min, blotted dry and transferred to wet filter paper. After 5 days co-cultivation, the seedlings are assayed for GUS activity by treatment with X-GIcA. GUS foci on a seedling indicate the presence of cells that have acquired and express the GusPlus containing T-DNA.
  • Oligonucleotides ADAPL and ADSPS and ADSPS are incubated together under annealing conditions, mixed with the digested genomic DNA, and ligated to the genomic DNA.
  • Amplification of the adapter-ligated genomic DNA is performed using oligonucleotide API, which has an EcoRI recognition sequence at its 5' end and then identical sequence to ADAPL, and a primer specific to T-DNA sequence located near either the left (HYGRl, HYGR2) or right (GPFWl, GPFW2, GPFW3, NOSpolyAfw) T-DNA border.
  • the following parameters are used for amplification: an initial 2 min denaturation at 94°C followed by 30 cycles of 30 sec at 94 0 C, 30s at 60 0 C, 4 min at 68°C, and one cycle of 10 min at 68°C.
  • the amplification reaction is diluted 100-fold before a second round of amplification using nested adaptor primer NAPl and a nested primer specific to the T-DNA sequence near to either the left or right T-DNA border.
  • Amplification products are run on an agarose gel. Bands are purified from the gel and subjected to DNA sequence reaction and analysis.
  • the sequence flanking the single T-DNA insertion in Arabidopsis plant #4 shows a perfect match to the A. thaliana protein phosphatase 2C gene on chromosome I.
  • the sequence of the T-DNA insertion site for Arabidopsis plant #5 shows a match at the left and right border with a site in Arabidopsis chromosome I (BAC clones T23G18 and T6D22), but with a 20b ⁇ deletion at the insertion site.
  • the T-DNA insertion site for Arabidopsis plant #6 is on chromosome III (Arabidopsis BAC F16B3).
  • Rice, tobacco, and Arabidopsis are transformed by the protocols taught in the Examples above using Sinorhizobium. The next generation is examined for GUS activity in the seedling stage. Rice seeds were surface sterilized and germinated in vitro on media containing hygromycin. Tobacco and Arabidopsis seeds are germinated in soil. Southern blot analysis indicate that all transgenic parental plants have single copy T- DNA insert and thus the GUS activity and hygromycin should segregate 3:1.
  • NGR234 recA Rhizobium spp. see Figure3
  • 16Srevl492 CGGCTACCTTGTTACGACTT atpDfw294 ATCGGCGAGCCGGTCGACGA
  • AtpDrev771 GCCGACACTTCCGAACCNGCCTG recAfW63 ATCGAGCGGTCGTTCGGCAAGGG

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

L'invention concerne généralement des techniques destinées au transfert de molécules d'acides nucléiques vers des cellules eucaryotes. Elle concerne notamment des espèces non pathogènes d'une bactérie qui interagissent avec les cellules végétales et qui s'utilisent pour transférer des séquences d'acides nucléiques. Les bactéries pour transformer les végétaux contiennent des vecteurs binaires tels qu'un plasmide, avec une région vir d'un plasmide Ti et un plasmide avec une région T contenant une séquence d'ADN d'intérêt.
PCT/US2005/023250 2004-06-28 2005-06-28 Systeme biologique de transfert de genes pour cellules eucaryotes WO2006004914A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
BRPI0512791-2A BRPI0512791A (pt) 2004-06-28 2005-06-28 sistema de transferência de gene biológico para células eucarióticas
EP05764395A EP1781082A4 (fr) 2004-06-28 2005-06-28 Systeme biologique de transfert de genes pour cellules eucaryotes

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US58342604P 2004-06-28 2004-06-28
US60/583,426 2004-06-28
US10/954,147 US20050289672A1 (en) 2004-06-28 2004-09-28 Biological gene transfer system for eukaryotic cells
US10/953,392 2004-09-28
US10/953,392 US20050289667A1 (en) 2004-06-28 2004-09-28 Biological gene transfer system for eukaryotic cells
US10/954,147 2004-09-28

Publications (2)

Publication Number Publication Date
WO2006004914A2 true WO2006004914A2 (fr) 2006-01-12
WO2006004914A3 WO2006004914A3 (fr) 2007-10-11

Family

ID=35783352

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/023250 WO2006004914A2 (fr) 2004-06-28 2005-06-28 Systeme biologique de transfert de genes pour cellules eucaryotes

Country Status (3)

Country Link
EP (1) EP1781082A4 (fr)
BR (1) BRPI0512791A (fr)
WO (1) WO2006004914A2 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007137075A3 (fr) * 2006-05-16 2008-04-24 Monsanto Technology Llc Utilisation d'espèces batériennes non agrobactériennes pour la transformation de plantes
WO2011116708A1 (fr) * 2010-03-26 2011-09-29 中国科学院上海生命科学研究院 Procédé de modification de caractères des plantes
WO2011161617A1 (fr) * 2010-06-24 2011-12-29 Basf Plant Science Company Gmbh Plantes ayant des traits liés au rendement améliorés et procédé pour les obtenir
WO2012025864A1 (fr) * 2010-08-24 2012-03-01 Basf Plant Science Company Gmbh Plantes ayant des caractères relatifs au rendement améliorés et leur procédé de fabrication
WO2012149883A1 (fr) * 2011-05-04 2012-11-08 The Univeristy Of Hong Kong Procédé pour l'accélération de la croissance végétale et l'amélioration du rendement par la modification des niveaux d'expression de kinases et de phosphatases
EP2651207A1 (fr) * 2010-12-17 2013-10-23 Monsanto Technology LLC Procédé pour améliorer la compétence de cellules végétales
CN106318969A (zh) * 2016-06-14 2017-01-11 扬州大学 一种小麦转化3t超毒载体及其制备方法和应用
WO2017040343A1 (fr) * 2015-08-28 2017-03-09 Pioneer Hi-Bred International, Inc. Transformation de plantes médiée par ochrobactrum
WO2017078836A1 (fr) * 2015-11-06 2017-05-11 Pioneer Hi-Bred International, Inc. Procédés et compositions de transformation végétale améliorée
WO2020128968A1 (fr) 2018-12-20 2020-06-25 Benson Hill, Inc. Traitements de préconditionnement pour améliorer la transformation de végétaux
WO2021260632A1 (fr) 2020-06-24 2021-12-30 Benson Hill, Inc. Traitements de cellules végétales pour améliorer la transformation de plantes

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL8502948A (nl) * 1985-10-29 1987-05-18 Rijksuniversiteit Leiden En Pr Werkwijze voor het inbouwen van "vreemd dna" in het genoom van dicotyle planten.

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1781082A4 *

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3608413A1 (fr) * 2006-05-16 2020-02-12 Monsanto Technology LLC Utilisation d'espèces bactériennes non agrobacterium pour la transformation de plantes
US7888552B2 (en) 2006-05-16 2011-02-15 Monsanto Technology Llc Use of non-agrobacterium bacterial species for plant transformation
EP2361986A1 (fr) * 2006-05-16 2011-08-31 Monsanto Technology LLC Utilisation d'espèces bactériennes non Agrobacterium pour la transformation de plantes
EP3196311A1 (fr) * 2006-05-16 2017-07-26 Monsanto Technology LLC Utilisation d'espèces bactériennes non agrobacterium pour la transformation de plantes
EP2371964A1 (fr) * 2006-05-16 2011-10-05 Monsanto Technology LLC Utilisation d'espèces bactériennes non Agrobacterium pour la transformation de plantes
US10006035B2 (en) 2006-05-16 2018-06-26 Monsanto Technology Llc Use of non-Agrobacterium bacterial species for plant transformation
US9365859B2 (en) 2006-05-16 2016-06-14 Monsanto Technology Llc Use of non-agrobacterium bacterial species for plant transformation
WO2007137075A3 (fr) * 2006-05-16 2008-04-24 Monsanto Technology Llc Utilisation d'espèces batériennes non agrobactériennes pour la transformation de plantes
EP2803728A1 (fr) * 2006-05-16 2014-11-19 Monsanto Technology LLC Utilisation d'espèces bactériennes non agrobacterium pour la transformation de plantes
US10724042B2 (en) 2006-05-16 2020-07-28 Monsanto Technology Llc Use of non-Agrobacterium bacterial species for plant transformation
WO2011116708A1 (fr) * 2010-03-26 2011-09-29 中国科学院上海生命科学研究院 Procédé de modification de caractères des plantes
CN103068992A (zh) * 2010-06-24 2013-04-24 巴斯夫植物科学有限公司 具有增强的产量相关性状的植物和用于制备该植物的方法
WO2011161617A1 (fr) * 2010-06-24 2011-12-29 Basf Plant Science Company Gmbh Plantes ayant des traits liés au rendement améliorés et procédé pour les obtenir
WO2012025864A1 (fr) * 2010-08-24 2012-03-01 Basf Plant Science Company Gmbh Plantes ayant des caractères relatifs au rendement améliorés et leur procédé de fabrication
EP2651207A4 (fr) * 2010-12-17 2014-03-12 Monsanto Technology Llc Procédé pour améliorer la compétence de cellules végétales
US11091767B2 (en) 2010-12-17 2021-08-17 Monsanto Technology Llc Methods for improving competency of corn plant immature embryo
EP4059342A1 (fr) * 2010-12-17 2022-09-21 Monsanto Technology LLC Procédé pour améliorer la compétence de cellules végétales
EP3275308A1 (fr) * 2010-12-17 2018-01-31 Monsanto Technology LLC Procédé pour améliorer la compétence de cellules végétales
US11473094B2 (en) 2010-12-17 2022-10-18 Monsanto Technology, Llc Methods for improving competency of plant cells
EP2651207A1 (fr) * 2010-12-17 2013-10-23 Monsanto Technology LLC Procédé pour améliorer la compétence de cellules végétales
US10407685B2 (en) 2010-12-17 2019-09-10 Monsanto Technology Llc Methods for improving competency of plant cells
WO2012149883A1 (fr) * 2011-05-04 2012-11-08 The Univeristy Of Hong Kong Procédé pour l'accélération de la croissance végétale et l'amélioration du rendement par la modification des niveaux d'expression de kinases et de phosphatases
US11236347B2 (en) 2015-08-28 2022-02-01 Pioneer Hi-Bred International, Inc. Ochrobactrum-mediated transformation of plants
WO2017040343A1 (fr) * 2015-08-28 2017-03-09 Pioneer Hi-Bred International, Inc. Transformation de plantes médiée par ochrobactrum
CN108350465A (zh) * 2015-11-06 2018-07-31 先锋国际良种公司 改善植物转化的方法和组合物
WO2017078836A1 (fr) * 2015-11-06 2017-05-11 Pioneer Hi-Bred International, Inc. Procédés et compositions de transformation végétale améliorée
CN106318969A (zh) * 2016-06-14 2017-01-11 扬州大学 一种小麦转化3t超毒载体及其制备方法和应用
WO2020128968A1 (fr) 2018-12-20 2020-06-25 Benson Hill, Inc. Traitements de préconditionnement pour améliorer la transformation de végétaux
WO2021260632A1 (fr) 2020-06-24 2021-12-30 Benson Hill, Inc. Traitements de cellules végétales pour améliorer la transformation de plantes

Also Published As

Publication number Publication date
EP1781082A2 (fr) 2007-05-09
EP1781082A4 (fr) 2008-08-27
BRPI0512791A (pt) 2007-10-23
WO2006004914A3 (fr) 2007-10-11

Similar Documents

Publication Publication Date Title
EP1781082A2 (fr) Systeme biologique de transfert de genes pour cellules eucaryotes
EP3341483B1 (fr) Transformation de plantes médiée par ochrobactrum
EP0176112B1 (fr) Procédé d'introduction d'un ADN étranger dans le génome des plantes
Depicker et al. Frequencies of simultaneous transformation with different T-DNAs and their relevance to the Agrobacterium/plant cell interaction
Boulton et al. Specificity of Agrobacterium-mediated delivery of maize streak virus DNA to members of the Gramineae
EP0687730B1 (fr) Procede de transformation de plantes et vecteur necessaire
US5463174A (en) Transformation and foreign gene expression in Brassica species
EP0122791B2 (fr) Expression de gène végétal
US5750871A (en) Transformation and foreign gene expression in Brassica species
US5668298A (en) Selectable marker for development of vectors and transformation systems in plants
US7939328B1 (en) Method of transforming monocotyledons using scutella of immature embryos
US5102796A (en) Plant structural gene expression
EP0270615B1 (fr) TRANSFORMATION DE CULTURES DE CELLULES ET EXPRESSION D'UN GENE ETRANGER DANS DES ESPECES $i(BRASSICA)
JPS6070081A (ja) 双子葉植物の染色体への外来性遺伝子の導入方法
US20120192318A1 (en) Transformation system for Camelina sativa
IL84381A (en) Process for genetic modification of single-stemmed plants from the Germanic family (EAENIMARG) (using agrobacterium) MUIRETCABORGA (
Hoekema et al. Delivery of T‐DNA from the Agrobacterium tumefaciens chromosome into plant cells
JP2018537123A (ja) 改良された植物形質転換の方法および組成物
Palanichelvam et al. A second T-region of the soybean-supervirulent chrysopine-type Ti plasmid pTiChry5, and construction of a fully disarmed vir helper plasmid
US6048730A (en) Selectable marker for development of vectors and transformation systems in plants
EP0126546B2 (fr) Expression de gènes structurels de plantes
Tinland et al. Agrobacterium tumefaciens T-DNA gene 6b stimulates rol-induced root formation, permits growth at high auxin concentrations and increases root size
Özyiğit Agrobacterium tumefaciens and its use in plant biotechnology
US20090075358A1 (en) Vectors for transformation of plant cells
CN101123869A (zh) 用于真核细胞的生物基因转移系统

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 8004/DELNP/2006

Country of ref document: IN

WWW Wipo information: withdrawn in national office

Ref document number: DE

WWE Wipo information: entry into national phase

Ref document number: 2005764395

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 200580029146.8

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005764395

Country of ref document: EP

ENP Entry into the national phase in:

Ref document number: PI0512791

Country of ref document: BR