WO2005123915A1 - Stably maintained multiple copies of at least two orf in the same orientation - Google Patents
Stably maintained multiple copies of at least two orf in the same orientation Download PDFInfo
- Publication number
- WO2005123915A1 WO2005123915A1 PCT/DK2005/000409 DK2005000409W WO2005123915A1 WO 2005123915 A1 WO2005123915 A1 WO 2005123915A1 DK 2005000409 W DK2005000409 W DK 2005000409W WO 2005123915 A1 WO2005123915 A1 WO 2005123915A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- orf
- host cell
- plasmid
- sequence
- dna
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/40—Systems of functionally co-operating vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/20—Vector systems having a special element relevant for transcription transcription of more than one cistron
Definitions
- TITLE Stably maintained multiple copies of at least two ORF in the same orientation.
- TECHNICAL FIELD A method for constructing a stable cell expressing a gene of interest and comprising at least two copies of said gene on the chromosome.
- BACKGROUND ART In the industrial production of polypeptides it is of interest to achieve a product yield as high as possible and to be able to control the said expression.
- One way to increase the yield is to increase the copy number of a gene encoding a polypeptide of interest. This can be done by placing the gene on a high copy number plasmid. However, plasmids are unstable and are often lost from the host cells if there is no selective pressure during the cultivation of the host cells.
- Another way to increase the copy number of the gene of interest is to integrate it into the host cell chromosome in multiple copies.
- the present invention provides a solution in which at least two copies of the gene can be integrated in the same orientation on the host cell chromosome, either in different positions or in the same position e.g. as a tandem repeat.
- the first aspect of the present invention therefore relates to a method for constructing a host cell expressing a polypeptide of interest from at least two ORF's stably integrated onto the chromosome of the host cell comprising the steps of: a) providing the at least two ORF's encoding the same polypeptide, wherein the at least two DNA sequences of the ORF's differ in at least one position; b) integrating the at least two ORF's in the same orientation on the host cell chromosome.
- the second aspect of the present invention relates to a host cell comprising at least two ORF's encoding the same polypeptide stably integrated in the same orientation onto the host cell chromosome wherein the at least two DNA sequences of the ORF's differ in at least one position.
- the third aspect of the present invention relates to a nucleic acid construct comprising at least two ORF's encoding the same polypeptide in the same orientation, wherein the at least two DNA sequences of the ORF's differ in at least one position.
- the fourth aspect of the present invention relates to a method of producing the same polypeptide from at least two ORF's stably integrated onto the host cell chromosome comprising the steps of: i) culturing a host cell according to the invention under conditions conducive for the expression of the polypeptide; and optionally ii) recovering the polypeptide.
- Fig. 1 shows a nucleic acid construct of the invention in a vector, pSJ7365, suitable for integrating two ORF in tandem repeat on the chromosome of the host cell.
- the object of the present invention is to solve the observed instability problem associated with expression of multiple gene copies integrated on a host cell chromosome in the same orientation, from e.g. a polycistronic messenger, and at the same time reduce the time required for constructing the host cell. According to the present invention only integration in one location is necessary.
- This object is solved by a method for constructing a host cell expressing a polypeptide of interest from at least two ORF's stably integrated onto the chromosome of the host cell comprising the steps of: a) providing the at least two ORF's encoding the same polypeptide, wherein the at least two DNA sequences of the ORF's differ in at least one position; b) integrating the at least two ORF's in the same orientation on the host cell chromosome.
- An "open reading frame”, (ORF) in the present invention means a DNA sequence that contains a signal for the start of translation followed in the correct register by a sufficient length of amino acid-encoding triplets to form a protein or a polypeptide, followed by a signal for termination of translation.
- a "polypeptide” in the present invention means two or more amino acids linked by peptide bonds.
- the "same polypeptide” referred to above is intended to mean that the at least two open reading frames (ORF's) encode functionally identical polypeptides. Therefore polypeptides having insignificant sequence differences, which do not alter the functionality of the polypeptide, e.g. in the case where an amino acid which does not alter the function has been changed or where additions or deletions have been introduced in the C- or N-terminus, are also comprised.
- the "same polypeptide” refers to identical polypeptides.
- the ORF's according to the invention can be integrated at different positions on the host cell chromosome or at the same position.
- the instability problems observed is more pronounced when the ORF's are located close together, however, the method according to the invention should provide stability to multiple ORF's encoding the same polypeptide in any situation where such multiple copies are present on the chromosome or on a plasmid in the same orientation.
- the ORF's are transcribed as a polycistronic messenger.
- Nucleic Acid Constructs The present invention also relates to nucleic acid constructs comprising a nucleic acid sequence of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. Expression will be understood to include any step involved in the production of the polypeptide including, but not limited to, transcription, post- transcriptional modification, translation, post-translational modification, and secretion.
- "Nucleic acid construct” is defined herein as a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acid combined and juxtaposed in a manner that would not otherwise exist in nature.
- nucleic acid construct is synonymous with the term expression cassette when the nucleic acid construct contains all the control sequences required for expression of a coding sequence of the present invention.
- coding sequence is defined herein as a nucleic acid sequence that directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by a ribosome binding site (prokaryotes) or by the ATG start codon (eukaryotes) located just upstream of the open reading frame at the 5' end of the mRNA and a transcription terminator sequence located just downstream of the open reading frame at the 3' end of the mRNA.
- a coding sequence can include, but is not limited to, DNA, cDNA, and recombinant nucleic acid sequences.
- An isolated nucleic acid sequence encoding a polypeptide of the present invention may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the nucleic acid sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying nucleic acid sequences utilizing recombinant DNA methods are well known in the art.
- control sequences is defined herein to include all components that are necessary or advantageous for the expression of a polypeptide of the present invention. Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide.
- control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
- the control sequences include a promoter, and transcriptional and translational stop signals.
- the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleic acid sequence encoding a polypeptide.
- linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleic acid sequence encoding a polypeptide.
- operably linked is defined herein as a configuration in which a control sequence is appropriately placed at a position relative to the coding sequence of the DNA sequence such that the control sequence directs the expression of a polypeptide.
- the control sequence may be an appropriate promoter sequence, a nucleic acid sequence that is recognized by a host cell for expression of the nucleic acid sequence.
- the promoter sequence contains transcriptional control sequences that mediate the expression of the polypeptide.
- the promoter may be any nucleic acid sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
- suitable promoters for directing the transcription of the nucleic acid constructs of the present invention are the promoters obtained from the E. coli lac operon, Streptomyces coelicolor agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha- amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, and prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75: 3727-3731), as well as the tac promoter (DeBoer et al., 1983,
- promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha- amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, and Fus
- useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP), and Saccharomyces cerevisiae 3-phosphoglycerate kinase.
- Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.
- the control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the polypeptide.
- terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin- like protease.
- Preferred terminators for yeast host cells are obtained from the genes for
- Saccharomyces cerevisiae enolase Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase.
- Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
- Preferred terminators for bacterial host cells are the terminators from Bacillus licheniformis alpha-amylase gene (amyL), the Bacillus stearothermophilus maltogenic amylase gene (amyM), or the Bacillus amyloliquefaciens alpha-amylase gene (amyQ).
- the control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell.
- the leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide.
- leader sequence that is functional in the host cell of choice may be used in the present invention.
- Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
- Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
- the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleic acid sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
- Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin-like protease, and Aspergillus niger alpha-glucosidase.
- Useful polyadenylation sequences for yeast host cells are described by Guo and
- the control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway.
- the 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide.
- the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region.
- the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide.
- any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice may be used in the present invention.
- Effective signal peptide coding regions for bacterial host cells are the signal peptide coding regions obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus stearothermophilus alpha-amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis alpha-amylase, Bacillus stearothermophilus neutral proteases (nprT, nprS, nprM), and Bacillus subtilis prsA. Further signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.
- Effective signal peptide coding regions for filamentous fungal host cells are the signal peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase.
- Useful signal peptides for yeast host cells are obtained from the genes for
- the control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide.
- the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
- a propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
- the propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila laccase (WO 95/33836). Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.
- regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell.
- regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
- Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems.
- yeast the ADH2 system or GAL1 system may be used.
- filamentous fungi the TAKA alpha-amylase promoter, Aspergillus niger glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences.
- Other examples of regulatory sequences are those which allow for gene amplification.
- nucleic acid construct In eukaryotic systems, these include the dihydrofolate reductase gene which is amplified in the presence of methotrexate, and the metallothionein genes which are amplified with heavy metals. In these cases, the nucleic acid sequence encoding the polypeptide would be operably linked with the regulatory sequence.
- the nucleic acid construct according to the present invention is used in the method of the invention for the construction of the host cell.
- the present invention also relates to recombinant expression vectors comprising a nucleic acid sequence of the present invention, a promoter, and transcriptional and translational stop signals.
- the various nucleic acid and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleic acid sequence encoding the polypeptide at such sites.
- the nucleic acid sequence of the present invention may be expressed by inserting the nucleic acid sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression.
- the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
- the recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleic acid sequence.
- the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
- the vectors may be linear or closed circular plasmids.
- the vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
- the vector may contain any means for assuring self-replication.
- the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
- a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
- the vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed cells.
- a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
- a conditionally essential gene may function as a non-antibiotic selectable marker.
- Non-limiting examples of bacterial conditionally essential non-antibiotic selectable markers are the dal genes from Bacillus subtilis, Bacillus licheniformis, or other Bacilli, that are only essential when the bacterium is cultivated in the absence of D-alanine.
- genes encoding enzymes involved in the turnover of UDP-galactose can function as conditionally essential markers in a cell when the cell is grown in the presence of galactose or grown in a medium which gives rise to the presence of galactose.
- Non-limiting examples of such genes are those from B. subtilis or B. licheniformis encoding UTP-dependent phosphorylase (EC 2.7.7.10), UDP-glucose-dependent uridylyltransferase (EC 2.7.7.12), or UDP-galactose epimerase (EC 5.1.3.2).
- a xylose isomerase gene such as xylA, of Bacilli can be used as selectable markers in cells grown in minimal medium with xylose as sole carbon source.
- the genes necessary for utilizing gluconate, gntK, and gntP can also be used as selectable markers in cells grown in minimal medium with gluconate as sole carbon source.
- Other examples of conditionally essential genes are known in the art.
- Antibiotic selectable markers confer antibiotic resistance to such antibiotics as, e.g., ampicillin, kanamycin, chloramphenicol, erythromycin, tetracycline, neomycin, hygromycin or methotrexate.
- Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3.
- Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), as well as equivalents thereof.
- the vectors of the present invention preferably contain an element(s) that permits stable integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
- the vector may rely on the nucleic acid sequence encoding the polypeptide or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologous recombination.
- the vector may contain additional nucleic acid sequences for directing integration by homologous recombination into the genome of the host cell.
- the additional nucleic acid sequences enable the vector to be integrated into the host cell genome at a precise location(s) in the chromosome(s).
- the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 1 ,500 base pairs, preferably 400 to 1,500 base pairs, and most preferably 800 to 1 ,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination.
- the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell.
- the integrational elements may be non-encoding or encoding nucleic acid sequences.
- the vector may be integrated into the genome of the host cell by non-homologous recombination.
- the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
- bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, and pUB110, pE194, pTA1060, and pAM ⁇ l permitting replication in Bacillus.
- origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1 , ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.
- the origin of replication may be one having a mutation which makes it functioning temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75: 1433). More than one copy of a nucleic acid sequence of the present invention may be inserted into the host cell to increase production of the gene product.
- An increase in the copy number of the nucleic acid sequence can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the nucleic acid sequence where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the nucleic acid sequence, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
- the procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook er a/., 1989, supra).
- the cell is preferably transformed with a vector comprising ORF's of the invention followed by integration of the vector into the host chromosome.
- Transformation means introducing a vector comprising a nucleic acid sequence of the present invention into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector. Integration is generally considered to be an advantage as the nucleic acid sequence is more likely to be stably maintained in the cell.
- the vector targets a specific chromosomal site for homologous recombination.
- the vector will contain sufficiently long regions of homology to sequences of the chromosome to allow complementary binding and incorporation of the vector into the chromosome. Longer regions of homology, and greater degrees of sequence similarity, may increase the efficiency of homologous recombination.
- the segment (contiguous sequence) having a 100 % sequence homology is at the most 750 bp, particularly 500 bp, more particularly 250 bp, more particularly 200 bp, even more particularly 150 bp, most particularly 100 bp.
- segment length is at the most 80 bp, particularly 70 bp, more particularly 50 bp, even more particularly 40 bp, more particularly 30 bp, or at the most 20 bp or 10 bp.
- the ORF encodes a polypeptide corresponding to a complete protein. This could be a mature form of the protein or including the pro-peptide.
- the situation is relatively simple since the DNA sequence comprising the ORF will be a contiguous DNA sequence not interrupted by non-coding regions.
- the at least two ORF's could be represented by DNA sequences comprising both introns and exons.
- the essential feature according to the invention will, however, be unchanged since the stability of the construct relies on the introduction of sequence changes affecting the recombination fequency, whether present in coding or non- coding regions, which changes will not result in a different polypeptide but rather the same polypeptide will be produced.
- nucleic acid construct may be synonymous with the term expression cassette when the nucleic acid construct contains all the control sequences required for expression of a coding sequence of the present invention.
- coding sequence as defined herein is a sequence which is transcribed into mRNA and translated into a polypeptide of the present invention when placed under the control of the above mentioned control sequences. The boundaries of the coding sequence are generally determined by a translation start codon ATG at the 5'-terminus and a translation stop codon at the 3'-terminus.
- a coding sequence can include, but is not limited to, DNA, cDNA, and recombinant nucleic acid sequences.
- Host Cells The present invention also relates to recombinant host cells, comprising an ORF of the invention, which are advantageously used in the recombinant production of the polypeptides.
- a vector comprising a nucleic acid sequence of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier.
- the term "host cell” encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
- the host cell may be a unicellular microorganism, e.g., a prokaryote, or a non-unicellular microorganism, e.g., a eukaryote.
- Useful unicellular cells are bacterial cells such as gram positive bacteria including, but not limited to, a Bacillus cell, or a Streptomyces cell, or cells of lactic acid bacteria; or gram negative bacteria such as E. coli and Pseudomonas sp.
- Lactic acid bacteria include, but are not limited to, species of the genera Lactococcus, Lactobacillus, Leuconostoc, Streptococcus, Pediococcus, and Enterococcus.
- Useful unicellular cells are bacterial cells such as gram positive bacteria including, but not limited to, a Bacillus cell, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megatehum, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis; or a Streptomyces cell, e.g., Streptomyces lividans or Streptomyces murinus, or gram negative bacteria such as E.
- a Bacillus cell e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus
- the bacterial host cell is a Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus or Bacillus subtilis cell.
- the Bacillus cell is an alkalophilic Bacillus.
- the introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, e.g., Young and Spizizin, 1961 , Journal of Bacteriology 81 : 823-829, or Dubnau and Davidoff-Abelson, 1971 , Journal of Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).
- protoplast transformation see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115
- competent cells see, e.g., Young and Spizizin, 1961 , Journal of Bacteriology 81 : 823-8
- the host cell may be a eukaryote, such as a non-human animal cell, an insect cell, a plant cell, or a fungal cell.
- the host cell is a fungal cell.
- "Fungi” as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth er al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth er a/., 1995, supra).
- the fungal host cell is a yeast cell.
- yeast as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F.A., Passmore, S.M., and Davenport, R.R., eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
- the yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia,
- the fungal host cell may be a filamentous fungal cell.
- "Filamentous fungi” include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra).
- the filamentous fungi are characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.
- filamentous fungal host cells are cells of species of, but not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, or Trichoderma.
- Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se.
- Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470- 1474. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156 and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N.
- the invention relates to a recombinant host cell comprising a polynucleotide of the invention, or an expression vector or polynucleotide construct of the invention.
- the recombinant host cell is a Bacillus cell.
- the present invention also relates to a transgenic plant, plant part, or plant cell which has been transformed with a nucleic acid sequence encoding a polypeptide so as to express and produce the polypeptide in recoverable quantities.
- the polypeptide may be recovered from the plant or plant part.
- the plant or plant part containing the recombinant polypeptide may be used as such for improving the quality of a food or feed, e.g., improving nutritional value, palatability, and rheological properties, or to destroy an antinutritive factor.
- the polypeptide is targeted to the endosperm storage vacuoles in seeds.
- the transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot) or engineered variants thereof.
- monocot plants are grasses, such as meadow grass (blue grass, Poa), forage grass such as festuca, lolium, temperate grass, such as Agrostis, and cereals, e.g., wheat, oats, rye, barley, rice, sorghum, and maize (corn).
- dicot plants are tobacco, legumes, such as lupins, potato, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape seed, and the closely related model organism Arabidopsis thaliana.
- Low-phytate plants as described e.g. in US patent no. 5,689,054 and US patent no. 6,111,168 are examples of engineered plants.
- plant parts are stem, callus, leaves, root, fruits, seeds, and tubers.
- specific plant tissues such as chloroplast, apoplast, mitochondria, vacuole, peroxisomes, and cytoplasm are considered to be a plant part.
- any plant cell, whatever the tissue origin, is considered to be a plant part.
- the progeny of such plants, plant parts and plant cells are included within the scope of the present invention.
- the transgenic plant or plant cell expressing a polypeptide of the present invention may be constructed in accordance with methods known in the art. Briefly, the plant or plant cell is constructed by incorporating one or more expression constructs encoding a polypeptide of the present invention into the plant host genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.
- the expression construct is a nucleic acid construct which comprises a nucleic acid sequence encoding a polypeptide of the present invention operably linked with appropriate regulatory sequences required for expression of the nucleic acid sequence in the plant or plant part of choice.
- the expression construct may comprise a selectable marker useful for identifying host cells into which the expression construct has been integrated and DNA sequences necessary for introduction of the construct into the plant in question (the latter depends on the DNA introduction method to be used).
- the choice of regulatory sequences, such as promoter and terminator sequences and optionally signal or transit sequences are determined, for example, on the basis of when, where, and how the polypeptide is desired to be expressed.
- the expression of the gene encoding a polypeptide of the present invention may be constitutive or inducible, or may be developmental, stage or tissue specific, and the gene product may be targeted to a specific tissue or plant part such as seeds or leaves. Regulatory sequences are, for example, described by Tague et al., 1988, Plant Physiology 86: 506.
- the 35S-CaMV promoter may be used (Franck et al., 1980, Cell 21 : 285-294).
- Organ-specific promoters may be, for example, a promoter from storage sink tissues such as seeds, potato tubers, and fruits (Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from metabolic sink tissues such as meristems (Ito er al., 1994, Plant Mol. Biol.
- a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu et al., 1998, Plant and Cell Physiology 39: 885-889), a Vicia faba promoter from the legumin B4 and the unknown seed protein gene from Vicia faba (Conrad er al., 1998, Journal of Plant Physiology 152: 708-711), a promoter from a seed oil body protein (Chen et al., 1998, Plant and Cell Physiology 39: 935-941), the storage protein napA promoter from Brassica napus, or any other seed specific promoter known in the art, e.g., as described in WO 91/14772.
- a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu et al., 1998, Plant and Cell Physiology 39: 885-889)
- the promoter may be a leaf specific promoter such as the rbcs promoter from rice or tomato (Kyozuka et al., 1993, Plant Physiology 102: 991-1000, the chlorella virus adenine methyltransferase gene promoter (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the aldP gene promoter from rice (Kagaya er al., 1995, Molecular and General Genetics 248: 668-674), or a wound inducible promoter such as the potato pin2 promoter (Xu et al., 1993, Plant Molecular Biology 22: 573-588).
- a promoter enhancer element may also be used to achieve higher expression of the protease in the plant.
- the promoter enhancer element may be an intron which is placed between the promoter and the nucleotide sequence encoding a polypeptide of the present invention.
- Xu et al., 1993, supra disclose the use of the first intron of the rice actin 1 gene to enhance expression.
- the selectable marker gene and any other parts of the expression construct may be chosen from those available in the art.
- the nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobacterium-me a e ⁇ transformation, virus- mediated transformation, microinjection, particle bombardment, biolistic transformation, and electroporation (Gasser et al., 1990, Science 244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).
- Agrobacterium tumefaciens-med ated gene transfer is the method of choice for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38). However it can also be used for transforming monocots, although other transformation methods are generally preferred for these plants.
- the method of choice for generating transgenic monocots is particle bombardment (microscopic gold or tungsten particles coated with the transforming DNA) of embryonic calli or developing embryos (Christou, 1992, Plant Journal 2: 275-281 ; Shimamoto, 1994, Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992, Bio/Technology 10: 667-674).
- the ORF's according to the invention encodes the same polypeptide, which in a particular embodiment is an enzyme.
- the enzyme in the context of the present invention may be any enzyme obtainable by fermentation.
- the enzyme classification employed in the present specification and claims is in accordance with Recommendations (1992) of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology, Academic Press, Inc., 1992.
- oxidoreductases EC 1.-.-.-
- transferases EC 2.-.-.-
- hydrolases EC 3.-.-.-
- lyases EC 4.-.-.-
- isomerases EC 5.-.-.-
- ligases EC 6.-.-.-
- Preferred oxidoreductases in the context of the invention are peroxidases (EC 1.11.1) such as haloperoxidase, laccases (EC 1.10.3.2) and glucose oxidases (EC 1.1.3.4)]
- preferred transferases are transferases in any of the following sub-classes:
- a most preferred type of transferase in the context of the invention is a transglutaminase (protein-glutamine ⁇ -glutamyltransferase; EC 2.3.2.13).
- transglutaminases are described in WO 96/06931 (Novo Nordisk A/S).
- Preferred hydrolases in the context of the invention are: Carboxylic ester hydrolases (EC 3.1.1.-) such as lipases (EC 3.1.1.3); phytases (EC 3.1.3.-), e.g. 3-phytases (EC 3.1.3.8) and 6-phytases (EC 3.1.3.26); glycosidases (EC 3.2, which fall within a group denoted herein as "carbohydrases”), such as ⁇ -amylases (EC 3.2.1.1); peptidases (EC 3.4, also known as proteases); and other carbonyl hydrolases.
- Carboxylic ester hydrolases EC 3.1.1.-
- lipases EC 3.1.1.3
- phytases EC 3.1.3.-
- 3-phytases EC 3.1.3.8
- 6-phytases EC 3.1.3.26
- glycosidases EC 3.2, which fall within a group denoted herein as "carbohydra
- proteases Polypeptides having protease activity, or proteases, are sometimes also designated peptidases, proteinases, peptide hydrolases, or proteolytic enzymes.
- Proteases may be of the exo-type that hydrolyses peptides starting at either end thereof, or of the endo-type that act internally in polypeptide chains (endopeptidases). Endopeptidases show activity on N- and C-terminally blocked peptide substrates that are relevant for the specificity of the protease in question.
- proteases is defined herein as an enzyme that hydrolyses peptide bonds. It includes any enzyme belonging to the EC 3.4 enzyme group (including each of the thirteen subclasses thereof).
- the EC number refers to Enzyme Nomenclature 1992 from NC-IUBMB, Academic Press, San Diego, California, including supplements 1-5 published in Eur. J. Biochem. 1994, 223, 1-5; Eur. J. Biochem. 1995, 232, 1-6; Eur. J. Biochem. 1996, 237, 1-5; Eur. J. Biochem. 1997, 250, 1-6; and Eur. J. Biochem. 1999, 264, 610-650; respectively.
- the nomenclature is regularly supplemented and updated; see e.g. the World Wide Web (WWW) at http://www.chem.qmw.ac.uk/iubmb/enzyme/index.html).
- Proteases are classified on the basis of their catalytic mechanism into the following groups: Serine proteases (S), Cysteine proteases (C), Aspartic proteases (A), Metalloproteases (M), and Unknown, or as yet unclassified, proteases (U), see Handbook of Proteolytic Enzymes, A.J.Barrett, N.D.Rawlings, J.F.Woessner (eds), Academic Press (1998), in particular the general introduction part. Serine proteases are ubiquitous, being found in viruses, bacteria and eukaryotes; they include exopeptidase, endopeptidase, oligopeptidase and omega-peptidase activity.
- proteolytic enzymes Another classification system of proteolytic enzymes is based on sequence information, and is therefore used more often in the art of molecular biology; it is described in Rawlings, N.D. et al., 2002, MEROPS: The protease database. Nucleic Acids Res. 30:343- 346. The MEROPS database is freely available electronically at http://www.merops.ac.uk. According to the MEROPS system, the proteolytic enzymes classified as S2A in 'The Handbook of Proteolytic Enzymes', are in MEROPS classified as 'S1 E' proteases (Rawlings ND, Barrett AJ. (1993) Evolutionary families of peptidases, Biochem. J. 290:205-218).
- proteases of the invention and for use according to the invention are selected from the group consisting of:
- protease For determining whether a given protease is a Serine protease, and a family S2A protease, reference is made to the above Handbook and the principles indicated therein. Such determination can be carried out for all types of proteases, be it naturally occurring or wild- type proteases; or genetically engineered or synthetic proteases.
- the enzyme is a protease.
- the protease is a serine protease.
- the serine protease is in one embodiment chosen from the group consisting of S2A or S1 E.
- the serine protease is encoded from a sequence chosen from the group consisting of SEQ ID NO: 1 , 2 or 51.
- Protease activity can be measured using any assay, in which a substrate is employed, that includes peptide bonds relevant for the specificity of the protease in question.
- Assay-pH and assay-temperature are likewise to be adapted to the protease in question. Examples of assay-pH-values are pH 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , or 12. Examples of assay-temperatures are 30, 35, 37, 40, 45, 50, 55, 60, 65, 70, 80, 90, or 95°C.
- protease substrates are casein, such as Azurine-Crosslinked Casein (AZCL- casein).
- AZCL- casein Azurine-Crosslinked Casein
- the so-called pNA Assay is a preferred assay.
- S2A protease activity can be measured using the PNA assay with succinyl-alanine-alanine- proline-phenylalnine-paranitroanilide as a substrate unless otherwise mention.
- the principle of the PNA assay is described in Rothgeb, T.M., Goodlander, B.D., Garrison, P.H., and Smith, LA, Journal of the American Oil Chemists' Society, Vol. 65 (5) pp. 806-810 (1988).
- carbohydrase is used to denote not only enzymes capable of breaking down carbohydrate chains (e.g. starches) of especially five- and six-membered ring structures (i.e. glycosidases, EC 3.2), but also enzymes capable of isomerizing carbohydrates, e.g. six-membered ring structures such as D-glucose to five-membered ring structures such as D-fructose.
- Carbohydrases of relevance include the following (EC numbers in parentheses): ⁇ -amylases (3.2.1.1), ⁇ -amylases (3.2.1.2), glucan 1 ,4- ⁇ -glucosidases (3.2.1.3), cellulases (3.2.1.4), endo-1 ,3(4)- ⁇ -glucanases (3.2.1.6), endo-1 ,4- ⁇ -xylanases (3.2.1.8), dextranases (3.2.1.11), chitinases (3.2.1.14), polygalacturonases (3.2.1.15), lysozymes (3.2.1.17), ⁇ - glucosidases (3.2.1.21), ⁇ -galactosidases (3.2.1.22), ⁇ -galactosidases (3.2.1.23), amylo-1 ,6- glucosidases (3.2.1.33), xylan 1 ,4- ⁇ -xylosidases (3
- Examples of commercially available oxidoreductases include GluzymeTM (enzyme available from Novo Nordisk A/S).
- Examples of commercially available proteases (peptidases) include KannaseTM, EverlaseTM, EsperaseTM, AlcalaseTM, NeutraseTM, DurazymTM, SavinaseTM, PyraseTM, Pancreatic Trypsin NOVO (PTN), Bio-FeedTM Pro and Clear-LensTM Pro (all available from Novo Nordisk A S, Bagsvaerd, Denmark).
- Other commercially available proteases include MaxataseTM, MaxacalTM, MaxapemTM, OpticleanTM and PurafectTM (available from Genencor International Inc. or Gist- Brocades).
- Examples of commercially available lipases include LipoprimeTM LipolaseTM,
- LipolaseTM Ultra LipozymeTM, PalataseTM, NovozymTM 435 and LecitaseTM (all available from Novo Nordisk A/S).
- Other commercially available lipases include LumafastTM (Pseudomonas mendocina lipase from Genencor International Inc.); LipomaxTM (Ps. pseudoalcaligenes lipase from Gist- Brocades/Genencor Int. Inc.; and Bacillus sp. lipase from Solvay enzymes.
- Examples of commercially available carbohydrases include Alpha-GalTM, Bio-FeedTM
- Combinations of enzymes may be obtained by fermenting two or more enzymes simultaneously in the same fermentation broth using this liquid or a processed liquid thereof as a starting material in a process of the invention.
- combinations of enzymes may be obtained by fermenting the enzymes separately and using mixtures of different fermentation broths and/or processed liquids thereof as a starting material for the process of the invention.
- the present invention also relates to methods for producing a polypeptide of the present invention comprising (a) cultivating a host cell or a transgenic plant or animal under conditions conducive for production of the polypeptide in a supernatant; and optionally (b) recovering the polypeptide.
- the present invention therefore relates to a method of producing the same polypeptide from at least two ORF's stably integrated onto the host cell chromosome comprising the steps of: i) culturing a host cell according to the invention under conditions conducive for the expression of the polypeptide; and optionally ii) recovering the polypeptide.
- the present invention therefore relates to a method of producing the same polypeptide from at least two ORF's present on a plasmid comprising the steps of: i) culturing a host cell comprising a plasmid comprising a nucleic acid construct of the invention under conditions conducive for the expression of the polypeptide; and optionally ii) recovering the polypeptide.
- the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art.
- the cell may be cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated.
- the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
- the polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of a product, or disappearance of a substrate. For example, a protease assay may be used to determine the activity of the polypeptide as described herein.
- the resulting polypeptide may be recovered by methods known in the art. For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
- polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
- chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
- electrophoretic procedures e.g., preparative isoelectric focusing
- differential solubility e.g., ammonium sulfate precipitation
- SDS-PAGE or extraction
- PS-1 shake flask medium (10 % sucrose, 4 % soybean flour, 1 % Na 2 SO 4 .12H 2 0, 0.5 % CaCO 3 , and 0.01 % pluronic acid) has been described in United States Patent 6,255,076, example 28.
- Example 1 Synthetic DNA sequences encoding protease 10R.
- Protease 10R is a proteolytic enzyme produced by Nocardiopsis prasina NRLL 18262.
- the DNA sequence given as SEQ ID NO: 1 is a synthetic DNA sequence encoding the signal peptide coding region from the Bacillus clausii alkaline protease gene, Savinase ®, followed in frame by a synthetic DNA sequence encoding the pro+mature parts of the 10R protease.
- the synthetic DNA sequence is changed compared to the Nocardiopsis wildtype sequence, but it still encodes the wildtype 10R enzyme.
- a synthetic gene can be constructed by PCR assembly of overlapping oligonucleotides in various methods described eg.
- Genes of the desired sequence can also be purchased from commercial companies like DNA2.0 inc., 1455 Adams Drive, Menlo Park, CA 94025.
- the DNA sequence given as SEQ ID NO: 2 is a DNA sequence encoding the signal peptide coding region from the Bacillus clausii alkaline protease gene, Savinase ®, followed in frame by a synthetic DNA sequence encoding the pro+mature parts of the 10R protease, followed in frame by an additional 6 basepair synthetic DNA sequence encoding the amino acid sequence TQ.
- the synthetic DNA sequence is changed compared to the Nocardiopsis wildtype sequence, and changed compared to SEQ ID NO: 1 , but it still encodes the wildtype 10R enzyme, with an addition of the two amino acids TQ at the C-terminal. As above, this synthetic DNA segment could be obtained e.g.
- the DNA sequences given as SEQ ID NO's: 3 - 7 are DNA sequences encoding the signal peptide coding region from the Bacillus clausii alkaline protease gene, Savinase ®, followed in frame by a synthetic DNA sequence encoding the pro+mature parts of the 10R protease.
- these DNA sequences can be regarded as examples of different DNA sequences encoding the same polypeptide product. It is not important, for the purpose of serving as an illustration of the present invention, that one sequence encodes a polypeptide which has a two amino acid C-terminal extension.
- Example 2 Construction of strain Bacillus subtilis ppP715-4, containing a chromosomally integrated copy of a synthetic gene encoding the protease 10R enzyme.
- Figure 25 in patent application US 2003/0170876 specifically illustrates a plasmid containing a particular composite promoter, including the crylllA promoter and mRNA stabilizing region.
- This plasmid was used as a vector plasmid to make a construct, in which the segment between a Pvul site in the signal peptide coding region of the aprL gene (encoding Savinase ®) and a Mlul site present immediately downstream of the end of the aprL coding region was replaced by the Pvul-Mlul part of a synthetic DNA fragment having the sequence given as SEQ ID NO: 8 (which has the Pvul site at pos.68-73, and the Mlul site at the 3' end).
- a plasmid was thereby constructed, which contained a DNA sequence encoding the signal peptide coding region from the Bacillus clausii alkaline protease gene, Savinase ®, followed in frame by a synthetic DNA sequence encoding the pro+mature parts of the 10R protease.
- This coding region was expressed using the composite consensus amyQ promoter/crylllA promoter/stabilizer, and it was integrated into the amyE locus of strain B. subtilis A164 ⁇ 5, as described in Widner et al. 2000, above.
- the resulting strain was named PP715-4.
- Example 3 Construction of a plasmid, pSJ6869, carrying SEQUENCE ID NO: 1 encoding protease 10R.
- PSJ6074 pSJ6074 is a pUC19 based plasmid carrying a segment consisting of the mRNA stabilizer sequence from the B. thuringiensis subsp. tenebrionis crylllA gene (a sequence found upstream of the coding region of the crylllA gene; Agaisse and Lereclus (1994) Mol. Microbiol. 13: 97-107), followed by the ribosome binding site from the B.
- crylllA stabilizer-1 OR construct was present as a chromosomally integrated segment in B. subtilis PP715-4, described in Example 2. Chromosomal DNA from PP715-4 was used as template in a PCR amplification, using a 61 °C annealing temperature, with primers
- the 1.2 kb EcoRI-Pstl fragment was excised from pSJ6064, ligated to the 3.2 kb Pstl-EcoRI fragment of pSJ6065, and the ligation mixture transformed into E. coli SJ2 by electroporation, selecting ampicillin resistance.
- 3 plasmids with correct restriction pattern were DNA sequenced, and all found to have the DNA segments exchanged as desired. 2 were kept, SJ6074 (SJ2/pSJ6074) and SJ6075 (SJ2/pSJ6075).
- plasmids contain a construct that still has an error at position 38 relative to the first nucleotide of the EcoRI site (TAACGCCCC changed to TAACCCCCC), but as this is close to the distal end of a 500 bp region that will eventually be used to direct homologous recombination with the host cell chromosome, and therefore with high probability will not become part of the final chromosomal construct, it was accepted.
- PSJ6814 pSJ6814 is a pUC19 based plasmid with the same structure as pSJ6074, with the difference that the Savinase® signal peptide-10Rpro+mature coding region consists of another synthetic DNA fragment with a DNA sequence different from that of pSJ6074, but still encoding the same aminoacid sequence as the gene on pSJ6074.
- the synthetic coding region has the sequence given as SEQ ID NO:1. DNA containing this synthetic coding region was used as template in a PCR amplification with primers Primer 7: 5'-GACTGAATTCGAGCTCTATAAAAATGAGGAGGGAACCGAATGAAAAAACCGCTGG ⁇ sav RBS > ⁇ start coding region
- Primer 8 5'-GACTAAGCTTACGCGTTATGTTCTAAGTCTAACGCCC-3' (SEQ ID NO: 16) ⁇ end coding region
- the annealing temperature was ramped down from 62 °C to 52 °C, then kept constant at 59 °C.
- a correctly sized PCR fragment was obtained, digested with Sacl + Mlul, and ligated to the 3.3 kb Mlul-Sacl fragment of pSJ6074.
- the ligation mixture was transformed into £. coli SJ2 by electroporation.
- the PCR amplified region was DNA sequenced on 2 plasmids, that by restriction digests were found to contain the desired insert. 1 plasmid had the correct DNA sequence, and was kept in strain SJ6814 (SJ2/pSJ6814).
- Plasmid pSJ6869 is designed to allow integration of the SEQUENCE ID NO: 1 expression cassette into the chromosome of a B. licheniformis strain, that already contains a triple- promoter (the amyL4199/scBAWcrylllA triple tandem promoter) integrated at the amyL locus, by homologous recombination at the crylllA stabilizer and downstream amyL segments.
- a triple- promoter the amyL4199/scBAWcrylllA triple tandem promoter
- B. subtilis PL1801 is a derivative of B. subtilis DN1885 (Diderichsen et al., 1990, J. Bacteriol. 172(8): 4315-4321) with deletions in protease genes apr and npr.
- Plasmid pSJ5487 is an integration vector constructed to allow insertion of expression cassettes at the amyL position in the B. licheniformis chromosome. It has the temperature- sensitive plasmid replication functions of pE194, encodes erythromycin resistance, and contains the oriT region from pUB110 to allow its transfer by conjugation (US Patent 6,066,473). It contains a segment derived from the B. licheniformis chromosome immediately upstream from the amyL promoter region, followed by a segment derived from the B. licheniformis chromosome immediately downstream of the amyL open reading frame. This last segment was amplified by PCR from chromosomal B. licheniformis DNA, using the following primers and an annealing temperature at 55 °C:
- Primer 9 5'-GACTGAATTCAGATCTACGCGTCCATGGGCTAGCGCGGCCGCGTCGACAGGCCT- CTTTGATTACATTTTATAATTAATTTTAAC-3' (SEQ ID NO: 17)
- the PCR amplified fragment was digested with Nsil + Bglll, and ligated to Bglll+EcoRI + EcoRI+Nsil fragments of a pSJ2739 (US Patent 6,100,063) derived vector containing the upstream amyL segment.
- the ligation mixture was transformed into competent B. subtilis DN1885, selecting erythromycin resistance (5 microgram/ml) at 30 °C. Two correct transformants were kept, as SJ5487 (DN1885/pSJ5487), and SJ5488 (DN1885/pSJ5488).
- Example 4 Construction of a plasmid, pSJ6996, carrying SEQUENCE ID NO: 2, encoding protease 10R with a two amino acid extension.
- pSJ6996 is a pUC19 based plasmid with the same structure as pSJ6074, with the difference that the Savinase® signal peptide-1 ORpro+mature coding region was extended to encode a 10R protein with a two amino acid C-terminal extension. It was constructed by PCR amplification using pSJ6074 as template, and primers
- the PCR amplified DNA fragment was digested with Kpnl + Mlul, and the 0.2 kb fragment ligated to the large Mlul-Kpnl fragment of pSJ6074.
- the ligation mixture was transformed into E. coli SJ2 by electroporation.
- Two transformants having the correct DNA sequence of the PCR amplified region were kept as SJ6996 (SJ2/pSJ6996) and SJ6997 (SJ2/pSJ6997).
- Example 5 Construction of a plasmid, pSJ7365, carrying SEQUENCE ID NO: 1, encoding protease 10R, followed by SEQUENCE ID NO: 2, encoding protease 10R with a two amino acid extension.
- pSJ6996 was used as template in a PCR amplification with primers
- the PCR amplified DNA fragment was digested with EcoRI + Hindlll, and ligated to the large Hindlll-EcoRI fragment of pUC19.
- the ligation mixture was transformed into E. coli SJ2 by electroporation.
- Two transformants having an almost correct DNA sequence of the PCR amplified region were kept as SJ7351 (SJ2/pSJ7351) and SJ7352 (SJ2/pSJ7352).
- SJ7351 SJ2/pSJ7351
- SJ7352 SJ2/pSJ7352
- a segment of pSJ7351 containing the protease 10R-TH encoding open reading frame was subsequently inserted into plasmid pSJ6869, which already contained the protease 10R encoding open reading frame given in SEQUENCE ID NO: 1.
- the 1.2 kb Mlul-Nhel fragment of pSJ7351 was isolated, and inserted into the 6.5 kb Nhel-Mlul fragment of pSJ6869.
- the ligation mixture was transformed into B. subtilis PL1801 competent cells, selecting erythromycin resistance (2 microgram/ml) at 30 °C. Two transformants were kept, SJ7355 (PL1801/pSJ7355) and SJ7356 (PL1801/pSJ7356).
- plasmid DNA prepared from these strains revealed no sign of recombination between the tandemly arranged, parallel open reading frames encoding essentially identical enzymes, but differing in their DNA sequence. It is of particular interest, given that the vector plasmid is based on pE194, which is a rolling circle replicating plasmid of the kind on which tandem repeats are notoriously unstable (Gruss and Ehrlich, 1989, Microbiological reviews, 53(2), 231-241).
- the desired construct should contain SEQUENCE ID NO: 2, encoding a 10R protein with the TQ amino acid extension.
- Example 6 Construction of a Bacillus licheniformis host strain, containing two triple- promoters in its chromosome.
- amyL promoter and amyL ribosome-binding site were replaced with a composite promoter lacking the RBS (to prevent expression of amyL).
- a second gene replacement was then performed to reintroduce the RBS, thereby generating a functional expression cassette.
- the pE194-based, temperature-sensitive plasmid pMRT064.1 (WO 03/054163) was introduced into Bacillus licheniformis strain SJ1904 via electroporation (Xue et. al., 1999, Journal of Microbiological Methods 34: 183-191).
- the cells were plated onto TBAB-agar plates supplemented with 1 ⁇ g of erythromycin and 25 ⁇ g of lincomycin per ml after incubation at 28°C for 24-48 hours.
- An erythromycin-resistant transformant was isolated and grown in the presence of erythromycin (5 ⁇ g/ml) at the non-permissive temperature of 50°C. At this temperature, the pE194 origin of replication is inactive.
- the cells were then plated on non-selective LB agar plates and colonies which contained the desired promoter replacement and loss of the pE194-based replicon were identified by the following criteria: (1) the inability to form haloes on Tryptose blood agar base (TBAB) plates containing a 0.5% starch-azure (Sigma Chemical Co., St. Louis, MO) plus TBAB overlay indicated the presence of the P11 promoter and the loss of the amyL RBS; and (2) erythromycin sensitivity indicated the loss of the pE194-based replicon.
- TBAB Tryptose blood agar base
- TBAB overlay indicated the presence of the P11 promoter and the loss of the amyL RBS
- erythromycin sensitivity indicated the loss of the pE194-based replicon.
- One transformant was chosen which met these three criteria and designated Bacillus licheniformis SJ1904::pMRT064.1.
- Plasmid pNBT23 (pDG268MCS ⁇ Neo-Pr sh ort "consensus” amyQ/PrcryiiiA/crylllAstab/SAV, U.S. Patent No. 6,255,076) was digested with Pad, the ends were blunted with T4 DNA polymerase I (Roche Applied Science; Indianapolis, IN), and then digested with Sa/I.
- Plasmid pUC19 (Yanisch-Perron et al., 1985, Gene 33(1): 103-119) was digested with Ec/136II and Sa/I.
- the digestions were resolved on a 0.8% agarose gel using 44 mM Tris Base, 44 mM boric acid, 0.5 mM EDTA buffer (0.5X TBE) buffer and the larger vector fragment (approximately 2661 bp) from pUC19 and the smaller crylllAstab/apr/7 5' fragment (approximately 1069 bp) from pNBT23 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions (QIAGEN, Valencia, CA). The two purified fragments were ligated together with T4 DNA ligase according to the manufacturer's instructions (Roche Applied Science; Indianapolis, IN) and the ligation mix was transformed into E.
- coli SURE® competent cells (Stratagene, Inc., La Jolla, CA). Transformants were selected on 2X yeast-tryptone (2X YT) agar plates supplemented with 100 ⁇ g of ampicillin per ml. Plasmid DNA was purified from several transformants using a Bio Robot 9600 according to the manufacturer's instructions (QIAGEN, Valencia, CA) and analyzed by EcoRI plus Sa/I digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 1071 bp EcoRI/Sa/l crylllAstab/aprH 5' fragment and was designated pNBT28.
- Plasmid pMRT038 was constructed by SOE (splicing by overlap extension) according to the procedure of Horton et al., 1989, Gene 77: 61-8.
- the amyL promoter region and 5' coding sequence from plasmid pDN1981 (U.S. Patent No. 5,698,415) were PCR amplified using primers pairs 733-45-1 and 733-45-2, and 733-68-1 and 733-70-1, respectively, as shown below.
- PCR amplification was conducted in 50 ⁇ l reactions composed of 1 ng of pDN1981 DNA, 0.4 ⁇ M of each primer, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II (Applied Biosystems, Inc., Foster City, CA) with 2.5 mM MgCI 2 , and 2.5 units of AmpliTaq GoldTM DNA polymerase (Applied Biosystems, Inc., Foster City, CA).
- the reactions were performed in a RoboCycler 40 thermacycler (Stratagene, Inc., La Jolla, CA) programmed for 1 cycle at 95°C for 10 minutes; 25 cycles each at 95°C for 1 minute, 50°C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72°C for 7 minutes.
- the PCR product was visualized using a 0.8% agarose-0.5X TBE gel. The expected fragments were approximately 600 and 500 bp, respectively.
- the final SOE fragment was amplified using primers 733-45-1 and 733-70-1 shown below.
- the final SOE fragment was cloned into pCR2.1 vector using the TA-TOPO Cloning Kit (Stratagene, Inc., La Jolla, CA).
- Transformants were selected on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml and incubated at 37°C for 16 hours. Transformants carrying the correct plasmid were verified by DNA sequencing using M13 forward and reverse primers (Invitrogen, Inc, Carlsbad, CA). This plasmid was designated PMRT038.
- Primer 733-45-1 5'-GTCCTTCTTGGTACCTGGAAGCAGAGC-3' (SEQ ID NO: 23)
- Primer 733-45-2 5'-GTATAAATATTCGGCCCTTAAGGCCAGTACCATTTTCCC-3' (SEQ ID NO: 24)
- Primer 733-70-1 5'-GGTGTTCTCTAGAGCGGCCGCGGTTGCGGTCAGC-3' (SEQ ID NO: 26)
- Plasmid pNBT28 was digested with ⁇ g/ll, the ends were blunted with Klenow fragment, and then digested with Sacl.
- Plasmid pMRT038 was digested with EcoRI, the ends were blunted with Klenow fragment, and then digested with Sacl. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 3253 bp) from pNBT28 and the smaller fragment (approximately 593 bp) from pMRT038 were gel- purified using a QlAquick DNA Extraction Kit according to the manufacturer's instructions.
- the two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into E. coli SURE® competent cells. Transformants were selected on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml. Plasmid DNA was purified from several transformants using a QIAGEN Bio Robot 9600 according to the manufacturer's instructions and analyzed by EcoRI plus Hind ⁇ digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 1168 bp EcoR ⁇ IHind ⁇ fragment and was designated pNBT29.
- Plasmids pNBT29 and pCJ791 were digested with EcoRI and Hind ⁇ . The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 4340 bp) from pCJ791 and the smaller fragment (approximately 1168 bp) from pNBT29 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions. The two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into Bacillus subtilis 168 ⁇ 4 (WO 03/054163).
- Plasmid DNA was purified from several transformants using a QIAGEN tip-20 columns (QIAGEN, Inc., Valencia, CA) according to the manufacturer's instructions and analyzed by EcoRI plus Hind ⁇ digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 1168 bp EcoRI/H/ndlll fragment and was designated pWWi001.1.
- plasmid pWWiOOH was introduced into this strain via electroporation, then integrated into the chromosome and excised as described above, creating Bacillus licheniformis MaTa2.
- the desired clone was identified by the restoration of amyL expression which was assayed by growing the strain on TBAB plates containing a 0.5% starch-azure plus TBAB overlay. Strains producing amylase formed a clear halo around the colony or patch.
- Plasmid pMRT064.1 was digested with Hind ⁇ , filled-in with Klenow fragment, and then digested with Sfi ⁇ .
- Plasmid pNBT23 (pDG268MCS ⁇ Neo-Pr snOr t -consensus- a y Q/Pr cry iii A /crylllAstab/SAV, U.S. Patent No. 6,255,076) was digested with Sfi ⁇ and Ec/136ll.
- the digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 4892 bp) from pMRT064.1 and the smaller fragment (approximately 728 bp) from pNBT23 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions.
- the two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into Bacillus subtilis 168 ⁇ 4. Plasmid DNA was purified from several transformants using QIAGEN tip-20 columns according to the manufacturer's instructions and analyzed by EcoRI plus Hind ⁇ digestion on a 0.8% agarose gel using 0.5X TBE buffer.
- Plasmid pWWiOO ⁇ was introduced into Bacillus licheniformis MaTa2 via electroporation, then integrated and excised from the chromosome as described previously, replacing the P11 promoter with the P12 promoter (U.S. Patent No. 6,255,076; Pr sh0 rt -con s e ns u s - a m yQ/Pr Cr y ///A /cry///>Astab), to create Bacillus licheniformis strain MaTa3.
- the expected fragment was approximately 230 bp.
- the amy 4199 promoter (Pr amy 4 i99, U.S. Patent No. 6,100,063), hereafter designated the P6 promoter), was PCR-amplified from Bacillus licheniformis SJ1904 (U.S. Patent No. 5,733,753) genomic DNA obtained according to the method of Pitcher et. al., 1989, supra, using the primers shown below, which incorporate a Sf/1 site and a Sacl site, respectively.
- Primer 950872 5'-CCAGGCCTTAAGGGCCGCATGCGTCCTTCTTTGTGCT-3' (SEQ ID NO: 29)
- PCR amplifications were conducted in triplicate in 50 ⁇ l reactions composed of 50 ng of chromosomal DNA, 0.4 ⁇ M each of primers 950872 and 991151, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 , and 2.5 units of AmpliTaq GoldTM DNA polymerase.
- the reactions were performed in a RoboCycler 40 thermacycler programmed for 1 cycle at 95°C for 9 minutes; 30 cycles each at 95°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72°C for 5 minutes.
- the PCR product was visualized using a 0.8% agarose gel with 0.5X TBE buffer. The expected fragment was approximately 600 bp.
- the 600 bp PCR fragment was cloned into pCR2.1 using the TA-TOPO Cloning Kit and transformed into E. coli OneShotTM competent cells according to the manufacturer's instructions (Stratagene, Inc., La Jolla, CA). Transformants were selected at 37°C after 16 hours of growth on 2X YT agar plates supplemented with 100 g of ampicillin per ml. Plasmid DNA from these transformants was purified using a QIAGEN Bio Robot 9600 according to the manufacturer's instructions and analyzed by digestion with EcoRI and electrophoresis on a 0.8% agarose gel using 0.5X TBE buffer.
- the plasmid was found to have the correct expected fragments (approximately 3913 bp and 640 bp).
- the DNA sequence of the insert DNA was confirmed by DNA sequencing using M13 (-20) forward and M13 reverse primers (Invitrogen, Inc, Carlsbad, CA).
- a plasmid with the correct cloned sequence was designated pNBT30.
- Plasmids pNBT3 (pDG268MCS ⁇ Neo-Pr cry ⁇ , A /crylllAstab/SAV, U.S. Patent No. 6,255,076) and pNBT30 were digested with Sfi ⁇ and Sacl. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 7931 bp) from pNBT3 and the smaller fragment (approximately 611 bp) from pNBT30 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions. The two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into E.
- coli SURE® competent cells Transformants were selected on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml. Plasmid DNA from these transformants was purified using a QIAGEN Bio Robot 9600 (QIAGEN, Valencia, CA) according to the manufacturer's instructions and analyzed by digestion with ⁇ /col and electrophoresis on a 0.8% agarose gel using 0.5X TBE buffer. The plasmid was found to have the correct expected fragments (approximately 6802 bp and 1741 bp) and was designated pNBT31.
- a Pr amy/ . 4199 /Pr Cf , /M /crylllAstab tandem promoter was constructed as follows. Plasmid pNBT2 (pDG268MCS ⁇ -Pr Cry i ⁇ i A /crylllAstab/SAV, U.S. Patent No. 6,255,076) was digested with Sfi ' l, the ends were blunted with T4 DNA polymerase, and then digested with >4sp718. Plasmid pNBT31 was digested with Ec/136ll and Asp7 8.
- the digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 8170 bp) from pNBT31 and the smaller fragment (approximately 996 bp) from pNBT2 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions.
- the two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into E. coli SURE® competent cells. Transformants were selected on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml.
- Plasmid DNA was purified from several transformants using a QIAGEN Bio Robot 9600 according to the manufacturer's instructions and analyzed by Sfi ⁇ plus Sacl digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 1235 bp fragment and was designated pNBT32.
- a Pr am y/. i99/Pr S ort -co n sensus- amyQ/c y/////Astab composite promoter (P16) was constructed as follows. Plasmid pNBT31 was digested with Oral 11 and Ec/136ll.
- Plasmid pNBT24 (pDG268MCS ⁇ Neo-Pr snorr consensus amyQ /long crylllAstab/SAV, U.S. Patent No. 6,255,076) was digested with Sfi ⁇ , the ends were blunted using T4 DNA polymerase I, and then digested with Dralll. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment from pNBT31 and the smaller promoter fragment (approximately 1100 bp) from pNBT24 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions.
- the two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into E. coli SURE® competent cells. Transformants were selected on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml. Plasmid DNA was purified from several transformants using a QIAGEN Bio Robot 9600 according to the manufacturer's instructions and analyzed by Sfi ⁇ plus Sacl digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 1400 bp Sffl/Sacl fragment and was designated pNBT33.
- Plasmid pNBT33 was digested with Avail and Ec/136ll.
- Plasmid pMRT074 (WO 03/054163) was digested with Not ⁇ , the ends were flushed using T4 DNA polymerase, and then digested with Aval ⁇ . The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 4433 bp) from pMRT074 and the smaller fragment (approximately 1157bp) from pNBT33 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions.
- the two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into Bacillus subtilis 168 ⁇ 4.
- Transformants were selected on TBAB-agar plates supplemented with 1 ⁇ g of erythromycin and 25 ⁇ g of lincomycin per ml after incubation at 28°C for 24-48 hours. Plasmid DNA from several transformants was isolated using QIAGEN tip-20 columns according to the manufacturer's instructions and verified by digestion with ⁇ amHI plus Hind ⁇ . The resulting plasmid was designated pMDTOO ⁇ .
- Plasmid pMDT006 was introduced into Bacillus licheniformis MaTa3 via electroporation. An erythromycin resistant transformant was isolated and the plasmid was integrated and excised from the chromosome as described previously. This resulted in the replacement of the P12 tandem promoter with the P16 promoter yielding Bacillus licheniformis strain MDT216. The desired clone was identified by PCR analysis using primers
- Primer 94-935 5'-GGCGTTACAATTCAAAGA-3'- (SEQ ID NO: 28)
- Plasmid pWWiOO ⁇ was digested with Sfi ⁇ and EcoRI to remove the DNA sequence located upstream of the amyL gene. The ends were blunted with T4 DNA polymerase and the fragments were resolved on a 0.8% agarose gel using 0.5X TBE buffer. The larger vector fragment (approximately 5069 bp) was gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions. The purified fragment was ligated together with T4 DNA ligase and the ligation mix was transformed into Bacillus subtilis 168 ⁇ 4.
- Transformants were selected on TBAB-agar plates supplemented with 1 ⁇ g of erythromycin and 25 ⁇ g of lincomycin per ml after incubation at 28°C for 24-48 hours. Plasmid DNA from several transformants was isolated using QIAGEN tip-20 columns according to the manufacturer's instructions and verified by digestion with ⁇ amHI plus H/ndlll. The resulting plasmid was designated pMDT007. Plasmid pMDT007 was introduced into Bacillus licheniformis MDT216 via electroporation.
- Bacillus licheniformis MDT220 a C-component-negative strain containing the amyL gene
- a deleted version of the gene encoding Bacillus licheniformis C-component protease (U.S. Patent No. 5,459,064, accession no. D10060, Kakudo et al., 1992, J. Biol. Chem. 267: 23782) was constructed by PCR using splicing by overlap extension (SOE) (Horton et al., 1989, supra).
- the 5' and 3' regions of the C-component gene were PCR amplified from Bacillus licheniformis SJ1904 DNA using primer 991173 (which introduced a 5' EcoRI restriction site) and primer 991174 for the 5' C-component fragment and primers 991175 and 991176 (which introduced a 3' Hind ⁇ restriction site) for the 3' C-component fragment, shown below.
- PCR amplifications were carried out in triplicate in 30 ⁇ l reactions composed of 50 ng of chromosomal DNA, 0.4 ⁇ M each of primer pair 991173 and 991174 for the 5' C-component fragment or primer pair 991175 and 991176 for the 3' C-component fragment, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 , and 2.5 units of AmpliTaq GoldTM DNA polymerase.
- the reactions were performed in a RoboCycler 40 thermacycler programmed for 1 cycle at 95°C for 9 minutes; 3 cycles each at 95°C for 1 minute, 52°C for 1 minute, and 72°C for 1 minute; 27 cycles each at 95°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72°C for 5 minutes.
- the PCR products were visualized using a 0.8% agarose-0.5X TBE gel. The expected fragments were approximately 290 bp in size.
- the final SOE fragment was generated using primer pair 991173 and 991176 according to Horton et al., 1989, supra, and cloned into pCR2.1 vector using the TA-TOPO Cloning Kit.
- Transformants were selected on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml after incubation at 37°C for 16 hours. Plasmid DNA from several transformants was isolated using QIAGEN tip-20 columns according to the manufacturer's instructions and verified by DNA sequencing with M13 (-20) forward and M13 reverse primers. The plasmid harboring the SOE fragment was designated pNBT37. Plasmids pCJ791 (WO 03/054163) and pNBT37 were digested with EcoRI and Hind ⁇ .
- the digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 4340 bp) from pCJ791 and the smaller C-component deletion fragment (approximately 580 bp) from pNBT37 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions.
- the two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into Bacillus subtilis 168 ⁇ 4. Transformants were selected on TBAB-agar plates supplemented with 1 ⁇ g of erythromycin and 25 ⁇ g of lincomycin per ml after incubation at 28°C for 24-48 hours.
- Plasmid DNA from several transformants was isolated using QIAGEN tip-20 columns according to the manufacturer's instructions and verified by digestion with EcoRI plus Hind ⁇ and agarose gel electrophoresis. A plasmid was identified, which yielded the expected fragment sizes of approximately 4340 bp and approximately 580 bp; and was designated pWWi002.
- Plasmid pWWi002 was introduced into Bacillus licheniformis MDT217 via electroporation. An erythromycin resistant transformant was isolated and the plasmid was integrated and excised from the chromosome as described previously. Chromosomal DNA was isolated from several transformants according to Pitcher et al., 1989, supra, and was analyzed by PCR using primers 991173 and 991176 above to identify the C-component-deleted strains. Several transformants were identified which yielded the expected size PCR fragment of approximately 580 bp which confirmed a partial deletion of the C-component gene. One of these strains was chosen and designated Bacillus licheniformis MDT220.
- Plasmid pMRT077 was constructed as follows. The upstream region and the 3' region of the amyL gene were fused via SOE using primer pair 733-45-1 and 733-45-7 and primer pair 757-19-1 and 733-45-6, respectively, shown below.
- Primer 733-45-1 5'-GTCCTTCTTGGTACCTGGAAGCAGAGC-3' (SEQ ID NO: 23)
- Primer 733-45-7 5'-CATGCTGGGCCCTTAAGGCCAGTACCATTTTCCC-3' (SEQ ID NO: 36)
- Primer 757-19-1 5'-CAGTAGGCCTTAAGGGCCCAGCATGATTGAGCTCACCACCATGGG- ATCCGCGGCCGCACAAGGGAAGGC-3' (SEQ ID NO: 37)
- Primer 733-45-6 5'-CAATTCATCCTCTAGAGTCTCAGG-3' (SEQ ID NO: 38)
- PCR amplification was conducted in 50 ⁇ l reactions composed of 1 ng of pDN1981 DNA (U.S. Patent No. 5,698,415), 0.4 ⁇ M of each primer, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 , and 2.5 units of AmpliTaq GoldTM DNA polymerase.
- the reactions were performed in a RoboCycler 40 thermacycler programmed for 1 cycle at 95°C for 10 minutes; 25 cycles each at 95°C for 1 minute, 50°C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72°C for 7 minutes.
- the PCR products were visualized in a 0.8% agarose gel using 0.5X TBE buffer.
- the expected fragments were approximately 600 and 500 bp, respectively.
- the final fragment was amplified using primers 733-45-1 and 733-45-6.
- the final fragment was cloned into pCR2.1 vector using the TA-TOPO Cloning Kit.
- Transformants were selected on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml and incubated at 37°C for 16 hours. Transformants carrying the correct plasmid were verified by DNA sequencing using M13 forward and reverse primers. This plasmid was designated pMRT040.
- Plasmid pMRT040 was digested with Kpn ⁇ /Xba ⁇ , filled with Klenow fragment DNA polymerase in the presence of dNTPs, and a fragment of approximately 1000 bp was isolated from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA purification Kit according to the manufacturer's instructions. This fragment was cloned into plasmid pShV3 (WO 03/054163) digested with EcoRV, and transformed into E. coli XL1 Blue cells according to the manufacturer's instructions (Stratagene, Inc., La Jolla, CA).
- Transformants were selected on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml and incubated at 37°C for 16 hours. Plasmid DNA from several transformants was isolated using QIAGEN tip-20 columns according to the manufacturer's instructions and verified on a 0.8% agarose gel using 0.5X TBE buffer by restriction analysis with Sac ⁇ /Sph ⁇ . The resulting plasmid was designated pMRT044. Plasmid pMRT044 and pNBT3 (pDG268MCS ⁇ Neo-Pr cry ⁇ n A /crylllAstab/SAV, U.S. Patent No. 6,255,076) were digested with Sacl plus Hind ⁇ .
- the digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately bp) from pMRT044 and the smaller crylllA stabilizer fragment from pNBT3 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions.
- the two purified fragments were ligated together with T4 DNA polymerase and the ligation mix was used to transform E. coli XL1 Blue cells according to the manufacturer's instructions.
- Transformants were selected on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml and incubated at 37°C for 16 hours.
- Plasmid DNA from several transformants was isolated using QIAGEN tip-20 columns according to the manufacturer's instructions and verified on a 0.8% agarose-0.5X TBE gel by restriction analysis with Sac ⁇ IHind ⁇ . The resulting plasmid was designated pMRT070. Plasmids pMRT074 (WO 03/054163) and pMRT070 were digested with EcoRI/H/noflll.
- a fragment of approximately 3500 bp from pMRT074 and a fragment of approximately 1100 bp from pMRT070 were isolated from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA purification Kit according to the manufacturer's instructions, ligated, and transformed into Bacillus subtilis A168 ⁇ 4 competent cells. Transformants were selected on TBAB-agar plates supplemented with 1 ⁇ g of erythromycin and 25 ⁇ g of lincomycin per ml and incubated at 30°C for 24-48 hours.
- Plasmid DNA from several transformants was isolated using QIAGEN tip-20 columns according to the manufacturer's instructions and verified on a 0.8% agarose- 0.5X TBE gel by restriction analysis with EcoRI/fy/ndlll. The resulting plasmid was designated pMRT075. Plasmids pMRT075 and pNBT40 were digested with Sacl plus Not ⁇ . Plasmid pNBT40 is essentially the pCR2.1-TOPO vector containing a gene (npr[BamP]) encoding a neutral protease from Bacillus amyliquefaciens (Vasantha et al., 1984, J. Bacteriol. 159(3): 811 , accession no. K02497).
- a DNA fragment of approximately 5500 bp from pMRT075 and a fragment of approximately 1600 bp from pNBT40 were isolated from a 0.8% agarose gel using 0.5X TBE buffer using a QIAquick DNA purification Kit according to the manufacturer's instructions, ligated, and transformed into Bacillus subtilis A168 ⁇ 4 competent cells. Transformants were selected on TBAB-agar plates supplemented with 1% skim milk, and 1 ⁇ g of erythromycin and 25 ⁇ g of lincomycin per ml and incubated at 30°C for 24-48 hours. Transformants producing clearing zones on TBAB-agar skim milk plates were obtained and the resulting plasmid was designated pMRT077.
- JP170 alkaline protease gene (WO 98/56927 and US Pat. No. 5891701 , accession no. AR069954) was PCR-amplified from Bacillus sp. JP170 genomic DNA obtained as described in WO 98/56927 using the primers below. Genomic DNA was prepared according to the procedure described by Pitcher et al., 1989, supra.
- Primer 961252 5'-GCGGCCGCGTCATAAACGTTGCAATCGTGCTC-3' (SEQ ID NO: 40) PCR amplifications were conducted in triplicate in 50 ⁇ l reactions composed of 50 ng of chromosomal DNA, 0.4 ⁇ M each of primers 992843 and 961252, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 , and 2.5 units of AmpliTaq GoldTM DNA polymerase.
- the reactions were performed in a RoboCycler 40 thermacycler programmed for 1 cycle at 95°C for 9 minutes; 30 cycles each at 95°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72°C for 5 minutes.
- the PCR product was visualized using a 0.8% agarose gel with 0.5X TBE buffer.
- the expected fragment was approximately 2163 bp.
- the 2163 bp PCR fragment was cloned into pCR2.1 using a TA-TOPO Cloning Kit and transformed into E. coli OneShotTM competent cells according to the manufacturer's instructions.
- Transformants were selected at 37°C after 16 hours of growth on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml. Plasmid DNA was purified from several transformants using a QIAGEN Bio Robot 9600 according to the manufacturer's instructions and analyzed by Sacl plus Not] digestion on a 0.8% agarose gel using 0.5X TBE buffer. Plasmids with the correct size inserts were identified and the DNA sequence of the inserts was confirmed by DNA sequencing using M13 (-20) forward and M13 reverse primers and the following internal primers. A plasmid with the correct sequence was identified and designated pNBT39.
- Primer 992843 5'-CGAGCTCGATGTGTTATAAATTGAGAGGAG-3' (SEQ ID NO: 39)
- Primer 961021 5'-GTCGAATATGATGGGGATG-3' (SEQ ID NO: 41)
- Primer 960898 5'-GGACAAGGACAGATTGTAGCAGTTGCTGATACTGG-3' (SEQ ID NO: 42)
- Primer 961048 5'-GCGATTACAGTTGGGGCAACC-3' (SEQ ID NO: 43)
- Primer 961222 5'-GGTAGCACGACGGCATCACTAAC-3' (SEQ ID NO: 44)
- Plasmid pNBT39 and pMRT077 were digested with Sacl plus Not]. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment from pMRT077 and the smaller JP170 fragment (approximately 2163 bp) from pNBT39 were gel- purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions. The two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into Bacillus subtilis 168 ⁇ 4 competent cells.
- Plasmid DNA was purified from several transformants using QIAGEN tip-20 columns according to the manufacturer's instructions and analyzed by Sacl plus Not] digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 2163 bp Sad/Not] JP170 fragment and was designated pTH012. Bacillus licheniformis TH3 was constructed by replacement of the amyL gene of Bacillus licheniformis MDT220 with the JP170 protease gene.
- pTH012 was introduced into Bacillus licheniformis MDT220 via electroporation, and then integrated and excised from the chromosome as described previously, replacing the amyL gene with the JP170 alkaline protease gene to create Bacillus licheniformis TH3.
- the desired erythromycin-sensitive clone was identified by protease expression based on the production of halos on TBAB plus 1 % dry milk plates.
- Plasmid pNBT35 (pDG268MCS ⁇ -Pr sh ort -consensus- amyQ/Pr C ry / ; / ⁇ /crylllAstab/SAV, equivalent to pNBT23 but lacking the neo gene) was digested with S7I and treated with T4 DNA polymerase to generate blunt ends; the polymerase was heat-inactivated and the plasmid digested with Dralll to remove a fragment upstream of the promoter, bearing the cat gene. Plasmid pNBT32 was digested with Ec/136ll and Dralll to release a fragment bearing the amyL4199 promoter and car gene.
- the digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 5811 bp) from pNBT35 and the smaller amyL4199 promoter-bearing fragment (approximately 2150 bp) from pNBT32 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions.
- the two purified fragments were ligated together with T4 DNA ligase, and the ligation mix was transformed into E. coli SURE® competent cells according to the manufacturer's instructions. Transformants were selected at 37°C on 2XYT agar plates supplemented with 100 mg of ampicillin per ml.
- Plasmid DNA from these transformants was purified using a QIAGEN Bio Robot 9600 (QIAGEN, Valencia, CA) according to the manufacturer's instructions and analyzed by digestion with ⁇ /col and electrophoresis on a 0.8% agarose gel using 0.5X TBE buffer. The plasmid was found to have the correct expected fragments (approximately 5492 bp and 2466 bp) and was designated pNBT36.
- Bacillus licheniformis TH4 was constructed by insertion of the crylllA promoter at the xylA locus (accession no. Z80222) of Bacillus licheniformis TH3. The crylllA promoter was PCR- amplified from pNBT36 plasmid DNA using the following primers.
- Primer 951036 5'-GAGCTCCATAATACATAATTTTCAAACTG-3' (SEQ ID NO: 45)
- Primer 993396 5'-GTCGACAACGTAAGATGAAACCTTAG-3' (SEQ ID NO: 46) PCR amplifications were conducted in triplicate in 50 ⁇ l reactions composed of 50 ng of plasmid DNA, 0.4 ⁇ M each of primers 951036 and 993396, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 , and 2.5 units of AmpliTaq GoldTM DNA polymerase.
- the reactions were performed in a RoboCycler 40 thermacycler programmed for 1 cycle at 95°C for 9 minutes; 30 cycles each at 95°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72°C for 5 minutes.
- the PCR product was visualized using a 0.8% agarose gel using 0.5X TBE.
- the expected fragment was approximately 622 bp.
- the 622 bp PCR fragment was cloned into pCR2.1 using the TA-TOPO Cloning Kit and transformed into E. coli OneShotTM competent cells according to the manufacturer's instructions.
- Transformants were selected at 37°C after 16 hours of growth on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml. Plasmid DNA from these transformants was purified using a QIAGEN Bio Robot 9600 according to the manufacturer's instructions and digested with Sacl plus Not]. Plasmids were identified and the DNA sequence of the inserts was confirmed by DNA sequencing using M13 (-20) forward and M13 reverse primers. A plasmid with the correct sequence was designated pNBT41. Plasmid pNBT41 was digested with Sa/I and £c/136ll to excise the promoter and crylllA stabilizer fragment.
- Plasmid pSJ5218 (containing a 5' fragment of Bacillus licheniformis xylR and an internal fragment of xylA; U.S. Patent Application No. 20030032186) was digested with Sa/I and ⁇ sr1071. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 6381 bp) from pSJ5218 and the smaller crylllA stabilizer fragment (approximately 622 bp) from pNBT41 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions.
- Plasmid DNA was purified from several transformants using QIAGEN tip-20 columns according to the manufacturer's instructions and analyzed by restriction enzyme or PCR analysis. The correct plasmid was identified and was designated pTH009. Plasmid pTH009 was introduced into Bacillus licheniformis TH3 via electroporation and integrated by selection for erythromycin resistance at 50°C. Desired integrants were identified by the inability to grow on minimal medium supplemented with 0.5% xylose (U.S. Patent Application No. 20030032186) due to insertion into the xylA gene.
- Bacillus licheniformis TH4 The plasmid was excised as described previously to create Bacillus licheniformis TH4, which contained the crylllA promoter at the xylA locus.
- the desired erythromycin-sensitive strain was identified by the inability to grow on minimal medium supplemented with 0.5% xylose as the carbon source and by PCR analysis.
- Bacillus licheniformis MDT223 was constructed by insertion of the remainder of the P1 triple tandem promoter at the xylA locus of Bacillus licheniformis TH4.
- the P17 triple tandem promoter minus the mRNA-stabilizing Shine-Dalgarno sequence, was PCR-amplified from pNBT36 plasmid DNA using primers 993397 and 993398 shown below and cloned into pCR2.1 using the TOPO-TA Cloning Kit.
- Primer 993398 5'-GAATTCAATAATTTATACACTATTCTATTGG-3' (SEQ ID NO: 48)
- PCR amplifications were conducted in triplicate in 50 ⁇ l reactions composed of 50 ng of plasmid DNA, 0.4 ⁇ M each of primers 993397 and 993398, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 , and 2.5 units of AmpliTaq GoldTM DNA polymerase.
- the reactions were performed in a RoboCycler 40 thermacycler programmed for 1 cycle at 95°C for 9 minutes; 30 cycles each at 95°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72°C for 5 minutes.
- the PCR product was visualized using a 0.8% agarose gel with 0.5X TBE buffer.
- the expected fragment was approximately 992 bp.
- the 992 bp PCR fragment was cloned into pCR2.1 using the TA-TOPO Cloning Kit and transformed into E. coli OneShotTM competent cells according to the manufacturer's instructions. Transformants were selected at 37°C after 16 hours of growth on 2X YT agar plates supplemented with 100 ⁇ g of ampicillin per ml. Plasmid DNA from these transformants was purified using a QIAGEN Bio Robot 9600 according to the manufacturer's instructions. The DNA sequence of the inserts was confirmed by DNA sequencing using M13 (-20) forward and M13 reverse primers. A plasmid with the correct sequence was identified and designated pTH027.
- Plasmid pTH027 was digested with EcoRI plus Sa/I. Plasmid pSJ5218 was digested with EcoR] and Sa/I to remove the xylA fragment and spectinomycin-resistance gene. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment from pSJ5218 and the smaller fragment (approximately 992 bp) from pNBT41 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions. The two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into Bacillus subtilis 168 ⁇ 4.
- Plasmid DNA was purified from several transformants using QIAGEN tip-20 columns according to the manufacturer's instructions and analyzed restriction enzyme digestion and/or PCR analysis. The correct plasmid was identified and was designated pTH010. Plasmid pTH010 was introduced into Bacillus licheniformis TH4 via electroporation and integrated by selection for erythromycin resistance at 50°C as described previously. PCR analysis was used to identify integrants with pTH010 inserted at the xy/4 locus. The plasmid was excised as described previously, and erythromycin-sensitive excision products were screened for presence of the triple promoter at xylA by PCR analysis. One such strain was designated Bacillus licheniformis MDT223.
- Plasmid pMB1242 contains the amyL ribosome-binding site (RBS) followed by the coding sequence for a fusion of the AmyL signal peptide to the mature mannanase of alkalophilic Bacillus sp. I633 (Sequence ID NO:1 in WO 99/64619), truncated at the C-terminus.
- RBS amyL ribosome-binding site
- the RBS and mannanase gene were PCR-amplified from pMB1242 using primers 993634 and 990498.
- Primer 993634 5'-GTTAACTTGAAAAACGGTGCTTAATC-3' (SEQ ID NO: 49)
- Primer 990498 5'-TGGTACTGGCCTTAAGGGCCGAATATTTATACAATATCATGAGCTC CACATTGAAAGGG-3' (SEQ ID NO: 50)
- pNBT45 The gene was cloned into pCR2.1 using the TOPO-TA Cloning Kit, creating pNBT45.
- pNBT45 and pNBT18 (pDG268MCS ⁇ Neo-cry3A stabilizer/SAV, U.S. Patent No. 6,255,076) were digested with Sacl and Hpal. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment from pNBT18 (approximately 7330 bp) and the smaller mannanase-bearing fragment (approximately 1008 bp) from pNBT45 were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions.
- Plasmid DNA was purified from several transformants using QIAGEN tip-20 columns according to the manufacturer's instructions and analyzed restriction enzyme digestion and/or PCR analysis. The correct plasmid was identified and was designated pNBT46. pNBT46 and pTH012 were digested with Sacl and Not].
- the digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment from pTH012 (approximately 5359 bp) and the smaller fragment from pNBT46 (approximately 1098 bp), bearing the mannanase gene and aprH terminator, were gel-purified using a QIAquick DNA Extraction Kit according to the manufacturer's instructions.
- the two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into Bacillus subtilis 168 ⁇ 4. Plasmid DNA was purified from several transformants using QIAGEN tip-20 columns according to the manufacturer's instructions and analyzed restriction enzyme digestion and/or PCR analysis.
- Plasmid pTH013 was introduced into Bacillus licheniformis MDT223 via electroporation and integrated by selection for erythromycin resistance at 50°C as described previously. Integrants with pTH013 integrated at the amyL locus were identified by a reduction in the size of zones of clearing on TBAB-agar plates supplemented with 1 % skim milk, indicating disruption of the JP170 protease expression cassette.
- the plasmid was excised as described previously, and erythromycin-sensitive excision products were screened for inability to form clearing zones on TBAB-agar skim milk plates. The presence of the triple promoter/mannanase expression cassette at amyL was verified by PCR analysis. One such strain was designated Bacillus licheniformis TH6.
- Example 7 Construction of a strain of Bacillus licheniformis, having in its chromosome an expression cassette containing two open reading frames in a closely spaced, parallel configuration, both encoding protease 10R (where one open reading frame encodes a protein with a two amino acid extension).
- ⁇ . subtilis strains that are able to transfer the integration vector plasmid designed for integration of the tandem gene construct at the amyL locus into B. licheniformis, were constructed by transformation of plasmids pSJ7365 and pSJ7366 into competent cells of B. subtilis PP289-5.
- PP289-5 (US Patent 6,066,473) contains a deletion in the dal gene (and is therefore able to grow only if media are supplemented with D-alanine), and contains plasmids pLS20 and pBC16, which together deliver the functions needed for conjugative transfer of the integration vector plasmid.
- Transformants were selected on LB PG Sk plates (LB plates with phosphate (0.01 M K 3 P0 ), glucose (0.4 %), and skimmed milk (1 %)), supplemented with erythromycin (5 ⁇ g/ml), tetracycline (5 ⁇ g/ml), and D-alanine (100 ⁇ g/ml), at 30 °C.
- the following strains were kept: SJ7369 and SJ7370 (both PP289-5/pSJ7365), and SJ7371 and SJ7372 (both PP289- 5/pSJ7366).
- Strain TH6 described above, can be used as recipient in conjugations with each of donor strains SJ7369 to SJ7372, performed as described in US Patent 6,066,473. Briefly, donor and recipient cells from overnight plates are mixed on LBPSG agar plates (LB plates with phosphate (0.01 M K 3 P0 4 ), glucose (0.4 %), and starch (0.5 %)), supplemented with D- alanine (100 ⁇ g/ml), incubated at 30 °C for 5 hours, and the plates subsequently replica plated onto LB PG Sk plates with erythromycin (2 ⁇ g/ml).
- Colonies are subsequently streaked on LB PG Sk plates with erythromycin (5 ⁇ g/ml), +/- tetracycline (5 ⁇ g/ml), and tetracycline-sensitive (indicating absence of pBC16), protease-positive transconjugants are streaked onto LB PG Sk plates with erythromycin (5 ⁇ g/ml), which are incubated at 50 °C over the weekend.
- the selection for erythromycin resistance at high temperature ensures that colonies formed have arisen by integration of the integration vector plasmid into the ⁇ .
- licheniformis host strain chromosome by homologous recombination at either the crylllA_stab or the dws_amy sequence, as the plasmid is unable to replicate as a free plasmid at this temperature.
- Colonies forming at 50 °C are streaked onto LB PG Sk plates and incubated at 30 °C overnight. This temperature allows the replication of the integrated plasmid, which facilitates its excision from the chromosome, and ultimately loss from the cell (indicated by erythromycin sensitivity).
- the plasmid may excise via the same region of homology, as was used for integration, in which case the resulting cell is identical to the host strain.
- the plasmid may alternatively excise via the other region of homology (e.g. integration via crylllA_stab, and excision via dws_a/nyL, or vice versa) in which case the tandem expression cassette is left in the chromosome.
- Such strains will in their chromosome, at the amyL locus, contain an expression cassette consisting of a strong composite promoter region (PamyL_4199/scBAN/crylllA+stab) driving expression of a bicistronic construct, carrying SEQUENCE ID NO: 1 , encoding protease 10R, followed by SEQUENCE ID NO: 2, encoding protease 10R with a two amino acid extension.
- a strong composite promoter region PamyL_4199/scBAN/crylllA+stab
- the strains can be evaluated by shake flask fermentation, by inoculation into PS-1 medium and incubation at 30 °C for 7 days, at 300 rpm, and the protease activity of full culture samples can be determined, using the PNA assay with succinyl-alanine-alanine-proline- phenylalnine-paranitroanilide as a substrate.
- the principle of the PNA assay is described in Rothgeb, T.M., Goodlander, B.D., Garrison, P.H., and Smith, L.A., Journal of the American Oil Chemists' Society, Vol. 65 (5) pp. 806-810 (1988).
- the genetic stability of the resulting strains can be investigated, e.g. by extraction of DNA following prolonged fermentation, and detection of the integrated construct composed of two, three, four or even more different sequences encoding the same polypeptide by Southern blot procedures.
- Southern blotting can reveal whether copy loss has occurred by recombination between integrated sequences.
- Example 8 Construction of a Bacillus licheniformis strain, SJ7013, having two copies of the SEQUENCE ID NO: 1, encoding protease 10R, integrated at two different locations in the chromosome.
- Plasmid pSJ6869 designed to allow integration of the SEQUENCE ID NO: 1 expression cassette into the chromosome of a B. licheniformis strain, that already contains a triple promoter integrated at the amyL locus, was described in example 3. Plasmid pSJ6869 was introduced into B. licheniformis TH6 (described in example 6) by conjugation from a B. subtilis donor strain, SJ6885 (PP289-5/pSJ6869), prepared as described in example 7. The protease gene, encoded by SEQUENCE ID NO: 1, was subsequently inserted into the chromosome at the amyL locus by the procedure described in example 7. A resulting strain was kept as SJ6924.
- Plasmid pSJ6408 is an integration vector designed to allow integration of crylllA stabilizer containing expression cassettes at the xylA locus of B. licheniformis host strains, that already contains an integrated copy of the triple promoter (the amyL4199lscBAWcry3A triple tandem promoter) at this locus. It was constructed by ligation of the 0.4 kb EcoRI-Hindlll fragment from pSJ5131 (described in International Patent Application WO 02/00907, page 43) to the 4.3 kb EcoRI-Hindlll fragment of pSJ2739 (US Patent 5,882,888, column 27). The ligation mixture was transformed into competent cells of B. subtilis DN1885, selecting erythromycin- resistance at 30 °C. Two transformants were kept, SJ6408 (DN1885/pSJ6408) and SJ6409 (DN1885/pSJ6409).
- Plasmid pSJ6422 was constructed by insertion of the 1.8 kb Bglll fragment containing the protease 10R gene from pSJ6074 (described in example 1) into Bglll-digested pSJ6408.
- the ligation mixture was transformed into competent cells of ⁇ . subtilis PL1801, selecting erythromycin-resistance at 30 DC, and two transformants kept as SJ6422 (PL1801/pSJ6422) and SJ6423 (PL1801/pSJ6423).
- Plasmid pSJ6973 is similar to pSJ6422, except that it contains the protease 10R gene having the SEQUENCE ID NO: 1 sequence. It was constructed by excision of the 1.2 kb Bsll-Mlul fragment containing the SEQUENCE ID NO: 1 gene from pSJ6869, and ligation of this fragment with the 2.2 kb MIul-Bsll fragment from pSJ6422 and the 3.2 kb Bsll-Bsll fragment from pSJ6422. The ligation mixture was transformed into competent cells of B. subtilis PL1801 , selecting erythromycin-resistance at 30 DC, and two transformants kept as SJ6973 (PL1801/pSJ6973) and SJ6974 (PL1801/pSJ6974).
- Plasmid pSJ6973 was introduced into B. licheniformis SJ6924 (the one-copy strain described above) by conjugation from a B. subtilis donor strain, SJ6983 (PP289-5/pSJ6973), prepared as described in example 7. Tetracyclin-sensitive transconjugants were spread on TSS minimal media plates supplemented with xylose, as described in Patent Publication WO 02/00907, and incubated at 50 DC. Strains, in which the desired integration event had restored the chromosomal xylAB operon, were picked as brownish coloured colonies on the TSS-xylose plates, and propagated in liquid TY cultures at 30 DC, to allow plasmid replication, excision, and loss from the cells.
- pSJ7305 is a pUC19 based plasmid with the same structure as pSJ6074, with the difference that the Savinase ® signal peptide-1 ORpro+mature coding region consists of another synthetic DNA fragment with a DNA sequence different from that of pSJ6074, but still encoding the same amino acid sequence as the gene on pSJ6074.
- the synthetic coding region has the sequence given as SEQ ID NO: 51. DNA containing this synthetic coding region was used as template in a PCR amplification with primers #388968:
- the annealing temperature was ramped down from 59 °C to 49 °C, then kept constant at 54 °C.
- a correctly sized PCR fragment was obtained, digested with Sacl + Mlul, and ligated to the 3.3 kb Mlul-Sacl fragment of pSJ6074.
- the ligation mixture was transformed into E. coli SJ2 by electroporation.
- the PCR amplified region was DNA sequenced on plasmids, that by restriction digests were found to contain the desired insert.
- a plasmid having the correct DNA sequence was kept in strain SJ7305 (SJ2/pSJ7305).
- Plasmid pSJ7312 is designed to allow integration of the SEQ ID NO: 51 expression cassette into the chromosome of a B. licheniformis strain, that already contains a triple-promoter (the amyL4199/scBAWcrylllA triple tandem promoter) integrated at the amyL locus, by homologous recombination at the crylllA stabilizer and downstream amyL segments. It was constructed by excision of the 1.8 kb EcoRI-Hindlll fragment from pSJ7305, and ligation of this fragment to the 4.6 kb EcoRI-Hindlll fragment of plasmid pSJ5487 (described in example 3). The ligation mixture was transformed into B.
- a triple-promoter the amyL4199/scBAWcrylllA triple tandem promoter
- subtilis PL1801 competent cells selecting erythromycin resistance (2 microgram/ml) at 30 °C. 6 protease-positive transformants, forming halos on plates supplemented with skimmed milk, were analysed by restriction digest, and found to be correct. 2 were kept, SJ7311 (PL1801/pSJ7311) and SJ7312 (PL1801/pSJ7312). Plasmid pSJ7312 was introduced into B. licheniformis TH6 (described in example 6) by conjugation from a ⁇ . subtilis donor strain, SJ7321 (PP289-5/pSJ7312), prepared as described in example 7. The protease gene, encoded by SEQUENCE ID NO: 51 , was subsequently inserted into the chromosome at the amyL locus by the procedure described in example 7. A resulting strain was kept as SJ7387.
- Example 10 Construction of a B. licheniformis strains SJ7430 and SJ7431, having one copy of the tandem gene construct SEQUENCE ID NO: 1 - SEQUENCE ID NO: 51, integrated at the amyL locus.
- Plasmid pSJ7420 is an integration vector plasmid for integration of the tandem gene construct SEQUENCE ID NO: 1 - SEQUENCE ID NO: 51 at the amyL locus in B. licheniformis. It was constructed in the following steps:
- Plasmid pSJ7351 was constructed by PCR amplification using pSJ6996 (described in example 4) as template, and primers
- the annealing temperature was ramped down from 58 °C to 48 °C, then kept constant at 53 °C.
- a correctly sized PCR fragment was obtained, digested with EcoRI+Hindlll, and the 1.2 kb fragment ligated to EcoRI+Hindlll digested pUC19 vector.
- the ligation mixture was transformed into E. coli SJ2 by electroporation, and a transformant was kept as SJ7351 (SJ2/pSJ7351).
- Plasmid pSJ7402 was constructed by excision of the 10R SEQ ID NO: 51 gene from pSJ7305 on a 1.2 kb Sacl-Hindlll fragment, and ligation of this fragment to the 2.7 kb Hindlll- Sacl fragment of pSJ7351.
- the ligation mixture was transformed into E. coli SJ2 by electroporation, and two transformants were kept as SJ7402 (SJ2/pSJ7402) and SJ7403 (SJ2/pSJ7403).
- Plasmid pSJ7404 carrying the tandem gene construct SEQUENCE ID NO: 1 - SEQUENCE ID NO: 51 , was constructed by excision of the 1.1 kb Mlul fragment from pSJ7402, and insertion of this fragment into Mlul-digested pSJ6814 (described in example 3).
- the ligation mixture was transformed into E. coli SJ2 by electroporation, and two transformants were kept as SJ7404 (SJ2/pSJ7404) and SJ7405 (SJ2/pSJ7405).
- Plasmid pSJ7420 was finally constructed by excision of the tandem gene construct on a 2.9 kb EcoRI-Hindlll fragment from pSJ7404, and ligation of this fragment to the 4.8 kb EcoRI- Hindlll fragment of pSJ5487 (described in example 3).
- the ligation mixture was transformed into B. subtilis PL1801 competent cells, selecting erythromycin resistance (2 microgram/ml) at 30 °C. 6 protease-positive transformants, forming halos on plates supplemented with skimmed milk, were analysed by restriction digest, and found to be correct. 2 were kept, SJ7420 (PL1801/pSJ7420) and SJ7421 (PL1801/pSJ7421).
- plasmid DNA prepared from these strains revealed no sign of recombination between the tandemly arranged, parallel open reading frames encoding identical enzymes, but differing in their DNA sequence. It is of particular interest, given that the vector plasmid is based on pE194, which is a rolling circle replicating plasmid of the kind on which tandem repeats are notoriously unstable (Gruss and Ehrlich, 1989, Microbiological reviews, 53(2), 231-241).
- Plasmids pSJ7420 and pSJ7421 were introduced into B. licheniformis TH6 (described in example 6) by conjugation from B. subtilis donor strains, SJ7422 (PP289-5/pSJ7422) and SJ7424 (PP289-5/pSJ7424), prepared as described in example 7.
- the tandem protease gene construct consisting of SEQUENCE ID NO: 1 followed by SEQUENCE ID NO: 51 , was subsequently inserted into the chromosome at the amyL locus by the procedure described in example 7. Resulting strains were kept as SJ7430 (from pSJ7420) and SJ7431 (from pSJ7421).
- Example 11 Construction of B. licheniformis strains SJ7502 to SJ7507, having two copies of the tandem gene construct SEQUENCE ID NO: 1 - SEQUENCE ID NO: 51, integrated at two different locations in the chromosome. Plasmid pSJ7465 for integration of the crylllA stabilizer SEQUENCE ID NO: 1 - SEQUENCE ID NO: 51 construct into the xyl locus of B.
- licheniformis host strains that already contains an integrated copy of the triple promoter (the amyL4199/scBAWcry3A triple tandem promoter) at this locus, was constructed by excision of the 1.8 kb Stul-Notl fragment from pSJ7420 (described in example 10) and ligation of this fragment to the 6.0 kb Stul-Notl fragment of pSJ6974 (described in example 8).
- the ligation mixture was transformed into competent cells of B. subtilis PL1801 , selecting erythromycin-resistance at 30 °C, and two transformants kept as SJ7465 (PL1801/pSJ7465) and SJ7466 (PL1801/pSJ7466).
- Plasmids pSJ7465 and pSJ7466 were introduced into B. licheniformis SJ6930 (the one-copy tandem-construct strain described in example 10) by conjugation from ⁇ . subtilis donor strains SJ7467 and SJ7468 (both PP289-5/pSJ7465) or from SJ7470 (PP289-5/pSJ7466), prepared as described in example 7. Tetracyclin-sensitive transconjugants were spread on TSS minimal media plates supplemented with xylose, as described in Patent Publication WO 02/00907, and incubated at 50 DC.
- Such strains having one copy of the 10R SEQUENCE ID NO: 1 - SEQUENCE ID NO: 51 tandem gene construct at the amyL locus, and another copy of the 10R SEQUENCE ID NO: 1 - SEQUENCE ID NO: 51 tandem gene construct at the xyl locus, were kept as SJ7502 and SJ7503 (obtained using pSJ7465 via strain SJ7467), SJ7504 and SJ7505 (obtained using pSJ7465 via strain SJ7468), and SJ7506 and SJ7507 (obtained using pSJ7466 via strain SJ7470).
- the yields from the tandem constructs compare favourably with the yield from the strain having two separately integrated gene copies, indicating stability and efficiency of the tandem gene constructs.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Description
Claims
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US11/571,091 US20080044853A1 (en) | 2004-06-21 | 2005-06-20 | Stably Maintained Multiple Copies of at Least Two Orf in the Same Orientation |
CN2005800284144A CN101006174B (en) | 2004-06-21 | 2005-06-20 | Stably maintained multiple copies of at least two ORF in the same orientation |
DK05750839.2T DK1766002T3 (en) | 2004-06-21 | 2005-06-20 | Stable maintenance of multiple copies of the at least two ORF in the same orientation |
EP05750839.2A EP1766002B1 (en) | 2004-06-21 | 2005-06-20 | Stably maintained multiple copies of at least two orf in the same orientation |
US14/034,124 US10640757B2 (en) | 2004-06-21 | 2013-09-23 | Stably maintained multiple copies of at least two ORF in the same orientation |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DKPA200400968 | 2004-06-21 | ||
DKPA200400968 | 2004-06-21 | ||
DKPA200401569 | 2004-10-13 | ||
DKPA200401569 | 2004-10-13 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US11/571,091 A-371-Of-International US20080044853A1 (en) | 2004-06-21 | 2005-06-20 | Stably Maintained Multiple Copies of at Least Two Orf in the Same Orientation |
US14/034,124 Continuation US10640757B2 (en) | 2004-06-21 | 2013-09-23 | Stably maintained multiple copies of at least two ORF in the same orientation |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2005123915A1 true WO2005123915A1 (en) | 2005-12-29 |
Family
ID=34970464
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/DK2005/000409 WO2005123915A1 (en) | 2004-06-21 | 2005-06-20 | Stably maintained multiple copies of at least two orf in the same orientation |
Country Status (5)
Country | Link |
---|---|
US (2) | US20080044853A1 (en) |
EP (1) | EP1766002B1 (en) |
CN (1) | CN101006174B (en) |
DK (1) | DK1766002T3 (en) |
WO (1) | WO2005123915A1 (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008077881A1 (en) * | 2006-12-22 | 2008-07-03 | Novozymes A/S | Selection of well-expressed synthetic genes |
WO2010097436A1 (en) | 2009-02-27 | 2010-09-02 | Novozymes A/S | Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production |
EP2468881A2 (en) | 2005-07-21 | 2012-06-27 | Abbott Laboratories | Multiple gene expression including sorf contructs and methods with polyproteins, pro-proteins, and proteolysis |
WO2012127001A1 (en) | 2011-03-23 | 2012-09-27 | Novozymes A/S | Methods for producing secreted polypeptides |
WO2018077796A1 (en) | 2016-10-25 | 2018-05-03 | Novozymes A/S | Flp-mediated genomic integrationin bacillus licheniformis |
WO2018234223A1 (en) * | 2017-06-20 | 2018-12-27 | Eth Zurich | Multiple copy gene constructs and methods for the rapid generation of recombinant protein production cell lines |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK3641550T3 (en) | 2017-06-22 | 2021-07-05 | Novozymes As | PROCEDURE FOR IMPROVING STRETCHABILITY OF DOUGH USING GAMMA-GLUTAMYL TRANSPPTIDASE |
Citations (24)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0238023A2 (en) | 1986-03-17 | 1987-09-23 | Novo Nordisk A/S | Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus |
WO1991009129A1 (en) | 1989-12-18 | 1991-06-27 | Novo Nordisk A/S | Stable integration of dna in bacterial genomes |
WO1991014772A1 (en) | 1990-03-23 | 1991-10-03 | Gist-Brocades N.V. | Production of enzymes in seeds and their use |
EP0523976A2 (en) | 1991-07-16 | 1993-01-20 | Connaught Laboratories Limited | Manipulation of gene copy number in bordetella |
WO1994014968A1 (en) | 1992-12-22 | 1994-07-07 | Novo Nordisk A/S | Dna amplification |
US5459064A (en) | 1990-10-24 | 1995-10-17 | Shionogi & Co., Ltd. | Protease |
WO1995033836A1 (en) | 1994-06-03 | 1995-12-14 | Novo Nordisk Biotech, Inc. | Phosphonyldipeptides useful in the treatment of cardiovascular diseases |
WO1996000787A1 (en) | 1994-06-30 | 1996-01-11 | Novo Nordisk Biotech, Inc. | Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein |
WO1996006931A1 (en) | 1994-08-26 | 1996-03-07 | Novo Nordisk A/S | Microbial transglutaminases, their production and use |
US5689054A (en) | 1994-03-17 | 1997-11-18 | The United States Of America As Represented By The Secretary Of Agriculture | Low phytic acid mutants and selection thereof |
US5698415A (en) | 1991-11-13 | 1997-12-16 | Novo Nordisk Als | Bacillus promoter derived from a variant of a bacillus licheniformis X-amylase promoter |
US5733753A (en) | 1992-12-22 | 1998-03-31 | Novo Nordisk A/S | Amplification of genomic DNA by site specific integration of a selectable marker construct |
WO1998056927A2 (en) | 1997-06-12 | 1998-12-17 | Novo Nordisk Biotech, Inc. | Nucleic acids encoding polypeptide having protease activity |
WO1999001562A1 (en) | 1997-07-03 | 1999-01-14 | Novo Nordisk A/S | Protein producing cell containing multiple copies of a desired gene and a screenable marker but no selection marker |
US5882888A (en) | 1995-01-23 | 1999-03-16 | Novo Nordisk A/S | DNA integration by transposition |
WO1999041358A1 (en) | 1998-02-12 | 1999-08-19 | Novo Nordisk A/S | A prokaryotic cell comprising two copies of a gene transcribed in different directions |
WO1999064619A2 (en) | 1998-06-10 | 1999-12-16 | Novozymes A/S | Novel mannanases |
US6066473A (en) | 1995-03-22 | 2000-05-23 | Novo Nordisk A/S | Introduction of DNA into bacillus strains by conjugation |
US6100063A (en) | 1998-02-12 | 2000-08-08 | Novo Nordisk A/S | Procaryotic cell comprising at least two copies of a gene |
WO2000078985A1 (en) * | 1999-06-24 | 2000-12-28 | Metabolix, Inc. | Plant multi-gene expression constructs |
WO2001011063A2 (en) * | 1999-08-10 | 2001-02-15 | Develogen Ag Für Entwicklungsbiologische Forschung | Gene transfer combination vectors, method for the production and utilization thereof |
US6255076B1 (en) | 1998-02-26 | 2001-07-03 | Novozymes Biotech, Inc. | Methods for producing a polypeptide in a Bacillus cell |
WO2002000907A1 (en) | 2000-06-23 | 2002-01-03 | Novozymes A/S | Method for stable chromosomal multi-copy integration of genes |
WO2003054163A2 (en) | 2001-12-21 | 2003-07-03 | Novozymes Biopolymer A/S | Methods for producing hyaluronan in a recombinant host cell |
Family Cites Families (36)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5766912A (en) * | 1986-03-17 | 1998-06-16 | Novo Nordisk A/S | Humicola lipase produced in aspergillus |
AU620026B2 (en) * | 1987-02-27 | 1992-02-13 | Genencor International, Inc. | Molecular cloning and expression of genes encoding proteolytic enzymes |
JP2637532B2 (en) * | 1987-02-27 | 1997-08-06 | ギスト ブロカデス ナームローゼ フェンノートチャップ | Stable gene amplification in chromosomal DNA of prokaryotic microorganisms |
ATE125865T1 (en) | 1987-08-28 | 1995-08-15 | Novo Nordisk As | RECOMBINANT HUMICOLA LIPASE AND METHOD FOR PRODUCING RECOMBINANT HUMICOLA LIPASES. |
JPH06506117A (en) * | 1991-04-01 | 1994-07-14 | メルク エンド カンパニー インコーポレーテッド | Genes affecting Pichia proteolytic activity and their use |
US5786464C1 (en) * | 1994-09-19 | 2012-04-24 | Gen Hospital Corp | Overexpression of mammalian and viral proteins |
US6329141B1 (en) * | 1995-12-22 | 2001-12-11 | Dsm N.V. | Methods for transforming Phaffia strains, transformed Phaffia strains so obtained and recombinant DNA in said methods |
US6020144A (en) * | 1996-09-12 | 2000-02-01 | Symbiontics, Inc. | Sustained delivery device comprising a Leishmania protozoa and methods of making and using the same |
US6114148C1 (en) * | 1996-09-20 | 2012-05-01 | Gen Hospital Corp | High level expression of proteins |
DE19733364A1 (en) * | 1997-08-01 | 1999-02-04 | Koszinowski Ulrich H Prof | Method of cloning a large virus genome |
US6307123B1 (en) * | 1998-05-18 | 2001-10-23 | Dekalb Genetics Corporation | Methods and compositions for transgene identification |
US6322962B1 (en) * | 1998-08-14 | 2001-11-27 | Board Of Regents, The University Of Texas System | Sterol-regulated Site-1 protease and assays of modulators thereof |
FR2784394B1 (en) * | 1998-10-09 | 2001-01-05 | Lesaffre & Cie | INTEGRATION-EXCISION CASSETTE |
US6916917B1 (en) * | 1998-11-17 | 2005-07-12 | California Institute Of Technology | Chimeric pro-caspases and methods of using same |
US6194636B1 (en) * | 1999-05-14 | 2001-02-27 | Dekalb Genetics Corp. | Maize RS324 promoter and methods for use thereof |
JP4660046B2 (en) * | 1999-10-13 | 2011-03-30 | イミュネックス・コーポレーション | Vectors and methods for recombinant protein expression |
EP1290207B1 (en) * | 2000-05-24 | 2010-09-08 | Novozymes A/S | Method for increasing gene copy number in a host cell and resulting host cell |
US20020168772A1 (en) | 2001-05-11 | 2002-11-14 | Lloyd Greg A. | Method of detecting poisoning of a MOS gas sensor |
DK1270722T3 (en) * | 2001-06-22 | 2007-05-14 | Inst Francais Du Petrole | Cytochrome P-450 cluster from Rhodococcus rubber and its use for ether fuel cleavage |
US20040078837A1 (en) * | 2001-08-02 | 2004-04-22 | Shannon Mark E. | Four human zinc-finger-containing proteins: MDZ3, MDZ4, MDZ7 and MDZ12 |
DK1414986T3 (en) * | 2001-08-06 | 2009-01-19 | Evonik Degussa Gmbh | Coryform bacteria that produce chemical compounds II |
US20040029129A1 (en) * | 2001-10-25 | 2004-02-12 | Liangsu Wang | Identification of essential genes in microorganisms |
US20030157641A1 (en) * | 2001-11-16 | 2003-08-21 | Idec Pharmaceuticals Corporation | Polycistronic expression of antibodies |
US20060040346A1 (en) * | 2002-04-10 | 2006-02-23 | Novozymes A/S | Bacillus host cell |
ATE399869T1 (en) * | 2002-04-10 | 2008-07-15 | Novozymes As | IMPROVED BACILLUS HOST CELL |
DE10236001A1 (en) * | 2002-08-06 | 2004-02-19 | Icon Genetics Ag | Producing transgenic plants transformed in the plastome, by introducing two DNA segments each containing a region homologous with plastome nucleic acid |
NZ539893A (en) * | 2002-11-08 | 2008-06-30 | Univ Queensland | A method for optimising gene expression using synonymous codon optimisation |
ATE368105T1 (en) * | 2003-02-07 | 2007-08-15 | Novozymes As | PROTEASES |
US20040231060A1 (en) * | 2003-03-07 | 2004-11-25 | Athenix Corporation | Methods to enhance the activity of lignocellulose-degrading enzymes |
US7485447B2 (en) * | 2003-06-19 | 2009-02-03 | Novozymes A/S | Proteases and methods for producing them |
CN1902318A (en) * | 2003-10-31 | 2007-01-24 | 诺维信公司 | Method for stable gene-amplification in a bacterial host cell |
CN1969045A (en) * | 2003-12-10 | 2007-05-23 | 诺维信公司 | Cell with improved secretion mediated by MrgA protein or homologue |
GB0329722D0 (en) * | 2003-12-23 | 2004-01-28 | Delta Biotechnology Ltd | Modified plasmid and use thereof |
WO2005123914A1 (en) * | 2004-06-21 | 2005-12-29 | Novozymes A/S | Improved methods of producing heterologous proteases |
US20080085535A1 (en) * | 2004-10-22 | 2008-04-10 | Novozymes A/S | Stable Genomic Integration of Multiple Polynucleotide Copies |
JP5631533B2 (en) * | 2004-12-23 | 2014-11-26 | ノボザイムス バイオファーマ デーコー アクティーゼルスカブ | Gene expression technology |
-
2005
- 2005-06-20 EP EP05750839.2A patent/EP1766002B1/en active Active
- 2005-06-20 WO PCT/DK2005/000409 patent/WO2005123915A1/en active Application Filing
- 2005-06-20 US US11/571,091 patent/US20080044853A1/en not_active Abandoned
- 2005-06-20 DK DK05750839.2T patent/DK1766002T3/en active
- 2005-06-20 CN CN2005800284144A patent/CN101006174B/en active Active
-
2013
- 2013-09-23 US US14/034,124 patent/US10640757B2/en active Active
Patent Citations (28)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0238023A2 (en) | 1986-03-17 | 1987-09-23 | Novo Nordisk A/S | Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus |
WO1991009129A1 (en) | 1989-12-18 | 1991-06-27 | Novo Nordisk A/S | Stable integration of dna in bacterial genomes |
WO1991014772A1 (en) | 1990-03-23 | 1991-10-03 | Gist-Brocades N.V. | Production of enzymes in seeds and their use |
US5459064A (en) | 1990-10-24 | 1995-10-17 | Shionogi & Co., Ltd. | Protease |
EP0523976A2 (en) | 1991-07-16 | 1993-01-20 | Connaught Laboratories Limited | Manipulation of gene copy number in bordetella |
US5698415A (en) | 1991-11-13 | 1997-12-16 | Novo Nordisk Als | Bacillus promoter derived from a variant of a bacillus licheniformis X-amylase promoter |
WO1994014968A1 (en) | 1992-12-22 | 1994-07-07 | Novo Nordisk A/S | Dna amplification |
US5733753A (en) | 1992-12-22 | 1998-03-31 | Novo Nordisk A/S | Amplification of genomic DNA by site specific integration of a selectable marker construct |
US5689054A (en) | 1994-03-17 | 1997-11-18 | The United States Of America As Represented By The Secretary Of Agriculture | Low phytic acid mutants and selection thereof |
US6111168A (en) | 1994-03-17 | 2000-08-29 | The United States Of America As Represented By The Secretary Of Agriculture | Low phytic acid mutants and selection thereof |
WO1995033836A1 (en) | 1994-06-03 | 1995-12-14 | Novo Nordisk Biotech, Inc. | Phosphonyldipeptides useful in the treatment of cardiovascular diseases |
WO1996000787A1 (en) | 1994-06-30 | 1996-01-11 | Novo Nordisk Biotech, Inc. | Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein |
WO1996006931A1 (en) | 1994-08-26 | 1996-03-07 | Novo Nordisk A/S | Microbial transglutaminases, their production and use |
US5882888A (en) | 1995-01-23 | 1999-03-16 | Novo Nordisk A/S | DNA integration by transposition |
US6066473A (en) | 1995-03-22 | 2000-05-23 | Novo Nordisk A/S | Introduction of DNA into bacillus strains by conjugation |
WO1998056927A2 (en) | 1997-06-12 | 1998-12-17 | Novo Nordisk Biotech, Inc. | Nucleic acids encoding polypeptide having protease activity |
US5891701A (en) | 1997-06-12 | 1999-04-06 | Novo Nordisk Biotech Inc. | Nucleic acids encoding a polypeptide having protease activity |
WO1999001562A1 (en) | 1997-07-03 | 1999-01-14 | Novo Nordisk A/S | Protein producing cell containing multiple copies of a desired gene and a screenable marker but no selection marker |
WO1999041358A1 (en) | 1998-02-12 | 1999-08-19 | Novo Nordisk A/S | A prokaryotic cell comprising two copies of a gene transcribed in different directions |
US6100063A (en) | 1998-02-12 | 2000-08-08 | Novo Nordisk A/S | Procaryotic cell comprising at least two copies of a gene |
US6255076B1 (en) | 1998-02-26 | 2001-07-03 | Novozymes Biotech, Inc. | Methods for producing a polypeptide in a Bacillus cell |
US20030170876A1 (en) | 1998-02-26 | 2003-09-11 | Novozymes Biotech, Inc. | Methods for producing a polypeptide in a bacillus cell |
WO1999064619A2 (en) | 1998-06-10 | 1999-12-16 | Novozymes A/S | Novel mannanases |
WO2000078985A1 (en) * | 1999-06-24 | 2000-12-28 | Metabolix, Inc. | Plant multi-gene expression constructs |
WO2001011063A2 (en) * | 1999-08-10 | 2001-02-15 | Develogen Ag Für Entwicklungsbiologische Forschung | Gene transfer combination vectors, method for the production and utilization thereof |
WO2002000907A1 (en) | 2000-06-23 | 2002-01-03 | Novozymes A/S | Method for stable chromosomal multi-copy integration of genes |
US20030032186A1 (en) | 2000-06-23 | 2003-02-13 | Novozymes A/S | Method for stable chromosomal multi-copy integration of genes |
WO2003054163A2 (en) | 2001-12-21 | 2003-07-03 | Novozymes Biopolymer A/S | Methods for producing hyaluronan in a recombinant host cell |
Non-Patent Citations (75)
Title |
---|
"Biology and Activities of Yeast", 1980 |
"Enzyme Nomenclature 1992 from NC-IUBMB", ACADEMIC PRESS |
"Handbook of Proteolytic Enzymes", 1998, ACADEMIC PRESS |
"Molecular Biological Methods for Bacillus", 1990, JOHN WILEY AND SONS LTD. |
"Nomenclature Committee of the International Union of Biochemistry and Molecular Biology", 1992, ACADEMIC PRESS, INC. |
"Protein Purification", 1989, VCH PUBLISHERS |
"Useful proteins from recombinant bacteria", SCIENTIFIC AMERICAN, vol. 242, 1980, pages 74 - 94 |
AGAISSE; LERECLUS, MOL. MICROBIOL., vol. 13, 1994, pages 97 - 107 |
AYARES ET AL., PROC. NATL. ACAD. SCI., vol. 83, 1986, pages 5199 - 5203 |
BECKER; GUARENTE: "Methods in Enzymology", vol. 194, ACADEMIC PRESS, INC., article "Guide to Yeast Genetics and Molecular Biology", pages: 182 - 187 |
BIOCHEM.J., vol. 290, 1993, pages 205 - 218 |
CHANG; COHEN, MOLECULAR GENERAL GENETICS, vol. 168, 1979, pages 111 - 115 |
CHÉDIN ET AL., MOL. MICROBIOL., vol. 12, 1994, pages 561 - 569 |
CHEN ET AL., PLANT AND CELL PHYSIOLOGY, vol. 39, 1998, pages 935 - 941 |
CHN ET AL., JOURNAL OF AMARICAL CHEMICAL SOCIATY, vol. 11, 1994, pages 8799 - 8800 |
CHRISTOU, PLANT JOURNAL, vol. 2, 1992, pages 275 - 281 |
CONRAD ET AL., JOURNAL OF PLANT PHYSIOLOGY, vol. 152, 1998, pages 708 - 711 |
DEBOER ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 80, 1983, pages 21 - 25 |
DIDERICHSEN ET AL., J. BACTERIOL., vol. 172, no. 8, 1990, pages 4315 - 4321 |
DILLON; ROSSEN, BIOTECHNIQUES, vol. 9, 1990, pages 298 - 300 |
DUBNAU; DAVIDOFF-ABELSON, JOURNAL OF MOLECULAR BIOLOGY, vol. 56, 1971, pages 209 - 221 |
EDWARDS; CORUZZI, ANN. REV. GENET., vol. 24, 1990, pages 275 - 303 |
EHRLICH, PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 75, 1978, pages 1433 |
EUR. J. BIOCHEM., vol. 223, 1994, pages 1 - 5 |
EUR. J. BIOCHEM., vol. 232, 1995, pages 1 - 6 |
EUR. J. BIOCHEM., vol. 237, 1996, pages 1 - 5 |
EUR. J. BIOCHEM., vol. 250, 1997, pages 1 - 6 |
EUR. J. BIOCHEM., vol. 264, 1999, pages 610 - 650 |
FRANCK ET AL., CELL, vol. 21, 1980, pages 285 - 294 |
GASSER ET AL., SCIENCE, vol. 244, 1990, pages 1293 |
GRUSS; EHRLICH, MICROBIOLOGICAL REVIEWS, vol. 53, no. 2, 1989, pages 231 - 241 |
GUO; SHERMAN, MOLECULAR CELLULAR BIOLOGY, vol. 15, 1995, pages 5983 - 5990 |
HAWKSWORTH ET AL.: "Ainsworth and Bisby's Dictionary of The Fungi", 1995, UNIVERSITY PRESS |
HINNEN ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 75, 1978, pages 1920 |
HONE ET AL., MICROBIAL PATHOGENESIS, vol. 5, 1988, pages 407 - 418 |
HOOYKAS; SCHILPEROORT, PLANT MOLECULAR BIOLOGY, vol. 19, 1992, pages 15 - 38 |
HORTON ET AL., GENE, vol. 77, 1989, pages 61 - 8 |
HORVATH ET AL., PNAS, vol. 97, no. 4, 15 February 2000 (2000-02-15), pages 1914 - 1919 |
ITO ET AL., JOURNAL OF BACTERIOLOGY, vol. 153, 1983, pages 163 |
ITO ET AL., PLANT MOL. BIOL., vol. 24, 1994, pages 863 - 878 |
KAGAYA ET AL., MOLECULAR AND GENERAL GENETICS, vol. 248, 1995, pages 668 - 674 |
KAKUDO ET AL., J. BIOL. CHEM., vol. 267, 1992, pages 23782 |
KHASANOV ET AL., MOL. GEN. GENET., vol. 234, 1992, pages 494 - 497 |
KOEHLER; THORNE, JOURNAL OF BACTERIOLOGY, vol. 169, 1987, pages 5771 - 5278 |
KYOZUKA; 1993 ET AL., PLANT PHYSIOLOGY, vol. 102, pages 991 - 1000 |
MALARDIER ET AL., GENE, vol. 78, 1989, pages 147 - 156 |
MITRA; HIGGINS, PLANT MOLECULAR BIOLOGY, vol. 26, 1994, pages 85 - 93 |
OMIRULLEH ET AL., PLANT MOLECULAR BIOLOGY, vol. 21, 1993, pages 415 - 428 |
POTRYKUS, BIOLTECHNOLOGY, vol. 8, 1990, pages 535 |
PRODROMOU; PEARL, PROTEIN ENGINEERING, vol. 5, 1992, pages 827 - 829 |
PUCHTA; HOHN, NUCLEIC ACID RESEARCH, vol. 19, 1991, pages 2693 - 2700 |
RAWLINGS ND; BARRETT AJ.: "Evolutionary families of peptidases", BIOCHEM. J., vol. 290, 1993, pages 205 - 218, XP008008506 |
RAWLINGS, N.D. ET AL.: "MEROPS: The protease database", NUCLEIC ACIDS RES., vol. 30, 2002, pages 343 - 346 |
RAWLINGS, N.D.; O'BRIEN, E. A.; BARRETT, A.J.: "MEROPS: the protease database", NUCLEIC ACIDS RES., vol. 30, 2002, pages 343 - 346 |
ROMANOS ET AL., YEAST, vol. 8, 1992, pages 423 - 488 |
ROTHGEB, T.M.; GOODLANDER, B.D.; GARRISON, P.H.; SMITH, L.A., JOURNAL OF THE AMERICAN OIL CHEMISTS' SOCIETY, vol. 65, no. 5, 1988, pages 806 - 810 |
ROTHGEB, T.M.; GOODLANDER, B.D.; GARRISON, P.H.; SMITH, L.A., JOURNAL OF THE AMERICAN OIL CHEMISTS, vol. 65, no. 5, 1988, pages 806 - 810 |
SHIGEKAWA; DOWER, BIOTECHNIQUES, vol. 6, 1988, pages 742 - 751 |
SHIMAMOTO ET AL., NATURE, vol. 338, 1989, pages 274 |
SHIMAMOTO, CURRENT OPINION BIOTECHNOLOGY, vol. 5, 1994, pages 158 - 162 |
SIMONEN; PALVA, MICROBIOLOGICAL REVIEWS, vol. 57, 1993, pages 109 - 137 |
STEMMER ET AL., GENE, vol. 164, 1995, pages 49 - 53 |
TAGUE ET AL., PLANT PHYSIOLOGY, vol. 86, 1988, pages 506 |
VASANTHA ET AL., J. BACTERIOL., vol. 159, no. 3, 1984, pages 811 |
VASIL ET AL., BIOLTECHNOLOGY, vol. 10, 1992, pages 667 - 674 |
VILLA-KAMAROFF ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 75, 1978, pages 3727 - 3731 |
WATT ET AL., PROC. NATL. ACAD. SCI., vol. 82, 1985, pages 4768 - 4772 |
WIDNER, B.; THOMAS, M.; STERNBERG, D.; LAMMON, D.; BEHR, R.; SLOMA, A.: "Development of marker-free strains of Bacillus subtilis capable of secreting high levels of industrial enzymes", JOURNAL OF INDUSTRIAL MICROBIOLOGY & BIOTECHNOLOGY, vol. 25, 2000, pages 204 - 212, XP009061785, DOI: doi:10.1038/sj.jim.7000051 |
WIDNER, W.; SLOMA, A.; THOMAS, M. D., METHODS FOR PRODUCING A POLYPEPTIDE IN A BACILLUS CELL, 2003 |
WU ET AL., PLANT AND CELL PHYSIOLOGY, vol. 39, 1998, pages 885 - 889 |
XU ET AL., PLANT MOLECULAR BIOLOGY, vol. 22, 1993, pages 573 - 588 |
XUE, JOURNAL OF MICROBIOLOGICAL METHODS, vol. 34, 1999, pages 183 - 191 |
YANISCH-PERRON ET AL., GENE, vol. 33, no. 1, 1985, pages 103 - 119 |
YELTON ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 81, 1984, pages 1470 - 1474 |
YOUNG; SPIZIZIN, JOURNAL OF BACTERIOLOGY, vol. 81, 1961, pages 823 - 829 |
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2468881A2 (en) | 2005-07-21 | 2012-06-27 | Abbott Laboratories | Multiple gene expression including sorf contructs and methods with polyproteins, pro-proteins, and proteolysis |
EP2468768A2 (en) | 2005-07-21 | 2012-06-27 | Abbott Laboratories | Multiple gene expression including sorf contructs and methods with polyproteins, pro-proteins, and proteolysis |
EP2484774A2 (en) | 2005-07-21 | 2012-08-08 | Abbott Laboratories | Multiple gene expression including sorf contructs and methods with polyproteins, pro-proteins, and proteolysis |
WO2008077881A1 (en) * | 2006-12-22 | 2008-07-03 | Novozymes A/S | Selection of well-expressed synthetic genes |
US9334493B2 (en) | 2006-12-22 | 2016-05-10 | Novozymes A/S | Selection of well-expressed synthetic genes |
WO2010097436A1 (en) | 2009-02-27 | 2010-09-02 | Novozymes A/S | Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production |
WO2012127001A1 (en) | 2011-03-23 | 2012-09-27 | Novozymes A/S | Methods for producing secreted polypeptides |
WO2018077796A1 (en) | 2016-10-25 | 2018-05-03 | Novozymes A/S | Flp-mediated genomic integrationin bacillus licheniformis |
WO2018234223A1 (en) * | 2017-06-20 | 2018-12-27 | Eth Zurich | Multiple copy gene constructs and methods for the rapid generation of recombinant protein production cell lines |
Also Published As
Publication number | Publication date |
---|---|
DK1766002T3 (en) | 2015-12-07 |
US20140106457A1 (en) | 2014-04-17 |
CN101006174A (en) | 2007-07-25 |
US20080044853A1 (en) | 2008-02-21 |
CN101006174B (en) | 2010-05-26 |
EP1766002B1 (en) | 2015-11-18 |
EP1766002A1 (en) | 2007-03-28 |
US10640757B2 (en) | 2020-05-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10640757B2 (en) | Stably maintained multiple copies of at least two ORF in the same orientation | |
JP4091119B2 (en) | Novel host cell and protein production method | |
EP3481959A1 (en) | Improving a microorganism by crispr-inhibition | |
US20060075519A1 (en) | Polypeptides having cellobiase activity and ploynucleotides encoding same | |
CN101495625B (en) | Chloramphenicol resistance selection in bacillus licheniformis | |
KR20180069057A (en) | Improved protein expression and methods thereof | |
JP2001514529A (en) | Nucleic acids encoding polypeptides having protease activity | |
JP6591998B2 (en) | Resolubilization of protein crystals at low pH | |
BRPI0718518B1 (en) | POLYNUCLEOTYDE ENCODING SELECTED MARKER OF ACETOLACTATE SYNTASE (ALS) OF TRICHODERMA REESEI, TRANSGENIC MICROORGANISM AND METHOD OF SELECTION OF A CELL | |
JP2011101651A (en) | Oxaloacetate hydrolase deficient fungal host cell | |
JP2022509215A (en) | Novel promoter sequences and methods for enhancing protein production in Bacillus cells | |
JP2002539822A (en) | Polypeptide having branching enzyme activity and nucleic acid encoding the same | |
JP6335793B2 (en) | Expression method | |
JP2021510070A (en) | Mutations and genetically modified Bacillus cells for increased protein production, and methods thereof | |
CN114717209A (en) | T4DNA ligase variants with increased salt tolerance | |
CA3121271A1 (en) | Modified filamentous fungal host cells | |
DK2697376T3 (en) | EXPRESSION PROCEDURE WITH A HELP PROTASE | |
EP1639107B1 (en) | Improved proteases and methods for producing them | |
US20220010305A1 (en) | Genome Editing by Guided Endonuclease and Single-stranded Oligonucleotide | |
CN114934026B (en) | T4DNA ligase variants with increased ligation efficiency | |
US20220298517A1 (en) | Counter-selection by inhibition of conditionally essential genes | |
EP3728583B1 (en) | Counter-selection by inhibition of conditionally essential genes | |
KR20220097505A (en) | Compositions and methods for enhancing protein production in Bacillus cells | |
EP4237430A1 (en) | Leader peptides and polynucleotides encoding the same | |
KR20240099301A (en) | Compositions and methods for enhancing protein production in Bacillus cells |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 11571091 Country of ref document: US |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2005750839 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 200580028414.4 Country of ref document: CN |
|
WWP | Wipo information: published in national office |
Ref document number: 2005750839 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 11571091 Country of ref document: US |