WO2005123772A2 - Anti-cancer therapy - Google Patents

Anti-cancer therapy Download PDF

Info

Publication number
WO2005123772A2
WO2005123772A2 PCT/IL2005/000638 IL2005000638W WO2005123772A2 WO 2005123772 A2 WO2005123772 A2 WO 2005123772A2 IL 2005000638 W IL2005000638 W IL 2005000638W WO 2005123772 A2 WO2005123772 A2 WO 2005123772A2
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
use according
chronic
carcinoma
mice
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IL2005/000638
Other languages
French (fr)
Other versions
WO2005123772A3 (en
Inventor
Yinon Ben Neriah
Eli Pikarsky
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hadasit Medical Research Services and Development Co
Yissum Research Development Co of Hebrew University of Jerusalem
Original Assignee
Hadasit Medical Research Services and Development Co
Yissum Research Development Co of Hebrew University of Jerusalem
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hadasit Medical Research Services and Development Co, Yissum Research Development Co of Hebrew University of Jerusalem filed Critical Hadasit Medical Research Services and Development Co
Publication of WO2005123772A2 publication Critical patent/WO2005123772A2/en
Publication of WO2005123772A3 publication Critical patent/WO2005123772A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/241Tumor Necrosis Factors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation

Definitions

  • the present invention concerns cancer therapy, and in particular preventive anti-cancer therapy.
  • NF- ⁇ B is an established central mediator of immune and inflammatory responses, yet its involvement in cancer is a matter of continuous debate. On one hand it is constitutively activated in certain tumors, and cell lines derived from such tumors succumb to apoptosis upon F- ⁇ B inhibition ' , suggesting that NF- B is pro-tumorigenic. Yet, the following examples argue to the contrary: NF- ⁇ B inhibition promotes tumor growth and invasiveness in oncogene-transformed epidermal cells , p53 cytotoxicity in mouse embryonic fibroblasts is NF- ⁇ B - dependent 8 ; upon geotaxis stress, NF- ⁇ B activation may repress anti-apoptotic genes 9 . " While the reason for these apparently conflicting in vitro data is not clear, a more realistic evaluation of the role of NF- ⁇ B in cancer would likely be derived from an in vivo model.
  • a useful mouse model in which the role of F- ⁇ B could be investigated throughout the entire tumorigenesis process would be such in which chronic inflammation prevails with minimal external perturbation, evolving to cancer with sufficiently high incidence to allow the dissection of the underlying mechanism.
  • the cholestasis-based inflammation model of the Mdr2 KO mice meets these criteria: close to 100%) of the mice spontaneously develop HCC following 10-12 month of chronic inflammation, and no intervention is necessary to ensure this outcome .
  • NF- ⁇ B activity is crucial for the progression from a chronic inflammation condition to tumor and that by inhibiting its activation it is possible to prevent the progression from a chronic inflammatory condition into tumor. While the association between NF- ⁇ B inhibition and cancer has been elucidated previously, albeit with conflicting results and conclusions, its specific connection in the prevention of the progression from a chronic inflammatory condition to neoplasm has not been elucidated.
  • the present invention is based on the surprising finding that anti-TNF ⁇ treatment of KO mice resulted in apoptosis of pre-neoplastic cells. This surprising finding, paves the way to the use of anti-TNF ⁇ agents in the prevention of the progression from chronic inflammation into cancer.
  • the present invention is further based on the finding that administration of non-steroidal anti-inflammatory drugs, in a mouse model of chronic inflammatory condition which evolved into neoplasm, prevented said evolvement from the chronic condition to the neoplastic state.
  • This surprising finding paves the way to the use of NSAIDs in the prevention of the progression from chronic inflammation into cancer.
  • the present invention concerns a method of preventing progression of a chronic inflammatory condition to cancer comprising administering to an individual, suffering from the chronic inflammatory condition, a therapeutic effective amount of an F- ⁇ B inhibitor.
  • the present invention further concerns the use of an NF- ⁇ B inhibitor for the preparation of a medicament for the prevention of the progression of a chronic inflammatory condition to cancer.
  • the present invention also concerns the use of an NF- ⁇ B inhibitor in individuals of families inflicted with high cancer incidence, where the particular cancer type is thought to be associated with chronic inflammation is prevalent (e.g. colorectal cancer- where aspirin has a preventive value).
  • the inhibitor may be used as a preventive measure also in individuals who do not have a chronic inflammation condition but who have a high probability of having cancer.
  • the prevented cancer should preferably be of the type associated with NF- KB activation such as for example colorectal carcinoma; oesophageal carcinoma; MALT lymphoma; hepatocellular carcinoma; prostate cancer; gastric cancer .
  • the cancer should be of a type which is known to involve NF- ⁇ B activation such as breast cancer particularly Estrogen receptor-negative, prostate cancer, multiple myeloma, non Hodgkin's lymphoma, activated B-cell lymphoma, Hodgkin's disease hepatocellular carcinoma.
  • the cancer is of the type which is strongly associated with chromic inflammatory condition, or a specific cancer that is significantly more prevalent in a population suffering from a specific chronic inflammatory disease as compares to the prevalence in the population at large. Examples of cancers associated with chronic inflammations (and the chronic conditions with which they are associated):
  • Lung carcinoma associated with chronic inflammation in the form of bronchitis
  • Bladder carcinoma associated with chronic cystitis and bladder inflammation
  • Oral squamous cell carcinoma (associated with gingivitis, lichen planus);
  • Salivary gland carcinoma associated with sialadenitis
  • Colorectal carcinoma associated with chronic inflammatory condition of inflammatory bowel disease, Crohn's disease, and chronic ulcerative colitis
  • Vulvar squamous cell carcinoma (associated with chronic inflammatory conditions of Lichen sclerosus);
  • Pancreatic carcinoma associated with a chronic inflammatory disease of chronic pancreatitis and hereditary pancreatitis
  • Oesophageal carcinoma associated with the chronic inflammatory condition of reflux oesophaglitis and Barrett's oesophagus
  • MALT lymphoma associated with the chronic disease of Sj ⁇ gren syndrome
  • the cancer is hepatocellular carcinoma (associated with the inflammatory disease of chronic hepatitis), Prostate cancer (associated with Proliferative Inflammatory Atrophy, PAI), Gastric cancer (associated with H. pylori gastritis) and es ⁇ phageal carcinoma on the background of reflux esophagitis and Barrett's disease.
  • the chronic inflammatory condition is hepatitis and the cancer is hepatocellular carcinoma.
  • the high probability may be calculated based on the mere existence of the chronic inflammation but may take in addition into account other factors that increase the probability of progression into cancer such as: duration of the inflammation, severity and activity of the inflammation, damage caused by the inflammation (cirrhosis increases the chances of chronic hepatitis patients developing hepatocellular carcinoma), genetic profile and life style.
  • the "prevention" may be the prevention of cancer altogether, may be the delay in the onset of cancer as compared to an untreated control, may be the progression to a cancer of a lesser severity as compared to control, extended period of a pre-malignant phase and slower progression of a once-appeared cancer, as compared to a control, e.g., delayed appearance of invasive or metastatic cancer.
  • Surrogate endpoints may include delay in the appearance and severity of recognized premalignant lesions such as high grade dysplasia (in the case of gastric and esophageal inflammation) or dysplatic nodules (in the case of chronic hepatitis)
  • the method of preventive treatment should involve periodic preventive administration, for relatively short periods of time of an NF- ⁇ B inhibitor, to a subject suffering from a chronic inflammatory condition which is know to be strongly associated with subsequent development of cancer, or a person at a premalignant phase that is normally not subject to anti-cancer treatment (e.g., chronic hepatitis C, or Barrett's disease) .
  • Treatment regime is preferably consisting of intermittent administration of an inhibitor, preferentially short periods of administration and relatively long periods of cessation of administration, which may be sufficient to block or delay the development of an associated cancer type It should be noted that the purpose of this short intermittent therapy is to eliminate cancer-prone epithelial cells and not to eradicate the mflammatory process itself.
  • NF-J B inhibitor refers to any agent, chemical or biological, which is known to reduce NF- ⁇ B levels or activity in humans by any mechanism such as by decrease in transcription, translation (antisense sequence, siRNA, , shRNA, , micRNA, ribozyme), by neutralizing NF- ⁇ B, by increase in NF- ⁇ B degradation, or stabilization of an NF- ⁇ B inhibitor (I ⁇ B), by inhibition of reaction with any of the upstream component in the NF- ⁇ B pathway, such as with IKK,.
  • I ⁇ B-E3 ubiquitin ligase
  • the present invention concerns a method of preventing progression of a chronic inflammatory condition to cancer comprising administering to an individual ,suffering from the chronic inflammatory condition, a therapeutic effective amount of an anti TNF ⁇ agent
  • the present invention also concerns the use of TNF ⁇ agents for the preparation of a medicament for of preventing progression of a chronic inflammatory condition to cancer whether via their activity in connection with NF- ⁇ B and/or their activity via another mechanism, (such as by suppression of cJun) .
  • anti-TNFa agent refers to any chemical or biological agent that can reduce the amount of physiologically-active TNF ⁇ , or reduce the signaling effect of TNF ⁇ (e.g. interaction of TNF ⁇ with its receptor or the intensity of receptor signaling).
  • the agent may be a nucleotide based agent (antisense sequence, siRNA, , shRNA, micRNA and ribozyme) working by decreasing transcription, translation of TNF- ⁇ or by increasing the RNA degradation; an agent capable of neutralizing the circulating TNF- ⁇ (antibodies, soluble receptors), agents capable of inhibiting enzymes involved in TNF- ⁇ synthesis or the processing of TNF ⁇ to its mature, active species.
  • a nucleotide based agent antisense sequence, siRNA, , shRNA, micRNA and ribozyme working by decreasing transcription, translation of TNF- ⁇ or by increasing the RNA degradation
  • an agent capable of neutralizing the circulating TNF- ⁇ antioxidants, antibodies, soluble receptors
  • agents capable of inhibiting enzymes involved in TNF- ⁇ synthesis or the processing of TNF ⁇ to its mature, active species capable of inhibiting enzymes involved in TNF- ⁇ synthesis or the processing of TNF ⁇ to its mature, active species.
  • Inhibition of synthesis may be indirect, for example, through the p38 MAP kinase which has a pivotal role in the regulation of TNF- ⁇ synthesis, through the TACE inhibition which controls the cleavage of membrane bound TNF- ⁇ ; through inhibition of photodiesterase type 4 enzyme (PDE4) - which indirectly decreases TNF- ⁇ production by increasing the level of intracellular cyclic adenosine monophosphase (cAMP).
  • Examples of anti-TNF agents already approved for clinical use are Etanercept (Enbrel; Amgen/Wyeth), Infliximab (Remicade; Centor/Schering- Plough/Tanabe Sieyaku); Adalimumab (Humira; Abbott).
  • Etanercept Enbrel; Amgen/Wyeth
  • Infliximab Remicade; Centor/Schering- Plough/Tanabe Sieyaku
  • Adalimumab Humira; Abbott
  • the NF- ⁇ B inhibitors in a rather non-specific manner
  • NSAIDs non-steroidal inflammatory drugs
  • the present invention concerns a method for preventing progression of a chronic inflammatory condition to cancer comprising administering to an individual suffering from the chronic inflammatory condition, cancer, a therapeutic effective amount of at least one non steroidal anti- inflammatory drug
  • non-steroidal anti-inflammatory drugs refers to any natural or synthetic agent that is known to decrease at least one parameter of inflammation, and which is not a steroid .This term also refers to a combination of two or more of such agents. Action of these drugs may be partially attributed to reducing the number of TNF ⁇ producing cells but may be also attributed to additional mechanisms.
  • Example of some common NSAID are:
  • diclofenac Voltaren, Cataflam
  • diflunisal Dolobid
  • etodolac Lidine
  • flurbiprofen Ansaid
  • ibuprofen Motrin, Advil
  • indomethacin Indocin
  • ketoprofen Orudis, Oruvail
  • ketorolac Toradol
  • Cox-2 selective NSAIDs celecoxib (Celebrex);rofecoxib (Vioxx).
  • Fig. l(a,b) shows tissue sections from WT and KO mice immunostained with ant p65/Rel A antibodies (a), hematoxylin and eosin (b) ; Fig.
  • FIG. 1(c) shows serum ALT levels from ibuprofen treated and untreated KO mice, and WT mice;
  • Fig 1 (d,e) shows Immunohistochemical stains for myeloperoxidase (MPO, d) and p65 (e) were performed on sections from naive and ibuprofen treated KO mice ;
  • Fig. 2a - shows Sections stained with H&E of 4 month old mice of the indicated genotypes;
  • Fig 2b(i) shows the number of CD3 positive cells, Fig. 2b(ii) shows the ALT serum levels, Fig. 2b(iii) shows the ploidity in liver cells and Fig.
  • FIG. 2b(iv) shows the level of proliferation in WT, KO and hybrid (Hyb) mice);
  • Fig 2(c ) shows H&E stained sections from livers of 7-month-old WT, KO and hybrid (Hyb) mice ;
  • Fig. 3 (a) shows MR images from the indicated genotypes;
  • Fig 3(b) shows liver tumor volume of KO ,hybrid, and hybrid mice fed with Dox;
  • Fig. 4 (a) shows.
  • Fig 4(b) shows the number of hepatocytes stained with antibodies against activated caspase-3 in 10 high power fields
  • Fig 4(c) shows western blot analysis of WT, KO, Hyb and TNF-treated WT with the indicated antibodies
  • Fig 4(d) shows PCR results from the indicated genotypes
  • Fig 4(e) shows western blot analysis of liver protein extracts from KO animals treated for 3 days with anti-TNF ⁇ antibodies, or IgG
  • Fig 5(a) shows livers of KO mice sacrificed at the indicated time points are shown.
  • Fig 5 (b) shows H&E stained sections from livers of the indicated time points
  • Fig 5 (c) shows CD3 immunostaining in the mixed inflammatory infiltrate
  • Fig 6a shows Luciferase (luc) activity was recorded in vivo using a CCCD camera after luciferin injection in a unique mouce model
  • Fig 6(b) shows p65 iminunostaining of livers from 4 months old KO and Hyb mice
  • mice were injected for 3 consecutive days with 20 ⁇ g of goat anti mouse TNF ⁇ IgG i.p (R&D Systems; AF-410-NA), or with control goat IgG. All mice were injected i.p.
  • mice were euthanised by a lethal dose of anesthesia.
  • a liver sample was removed and snap frozen for protein and RNA analyses.
  • the animal was then perfused through the left ventricle with 10ml of cold heparinized PBS, followed with 25ml of 4%> buffered formalin. Livers were removed, weighed, photographed, and fixed in formalin over night. The next day the entire liver was submitted for paraffin embedding in 3 to 5 cassettes. 5 ⁇ M sections were stained with hematoxylin and eosin and evaluated by a pathologist that was blinded to the genetic make up or treatment group.
  • nuclei were isolated from paraffin blocks after rehydration and treatment with proteinsae K. Nuclei were filtered through a gauze, stained with propidium iodide and the percentage of cells carrying a specific DNA content was analyzed by FACS.
  • liver and tumor boundaries visualized in each slice were outlined by using image processing software (NTH image), by an observer that was blinded to the genetic makeup.
  • NTH image image processing software
  • the number of pixels (for both liver and tumor) were converted to an area by multiplication by the factor [(field of view)2 X(matrix)2].
  • Antibodies used in this study were: BrdU (Clone BRD.3), p65 (RB- 1638), Myeloperoxidase (RB-373), and Ki67 (Clone SP6) from Lab Vision- NeoMarkers; Activated caspase 3 (Cell Signaling); Luciferase (Cortex Biochem); J K (J4500) and phospho-JNK (clone JNK-PT48) from Sigma; I ⁇ B ⁇ (clone c-21) and GADD45 ⁇ (clone N-19) from Santa Cruz Biotechnologies; Al (clone 78616) and cIAP-1 (AF818) from R&D Systems; CD3 (clone CD3-12) from Serotec.
  • cDNA products were amplified by PCR using primers specific for XIAP: 5'CCATGTGTAGTGAAGAAGCCAGAT;3'GATCATCAGCCCCTGTGTAGTAG, Al: 5TGCCAGGGAAGATGGCTGAG; 3TCCGTAGTGTTACTTGAGGAG, and
  • Gadd45 ⁇ 5*CTTCTGGTCGCACGGGAAGG; 3'GCTCCACCGCGGCAGTCACC
  • Example 1 NF- B Activation Is Involved In Hepatocarcinogenesis
  • NF-i B activation is involved in Mdr2-KO hepatocarcinogenesis
  • hepatic NF- ⁇ B activation was assayed using immunostaining for RelA/p65 (Fig. la).
  • Tissue sections from WT and KO mice were immunostained with antibodies against p65/ReLA.
  • Naive and TNF treated WT livers serve as negative and positive controls.
  • NF- ⁇ B activation was evident in all KO liver samples of mice at all ages, but not in normal, aged-matched mice.
  • NF- ⁇ B activation is an intrinsic, tumor autonomous feature of some neoplastic diseases such as some B-cell lymphomas and Hodgkin's disease, possibly due to mutations in the NF- ⁇ B pathway ' .
  • This activation mode is less likely in the KO livers, as nuclear NF- ⁇ B in all neoplastic hepatocytes could not be detected (Fig. la). Rather, it seems that NF- ⁇ B activation is scattered both through the tumors and the adjacent inflamed parenchyma, suggesting it is a signaling-induced phenomenon.
  • the hepatitis is the source of the signals that activate hepatocyte NF- ⁇ B.
  • KO and WT 2.5 month mice were fed with the non-steroidal anti-inflammatory drug (NSAID) ibuprofen for 10 days and the liver sections were stained with hematoxylin and eosin (H&E)
  • H&E hematoxylin and eosin
  • This treatment resulted in decreased inflammation evident by histological analysis (Fig. lb), decreased serum ALT, a marker for hepatocyte damage (Fig. lc) and fewer CD3 and myeloperoxidase positive cells (Fig. Id).
  • NF- ⁇ B activation in the KO hepatocytes is secondary to parenchymal infiltration by inflammatory cells.
  • the frequent activation of NF- ⁇ B in hepatocytes, and the finding that this activation is directly linked to inflammation raised the possibility that inflammation-associated NF- ⁇ B activation may promote neoplastic growth.
  • Example 2 Assessment Of The NF- ⁇ B Role In Hepatocarcinogenesis
  • Mdr2-KO mice were bred with ⁇ N-I- ⁇ B hep mice, previously developed in the lab of the inventors, which carry two transgenes: a non-degradable ⁇ N-I- ⁇ B controlled by a tet-regulated promoter and the tetracycline transactivator under control of the hepatocyte specific C/EBP ⁇ promoter .
  • the tet-regulated promoter also directs the expression of luciferase, consequently, transgene expression levels and its tissue specificity can be determined using a live-mouse recording of luciferase activity .
  • Crossing the bi- transgenic ⁇ N-I- ⁇ B hep mice with Mdr2-KO mice generates Mdr2 ⁇ N-I- ⁇ B hep (hybrid) mice amenable to NF- ⁇ B modulation.
  • Immunohistochemical staining of livers from the same animals with anti-luciferase antibodies demonstrated that only hepatocytes, but not the bile duct epithelium, express the transgene (Fig 6a).
  • p65 immunostaining detected many positive hepatocyte nuclei in KO and Dox- treated mice but no positive hepatocyte nuclei in the untreated hybrid mice ( Fig 6 b,c). Positively-stained biliary and Kupffer cells were detectable in all KO and hybrid mice irrespective of dox treatment (not shown), attesting to the specificity and efficiency of the transgene in blocking NF- ⁇ B activation.
  • Example 3 The Effect Of Transgene Expression On Inflammation Since the origin of liver inflammation in the Mdr2 KO is the biliary system 2 , it should not be affected by the hepatocyte-specific ⁇ N-I ⁇ B hep transgene. Nevertheless, prior to assessing the effect of NF- ⁇ B inhibition on tumorigenesis, the transgene expression's effects on the inflammatory process were rested . Procedure: Histological sections stained with H&E of 4 month old mice of the indicated genotypes were obtained and the results are shown in Fig 2(a) The average number of CD3 positive cells per 1 high power field (HPF) was determined by counting 10 HPFs in each animal.
  • HPF high power field
  • liver cell nuclei were isolated from paraffin blocks, stained with propidium iodide and submitted to FACS analysis. The percent of h perploid nuclei at the indicated age is shown. Proliferative activity was quantified by measuring the number of Ki-67 positive hepatocytes per 20 HPFs. All bar-graphs indicate mean ⁇ SEM (results shown in Figs 2b(i)-2b(iv). H&E stained sections from livers of 7-month-old WT, KO and hybrid (Hyb) mice showing comparable dysplasia evident by architectural disorganization and prominent nuclear pleomorphism in both KOs and Hybs, in contrast to the normal nuclei in WTs.
  • KO hepatocytes are distinguished from WT cells by several abnormal features: high proliferation rate, accelerated hyperploidy and dysplastic features. Whereas the first are also characteristics of liver damage and partial hepatectomy , dysplasia is a preneoplastic condition . Hepatocyte proliferation was evaluated by bromo-deoxy uridine (BrdU) incorporation and Ki-67 antigen staining. Both markers were clearly enhanced in KO and hybrid mice compared to WT mice (Fig. 2b(iv)).
  • Hepatocyte dysplasia has two major features, architectural disorganization and cytological atypia manifested mainly by nuclear pleomorphism, often observed in human HCCs. Histological analysis revealed that anisocytosis was a prominent feature of both KO and hybrid mice; dysplasia was evident at 4 months and increased in severity with age in both animal strains. Remarkably, no difference could be detected in the extent or degree of dysplasia between KO and hybrid mice at any age group (Fig.
  • Liver tumor volume was calculated by analyzing all coronal and axial images of each animal; nodules smaller than 100 mm 3 were often found to represent dysplastic nodules rather than HCC in histological analysis and were therefore not scored as tumors.
  • Hyb+Dox mice fed on Dox between 7-10 months of age. Both KO and Hyb+Dox groups differ significantly (p O.01, Mann- Whitney test) from the Hyb group, but not from each other. (Fig 3b). Results: At 10 months, 60% and 78% of KO and Dox-treated hybrid mice respectively had liver tumors, compared with only 10% of untreated hybrid mice (p ⁇ 0.01 Fig. 3).
  • Example 5 NF- ⁇ B Activation Is Induced Via TNF ⁇ Stimulation What is the mechanism for NF- ⁇ B activation in the inflamed Mdr2 KO liver, and how is NF- ⁇ B contributing to tumor promotion?
  • TNF ⁇ the source of which could be the abundant infiltrating CD3 positive T-cells (Fig. 2b(i)) 20 .
  • KO mice were treated with anti-TNF ⁇ antibodies for 3 days and analyzed for hepatocyte NF- ⁇ B activation and apoptosis.
  • PCR was performed on cDNA samples from several animals of the indicated genotypes that were normalized according to real-time PCR anlaysis for LI 9 mRNA. RT-PCR reactions were set and calibrated to yield products within a linear recording range.
  • NF- ⁇ B has a major anti-apoptotic effect in 91 the mouse liver during development and is necessary to protect mature hepatocytes against immune attack 18 and genotoxic stress 22 .
  • Compromising the anti-apoptotic function of NF- ⁇ B could contribute to the tumor-suppressing effect of the I ⁇ B-SR in the hybrid mice.
  • the apoptosis was assessed using immunostaining for activated caspase-3.
  • KO livers at 7 months in which the majority of hepatocytes are dysplastic (Fig. 2c) showed more apoptosis than WT livers - probably due to the toxic effects of inflammation (Fig. 4b).
  • hepatocyte NF- ⁇ B induced a further 3 fold increase in hepatocyte apoptosis.
  • NF- ⁇ B inhibition exerts its tumor-suppressive effect by promoting apoptosis of transformed hepatocytes.
  • NF- ⁇ B regulates multiple anti-apoptotic genes, some of which could be relevant to hepatocyte transformation.
  • the expression of candidate genes was determined by semi-quantitative RT-PCR and Western blot analyses.
  • TNF ⁇ is distinguished from other mflammatory mediators by its central role in activating NF- ⁇ B and protecting transforming hepatocytes against apoptosis.
  • the above data showing that short-term treatment with either NSAIDs or anti-TNF ⁇ antibodies are sufficient to curtail NF- ⁇ B activation leads the way to preventive therapy in inflammation-associated cancers.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

A method of prevention progression from chronic inflammatory condition to cancer, by administration an NF- B inhibitor, anti TNF agent or an NSAID. The method can also be used to prevent cancer in an individual having a high probability (genetic) of developing the types of cancer usually associated with inflammation.

Description

ANTI-CANCER THERAPY
FIELD OF THE INVENTION The present invention concerns cancer therapy, and in particular preventive anti-cancer therapy.
BACKGROUND OF THE INVENTION NF-κB is an established central mediator of immune and inflammatory responses, yet its involvement in cancer is a matter of continuous debate. On one hand it is constitutively activated in certain tumors, and cell lines derived from such tumors succumb to apoptosis upon F-κB inhibition ' , suggesting that NF- B is pro-tumorigenic. Yet, the following examples argue to the contrary: NF-κB inhibition promotes tumor growth and invasiveness in oncogene-transformed epidermal cells , p53 cytotoxicity in mouse embryonic fibroblasts is NF-κB - dependent8; upon geotaxis stress, NF-κB activation may repress anti-apoptotic genes9. "While the reason for these apparently conflicting in vitro data is not clear, a more realistic evaluation of the role of NF-κB in cancer would likely be derived from an in vivo model.
Most mouse models of human cancer are based on whole genome manipulations, enforced expression of a dominant oncogene, or the ablation of a tumor suppressor gene, which correspond to rare hereditary cancers, but not to the prevailing sporadic human tumors10. The etiologic causes of sporadic human cancer are seldom recognized, but it is estimated that carcinogen exposure and chronic inflammation are two major underlying conditions for tumor development, the latter accounting for approximately 20% of human cancer1. Whereas the causal relationship between carcinogen exposure and cancer has been intensely investigated, the molecular and cellular mechanisms linking chronic inflammation to tumorigenesis remain largely unresolved1. A useful mouse model in which the role of F-κB could be investigated throughout the entire tumorigenesis process would be such in which chronic inflammation prevails with minimal external perturbation, evolving to cancer with sufficiently high incidence to allow the dissection of the underlying mechanism. The cholestasis-based inflammation model of the Mdr2 KO mice meets these criteria: close to 100%) of the mice spontaneously develop HCC following 10-12 month of chronic inflammation, and no intervention is necessary to ensure this outcome . This is in contrast to other hepatitis models, such as the hepatitis BsAg transgenics, where only 2/3rd of the male and none of the female mice develop HCC by 13 months, provided that they are injected with the carcinogen aflatoxin Previous results ' according to which tumor development in the Mdr2 KO mouse, similarly to human HCC14 and some other epithelial cancers15, progresses through distinct phases: inflammation, dysplasia, dysplastic nodules (adenomalike), carcinoma and metastasis ( Fig 5 ) were confirmed . US patent application 20050074454 4concerns use of anti-TNFα antibodies for diagnosis and treatment of established cancer.
SUMMARY OF THE INVENTION
In accordance to the present invention it was realized that NF-κB activity is crucial for the progression from a chronic inflammation condition to tumor and that by inhibiting its activation it is possible to prevent the progression from a chronic inflammatory condition into tumor. While the association between NF-κB inhibition and cancer has been elucidated previously, albeit with conflicting results and conclusions, its specific connection in the prevention of the progression from a chronic inflammatory condition to neoplasm has not been elucidated. The present invention is based on the surprising finding that anti-TNFα treatment of KO mice resulted in apoptosis of pre-neoplastic cells. This surprising finding, paves the way to the use of anti-TNFα agents in the prevention of the progression from chronic inflammation into cancer. The present invention is further based on the finding that administration of non-steroidal anti-inflammatory drugs, in a mouse model of chronic inflammatory condition which evolved into neoplasm, prevented said evolvement from the chronic condition to the neoplastic state. This surprising finding, paves the way to the use of NSAIDs in the prevention of the progression from chronic inflammation into cancer. Thus the present invention concerns a method of preventing progression of a chronic inflammatory condition to cancer comprising administering to an individual, suffering from the chronic inflammatory condition, a therapeutic effective amount of an F-κB inhibitor. The present invention further concerns the use of an NF-κB inhibitor for the preparation of a medicament for the prevention of the progression of a chronic inflammatory condition to cancer. The present invention also concerns the use of an NF-κB inhibitor in individuals of families inflicted with high cancer incidence, where the particular cancer type is thought to be associated with chronic inflammation is prevalent (e.g. colorectal cancer- where aspirin has a preventive value). Thus the inhibitor may be used as a preventive measure also in individuals who do not have a chronic inflammation condition but who have a high probability of having cancer. The prevented cancer should preferably be of the type associated with NF- KB activation such as for example colorectal carcinoma; oesophageal carcinoma; MALT lymphoma; hepatocellular carcinoma; prostate cancer; gastric cancer . The cancer should be of a type which is known to involve NF-κB activation such as breast cancer particularly Estrogen receptor-negative, prostate cancer, multiple myeloma, non Hodgkin's lymphoma, activated B-cell lymphoma, Hodgkin's disease hepatocellular carcinoma. The cancer is of the type which is strongly associated with chromic inflammatory condition, or a specific cancer that is significantly more prevalent in a population suffering from a specific chronic inflammatory disease as compares to the prevalence in the population at large. Examples of cancers associated with chronic inflammations (and the chronic conditions with which they are associated):
Mesothelioma, lung carcinoma (associated with chronic inflammation in the form of asbestosis and silicosis);
Lung carcinoma (associated with chronic inflammation in the form of bronchitis);
Bladder carcinoma (associated with chronic cystitis and bladder inflammation);
Oral squamous cell carcinoma (associated with gingivitis, lichen planus);
Salivary gland carcinoma (associated with sialadenitis)
Colorectal carcinoma (associated with chronic inflammatory condition of inflammatory bowel disease, Crohn's disease, and chronic ulcerative colitis);
Vulvar squamous cell carcinoma (associated with chronic inflammatory conditions of Lichen sclerosus);
Pancreatic carcinoma (associated with a chronic inflammatory disease of chronic pancreatitis and hereditary pancreatitis);
Oesophageal carcinoma (associated with the chronic inflammatory condition of reflux oesophaglitis and Barrett's oesophagus);
MALT lymphoma (associated with the chronic disease of Sjδgren syndrome and
Hashimoto's thyroiditis); and
Melanoma (associated with the chronic inflammation of the skin). Most preferably, the cancer is hepatocellular carcinoma (associated with the inflammatory disease of chronic hepatitis), Prostate cancer (associated with Proliferative Inflammatory Atrophy, PAI), Gastric cancer (associated with H. pylori gastritis) and esόphageal carcinoma on the background of reflux esophagitis and Barrett's disease. Still most preferably the chronic inflammatory condition is hepatitis and the cancer is hepatocellular carcinoma. The term prevention " in the context of the present invention" refers to preventive treatment in a subject having a condition of chronic inflammation and having a high probability of developing cancer, in particular inflammation associated cancer for example one of the list indicated . The high probability may be calculated based on the mere existence of the chronic inflammation but may take in addition into account other factors that increase the probability of progression into cancer such as: duration of the inflammation, severity and activity of the inflammation, damage caused by the inflammation (cirrhosis increases the chances of chronic hepatitis patients developing hepatocellular carcinoma), genetic profile and life style. The "prevention" may be the prevention of cancer altogether, may be the delay in the onset of cancer as compared to an untreated control, may be the progression to a cancer of a lesser severity as compared to control, extended period of a pre-malignant phase and slower progression of a once-appeared cancer, as compared to a control, e.g., delayed appearance of invasive or metastatic cancer. Surrogate endpoints may include delay in the appearance and severity of recognized premalignant lesions such as high grade dysplasia (in the case of gastric and esophageal inflammation) or dysplatic nodules (in the case of chronic hepatitis) In the context of the invention, the method of preventive treatment should involve periodic preventive administration, for relatively short periods of time of an NF-κB inhibitor, to a subject suffering from a chronic inflammatory condition which is know to be strongly associated with subsequent development of cancer, or a person at a premalignant phase that is normally not subject to anti-cancer treatment (e.g., chronic hepatitis C, or Barrett's disease) . Treatment regime is preferably consisting of intermittent administration of an inhibitor, preferentially short periods of administration and relatively long periods of cessation of administration, which may be sufficient to block or delay the development of an associated cancer type It should be noted that the purpose of this short intermittent therapy is to eliminate cancer-prone epithelial cells and not to eradicate the mflammatory process itself. The term "NF-J B inhibitor" refers to any agent, chemical or biological, which is known to reduce NF-κB levels or activity in humans by any mechanism such as by decrease in transcription, translation (antisense sequence, siRNA, , shRNA, , micRNA, ribozyme), by neutralizing NF-κB, by increase in NF-κB degradation, or stabilization of an NF-κB inhibitor (IκB), by inhibition of reaction with any of the upstream component in the NF-κB pathway, such as with IKK,. This term may also include IκB-E3 (ubiquitin ligase) inhibitors. A large list of possible inhibitors and the scientific references reciting them can be found at: http://people.bu.edu/gilmore/nf-kb/inhibitors/ and in "Nuclear factor- kappaB inhibitors as sensitizers to anticancer drugs".Nat Rev Cancer. 2005 Apr;5(4):297-309 10 the contents of which are incorporated here by reference. The term also refers to agents working in the NF-κB signaling pathway such as inhibitors of IKK. A specific example of an inhibitor is Velcade (Borethesomibe) by Millenium Pharmaceuticals. Another class of NF-κB inhibitors, surprisingly found by the present invention to be effective in prevention of progression from chronic inflammation into cancer, are anti TNFα agents, as will be explained below. Thus the present invention concerns a method of preventing progression of a chronic inflammatory condition to cancer comprising administering to an individual ,suffering from the chronic inflammatory condition, a therapeutic effective amount of an anti TNFα agent The present invention also concerns the use of TNFα agents for the preparation of a medicament for of preventing progression of a chronic inflammatory condition to cancer whether via their activity in connection with NF-κB and/or their activity via another mechanism, (such as by suppression of cJun) . The term "anti-TNFa agent" refers to any chemical or biological agent that can reduce the amount of physiologically-active TNFα, or reduce the signaling effect of TNFα (e.g. interaction of TNFα with its receptor or the intensity of receptor signaling). The agent may be a nucleotide based agent (antisense sequence, siRNA, , shRNA, micRNA and ribozyme) working by decreasing transcription, translation of TNF-α or by increasing the RNA degradation; an agent capable of neutralizing the circulating TNF-α (antibodies, soluble receptors), agents capable of inhibiting enzymes involved in TNF-α synthesis or the processing of TNFα to its mature, active species. Inhibition of synthesis may be indirect, for example, through the p38 MAP kinase which has a pivotal role in the regulation of TNF-α synthesis, through the TACE inhibition which controls the cleavage of membrane bound TNF-α; through inhibition of photodiesterase type 4 enzyme (PDE4) - which indirectly decreases TNF-α production by increasing the level of intracellular cyclic adenosine monophosphase (cAMP). Examples of anti-TNF agents already approved for clinical use are Etanercept (Enbrel; Amgen/Wyeth), Infliximab (Remicade; Centor/Schering- Plough/Tanabe Sieyaku); Adalimumab (Humira; Abbott). The following are examples of some anti-TNFα agents divided into the functional groups:
Protein-based injectable anti-TNF-α agents
Figure imgf000009_0001
TNF-α synthesis inhibitors
Figure imgf000009_0002
By another option the NF-κB inhibitors (in a rather non-specific manner) are non-steroidal inflammatory drugs (NSAIDs) such as Ibuprofen and additional drugs as will be further specified bellow. By a third aspect, the present invention concerns a method for preventing progression of a chronic inflammatory condition to cancer comprising administering to an individual suffering from the chronic inflammatory condition, cancer, a therapeutic effective amount of at least one non steroidal anti- inflammatory drug The term "non-steroidal anti-inflammatory drugs (NSAIDs) " refers to any natural or synthetic agent that is known to decrease at least one parameter of inflammation, and which is not a steroid .This term also refers to a combination of two or more of such agents. Action of these drugs may be partially attributed to reducing the number of TNFα producing cells but may be also attributed to additional mechanisms.
Example of some common NSAID are:
Traditional NSATDs:
Aspirin, diclofenac (Voltaren, Cataflam); diflunisal (Dolobid);etodolac (Lodine); flurbiprofen (Ansaid); ibuprofen (Motrin, Advil); indomethacin (Indocin); ketoprofen (Orudis, Oruvail);ketorolac (Toradol); nabumetone
(Relafen);naproxen (Naprosyn, Alleve);oxaprozin (Daypro);piroxicam
(Feldene);sulindac (Clinoril) ;tolmetin (Tolectin)
Cox-2 selective NSAIDs: celecoxib (Celebrex);rofecoxib (Vioxx).
DESCRIPTION OF THE DRAWINGS In order to understand the invention and to see how it may be carried out in practice, some preferred embodiments will now be described, by way of non- limiting examples only, with reference to the accompanying drawings, in which: Fig. l(a,b) - shows tissue sections from WT and KO mice immunostained with ant p65/Rel A antibodies (a), hematoxylin and eosin (b) ; Fig. 1(c) shows serum ALT levels from ibuprofen treated and untreated KO mice, and WT mice; Fig 1 (d,e) shows Immunohistochemical stains for myeloperoxidase (MPO, d) and p65 (e) were performed on sections from naive and ibuprofen treated KO mice ; Fig. 2a -shows Sections stained with H&E of 4 month old mice of the indicated genotypes; Fig 2b(i) shows the number of CD3 positive cells, Fig. 2b(ii) shows the ALT serum levels, Fig. 2b(iii) shows the ploidity in liver cells and Fig. 2b(iv) shows the level of proliferation in WT, KO and hybrid (Hyb) mice); Fig 2(c ) shows H&E stained sections from livers of 7-month-old WT, KO and hybrid (Hyb) mice ; Fig. 3 (a) shows MR images from the indicated genotypes; Fig 3(b) shows liver tumor volume of KO ,hybrid, and hybrid mice fed with Dox; Fig. 4 (a) shows. anti-p65 immunostaining of KO livers from 4 month old mice treated with anti-TNFα or control IgG ; Fig 4(b) shows the number of hepatocytes stained with antibodies against activated caspase-3 in 10 high power fields; Fig 4(c) shows western blot analysis of WT, KO, Hyb and TNF-treated WT with the indicated antibodies; Fig 4(d) shows PCR results from the indicated genotypes; Fig 4(e) shows western blot analysis of liver protein extracts from KO animals treated for 3 days with anti-TNFα antibodies, or IgG ; Fig 5(a) shows livers of KO mice sacrificed at the indicated time points are shown. Tumors are indicated by arrowheads; Fig 5 (b) shows H&E stained sections from livers of the indicated time points; Fig 5 (c) shows CD3 immunostaining in the mixed inflammatory infiltrate; Fig 6a shows Luciferase (luc) activity was recorded in vivo using a CCCD camera after luciferin injection in a unique mouce model; Fig 6(b) shows p65 iminunostaining of livers from 4 months old KO and Hyb mice; and Fig 6c shows NF-κB activation was measured by counting the number of positive hepatocyte nuclei in the livers (mean±SEM). Scale Bars = 50μm. DETAILED DESCRIPTION OF THE INVENTION
EXPERIMENTAL PROCEDURES
Animal Studies and Tissue Preparation All animal experiments were performed in accordance with the guidelines of the institutional committee for the use of animals for research. The construction of the ΔN-IκBhep mice, in vivo luciferase imaging and doxycycline treatment were previously described (Lavon I et al, High susceptibility to bacterial infection, but no liver dysfunction, in mice compromised for hepatocyte NF-kappaB activation. Nat Med. 2000 May;6(5):573-7) For anti-TNFα treatment, mice were injected for 3 consecutive days with 20 μg of goat anti mouse TNFα IgG i.p (R&D Systems; AF-410-NA), or with control goat IgG. All mice were injected i.p. with BrdU (Amersham; lOOμl/lOgr body weight) 3 and 24 h before sacrifice. For all experiments mice were euthanised by a lethal dose of anesthesia. In some animals, a liver sample was removed and snap frozen for protein and RNA analyses. The animal was then perfused through the left ventricle with 10ml of cold heparinized PBS, followed with 25ml of 4%> buffered formalin. Livers were removed, weighed, photographed, and fixed in formalin over night. The next day the entire liver was submitted for paraffin embedding in 3 to 5 cassettes. 5μM sections were stained with hematoxylin and eosin and evaluated by a pathologist that was blinded to the genetic make up or treatment group. For ploidy analysis nuclei were isolated from paraffin blocks after rehydration and treatment with proteinsae K. Nuclei were filtered through a gauze, stained with propidium iodide and the percentage of cells carrying a specific DNA content was analyzed by FACS.
MRI analysis MR imaging was performed on a horizontal 4.7T Biospec spectrometer (Bruker Medical), using a birdcage coil. Mice were anesthetized (30 mg/kg pentobarbital, i.p.) and placed supine with the liver located at the center of the coil. Liver and tumor volumes were determined from multi-slice coronal and axial Tl weighted fast spin echo images covering the entire liver both coronally and axially (repetition time=400ms, echo time=17ms, slice thickness=l mm, and field of view of 5cm (coronal) and 3.4 cm (axial) using a 256X 256 matrix). In brief, the liver and tumor boundaries visualized in each slice were outlined by using image processing software (NTH image), by an observer that was blinded to the genetic makeup. The number of pixels (for both liver and tumor) were converted to an area by multiplication by the factor [(field of view)2 X(matrix)2].
Antibodies Antibodies used in this study were: BrdU (Clone BRD.3), p65 (RB- 1638), Myeloperoxidase (RB-373), and Ki67 (Clone SP6) from Lab Vision- NeoMarkers; Activated caspase 3 (Cell Signaling); Luciferase (Cortex Biochem); J K (J4500) and phospho-JNK (clone JNK-PT48) from Sigma; IκBα (clone c-21) and GADD45β (clone N-19) from Santa Cruz Biotechnologies; Al (clone 78616) and cIAP-1 (AF818) from R&D Systems; CD3 (clone CD3-12) from Serotec.
Western blot analysis Liver samples were homogenized in cell culture lysis reagent (Promega), with a Polytron homogenizer. Tissue lysates containing 100 μg protein were separated by 12% SDS-PAGE, and assessed by western blot analysis, using sequential probing with the relevant primary antibody and a relevant anti-IgG conjugated to HRP (Jackson).
Immunohistochemistry For p65 immunostains 5μM sections, that were cut on the same day, were dewaxed and hydrated through graded ethanols, cooked in 25mM citrate buffer pH 6.0 in a pressure cooker at 115°C for 3 minutes (decloaking chamber, Biocare Medical) transfered into boiling deinoized water and let to cool down for 20 minutes. After 5 minutes treatment in 3% H2O2, slides were incubated with rabbit polyclonal p65 antibodies diluted 1:100 in CAS-Block (Zymed) for 1 hour at room temperature, washed 3 times with Optimax (biogenex HK583), incubated for 30 minutes with anti rabbit Envision-1" (DAKO K4007) and developed with DAB for 15 mins. Antigen retrieval for CD3, BrdU, activated Caspase 3, Luciferase, MPO and Ki-67 were performed in 25mM citrate buffer pH 6.0. Specific protocols for each antibody are available on request.
Semi-quantitative RT-PCR Following liver homogenization with a Polytron homogenizer, total RNA was extracted in TRI Reagent (Sigma). cDNA was generated from 5 μg of total RNA using Superscript II reverse transcriptase (Invitrogen). Samples were normalized according to L19 mRNA levels by SYBR green real-time PCR 5'CCAAGAAGATTGACCGCCATA; 3'CAGCΠGTGGATGTGCTCCAT. cDNA products were amplified by PCR using primers specific for XIAP: 5'CCATGTGTAGTGAAGAAGCCAGAT;3'GATCATCAGCCCCTGTGTAGTAG, Al: 5TGCCAGGGAAGATGGCTGAG; 3TCCGTAGTGTTACTTGAGGAG, and
Gadd45β: 5*CTTCTGGTCGCACGGGAAGG; 3'GCTCCACCGCGGCAGTCACC
Example 1: NF- B Activation Is Involved In Hepatocarcinogenesis To test the possibility that NF-i B activation is involved in Mdr2-KO hepatocarcinogenesis hepatic NF-κB activation was assayed using immunostaining for RelA/p65 (Fig. la). Tissue sections from WT and KO mice were immunostained with antibodies against p65/ReLA. Naive and TNF treated WT livers serve as negative and positive controls. NF-κB activation was evident in all KO liver samples of mice at all ages, but not in normal, aged-matched mice. NF-κB activation is an intrinsic, tumor autonomous feature of some neoplastic diseases such as some B-cell lymphomas and Hodgkin's disease, possibly due to mutations in the NF-κB pathway ' . This activation mode is less likely in the KO livers, as nuclear NF-κB in all neoplastic hepatocytes could not be detected (Fig. la). Rather, it seems that NF-κB activation is scattered both through the tumors and the adjacent inflamed parenchyma, suggesting it is a signaling-induced phenomenon. One likely possibility is that the hepatitis is the source of the signals that activate hepatocyte NF-κB. To evaluate this possibility, KO and WT 2.5 month mice were fed with the non-steroidal anti-inflammatory drug (NSAID) ibuprofen for 10 days and the liver sections were stained with hematoxylin and eosin (H&E) This treatment resulted in decreased inflammation evident by histological analysis (Fig. lb), decreased serum ALT, a marker for hepatocyte damage (Fig. lc) and fewer CD3 and myeloperoxidase positive cells (Fig. Id). p65 immunostaining showed that the degree of hepatocyte NF.-κB activation in the NSAID-treated group was significantly lower than in the untreated KO mice (Fig. le). (All Scale Bars = 50μm. KO = Mdr2 knockout, WT = wild type.) Hence, it appears that NF-κB activation in the KO hepatocytes is secondary to parenchymal infiltration by inflammatory cells. The frequent activation of NF-κB in hepatocytes, and the finding that this activation is directly linked to inflammation raised the possibility that inflammation-associated NF-κB activation may promote neoplastic growth.
Example 2: Assessment Of The NF-κB Role In Hepatocarcinogenesis To directly assess the role of NF-κB in hepatocarcinogenesis, Mdr2-KO mice were bred with ΔN-I-κBhep mice, previously developed in the lab of the inventors, which carry two transgenes: a non-degradable ΔN-I-κB controlled by a tet-regulated promoter and the tetracycline transactivator under control of the hepatocyte specific C/EBPβpromoter . The tet-regulated promoter also directs the expression of luciferase, consequently, transgene expression levels and its tissue specificity can be determined using a live-mouse recording of luciferase activity . Crossing the bi- transgenic ΔN-I-κBhep mice with Mdr2-KO mice generates Mdr2ΔN-I-κBhep (hybrid) mice amenable to NF-κB modulation. Immunohistochemical staining of livers from the same animals with anti-luciferase antibodies demonstrated that only hepatocytes, but not the bile duct epithelium, express the transgene (Fig 6a). p65 immunostaining detected many positive hepatocyte nuclei in KO and Dox- treated mice but no positive hepatocyte nuclei in the untreated hybrid mice ( Fig 6 b,c). Positively-stained biliary and Kupffer cells were detectable in all KO and hybrid mice irrespective of dox treatment (not shown), attesting to the specificity and efficiency of the transgene in blocking NF-κB activation.
Example 3: The Effect Of Transgene Expression On Inflammation Since the origin of liver inflammation in the Mdr2 KO is the biliary system2 , it should not be affected by the hepatocyte-specific ΔN-IκBhep transgene. Nevertheless, prior to assessing the effect of NF-κB inhibition on tumorigenesis, the transgene expression's effects on the inflammatory process were rested . Procedure: Histological sections stained with H&E of 4 month old mice of the indicated genotypes were obtained and the results are shown in Fig 2(a) The average number of CD3 positive cells per 1 high power field (HPF) was determined by counting 10 HPFs in each animal. For ploidy analysis liver cell nuclei were isolated from paraffin blocks, stained with propidium iodide and submitted to FACS analysis. The percent of h perploid nuclei at the indicated age is shown. Proliferative activity was quantified by measuring the number of Ki-67 positive hepatocytes per 20 HPFs. All bar-graphs indicate mean±SEM (results shown in Figs 2b(i)-2b(iv). H&E stained sections from livers of 7-month-old WT, KO and hybrid (Hyb) mice showing comparable dysplasia evident by architectural disorganization and prominent nuclear pleomorphism in both KOs and Hybs, in contrast to the normal nuclei in WTs. All Scale Bars =T00μm. m.o.= months old.(results shown in Fig 2c). Results: Both the KO and the hybrid mice showed elevated ALT levels, significantly higher than those of age matched WT mice (Fig. 2b(ii)). Histological analysis of livers from both groups at all ages revealed comparable non- suppurative inflammatory cholangitis with portal expansion due to ductular proliferation, a mixed portal inflammatory infiltrate and mild to moderate fibrosis (Fig. 2a). Both strains had high numbers of CD3 and MPO positive cells in the portal tracts and the liver parenchyma. Thus, it appears that the fundamental inflammatory process in Mdr2-KO mouse is maintained in the hybrid mouse and is independent of hepatocytes NF-κB activity. KO hepatocytes are distinguished from WT cells by several abnormal features: high proliferation rate, accelerated hyperploidy and dysplastic features. Whereas the first are also characteristics of liver damage and partial hepatectomy , dysplasia is a preneoplastic condition . Hepatocyte proliferation was evaluated by bromo-deoxy uridine (BrdU) incorporation and Ki-67 antigen staining. Both markers were clearly enhanced in KO and hybrid mice compared to WT mice (Fig. 2b(iv)). However, there was no significant difference in either hepatocyte BrdU incorporation or Ki-67 staining between the KO and the hybrid mice at any age. Thus, it appears that NF-κB is not necessary for the increased hepatocyte proliferation in the Mdr2-KO disease. Hepatocyte dysplasia has two major features, architectural disorganization and cytological atypia manifested mainly by nuclear pleomorphism, often observed in human HCCs. Histological analysis revealed that anisocytosis was a prominent feature of both KO and hybrid mice; dysplasia was evident at 4 months and increased in severity with age in both animal strains. Remarkably, no difference could be detected in the extent or degree of dysplasia between KO and hybrid mice at any age group (Fig. 2c). In an attempt to quantitate the preneoplastic changes hepatocyte ploidy was analyzed in both strains in comparison to age matched WT mice. Isolated nuclei from livers were stained with propidium-iodide and subjected to FACS analysis. Both groups had a high degree of hyperploidy, and we noted no significant difference between the cell-cycle profiles of the KO and hybrid mice at 4 or 7 months (Fig. 2b(iii)).
Example 4: NF-κB is Critical for Tumor Promotion. Whereas liver analysis of young hybrid mice did not reveal a significant effect of NF-κB inhibition on early neoplastic events, MRI and histological analysis of older mice clearly discerned the KO and Dox-treated from Dox-free hybrid mice. Procedure: NMR images from the several genotypes indicated in Fig 3. were taken at 10 months of age; each image shown is from a different animal. The colored arrowheads indicate the tumors - different colors indicate individual tumors. Scale bar = 1cm. (Fig 3a). Liver tumor volume was calculated by analyzing all coronal and axial images of each animal; nodules smaller than 100 mm3 were often found to represent dysplastic nodules rather than HCC in histological analysis and were therefore not scored as tumors. Hyb+Dox = mice fed on Dox between 7-10 months of age. Both KO and Hyb+Dox groups differ significantly (p O.01, Mann- Whitney test) from the Hyb group, but not from each other. (Fig 3b). Results: At 10 months, 60% and 78% of KO and Dox-treated hybrid mice respectively had liver tumors, compared with only 10% of untreated hybrid mice (p < 0.01 Fig. 3). A similar tumor suppression effect in the NF-κB-deficient animals was noted in comparing the two mouse groups for the mean number of tumors per animal. Histological analysis of several mice fully confirmed MRI data: all the MRI-detectable tumors were histologically-identified and no other tumors larger than 1mm were found (data not shown). At which stage of tumor development is NF-κB inhibition effective in suppressing tumorigenesis? Since by 7 months, no difference was noticed between KO and hybrid mice in early tumor development and no tumors were detected by MRI at either group, the transgene was switched off at 7 month and monitored tumor development by MRI for 3 months. Surprisingly, 7 of 9 mice fed on Dox developed MRI-detectable tumors within 3 months, which were indistinguishable from those of KO mice at comparable age by histological analysis (Fig. 3b). Thus, the analysis shows that blocking hepatocyte NF-κB has a remarkable tumor suppression effect in the Mdr2-KO model, yet the effect is restricted to tumor progression beyond development of dysplastic nodules. Hence, it appears that whereas NF-κB is dispensable for the early transformation phase, (i.e., tumor initiation) it is essential for tumor promotion.
Example 5: NF-κB Activation Is Induced Via TNFα Stimulation What is the mechanism for NF-κB activation in the inflamed Mdr2 KO liver, and how is NF-κB contributing to tumor promotion? One likely mediator of NF-κB activation in the liver is TNFα, the source of which could be the abundant infiltrating CD3 positive T-cells (Fig. 2b(i))20. To study this possibility, KO mice were treated with anti-TNFα antibodies for 3 days and analyzed for hepatocyte NF-κB activation and apoptosis. Procedure: Anti-p65 immunostaining of KO livers from 4 month old mice treated with anti-TNFα or control IgG (Fig 4a) Caspase activity was quantitated by counting the number of hepatocytes stained with antibodies against activated caspase-3 in 10 high power fields (mean+SEM). (Fig 4b). Protein extracts from WT, KO, Hyb and TNF-treated WT animals were subjected to western blot analysis with the indicated antibodies. Liver extracts from 3 different KO and Hyb animals are shown. JNKl, 2: Jun N-terminal Kinase, isoforms 1 and 2. pJNK: phospho-JNK(fιg 4c). PCR was performed on cDNA samples from several animals of the indicated genotypes that were normalized according to real-time PCR anlaysis for LI 9 mRNA. RT-PCR reactions were set and calibrated to yield products within a linear recording range. (Fig 4d). Liver protein extracts from KO animals treated for 3 days with anti-TNFα antibodies, or IgG were subjected to Western blot analysis with the indicated antibodies. All Scale Bars =50μm.(Fig 4e). Results: Remarkably, anti-TNFα treatment abolished hepatocyte p65 nuclear staining (Fig. 4a), indicating that NF-κB activation in the inflamed liver tissue is primarily induced by TNFα. NF-κB has a major anti-apoptotic effect in 91 the mouse liver during development and is necessary to protect mature hepatocytes against immune attack18 and genotoxic stress22 . Compromising the anti-apoptotic function of NF-κB could contribute to the tumor-suppressing effect of the IκB-SR in the hybrid mice. To study this possibility, the apoptosis was assessed using immunostaining for activated caspase-3. KO livers at 7 months in which the majority of hepatocytes are dysplastic (Fig. 2c) showed more apoptosis than WT livers - probably due to the toxic effects of inflammation (Fig. 4b). However, blocking hepatocyte NF-κB induced a further 3 fold increase in hepatocyte apoptosis. Remarkably, a similar effect was achieved by anti-TNFα treatment. Taken together, out results suggest that NF-κB inhibition exerts its tumor-suppressive effect by promoting apoptosis of transformed hepatocytes. NF-κB regulates multiple anti-apoptotic genes, some of which could be relevant to hepatocyte transformation. To identify the relevant target genes, the expression of candidate genes was determined by semi-quantitative RT-PCR and Western blot analyses. Whereas some examined targets were similarly expressed in NF-κB -proficient and deficient livers, Al/Bfll, cIAP-1 and GADD45β were significantly enhanced in the KO livers (Fig. 4c,d). Noteworthy, Al is the 9 prominent NF-κB target associated with cholestatic liver injury . Anti-TNFα treatment prevented the induction of GADD45β and Al in KO mice (Fig. 4e). The above data suggests that NF-κB activation in the epithelium is a common molecular link between inflammation and cancer. Whereas inflammation releases many growth factors and cytokines1(delete ref) , the data indicate that TNFα is distinguished from other mflammatory mediators by its central role in activating NF-κB and protecting transforming hepatocytes against apoptosis. The above data showing that short-term treatment with either NSAIDs or anti-TNFα antibodies are sufficient to curtail NF-κB activation leads the way to preventive therapy in inflammation-associated cancers.
REFERENCES
1. Coussens, L. M. & Werb, Z. Inflammation and cancer. Nature 420, 860-7 (2002).
2. Mauad, T. H. et al. Mice with homozygous disruption of the mdr2 P- glycoprotein gene. A novel animal model for studies of nonsuppurative inflammatory cholangitis and hepatocarcinogenesis. Am J Pathol 145, 1237-45 (1994).
3. Nakamoto, Y., Guidotti, L. G., Kuhlen, C. V., Fowler, P. & Chisari, F. V. Immune pathogenesis of hepatocellular carcinoma. J Exp Med 188, 341-50 (1998).
4. US patent application 20050074454
5. Mayo, M. W. & Baldwin, A. S. The transcription factor NF-kappaB: control of oncogenesis and cancer therapy resistance. Biochim Biophys Ada 1470, M55-62 (2000).
6. Lin, A. & Karin, M. NF-kappaB in cancer: a marked target. Semin Cancer Biol 13, 107-14 (2003).
7. Dajee, M. et al. NF-kappaB blockade and oncogenic Ras trigger invasive human epidermal neoplasia. Nature 421, 639-43 (2003).
8. Ryan, K. M., Ernst, M. K., Rice, N. R. & Vousden, K. H. Role of NF- kappaB in p53-mediated programmed cell death. Nature 404, 892-7 (2000).
9. Campbell, K. J., Rocha, S. & Perkins, N. D. Active repression of antiapoptotic gene expression by RelA(p65) NF-kappa B. Mol Cell 13, 853-65 (2004).
10. (-)
11. Nuclear factor-kappaB inhibitors as sensitizers to anticancer drugs".Nat Rev Cancer. 2005 Apr;5(4):297-309
12. (-)
13. De Vree, J. M. et al. Correction of liver disease by hepatocyte transplantation in a mouse model of progressive familial intrahepatic cholestasis. Gastroenterology 119, 1720-30 (2000). 14. (-)
15. Fearon, E. R. & Vogelstein, B. A genetic model for colorectal tumorigenesis. Cell 61, 759-67 (1990).
16. Staudt, L. M. Molecular diagnosis of the hematologic cancers. N Engl J Me d 348, 1777-85 (2003).
17. Hinz, M. et al. Nuclear factor kappaB-dependent gene expression profiling of Hodgkin's disease tumor cells, pathogenetic significance, and link to constitutive signal transducer and activator of transcription 5a activity. JExp Med 196, 605-17 (2002).
18. Lavon, I. et al. High susceptibility to bacterial infection, but no liver dysfunction, in mice compromised for hepatocyte NF-kappaB activation. Nat Med 6, 573-7 (2000).
19. (-)
21. Beg, A. A., Sha, W. C, Bronson, R. T., Ghosh, S. & Baltimore, D. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature 376, 167-70 (1995).
22. Lavon, I. et al. Nuclear factor-kappaB protects the liver against genotoxic stress and functions independently of p53. Cancer Res 63, 25- 30 (2003).
23. (-)
24. Friedberg, E. C, McDaniel, L. D. & Schultz, R. A. The role of endogenous and exogenous DNA damage and mutagenesis. Curr Opin Genet Dev 14, 5-10 (2004).
25. Wang, J. S. & Groopman, J. D. DNA damage by mycotoxins. Mutat Res 424, 167 -81 (1999).
26. Tang, G. et al. Inhibition of JNK activation through NF-kappaB target genes. Nature 414, 313-7 (2001).
27. Papa, S. et al. Gadd45 beta mediates the NF-kappa B suppression of JNK signalling by targeting MKK7/JNKK2. Nat Cell Biol 6, 146-53 (2004). 8. Radisky, D., Hagios, C. & Bissell, M. J. Tumors are unique organs defined by abnormal signaling and context. Semin Cancer Biol 11, 87- 95 (2001).
29. Hedley, D. W., Friedlander, M. L, Taylor, I. W., Rugg, C. A. & Musgrove, E. A. Method for analysis of cellular DNA content of paraffin-embedded pathological material using flow cytometry. J Histochem Cytochem 31, 1333-5 (1983).
30. US patent application 20050074454

Claims

Claims:
1. Use of an NF-κB inhibitor for the preparation of a medicament for the prevention of the progression of a chronic inflammatory condition to cancer.
2. Use according to claim 1 wherein the NF-κB inhibitor is an anti-TNF α agent.
3. Use of anti-TNFα agent for the preparation of a medicament for the prevention of the progression of a chronic inflammatory condition to cancer.
4. Use according to claim 2 or 3, wherein the anti-TNF α agent is selected from: anti-TNF alpha antibody, soluble TNF alpha receptor and an inhibitor of TNF a synthesis or processing.
5. Use according to claim 2 or 3 wherein the anti TNFα agent is selected from: soluble TNFR2 coupled to Fc portion of IgG, mouse-human chimeric anti-human TNF-α antibody, human anti-human TNF-α antibody ,pegylated form of soluble TNFR1, pegylated Fab of humanized antibody CDP-571, p38 kinase TACE, Thalomid and rationally designed rationally designed L-amino acid peptide.
6. Use according to claim 5 wherein the anti TNFα is selected from Etanercept, Infliximb, Adalimumab , PEG-sTNFRl and CDP-870
7. Use according to claim 1 wherein the NF-κB inhibitor is a Non steroidal anti inflammatory drug (NSAID).
8. Use of NSAID for the preparation of a medicament for the prevention of the progression of a chronic inflammatory condition to cancer.
9. Use according to claim 7 or 8 wherein the NSAID is selected from traditional NSAIDs and selective Cox 2 NSAIDs.
10. Use according to claim 9 wherein the traditional NSAID is selected from ;ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam, sulindac and tolmetin .
11. Use according to claim 9 wherein the selective Cox2 NSAID is selected from celecoxib and rofecoxib .
12. se according to any one of the preceding claims wherein the chronic inflammatory condition is selected from: asbestosis ,silicosis; bronchitis, chronic cystitis, bladder mflammation, gingivitis, lichen planus, sialadenitis, Crohn's disease, chronic ulcerative colitis, Lichen sclerosus; chronic pancreatitis, hereditary pancreatitis, reflux oesophaghtis, Barrett's oesophagus; Sjδgren syndrome ,Hashimoto's thyroiditis, chronic inflammation of the skin, chronic hepatitis, Proliferative Inflammatory Atrophy, PAL and H. pylori gastritis.
13. Use according to claim 12 wherein the chronic inflammatory condition is chronic hepatitis.
14. Use according to any the preceding claims wherein the cancer is selected from: Mesothelioma, lung carcinoma, Lung carcinoma, Bladder carcinoma ,Oral squamous cell carcinoma ,Salivary gland carcinoma ,Colorectal carcinoma ,Vulvar squamous cell carcinoma; Pancreatic carcinoma, Oesophageal carcinoma, MALT lymphoma ,Melanoma, colorectal carcinoma, hepatocellular carcinoma, Prostate cancer Gastric cancer breast cancer, Multiple myeloma, Hodgkin's lymphoma, activated B-cell ly,phoma and Hodgkin's disease
15. Use according to claim 14 wherein the cancer is hepatocellular carcinoma.
16. Use according to claims 1-3 or 7 -9, where the patient has a premalignant disease that is likely to progress to cancer via inflammatory-associated mechanism
17. Use according to any one of the preceding claims wherein the medicament is for periodical administration with periods of administration and periods of cease of administration.
PCT/IL2005/000638 2004-06-17 2005-06-16 Anti-cancer therapy Ceased WO2005123772A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US58010604P 2004-06-17 2004-06-17
US60/580,106 2004-06-17

Publications (2)

Publication Number Publication Date
WO2005123772A2 true WO2005123772A2 (en) 2005-12-29
WO2005123772A3 WO2005123772A3 (en) 2006-02-02

Family

ID=35355758

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2005/000638 Ceased WO2005123772A2 (en) 2004-06-17 2005-06-16 Anti-cancer therapy

Country Status (1)

Country Link
WO (1) WO2005123772A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2054061A4 (en) * 2006-08-02 2009-09-02 Ariad Pharma Inc Combination therapy
EP2350641A4 (en) * 2008-09-22 2012-10-31 Amgen Inc PROCESSING METHOD
US9028822B2 (en) 2002-06-28 2015-05-12 Domantis Limited Antagonists against TNFR1 and methods of use therefor

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BEACHY PHILIP A ET AL: "Mending and malignancy." NATURE. 23 SEP 2004, vol. 431, no. 7007, 23 September 2004 (2004-09-23), page 402, XP002356261 ISSN: 1476-4687 *
COUSSENS LISA M ET AL: "Inflammation and cancer." NATURE (LONDON), vol. 420, no. 6917, 2002, pages 860-867, XP002356258 ISSN: 0028-0836 cited in the application *
LAVON I ET AL: "HIGH SUSCEPTIBILITY TO BACTERIAL INFECTION, BUT NO LIVER DYSFUNCTION, IN MICE COMPROMISED FOR HEPATOCYTE NF-KAPPAB ACTIVATION" NATURE MEDICINE, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 6, no. 5, May 2000 (2000-05), pages 573-577, XP000962406 ISSN: 1078-8956 cited in the application *
LIN ANNING ET AL: "NF-kappaB in cancer: A marked target." SEMINARS IN CANCER BIOLOGY, vol. 13, no. 2, April 2003 (2003-04), pages 107-114, XP002356257 ISSN: 1044-579X *
MAYO M W ET AL: "The transcription factor NF-kappaB: control of oncogenesis and cancer therapy resistance" BBA - REVIEWS ON CANCER, ELSEVIER SCIENCE BV, AMSTERDAM, NL, vol. 1470, no. 2, 27 March 2000 (2000-03-27), pages M55-M62, XP004281881 ISSN: 0304-419X cited in the application *
NICKOLOFF BRIAN J ET AL: "Inflammation and cancer: Is the link as simple as we think?" JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 124, no. 6, June 2005 (2005-06), pages X-xiv, XP002356260 ISSN: 0022-202X *
PERKINS N D: "The Rel/NF-kappaB family: friend and foe" TRENDS IN BIOCHEMICAL SCIENCES, ELSEVIER, HAYWARDS, GB, vol. 25, no. 9, 1 September 2000 (2000-09-01), pages 434-440, XP004210315 ISSN: 0968-0004 *
PIKARSKY ELI ET AL: "NF-kappaB functions as a tumour promoter in inflammation-associated cancer" NATURE (LONDON), vol. 431, no. 7007, 23 September 2004 (2004-09-23), pages 461-466, XP002356259 ISSN: 0028-0836 *
TOMITA T ET AL: "TRANSCRIPTION FACTOR DECOY FOR NFKB INHIBITS CYTOKINE AND ADHESION MOLECULE EXPRESSIONS IN SYNOVIAL CELLS DERIVED FROM RHEUMATOID ARTHRITIS" RHEUMATOLOGY, OXFORD UNIVERSITY PRESS, LONDON, GB, vol. 39, 2000, pages 749-757, XP002951052 ISSN: 1462-0324 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9028822B2 (en) 2002-06-28 2015-05-12 Domantis Limited Antagonists against TNFR1 and methods of use therefor
EP2054061A4 (en) * 2006-08-02 2009-09-02 Ariad Pharma Inc Combination therapy
EP2350641A4 (en) * 2008-09-22 2012-10-31 Amgen Inc PROCESSING METHOD

Also Published As

Publication number Publication date
WO2005123772A3 (en) 2006-02-02

Similar Documents

Publication Publication Date Title
Mohammed et al. Atorvastatin delays progression of pancreatic lesions to carcinoma by regulating PI3/AKT signaling in p48Cre/+ LSL‐KrasG12D/+ mice
Olson et al. Inhibition of prostate carcinoma establishment and metastatic growth in mice by an antiangiogenin monoclonal antibody
Chen et al. CD95 promotes tumour growth
Sakurai et al. Loss of hepatic NF-κB activity enhances chemical hepatocarcinogenesis through sustained c-Jun N-terminal kinase 1 activation
Kuprash et al. Novel tumor necrosis factor‐knockout mice that lack Peyer's patches
Torbenson et al. STAT-3 overexpression and p21 up-regulation accompany impaired regeneration of fatty livers
Boege et al. Chronic liver inflammation and hepatocellular carcinoma: persistence matters
Shi et al. Targeting androgen receptor (AR)→ IL12A signal enhances efficacy of sorafenib plus NK cells immunotherapy to better suppress HCC progression
Bandoh et al. Prognostic value of p53 mutations, bax, and spontaneous apoptosis in maxillary sinus squamous cell carcinoma
Yeoh et al. A novel animal model to investigate fractionated radiotherapy-induced alimentary mucositis: the role of apoptosis, p53, nuclear factor-κB, COX-1, and COX-2
Urbanik et al. Liver specific deletion of CYLDexon7/8 induces severe biliary damage, fibrosis and increases hepatocarcinogenesis in mice
Alvarez et al. Expression of epidermal growth factor receptor in squamous cell carcinomas of the anal canal is independent of gene amplification
JP6502863B2 (en) Method of treating colorectal cancer
Smits et al. E-cadherin and adenomatous polyposis coli mutations are synergistic in intestinal tumor initiation in mice
Giovannoni et al. Alpha‐1‐antitrypsin deficiency: from genoma to liver disease. PiZ mouse as model for the development of liver pathology in human
JP7672526B2 (en) Treatment of Nonalcoholic Steatohepatitis (NASH)
Ghebranious et al. The mouse equivalent of the human p53ser249 mutation p53ser246 enhances aflatoxin hepatocarcinogenesis in hepatitis B surface antigen transgenic and p53 heterozygous null mice
Chen et al. AXL targeting by a specific small molecule or monoclonal antibody inhibits renal cell carcinoma progression in an orthotopic mice model
Hu et al. Bcl-3 promotes TNF-induced hepatocyte apoptosis by regulating the deubiquitination of RIP1
Banerjee et al. Experimental models of colorectal cancer
Leung et al. Transgenic cyclooxygenase-2 expression and high salt enhanced susceptibility to chemical-induced gastric cancer development in mice
Hsu et al. Aryl hydrocarbon receptor promotes hepatocellular carcinoma tumorigenesis by targeting intestine‐specific homeobox expression
Kim et al. Hedgehog signaling is associated with liver response to fractionated irradiation in mice
Zhang et al. Cellular dissociation of NF-κB and inducible nitric oxide synthase in Helicobacter pylori infection
Zhang et al. E3 ligase HERC5-catalyzed UGDH isgylation promotes SNAI1-mediated tumor metastasis and cisplatin resistance in oral squamous cell carcinoma

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase