ETHODS OF MODULATING THE REPRODUCTIVE ENDOCRINE SYSTEM BY MODULATION OF TNF-α ACTIVITY
{.elated Applications This application claims the benefit of priority to U.S. Provisional
Application Serial No. 60/575,143, filed May 28, 2004, the entire contents of which is incorporated herein by this reference.
Government Funding Work described herein was supported, at least in part, by National Institutes of Health (NIH) under grants AI01650 and AI54370. The government may therefore have certain rights in this invention.
Background of the Invention The mechanisms underlying immune-mediated pregnancy failure remain largely unknown (Laird, S.M., et al. (2003) Hum Reprod Update 9:163-174). In women with recurrent pregnancy loss, increased numbers and cellular activation of peripheral blood CD56+ natural killer (NK) cells have suggested an important role for the innate immune system (Aoki, K., et al. (1995) Lancet 345:1340-1342; Coulam, C.B., et al. (1995) Am J Reprod Immunol 33:40-46; Kwak, J.Y., et al. (1995) Am J Reprod Immunol 34:93-99; Emmer, P.M., et al. (2000) Hum Reprod 15:1163-1169; Nτrivalas, E.I., et al. (2001) Hum Reprod 16:855-861). Since NK cells produce the signature T helper-1 (Thl) cytokine IFN-γ, NK cell activation during pregnancy might explain the apparent Thl bias also associated with recurrent pregnancy loss (Raghupathy, R. (1997) Immunol Today 18:478-482; Piccinni, M.P., et al (1998) Nat Med 4:1020-1024). These associations, however, have not led to a clear understanding of the ultimate cause of fetal loss. Data from rodent studies have suggested that the major mechanism of immune-mediated pregnancy failure is immune activation at the maternal-fetal interface. Activation of decidual immune cells with attendant inflammatory cytokine production or activation of complement via the binding of anti-phospholipid antibodies is thought to directly damage the fetus and placenta or lead to derangements in decidual or placental hemostasis (Laird, S.M., et al. (2003) Hum Reprod Update 9:163-174; Gendron, R.L., et al. (1990) J Reprod Fertil 90:395-402; Clark, D.A-, et al. (1998) J Immunol 160:545- 549; Holers, V.M., et al. (2002) J Exp Med 195:211-220). Endocrine failure is not thought to be an issue in recurring spontaneous abortion and the possibility that immune activation might cause pregnancy failure by inhibiting the reproductive endocrine system has been largely unexplored, despite indications that immune processes regulate reproductive endocrine function in non-
pregnant mammals, hiflammatory cytokines are thought to inhibit gonadotropin production at the level of the hypothalamus and pituitary in cases of chronic or acute illness (Rivest, S., and Rivier, C. (1995) EndocrRev 16:177-199), and inhibit progesterone synthesis by the corpus luteum and promote luteal regression as part of the normal ovulatory cycle (Davis, J.S., and Rueda, B.R. (2002) Front Biosci 7:dl949- 1978). During early gestation in rodents, progesterone production by the corpus luteum is driven primarily by pituitary-derived prolactin binding to its Janus kinase (JAK) 2/Signal transducer and activator of transcription (STAT) 5-coupled receptor expressed by corpus luteal cells (Risk, M., and Gibori, G. (2001) Mechanisms of luteal cell regulation by prolactin. In Prolactin. N.D. Horseman, editor. Boston: Kluwer Academic Publishers. 265-295). The binding of progesterone to its nuclear receptor, in turn, is thought to maintain decidual viability and inhibit myometrial contractility (Deanesly, R. (1973) J Reprod Fertil 35:183-186; Jaffe, R.B. (1999). Neuroendocrine-metabolic regulation of pregnancy. In Reproductive Endocrinology. S.S.C. Yen, R.B. Jaffe, and R.L. Barbieri, editors. Philadelphia: W. B. Saunders Company. 751-784). In addition, there is strong evidence that lutenizing hormone (LH) produced by the pituitary is also critical for maintaining luteal function in rats early in pregnancy (Raj, H. G. and Moudgal, N.R. (1970) Endocrinology 86:874), and this is likely also to be the case in mice (Mednick, D.L., et al. (1980) J. Reprod. Fertil. 60:201). Thus, the reproductive endocrine system provides multiple potential points for inhibition by the immune system. However, it is unknown whether and how such pathways play a role during pregnancy.
Summary of the Invention The present invention is based, at least in part, on the discovery that spontaneous abortion requires TNF- . In particular, the present invention demonstrates that in a murine model of pregnancy loss employing anti-CD40 ligation, TNF-α acts on corpus luteal cells to induce the expression of the suppressor of cytokine signaling molecules, which in turn leads to decreased progesterone levels. Accordingly, the instant invention provides methods to modulate the reproductive-endocrine system. In one embodiment, these methods enable subjects, both human and animal subjects, to carry offspring to term by inhibiting spontaneous abortion. In one aspect, the invention pertains to a method of inhibiting spontaneous abortion in a mammalian subject comprising administering to the mammalian subject a compound that inhibits TNF-α activity such that spontaneous abortion in the mammalian subject is inhibited.
In another aspect, the invention pertains to a method of enhancing the ability of a mammalian subject to carry at least one embryo to term, comprising administering to the mammalian a compound that inhibits TNFα activity such that the ability of the mammalian subject to carry at least one embryo to term is enhanced. In one embodiment, the compound is an antibody that binds to TNFα. In another embodiment, the antibody that binds to TNFα binds human TNFα. In another embodiment, the antibody that binds to human TNFα is selected from the group consisting of: HUMIRA® and REMICADE®. In yet another embodiment, the compound is a soluble form of at least one TNF receptor. In one embodiment, the soluble form of TNF receptor is selected from the group consisting of: ENBREL® and LENERCEPT®. r one embodiment, the compound is administered in an amount sufficient to prevent the upregulation of SOCS 1 and SOCS3 expression such that spontaneous abortion is inhibited. hi another embodiment, the compound is administered in an amount sufficient to maintain progesterone levels in early pregnancy such that spontaneous abortion is inhibited. In another embodiment, the method further comprises administering progesterone or a progesterone derivative. In one embodiment, the mammalian subject has had a previous spontaneous abortion. In one embodiment, the compound is administered to the mammalian subject prior to implantation of an embryo. In one embodiment, the compound is administered to the mammalian subject after implantation of an embryo. In one embodiment, the mammalian subject is human. In another embodiment, the subject is a domesticated animal. In one embodiment, the subject is an endangered species. hi another embodiment, the subject is a non-human animal being used to carry cloned, non-human animals. In one aspect, the invention pertains to a prognostic method for determining whether a subject is at risk for having a spontaneous abortion comprising detecting the presence or level of at least one of SOCS 1 , SOCS3 or IκBα mRNA or polypeptide in a biological sample obtained from said subject to thereby determine whether the subject is at risk for having a spontaneous abortion, wherein if the level of at least one of SOCS 1, SOCS3 or IκBα mRNA or polypeptide is elevated relative to a
suitable control, the subject is at risk of having a spontaneous abortion. In yet another aspect, the invention pertains to a prognostic method for determining whether a subject is at risk for having a spontaneous abortion comprising detecting the presence or level of mRNA or polypeptide of at least one of IL-6 and TNFα in a biological sample obtained from said subject, to thereby determining whether the subject is at risk for having a spontaneous abortion, wherein if the level of at least one of IL-6 and TNFα mRNA or polypeptide is elevated relative to a suitable control, the subject is at risk of having a spontaneous abortion. In another aspect, the invention pertains to a diagnostic method for determining whether a subject has had a spontaneous abortion that would benefit from treatment with a compound that inhibits TNFα activity comprising detecting the presence or level of SOCS1, SOCS3 or IκBα mRNA or polypeptide in a biological sample obtained from said subject to thereby determine whether the subject has had a spontaneous abortion that would benefit from treatment with a compound that inhibits TNFα activity, wherein if the level of at least one of SOCS 1 , SOCS3 or IκBα mRNA or polypeptide is elevated relative to a suitable control, the subject has had a spontaneous abortion. In another embodiment, the invention pertains to a diagnostic method for determining whether a subject has had a spontaneous abortion that would benefit from treatment with a compound that inhibits TNFα activity comprising detecting the presence or level of mRNA or polypeptide of at least one of IL-6 and TNFα in a biological sample obtained from said subject thereby determining whether the subject has had a spontaneous abortion that would benefit from treatment with a compound that inhibits TNFα activity, wherein if the level of at least one of IL-6 and TNFα mRNA or polypeptide is elevated relative to a suitable control, the subject has had a spontaneous abortion.. In still another embodiment, the invention pertains to a method for determining whether a subject is responding to treatment for recurring spontaneous abortions comprising detecting the presence or level of SOCS1, SOCS3 or IκBα mRNA or polypeptide in a biological sample obtained from said subject to thereby determining whether the subject is responding to treatment for recurring spontaneous abortions, wherein if the level of at least one of SOCS1, SOCS3 or IκBα mRNA or polypeptide is reduced relative to a suitable control, the subject is responding to treatment for recurring spontaneous abortions. In another embodiment, the invention pertains to a method for determining whether a subject is responding to treatment for recurring spontaneous abortions comprising detecting the presence or level of mRNA or polypeptide of at least one of IL-6 and TNFα in a biological sample obtained from said subject to thereby
determining whether the subject is responding to treatment for recurring spontaneous abortions, wherein if the level of at least one of IL-6 and TNFα mRNA or polypeptide is reduced relative to a suitable control, the subject is responding to treatment for recurring spontaneous abortions. In one embodiment, the method further comprises detecting the presence or level of mRNA or polypeptide of one or more of an immune cell surface molecule selected from the group consisting of: CD69, CD25, CD44, CD45RB, CD62L, CD80, CD86, CD40, MHC class II, and CD54. In one embodiment, the method further comprises detecting the presence or level of marker mRNA or polypeptide, wherein the marker is selected from the group consisting of: luteinizing hormone, luteinizing hormone receptor, steroid acute regulatory protein, phosphorylated steroid acute regulatory protein, and 3β- hydroxysteroid dehydrogenase. In another embodiment, the method further comprises detecting the level of progesterone. In one embodiment, the biological sample is selected from the group consisting of: a tissue sample, a cell sample, or a serum sample. In one embodiment, the tissue sample is a chorionic villus sample or a placental sample.
Brief Description of the Drawings Figures 1A-1E show that overt embryo resorption is preceded by decreased serum progesterone concentrations following systemic CD40 ligation. Figures 2A-2D depict post-receptor prolactin signaling defects and luteal insufficiency following systemic CD40 ligation. Figures 3A-3I depict rescue of CD40 ligation-induced pregnancy failure by exogenous progesterone or prolactin. Figures 4A-4E depict components of immune activation acting upstream from endocrine failure. Figures 5A-5D depict the involvement of TNF-α in anti-CD40-induced pregnancy failure. Figure 6 depicts the ovarian expression of IL-6, IκBα, SOCS1 and SOCS3 upon systemic CD40 ligation.
Detailed Description of the Invention The present invention is based, at least in part, on the discovery that activation of the innate immune system and associated inflammatory cytokine production leads to pregnancy failure through inhibition of the reproductive-endocrine system. More specifically, utilizing an animal model in which pregnancy failure is induced by systemic activation of the CD40 immune costimulatory pathway, it was found that spontaneous abortion requires TNF-α. Without wishing to be bound by theory, TNF-α appears to act on corpus luteal cells to induce the expression of the suppressor of cytokine signaling molecules, SOCS1 and SOCS3, which in turn leads to decreased progesterone levels and spontaneous abortion. Accordingly, the instant invention provides methods, inter alia, to modulate the reproductive endocrine system which inhibits spontaneous abortion in subjects and enables subjects, both human and animal subjects, to carry offspring to term.
Various aspects of the invention are described in further detail in the following subsections:
I. Definitions The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. Byway of example, "a TNF-α receptor" means one or more than one TNF-α receptor. As used herein, "TNF-α" is a non-glycosylated protein of 17 kDa and a length of 157 amino acids which is observed as homotrimer under physiological conditions, but can also exist as a homodimer. The 17 kDa form of TNF-α is synthesized as a 26 kDa soluble precursor molecule and is processed to the 17 kDa form by TNF-alpha converting enzyme (TACA) (Jones, E. Y. et al. Nature, 1989, 338, 225- 8). Most of the cellular actions of TNF-α have been attributed to the activities of two distinct TNF-α receptor molecules, a type I receptor and a type II receptor. "TNFRI" (also known as, p55, CD120a, and TNFRSF1 A) and "TNFRII" (ρ75, CD120b, and TNFRSF1B ) (Bazzoni, F. and Beutler, B. N. Engl. J. Med., 1996, 334, 1717-25) which are expressed ubiquitously. Binding of TNF-α to its membrane- bound receptors induces diverse effects in different organs and tissues. The extracellular portions of both TNF receptors can also be shed from the cell surface through proteolytic cleavage and exist in soluble form. These soluble receptors retain the ability to bind TNF-α and thus may act as physiological modulators of TNF activity in vivo (Engelmann, H.; et al. J. Biol. Chem., 1989, 264, 11974-80, Seckinger, P. et al. J. Exp.
Med, 1988, 167, 1511-6). The cytoplasmic domains of TNFRI bear a motif termed 'death domain' (DD). The DD is a protein-protein interaction motif that allows two proteins with DD to bind to each other. Binding of TNF-α to TNFRI induces recruitment of the DD- containing protein TRADD to the DD of TNFRI (Hsu, H. et al, Cell, 1995, 81, 495- 504). Overexpression of TRADD also induces TNF-α-regulated responses such as apoptosis and activation of the transcription factors NF-κB and Jun kinase (Hsu, H. et al, Immunity, 1996, 4, 387-96). Recently several TNF receptor-associated proteins have been cloned. The cytoplasmic domains of the "TNF receptor-associated proteins" do not have any intrinsic enzymatic activity, and hence they signal by inducing aggregation of intracellular adaptor molecules. TNF receptor-associated factors (TRAF) also interact with members of the TNFR family (Arch, R. H. et al. Genes Dev., 1998, 12, 2821-30). Most of TRAF proteins interact with receptor molecules either directly, or indirectly tlirough binding to other TRAF, or through binding to TRADD. TNFRII contains cytoplasmic TRAF binding motifs and is able to bind directly to TRAF proteins. Because TRAF2 can bind to TRADD, which in turn can associate with TNFRI, TRAF2 can indirectly participate in signaling from this receptor as well. As used herein, the phrase "TNF-α activity" includes activities mediated by TNF-α, such as binding to a TNF receptor (e.g., a type I or type II receptor, e.g., TNFRI or TNFRIT), transmission of a signal via such a receptor (e.g., second messenger generation), modulation of gene transcription (e.g., IL-6, SOCSl, SOCS3 or IκBα), or downstream biological effects on a cell (e.g., modulation of cytotoxicity, proliferation and/or apoptosis), or on an organism, e.g., modulation of the reproductive endocrine system, e.g., spontaneous abortion. Other exemplary TNF-α activities include: upmodulation of lymphoid activation markers, e.g., CD69, CD25, CD44, CD45RB, and CD62L, upmodulation of SOCSl and SCOS3 expression, upregulation of 20α-HSD expression, downregulation of 3β-HSD expression as well as downregulation of LHR expression, decreased prolactin receptor expression, and decreased progesterone production. These or other activities of TNF-α can be assessed by one or more of several standard in vitro or in vivo assays known in the art. For example, the ability of a compound that modulates TNF-α activity or TNF-α receptor mediated signaling to modulate the presence or expression level of IL-6, SOCSl, SOCS3, and IκBα can be assessed by semi-quantitative RT-PCR; the ability of an antibody to neutralize TNF-α activity can be assessed by inhibition of TNF-α-induced cytotoxicity of, for example, L929 cells; additionally, the ability of an antibody to inhibit TNF-α-induced expression
of, for example, ELAM-1 on HUNEC, as a measure of TΝF-α-induced cellular activation, can be assessed. As used herein, the phrase "reproductive endocrine system" includes the system of glands that have no ducts and that release their secretions, e.g., hormones, directly into the circulatory system and influence the reproductive system in female subjects, e.g., the organs involved in producing eggs and in conceiving and carrying offspring. The glands of the reproductive endocrine system include, for example, the hypothalamus, pituitary, and the gonads. The organs of the reproductive system include, for example, in women, the ovaries, the fallopian tubes, the uterus, the cervix, and the vagina. As used herein, the term "hormone" includes a substance which is a product of living cells and that circulates in body fluids and produces a specific effect on the activity of cells remote from its point of origin. The term hormone, as used herein, also refers to synthetic versions thereof. The terms "spontaneous abortion," "miscarriage," and "pregnancy loss," used interchangeably herein, refer to the uninduced termination of a pregnancy. A spontaneous abortion as defined herein includes failure of a fertilized embryo to properly implant in the wall of the uterus of a subject or, once implanted, shedding of the embryo from the uterus of the subject, or reabsorption of an embryo by the subject, and includes both recurrent loss and occult loss of a pregnancy. As used herein the term "subject" includes mammalian subjects. A subject of the invention can be or can become naturally pregnant or can be or can become pregnant using assisted reproductive technologies, e.g., in vitro fertilization, insemination, etc. In preferred embodiments, the subjects of the present invention are human, although the claimed methods are also for use in other subjects such as domesticated animals, livestock, zoo animals, etc. hi one embodiment, a subject of the invention is an endangered species. Νon-limiting examples of endangered species, e.g., endangered mammals, include Aye-aye, Banteng, Bighorn Sheep, Blue Whale, Bonobo, Common Chimpanzee, Chinese River Dolphin, Elephant, Fin Whale, Gelada, Giant golden-crowned flyingfox, Giant Panda, Giant Pangolin, Golden Lio, Tamarin, Gorilla, Gray bat, Hawaiian Monk Seal, Lidri, Kouprey, Leopard, Orangutan, Pere David's Deer, Proboscis Monkey, Red Panda, Red Wolf, Sea Otter, Sei Whale, Snow Leopard, Steller's Sea Lion, Tiger, and Naquita. In another embodiment, a subject is a non-human animal which is used for the purposes of carrying cloned non-human animals. Νon-limiting examples of subjects include humans, cows, cats, dogs, goats, horses, sheep, pigs, rats and mice.
In a preferred embodiment, a subject of the invention does not have detectable levels of anti-phospholipid antibodies (aPL). As used herein, "anti- phospholipid antibodies", are antibodies directed against phospholipids. Subjects with anti-phospholipid antibodies may develop antiphospholipid syndrome (APS) (also known as Hughes' syndrome) in which subjects may have blood clots, headaches, strokes, recurrent pregnancy loss, and thrombosis. Anti-phospholipid antibodies are often found in subjects with autoimmune disorders, such as systemic lupus erythematosis, however not all subjects with anti-phospholipid antibodies develop lupus. Non-limiting examples of anti-phospholipid antibodies are, lupus anticoagulant, anticardiolipin antibody, anti-beta 2 glycoprotein 1, and anti-prothrombin. As used herein, the term "implantation" includes attachment of the fertilized egg to the uterine lining following a natural fertilization process or with the aid of assisted reproductive technology. As used herein "assisted reproductive technology" refers to any technically assisted method of reproduction such as, for example ovulation induction, in vitro fertilization, embryo transfer, and the like. In humans implantation usually occurs five to seven days after ovulation in the natural reproductive process. As used herein, the term "maintain progesterone levels" includes maintaining such levels in the normal range for a pregnant female in order to maintain a pregnancy. Such levels can readily be determined by one of ordinary skill in the art. Exemplary guidelines for normal pregnant human progesterone levels are about 11.2 - 90.0 ng/mL in the first trimester, 25.6 - 89.4 ng/mL in the second trimester, and 48.4 - 422.5 ng/mL in the third trimester. As used herein the term "embryo" includes a stage in the development of a multicellular organism between the time that the zygote is fertilized and the point at which the organism developing from that zygote becomes free-living. As used herein, the various forms of the term "modulate" are intended to include upmodulation (e.g., increasing or upregulating a particular response or activity) and downmodulation (e.g., decreasing or downregulating a particular response or activity). The term "interact" as used herein is meant to include detectable interactions between molecules, such as can be detected using, for example, a yeast two hybrid assay or coimmunoprecipitation. The term interact is also meant to include "binding" interactions between molecules. Interactions may be protein-protein or protein-nucleic acid in nature. As used herein, the term "contacting" (i.e., contacting a cell) includes incubating the compound and the cell together in vitro (e.g., adding the compound to cells in culture) or administering the compound to a subject such that the compound and cells of the subject are contacted in vivo. The term "contacting" is not intended to
include exposure of cells to a modulator of TNF-α activity that may occur naturally in a subject (i.e., exposure that may occur as a result of a natural physiological process). As used herein, the term "test compound" includes a compound that has not previously been identified as, or recognized to be, a modulator of TNF-α activity and/or a modulator of reproductive endocrine function, e.g., an inhibitor of spontaneous abortion. The term "library of test compounds" is intended to refer to a panel comprising a multiplicity of test compounds. As used herein, the term "cell free composition" includes an isolated composition which does not contain intact cells. Examples of cell free compositions include cell extracts and compositions containing isolated proteins. As used herein, the term "immune cell" includes cells that are of hematopoietic origin and that play a role in the immune response. Immune cells include lymphocytes, such as B cells and T cells; dendritic cells; natural killer cells; and myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes. As used herein the term "innate immune system" includes natural or native immune mechanisms, i.e., mechanisms that exist before infection, are capable of rapid responses to microbes, and react in essentially the same way to repeated infections. As used herein, the term "adaptive immune system" or "specific immune system" includes immune mechanisms that are stimulated by exposure of infectious agents and increase in magnitude and defensive capabilities with each successive exposure to a particular microbe. As used herein, "inflammation" is a local accumulation of fluid, plasma proteins and leukocytes (mostly neutrophils, macrophages and lymphocytes).
Inflammation occurs after most kinds of tissue injuries or infections or immunologic stimulation as a defense against foreign or altered endogenous substances. Inflammation is normally a self-limiting episode. An inflammatory reaction is characterized by an initial increase in blood flow to the site of injury, enhanced vascular permeability, and the ordered and directional influx and selective accumulation of different effector cells from the peripheral blood at the site of injury. Inflammation is also associated with the upmodulation of a number of cytokines , known collectively as pro-inflammatory cytokines. The major pro- inflammatory cytokines are ILl-alpha , ILl-beta , IL6 , and TNF-alpha. Other pro- inflammatory mediators include LIF , IFN-gamma, OSM , CNTF , TGF-beta , GM-CSF , IL11 , IL12 , IL17 , IL18 , IL8 and a variety of other chemokines that chemoattract inflammatory cells, and various neuromodulatory factors.
As used herein, "CD40" is a cell surface antigen that is a member of the TNF receptor superfamily. CD40 is also called Bp50 and TNFRSF5. CD40 is a transmembrane glycoprotein with a length of 277 amino acids (48 kDa). CD40 is phosphorylated and can be expressed as a homodimer. A soluble form of CD40 (28 kDa) has been described also. CD40 has a short cytoplasmic domain with limited homology to the conserved cytosolic death domain of the TNFRI receptor and APO-1. CD40 protein is expressed on all B-lymphocytes during various stages of development, activated T- cells and monocytes, follicular dendritic cells, thymic epithelial cells, and various carcinoma cell lines. As used herein, the term "antibody", includes immunoglobulin molecules comprised of four polypeptide chains, two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CHI, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino- terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3,
CDR3, FR4. The term antibody includes immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site which binds (immunoreacts with) an antigen, such as Fab and F(ab')2 fragments, single chain antibodies, intracellular antibodies, scFv, Fd, or other fragments. The term " antibody", as used herein, also includes antibodies that are prepared, expressed, created, or isolated by recombinant means, such as antibodies expressed using a recombinant expression vector transfected into a host cell, antibodies isolated from a recombinant, combinatorial antibody library, antibodies isolated from an animal (e.g., a mouse) that is transgenic for human immunoglobulin genes (see e.g., Taylor, L.D., et al. (1992) Nucl. Acids Res. 20:6287-6295) or antibodies prepared, expressed, created or isolated by any other means that involves splicing of, for example, human immunoglobulin gene sequences to other DNA sequences. Such recombinant antibodies have, for example, variable and constant regions derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant antibodies are subjected to in vitro mutagenesis (or, for example, when an
animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis), and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo. Preferably, antibodies of the invention bind specifically or substantially specifically to TNF-α and/or TNF-α receptor molecules (i.e., have little to no cross reactivity with non-TNF-α, non-TNF-α receptor molecules). The terms "monoclonal antibodies" and "monoclonal antibody composition", as used herein, refer to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of an antigen, whereas the term "polyclonal antibodies" and "polyclonal antibody composition" refer to a population of antibody molecules that contain multiple species of antigen binding sites capable of interacting with a particular antigen. A monoclonal antibody composition thus typically display a single binding affinity for a particular antigen with which it immunoreacts. An "isolated antibody", as used herein, is intended to refer to an antibody that is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds TNF-α or a TNF-α receptor and is substantially free of antibodies that specifically bind antigens other than TNF-α or a TNF-α receptor). An isolated antibody that specifically binds TNF-α or a TNF-α receptor may, however, have cross-reactivity to other antigens, such as TNF-α or TNF-α receptor molecules from other species. Moreover, an isolated antibody may be substantially free of other cellular material and/or chemicals. A "neutralizing antibody", as used herein (or an "antibody that neutralizes TNF"), includes antibodies whose binding results in inhibition of the biological activity of TNF-α. This inhibition of the biological activity of TNFα can be assessed by measuring one or more indicators of TNF-α activity. As used herein the term "soluble" with respect to TNF receptors includes forms of receptors which are not cell associated, e.g., which lack transmembrane domains. Such soluble molecules may or may not be fusion proteins, e.g., which incorporate amino acid sequences from a non-TNF receptor protein to improve desired characteristics, such as affinity, solubility, half-life, etc. The term "treatment," as used herein, is defined as the application or administration of a therapeutic agent to a subject, or application or administration of a therapeutic agent to an isolated tissue or cell line from a subject, who has a disease, disorder, or infection, a symptom of a disease, disorder, or infection, or a predisposition toward a disease, disorder, or infection, with the purpose of curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving or affecting the disease, disorder,
or infection, the symptoms of disease, disorder, or infection, or the predisposition toward a disease, disorder, or infection. A therapeutic agent includes agents which mediate TNF-α blockade (i.e., inhibit TNF-α and/or TNF-α receptor activity) including, but not limited to, nucleic acid molecules, small molecules, peptides, peptidomimetics, antibodies, ribozymes, and sense and antisense oligonucleotides or nucleic acid molecules which mediate RNAi as described herein.
II. Methods of the Invention A. Modulation of TNF-α Activity The present invention demonstrates that activation of the innate immune system and associated inflammatory cytokine production leads to pregnancy failure through inhibition of the reproductive-endocrine system and that TNF-α is required for this failure. A number of changes in gene expression or cell surface expression are associated with spontaneous abortion (using an anti-CD40 ligation model), such as for example, upregulation of inflammatory cytokine production, e.g., IL-6, modulated expression of cell surface lymphoid markers, e.g., CD69, CD25, CD44, CD45RB, CD62L, CD80, CD86, CD40, MHC class II, and CD54, upregulation of SOCSl, SOCS3 and IκBα, upregulated 2Qα-HSD expression, downregulated 3β-HSD expression as well as downregulated LHR expression, decreased prolactin receptor expression and decreased progesterone production. Accordingly, in one aspect, the invention features methods of modulating the reproductive endocrine system, e.g., inhibiting spontaneous abortion, comprising administering an agent that modulates TNF-α activity, e.g., by modulating TNF-α expression or TNF-α receptor-mediated signaling. In one embodiment, spontaneous abortion is inhibited in a mammalian subject by administering an antibody to TNF- α or a TNF-α blocking antibody which binds to at least one TNF-α receptor but does not transmit a signal. In another embodiment, spontaneous abortion in a mammalian subject is inhibited by administering a soluble form of the TNF-α receptor, hi another embodiment, the ability of a mammalian subject having low progesterone levels to carry at least one embryo to term is enhanced by administering an agent that modulates TNF- α activity in a subject. In a further embodiment, progesterone or a progesterone derivative (e.g., the 19-nortestosterone derivatives (e.g., norethisterone, levonorgestrel, desogestrel, gestodene, norgestimate), and the progesterone derivatives (e.g., medroxyprogesterone acetate, cyproterone acetate, progesterone caproate (NEnglJ Med. 2003 349:1087)), is additionally administered to the subject. In another embodiment, the ability of a mammalian subject having increased NK cell activation or NK cell infiltrates to carry at least one embryo to term is enhanced by administering an agent that modulates TNF-α activity to a subject. In a preferred embodiment, the agent
that modulates TNF-α activity is administered in an amount sufficient to prevent the upregulation of SOCSl and SOC3 expression, hi another preferred embodiment, the compound that modulates TNF-α activity is administered in an amount sufficient to maintain progesterone levels during pregnancy. In one embodiment, TNF-α activity is modulated without modulating IL-
1 activity (either IL-lα or IL-lβ). hi one embodiment, TNF-α activity is modulated in a subject that does not have detectable levels of anti-phospholipid antibodies. In another embodiment, TNF-α activity is modulated in a subject in which pregnancy is characterized by activation of the innate immune system and/or inflammatory cytokine production. In another embodiment, TNF-α activity is modulated in a subject in which pregnancy is not characterized by direct damage at the maternal-fetal interface, e.g., the placental blood supply. Agents useful for modulating TNF-α activity can be identified utilizing the screening assays of the invention, or can be a known compounds that modulate TNF- α activity, described in further detail below. The methods of the present invention also include prognostic and diagnostic methods and methods which determine whether treatment of a subject is having the desired effect (hereinafter "treatment monitoring methods") or whether a subject is in need of treatment. Prognostic methods include methods which determine whether subjects are at risk for developing a spontaneous abortion treatable by modulation of TNF-α. Diagnostic methods include methods which determine whether a subject might be at risk for or has experienced a spontaneous abortion treatable by modulation of TNF-α.
1. Inhibitory Compounds for Blockade of TNF-α activity Data presented herein demonstrate that an increase in TNF-α activity is associated with spontaneous abortion. Accordingly, compounds that downmodulate TNF-α and/or TNFR activity can be used to modulate the reproductive endocrine system, e.g., inhibit spontaneous abortion and/or enhance the ability of a subject to carry an embryo to term. Inhibitory compounds of the invention can act extracellularly or intracellularly to specifically modulate TNF-α activity. Exemplary molecules that act extracellularly to inhibit TNF-α activity include antibodies that recognize TNF-α, antibodies that bind to the TNF-α receptor but do not transmit a signal, soluble forms of the TNF-α receptor, and dominant negative TNF-α mutants. As used herein, the term "intracellular binding molecule" is intended to include molecules that act intracellularly to inhibit the expression or activity of a molecule that mediates a TNF-α activity by binding to the
protein or to a nucleic acid (e.g., an mRNA molecule) that encodes a protein. Examples of intracellular binding molecules, described in further detail below, include antisense nucleic acids, nucleic acid molecules that mediate RNAi, intracellular antibodies, or certain chemical agents that specifically inhibit TNF-α activity, e.g., by acting to decrease expression or activity of TNF-α, its receptor, or a molecule involved in transducing a signal upon the binding of TNF-α to its receptor. a. Anti-TNF Antibodies One type of inhibitory compound that can be used for blockade of TNF- α activity is an antibody that binds to TNF-α and inhibits its activity, e.g., by inhibiting the binding of TNF-α to its receptor and activate inflammatory pathways, e.g., cytokine production. Antibodies to TNF-α can be known or can be made using standard techniques. In one embodiment, the anti-TNF-α antibody is a commercially available (known) anti-TNF-α antibody. In one embodiment, the anti-TNF-α antibody is h fliximab. hifliximab, also referred to as cA2, is marketed as REMICADE®, and produced by Centocor, Malvern, PA. REMICADE® is indicated for the treatment of rheumatoid arthritis and Crohn's Disease. REMICADE® is a humanized (e.g., chimeric) IgGlκ monoclonal antibody with an approximate molecular weight of 149, 000 daltons. It is composed of human constant and murine variable regions, hifliximab neutralizes the biological activity of TNF-α by binding with high affinity to the soluble and transmembrane forms of TNF-α and inhibits binding of TNF-α with its receptors (American Thoracic Society, Centers for Disease Contol and Prevention (2000) Am J Respir Crit Care Med 161 : S221 ; Knight, D.M., et al. (1993) Molec Immunol 30:1443). Infliximab does not neutralize TNF-β. Biological compositions and methods for this antibody can be found in, for example, US Patent 6284471 : Anti-TNF - antibodies and assays employing anti- TNF-a antibodies, Le, Junming, et al; US Patent 6277969: Anti-TNF antibodies and peptides of human tumor necrosis factor, Le, Junming, et al. In another embodiment, the anti-TNF-α antibody is Adalimumab.
Adalimumab, also referred to as D2E7, is marketed as Humira™, and is produced by Cambridge Antibody Technology, Great Britain. Humira™ is indicated for the treatment of rheumatoid arthritis. Humira™ is a recombinant IgGl monoclonal antibody composed of human heavy and light chain variable regions and human IgGl K constant regions. Adalimumab binds specifically to TNF-α and blocks the interaction with p55 (type I) and p75 (type II) cell surface TNF-α receptors. Adalimumab does not neutralize TNF-β. Adalimumab also lyses surface TNF-α expressing cells in vitro in the presence of complement. Biological compositions and methods for this antibody can be
found in, for example, US Patents 6,090,382, 6,258,562, and 6,509,015. Other non-limiting, exemplary antibodies that can be used in connection with the instant invention include CBOOO6, BAY x 1351, and afelimomab (Vincent, J.L. 2000 Int. J. Clin. Pract. 54:190) and CDP571, an engineered human antibody that neutralizes human TNF-α (Rankin E.G., et al. 1995. Br. J. Rheumatol. 34:334). h one embodiment, antibodies may be modified to improve their characteristics, e.g., to increase their half-life in serum. For example, CDP870 is anti- TNF-α antibody fragment modified to obtain a prolonged plasma half-life (approximately 14 days) (Choy, E.H. et al. 2002 Rheumatology 41:1133). In another embodiment, an antibody to TNF-α is made using methods known to those of skill in the art. Antibodies can be prepared by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal), e.g., with a TNF-α protein immunogen. An appropriate immunogenic preparation can contain, for example, recombinantly expressed protein or a chemically synthesized peptide. The preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory compound. Antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256:495-497) (see also, Brown et al. (1981) J. Immunol 127:539-46; Brown et al. (1980) JBiol Chem 255:4980-83; Yeh et al. (1976) PNAS 76:2927-31 ; and Yeh et al. (1982) Int. J. Cancer 29:269-75). The technology for producing monoclonal antibody hybridomas is well known (see generally R. H. Kenneth, i Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, New York (1980); E. A. Lerner (1981) YaleJ. Biol. Med, 54:387-402; M. L. Gefter et al (1977) Somatic Cell Genet, 3:231-36). Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with a protein immunogen as described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds specifically, e.g., to the TNF-α protein. Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating a monoclonal antibody (see, e.g., G. Galfre et al. (1977) Nature 266:550-52; Gefter et al. Somatic Cell Genet, cited supra; Lerner, Yale J. Biol. Med., cited supra; Kenneth, Monoclonal Antibodies, cited supra). Moreover, the ordinary skilled artisan will appreciate that there are many variations of such methods which also would be useful. Typically, the immortal cell line (e.g., a myeloma cell line) is derived from the same mammalian species as the lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line. Preferred
immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium"). Any of a number of myeloma cell lines can be used as a fusion partner according to standard techniques, e.g., the P3-NSl/l-αg4-l, P3-x63-αg8.653 or Sp2/O-αgl4 myeloma lines. These myeloma lines are available from the American Type Culture Collection (ATCC), Rockville, Md. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG"). Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed). Hybridoma cells producing a monoclonal antibody that specifically binds the protein are identified by screening the hybridoma culture supernatants for such antibodies, e.g., using a standard ELISA assay. Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal antibody that binds to a protein can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g. , an antibody phage display library) with the protein, or a peptide thereof, to thereby isolate immunoglobulin library members that bind specifically to the protein. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene SurfZAPτM Phage Display Kit, Catalog No. 240612). Additionally, examples of methods and compounds particularly amenable for use in generating and screening antibody display library can be found in, for example, Ladner et al. U.S. Patent No. 5,223,409; Kang et al. International Publication No. WO 92/18619; Dower et al. International Publication No. WO 91/17271; Winter et al. Intemational Publication WO 92/20791; Markland et al. International Publication No. WO 92/15679; Breitling et al. International Publication WO 93/01288; McCafferty et al. International Publication No. WO 92/01047; Garrard et al. International Publication No. WO 92/09690; Fuchs et al. (1991) Bio/Technology 9:1370-1372; Hay et al. (1992) Hum Antibod Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281; Griffiths et al. (1993) EMBO J 12:725-734; Hawkins et al. (1992) JMol Biol 226:889-896; Clarkson et al. (1991) Nature 352:624-628; Gram et al. (1992) PNAS 89:3576-3580; Garrad et al. (1991) Bio/Technology 9:1373-1377; Hoogenboom et al. (1991) Nuc Acid Res 19:4133-4137; Barbas et al. (1991) PNAS 88:7978-7982; and McCafferty et al. Nature (1990) 348:552-554. In another embodiment, ribosomal display can be used to replace bacteriophage as the display platform (see, e.g., Hanes et al. 2000. Nat. Biotechnol. 18:1287; Wilson et al. 2001. Proc. Natl. Acad. Sci. USA 98:3750; or Irving et al. 2001 J. Immunol. Methods 248:31. In yet another embodiment, cell surface libraries can be screened for antibodies (Boder et al. 2000. Proc. Νatl. Acad. Sci. USA 97:10701;
Daugherty et al. 2000 J. Immunol. Methods 243:211. Such procedures provide alternatives to traditional hybridoma techniques for the isolation and subsequent cloning of monoclonal antibodies. Yet other embodiments of the present invention comprise the generation of substantially human antibodies in transgenic animals (e.g. , mice) that are incapable of endogenous immunoglobulin production (see e.g., U.S. Pat. Nos. 6,075,181, 5,939,598, 5,591,669 and 5,589,369 each of which is incorporated herein by reference). For example, it has been described that the homozygous deletion of the antibody heavy- chain joining region in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of a human immunoglobulin gene array to such germ line mutant mice will result in the production of human antibodies upon antigen challenge. Another preferred means of generating human antibodies using SCID mice is disclosed in U.S. Pat. No. 5,811,524 which is incorporated herein by reference. It will be appreciated that the genetic material associated with these human antibodies can also be isolated and manipulated as described herein. Yet another highly efficient means for generating recombinant antibodies is disclosed by Newman, Biotechnology, 10: 1455-1460 (1992). Specifically, this technique results in the generation of primatized antibodies that contain monkey variable domains and human constant sequences. This reference is incorporated by reference in its entirety herein. Moreover, this technique is also described in U.S. Pat. Nos. 5,658,570, 5,693,780 and 5,756,096 each of which is incorporated herein by reference. Once a monoclonal antibody of has been identified (e.g., either a hybridoma-derived monoclonal antibody or a recombinant antibody from a combinatorial library, including monoclonal antibodies that are already known in the art), DNAs encoding the light and heavy chains of the monoclonal antibody can be isolated by standard molecular biology techniques. For hybridoma derived antibodies, light and heavy chain cDNAs can be obtained, for example, by PCR amplification or cDNA library screening. For recombinant antibodies, such as from a phage display library, cDNA encoding the light and heavy chains can be recovered from the display package (e.g., phage) isolated during the library screening process. Nucleotide sequences of antibody light and heavy chain genes from which PCR primers or cDNA library probes can be prepared are known in the art. For example, many such sequences are disclosed in Kabat, E.A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NTH Publication No. 91-3242 and in the "Vbase" human germline sequence database.
Once obtained, the antibody light and heavy chain sequences can be cloned and manipulated using standard methods. For example, in one embodiment, variable regions of the light and heavy chains can linked by a flexible peptide linker (e.g., (Gly4Ser)3) and expressed as a single chain molecule. h one embodiment, antibody of the invention may be modified to reduce their immunogenicity using art-recognized techniques. For example, antibodies can be humanized, deimmunized, or chimeric antibodies can be made. These types of antibodies are derived from a non-human antibody, typically a murine antibody, that retains or substantially retains the antigen-binding properties of the parent antibody, but which is less immunogenic in humans. This may be achieved by various methods, including (a) grafting the entire non-human variable domains onto human constant regions to generate chimeric antibodies; (b) grafting at least a part of one or more of the non-human complementarity determining regions (CDRs) into a human framework and constant regions with or without retention of critical framework residues; or (c) transplanting the entire non-human variable domains, but "cloaking" them with a human-like section by replacement of surface residues. Such methods are disclosed in Morrison et al, Proc. Natl. Acad. Sci. 81: 6851-5 (1984); Morrison et al, Adv. Immunol. 44: 65-92 (1988); Verhoeyen et al, Science 239: 1534-1536 (1988); Padlan, Molec. Immun. 28: 489-498 (1991); Padlan, Molec. Immun. 31: 169-217 (1994), and U.S. Pat. Nos. 5,585,089, 5,693,761 and 5,693,762 all of which are hereby incorporated by reference in their entirety. De-immunization can also be used to decrease the immunogenicity of an antibody. As used herein, the term "de-immunization" includes alteration of an antibody to modify T cell epitopes (see, e.g., WO9852976A1, WO0034317A2). For example, VH and VL sequences from the starting antibody are analyzed and a human T cell epitope "map" from each V region showing the location of epitopes in relation to complementarity-determining regions (CDRs) and other key residues within the sequence Individual T cell epitopes from the T cell epitope map are analyzed in order to identify alternative amino acid substitutions with a low risk of altering activity of the final antibody. A range of alternative VH and VL sequences are designed comprising combinations of amino acid substitutions and these sequences are subsequently incorporated into a range of polypeptides of the invention that are tested for function. Typically, between 12 and 24 variant antibodies are generated and tested. Complete heavy and light chain genes comprising modified V and human C regions are then cloned into expression vectors and the subsequent plasmids introduced into cell lines for the production of whole antibody. The antibodies are then compared in appropriate biochemical and biological assays, and the optimal variant is identified.
Those skilled in the art will appreciate that chimeric antibodies can also be produced. In the context of the present application the term "chimeric antibodies" will be held to mean any antibody wherein the immunoreactive region or site is obtained or derived from a first species and the constant region (which may be intact, partial or modified in accordance with the instant invention) is obtained from a second species, hi preferred embodiments the target binding region or site will be from a non-human source (e.g. mouse) and the constant region is human. While the immunogenic specificity of the variable region is not generally affected by its source, a human constant region is less likely to elicit an immune response from a human subject than would the constant region from a non-human source. Preferably, the variable domains in both the heavy and light chains are altered by at least partial replacement of one or more CDRs and, if necessary, by partial framework region replacement and sequence changing. Although the CDRs may be derived from an antibody of the same class or even subclass as the antibody from which the framework regions are derived, it is envisaged that the CDRs will be derived from an antibody of different class and preferably from an antibody from a different species. It may not be necessary to replace all of the CDRs with the complete CDRs from the donor variable region to transfer the antigen binding capacity of one variable domain to another. Rather, it may only be necessary to transfer those residues that are necessary to maintain the activity of the target binding site. Given the explanations set forth in U. S. Pat. Nos. 5,585,089, 5,693,761 and 5,693,762, it will be well within the competence of those skilled in the art, either by carrying out routine experimentation or by trial and error testing to obtain a functional antibody with reduced immunogenicity. In another embodiment, the polypeptides described herein may be altered to provide for altered effector functionality that, e.g., affects the biological profile of the administered antibody. For example, the deletion or inactivation (through point mutations or other means) of a constant region domain may reduce Fc receptor binding of the circulating modified antibody. In other cases it may be that constant region modifications consistent with the instant invention moderate compliment binding and thus reduce the serum half life. Yet other modifications of the constant region may be used to modify disulfide linkages or oligosaccharide moieties that allow for enhanced localization due to increased antigen specificity or antibody flexibility. More generally, those skilled in the art will realize that antibodies modified as described herein may exert a number of subtle effects that may or may not be readily appreciated. However the resulting physiological profile, bioavailability and other biochemical effects of the modifications, such as serum half-life, may easily be measured and quantified using well know immunlogical techniques without undue experimentation.
In another embodiment, an antibody that recognizes a TNF-α receptor and does not transduce a signal can be made. Such an antibody can be selected using a screen which demonstrates that the antibody does not have one or more activities associated with the binding of TNF-α to a cell. b. Soluble TNF Receptor Molecules and Antibodies Thereto In another embodiment, a soluble form of a TNF receptor molecule can be used as a blockade or to inhibit TNF-α activity. Both type I and type II TNF-α receptors, e.g., TNF receptor I (TNFRI, ρ55) and TNFRII (ρ75), have been found to mediate biological effects of TNF-α. Accordingly, soluble forms of either or both receptors can be used to reduce circulating levels of TNF-α. Soluble TNF receptors are naturally produced and can be purified for use in the subject methods of can be made, e.g., by engineering a form of the molecule lacking the transmembrane and cytoplasmic domains. Exemplary forms of soluble TNF receptors are also known in the art and are commercially available. Antibodies to TNF-α receptors can be known or can be made using standard techniques, e.g., such as those described supra. Preferably, such anti-TNF receptor antibodies do not transduce a signal to a cell resulting in a TNF-α activity. In one embodiment, the anti-TNF-α receptor antibody is a commercially available (known) anti-TNF-α receptor antibody. r one embodiment, the agent is Etanercept. Etanercept is also referred to as p75 TNFR:Fc, TNF receptor fusion protein, TNF receptor fusion Fc protein, TNFR:Fc, sTNFR:Fc, tumor necrosis factor receptor p75 Fc fusion protein, soluble tumor necrosis factor receptor, and TNF receptor (p80) Fc fusion protein. Marketed as ENBREL®, and produced by hnmunex Corp., Seattle, WA, Etanercept is indicated for the treatment of rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis and ankylosing spondylitis. Etanercept is a soluble form of the TNF receptor which consists of two identical, soluble extracellular domains of the human p75 TNF receptor fused to the Fc fragment of human immunoglobulin Gl (IgGl). The Fc component of etanercept contains the CH2 domain, the CH3 domain and hinge region, but not the CHI domain of IgGl. Etanercept inhibits the binding of both TNF-α and TNF-β to cell surface receptors. The isolation and characterization of this drug is described in, for example, Eason et al, Transplantation 61:224 (1996); Eason et al, Transplantation 59:300 (1995); Fisher et al, New Eng. J. Med. 334:1697 (1996); Heilig et al, Clin. Invest. 70:22 (1992); Howard et al, Proc. Natl. Acad. Sci. USA 90:2335 (1993); Mohler et al, J. Immunol. 151:1548 (1993); Moreland et al, J. Rheumatol. 23:1849 (1996); Wooley et al, J. Immunol 151:6602 (1993).
hi another embodiment, the agent is LENERCEPT®. LENERCEPT® is also referred to as Ro-45-2081 and is produced by Roche. It is a recombinant soluble TNF receptor p55 (type I) fused to an immunoglobulin heavy chain IgGl (Renzetti, L. M., et al. J. Pharmacol. Exp. Ther. 278: 847-853, 1996; Abraham, E., et al 1997. J.A.M.A. 277: 1531-1538). In yet another embodiment, the agent is onercept (Sandborn, J. Best Pract Clin Gastroenterol. 2003 48:35). hi one embodiment, such molecules can be modified to improve their characteristics, e.g., to increase their half-life. For example, a recombinant C-terminal truncated form of the human soluble tumor necrosis factor receptor type I (sTNF-RI) has been produced in E. coli. This soluble receptor contains the first 2.6 of the 4 domains of an intact sTNF-RI molecule. A monoPEGylated form of this molecule has been produced using a 30 kD methoxyPEG aldehyde with approximately 85% selectivity for the N-terminal amino group. This molecule was shown to be less immunogenic in primates than the full length (4.0 domain) molecule or other versions of sTNF-RI which were either PEGylated at different sites or with different molecular weight PEGs. The 30 kD PEG also has a longer serum half-life to the molecule than lower molecular weight PEGs (Edwards, CK et al, 2003. Adv. Drug. Deliv. Rev. 55:1315). c. Nucleic Acid Molecules Another type of inhibitory compound that can be used to inhibit TNF-α and/or
TNFR activity is an antisense nucleic acid molecule that is complementary to a gene encoding TNF-α, TNF-α receptor, or intracellular signaling molecule, or to a portion of said gene, or a recombinant expression vector encoding such an antisense nucleic acid molecule. The use of antisense nucleic acid molecules to downregulate the expression of a particular protein in a cell is well known in the art (see e.g. , Weintraub, H. et al. , Antisense RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986; Askari, F.K. and McDonnell, W.M. (1996) N. Eng. J. Med. 334:316- 318; Bennett, M.R. and Schwartz, S.M. (1995) Circulation 92:1981-1993; Mercola, D. and Cohen, J.S. (1995) Cancer Gene Ther. 2:47-59; Rossi, JJ. (1995) Br. Med. Bull 51 :217-225; Wagner, R.W. (1994) Nature 372:333-335). An antisense nucleic acid molecule comprises a nucleotide sequence that is complementary to the coding strand of another nucleic acid molecule (e.g., an mRNA sequence) and accordingly is capable of hydrogen bonding to the coding strand of the other nucleic acid molecule. Antisense sequences complementary to a sequence of an mRNA can be complementary to a sequence found in the coding region of the mRNA, the 5' or 3' untranslated region of the mRNA or a region bridging the coding region and an untranslated region (e.g., at the junction of the 5' untranslated region and the coding region). Furthermore, an antisense nucleic acid can be complementary in sequence to a regulatory region of the gene
encoding the mRNA, for instance a transcription initiation sequence or regulatory element. Preferably, an antisense nucleic acid is designed so as to be complementary to a region preceding or spanning the initiation codon on the coding strand or in the 3' untranslated region of an mRNA. Given the known nucleotide sequences for the coding strands of TNF-α, TNF-α receptors, and TNF-α signaling molecules, antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of an mRNA, but more preferably is an ohgonucleotide which is antisense to only a portion of the coding or noncoding region of an mRNA. For example, the antisense ohgonucleotide can be complementary to the region surrounding the translation start site of an mRNA. An antisense ohgonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense ohgonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-αcetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-αdenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio- N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5- methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl- 2-thiouracil, 3-(3-αmino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. To inhibit expression in cells in culture, one or more antisense oligonucleotides can be added to cells in culture media. Known compositions and methods for the use of antisense can be found in, for example, US Patent 6228642 and US Patent 6080580.
Alternatively, an antisense nucleic acid can be produced biologically using an expression vector into which a cDNA has been subcloned in an antisense orientation (i.e., nucleic acid transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest). Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the expression of the antisense RNA molecule in a cell of interest, for instance promoters and/or enhancers or other regulatory sequences can be chosen which direct constitutive, tissue specific or inducible expression of antisense RNA. The antisense expression vector is prepared according to standard recombinant DNA methods for constructing recombinant expression vectors, except that the cDNA (or portion thereof) is cloned into the vector in the antisense orientation. The antisense expression vector can be in the form of, for example, a recombinant plasmid, phagemid or attenuated virus. The antisense expression vector is introduced into cells using a standard transfection technique.
The antisense nucleic acid molecules of the invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix. An example of a route of administration of an antisense nucleic acid molecule of the invention includes direct injection at a tissue site. Alternatively, an antisense nucleic acid molecule can be modified to target selected cells and then administered systemically. For example, for systemic administration, an antisense molecule can be modified such that it specifically binds to a receptor or an antigen expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecule to a peptide or an antibody which binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred. In yet another embodiment, the antisense nucleic acid molecule of the invention is an α-anomeric nucleic acid molecule. An α-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual β-units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15:6625-6641). The antisense nucleic acid molecule can also comprise a 2'-o- methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a
chimeric RNA-DNA analogue (Inoue et al. (1987) FEBSLett. 215:327-330). In still another embodiment, an antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334:585-591)) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of mRNAs. Known compositions and methods for ribozymes that are specific for TNF-α can be found in, for example, US Patent 5811300. A ribozyme having specificity for a nucleic acid can be designed based upon the nucleotide sequence of the cDNA. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in an mRNA. See, e.g., Cech et al. U.S. Patent No. 4,987,071 and Cech et al. U.S. Patent No. 5,116,742. Alternatively, mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel, D. and Szostak, J.W. (1993) Science 261:1411-1418. Alternatively, gene expression can be inhibited by targeting nucleotide sequences complementary to a regulatory region of, e.g., a TNF-α gene (e.g., an TNF-α promoter and/or enhancer) to form triple helical structures that prevent transcription of the gene in target cells. See generally, Helene, C. (1991) Anticancer Drug Des. 6(6):569-84; Helene, C. et al (1992) Ann. NY. Acad. Sci. 660:27-36; and Maher, L.J. (1992) Bioassays 14(12):807-15. In one embodiment, a nucleic acid molecule of the invention is a compoimd that mediates RNA interference, RNAi. RNA interfering agents include, but are not limited to, nucleic acid molecules including RNA molecules which are homologous to the target gene or genomic sequence, e.g., TNF-α or TNF-α receptor, or a fragment thereof, "short interfering RNA" (siRNA), "short hairpin" or "small hairpin RNA" (shRNA), and small molecules which interfere with or inhibit expression of a target gene by RNA inerference (RNAi). RNA interference is a post-transcriptional, targeted gene-silencing technique that uses double-stranded RNA (dsRNA) to degrade messenger RNA (mRNA) containing the same sequence as the dsRNA (Sharp, P.A. and Zamore, P.D. 287, 2431-2432 (2000); Zamore, P.D., et al. Cell 101, 25-33 (2000). Tuschl, T. et al. Genes Dev. 13, 3191-3197 (1999)). The process occurs when an endogenous ribonuclease cleaves the longer dsRNA into shorter, 21- or 22-nucleotide- long RNAs, termed small interfering RNAs or siRNAs. The smaller RNA segments then mediate the degradation of the target mRNA. The antisense RNA strand of RNAi can be antisense to at least a portion of the coding region of TNF-α or a TNF-α receptor or to at
least a portion of the 5' or 3' untranslated region of the TNF-α or TNF-α receptor gene. In one embodiment, siRNA duplexes are composed of 21-nt sense and 21-nt antisense strands, paired in a manner to have a 2-nt 3' overhang. In one embodiment, siRNA sequences with TT in the overhang. The target region can be, e.g., 50 to 100 nt downstream of the start codon, 3'-UTRs may also be targeted. In one embodiment, a 23- nt sequence motif AA(N19)TT (N, any nucleotide) can be searched for and hits with between about 30-70% G/C-content can be selected. If no suitable sequences are found, the search is extended using the motif NA(N21). SiRNAs are preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. SiRNAs are also available commercially from, e.g., Dharmacon, Xeragon Inc, Proligo, and Ambion. Kits for synthesis of RNAi are commercially available from, e.g. New England Biolabs and Ambion. For example, Ambion catalog ID Nos: 3925, 4021, and 4115 are specific for TNF-α. In one embodiment one or more of the chemistries known in the art for use in antisense RNA can be employed. d. Peptidic Compounds hi another embodiment, an inhibitory compound of the invention is a peptidic compound derived from TNF-α or a TNF-α receptor. As used herein, the term "peptide" includes relatively short chains of amino acids linked by peptide bonds. The term "peptidomimetic" includes compounds containing non-peptidic structural elements that are capable of mimicking or antagonizing peptides. Preferably, the inhibitory compound(s) comprises a portion of TNF-α or the TNF-α receptor (or a peptidomimetic thereof) that mediates interaction of the two molecules such that the peptidic compound competitively inhibits the interaction of TNF-α and its receptor. For example, peptidic compounds for TNF receptors have been described in, for example, European Patent Application EP 568 925. In another embodiment, site-directed mutagenesis of TNF-α can be performed to generate dominant negative constructs in which amino acid changes result in decreased receptor binding and cellular activation (See, e.g., Abraham, E. Sci STKE. 2003 1 PE51.) The peptidic compounds of the invention can be made by recombinant synthesis in cells or by chemical synthesis using standard peptide synthesis techniques. e. Other TNF- a Inhibitory Compounds Other inhibitory compounds include those that interfere with signal transduction mediated by TNF-α. (See, e.g., Rechless, J. et al. Immunology 2001. 103:244; Chandel et al. J. Immunol. 2000 165:1013; Manna SK. 2000. J. Immunol. 164:6509). In addition small molecule inhibitors that act on the TNF-α signaling cascade, e.g., by blocking the activity of p38, JNK, ERK kinases, or activation of the transcription factor NF-κB can be used. Additional compounds can be identified using screening assays
that select for such compounds, as described in detail below.
B. Prognostic and Diagnostic Assays One embodiment of the present invention provides a method of diagnosing whether a subject is at risk for or has had a spontaneous abortion that would benefit from treatment with a modulator of TNF-α activity, which includes determining the presence or level of TNF-α or IL-6 in a tissue, cell, or biological fluid sample from a subject (e.g., a pregnant subject). In another embodiment, the present invention provides a method of diagnosing a subject who is at increased risk for or has had a spontaneous abortion that would have benefited from modulation of TNF-α activity. For example, the method includes determining the presence or level of at least one of SOCSl, SOCS3 or IκBα in a tissue, cell, or biological fluid sample from a subject (e.g., a pregnant subject). In yet another embodiment of the present invention, prognostic methods are provided to determine whether a subject is at risk for having a spontaneous abortion that would benefit from modulation of TNF-α activity including detecting the presence or level of at least one of SOCSl, SOCS3 or IκBα, in a tissue, cell, or biological fluid sample from a subject (e.g., a pregnant subject). In another embodiment, the present invention provides a prognostic method of determining whether a subject is at risk for having a spontaneous abortion that would benefit from treatment with a compound that inhibits TNF-α activity, which includes detecting the presence or level of one of TNF-α or IL-6 in a tissue, cell, or biological fluid sample from a subject (e.g., a pregnant subject). The diagnostic and prognostic methods can further comprise detecting the presence or level of one or more immune cell surface molecules selected from the group consisting of CD69, CD25, CD44, CD45RB, CD62L, CD80, CD86, CD40, MHC class II, and CD54. In addition, the diagnostic and prognostic methods can further comprise detecting the presence or level of luteinizing hormone, luteinizing hormone receptor, 3β- hydroxysteroid dehydrogenase, and/or StAR protein or phosphorylated StAR protein (steroid acute regulatory protein; JBiol Chem. 1997, 272:32656), and, e.g., in the case of endangered species, prolactin receptor, prolactin, and 20α-hydroxysteroid dehydrogenase. The level of progesterone can also be determined in connection with a prognostic or diagnostic method of the invention. Preferably, these determinations are made utilizing maternal serum or blood. The presence or level of the above may also be determined from an amniotic fluid sample or from a tissue sample such as a chorionic villus sample or a placental bed sample.
In order to determine if the presence or level of TNF-α, IL-6, SOCSl, SOCS3, IκBα, CD69, CD25, CD44, CD45RB, CD62L, CD80, CD86, CD40, MHC class II, CD54, luteinizing hormone, luteinizing hormone receptor, 3β-hydroxysteroid dehydrogenase, and StAR protein and/or phosphorylated StAR protein, progesterone and/or leutinizing hormone receptor (and, e.g., in the case of endangered species, prolactin receptor, prolactin, and 20α-hydroxysteroid dehydrogenase) in a biological sample from a test subject is abnormal, the level of one or more of these molecules from the test subject is compared, for example, to the average level of those molecules determined from women who have had normal pregnancies. Standard techniques can be used for determining the presence or level of one or more of the above-identified molecules in a sample. For example, in one embodiment, a biological sample can be contacted with an agent capable of detecting protein or nucleic acid molecules (e.g., mRNA) such that the presence or level of a molecule can be determined by measuring protein molecules or nucleic acid molecules encoding a particular protein. One agent for detecting mRNA is a labeled or labelable nucleic acid probe capable of hybridizing specifically to the mRNA of a particular gene. The nucleic acid probe can be, for example, the full-length cDNA, or a portion thereof, such as an ohgonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and is sufficiently complimentary to specifically hybridize under stringent conditions to the particular mRNA. As used herein, the term "hybridizes under stringent conditions" is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% (65%, 70%, 75%, 80%, preferably 85%) identical to each other typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and can be found in sections 6.3.1-6.3.6 of Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989). A preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-65°C. Probes can be designed using the publicly available sequences, determined by searching Genbank using the following Gl numbers : gi:25952110 (human TNF-α nucleic acid) (SEQ ID NO. :30) (human TNF- α amino acid) (SEQ ID NO.:31); gi:23312372 (human TNFRI nucleic acid) (SEQ ID NO.:32) (human TNFRI amino acid) (SEQ ID NO.:33); gi:10834983 (human IL-6 nucleic acid) (SEQ ID NO.:34) (human IL-6 amino acid) (SEQ ID NO.:35); gi:10092618 (human IκBα nucleic acid) (SEQ ID NO.:36) (human IκBα amino acid) (SEQ ID NO.:37); gi:4507232 (human SOCSl nucleic acid) (SEQ ID No.:38) (human SOCSl amino acid) (SEQ ID No.:39); gi:45439351 (human SOCS3 nucleic acid) (SEQ ID No.:40) (human SOCS3 amino acid) (SEQ ID No.:41); gi:4504506 (human HSD3Blnucleic acid) (SEQ ID NO.:42) (human HSD3B1 amino
acid) (SEQ ID NO.:43); gi:4504508 (human HSD3B2 nucleic acid) (SEQ ID NO.:44) (human HSD3B2 amino acid) (SEQ ID NO.:45); gi:4502680 (human CD69 nucleic acid) (SEQ ID NO.:46) (human CD69 amino acid) (SEQ ID NO.:47); gi:4557666 (human CD25 nucleic acid) (SEQ ID NO.:48) (human CD25 amino acid) (SEQ ID NO.:49); gi:5713320 (Human CD62L nucleic acid) (SEQ ID NO.:50) (human CD62L amino acid) (SEQ ID NO.:51); gi:31377790 human CD80 nucleic acid) (SEQ ID NO.:52) (human CD80 amino acid) (SEQ ID NO.:53); gi:29029570 (human CD86, variant 2, nucleic acid) (SEQ ID NO.:54) (human CD86, variant 2, amino acid) (SEQ ID NO.:55); gi:29029571 (human CD86, variant 1, nucleic acid) (SEQ ID NO.:56) (human CD86, variant 1, amino acid) (SEQ ID NO.:57); gi:23312369 (human CD40, variant 1, nucleic acid) (SEQ JD NO.-.58) (human CD40, variant 1, amino acid) (SEQ ID NO.:59); gi:23312370 (human CD40, variant 2, nucleic acid) (SEQ ID NO.:60) (human CD40, variant 2, amino acid) (SEQ ID NO.:61); gi:4557877 (human CD54 nucleic acid) (SEQ ID NO.:62) (human CD54 amino acid) (SEQ ID NO.:63); gi:10834989 (human CD56, variant 1, nucleic acid) (SEQ ID NO.:64) (human CD56, variant 1, amino acid) (SEQ ID NO.:65); gi:41281936 (human CD56, variant 2, nucleic acid) (SEQ ID NO.:66) (human CD56, variant 2, amino acid) (SEQ ID NO.:67); gi:4557716 (human LHR nucleic acid) (SEQ ID NO.:68) (human LHR amino acid) (SEQ ID NO.:69); gi:15431286 (human LHB nucleic acid) (SEQ ID NO.:70) (human LHB amino acid) (SEQ DO NO.:71); gi:10800407 (human LHA nucleic acid) (SEQ ID NO.:72) (human LHA amino acid) (SEQ ID NO.:73); gi:40254435 (human PRLR nucleic acid) (SEQ ID NO.:74) (human PRLR amino acid) (SEQ ID NO.:75); gi:40254429 (human PRL nucleic acid) (SEQ ID NO.:76) (human PRL amino acid) (SEQ ID NO.:77); gi:4504500 (human HSD17B1 nucleic acid) (SEQ ID NO.:78) (human HSD17B1 amino acid) (SEQ ID NO.:79); gi:4504502 (human HSD17B2 nucleic acid) (SEQ ID NO.:80) (human
HSD17B2 amino acid) (SEQ ID NO.:81); gi:18765714(human HLA-DMA nucleic acid) (SEQ ID NO.:82) (human HLA-DMA amino acid) (SEQ ID NO.:83); gi:18641376 (human HLA-DMB nucleic acid) (SEQ ID NO.:84) (human HLA-DMB amino acid) (SEQ ID NO.:85); gi:34419636 (human HLA-DOA nucleic acid) (SEQ ID NO.:86) (human HLA-DOA amino acid) (SEQ ID NO.:87); gi:18641377 (human HLA-DOB nucleic acid) (SEQ ID NO.:88) (human HLA-DOB amino acid) (SEQ ID NO.:89); gi: 18641378 (human HLA-DRA nucleic acid) (SEQ ID NO.:90) (human HLA-DRA amino acid) (SEQ ID NO.:91); gi:24797073 (human HLA-DPA1 nucleic acid) (SEQ ID NO.:92) (human HLA-DPA1 amino acid) (SEQ ID NO.:93); gi:21361192 (human CD44 nucleic acid) (SEQ ID NO. :94) (human CD44 amino acid) (SEQ ID NO. :95); gi: 14714802 (human StAR nucleic acid) (SEQ ID NO:96) (human StAR amino acid) (SEQ ID NO.:97); gi:34280 (human leukocyte common antigen (CD45) (SEQ ID NO:98 nucleic acid) (human CD45 amino acid) (SEQ ID NO.:99); the entire contents of each of
these references is incorporated herein by reference. Sequences for any of the aforementioned genes from species other than humans may be obtained by searching GenBank using the desired gene name and the name of the desired organism. In a preferred embodiment, the presence or level of mRNA in a sample is determined using quantitative real-time RT-PCR, as described in the Examples. Gene specific primers and probes can be designed using the gene sequences described above by GenBank GI number. In one embodiment, the expression pattern of one or more genes may form part of a "gene expression profile" or "transcriptional profile" which may be then be used in such an assessment. "Gene expression profile" or "transcriptional profile," as used herein, includes the pattern of mRNA expression of one or more genes obtained for a given tissue or cell type under a given set of conditions. Gene expression profiles may be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR. hi another embodiment, the presence or level of a molecule of the invention can be detected using a labeled or labelable antibody, e.g., a labeled or radiolabeled antibody, capable of binding to that specific protein. Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab')2) can be used. The term "labeled or labelable", with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance (e.g., I ) to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin. Exemplary techniques employing antibodies include, e.g., enzyme linked immunosorbent assays (ELISAs), radioimmunoassays, Western blots, immunoprecipitations, immunofluorescence, and the like. As used herein, the term "biological sample" refers to a sample of biological material isolated from a subject, preferably a human subject, or present within a subject, preferably a human subject. The "biological material" can include, for example, tissues, tissue samples, tumors, tumor samples, cells, biological fluids, and purified and/or partially-purified biological molecules. Preferably, the biological material is maternal serum, maternal blood, amniotic fluid, a chorionic villus sample, or a placental bed sample. As used herein, the term "isolated", when used in the context of a biological sample, is intended to indicate that the biological sample has been removed from the subject. In one embodiment, a biological sample comprises a sample which
has been isolated from a subject and is subjected to a method of the present invention without further processing or manipulation subsequent to its isolation. In another embodiment, the biological sample can be processed or manipulated subsequent to being isolated and prior to being subjected to a method of the invention. For example, a sample can be refrigerated (e.g., stored at 4°C), frozen (e.g., stored at -20°C, stored at - 135°C, frozen in liquid nitrogen, or cryopreserved using any one of many standard cryopreservation techniques known in the art). Furthermore, a sample can be purified subsequent to isolation from a subject and prior to subjecting it to a method of the present invention. As used herein, the term "purified" when used in the context of a biological sample, is intended to indicate that at least one component of the isolated biological sample has been removed from the biological sample such that fewer components, and consequently, purer components, remain following purification. For example, a serum sample can be separated into one or more components using centrifugation techniques known in the art to obtain partially-purified sample preparation. Furthermore, it is possible to purify a biological sample such that substantially only one component remains. For example, a tissue or tumor sample can be purified such that substantially only the protein or mRNA component of the biological sample remains. Furthermore, it may be desirable to amplify a component of a biological sample such that detection of the component is facilitated. For example, the mRNA component of a biological sample can be amplified (e.g., by RT-PCR) such that detection of mRNA is facilitated. As used herein, the term "RT-PCR" ("reverse transcriptase-polymerase chain reaction") includes subjecting mRNA to the reverse transcriptase enzyme resulting in the production of DNA which is complementary to the base sequences of the mRNA. Large amounts of selected cDNA can then be produced via the polymerase chain reaction which relies on the action of heat-stable DNA polymerase for its amplification action. Alternative amplification methods include, but are not limited to, self sustained sequence replication (Guatelli, J.C. et al, 1990, Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D.Y. et al, 1989, Proc. Natl Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi, P.M. et al, 1988, Bio/Technology 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. Preferably, the detection methods of the present invention can be used to detect protein or nucleic acid molecules in a biological sample in vitro.
In one embodiment, a subject is identified using a prognostic or diagnostic method of the invention based on a statistically significant difference between the level of at least one of the molecules set forth above. In one embodiment, the level of expression of one or more of the molecules differs from the control level by at least about 1-10%. In another embodiment, the level of expression of one or more of the molecules differs from the control level by about 10-20%. In another embodiment, the level of expression of one or more of the molecules differs from the control level by about 30-40%. hi another embodiment, the level of expression of one or more of the molecules differs from the control level by about 40-50%. In another embodiment, the level of expression of one or more of the molecules differs from the control level by about 50-100%. In another embodiment, the level of expression of one or more of the molecules differs from the control level by about 100-200%. In another embodiment, the level of expression of one or more of the molecules differs from the control level by about 200-400%. (e.g., 2-fold to 4-fold), 4-fold to 10-fold, 10-fold to 100-fold, 100-fold or greater change in levels. As set forth in the instant examples, TNF-α is required for spontaneous abortion which is characterized by increased levels of expression of TNF-α, IL-6, SOCSl, SOCS3, IκBα, CD69, CD25, CD44, CD45RB, CD62L, CD80, CD86, CD40, MHC class II, CD54, 20α-hydroxysteroid dehydrogenase and decreased levels of luteinizing hormone, luteinizing hormone receptor, progesterone, 3β-hydroxysteroid dehydrogenase, and StAR protein and/or phosphorylated StAR protein, ,and, e.g., in the case of endangered species, prolactin receptor, prolactin, and 20α-hydroxysteroid dehydrogenase. Accordingly, the level of one or more of these molecules can be measured and compared with that of an appropriate control to identify a subject as one at risk for a spontaneous abortion that would benefit from treatment with an agent that inhibits TNF-α activity. It may also be desirable to use the methods of the present invention, as described above, to monitor the progress of treatment of a subject. For example, a subject (e.g., a human) may be undergoing treatment for spontaneous abortion using any one of the methods of treatment described herein. Treatment of the subject can then be modified (e.g., increased or decreased) depending on the results. The treatment monitoring methods can be used alone or in conjunction with other methods. The "desired effect" includes at least one effect capable of providing an indication of the ability of the treatment methods of the invention to treat a subject. For example, the desired effect may be modulation of the reproductive endocrine system. The desired effect may also be the prevention of spontaneous abortion or the ability of a subject to carry at least one embryo to term. In addition, the
desired effect may be a determination that the level of one or more of TNF-α, IL-6, SOCSl, SOCS3, IκBα, CD69, CD25, CD44, CD45RB, CD62L, CD80, CD86, CD40, MHC class II, CD54, luteinizing hormone, luteinizing hormone receptor, progesterone, 3β-hydroxysteroid dehydrogenase, StAR protein and/or phosphorylated StAR protein (and, e.g., in the case of endangered species, prolactin receptor, prolactin, and 20α- hydroxysteroid dehydrogenase) from a biological sample from the subject is normal or is normalizing. In one embodiment, the invention also pertains to kits for detecting the level or presence of one or more of TNF-α, IL-6, SOCSl, SOCS3, IκBα, CD69, CD25, CD44, CD45RB, CD62L, CD80, CD86, CD40, MHC class II, CD54, luteinizing hormone, luteinizing hormone receptor, progesterone, 3β-hydroxysteroid dehydrogenase, StAR protein and/or phosphorylated StAR protein (and, e.g., in the case of endangered species, prolactin receptor, prolactin, and 20α-hydroxysteroid dehydrogenase) in a biological sample. For example, the kit can comprise a labeled or labelable agent capable of detecting one or more of the molecules in a biological sample and a control sample or a chart showing normal and abnormal ranges for the molecule(s). The kit can further comprise an agent for reducing the activity of TNF-α. The kit can further comprise instructions for use. C. Screening Assays for the Identification of Novel Modulators of TNF-α Activity In one aspect, the present invention provides methods (also referred to herein as "screening assays") for identifying modulators, i.e., candidate or test compounds or agents (e.g., peptidomimetics, small molecules or other drugs) which modulate the reproductive-endocrine system, e.g., inhibit spontaneous abortion, by modulating, TNF-α activity. For example one or more of the following may be modulated: the production of TNF-α mRNA or polypeptide; a TNF-α activity (e.g., the ability to modulate IL-6, IkBa, SOCSl and/or SOCS3 mRNA or polypeptide production, modulation of progesterone levels, modulation of lymphoid activation markers, e.g., CD69, CD25, CD44, CD45RB, and CD62L, and/or modulation of costimulatory molecules, e.g., CD80, CD86, MHC class II, CD40, and CD54 on human dendritic cells; TNF-α-induced cytotoxicity (either in vitro or in vivo), TNF-α-induced cellular activation, TNF-α binding to TNF-α receptors). These assays are designed to identify compounds that modulate the function of TNF-α. Alternatively, such assays can be used for testing or optimizing the activity of such agents, hi one embodiment, such agents bind to or interact with intracellular or extracellular proteins that interact with TNF-α or transduce a TNF-α-mediated signal. For example, such agents may interact with TNFα or a TNF receptor.
The subject screening assays can measure the activity of TNF-α directly or can measure a downstream event controlled by modulation of TNF-α. In one embodiment, cell-based can be used to identify agents that modulate TNF-α expression or activity. For example, in one embodiment, the subject screening assays employ indicator compositions. These indicator compositions comprise the components required for performing an assay that detects and/or measures a particular event. The indicator compositions of the invention provide a reference readout and changes in the readout can be monitored in the presence of one or more test compounds. A difference in the readout in the presence and the absence of the compound indicates that the test compound is a modulator of the molecule(s) present in the indicator composition. The indicator composition used in the screening assay can be a cell that expresses a TNF-α polypeptide or a molecule in a signal transduction pathway involving TNF-α, e.g., a TNF receptor molecule or a second messenger or mediator of a TNF-α-mediated signal. For example, a cell that naturally expresses or has been engineered to express the protein by introducing into the cell an expression vector encoding the protein may be used. Preferably, the cell is a mammalian cell, e.g., a human cell. As set forth in more detail below, cell free assays can also be used to identify modulators of TNF-α activity. For example, the indicator composition can be a cell-free composition that includes the protein (e.g., a cell extract or a composition that includes e.g., either purified natural or recombinant protein). In another embodiment, an indicator composition comprises more than one polypeptide. For example, in one embodiment the subject assays are performed in the presence of TNF-α and a TNF receptor and/or a molecule in a signal transduction pathway involving TNF-α. Compounds that modulate the expression and/or activity of TNF-α identified using the assays described herein can be useful, e.g., for treating a subject that would benefit from modulation of the reproductive endocrine system, e.g., a subject at risk for a spontaneous abortion. The subject screening assays can be performed in the presence or absence of other agents, i one embodiment, the subject assays are performed in the presence of an agent that provides a stimulatory signal to a cell. For example, in one embodiment, assays are performed in the presence of an agent that delivers or mimics a T cell receptor-mediated signal (e.g., (e.g., an antibody that recognizes the T cell receptor or an associated molecule, e.g., CD3, CD28, CD40 or PMA and Ionomycin). In one embodiment, secondary assays can be used to confirm the activity of an agent. For example, compounds identified in a primary screening assay can be used in a secondary screening assay to determine whether the compound affects the
reproductive endocrine function, e.g., spontaneous abortion. Accordingly, in another aspect, the invention pertains to a combination of two or more of the assays described herein. For example, a modulating agent can be identified using a cell-based or a cell- free assay, and the ability of the agent to modulate the activity of TNF-α can be confirmed in vivo, e.g., in an animal such as, for example, in an animal model of a disorder, e.g., reproductive-endocrine function, e.g., spontaneous abortion, as described herein. For example, in one aspect, the invention pertains to a mouse that is an animal model of spontaneous abortion. The invention provides a mouse, e.g., an inbred mouse, and/or a transgenic mouse treated with an agent, e.g., an anti-CD40 antibody such that the reproductive endocrine system of the mouse is modulated, e.g., spontaneous abortion is enhanced. This animal model of spontaneous abortion is characterized by increased spontaneous abortion, relative to a wild-type or untreated mice. The phenotype of the mice can further be characterized by: an increase in the level of mRNA and polypeptide of TNF-α, IL-6 IkBa, SOCSl and SOCS3. hi addition, these animals exhibit upmodulation of various immune cell surface markers, e.g., CD69, CD25, CD44, CD45RB, CD62L, CD80, CD86, CD40, MHC class U, and CD54, upmodulation of 20α-hydroxysteroid dehydrogenase and a reduction in steridiogenic hormones, e.g., luteinizing hormone, luteinizing hormone receptor, progesterone, 3β-hydroxysteroid dehydrogenase, StAR protein and/or phosphorylated StAR protein (steroid acute regulatory protein; J Biol Chem. 1997, 272:32656) (and, e.g., in the case of endangered species, prolactin receptor, prolactin, and 20α-hydroxysteroid dehydrogenase) levels relative to an untreated mouse. In the screening method, cells from the animal model of spontaneous abortion of the present invention can be contacted with a test compound and a biological response regulated by TNF-α can be measured. Modulation of spontaneous abortion (as compared to an appropriate control such as, for example, untreated animals) identifies or confirms a test compound as a modulator of the response, r another embodiment, cells from the animal are isolated and contacted with the test compound ex vivo to identify a test compound that modulates a response of spontaneous abortion, e.g., modulation of one or more of the molecules described above. The test compound can be administered to an animal model of spontaneous abortion of the present invention as a pharmaceutical composition. Such compositions typically comprise the test compound and a pharmaceutically acceptable carrier. As used herein the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds, isotonic and absorption delaying compounds, and the like, compatible with pharmaceutical
administration. The use of such media and compounds for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or compound is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions. Pharmaceutical compositions are described in more detail below. Additionally, gene expression patterns may be utilized to assess the ability of a compound to modulating the reproductive endocrine system. For example, the expression pattern of one or more genes may form part of a "gene expression profile" or "transcriptional profile" which may be then be used in such an assessment. "Gene expression profile" or "transcriptional profile", as used herein, includes the pattern of mRNA expression obtained for a given tissue or cell type under a given set of conditions. Gene expression profiles may be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR. Gene expression profiles may be characterized for known states within the cell- and/or animal-based model systems. Subsequently, these known gene expression profiles may be compared to ascertain the effect a test compound has to modify such gene expression profiles, and to cause the profile to more closely resemble that of a more desirable profile. Moreover, a modulator of TNF-α and/or TNFR expression and/or activity identified as described herein (e.g., an antisense nucleic acid molecule, or a specific antibody, or a small molecule) may be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such a modulator. Alternatively, a modulator identified as described herein may be used in an animal model to determine the mechanism of action of such a modulator. In one embodiment, the screening assays of the invention are high throughput or ultra high throughput (e.g., Fernandes PB, Curr Opin Chem Biol. 1998 2:597; Sundberg SA, Curr Opin Biotechnol. 2000, 11:47). Exemplary cell based and cell free assays of the invention are described in more detail below. 1. Cell Based Assays In one embodiment, an indicator composition of the invention may be a cells that expresses TNF-α and/or TNFR. For example, a cell that naturally expresses endogenous polypeptide, or, a cell that has been engineered to express one or more exogenous polypeptides, e.g., by introducing into the cell an expression vector encoding the protein may be used in a cell based assay. The cells used in the instant assays can be eukaryotic or prokaryotic in origin. For example, in one embodiment, the cell is a bacterial cell. In another embodiment, the cell is a fungal cell, e.g., a yeast cell. In another embodiment, the cell
is a vertebrate cell, e.g., an avian or a mammalian cell (e.g., a murine cell, or a human cell). In a preferred embodiment, the cell is a human cell. hi one embodiment, a cell is capable of producing progesterone, SOCSl, SOCS3, IL-6 and/or IκBα (either naturally or upon expression of introduction of nucleic acid sequences). For example, a corpus leuteal cell is capable of producing SOCSl, SOCS3, IL-6 and/or IκBα. Recombinant expression vectors that may be used for expression of polypeptides are known in the art. For example, the cDNA is first introduced into a recombinant expression vector using standard molecular biology techniques. A cDNA can be obtained, for example, by amplification using the polymerase chain reaction (PCR) or by screening an appropriate cDNA library. Following isolation or amplification of a cDNA molecule encoding the gene of interest, e.g., TNF-α and/or TNFR, the DNA fragment is introduced into an expression vector. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" or simply "expression vectors", hi general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions. Exemplary recombinant expression vectors comprise a nucleic acid molecule in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression and the level of expression desired, which is operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a
manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell, those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences) or those which direct expression of the nucleotide sequence only under certain conditions (e.g., inducible regulatory sequences). In one embodiment, e.g., for measuring the effect of a compound on expression of TNF-α and/or TNFR, the expression of the gene is controlled by naturally-occurring regulatory elements. When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma virus, adenovirus, cytomegalovirus and Simian Virus 40. Non-limiting examples of mammalian expression vectors include pCDM8 (Seed, B., (1987) Nature 329:840) and pMT2PC (Kaufman et al (1987), EMBO J. 6:187-195). A variety of mammalian expression vectors carrying different regulatory sequences are commercially available. For constitutive expression of the nucleic acid in a mammalian host cell, a preferred regulatory element is the cytomegalovirus promoter/enhancer. Moreover, inducible regulatory systems for use in mammalian cells are known in the art, for example systems in which gene expression is regulated by heavy metal ions (see e.g., Mayo et al. (1982) Cell 29:99-108; Brinster et al. (1982) Nature 296:39-42; Searle et al. (1985) Mol. Cell. Biol. 5:1480-1489), heat shock (see e.g., Nouer et al. (1991) in Heat Shock Response, e.d. Nouer, L. , CRC, Boca Raton , FL, ppl67-220), hormones (see e.g., Lee et al. (1981) Nature 294:228-232; Hynes et al. (1981) Proc. Natl. Acad. Sci. USA 78:2038-2042; Klock et al (1987) Nature 329:734- 736; Israel & Kaufman (1989) Nucl. Acids Res. 17:2589-2604; and PCT Publication No. WO 93/23431), FK506-related molecules (see e.g., PCT Publication No. WO 94/18317) or tetracychnes (Gossen, M. and Bujard, H. (1992) Proc. Natl. Acad. Sci. USA 89:5547- 5551; Gossen, M. et al. (1995) Science 268:1766-1769; PCT Publication No. WO 94/29442; and PCT Publication No. WO 96/01313). Still further, many tissue-specific regulatory sequences are known in the art, including the albumin promoter (liver- specific; Pinkert et al. (1987) Genes Dev. 1 :268-277), lymphoid-specifϊc promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBOJ. 8:729-733) and immunoglobulins
(Banerji et al. (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477), pancreas-specific promoters (Edlund et al. (1985) Science 230:912-916) and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No.
264,166). Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the α- fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546). Vector DNA may be introduced into mammalian cells via conventional transfection techniques. As used herein, the various forms of the term "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into mammalian host cells, including calcium phosphate co- precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transfecting host cells can be found in Sambrook et al (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory manuals. For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on a separate vector from that encoding the gene of interest or, more preferably, on the same vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die). In one embodiment, within the expression vector coding sequences are operatively linked to regulatory sequences that allow for constitutive expression of the molecule in the indicator cell (e.g., viral regulatory sequences, such as a cytomegalovirus promoter/enhancer, may be used). Use of a recombinant expression vector that allows for constitutive expression of the genes in the indicator cell is preferred for identification of compounds that enhance or inhibit the activity of the molecule. In an alternative embodiment, within the expression vector the coding sequences are operatively linked to regulatory sequences of the endogenous gene (i.e., the promoter regulatory region derived from the endogenous gene). Use of a recombinant expression vector in which expression is controlled by the endogenous regulatory sequences is preferred for identification of compounds that enhance or inhibit
the transcriptional expression of the molecule. For example, an indicator cell can express (or can be transfected with an expression vector comprising a nucleic acid molecule encoding TNF-α and/or TNFR and any appropriate regulatory elements) incubated in the presence and in the absence of a test compound, and the effect of the compound on the expression of the molecule can be determined. hi another embodiment, the effect of the compound on one or more activities of TNF-α can be measured according to standard techniques. Activity can be a direct activity, such as an association with or binding to a TNF-α receptor protein. Alternatively, activity may be a more downstream event associated with binding to a receptor and initiating signal transduction, such as, for example, generation of second messengers, or a biological effect on a cell or on an organism occurring as a result of the signaling cascade triggered by that interaction. For example, downstream activities of TNF-α described herein include the ability to: modulate the reproductive-endocrine system, e.g., inhibit spontaneous abortion, modulate cytokine production, e.g., IL-6, modulate IkBa, SOCSl and/or SOCS3 mRNA or polypeptide production, and/or modulate progesterone production. Compounds that modulate expression and/or activity of TNF-α or a molecule whose expression is regulated by TNF-α may be identified using various "read-outs." For example, a variety of reporter genes are known in the art and are suitable for use in the screening assays of the invention. As used herein, the term "reporter gene" includes genes that express a detectable gene product, which may be RNA or protein. Preferred reporter genes are those that are readily detectable. The reporter gene may also be included in a construct in the form of a fusion gene with a gene that includes desired transcriptional regulatory sequences or exhibits other desirable properties. Examples of reporter genes include, but are not limited to CAT (chloramphenicol acetyl transferase) (Alton and Vapnek (1979), Nature 282: 864-869) luciferase, and other enzyme detection systems, such as beta-galactosidase; firefly luciferase (deWet, et al. (1987), Mol. Cell. Biol. 7:725-737); bacterial luciferase (Engebrecht and Silverman (1984), Proc. Natl. Acad. Sci., USA 1: 4154-4158; Baldwin, et al. (1984), Biochemistry 23: 3663-3667); alkaline phosphatase (Toh, et al. (1989) Eur. J. Biochem. 182: 231-238, Hall, et al. (1983) J. Mol. Appl. Gen. 2: 101), human placental secreted alkaline phosphatase (Cullen and Malim (1992) Methods in Enzymol 216:362-368) and green fluorescent protein (U.S. Patent No. 5,491,084; WO 96/23898). Standard methods for measuring the activity of these gene products are known in the art.
To determine whether a test compound modulates expression, in vitro transcriptional assays can be performed. For example, mRNA or protein expression can be measured using methods well known in the art. For instance, one or more of Northern blotting, slot blotting, ribonuclease protection, quantitative RT-PCR, or microarray analysis (e.g., Current Protocols in Molecular Biology (1994) Ausubel FM et al, eds., John Wiley & Sons, Inc.; Freeman WM et al, Biotechniques 1999 26:112; Kallioniemi et al. 2001 Ann. Med. 33:142; Blohm and Guiseppi-Eli 2001 Curr Opin Biotechnol. 12:41) may be used to confirm that expression is modulated in cells treated with a modulating agent. In another example, agents that modulate the expression of a TNF-α and/or TNFR can be identified by operably linking the upstream regulatory sequences (e.g., the full length promoter and enhancer) of a TNF-α and/or TNFR or a gene whose expression is regulated by TNF-α to a reporter gene such as chloramphenicol acetyltransferase (CAT) or luciferase and introducing in into host cells. The ability of an agent to modulate the expression of the reporter gene product as compared to control cells (e.g., not exposed to the compound) can be measured. As used interchangeably herein, the terms "operably linked" and "operatively linked" are intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleotide sequence in a host cell (or by a cell extract). Regulatory sequences are art-recognized and can be selected to direct expression of the desired protein in an appropriate host cell. The term regulatory sequence is intended to include promoters, enhancers, polyadenylation signals and other expression control elements. Such regulatory sequences are known to those skilled in the art and are described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transfected and/or the type and/or amount of protein desired to be expressed. In one embodiment, the level of expression of the reporter gene in the indicator cell in the presence of the test compound is higher than the level of expression of the reporter gene in the indicator cell in the absence of the test compound and the test compound is identified as a compound that stimulates the expression of a cytokine gene. In another embodiment, the level of expression of the reporter gene in the indicator cell in the presence of the test compound is lower than the level of expression of the reporter gene in the indicator cell in the absence of the test compound and the test compound is identified as a compound that inhibits the expression of a cytokine gene.
In another embodiment, protein expression may be measured. For example, standard techniques such as Western blotting, ELISA, or in situ detection can be used. In one embodiment, the ability of a compound to modulate expression of TNF- α or a cytokine whose expression is regulated by TNF-α can be determined by measuring the intracellular concentration of a cytokine (using intracellular cytokine FACS). In one embodiment, the ability of a compound to modulate cytokine production can be determined by measuring the concentration of the cytokine secreted by a cell. For example, IL-6 can be measured by measuring the effect of the supernatant on an indicator cell line (e.g., on proliferation of the indicator cell line), or, e.g., in an ELISA assay. Standard methods for detecting mRNA of interest, such as reverse transcription-polymerase chain reaction (RT-PCR) and Northern blotting, are known in the art. Standard methods for detecting protein secretion in culture supernatants, such as enzyme linked immunosorbent assays (ELISA), are also known in the art. Proteins can also be detected using antibodies, e.g., in an immunoprecipitation reaction or for staining and FACS analysis. In one embodiment a downstream effect of modulation of cytokine production, e.g., the effect of a compound on cell cytotoxicity, e.g., immune cells, may be used as an indicator of modulation of TNF-α activity. For example, apoptosis can be monitored by measuring cytochrome C release from mitochondria during cell apoptosis and can be detected, e.g., plasma cell apoptosis (as described in, for example, Bossy- Wetzel E. et al. (2000) Methods in Enzymol. 322:235-42). Other exemplary assays include: cytofluorometric quantitation of nuclear apoptosis induced in a cell-free system (as described in, for example, Lorenzo H.K. et al. (2000) Methods in Enzymol. 322:198- 201); apoptotic nuclease assays (as described in, for example, Hughes F.M. (2000)
Methods in Enzymol. 322:47-62); analysis of apoptotic cells, e.g., apoptotic plasma cells, by flow and laser scanning cytometry (as described in, for example, Darzynkiewicz Z. et al. (2000) Methods in Enzymol. 322:18-39); detection of apoptosis by annexin V labeling (as described in, for example, Bossy- Wetzel E. et al. (2000) Methods in Enzymol. 322:15-18); transient transfection assays for cell death genes (as described in, for example, Miura M. et al. (2000) Methods in Enzymol. 322:480-92); and assays that detect DNA cleavage in apoptotic cells, e.g., apoptotic plasma cells (as described in, for example, Kauffman S.H. et al. (2000) Methods in Enzymol 322:3-15). Apoptosis can also be measured by propidium iodide staining or by TUNEL assay. In another embodiment, the transcription of genes associated with a cell signaling pathway involved in apoptosis (e.g., JNK) can be detected using standard methods.
In another embodiment, mitochondrial inner membrane permeabihzation can be measured in intact cells by loading the cytosol or the mitochondrial matrix with a die that does not normally cross the inner membrane, e.g., calcein (Bernardi et al. 1999. Eur. J. Biochem. 264:687; Lemasters, J., J. et al. 1998. Biochem. Biophys. Acta 1366:177. In another embodiment, mitochondrial inner membrane permeabihzation can be assessed, e.g., by determining a change in the mitochondrial inner membrane potential (ΔΨm). For example, cells can be incubated with lipophilic cationic fluorochromes such as DiOC6 (Gross et al. 1999. Genes Dev. 13:1988) (3,3'dihexyloxacarbocyanine iodide) or JC-1 (5,5',6,6'-tetrachloro-l,l', 3,3'- tetraethylbenzimidazolylcarbocyanine iodide). These dyes accumulate in the mitochondrial matrix, driven by the Ψm . Dissipation results in a reduction of the fluorescence intensity (e.g., for DiOC6 (Gross et al. 1999. Genes Dev. 13:1988) or a shift in the emission spectrum of the dye. These changes can be measured by cytofluorometry or microscopy. The ability of the test compound to modulate binding of TNF-α or a TNF receptor or other TNF-α-interacting polypeptide can also be determined. For example, binding can be detected by determining the ability of the molecules to be coimmunoprecipitated or by coupling the target molecule (or TNF-α) with a detectable label (e.g., a radioisotope or enzymatic label) such that binding of the molecules can be determined, e.g., by detecting the labeled TNF-α target molecule in a complex. Determining the ability of the test compound to bind to TNF-α can also be accomplished, for example, by coupling the compound with a radioisotope or enzymatic label such that binding of the compound can be determined by detecting the labeled compound in a complex. For example, targets can be labeled with 125 j? 35§5 14c, or ^H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, compounds can be labeled, e.g., with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product. In another embodiment, fluorescence technologies can be used, e.g., fluorescence polarization, time-resolved fluorescence, and fluorescence resonance energy transfer (Selvin PR, Nat. Struct. Biol. 2000 7:730; Hertzberg RP and Pope AJ, Crurr Opin Chem Biol. 2000 4:445). It is also within the scope of this invention to determine the ability of a compound to interact with TNF-α or the effect of a compound on the interaction of TNF-α with a TNF-α interacting molecule without the labeling of any of the interactants. For example, a microphysiometer may be used to detect the interaction of a compound with a TNF-α without the labeling of either the compound or the molecule
(McConnell, H. M. et al. (1992) Science 257:1906-1912). As used herein, a "microphysiometer" (e.g., Cytosensor) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate may be used as an indicator of the interaction between compounds. 2. Cell-free assays Alternatively, the indicator composition can be a cell-free composition that includes a TNF-α- and/or a TNF-α-interacting molecule (e.g., TNF-α receptor protein) e.g., a cell extract from a cell expressing the protein or a composition that includes purified either natural or recombinant protein. In one embodiment, the indicator composition is a cell free composition. Polypeptides expressed by recombinant methods in a host cells or culture medium can be isolated from the host cells, or cell culture medium using standard methods for protein purification. For example, ion-exchange chromatography, gel filtration chromatography, ulfrafiltration, elecfrophoresis, and iπrmunoaffinity purification with antibodies may be used to produce a purified or semi-purified protein that may be used in a cell free composition. An "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. Alternatively, a lysate or an extract of cells expressing the protein of interest can be prepared for use as cell-free composition. Cell extracts with the appropriate post-translation modifications of proteins can be prepared using commercially available resources found at, for example Promega, Inc., and include but are not limited to reticulocyte lysate, wheat germ extract and E. coli S30 extract. In one embodiment, compounds that specifically modulate the interaction of TNF-α with a target molecule to which TNF-α binds, e.g., a TNF receptor. Suitable assays are known in the art that allow for the detection of protein-protein interactions (e.g., immunoprecipitations and the like). By performing such assays in the presence and absence of test compounds, these assays may be used to identify compounds that modulate the interaction of TNF-α with a target molecule. In the methods of the invention for identifying test compounds that modulate an interaction between a TNF-α-interacting protein and TNF-α, the complete TNF-α protein may be used in the method, or, alternatively, only portions of the protein may be used. For example, binding of TNF-α or a TNF-α-interacting polypeptide can be determined either directly or indirectly as described above. Determining the ability
of TNF-α or TNFR protein to bind to a test compound can also be accomplished using a technology such as real-time Biomolecular Interaction Analysis (BIA) (Sjolander, S. and Urbaniczky, C. (1991) Anal. Chem. 63:2338-2345; Szabo et al. (1995) Curr. Opin. Struct. Biol. 5:699-705). As used herein, "BIA" is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore).
Changes in the optical phenomenon of surface plasmon resonance (SPR) may be used as an indication of real-time reactions between biological molecules. In one embodiment of the above assay methods, it may be desirable to immobilize either TNF-α or a TNF-α-interacting polypeptide for example, to facilitate separation of complexed from uncomplexed forms of one or both of the proteins, or to accommodate automation of the assay. Binding to a surface can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided in which a domain that allows one or both of the proteins to be bound to a matrix is added to one or more of the molecules. For example, glutathione-S-transferase fusion proteins or glutathione-S-transferase/target fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined with the test compound or the test compound and either the non-adsorbed target protein or TNF-α protein, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtitre plate wells are washed to remove any unbound components, the matrix is immobilized in the case of beads, and complex formation is determined either directly or indirectly, for example, as described above. Alternatively, the complexes can be dissociated from the matrix, and the level of binding or activity determined using standard techniques. Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention. For example, proteins may be immobilized utilizing conjugation of biotin and sfreptavidin. Biotinylated protein or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, IL), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which are reactive with protein or target molecules but which do not interfere with binding of the protein to its target molecule can be derivatized to the wells of the plate, and unbound target or TNF-α protein is trapped in the wells by antibody conjugation. Methods for detecting such complexes, in addition to those described above for the
GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with TNF-α or a TNF-α-interacting polypeptide.
3. Jest Compounds A variety of test compounds can be evaluated using the screening assays described herein. The term "test compound" includes any reagent or test agent which is employed in the assays of the invention and assayed for its ability to influence the production, expression and/or activity of TNF-α. More than one compound, e.g., a plurality of compounds, can be tested at the same time in a screening assay. The term "screening assay" preferably refers to assays which test the ability of a plurality of compounds to influence the readout of choice rather than to tests which test the ability of one compound to influence a read-out. Preferably, the subject assays identify compounds not previously known to have the effect that the screening assay detects. In one embodiment, high throughput screening may be used to assay for the activity of a compound. In certain embodiments, the compounds to be tested can be derived from libraries (i.e., are members of a library of compounds). While the use of libraries of peptides is well established in the art, new techniques have been developed which have allowed the production of mixtures of other compounds, such as benzodiazepines (Bunin, et al. (1992). J. Am. Chem. Soc. 114:10987; DeWitt et al. (1993). Proc. Natl. Acad. Set, USA 90:6909) peptoids (Zuckermann. (1994). J. Med. Chem. 37:2678) oligocarbamates (Cho, et al (1993). Science.26 : 1303), and hydantoins (DeWitt et al. supra). An approach for the synthesis of molecular libraries of small organic molecules with a diversity of 104-105 as been described (Carell, et al. (1994). Angew. Chem. Int. Ed. Engl 33:2059; Carell, et al. (1994) Angew. Chem. Int. Ed. Engl 33:2061). The compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring de-convolution, the 'one-bead one-compound' library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries ofcompounds (Lam, K.S. (1997) Anticancer Drug Des. 12:145). Other exemplary methods for the synthesis of molecular libraries can be found in the art, for example in: Erb, et al. (1994). Proc. Natl. Acad. Set, USA 91:11422; Horwell, et al (1996) Immunopharmacology 33:68; and in Gallop, et al. (1994) J. Med. Chem. 37:1233. Exemplary compounds which can be screened for activity include, but are not limited to, peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries.
The term "small molecule" is a term of the art and includes molecules that are less than about 1000 molecular weight or less than about 500 molecular weight. In one embodiment, small molecules do not exclusively comprise peptide bonds. In another embodiment, small molecules are not oligomeric. Exemplary small molecule compounds which can be screened for activity include, but are not limited to, peptides, peptidomimetics, nucleic acids, carbohydrates, small organic molecules (e.g., polyketides) (Cane, et al. 1998. Science 282:63), and natural product extract libraries. In another embodiment, the compounds are small, organic non-peptidic compounds, a further embodiment, a small molecule is not biosynthetic. For example, a small molecule is preferably not itself the product of transcription or translation. Candidate/test compounds include, for example, 1) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e.g., Lam, K.S. et al. (1991) Nature 354:82-84; Houghten, R. et al. (1991) Nature 354:84-86) and combinatorial chemistry-derived molecular libraries made of D- and/or L- configuration amino acids; 2) phosphopeptides (e.g., members of random and partially degenerate, directed phosphopeptide libraries, see, e.g., Songyang, Z. et al.
(1993) Ce/ 72:767-778); 3) antibodies (e.g., antibodies (e.g., intracellular, polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies as well as Fab, F(ab')2, Fab expression library fragments, and epitope-binding fragments of antibodies); 4) small organic and inorganic molecules (e.g., molecules obtained from combinatorial and natural product libraries); 5) enzymes (e.g., endoribonucleases, hydrolases, nucleases, proteases, synthatases, isomerases, polymerases, kinases, phosphatases, oxido-reductases and ATPases), and 6) mutant forms of molecules (e.g., dominant negative mutant forms of TNF-α or a TNF-α-interacting protein). The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring de-convolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K.S. (1997) Anticancer Drug Des. 12:145). Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci, U.S.A. 90:6909; Erb, et al. (1994) Proc. Natl. Acad. Sci., USA 91:11422; Zuckermann, et al.
(1994) J. Med. Chem. 37:2678; Cho, et al. (1993) Science 261:1303; Carrell, et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell, et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop, et al. (1994) J. Med. Chem. 37:1233.
Libraries of compounds can be presented in solution (e.g., Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner USP 5,223,409), spores (Ladner USP '409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci., USA 89:1865-1869) or phage (Scott and Smith (1990) Science 249:386-390; Devlin (1990) Science 249:404- 406; Cwirla et al. (1990) Proc. Natl Acad. Sci., 87:6378-6382; Felici (1991) J. Mol Biol. 222:301-310; Ladner supra.). Compounds identified in the subject screening assays may be used, e.g., in methods of modulating reproductive endocrine function, inhibiting spontaneous abortion. It will be understood that it may be desirable to formulate such compound(s) as pharmaceutical compositions (described supra) prior to contacting them with cells. Once a test compound is identified that directly or indirectly modulates TNF-α using a method known in the art or one of the variety of methods described herein, the selected test compound (or "compound of interest") can then be further evaluated for its effect on cells or animals, and determining the effect of the compound of interest, as compared to an appropriate confrol. The instant invention also pertains to compounds identified in the subject screening assays.
III. Administration of Agents Administration of the compositions and/or agents described herein can be in any pharmacological form that includes a therapeutically active amount of an agent and optionally a pharmaceutically acceptable carrier. Administration of a therapeutically active amount of the subject agents and/or compositions is defined as an amount effective, at dosages and for periods of time necessary to modulate the reproductive endocrine system, e.g., to inhibit spontaneous abortion, preferably an amount which enables a subject to carry one or more embryos to term. A therapeutically active amount of an agent or composition may vary according to factors such as the age, and weight of the individual, and whether or not the individual has had a previous spontaneous abortion. Such an amount can be readily determined by one of ordinary skill in the art. The optimal course of administration of the agents and/or compositions may also vary depending upon the subject to be treated. For example in one embodiment, an agent which modulates the reproductive endocrine system, e.g., inhibits spontaneous abortion, is administered prior to fertilization. In another embodiment, the agent can be administered at the time of implantation (e.g., natural or assisted implantation) or at the time of embryo transfer. In another embodiment, the agent can be administered after implantation of the embryo into the uterine wall. In one
embodiment, an agent which modulates the reproductive endocrine system, e.g., inhibits spontaneous abortion, is administered throughout the course of the pregnancy, e.g., beginning prior to fertilization, prior to implantation, or at about the time of implantation, and, e.g., ending when the risk of spontaneous abortion has decreased or can be administered up to the time of delivery. In one embodiment an agent that modulates the reproductive endocrine system, e.g., inhibits spontaneous abortion, is administered prior to, during, and/or after a procedure employed to promote fertility or pregnancy. For example, in one embodiment, an egg or a fertilized embryo is suspended in a composition comprising an agent that modulates the reproductive endocrine system, e.g., inhibits spontaneous abortion, and is transferred into the uterus of a subject. In another embodiment, an agent that modulates the reproductive endocrine system, e.g., inhibits spontaneous abortion, is administered to a subject, e.g., is applied topically in the uterus prior to and/or after embryo transfer. In one embodiment, an agent that modulates the reproductive endocrine system, e.g., inhibits spontaneous abortion, is administered systemically instead of or in addition to being administered directly to the uterus or vaginally. A dosage regime may be adjusted to provide the optimum therapeutic response for each subject without undue experimentation. An agent that modulates the reproductive endocrine system, e.g., inhibits spontaneous abortion, can be administered in the form of a pharmaceutical composition suitable for administration. Such compositions typically comprise the agent and a pharmaceutically acceptable carrier. As used herein the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, they may be used in the instant composition. Supplementary active compounds can also be incorporated into the compositions. A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. For example, solutions or suspensions used for parenteral, intradermal, topical, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The
parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. In one embodiment an agent which modulates the reproductive endocrine system, e.g., inhibits spontaneous abortion, is formulated into a suppository for vaginal use. These can be prepared by mixing the agent with a suitable non-irritating carrier which is solid at room temperature but liquid at rectal temperature and therefore will melt in the vagina to release the drug. Such materials include cocoa butter, beeswax, polyethylene glycols, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the vaginal cavity and release the active agent. Compositions which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams, films, or spray compositions containing such carriers as are known in the art to be appropriate. The carrier employed in the should be compatible with vaginal administration. Combinations can be, e.g., in solid, semi-solid and liquid dosage forms, such as douches, foams, films, ointments, creams, balms, gels, salves, pastes, slurries, vaginal suppositories, or sexual lubricants. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water,
Cremophor EL^M (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition will be sterile and should be fluid to the extent that easy syringability exists. Preferably, it will be stable under the conditions of manufacture and storage and will be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the agent in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Oral compositions generally include an inert diluent or an edible carrier.
They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of
active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active agent or composition for the freatment of individuals. Appropriate dosages can readily be determined by one of ordinary skill in the art. In one embodiment, the compositions and/or agents described herein are administered to a subject at a dose level in the range of 1 mg to 300 mg per dose for as many doses as determined appropriate by one of ordinary skill in the art. A single dose may be administered or multiple doses may be administered. hi one embodiment, the compositions and/or agents described herein are administered subcutaneously to a subject at a dose level in the range of 1 mg to 300 mg per dose, e.g., with a dosage interval ranging from 1 day to 1 month. r another embodiment, the compositions and/or agents described herein are administered intramuscularly to a subject at a dose level in the range of 1 mg to 300 mg per dose, e.g., with a dosage interval ranging from 1 day to 1 month. hi another embodiment, the compositions and/or agents described herein are administered intravenously to a subject at a dose level in the range of 1 mg to 300 mg per dose, e.g., with a dosage interval ranging from 1 day to 1 month. In another embodiment, an anti-TNF-α antibody is administered intravenously at 3mg kg-10mg/kg every 4-8 weeks), preferably 5mg/kg every 2-6 weeks. In one embodiment, an anti-TNF-α antibody is administered subcutaneously with a dose of 40 mg every other week. In one embodiment, an anti-TNF-α receptor antibody is administered subcutaneously with a dose of 50 mg every week. In another embodiment, an anti-TNF-α receptor antibody is administered subcutaneously with a dose of 25 mg twice per week.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Ohgonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Patent NO: 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J.
Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, AlanR. Liss, fnc, 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods hi Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-JN (D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Ν.Y., 1986).
EXAMPLES
This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application are hereby incorporated by reference. Nucleotide and amino acid sequences deposited in public databases as referred to herein are also hereby incorporated by reference. The following Materials and Methods were used in the Examples:
Mice, antibody and hormone treatments. CD40"7" mice were the gift of R. Geha (Harvard Medical School, Boston, MA); C57BL/6 (B6), BALB/c, B6CBAF and B6129F1 (a strain-matched control for CD40_/" mice) were from The Jackson Laboratories; Rag2"7" and Rag2-/ ~yά'~ mice were from Taconic Farms. Males were mated with individual females no more than once per week; B6CBAF1 females and B6 males were used in all experiments except when noted. The day of the copulation plug was counted as E0. All antibodies were given via intraperitoneal injection at the dose of 100 μg in 0.1 ml PBS. The FGK45 rat hybridoma cell line was the gift of A. Groenewegen (Basel Institute for Immunology, Switzerland); antibodies were prepared from hybridoma supernatants by protein G chromatography either in house or by BioExpress (West Lebanon, NH). Polyclonal rat IgG antibodies were purchased from ICN (Aurora, OH). Mice received FGK45 or rat IgG antibodies between 0830 and 1200 h. For experiments evaluating the role of TNF-α, mice were additionally injected two hours later with TN3-19.12, a hamster IgG monoclonal antibody that neutralizes murine TNF-α ( Sheehan, K.C., et al. (1989) J Immunol 142:3884-3893), or 100 μg PIP, an irrelevant hamster IgG monoclonal antibody that recognizes glutathione s-transferase. Both of these antibodies were the gifts of R.
Schreiber (Washington University in St. Louis). Progesterone (Sigma, St. Louis, MO) was dissolved in sesame seed oil (Sigma) and 2 mg/0.1 ml was injected subcutaneously at the time of concurrent antibody injections. Ovine prolactin (NIDDK-oPRL-21) was dissolved in alkaline saline and 100 μg/0.1 ml was injected subcutaneously twice a day between 0800-0830 h and 1600-1630 h.
Serum hormone and cytokine measurements. Serum was collected by retro-orbital eye bleeds. Progesterone concentrations were measured by enzyme-linked immunoassay (Alpco Diagnostics, Windham, NH), prolactin and luteinizing hormone (LH) concentrations were measured in the laboratory of the National Hormone and Peptide Program by radioimmunoassay, and cytokines were measured by the Searchlight assay (Pierce, Rockford, IL).
Flow cytometry. Splenocyte forward scatter and cell surface marker expression was determined by flow cytometry using a Becton-Dickinson FACS Calibur and CellQuest software. The following antibodies were purchased from BD Biosciences (San Diego, CA) : CyChrome-conjugated anti-TCR-β (clone H57-597), FITC-anti-NKl.l (PK136), PE-anti-B220 (RA3-6B2), PE-anti-CD69 (H1.2F3), APC-anti-CDllc (HL3), PE-anti- CDl lb (Ml/70), FITC-anti-CD80 (16-10A1), FITC-anti-CD86 (GLl), FITC-anti-MHC class II (AF6-120.1), FITC-anti-CD40 (HM40-3). Following an initial gating on all lymphoid cells based upon their forward and side scatter characteristics, T cells were identified as the TCRβ^^WQ.l" population, NK cells were identified as the TCRβ" NK1.1+ population, and B cells were identified as the TCRβTNJKl.r population. True B220+ B cells comprised 70-80% of this latter population in rat IgG-freated mice, and 85-95% of this latter population in FGK45-treated mice. Dendritic cells were identified and gated by virtue of their expression of CDl lc, with an unused fluorescence channel was used to gate away autofluorescent cells.
Histology and immunfluorescence microscopy. Tissue was fixed overnight at 4° C in 4% paraformaldehyde prior to routine paraffin embedding. For leukocyte visualization, sections were stained with biotin-conjugated antibodies against the common leukocyte antigen CD45 (clone 30- Fl 1, BD Biosciences), using horseradish peroxidase-conjugated streptavidin as a secondary reagent (NEN, Boston, MA), biotin-tyramide amplification (NEN), and streptavidin- Alexa 954 (Molecular Probes, Eugene, OR) as the final fluorochrome. Sections were counterstained with DAPI (Sigma), and digitally photographed at 4x magnification. Composites were assembled in Adobe Photoshop (San Jose, CA). NF-
KB p65 was visualized with a goat primary antibody (C-20, Santa Cruz Biotechnology, Santa Cruz, CA), a biotin-conjugated horse anti-goat secondary antibody (Vector Laboratories, Burlingame, CA), and streptavidin-Alexa 954.
RNA analysis. RNA was prepared from homogenized ovaries using the Trizol reagent (Invitrogen, Carlsbad, CA). Real-time RT-PCR was performed as described previously (Erlebacher, A., et al. (2002) Proc Natl Acad Sci USA 99:16940-16945). All reactions were run in duplicate using cDNA template synthesized from 10 ng RNA. ΔCx values were calculated relative to β-actin, and statistical analyses were performed on groups of raw ΔCT values. Expression levels relative to β-actin were calculated as 2" , with error bars extrapolated from the standard deviation of the ΔCT mean for each group. All probes were dual-labeled with FAM and TAMRA. SYBRG was used for amplifications when a primer set was used without a probe. For all reactions, the approximate fold difference in amplification between plus and minus RT reactions was >1000x, except the SYBRG (SYBR Green) amplifications of β-actin (50x), STAT5a (lOOx), STAT5b (50x). Real-time PCR primer and probe sets are listed 5' to 3' in the order of forward primer, reverse primer, and probe (when employed):
β-actin
Forward primer: 5'-GCTCTGGCTCCTAGCACCAT-3' (SEQ ID NO. 1) Reverse primer: 5'-GCCACCGATCCACACCGCGT-3' (SEQ ID NO. 2) Probe: 5'-TCAAGATCATTGCTCCTCCTGAGCGC-3' (SEQ ID NO. 3)
StAR
Forward primer: 5'-TCACTTGGCTGCTCAGTATTGAC-3' (SEQ ID NO. :4) Reverse primer: 5'-TCTATCTGGGTCTGCGATAGGAC-3' (SEQ ID NO.:5)
P450scc Forward primer: 5 '-CGGTACTTGGGCTTTGGCT-3 ' (SEQ 3D NO. :6)
Reverse primer: 5'-AGCAGATTGATAAGGAGGATGGTC-3' (SEQ JD NO.:7)
3β-HSD
Forward primer: 5'- CCAGGCAGACCATCCTAGATGT-3' (SEQ ID NO.:8) Reverse primer: 5 '- AGATGAAGGCTGGCACACTTG-3 ' (SEQ ID NO. :9)
LHR
Forward primer: 5'-CGAGACGCTTTATTCTGCCAT-3' (SEQ ID NO.:10)
Reverse primer: 5 '-AGCATCTGGTTCTGGAGTACATTG-3 ' (SEQ ID NO. : 11)
20α-HSD
Forward primer: 5'- GCTGATATGTTTAAGGCTCACCCTAA-3' (SEQ ID NO.: 12) Reverse primer: 5'- AGAGTCCAGCATCACACAAAAGATC-3' (SEQ ID NO.: 13)
PRLR Forward primer: 5'- GGATGTGACTTACATTGTTGAACCA-3' (SEQ ID NO.:14) Reverse primer: 5'- TACCCACAGATATGTTTTTTTGTCTTTT-3' (SEQ ID NO.: 15)
STAT5a
Forward primer: 5'-TGGTCCCTGAGTTCGTCAATG-3' (SEQ ID NO.: 16) Reverse primer: 5'-GTTGAGGGCACACGACTGG-3' (SEQ ID NO.: 17)
STAT5b
Forward primer: 5'- GCGCCACCTACATGGATCA-3' (SEQ ID NO.: 18)
Reverse primer: 5'- GACGGAGTCCGGGTTGG-3' (SEQ ID NO.: 19)
IL-6
Forward primer: 5'-TTCAACCAAGAGGTAAAAGATTTACATAA-3' (SEQ ID
NO.:20)
Reverse primer: 5'-CACTCCTTCTGTGACTCCAGCTT-3' (SEQ ID NO.:21)
IκBα
Forward primer: AGATGCTACCCGAGAGCGAG (SEQ ID NO.:22)
Reverse primer: TCATCATAGGGCAGCTCATCC (SEQ ID NO.:23)
SOCSl
Forward primer: 5'-TGTGCCGCAGCATTAAGTG-3' (SEQ ID NO.:24) Reverse primer: 5'-GGCATCTCACCCTCCACAAC-3' (SEQ ID NO.:25) Probe: 5'-CCGCCTGGGTCGGAGGGAGT-3' (SEQ ID NO.:26)
SOSC3
Forward primer: 5'-TGCTGGCCAAAGAAATAACCA-3' (SEQ ID NO.:27) Reverse primer: 5'-GGTCACCCCTTGCCACTCT-3' (SEQ ID NO.:28) Probe: 5'-CCCACTGCCCAGCCTAGGTGAGGA-3' (SEQ ID NO.:29)
Statistical analysis. Pregnancy rates were compared by Cbi-square statistics; all other comparisons used Student's t test.
Example 1. Systemic CD40 ligation in mice causes early pregnancy failure preceded by decreased serum progesterone concentrations. To determine the gestational effects of systemic CD40 ligation, the agonistic anti-CD40 monoclonal antibody FGK45 was injected ( Rolifrk, A., et al. (1996) Immunity 5:319-330) at various times during pregnancy. Mice were treated with control rat IgG or agonistic anti-CD40 antibodies (FGK45) either once on embryonic day (E) E4 and sacrificed 24 h later on E5, or daily on E4-7 and sacrificed on E8. Four daily injections of FGK45 from E4 to E7 dramatically reduced the percentage of pregnant mice per total mated mice to nearly 0% in females of all strains tested, with control pregnancy rates following treatment with polyclonal rat IgG varying between 40% and 100% depending upon the background strain (Table 1). The effect of FGK45 injection occurred in both syngeneic and allogeneic mating combinations and was restricted to this immediate post-implantation period, since similar daily injections on E8-11 did not reduce pregnancy rates or litter sizes. FGK45 injection also did not inhibit pregnancy in CD40" " females ( Castigli, E., et al. (1994) Proc Natl Acad Sci USA 91:12135-12139) mated to wild- type males, ruling out the possibility that its abortifacient effect was non-specific, or due to embryonic or placental ligation of CD40. Rather, pregnancy failure required maternal CD40 expression.
Table 1. Systemic CD40 ligation causes murine pregnancy failure in the post- implantation period.
Litter
Treatment Number Pregnancy size period Female Male Treatment Sacrifice : n pregnanl : rate (%) (+/- SD)
BALB/c or 7.2 +/-
E4-7 BALB/c B6a rat IgG El 7 25 14 56 1.7 anti-CD40 E17 25 1 4° 9
8.6 +/- B6 B6 rat IgG E14-17 12 5 42 0.9 anti-CD40 E14-17 11 0 0d NA 9.3 +/- B6CBAF1 B6 rat IgG E8 15 15 100 1.3 anti-CD40 E8 22 1 5C 8
BALB/c or 6.5 +/-
E8-11 BALB/c B6b rat IgG E17 11 4 36 1.7 7.0 +/- anti-CD40 E17 12 6 50 1.8
6.9 +/- B6CBAF1 B6 rat IgG E12 7 6 86 2.3 7.9 +/■ anti-CD40 E12 6 6 100 1.1
aMales were divided between w=12 BALB/c and n=l3 C57BL/6 (B6) mice for both treatment groups. bMales were divided between »=5-6 BALB/c and n-5-6 B6 mice for both treatment groups. CP<0.0001 αP<0.02
Although CD40 is largely considered an immune stimulatory molecule, the timing of events leading to embryo loss suggested that the ultimate cause of pregnancy failure following CD40 ligation was endocrinological rather than immunological. Employing B6CBAF1 females to take advantage of their high natural pregnancy rate (Table 1), it was found that a single FGK45 injection on E4 dramatically reduced serum progesterone levels (+/- SEM of n-6 mice per group ) within 24 hours (Figure 1 A; *, PO.001)), yet implantation sites from these mice showed no evidence of a pathological leukocyte infiltration that might be expected with a tissue rejection response. Rather, compared to controls (Figure IB, whole mount uteri preparation; and Figure ID, paraffin sections of implantation sites), implantation sites from FGK45- treated mice were only mildly reduced in size at E5 (Figure 1C, paraffin sections of implantation sites) and contained implanted embryos with the typical clearing of CD45+ leukocytes from the early primary maternal decidua (Figure IE; immunostaining is representative of n=2-3 mice per group, encompassing a total of «=15-20 implantation sites in each group. Scale bar shows 0.5 mm). By E8, however, after daily E4-7 FGK45 injections, all implantation sites had been completely resorbed (see below) and serum progesterone levels remained low (Figure 1A). The mesometrial pole of each implantation site in Figures ID and IE is oriented toward the top of the panel, and a recently implanted embryo can be seen in the center of each section (arrowhead). Since progesterone is the sole ovarian hormone required for the maintenance of post-implantation pregnancy ( Rubinstein, L., and Forbes, T.R. (1963) Proc Soc Exp Biol Med 113:1043-1046), its reduced concentration in serum prior to overt embryo resorption suggested that CD40 ligation-induced abortion involved an inhibition of the hypothalamic-pituitary-gonadal axis. This possibility would also be consistent with the observation that pregnancy failure occurred in an all-or-nothing fashion, with the normal-sized litters in those few females maintaining pregnancy following E4-7 FGK45 treatment (Table 1) showing no evidence of piecemeal embryonic resorption.
Example 2. Pregnancy failure following CD40 ligation is due to luteal insufficiency associated with ovarian prolactin resistance and defective prolactin receptor signaling. The mechanism of inhibition of ovarian function following CD40 ligation was investigated. Compared to paraffin control sections stained with hematoxylin and eosin (Figure 2A), there was little microscopic evidence that CD40 ligation caused the histological regression of corpora lutea (i.e. structural luteolysis), since these structures were still clearly present on E8 following daily E4-7 FGK45 injections and only showed a mild and variable increase in luteal cellularity (Figure 2B). Furthermore, quantitative
real-time RT-PCR analysis of ovarian RNA from FGK45-freated mice (Figure 2C) revealed no significant change on either E5 or E8 in the levels of mRNA encoding the steroidogenic enzymes Steroidogenic Acute Regulatory protein (StAR) and P450 side chain cleavage enzyme (P450ssc), and only transient 2-fold decreases on E5 alone in the mRNA levels of 3β-hydroxysteroid dehydrogenase (3β-HSD). Ovaries were collected from mice treated with control rat IgG or anti-CD40 antibodies (FGK45) either once on E4 and sacrificed 24 h later on E5 (n=4 mice per group; upper panel), or daily on E4-7 and sacrificed on E8 (w=3 mice per group; lower panel). Data represent mean +/- SD. On the other hand, CD40 ligation induced dramatic changes in the mRNA expression levels of the luteinizing hormone receptor (LHR) and 20α-HSD, the two major transcriptional targets of prolactin receptor signaling in corpus luteal cells ( Risk, M., and Gibori, G. (2001) Mechanisms of luteal cell regulation by prolactin. In Prolactin. N.D. Horseman, editor. Boston: Kluwer Academic Publishers. 265-295; Stocco, C, et al. (2001) Endocrinology 142:4158-4161) (Figure 2C). Normally, prolactin receptor signaling via JAK2/STAT5 induces the transcription of LHR and represses the transcription of 20α-HSD ( Risk, M., and Gibori, G. (2001) Mechanisms of luteal cell regulation by prolactin. In Prolactin. N.D. Horseman, editor. Boston: Kluwer Academic Publishers. 265-295). However, as shown in Figure 2C, on both E5 and E8, 20α-HSD and LHR mRNA levels were increased and decreased, respectively (fold changes indicated by brackets in Figure 2C), whereas 3β-HSD and PRLR mRNA levels were decreased on E5 only (*, PO.02; **, P<0.005; ***, PO.001). Prolactin and LH concentrations in FGK45-treated mice on E5 were significantly elevated compared to control mice (*, PO.05; data represent mean +/- SEM of n=12 mice per group), but there was no change in prolactin concentrations on E8 (n=6 mice per group). (Figure 2D). The limit ofdetection for LH was 0.2 ng/ml. Thus, a single FGK45 injection on E4 led to a 12-fold decrease the abundance of LHR mRNA and a 2-fold increase in 20α- HSD mRNA within 24 h, which progressed after daily E4-7 FGK45 injections to a 13- fold decrease and a 15 -fold increase in mRNA transcript levels, respectively, on E8 (Figure 2C). Thus, CD40 ligation led to a functional luteal insufficiency associated with defective prolactin receptor target gene expression. Since 20α-HSD catalyzes the infra-ovarian catabolism of newly synthesized progesterone ( Risk, M., and Gibori, G. (2001) Mechanisms of luteal cell regulation by prolactin. In Prolactin. N.D. Horseman, editor. Boston: Kluwer Academic Publishers. 265-295), its derepression in FGK45- treated mice likely contributed to the decrease in serum progesterone concentrations. Further molecular and hormonal analyses suggested that the defect in prolactin target gene expression was due to inhibition at the post-receptor level. Thus, serum levels of prolactin were actually modestly elevated from controls 24 hours after a
single FGK45 injection on E4 (Figure 2D), consistent with a loss of feedback inhibition by progesterone ( Davis, J. S., and Rueda, B .R. (2002) Front Biosci 7 :dl 949- 1978), and similar to controls on E8 after daily E4-7 injections. The overall decrease in serum prolactin levels at this latter time point is consistent with the known pattern of pituitary prolactin secretion during early mouse gestation ( Markoff, E., and Talamantes, F.
(1981) Biol Reprod 24:846-851), and unimpaired pituitary function was also suggested by the modestly elevated serum levels of LH seen on E5 (Figure 2D). Furthermore, we observed only a transient 3 -fold decrease in prolactin receptor (PRLR) mRNA expression on E5 alone (due to proportionate decreases in mRNAs for the long and short isoforms) and normal expression levels on E8, with unaltered mRNA expression of STAT5a and STAT5b on both E5 and E8 (Figure 2C). Collectively, these data implied that the deregulation of prolactin target genes was due to the presence of a dominant inhibitor of STAT5 signaling, a possibility we explore further below. To directly evaluate whether luteal insufficiency was the ultimate cause of pregnancy failure, pregnant mice were treated with both FGK45 and progesterone. Strikingly, daily E4-7 progesterone administration, which led to serum concentrations of about 35 ng/ml 24 h after the E7 injection, almost completely prevented abortions caused by daily E4-7 FGK45 injection (Figure 3A). Implantation sites at E8 from dually-treated mice appeared completely normal both grossly (Fig. 3H) as well as histologically (Figure 31), and showed no evidence of an altered distribution of CD45+ leukocytes compared to control mice treated with either rat IgG plus progesterone (Fig. 3F, 3G) or with rat IgG plus sesame seed oil vehicle (Figures 3B and 3C). In contrast, E8 uteri of mice treated with anti-CD40 antibodies plus vehicle showed no evidence of implantation (Figure 3D), occasionally contained debris in the uterine lumen (Figure 3E, arrowhead), and by this end stage were infiltrated with CD45+ leukocytes scattered throughout the uterine stroma. The CD45 staining intensity in these sections tended to be greater than that at viable implantation sites because they do not contain the high numbers of CD45dιm uterine natural killer cells present in the decidua. hnmunostaining is representative of «=2 mice per group, encompassing a total of about n=\ 2 implantation sites in each group. Scale bar shows 0.5 mm. Continued daily progesterone injection, up to E17, also maintained pregnancy in mice treated with FGK45 on E4-7 (6/6 mice). In addition to progesterone, twice-daily coadminisfration of 100 μg ovine prolactin prevented CD40 ligation-induced abortion (Figure 3A), and implantation sites from these mice also showed no histological abnormalities. Prolactin injections raised serum progesterone concentrations above those seen in mice freated with FGK45 alone, however these levels still remained subphysiological (10.9+/- 1.5 ng/ml [mean +/- SEM]
on E8). Thus, although the corpora lutea of FGK45 -treated mice were resistant to physiological or modestly elevated serum prolactin levels, this could be overcome by exogenous prolactin administration at high doses.
Example 3. Induction of luteal insufficiency requires a lymphoid intermediate and TNF-α, and is associated with increased SOCSl and SOCS3 expression. To understand how systemic CD40 ligation caused luteal insufficiency, flow cytometry was used first to determine that there was no significant CD40 staining of enzymatically dispersed E4 ovarian cell suspensions aside from a subset of CD45+ leukocytes. This ruled out the possibility that FGK45 treatment induced abortion via direct ligation of CD40 on corpus luteal cells themselves. Furthermore, CD40 ligation induced abortion in Rag2_ " mice, which lack B cells, T cells and NKT cells ( Shinkai, Y., et al. (1992) Cell 68:855-867), yet had no effect on pregnancy in completely alymphoid Rag2~ γc " _ mice, which additionally lack NK cells ( Cao, X., et al. (1995) Immunity 2:223-238) (Figure 4A). Mice were sacrificed on E8 following daily E4-7 treatment with rat IgG or anti-CD40 antibodies (FGK45). Data for control C57BL/6 matings are shown in Table 1. Thus, a lymphocyte population was required for the abortifacient effects of CD40 ligation, and NK cells were sufficient to perform this function.! Systemic CD40 ligation led to broad activation of lymphocytes and dendritic cells. Importantly, this activation was not affected by concurrent progesterone administration, suggesting that it lay entirely upstream to luteal insufficiency. Thus, the same degree of splenomegaly and elevated splenocyte numbers following FGK45 treatment in both groups (P<0.005) (Figure 4B), increased lymphocyte cell size (Figure 4C), modulated expression of the lymphoid activation markers CD69 (Figure 4C), CD25, CD44, CD45RB, and CD62L, as well as upregulation of the costimulatory molecules CD80, CD86, MHC class II (Figure 4D), CD40 and CD54 on CDllc+ dendritic cells was found. The splenic CDl lb+ CDl lc" macrophage population expressed low levels of CD40 and showed only modest changes in surface marker expression after daily E4-7 FGK45 treatment. Flow cytometric analysis of cell size and surface activation marker expression is shown with the shaded histograms denoting rat IgG-freated mice, while open histograms show data from FGK45-freated mice. Data is representative of n—3 mice per group. Increased forward scatter indicating increased cell size (Figure AC) and increased CD69 expression indicating cell activation (Figure 4D) was seen in B cells, NK cells, and a fraction of T cells following FGK45 treatment in both groups. Dendritic cells were identified and gated by virtue of their expression of CDl lc. Increased CD80, CD86 and MHC class II expression indicating cell activation was seen following FGK45 treatment in both groups.
Since FGK45 injection did not cause a significant leukocytic infiltration into the ovaries, luteal insufficiency following CD40 ligation was likely due to inflammatory cytokines produced by the immune system potentially acting at the systemic level. In contrast to unaltered serum levels of IL-lβ, IL-2, IL-4, IL-10, IL-12 or IFN-γ, a single FGK45 injection on E4 induced a transient increase after 24 h in the serum concentrations of TNF-α and its downstream target IL-6 (Figure 5A) (Ghosh, S., et al. (1998) Annu Rev Immunol 16:225-260). The limits ofdetection were 31.1 pg/ml TNF-α and 54.7 pg/ml IL-6. Indeed, TNF-α was critical for pregnancy failure, as its neutralization with a specific monoclonal antibody prevented FGK45 -induced abortion (Figure 5B). Mice were sacrificed on E8-E10 after daily E4-7 injections of rat IgG and control hamster IgG monoclonal antibodies, FGK45 and control hamster IgG monoclonal antibodies, or FGK45 and TNF-α-neutralizing hamster IgG monoclonal. One mouse receiving FGK45 and TNF-α-neutralizing antibodies was allowed to carry its litter to term. In addition, admirήsfration of a single dose (100 μg) of FGK45 and TNF-α-neufralizing antibodies at embryonic day (E) 4.5 also prevented FGK45-induced abortion (6/8 mice were pregnant). Furthermore, immunohistochemical and biochemical studies suggested that the cytokine was acting directly on corpus luteal cells. Thus, the p65 subunit of NFKB, a transcriptional mediator of TNF receptor (TNFR) signaling present in the cytoplasm of unstimulated cells (Figure 5C), had assumed a nuclear distribution pattern in corpus luteal cells 12 h after FGK45 injection on E4 (Figure 5D; data is representative ofimmunostained ovaries from n=3 mice per group. Scale bar shows 50 μm). FGK45 injection also led to 11-fold and 2-fold respective increases in the ovarian abundances of transcripts for IL-6 and the additional NF-κB target IκBα (Ghosh, S., et al. (1998) Annu Rev Immunol 16:225-260), and these increases could largely be inhibited by administration of TNF-α neutralizing antibodies (Figure 6). Collectively, these data show that TNF-α was required for FGK45-induced pregnancy failure, and that corpus luteal cells were functionally exposed to this cytokine during the course of FGK45- induced abortion. The ovary was also likely exposed to IL-6 as a secondary consequence of its systemic or local induction. Both TNF-α and IL-6 are known to transcriptionally induce multiple SOCS family members ( Alexander, W.S. (2002) Nat Rev Immunol 2:410-416; Shuai, K., and Liu, B. (2003) Nat Rev Immunol 3:900-911). While only assessed to date outside the context of pregnancy, SOCS induction is thought to be the major mechanism of cross-talk inhibition between JAK/STAT signaling cascades of the immune and endocrine system (Auernhammer, C.J., and Melmed, S. (2001) J Clin Invest 108:1735- 1740; Alexander, W.S. (2002) Nat Rev Immunol 2:410-416; Shuai, K., and Liu, B. (2003) Nat Rev Immunol 3 :900-911). By analogy, the ovarian exposures to TΝF-α and
IL-6 directly suggested SOCS proteins as the dominant inhibitors of STAT5 signaling that was inferred to exist from our expression studies of ovarian steridogenic enzymes and prolactin receptor signaling components (see above). Indeed, 12 h after a single FGK45 injection on E4, ovarian SOCSl and SOCS3 mRNA expression was induced 11- fold and 2-fold, respectively (Fig. 5f), while SOCS2 mRNA levels remained unchanged. Mice treated with FGK45 plus TNF-α-neutralizing antibodies showed partially inhibited SOCSl and SOCS3 induction on E4. Thus, SOCSl and SOCS3 inducibility correlated with the E4-7 temporal window of sensitivity towards FGK45 -induced abortion, since FGK45 injection on E8 did not significantly increase SOCSl and SOCS3 mRNA expression (Figure 6; on E4, 12 hours after treatment, IL-6, IκBα, SOCSl and SOCS3 mRNA levels were increased following FGK45 injection (*, PO.05; **, PO.005; ***, PO.0005). Baseline ovarian SOCSl and SOCS3 expression was higher at this later point in gestation. The failure to induce SOCSl and SOCS3 was likely due to altered ovarian TNF-α responsiveness on E8 since the pattern of immune cell surface marker modulation following FGK45 injection was identical in the E8-11 and E4-7 periods, and similar levels of IL-6 and IκBα mRNA induction were seen 12 h after FGK45 injection on E8 versus E4 (Figure 6). Lastly, progesterone treatment did not affect the FGK45- induced ovarian upregulation of IL-6, IκBα, SOCSl, or SOCS3 expression, consistent with immune activation acting entirely upstream to luteal insufficiency. Together, these data suggest that the direct or indirect induction of SOCSl and SOCS3 by TNF-α is a major mechanism of deregulated luteal prolactin target gene expression and decreased ovarian progesterone synthesis following systemic CD40 ligation. For ease of graphical representation, transcript levels for IL-6, IκBα, and SOCS3 were multiplied by 1000, 2, and 5, respectively.
Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.