WO2005103297A1 - METHODS AND COMPOSITIONS RELATED TO MODULATION OF p22phox - Google Patents

Abstract

Described herein are methods and compositions related to the modulation of p22phox activity. In certain embodiments, the invention relates to methods for the treatment of oxidative stress.

Description

METHODS AND COMPOSITIONS RELATED TO MODULATION _{OF p22}phox

RELATED APPLICATIONS This application claims the benefit of U.S. provisional application No.

60/558,797 filed March 31, 2004 by C. Wilcox entitled "Methods and Compositions Related to the Prevention or Treatment of Oxidative Stress" and the benefit of U.S. provisional application No. 60/558,895 filed April 1, 2004 by C. Wilcox entitled "Methods and Compositions Related to the Prevention or Treatment of Oxidative Stress". The teachings of the referenced applications are hereby incorporated by reference in their entirety.

FUNDING This invention was made with government support under grants HL-68686 NHLBI, DK-36079 NIDDK, and DK-49870 NIDDK awarded by the National Institutes of Health. The United States government has certain rights in the invention.

BACKGROUND OF THE INVENTION The identification of genes and proteins involved in various disease states or key biological processes, such as oxidative stress, is a vital part of the drug design process. Many diseases and disorders could be treated or prevented by decreasing the expression of one or more genes involved in the molecular etiology of the condition if the appropriate molecular target could be identified and appropriate antagonists developed. However, the discovery of relevant gene or protein targets is often difficult and time consuming. Oxidative stress implies an increased production, or a decreased scavenging or metabolism, of reactive oxygen species (ROS). Work by Harrison, Griendling and others (1', 2') established that angiotensin II (Ang II)-induced hypertension in the rat is accompanied by oxidative stress in blood vessels. They showed further that administration of forms of superoxide dismutase (SOD) that interact with endothelial cells reduce blood pressure (BP) in this model, but not in rats with norepinephrine-induced hypertension that do not develop oxidative stress(3'). Subsequent studies by Schiffrin and Touyz(4'-7'), Harrison(δ'), Webb(9'), Manning (10'), Schmid-Schobein (ll¹) and colleagues showed further that oxidative stress is engendered during mineralocorticoid (MC)-salt hypertension and salt-loaded Dahl salt-sensitive or spontaneously hypertensive stroke-prone rats (SHRsp) in which the renin-angiotensin -aldosterone system (RAAS) is suppressed, thereby widening the role of oxidative stress in hypertension. Indeed, an increase in salt intake without accompanying hypertension also can enhance renal NADPH oxidase, impair SOD and cause oxidative stress(12'). Antioxidants can diminish not only the increase in BP, but also the inflammation, fibrosis, sclerosis and dysfunction of the heart, kidneys and other organs of certain hypertensive models (13'-34'). However, in some models, such as that caused by prolonged infusion of endothelin-1 (ET-1), hypertension is resistant to an effective antioxidant regimen (35'). The cellular and organ-sparing effects of antioxidants in hypertensive models appear to be at least partially independent of any BP lowering (14', 36'-38'). Studies of human subjects with essential or renovascular hypertension report evidence of oxidative stress (39') that underlies the endothelial dysfunction of forearm blood vessels observed in vivo (40'; 41') or of isolated vessels studied ex vivo (42'; 43'). Inhibition of nitric oxide synthase (NOS) causes hypertension and renal and systemic vasoconstriction in normal human subjects which demonstrates the importance of ongoing nitric oxide (NO) generation for the maintenance of normal BP and blood flow (44'-46'). The evidence of the primary role of the kidneys in setting the long term level of BP (47'; 48') has focused attention on renal mechanisms of hypertension mediated through oxidative stress and NO deficiency. Among ROS, attention has centered on the free radical, highly reactive superoxide anion (O₂ ^" ) and the more stable hydrogen peroxide (H₂O₂). Reaction of H₂O₂ with metals, notably Fe⁺⁺, leads directly to the formation of the highly reactive hydroxyl radical (OH^"). OH^" is also generated by a reaction between O₂" and NO(49'). The reaction of O₂ ^" or OH^" with NO not only leads to NO bioinactivation (50', 51'), and thereby to endothelial dysfunction (52'), but to the generation of highly oxidative and nitrosating species including peroxynitrite (ONOO^")(53', 54'). Hypochlorous acid (HOC1^") is generated by myeloperoxidase in activated phagocytes and can circulate to cause widespread endothelial dysfunction (55'). These species represent only some of the proximate ROS. Their further reaction with cell products can lead to long lasting mediators. These include oxidized low density lipoprotein ( LDL) formed from the interaction of H O₂ or OH^" with LDL, or isoprostanes formed by the interaction of O ^" with arachidonic acid (AA), or advanced glycation end products (AGEs) formed by the interaction of ROS with carbohydrate moieties, or carbonyl species formed by the interaction of ROS with proteins, or oxidized DNA and its products, or nitrosated tyrosine epitopes on proteins.

Angiotensin-II (Ang II) has been assigned a critical role in the generation and complications of human essential hypertension, yet plasma renin activity (PRA) and plasma concentrations of Ang II are not remarkably elevated (1). Mice (2), rats (3-5), rabbits (6, 7) or humans (8) infused with Ang II at doses that are initially sub- pressor develop a "slow-pressor response" in which the blood pressure (BP) increases progressively despite plasma Ang II concentrations that are increased only moderately (4). The kidney is implicated in the slow pressor response, since the development of hypertension depends on salt intake (4). Moreover, rats or rabbits infused with Ang II have enhanced renal vasoconstriction to Ang II (9) despite downregulation of Ang II type 1 receptors. It would be beneficial to identify proteins involved in one or more of these processes for use in, among other things, drug screening methods or therapies to treat oxidative stress.

SUMMARY OF THE INVENTION

Described herein are methods and compositions relating to the modulation of p22phox. In certain embodiments, the invention relates to methods and compositions for the treatment or prevention of oxidative stress.

In certain embodiments, the invention relates to a method of identifying an agent that inhibits oxidative stress, comprising (a) determining the level of p22phox in a cell in the presence of (e.g., contacting a cell with) a test agent and (b) comparing the level of p22phox determined in (a) with the level of p22phox determined in a control cell, wherein if the level of p22phox in (a) is less than the level of p22phox in the control cell, the test agent is an agent that inhibits oxidative stress. Examples of agents include nucleic acids, proteins, peptides, and small molecules.

In other embodiments, the invention relates to a method of identifying an agent that inhibits NADPH oxidase activity, comprising (a) determining the level of p22phox in a cell in the presence of a test agent and (b) comparing the level of p22phox determined in (a) with the level of p22phox determined in a control cell, wherein if the level of p22phox in (a) is less than the level of p22phox in the control cell, the test agent is an agent that inhibits NADPH oxidase activity.

In yet other embodiments, the invention relates to a method of identifying an agent that inhibits p22phox expression in a cell, comprising (a) determining the level of p22phox in a cell in the presence of a test agent and (b) comparing the level of p22phox determined in (a) with the level of p22phox determined in a control cell, wherein if the level of p22phox in (a) is less than the level of p22phox in the control cell, the test agent is an agent that inhibits p22phox expression in a cell.

Control cells are treated the same way as test cells, but treated in the absence of the test agent. For example, control cells can be cultured in the absence of the candidate drug. In in vivo embodiments, control cells may be cells in an animal model that is not treated with the candidate drug. The level of p22phox in control cells can be determined simultaneously with the test cells or can be determined at a different time (e.g., prior to or after the level of p22phox in test cells is determined) and results used to produce a reference or standard with which results obtained with test cells can be compared. A cell population may consist of one or more than one cell. In certain embodiments of the invention, determining the level of p22phox comprises detecting the level of p22phox mRNA in a cell. In other embodiments, determining the level of p22phox comprises detecting the level of p22phox protein in a cell. Examples of cells that can be used in the methods of the subject invention include kidney cells. Cells used in embodiments of the present invention can be cultured cells or cells situated in an animal model (e.g., kidney cells in a rat). In certain embodiments, the invention relates to a method of identifying an agent that inhibits oxidative stress, comprising (a) forming a mixture comprising a p22phox polypeptide and one or more components of NADPH oxidase, (b) contacting the mixture with a test agent, (c) detennining the association of p22phox with one or more NADPH components in the presence of the test agent, (d) determining the association of p22phox with one or more NADPH components in a control mixture in the absence of the test agent, and (e) comparing the association of p22phox determined in (c) with the association of p22phox determined in (d), wherein if p22phox association with one or more NADPH components in (c) is less than the level of p22phox association with one or more NADPH components in (d), the test agent is an agent that inhibits oxidative stress. In certain embodiments, the method further comprises (f) determining NADPH oxidase activity in the presence of the test agent; (g) determining NADPH oxidase activity in a control mixture in the absence of the test agent; and (h) comparing NADPH oxidase activity determined in (f) with NADPH oxidase activity determined in (g), wherein if NADPH oxidase activity in (f) is less than NADPH oxidase activity in (g), the test agent is an agent that inhibits oxidative stress. In other embodiments, the invention relates to a pharmaceutical composition comprising an agent that inhibits p22phox. h certain embodiments, the agent decreases p22phox mRNA levels. In other embodiments, the agent decreases p22phox protein levels. In certain embodiments, the agent associates with the carboxy terminal proline-rich domain of p22phox. h yet other embodiments, the agent inhibits p22phox association with one or more components of NADPH oxidase. Examples of NADPH oxidase components include gp91phox, Noxl, Nox3, Nox4, p47phox, p41nox, p40phox, p67phox, p51nox, Rac-1, and Rac-2 and homologs thereof. In certain embodiments, the invention provides an agent that is an RNAi construct, such as an siRNA. In certain embodiments, the siRNA construct decreases p22phox mRNA levels. In other embodiments, the siRNA construct inhibits p22phox protein expression. Examples of siRNA constructs include 5'- AUUACUACGUCCGGGCUGU-3' (SEQ ID NO: 1) and 5'- ACAGCCCGGACGUAGUAAU-3' (SEQ ID NO: 2). In yet other embodiments, the invention relates to a method of treating or preventing oxidative stress in an individual in need thereof, comprising administering to the individual an agent that inhibits p22phox, thereby treating or preventing oxidative stress in the individual. In other embodiments, the oxidative stress is associated with a condition selected from the group consisting of: damage caused by acute ischemia; contrast associated with nephropathy; oxidative damage complicating surgical or medical procedures; blood pressure and organ damage in hypertensive emergencies, malignant hypertension, or hypertension accompanying vasculitis; heart failure; hypercholesterolemia; smoking; kidney failure; aging; and atherosclerosis. In certain embodiments, the agent is administered to the individual following angina, following a transient ischemic attack, during vascular surgery, during coronary artery by-pass surgery, after organ transplantation, during malignant hypertension, in the treatment of diabetes mellitus, in the treatment of hyperglycemia, following drug poisoning, following drug overdose, in the treatment of hyperoxia, and in the treatment of oxygen toxicity. In further embodiments, the level of a marker of oxidative stress is detected in the individual, wherein if the level of the marker of oxidative stress in the presence of the agent is less than the level of the marker of oxidative stress in the absence of the agent, the agent treats or prevents oxidative stress in the individual. An example of a marker of oxidative stress is 8-isoprostane. In certain embodiments, the levels of 8-isoprostane are detected in the urine of the individual. In other embodiments, the invention relates to a method of inhibiting the activity of a target polypeptide in a rat, comprising administering to the rat an RNAi construct that decreases mRNA levels of the target polypeptide in the rat. In certain embodiments, the invention relates to a method of inhibiting the activity of a target polypeptide in a rat, comprising administering to the rat an RNAi construct that decreases protein levels of the target polypeptide in the rat. In certain embodiments, RNA is administered to a mammal, such as rat, with a gene complexing solution, hi certain embodiments, the RNA is administered intravenously to the mammal. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows oligonucleotide sequences for forward (F) and reverse (R) primers (5 '-3'), probes, siRNA target sequence, and siRNA duplex sequence related to p22^phox.

Figure 2 shows the effects of a silencing construct targeted to p22 ^hox on expression in cell culture and kidney cortex in vivo and oxidative stress in rats during an angiotensin slow response. Figure 3 depicts mean ± SEM values comparing sham-infused rats (solid bars) with rats infused with Ang II for 10-12 days (open bars). Compared to sham: **, p < 0.01; ***, p < 0.005.

Figure 4 depicts mean ± SEM values (number of rats or number of studies) for data from the renal cortex and for mRNA (panel A) or protein (panel B) expression for p22phox and NADPH oxidase activity (panel C) 72 hours after a second iv injection of vehicle (open bars), siCont (diagonally shading) or sip22phox (doubling cross-hatched shading). Compared to vehicle: **, p < 0.01, ***, p < 0.005.

Figure 5 depicts mean ± SEM values for 8-isoprostane PGF2α excretion (panel A) and mean arterial pressure (panel B) before, and during infusion of Ang II. Compared to siCont: *, p < 0.05, **, p < 0.01 ***, p < 0.005.

Figure 6 depicts mean ± SEM values (number of rats) for mRNA and protein expression for p22phox in kidney cortex, and mean arterial pressure on day 12 of Ang II infusions after siCont (horizontal shading), sip22phox #1 (grey shading) or sip22phox #2 (black shading). Compared to siCont: **, pθ.01; ***, p<0.005.

Figure 7 depicts mean ± SEM values for mRNA expression for toll-like receptor-3 (panel A) or STAT-1 (panel B) in kidney cortex 72 hours after iv injection of vehicle (diagonal shading), siCont (horizontal shading), sip22phox #1 (grey shading) or sip22phox #2 (solid black shading). There were no significant differences among groups.

DETAILED DESCRIPTION OF THE INVENTION In part, the present invention relates to the discovery that inhibition of p22phox is useful to treat oxidative stress. In certain embodiments, the invention relates to methods and compositions for inhibiting p22phox. For example, in certain embodiments, the invention provides inhibitors of p22phox mRNA and protein expression. In other embodiments, the invention relates to the inhibition of p22phox interaction, direct or indirect, with other components of NADPH oxidase. For example, in certain embodiments, the invention provides methods and compositions for the prevention of formation at the cell membrane of complexes comprising p22phox and one or more of the following: gp91phox, p47phox, p67phox and Rac-1 or any homologs of gp91phox, p47phox, p67phox and Rac-1 (referred to collectively as ' 'homologs thereof ') .

Reactive oxygen species (ROS) and superoxide anion (O₂'^~ ) have been implicated in the development of hypertension in the Ang II slow pressor model, since hypertension is prevented by antioxidant molecules, such as a permeabilized form of superoxide dismutase (SOD) or an SOD mimetic nitroxide tempol (2, 3, 5, 6, 10, 11). Infusions of Ang II increase the activity of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase in blood vessels (12) and the kidney cortex (5, 10, 13). This complex enzyme, which was first described in phagocytes and later in blood vessels and the kidney, is composed of membrane-associated components of the flavoprotein catalytic core, gp91phox (also known as Nox-2) and p22phox (14). Activation requires phosphorylation of p47phox (15), and its assembly with p67phox (16) and Rac-1 at the membrane (14). Homologues of Nox-2 include Nox-1, which has been characterized in vascular smooth muscle cells (VSMCs) (12), and Nox-4 which has been characterized in the kidney (17). VSMCs and the kidneys express the complement of phagocytic NADPH oxidase components (12, 14, 18-20). NADPH oxidase has been identified as the major source of superoxide (O₂) in the kidney. It has been demonstrated that Ang II infused rats have increased blood pressure, oxidative stress, and upregulation of kidney p22^{ph ox}, an essential component of the NADPH oxidase enzyme. The p22phox is believed to dock the enzyme complex in the cell membrane and stabilize Nox proteins (14). There is co- localization of p22phox and O₂ ^" generation in atherosclerotic plaques from human blood vessels (21). The p22phox component is upregulated in blood vessels (19) and the kidneys (5, 13) of rats undergoing an Ang II slow-pressor response. Antisense constructs targeted at p22phox inhibit hypertrophy of cultured VSMCs to Ang II (20) and mice overexpressing p22phox in their VSMCs have an exaggerated hypertrophic response to Ang LI infusion (22). Recent studies with mice over-expressing p22^phox in blood vessels, however, show that despite increased aortic expression of p22^phox and Nox- 1 and increased O₂ ^" and H₂O generation, the basal blood pressure (BP) is not increased (23) and rises only slightly more rapidly during- infusion of Ang π (22). It would be advantageous to know more about the role of p22^phox in the physiologic response to Ang II.

Applicants hypothesized that the upregulation of kidney p22^phox mediates the increase in oxidative stress and NADPH oxidase activity in the Ang II infused animal. In order to test this hypothesis, Applicants developed an in vivo RNA interference strategy.

The term p22phox is used herein to refer to various naturally occurring p22phox homologs, as well as functionally similar variants and fragments that retain at least 80%, 90%, 95%, or 99% sequence identity to a naturally occurring p22phox (e.g., the nucleic acid and amino acid sequences for rat p22phox, GenBank Accession Nos. U18729 and AAA85865). The term specifically includes human p22ρhox nucleic acid and amino acid sequences (e.g., the nucleic acid and amino acid sequences for human p22phox presented in GenBank Accession Nos. NM 000101 and NP 000092) and the sequences presented in the Examples.

As used herein, the singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "a cultured cell" includes a plurality of such cultured cells. As used herein, "or" means "and/or." Variants of the amino acid sequence of the proteins of the present application include but are not limited to naturally occurring mature forms of the peptide, allelic/sequence variants of the peptides, non-naturally occurring recombinantly derived variants of the peptides, and orthologs and paralogs of the peptides. The term "binding" refers to a direct association between two molecules, due to, for example, covalent, electrostatic, hydrophobic, ionic and/or hydrogen-bond interactions. As used herein, the term "nucleic acid" refers to polynucleotides such as, for example, deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The term should also be understood to include analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single- stranded (such as sense or antisense) and double-stranded polynucleotides. The terms proteins and polypeptides are used interchangeably herein. The term "purified" as used herein with reference to the subject proteins, protein complexes, and nucleic acids (such as DNA or RNA) refers to a preparation of a protein, protein complex, or nucleic acid that is substantially free from proteins or nucleic acids that normally would be present with the protein, complex, or nucleic acid, e.g., in a cellular milieu or cell lysate. The term "RNA interference" or "RNAi" refers to any method by which expression of a gene or gene product is decreased by introducing into a target cell one or more double-stranded RNAs which are homologous to the gene of interest (particularly to the messenger RNA of the gene of interest). RNAi may also be achieved by introduction of a DNA:RNA hybrid wherein the antisense strand

(relative to the target) is RNA. Either strand may include one or more modifications to the base or sugar-phosphate backbone. For example, phosphorothioate can be a modification to the backbone of an RNAi construct. Any nucleic acid preparation designed to achieve an RNA interference effect is referred to herein as an RNAi construct. By RNAi construct is meant an agent that modulates expression of a target gene by an RNA interference mechanism. The RNAi constructs employed in certain embodiments of the subject invention are small interfering ribonucleic acids (siRNA), e.g., oligoribonucleotides, that are present in duplex structures, e.g., two distinct oligoribonucleotides hybridized to each other or a single ribooligonucleotide that assumes a small hairpin formation to produce a duplex structure. Where the RNA construct is a duplex structure of two distinct ribonucleic acids hybridized to each other, e.g., an siRNA, the length of the duplex structure typically ranges from about 15 to 30 bp, usually from about 15 to 29 bp, where lengths between about 20 and 29 bps, e.g., 21 bp, 22 bp, are of interest in certain embodiments. Where the RNA construct is a duplex structure of a single ribonucleic acid that is present in a hairpin formation, e,g, a short hairpin RNA (shRNA), the length of the hybridized portion of the hairpin is typically the same as that provided above for the siRNA type of agent or longer by 4-8 nucleotides. In certain embodiments, instead of the RNAi construct being an interfering ribonucleic acid, e.g., an siRNA or shRNA as described above, the RNAi construct may encode an interfering ribonucleic acid, e.g., an shRNA, as described above. For example, the RNAi construct may be a transcriptional template of the interfering ribonucleic acid. In these embodiments, the transcriptional template is typically a DNA that encodes the interfering ribonucleic acid. The DNA may be present in a vector, where a variety of different vectors are known in the art, e.g., a plasmid vector or a viral vector. The term "expression" with respect to a gene sequence refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein. For example, expression of p22phox mRNA results from transcription of the p22phox coding sequence and expression of p22phox protein results from transcription and translation of the p22phox coding sequence. The present invention describes a new approach to prevent or treat oxidative stress. In certain embodiments, the methods and compositions of the present invention are useful to limit damage caused by acute ischemia, such as that accompanying myocardial infarction, stroke, or vascular or cardiac surgery procedures; to prevent contrast associated with nephropathy (e.g., as assessed by radiologic imaging with an iodine-containing agent); to prevent or treat oxidative damage complicating procedures, including prolonged use of high tension oxygen in patients with respiratory distress, radiation therapy, severe infection, sepsis, and drug poisoning; or to reduce blood pressure and organ damage in hypertensive emergencies, malignant hypertension, or hypertension accompanying vasculitis. additional embodiments, the methods and compositions of the present invention are useful to treat, reduce the severity of or prevent clinical syndromes accompanied by oxidative stress, including heart failure, hypercholesterolemia, smoking, and kidney failure. In certain embodiments, the methods and compositions of the present invention are useful to treat or prevent oxidative stress that accompanies aging and atherosclerosis. Applicants have confirmed that an Ang II infusion causes a progressive increase in MAP ⁶' ¹², accompanied by increased expression of mRNA and protein for p22^phox in the kidneys⁶, increased renal cortical NADPH oxidase activity⁶' ¹² and increased excretion of the lipid peroxidation marker, 8-isoprostane PGF_2α ³⁷. h certain embodiments, the invention provides a simple RNAi strategy in vivo in rats utilizing an RNA complexing solution and a rapid, large volume injection. This prevented increased expression of a target mRNA and protein in the kidney and provides a model to investigate its biochemical and physiologic actions. Applicants have discovered that injection of sip22^phox (small interfering RNA to p22phox) prevents an increase in expression of p22^phox mRNA and protein in the kidney and prevents an increase in NADPH oxidase activity, oxidative stress and progressive rise in MAP of conscious rats during the second week of an Ang II infusion. In contrast, injection of a control siRNA sequence did not perturb these parameters. The effect was apparent between 48 and 96 hours after injection and was seen with two siRNAs targeted to different regions of the p22 ^hox cDNA. In both angiotensin II and volume dependent models of hypertension there are increases in oxidative stress in the kidneys and blood vessels and increased excretion of lipid peroxidation products. ROS have been assigned a critical role in vasoconstriction¹⁸' ⁴⁹, endothelial dysfunction^22, , vascular remodeling²¹ and atherosclerosis⁵¹ accompanying hypertension, hi the kidney, ROS can enhance many processes linked to the development of hypertension, including tubuloglomerular feedback ¹⁰, afferent arteriolar vasoconstriction⁵², NaCl reabsorption⁵ and oxygen usage⁵³. Ang II can upregulate many of the components of NADPH oxidase in addition to p22^phox in blood vessels or kidneys, including gp91^{phox 53}, p67 ^{hox 12}' ¹³ Nox-1¹⁵ and p47^{phox 15}. Mice with targeted deletions of p47^phox have a diminished increase in BP with Ang II⁵⁴. A gp91^phox blocking peptide prevents Ang Il-Induced endothelial dysfunction in rats⁵⁵. These can be a complex set of changes in NADPH oxidase during Ang II infusion. While Of^" can be generated by xanthine oxidase in the blood vessel of the spontaneously hypertensive rat (SHR)⁵⁶ and by an uncoupled nitric oxide synthase (NOS) in the deoxycorticosterone (DOCA)-salt model, these enzymes may be activated by ROS produced by the NADPH oxidase. The present disclosure shows a critical role for upregulation of p22^phox in the generation of oxidative stress and for about one third of the increase in BP, during prolonged infusion of Ang II in the rat. Thus, p22^phox may be a useful target for drug development to obviate oxidative stress and its consequences in the hypertensive kidney. In certain aspects, the present invention provides assays for identifying therapeutic agents which either interfere with or promote p22phox expression, such as p22phox mRNA or protein expression, hi certain aspects, the present invention also provides assays for identifying therapeutic agents that either interfere with or promote the formation of a complex comprising a p22phox polypeptide and one or more components of NADPH oxidase, such as p47phox. In certain embodiments, an agent of the application modulates (e.g., disrupts or pontentiates) an interaction between a p22phox protein and an NADPH oxidase component. For example, an agent of the application may disrupt interaction between a p22phox polypeptide and a gp91phox polypeptide or homolog thereof. Examples of NADPH oxidase components are gp91phox, Noxl, Nox3, Nox4, p47phox, p41nox, p40phox, p67phox, p51nox, Rac-1, and Rac-2. In a screening assay, the effect of a test agent may be assessed by, for example, assessing the effect of the test agent on kinetics, steady-state and/or endpoint of the reaction. In addition to high throughput screening activities, compounds identified in various assays may be screened in dose/response studies. A compound may be tested for its ability to completely inhibit interaction between a p22phox protein and an NADPH oxidase component. Screening data that is generated may be subjected to chemi-informatic analysis. Certain embodiments of the application relate to assays for identifying agents that bind to a p22phox polypeptide involved in oxidative stress. Agents can bind, for example, to a particular domain of a p22phox protein, such as proline-rich domain. A wide variety of assays may be used for this purpose, including labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, and immunoassays for protein binding. A purified protein may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions and design of test agents. In another embodiment, an assay detects agents that modulate interaction of one or more subject p22phox polypeptides involved in oxidative stress. In another embodiment, the assay detects agents that modulate the intrinsic biological activity of a p22phox polypeptide, such as a regulatory activity, e.g., binding to other cellular components. A variety of assay formats can be used. Assay formats that provide conditions appropriate for formation of protein complexes or enzymatic activity may be generated in many different forms and include assays based on cell-free systems, e.g., purified proteins or cell lysates, as well as cell-based assays that utilize intact cells. Simple binding assays can also be used to detect agents that bind to a p22phox protein. Such binding assays may also identify agents that act by inhibiting the interaction between a p22phox polypeptide and an interacting protein. Agents to be tested can be produced, for example, by bacteria, yeast or other organisms (e.g., natural products), produced chemically (e.g., small molecules, including peptidomimetics), or produced recombinantly. In certain embodiments, the test agent is a small organic molecule, such as a molecule, other than a peptide or oligonucleotide, which has a molecular weight of less than about 2,000 daltons. In many drug screening programs that test libraries of compounds and natural extracts, high throughput assays are desirable in order to maximize the number of compounds surveyed in a given period of time. Assays of the present application which are performed in cell- free systems, such as may be developed with purified or semi-purified proteins or with lysates, are often preferred as "primary" screens in that they can be generated to permit rapid development and relatively easy detection of an alteration in a molecular target which is mediated by a test compound. In in vitro systems, the assay is focused primarily on the effect of a test compound on the molecular target, as may be indicated by an alteration of binding affinity with other proteins or changes in enzymatic properties of the molecular target. In certain in vitro embodiments of the present assay, a complex comprising a p22phox polypeptide and an NADPH oxidase component comprises a mixture of at least semi-purified proteins. By semi-purified, it is meant that the proteins utilized in the mixture have been previously separated from other cellular or viral proteins. For instance, in contrast to cell lysates, the proteins involved in p22phox polypeptide complex formation are present in the mixture to at least 50% purity, relative to all other proteins in the mixture, and typically are present at 90-95% or greater purity. Assaying polypeptide complexes of the present invention, in the presence and absence of a test agent, can be accomplished in any vessel suitable for containing the reactants. Examples include microtitre plates, test tubes, and micro- centrifuge tubes. One embodiment of the present invention relates to drug screening assays that detect inhibitory agents on the basis of their ability to interfere with assembly or stability of the p22phox polypeptide complex. For example, a test compound (a compound to be assessed) is contacted with a mixture comprising a p22phox polypeptide and at least one interacting polypeptide, such as gp91phox. Detection and quantification of p22phox polypeptide complexes provides a means for determining the compound's efficacy at inhibiting or potentiating interaction between the two polypeptides. The efficacy of the compound can be assessed, for example, by generating dose response curves from data obtained using various concentrations of the test compound. Moreover, a control assay can also be performed to provide a baseline for comparison. In the control assay, the formation of complexes is detected and quantitated under the same assay conditions used to assess the formation of complexes in the absence of the test compound. Complex formation between p22phox polypeptides of the subject invention and an interacting polypeptide may be detected by a variety of techniques, many of which are effectively described above. For instance, modulation in the formation of complexes can be quantitated using, for example, detectably labeled proteins (e.g., radiolabeled, fluorescently labeled, or enzymatically labeled), by immunoassay, or by chromatographic detection. Surface plasmon resonance systems, such as those available from Biacore International AB (Uppsala, Sweden), may also be used to detect protein-protein interactions. Often, it will be desirable to immobilize one of the polypeptides to facilitate separation of complexes from uncomplexed forms of one of the proteins, as well as to accommodate automation of the assay. In an illustrative embodiment, a fusion protein can be provided which adds a domain that permits the protein to be bound to an insoluble matrix. For example, GST-p22phox fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined with a potential interacting protein, e.g., an ³⁵S-labeled polypeptide, and the test compound and incubated under conditions conducive to complex formation. Following incubation, the beads are washed to remove any unbound interacting protein, and the matrix bead-bound radiolabel determined directly (e.g., beads placed in scintillant), or in the supernatant after the complexes are dissociated, e.g., when microtitre plate is used. Alternatively, after washing away unbound protein, the complexes can be dissociated from the matrix, separated by SDS-PAGE gel, and the level of interacting polypeptide found in the matrix-bound fraction quantitated from the gel using standard electrophoretic techniques. In yet another embodiment, the p22phox polypeptide and potential interacting polypeptide can be used to generate an interaction trap assay (see also, U.S. Patent NO: 5,283,317, Zervos et al. (1993) Cell 72:223-232, Madura et al. (1993) J Biol Chem 268:12046-12054, Bartel et al. (1993) Biotechniques 14:920- 924, and Iwabuchi et al. (1993) Oncogene 8:1693-1696), for subsequently detecting agents which disrupt binding of the proteins to one and other. In particular, the method makes use of chimeric genes that express hybrid proteins. To illustrate, a first hybrid gene that comprises the coding sequence for a DNA-binding domain of a transcriptional activator can be fused in frame to the coding sequence for a "bait" protein, e.g., a polypeptide of sufficient length to bind to a potential interacting protein. The second hybrid protein encodes a transcriptional activation domain fused in frame to a gene encoding a "fish" protein, e.g., a potential interacting protein of sufficient length to interact with the polypeptide portion of the bait fusion protein. If the bait and fish proteins are able to interact, e.g., to form a complex, they bring into close proximity the two domains of the transcriptional activator.

This proximity causes transcription of a reporter gene which is operably linked to a transcriptional regulatory site responsive to the transcriptional activator, and expression of the reporter gene can be detected and used to score for the interaction of the bait and fish proteins. One aspect of the present invention provides protein preparations including a p22phox polypeptide and one or more interacting polypeptides, e.g., an NADPH oxidase component such as gp91phox or p47phox. h still further embodiments of the present assay, the p22phox polypeptide complex is generated in whole cells, taking advantage of cell culture techniques to support the subject assay. For example, as described below, the complex can be in a eukaryotic cell culture system, including mammalian and yeast cells. It may also be desirable to infect the cell with a virus of interest. Advantages to generating the subject assay in an intact cell include the ability to detect inhibitors which are functional in an environment more closely approximating that which therapeutic use of the inhibitor would require, including the ability of the agent to gain entry into the cell. Furthermore, certain of the in vivo embodiments of the assay, such as examples given below, are amenable to high throughput analysis of candidate agents. The components of the p22phox polypeptide complex can be endogenous to the cell selected to support the assay. Alternatively, some or all of the components can be derived from exogenous sources. For instance, fusion proteins can be introduced into the cell by recombinant techniques (such as through the use of an expression vector), as well as by microinjecting the fusion protein itself or mRNA encoding the fusion protein. hi many embodiments, a cell is manipulated after incubation with a candidate agent and assayed for an activity. Bioassays for activities associated with a p22phox polypeptide of the invention include assays for NADPH oxidase activity, such as that described in Wang et al. J Am Soc Nephrol 14:2783-2789 (2003); assessment of mean arterial pressure (MAP) in e.g., an animal model such as the Ang-II infused rat described in the Examples; and assays for the detection of excretion of lipid peroxidation markers, such as 8-isoprstane PGF_2o(8-Iso) and malondialdehyde (MDA). In certain embodiments, activities of p22phox polypeptides involved in, among other things, oxidative stress may include NADPH oxidase complex formation. p22phox polypeptide complex formation may be assessed by immunoprecipitation and analysis of co-immunoprecipiated proteins or affinity purification and analysis of co-purified proteins. Fluorescence Resonance Energy Transfer (FRET)-based assays or other energy transfer assays may also be used to determine complex formation. In a further embodiment, transcript levels may be measured in cells having higher or lower levels of p22phox polypeptide activity in order to identify genes that are regulated by these polypeptides. Promoter regions for such genes (or larger portions of such genes) may be operatively linked to a reporter gene and used in a reporter gene-based assay to detect agents that enhance or diminish p22phox polypeptide-regulated gene expression. Transcript levels may be determined in any way lαiown in the art, such as, for example, Northern blotting, RT-PCR, microarray, etc. Increased p22phox polypeptide activity may be achieved, for example, by introducing a strong expression vector. Decreased p22phox polypeptide activity may be achieved, for example, by siRNA, antisense, ribozyme, or gene knockout. h general, where the screening assay is a binding assay (whether e.g., protein-protein binding, e.g., agent-protein binding), one or more of the molecules may be joined to a label, where the label can directly or indirectly provide a detectable signal. Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g., magnetic particles, and the like. Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin. For the specific binding members, the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures. In further embodiments, the application provides methods for identifying targets for therapeutic intervention. A polypeptide that interacts with a p22phox polypeptide may be used to identify candidate therapeutics. Such targets may be identified by identifying proteins that associate with a p22phox protein by, for example, immunoprecipitation with an anti-p22phox antibody, in silico analysis of high-throughput binding data, two-hybrid screens, and other protein-protein interaction assays such as for example, GST- or his-tagged affinity chromatography, described herein or otherwise known in the art in view of this disclosure. Agents that bind to such targets, disrupt protein-protein interactions thereof, or inhibit a biochemical activity thereof may be used in such an assay. A variety of other reagents may be included in a screening assay. These include reagents like salts, neutral proteins, e.g., albumin, detergents that are used to facilitate optimal protein-protein binding and/or reduce nonspecific or background interactions. Reagents that may improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, or antimicrobial agents can be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, such as between 4°C and 40 °C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. In certain embodiments, a test agent may be assessed for inhibition of p22phox activity by assessing effects on an activity of a p22phox polypeptide involved in oxidative stress. For example, an activity of a p22phox polypeptide involved in oxidative stress may be its ability to interact with a protein subunit of NADPH oxidase. Activity may be affected by an agent that acts at one or more of the transcriptional, translational or post-translational stages. For example, an siRNA directed to a p22phox encoding gene will decrease activity, h other embodiments, the invention relates to a small molecule that interferes with a regulatory activity of a p22phox protein. RNAi originated with the finding that double stranded (ds) RNAs injected into Caenorhabditis elegans silenced genes with complimentary sequences³⁸. dsRNA can be processed in cells into siRNAs, about 20-22 nucleotides in length, by the enzyme Dicer^{25, 38"40}. These siRNAs are incorporated into an RNA-induced silencing complex (RISC) which silences complementary RNAs ²⁶. Hydrodynamic transfection of siRNAs has been used in mice to suppress a luciferase reporter gene in mouse liver ^{29, 30}, whereas other strategies using lipid-incorporated constructs or naked RNAs have also been applied successfully to silence genes in the liver of mice in vivo. The hydrodynamic method developed in mice involves rapid injection over about 10 seconds of a volume equivalent to the blood volume to transiently increase venous pressure, which favors uptake of siRNA into cells²⁷. This has been used successfully in mice to silence genes in organs with high blood flow, including the kidney^41"45, liver^{26, 28}, lung⁴⁰ and blood vessel ²⁷. Described herein is a modified strategy of rapid injection of siRNAs in a gene complexing solution. Applicants demonstrated that this was effective in reducing the expression of the target mRNA in vivo in the kidney cortex, despite a smaller volume injected (when factored for body weight) than has been used in mice. There was an equivalent 50% reduction in the mRNA and protein expression for p22^phox, matched by an equivalent reduction in the target enzyme activity in the kidney cortex 72 hours after siRNA injection. The increase in NADPH oxidase activity in the kidney with Ang II depends on increased p22^pho protein expression. i certain embodiments of the invention, similar effects of RNAi may be achieved in rats in other organs besides the kidney. Increased efficiency and prolonged duration of the therapeutic effects may be achieved with alternate RNAi constructs or methods of delivery. In certain embodiments, the invention relates to use of materials and methods for effecting knockdown of p22^phox genes by means of RNA interference (RNAi). In other embodiments, the invention relates to materials and methods for modulating (e.g., reducing) mRNA or protein expression of any gene in a mammal (e.g., a rat) by means of RNAi. For example, siRNA for effecting knockdown of a target gene in a rat can be administered with a gene complexing solution intravenously to the rat. hi certain embodiments, the RNA can be administered with other agents, such as RNAse inhibitors. The subject methods are, in certain embodiments, suitable for introduction of nucleic acids into a target cell of a host, such as a rat or a human. The double stranded oligonucleotides used to effect RNAi are preferably less than 30 base pairs in length and, more preferably, comprise about 25, 24, 23, 22, 21, 20, 19, 18 or 17 base pairs of ribonucleic acid. Optionally the dsRNA oligonucleotides of the application may include 3' overhang ends. 2-nucleotide 3' overhangs may be composed of ribonucleotide residues of any type and may even be composed of 2 '-deoxythymidine resides, which lowers the cost of RNA synthesis and may enhance nuclease resistance of siRNAs in the cell culture medium and within transfected cells (see Elbashir et al. (2001) Nature 411 : 494-8). For example, dsRNAs may be synthesized chemically or produced in vitro or in vivo using appropriate expression vectors. For example, synthetic RNAs include 21 nucleotide RNAs chemically synthesized using known methods (e.g., Expedite RNA phophoramidites and thymidine phosphoramidite (Proligo, Germany). Synthetic oligonucleotides can be deprotected and gel-purified using methods known in the art (see e.g., Elbashir et al. (2001) Genes Dev. 15: 188-200). Longer RNAs may be transcribed from promoters, such as T7 RNA polymerase promoters. A single RNA target, placed in both possible orientations downstream of an in vitro promoter, will transcribe both strands of the target to create a dsRNA oligonucleotide of the desired target sequence. In certain embodiments of the invention, the RNA species will be designed to include a portion of nucleic acid sequence represented in a p22^phox nucleic acid. Methods and compositions for designing appropriate oligonucleotides maybe found, for example, in U.S. Patent Nos. 6,251,588, the contents of which are incorporated herein by reference. Further compositions, methods and applications of RNAi technology are provided in U.S. Patent Application Nos. 6,278,039, 5,723,750 and 5,244,805, which are incorporated herein by reference. Short interfering RNAs (siRNAs) have been applied by Applicants to silence the ρ22^phox gene in the rat in vivo, hi vitro, siRNAs can activate PKR, which induces an interferon-stat dependent pathway and cytokine inducible genes. Therefore, in certain embodiments of the invention, the lowest effective dose of siRNA targeted to p22^phox is employed. Applicants have demonstrated that three days after iv injection of 50μg of siRNA targeted to p22^phox in rats undergoing an Ang II slow pressor response, p22 ^ox mRNA expression in the kidneys is reduced by 50%). Additionally, this is matched by a 50% reduction in excretion of 8- isoPGF_2α (8-isoprostane), which is a marker of oxidative stress. In certain aspects, the invention relates to RNAi, ribozyme, antisense and other nucleic acid-related methods and compositions for manipulating (typically decreasing) an activity of a p22phox polypeptide.

Ribozyme molecules designed to catalytically cleave mRNA transcripts can also be used to prevent translation of subject mRNAs and/or expression (see, e.g., PCT International Publication WO90/11364, published October 4, 1990, Sarver et al. (1990) Science 247:1222-1225 and U.S. Patent No. 5,093,246). Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. (For a review, see Rossi (1994) Current Biology 4: 469-471). The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage event. The composition of ribozyme molecules preferably includes one or more sequences complementary to an mRNA of a p22^phox polypeptide of the subject invention, and the a catalytic sequence responsible for mRNA cleavage or a functionally equivalent sequence (see, e.g., U.S. Pat. No. 5,093,246, which is incoφorated herein by reference in its entirety). Gene targeting ribozymes contain a hybridizing region complementary to two regions, each of at least 5 and preferably each 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides in length of an mRNA. hi addition, ribozymes possess highly specific endoribonuclease activity, which autocatalytically cleaves the target sense mRNA. The present invention extends to ribozymes which hybridize to a sense mRNA encoding a gene of interest such as a therapeutic drug target candidate gene, such as p22^phox, thereby hybridizing to the sense mRNA and cleaving it, such that it is no longer capable of being translated to synthesize a functional polypeptide product. A further aspect of the invention relates to the use of the isolated "antisense" nucleic acids to inhibit expression, e.g., by inhibiting transcription and/or translation of a nucleic acid of the invention. The antisense nucleic acids may bind to the potential drug target by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix, hi general, these methods refer to the range of techniques generally employed in the art, and include any methods that rely on specific binding to oligonucleotide sequences. The antisense oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553- 6556, Lemaitre et al, 1987, Proc. Natl. Acad. Sci. 84:648-652, PCT Publication No. W088/09810, published December 15, 1988) or the blood- brain barrier (see, e.g., PCT Publication No. W089/10134, published April 25, 1988), hybridization- triggered cleavage agents. (See, e.g., Krol et al., 1988, BioTechniques 6:958- 976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc. Gene expression of e.g., p22^{p ox}, can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the gene (e.g., the promoter and/or enhancers) to form triple helical structures that prevent transcription of the gene in target cells in the body. (See generally, Helene, C. 1991, Anticancer Drug Des., 6(6):569-84, Helene, C, et al, 1992, Ann. N.Y. Acad. Sci., 660:27-36, and Maher, L.J., 1992, Bioassays 14(12):807-15). A further aspect of the invention relates to the use of DNA enzymes to inhibit expression of a gene such as p22^phox. DNA enzymes incorporate some of the mechanistic features of both antisense and ribozyme technologies. DNA enzymes are designed so that they recognize a particular target nucleic acid sequence, much like an antisense oligonucleotide, however much like a ribozyme they are catalytic and specifically cleave the target nucleic acid. Briefly, to design a DNA enzyme that specifically recognizes and cleaves a target nucleic acid, a unique target sequence must first be identified. This can be done using the same approach as outlined for antisense oligonucleotides. The unique or substantially unique sequence is typically a G/C rich sequence of approximately 18 to 22 nucleotides. High G/C content helps insure a stronger interaction between the DNA enzyme and the target sequence. Methods of making and administering DNA enzymes can be found, for example, in US 6110462. Additionally, like antisense oligonucleotides, DNA enzymes can be optionally modified to improve stability and improve resistance to degradation. Antisense RNA and DNA, ribozyme, RNAi and triple helix molecules of the invention may be prepared by any method known in the art for the synthesis of DNA and RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines. Moreover, various modifications to nucleic acid molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone. In certain aspects, the invention relates to agents that modulate an activity of a p22^phox polypeptide. In certain further aspects, the invention relates to agents that modulate (e.g., inhibit or potentiate) the interaction between a p22^phox polypeptide and NADPH oxidase component. In certain aspects, the invention relates to small molecules, peptidomimetics, peptides, or nucleic acids. Agents contemplated by the invention include compounds selected from libraries of either potential activators or potential inhibitors. A number of different libraries may be used for the identification of small molecule modulators, including chemical libraries, natural product libraries, and combinatorial libraries comprised of random peptides, oligonucleotides or organic molecules. Chemical libraries include libraries that comprise random chemical structures, some of which are analogs of known compounds or analogs of compounds that have been identified as "hits" or "leads" in other drug discovery screens, some of which are derived from natural products, and some of which arise from non-directed synthetic organic chemistry.

Natural product libraries include libraries that are collections of microorganisms, animals, plants, or marine organisms that are used to create mixtures for screening by: (1) fermentation and extraction of broths from soil, plant or marine microorganisms or (2) extraction of plants or marine organisms. Natural product libraries include polyketides, non-ribosomal peptides, and variants (non- naturally occurring) thereof. Combinatorial libraries include libraries that are composed of large numbers of peptides, oligonucleotides, or organic compounds as a mixture. These libraries are relatively easy to prepare by traditional automated synthesis methods, PCR, cloning, or proprietary synthetic methods. Of interest are- non-peptide combinatorial libraries. Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombinatorial, polypeptide, antibody, and RNAi libraries. Identification of modulators through use of the various libraries described herein permits modification of the candidate "hit" or "lead" to optimize the capacity of the "hit" to modulate activity. Antibodies can be used as modulators of the activity of a particular protein, such as p22^phox. Antibodies can have extraordinary affinity and specificity for particular epitopes. Antibodies may bind to a particular protein in such a way that the binding of the antibody to the epitope on the protein can interfere with the function of that protein. For example, an antibody may inhibit the function of a p22^phox polypeptide of the application by sterically hindering the proper interactions between the ρ22^phox polypeptide and another protein, such as p47phox, or proper interactions with other molecules or occupying active sites. Alternatively the binding of the antibody to an epitope on a p22^phox protein may alter the conformation of the p22^phox protein such that it is no longer able to properly function.

Monoclonal or polyclonal antibodies can be made using standard protocols (see, e.g., Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988). A mammal, such as a mouse, a hamster, a rat, a goat, or a rabbit can be immunized with an immunogenic form of the peptide. Techniques for confe ing immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art.

Both monoclonal and polyclonal antibodies (Ab) directed against a particular polypeptides, and antibody fragments such as Fab, F(ab)2, Fv and scFv can be used to block the action of a particular protein. Such antibodies can be used either in an experimental context to further understand the role of a p22^phox protein in a biological process, or in a therapeutic context.

Variant polypeptides and peptide fragments can agonize or antagonize the function of a particular protein. Examples of such variants and fragments include constitutively active or dominant negative mutants of a particular protein. Agonistic or antagonistic variants may function in any of a number of ways, for example, as described herein. One of skill in the art can readily make variants comprising an amino acid sequence at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to a p22^phox polypeptide, or a fragment thereof, and identify variants that agonize or antagonize the function of the p22^phox polypeptide (including but not limited to its ability to interact or associate with other proteins or molecules). Similarly, one can make peptide mimetics (e.g., peptidomimetics) that agonize or antagonize the function of a particular protein. Methods of making various peptide mimetics are well known in the art, and one of skill can readily make a peptide mimetic of a p22^phox polypeptide or fragment thereof, and identify mimetics that agonize or antagonize the function of the polypeptide (including but not limited to its ability to interact or associate with other proteins or molecules).

Small organic molecules can agonize or antagonize the function of a particular protein, such as p22phox. Examples of small organic molecules include carbon contain molecules having a molecular weight less than 2500 amu, more preferably less than 1500 amu, and even more preferably less than 750 amu.

Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining The LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit large therapeutic indices are prefened. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods of the application, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. Pharmaceutical compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients. Thus, the compounds and their physiologically acceptable salts and solvates may be formulated for administration by, for example, injection, inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration. In certain embodiments, a composition of the application comprises an RNAi mixed with a delivery system, such as a liposome system, and optionally including an acceptable excipient. In other embodiments, a pharmaceutical composition comprises an RNAi construct in a gene complexing solution, such as a polymer from TransIT in vivo Gene Delivery System. The methods and compositions of the invention can be administered to a vascularized multi-cellular organism, which is a multi-cellular organism that includes a vascular system. Multi-cellular organisms of interest include plants and animals, where animals are of particular interest, particularly vertebrate animals that have a vascular system made up of a system of veins and arteries through which blood is flowed, e.g., in response to the beating of a heart. Animals of interest are mammals in many embodiments. Mammals of interest include; rodents, e.g., mice, rats; livestock, e.g., pigs, horses, cows, etc., pets, e.g. dogs, cats; and primates, e.g. humans. In certain embodiments, the multi-cellular organism is a human, h other embodiments, the multi-cellular organism is a non-human mammal, e.g. a rodent, such as a mouse, rat, etc. The compounds of the application can be formulated for a variety of routes of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA. For systemic administration, oligomers of the invention may be administered by injection, including intramuscular, intravenous, intraperitoneal, and subcutaneous. For injection, the compounds of the application can be formulated in liquid solutions, such as in physiologically compatible buffers such as Hank's solution or Ringer's solution, hi addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included. For oral administration, the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpynolidone or hydroxypropyl methylcellulose), fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate), lubricants (e.g., magnesium stearate, talc or silica), disintegrants (e.g., potato starch or sodium starch glycolate), or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats), emulsifying agents (e.g., lecithin or acacia), non-aqueous vehicles (e.g., ationd oil, oily esters, ethyl alcohol or fractionated vegetable oils), and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate. Preparations for oral administration may be suitably formulated to give controlled release of the active compound. For buccal administration the compositions may take the form of tablets or lozenges formulated in conventional manner. For administration by inhalation, the compounds for use according to the present application are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoro ethane, carbon dioxide or other suitable gas. h the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch. The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder fonn for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. The compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt. Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the fonnulation. Such penetrants are generally lαiown in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be through nasal sprays or using suppositories. For topical administration, the oligomers of the application are formulated into ointments, salves, gels, or creams as generally lαiown in the art. A wash solution can be used locally to treat an injury or inflammation to accelerate healing. The compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. For therapies involving the administration of nucleic acids, the oligomers of the application can be formulated for a variety of modes of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA. For systemic administration, oligomers of the invention may be administered by injection, including intramuscular, intravenous, intraperitoneal, intranodal, and subcutaneous for injection, and can be formulated in liquid solutions, such as in physiologically compatible buffers such as Hank's solution or Ringer's solution, hi addition, the oligomers may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included. Systemic administration can also be by transmucosal or transdermal means, or the compounds can be administered orally. For transmucosal or transdermal administration, penetrants appropriate to the banier to be permeated are used in the fonnulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be through nasal sprays or using suppositories. For oral administration, the oligomers are formulated into conventional oral administration forms such as capsules, tablets, and tonics. For topical administration, the oligomers of the application are formulated into ointments, salves, gels, or creams as generally lαiown in the art. The practice of the present application will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, virology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are described in the literature. See, for example, see, for example, Current Protocols in Molecular Biology, eds. Roger Brent et al, John Wiley & Sons: 2003; Molecular Cloning: A Laboratory Manual, 3rd Ed., ed. by Sambrook and Russell (Cold Spring Harbor Laboratory Press: 2001); the treatise, Methods hi Enzymology (Academic Press, Inc., N.Y.); Using Antibodies, Second Edition by Harlow and Lane, Cold Spring Harbor Press, New York, 1999; Current Protocols in Cell Biology, ed. by Bonifacino, Dasso, Lippincott-Schwartz, Harford, and Yamada, John Wiley and Sons, Inc., New York, 1999. The invention now being generally described, it will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.

EXAMPLE 1. Applicants designed a 21 base pair double-stranded RNA molecule (siRNA) homologous to part of the DNA sequence encoding the p22^phox subunit of NADPH oxidase (GenBank Accession No. U18729). The siRNA construct was validated in tissue culture using rat aortic vascular smooth muscle cells (VSMCs) prior to infusion into the rat. VSMCs were each treated with vehicle, non-silencing siRNA (NSsiRNA), or siRNA and harvested after 30 hours for p22^phox mRNA quantification using real time PCR (RT-PCR). Sprague-Dawley rats weighing 200 grams were infused with vehicle or 50 μg of the same siRNA in 10 ml PBS over 1 minute via the internal jugular vein, and their kidneys were harvested after 48 hours for p22^phox mRNA quantification using RT-PCR. VSMCs treated with siRNA had a 56% reduction in ρ22^phox expression compared to NSsiRNA (ΔC_τNSsiRNA=4.97±.03, ΔC_T siRNA=6.17±.20; ΔΔC_T siRNA vs NSsiRNA=1.2±.20, ρ<.01). However, there was no difference in p22^phox expression in VSMCs between the no treatment, vehicle or NSsiRNA groups (ΔC_T no treatment=4.74±0.46, ΔC_T vehicle=5.02±.13, ΔC_τNSsiRNA=4.97±.03, ns). Rats treated with siRNA had a 50% reduction in p22^phox mRNA expression compared to vehicle infused rats (ΔC_T vehicle=1.25±.18, ΔC_T siRNA=2.26±.21, ΔΔC_T =1.01±.27, p<.05, n=3).

RNA interference is an effective technique to inhibit the expression of p22^phox mRNA in vivo. This technique can be used to examine the effects of p22^phox silencing on oxidative stress markers, blood pressure, renal blood flow, and salt sensitivity in the Ang II infused rat as well as in other rat models. Materials and Methods (in vitro and in vivo p22^phox)

siRNA

Synthetic siRNAs were obtained from Qiagen as annealed duplexes. The sense sequence to the p22ρhox target is AUUACUACGUCCGGGCUGU (SEQ ID NO: 1) and the sense sequence for the control (non-silencing) siRNA is

UUCUCCGAACGUGUCACGU (SEQ ID NO: 2). There is no corresponding mammalian target for the control siRNA sequence.

Cell culture and transfections

Rat aortic vascular smooth muscle cells (VSMCs) were grown at 37 degrees in an atmosphere of 5% CO in Dulbecco's modified Eagle's medium supplemented with 2mM glutamine (DMEM/F-12, Biofluids) plus 100 units/ml penicillin, 100 μcg/ml streptomycin, and 10% fetal bovine serum (FBS). Twenty four hours prior to transfection the VSMCs were trypsinized at 90% confluency and diluted 1:10 with DMEM/F-12 + FBS and antibiotics and then transfened in 4 ml aliquots to 6 well plates for a goal of 5 x 10⁴ cells/ml. On the day of the transfection the wells were aspirated and replaced with 2 ml of DMEM + FBS without antibiotics. For each well, 3.36 μcg of siRNA duplex were transfected with oligofectamine (Invitrogen) according to a previously published protocol (Elbashir, et al. Methods 26 (2002), 199-213). VSMCs treated with vehicle only received oligofectamine but no siRNA.

siRNA treatment in vivo

All experiments in vivo were performed using 7-8 week old male 225-275 gram Sprague-Dawley rats. All rats underwent subcutaneous mini-osmotic pump (Alzet, model 2002) containing angiotensin II (Angll) 200 ng/kg/minute. On the ninth day of the Angll treatment, the rats underwent anesthesia induction using aerosolized halothane and then continuous aerosolized isoflourane (Vapomatic). The animals were prepped and draped in a sterile fashion and the left internal jugular was exposed by blunt dissection and cannulated with polyethylene tubing (PE-50). Frozen aliquots of 10 or 50 μcg of siRNA stock solution were thawed and diluted in 10 ml of nuclease-free IX Phosphate Buffered solution (PBS), and the lot was infused over 15 seconds. The PE-50 tubing was flushed with 0.5 cc PBS and then removed, followed by ligation of the internal jugular vein. The incision was then closed with sterile wound clips and the animals were allowed to recover.

Quantitative PCR

VSMCs and kidney cortex were harvested 48 hours after siRNA administration. The media from VSMCs was aspirated and the cells were washed with sterile PBS. The cells were lysed and collected using Trizol reagent (hivitrogen).

Urine 8-isoprostane measurements

One day prior to siRNA administration (day 8 of Angll treatment), rats were placed in metabolic diuresis cages (Nalgene) for 24 hour urine collection (pre- operative collection). The morning following siRNA infusion the rats were placed back in the diuresis cages (post-operative day 1) for a 24 hour urine collection, and they remained in the cages for the next 4 days (post-operative days 2-5). After each 24 hour period the rats were removed transiently from the cages to allow thorough rinsing of the cages and collection tubes. The urine specimens were centrifuged to allow removal of food and waste. Applicants have developed a targeted gene silencing strategy with p22^phox since measurements of oxidative stress by renal excretion of 8-isoPGF _α provide a quantitative, non-invasive index that can be followed sequentially in conscious rats to define the concentration- and time-dependent physiologic consequences of RNA silencing in vivo. From a group of siRNA constructs, Applicants selected one that reduced p22^phox mRNA expression by 50%, compared to scrambled Si in cultured rat VSMCs (Fig. 2A). An Ang II slow pressor response generates oxidative stress and enhances expression of p22^phoxin the kidney. Applicants evaluated the dose- and time-dependent effects of iv Si RNA to p22^phox in rats during days 9-14 of Ang II (200ngkg^"1 min sc). Compared to scrambled siRNA, an siRNA to ρ22^phox (50μgrat^" Hv) reduced mRNA expression in the kidneys at 3 days by 50% (Fig. 2B) accompanied by a 50% reduction in the execution of 8-isoPGF_2α at this time (Fig. 2C). Higher doses were no more effective, but data suggest that 5μg may be sufficient.

EXAMPLE 2.

Methods Animal preparation and studies ofisoprostane excretion and mRNA and protein expression: Studies were approved by the Georgetown University Animal Care and Use Committee. Experiments were performed on male Sprague-Dawley rats weighing 280 to 350g maintained on a synthetic casein-based diet with precisely regulated NaCl content (Na⁺ 0.3g ^• lOOg^"1; Teckland Inc., Madison, WI). Rats were maintained in individual cages under conditions of constant temperature and humidity and exposed to 12 hour cycles of light and dark with unrestricted water intake. Under brief anesthesia with 1-2% isoflurane, an osmotic minipump (model

202 Alzet Corporation, Palo Alto, CA) was inserted sc in the nape of the neck and filled with human Ang II (Peninsula Laboratories, San Carlos, CA) to deliver 200 ng^{"1 •} kg^"1' min^"1. This protocol provides a gradual increase in MAP over two weeks with increases in oxidative stress as assessed from excretion of lipid peroxidation markers 8-isoprostane PGF_2cϊ (8-Iso) and malondialdehyde (MDA), and increased expression of p22^phox mRNA¹³ and protein⁵ in the kidney. Before starting Ang II, a cannula was inserted into a femoral vein, tunneled subcutaneously to the nape of the neck, filled with heparin-saline and plugged. This was used subsequently for intravenous (iv) injection of siRNA on vehicle. The effects of an infusion of Ang II on renal expression of mRNA and protein for p22^phox, renal NADPH oxidase activity, excretion of 8-isoprostane PGF_2α and mean arterial pressure (MAP) were assessed. Eleven days after sham operations (sham) or insertion of Ang II minipumps (Ang II), rats were placed in metabolic cages and on day 12 a 24 hour urine was collected for excretion of 8-Iso. On the next day rats were sacrificed for harvesting kidneys. Separate groups of rats were equipped with telemetric BP recorders (see below) and, after two weeks for recovery, received sham or Ang II infusions. MAP was recorded on day 12. The effects of sip22^phox on the excretion of 8-Iso during the hypertensive phase of an Ang II slow pressor response were also assessed. Rats were infused with Ang II (n=6 to 8 per group) and were habituated to metabolic cages on day 7 of Ang infusion. Twenty-four hour urine collections were undertaken on day 8-13 of Ang II infusion for excretion of 8-Iso, as described previously ¹³. On day 9, rats received 6 ml of fluid iv containing either a vehicle or 50μg of a control siRNA (siCont)or sip22^phox given by rapid iv bolus over 10 seconds ^26"30. Additionally, Applicants assessed the effects of sip22^phox on the renal cortical expression of mRNA and protein for p22 ^hox and NADPH oxidase activity and the MAP of conscious rats. Ten days after insertion of BP telemeters, BP was monitored for 5 days and averaged for basal values, after which rats were briefly anesthized for insertion of a femoral catheter and osmotic minipumps (see above). Rats received 100 μg of siRNA on day 5 of Ang II, and 50 μg on day 8 (or equivalent vehicle). The siRNA was complexed with a polymer from TransIT in vivo Gene Delivery System and delivered according to the manufactures recommendations (Minis hie, Madison, WI). Rats were sacrificed 72 hours after the second injection of siRNA. Under thiobarbital anesthesia (Inactin; lOOmg- kg^"1 ip; Research Biochemicals hie, Natick, MA) the kidneys were flushed free of blood with phosphate buffered saline (PBS), harvested, and the cortex dissected and frozen for subsequent analysis of mRNA, protein and NADPH oxidase activity. Telemetric BP recording and injection of siRNAs: Under brief anesthesia (1- 2% isoflurane), radiotelemetric BP transmitters were inserted into the abdominal cavity and connected to a catheter glued into the terminal aorta ³¹. Fourteen days were allowed for recovery. siRNA construction and validation: RNAi duplexes of 21 nucleotides targeting coding regions of p22^phox (siRNA) were generated by a Tuschl-based algorithm³² (Qiagen, Valencia, CA). They were validated in vitro using a rat VSMC line (A- 10 cells, ATCC, Manassas, VA). Cells were cultured at 37°C in six -well plates at a density of 10⁵ cells per well in Dulbecco's Modified Eagles Medium (DMEM) supplemented with 4mM 1-glutamine and 10% FBS (ATCC, Manassas, VA). Cells were transfected with siRNA targeted to p22^phox (siρ22^phox) or a control, non-targeted siRNA (siCont) in serum free media using Lipofectamine 2000 (Invitrogen hie, Carlsbad, CA) and harvested after 24 hours. The mRNA was expressed relative to 18s (realtime PCR) or glyceraldehyde-3-phosphate dehydrogenase (G3PDH) (conventional PCR)^{13, 33}. The two sip22 ^hox constructs selected reduced mRNA expression up to 90% compared to siCont or vehicle (p<0.005). The target site in p22^phox cDNA (gene bank accession #: U18729) of the two constructs selected are: 299-320 (AAATTACTACGTCCGGGCTGT) (SEQ ID NO: 3) and 590-611 bp (AACCCAATTCCAGTGACAGAT) (SEQ ID NO: 4). The non-silencing control siRNA sequence AATTCTCCGAACGTGTCACGT (SEQ ID NO: 5) (catalogue # 1022076; Qiagen, Valencia, CA) has no homology to any sequence in the mammalian genome. mRNA isolation and RT-PCR: Total RNA was isolated from the kidney cortex with the guanidinium-based lysis buffer method with RNA quous 4 PCR Kit (Ambion, Austin, TX) and treated with DNasel. RT reactions were performed using

Superscript III first strand cDNA synthesis (Invitrogen, Carlsbad, CA). For real time PCR (ABI PRISM 7700, ABI, Foster City, CA) of mRNA for p22^phox, the taqman probe set used was as reported ' ' : Forward 5' ACCTGACCGCTGTGGTGAA-3' (SEQ ID NO: 6) Reverse 5'-GTG GAG GAC AGC CCG GA-3' (SEQ ID NO: 7). In series 3 experiment, we used conventional RT-PCR reaction with the following p22^phox primer set: Forward 5'- TTGTTGCAGGAGTGCTCATC-3'(SEQ ID NO: 8) and Reverse 5'- CTGCCAGCAGGTAGATCACA-3'(SEQ ID NO: 9). For conventional RT-PCR of Signal Transducers and Activators Transcription -1 (STAT-1) (Accession # AF205604) we used: Forward: 5 '-AGAGCGACCAGAAACAGGAA-3 '(SEQ ID NO: 10). Reverse: 5'-GCTCTCTGCAACAATGGTGA-3' (SEQ ID NO: 11) for toll-like receptor-3 (Tlr-3) we used: (Accession # NM 198791) Forward: 5'- AGCCTTCAACGACTGATGCT-3' (SEQ ID NO: 12); Reverse: 5'- GGAAATTAACGGGACCACCT-3' (SEQ ID NO: 13). The comparative ΔC_T method was used for relative quantification and statistical analysis of real-time PCR³⁴. Protein isolation, quantification and immunoblotting: The kidney cortex was dissected and homogenized in ice-cold SDS lysis buffer {80 mM Tris HCl (pH7.5), 1% SDS, lmM EDTA, ImM NaF} containing a protease inhibitor cocktail (Focus- Protease Areest, St. Louis, MO). The sample homogenates were centrifuged at 12,500 rpm for 15 min at 4°C and western blotting was carried out on the supematants as reported previously^{35, 3} . Briefly, the proteins were quantified using Biorad Protein Assay (Bio-Rad Laboratories, Hercules, CA). For each sample, 50 or lOOug of protein was loaded on to precast polyacrylamide TRIS-HCL 12.5 or 15% SDS-PAGE gels (Bio-Rad Laboratories, Hercules, CA), run on a Criterion cell system and transferred to a nitrocellulose membrane in a Transblot cell (Bio-Rad Laboratories, Hercules, CA). We used a monoclonal antibody for p22^phox at a dilution of 1 :2000²³. Membranes were washed in TBST and exposed to horseradish peroxidase-labeled secondary antibody for 30 minutes: rabbit anti-mouse (1:10,000 Kirkegaard and Perry Laboratories, Gaithersburg, MD). After washing with TBST, the bands were visualized with a luminol-based chemiluminescence substrate (LumiGLO, Kirkegaard and Peny Laboratories, Gaithersburg, MD). The blots were stripped with western blot stripping buffer (Pierce, Rockford, IL) and probed for equal loading using /3-actin primary antibody (Sigma, St. Louis, MO). Chemical Methods: The methods used for collection, extraction, purification, and analysis of urinary 8-isoprostane PGF _αhave been described previously, together with validation against GCMS . Statistical analysis: Statistical tests used two factors, repeated-measures analysis of variance (ANOVA). Where appropriate, post hoc comparisons were made between groups using Dunnett's t test. Statistical significance was accepted at p<0.05. Data are represented as means ± SEM. Results Pilot studies of isoprostane excretion of rats infused with Ang II were undertaken to establish optimal iv doses of sip22^phox constructs. Two days after 5μg sip22^phox, the excretion of 8-Iso was reduced by 20± 10% (n=6) whereas 50 μg reduced excretion more consistently and significantly by 50% (see below). A dose 200 μg produced more variable results. siCont had no effect. Maximal effects were apparent at 72 h after injection. Therefore, a dose of 50-100 μg was used, and organs were harvested 72 hours after injection. Compared to rats that received a sham infusion, those receiving Ang II for 12 days had increased renal cortical expression of mRNA and protein for p22^phox, increased renal cortical NADPH oxidase activity, increased excretion of 8-Iso and increased MAP (Figure 3). As shown in Figure 4, studies in rats infused with Ang II showed a 50% reduction in the expression of p22^{p ox} mRNA and protein and in the activity of

NADPH oxidase in kidney cortex 72 hours after the second of two iv injections of sip22^phox, compared to vehicle or siCont. Comparison of data in Figures 3 and 4 show that relative to sham infused control rats, those infused with Ang II and given sip22^phox had similar values for renal expression of mRNA and protein for p22^phox and NADPH oxidase activity.

Therefore, the siRNA strategy effectively prevented Ang Il-induced changes in these parameters. Before injection of vehicle or siRNA, the 8-isoprostane PGF_2α excretion of rats infused with Ang II averaged 12.5± 1.8 pg-24h^_1. The excretion of Ang-II infused rats that received a vehicle or siCont increased progressively over 4 days

(Figure 5A). hi contrast, those that received sip22^phox had no significant increase over this time. This resulted in a significantly (p<0.05) reduced excretion of 8- isoprostane PGF_2o: in this group, relative to siCont, from 48-96 hours after injection by approximately 50%. Ang II caused progressive increases in MAP after the first day of Ang II infusion (Figure 5B). In rats receiving injections of vehicle or siCont, the MAP rose to a plateau by day 9 of circa 170 mmHg. In contrast, in those that received sip22^phox, the MAP did not increase significantly from the time of the first injection

(day 5; 132-1-3 mmHg) to 72 hours after the second injection (day 11; 141±5 mmHg).

However, the MAP remained significantly (p<0.005) above levels of sham infused rats of 107 ± 4mmHg. Therefore, an increase in p22^phox expression in the kidney can account for up to about one third of the increase in blood pressure during a 12 day infusion of Ang II. As shown in Figure 6, the sip22^phox#l and #2 produced equivalent reduction in both p22^phox mRNA (siCont: 1.01 ± 0.02, n=6; sip22^phox #1 : 0.52 ± 0.03, n=6; sip22^phox #2: 0.45 ± 0.03, n= 4 relative to G3PDH), p22^phox protein expression (siCont 0.28± 0.02; sip22^phox#l: 0.14±0.02; sip22^phox #2: 0.14±0.02, relative to β actin), NADPH oxidase activity (siCont: 54,500±7,500; sip22^phox #1 :29,00±YC; sip22^phox#2: 30, OOO±YC, counts- mg protein^"1 -5 min^"1) and similar values for MAP (siCont: 171±4; sip22^phox #1:139± 7; sip22^phox #2: 147±8mmHg). Therefore, data for sip22^phox #1 and #2 are presented together. siRNA administration can activate off-target effects via cellular signaling through the toll-like receptor 3 (TLR-3) with synthesis of interferons that signal via STAT-1. However, we found no changes in the mRNA expression for TLR-3 and STAT-1 in the kidney cortex 72 hours after injection of siRNAs, relative to vehicle (Figure 7). Reference List

(1) Brown JJ, Davies DL, Lever AF, Robertson JIS. Plasma renin concentration in human hypertension. 1 : Relationship between renin, sodium, and potassium. BrMedJ 1965;2:144-8. (2) Kawada N, Imai E, Karber A, Welch WJ, Wilcox CS. A mouse model of angiotensin II slow pressor response: role of oxidative stress. J Am Soc Nephrol 2002;13:2860-8.

(3) Ortiz MC, Manriquez MC, Romero JC, Juncos LA. Antioxidants block angiotensin II-induced increases in blood pressure and endothelin. Hypertens 2001;38:655-9.

(4) Brown AJ, Casals-Stenzel J, Gofford S, Lever AF, Morton JJ. Comparison of fast and slow pressor effects of angiotensin II in the conscious rats. Am J Physiol 1981;241:H381-H388. (5) Welch WJ, Blau J, Xie H, Chabrashvih T, Wilcox CS. Angiotensin-induced defects in renal oxygenation: role of oxidative stress. Am J Physiol 2004;288:H22-H28.

(6) Wang D, Chabrashvih T, Wilcox CS. Enhanced contractility of renal afferent arterioles from angiotensin-infused rabbits: roles of oxidative stress, thromboxane-prostanoid receptors and endothelium. Circ Res 2004;94:1436-42.

(7) Dickinson CJ, Yu R. Mechanisms involved in the progressive pressor response to very small amounts of angiotensin II in conscious rabbits. Circ Res 1967;20:II-157-II-163.

(8) Ames RP, Borkowski AJ, Sicinski AM, Laragh JH. Prolonged infusions of angiotensin II and norepinephrine and blood pressure, electrolyte balance, aldosterone and cortisol secretion in normal man and in ckrhosis with ascites. J Clin Invest 1965;44:1171-86. (9) hnig JD. Afferent arteriolar reactivity to angtiotensin II is enhanced during the early phase of angiotensin II hypertension. Am JHypertens 2000;13:810-8.

(10) Wang D, Chen Y, Chabrashvih T, Aslam S, Borrego L, Umans J, Wilcox CS. Role of oxidative stress in endothelial dysfunction and enhanced responses to Ang II of afferent arterioles from rabbits infused with Ang II. J Am Soc Nephrol 2003;14:2783-9.

(11) Laursen JB, Rajagopalan S, Galis Z, Tarpey M, Freeman BA, Harrison DG. Role of superoxide in angiotensin Il-induced but not catecholamine-induced hypertension. Circ 1997;95:588-93. (12) Lassegue B, Sorescu D, Szocs K, Yin Q, Akers M, Zhang Y, Grant SL, Lambeth JD, Griendling KK. Novel gp91(phox) homologues in vascular smooth muscle cells : noxl mediates angiotensin II-induced superoxide formation and redox-sensitive signaling pathways. Circ Res 2001;88:888- 94.

(13) Chabrashvih T, Kitiyalcara C, Blau J, Karber A, Aslam S, Welch WJ, Wilcox CS. Effects of Ang II type 1 and 2 receptors on oxidative stress, renal NADPH oxidase and SODs expression. Am J Physiol 2003;285:R117-R124.

(14) Lassegue B, Clempus RE. Vascular NAD(P)H oxidases: specific features, expression, and regulation. Am J Physiol 2003 ;285 :R277-R297.

(15) Landmesser U, Cai H, Dikalov S, McCann L, Hwang J, Jo H, Holland SM, Harrison DG. Role of p47(phox) in vascular oxidative stress and hypertension caused by angiotensin II. Hypertens 2002;40:511-5.

(16) Pagano PJ, Chanock SJ, Siwik DA, Colucci WS, Clark JK. Angiotensin II induces p67^phox mRNA expression and NADPH oxidase superoxide generation in rabbit aortic adventitial fibroblasts. Hypertens 1998;32:331-7.

(17) Geiszt M, Kopp JB, Vamai P, Leto TL. Identification of renox, an NADPH oxidase in kidney. Proc Natl Acad Sci USA 2000;97:8010-4.

(18) Mollnau H, Wendt M, Szocs K, Lassegue B, Schulz E, Oelze M, Li H, Bodenschatz M, August M, Kleschyov AL, Tsilimingas N, Walter U, Forstennann U, Meinertz T, Griendling K, Munzel T. Effects of angiotensin II infusion on the expression and function of NAD(P)H oxidase and components of nitric oxide/cGMP signaling. Circ Res 2002;90:E58-E65. (19) Fukui T, Ishizaka N, Rajagopalan S, Laursen JB, Capers IQ, Taylor WR, Harrison DG, De Leon H, Wilcox JN, Griendling KK. p22^phox mRNA expression and NADPH oxidase activity are increased in aortas from hypertensive rats. Circ Res 1997;80:45-51.

(20) Ushio-Fukai M, Zafari AM, Fukui T, Ishizaka N, Griendling KK. p22^phox is a critical component of the superoxide-generating NADH/NADPH oxidase system and regulates angiotensin II-induced hypertrophy in vascular smooth muscle cells. JBiol Chem 1996;271:23317-21.

(21) Sorescu D, Weiss D, Lassegue B, Clempus RE, Szocs K, Soreescu GP, Valppu L, Quinn MT, Lambeth JD, Vega JD, Taylor R, Griendling KK. Superoxide production and expression of Nox family proteins in human atherosclerosis. Circ 2002;105:1429-35.

(22) Weber DS, Rocic P, Mellis AM, Laude KM, Lyle A, Harrison DG, Griendling KK. Angiotensin II-induced hypertrophy is potentiated in mice overexpressing p22^phox in vascular smooth muscle. Am J Physiol 2004;288:H37-H42.

(23) Laude KM, Cai H, Fink B, Hoch N, Weber DS, McCann L, Kojda G, Fukai T, Dikalov S, Ramasamy S, Gamez G, Griendling KK, Harrison DG. Hemodynamic and biochemical adaptations to vaxcular smooth muscle overexpression of p22^phox in mice. -4rø JPA ,s7θ/ 2004;288:H7-H12.

(24) Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998;391:806-11.

(25) Mello CC, Conte D. Revealing the world of RNA interference. Nature 2004;431:338-42. (26) McCaffrey AP, Meuse L, Pham TT, Conklin DS, Hannon GJ, Kay MA. Gene expression: RNA interference in adult mice. Nature 2002;418:38-9.

(27) Hamar P, Song E, Kδkeny G, Chen A, Ouyang N, Lieberman J. Small interfering RNA targeting Fas protects mice against renal ischemia- reperfusion injury. Proc Natl Acad Sci USA 2004;101:14883-8.

(28) Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, Herweijer H. Efficient delivery of siRNA for inhibition of gene expression in postnatal mice. Nature Genet 2002;32:107-8.

(29) Zhang G, Budker V, Wolff JA. High levels of foreign gene expression in hepatocytes after tail vein injections of naked plasmid DNA. Human Gene Therapy 1999;10:1735-7.

(30) Liu F, Song YK, Liu D. Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA. Gene Therapy 1999;6:1258-66.

(31) Welch WJ, Mendonca M, Blau J, Karber A, Dennehy K, Lao Y, Jose P, Wilcox CS. Antihypertensive response to prolonged tempol in the SHR. Hypertens. In press 2005.

(32) Elbashir SM, Martinez J, Patkaniowska W, Lendeckel T, Tuschl T. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J 2001 ;20 : 6877-88.

(33) Chabrashvih T, Tojo A, Onozato M, Kitiyalcara C, Quinn MT, Fujita T, Welch WJ, Wilcox CS. Expression and cellular localization of classic NADPH oxidase subunits in the spontaneously hypertensive rat kidney. Hypertens 2002;39:269-74. (34) Pfaffl MW. A new mathematical model for relative quantification in realtime PCR. Nucleic Acid Research 2001 ;29 :45.

(35) Tojo A, Kimoto M, Wilcox CS. Renal expression of constitutive NOS and DDAH: separate effects of salt intake and angiotensin. Kidney Int 2000;58:2075-83.

(36) Onozato ML, Tojo A, Goto A, Fujita T, Wilcox CS. Oxidative stress and nitric oxide synthase in rat diabetic nephropathy: effects of ACEI or ARB. Kidney Int 2002;61 : 186-94.

(37) Fire A, Albertson D, Harrison S, Moerman DG. Production of antisense RNA leads to effective and specific inhibition of gene expression in C. elegans muscle. Development 1991;113:503-14.

(38) Hannon GJ. RNA interference. Nature 2002;418:244-51.

(39) Meister G, Tuschl T. Mechanisms of gene silencing by double-stranded RΝA. Nature 2004;431:343-9.

(40) Harmon GJ, Rossi JJ. Unlocking the potential of the human genome with RΝA interference. Nature 2004;431 :371-8.

(41) Song E, Lee SK, Wang J, Jnce Ν, Ouyang Ν, Min J, Chen J, Shankar P, Lieberman J. RΝA interference targeting Fas protects mice from fulminant hepatitis. Nature Med 2003;9:347-51.

(42) Sørensen DR, Leirdal M, Sioud M. Gene silencing by systemic delivery of synthetic siRNAs in adult mice. JMolBiol 2003;327:761-6. (43) Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, Herweijer H. Efficient delivery of siRNA for inhibition of gene expression in postnatal mice. Nat Genet 2002;32:107-8.

(44) Song E, Lee SK, Wang J, Ince Ν, Ouyang Ν, Min J, Chen J, Shankar P, Lieberman J. RΝA interference targeting Fas protects mice from fulminant hepatitis. Nat Med 2003;9:347-51.

(45) McCaffrey AP, Νalcai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA. Inhibition of hepatitis B virus in mice by RΝA interference. Nat Biotechnol 2003;21:639-44.

(46) Bridge AJ, Pebemard S, Ducraux A, Nicoulaz AL, Iggo R. Induction of an interferon response by RNAi vectors in mammalian cells. Nature Genet 2003;34:263-4.

(47) Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M, Li B, Carvet G, Linsley PS. Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechnol 2003;21:635-7.

(48) Soutschek J, Akinc A, Bramiage B, Charisse K, Constien R, Donoghue M, Elbashir S, Geiclc A, Hadwiger P, Harborth J, John M, Kesavan V, Lavine G, Pandey RK, Racie T, Rajeev KG, Rohl I, Toujarska I, Wang G, Wuschko S, Bumcrot D, Koteliansky V, Limmer S, Manoharan M, Vomlocher H. Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature 2004;432:173-8.

(49) Hamilton CA, Brosnan MJ, Al-Benna S, Berg G, Dominiczak AF. NAD(P)H oxidase inhibition improves endothelial function in rat and human blood vessels. Hypertens 2002;40:755-62. (50) Park JB, Touyz RM, Chen X, Schiffrin EL. Chronic treatment with a superoxide dismutase mimetic prevents vascular remodeling and progression of hypertension in salt-loaded stroke-prone spontaneously hypertensive rats. Am J Hypertens 2002;15:78-84.

(51) Welch WJ, Tojo A, Wilcox CS. Roles of NO and oxygen radicals in tubuloglomerular feedback in SHR. Am J Physiol 2000;278:F769-F776.

(52) Majid DS, Nishiyama A. Nitric oxide blockade enhances renal responses to superoxide dismutase inhibition in dogs. Hypertens 2002;39:293-7.

(53) Cifuentes ME, Rey FE, Canetero OA, Pagano PJ. Upregulation of p67(phox) and gp91(phox) in aortas from angiotensin II-infused mice. Am J Physiol Heart Circ Physiol 2000;279:H2234-H2240.

(54) Rey FE, Li XC, Carretero OA, Garvin JL, Pagano PJ. Perivascular superoxide anion contributes to impairment of endothelium-dependent relaxation: role of gρ91(phox). Circ 2002;106:2497-502.

(55) Suzuki H, DeLano FA, Parks DA, Jamsbidi N, Granger DN, Ishii H, Suematsu M, Zweifach BW, Schmid-Schonbein GW. Xanthine oxidase activity associated with arterial blood pressure in spontaneously hypertensive rats. Proc Natl Acad Sci USA 1998;95:4754-9.

(56) Landmesser U, Dikalov S, Price SR, McCann L, Fukai T, Holland SM, Mitch WE, Harrison DG. Oxidation oftetrahydrobiopterin leads to uncoupling of endothelial cells nitric oxide synthase in hypertension. J Clin In est 2003;111:1201-9. (57) Ambasta RK et al. Direct Interaction of the Novel Nox Proteins with p22phox Is Required for the Formation of a Functionally Active NADPH Oxidase. JBiol Chem 2004; 279(44):45935-45941.

(58) Takeya, R. Novel Human Homologues of P47^phox and p67 ^hox Participate in Activation of Superoxide-producing NADPH Oxidases. JBiol Chem 2003; 278(27) :25234-25246.

References

1 '. Fukui T, Ishizaka N, Rajagopalan S, Laursen JB, Capers IQ, Taylor WR, Harrison DG, De Leon H, Wilcox JN and Griendling KK. p22^phox mRNA expression and NADPH oxidase activity are increased in aortas from hypertensive rats. Circ Res 80: 45-51 , 1997. Ref ID: 9530

2'. Rajagopalan S, Kurz S, Munzel T, Tarpey M, Freeman BA, Griendling KK and Harrison DG. Angiotensin Il-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation. Contribution to alterations of vasomotor tone. J Clin Invest 97: 1916-1923, 1996. Ref ID: 9529

3'. Laursen JB, Rajagopalan S, Galis Z, Tarpey M, Freeman BA and Harrison DG. Role of superoxide in angiotensin II-induced but not catecholamine- induced hypertension. Circ 95: 588-593, 1997. Ref ID: 7456

4'. Pu Q, Neves F, Virdis A, Touyz RM and Schiffrin EL. Effect of endothelin antagonism on aldosterone-induced oxidative stress and vascular remodeling. Hypertens 42: 49-55, 2003. Ref ID: 11521

5'. Iglarz M, Touyz RM, Viel EC, Amiri F and Schiffrin EL. Involvement of oxidative stress in the profibrotic action of aldosterone: interaction with the renin-angiotensin system. Am J Hypertens 17: 597-603, 2004. Ref ID: 22892

6'. Park JB, Touyz RM, Chen X and Schiffrin EL. Chronic treatment with a superoxide dismutase mimetic prevents vascular remodeling and progression of hypertension in salt-loaded stroke-prone spontaneously hypertensive rats. Am J Hypertens 15: 78-84, 2002. Ref ID: 10691

T. Virdis A, Neves MF, Amiri F, Viel E, Touyz RM and Schiffrin EL. Sprionolactone improves angiotensin induced vascular changes and oxidative stress. Hypertens 40: 504-510, 2003. Ref ID: 11720

8'. Somers MJ, Mavromatis K, Galis ZS and Harrison DG. Vascular superoxide production and vasomotor function in hypertension induced by deoxycorticosterone acetate-salt. Circ 101: 1722-1728, 2000. Ref ID: 11728

9'. Beswick RA, Dorrance AM, Leite R and Webb C. NADH/NADPH oxidase and enhanced superoxide production in the mineralocorticoid hypertensive rat. Hypertens 38: 1107-1111, 2001. Ref ID: 10742 0'. Manning RD, Jr., Meng S and Tian N. Renal and vascular oxidative stress and salt-sensitivity of arterial pressure. Ada Physiol Scand 179: 243-250, 2003. Ref ID: 22930

'. Swei A, Lacy F, DeLano FA and Schmid-Schonbein GW. Oxidative stress in the Dahl hypertensive rat. Hypertens 30: 1628-1633, 1997. Ref ID: 9399

'. Kitiyalcara C, Chabrashvih T, Chen Y, Blau J, Karber A, Aslam S, Welch WJ and Wilcox CS. Salt intake, oxidative stress and renal expression of NADPH oxidase and superoxide dismutase. J Am Soc Nephrol 14: 2775- 2782, 2003. Ref ID: 11167

'. Griendling KK, Sorescu D and Ushio-Fukai M. NAD(P)H oxidase: role in cardiovascular biology and disease. Circ Res 86: 494-501, 2000. Ref ID: 10102

'. Kitiyalcara C and Wilcox CS. Antioxidants for hypertension. Nephrol Hypertens 1: 531-538, 1998. Ref ID: 7461

'. Modlinger P, Wilcox CS and Aslam S. Nitric oxide, oxidative stress and progression of chronic renal failure. Semin Nephrol 24: 354-365, 2004. Ref ID: 22822

'. Wilcox CS. Reactive oxygen species: role in blood pressure and kidney function. Curr Hypertens Rep 4: 160-166, 2002. Ref ID: 10642 '. Wilcox CS. Redox regulation of the afferent arteriole and tubuloglomemlar feedback. Ada Physiol Scand 179: 217-223, 2003. Ref ID: 11442

'. Schnackenberg CG. Physiological and pathophysiological roles of oxygen radicals in the renal microvasculature. Am J Physiol 282: R335-R342, 2003. Ref ID: 11609

'. Touyz RM. Oxidative stress and vascular damage in hypertension. Curr Hypertens Rep 2: 98-105, 2000. Ref ID: 10354

'. Touyz RM. Reactive oxygen species in vascular biology: role in arterial hypertension. Expert Rev Cardiovasc Ther 1: 91-106, 2003. Ref TD: 22968

'. Touyz RM. Reactive oxygen species, vascular oxidative stress, and redox signaling in hypertension: what is the clinical significance? Hypertens 44: 248-252, 2004. Ref ID: 23074

'. Fukai T, Folz RJ, Landmesser U and Harrison DG. Extracellular superoxide dismutase and cardiovascular disease. Cardiovasc Res 55: 239-249, 2002. Ref ID: 11190

'. Hamson DG, Cai H, Landmesser U and Griendling KK. Interactions of angiotensin II with NAD(P)H oxidase, oxidant stress and cardiovascular disease. JRAAS4: 51-61, 2003. Ref ID: 11534 '. Khatri JJ, Johnson C, Magid R, Lessner SM, Laude KM, Dikalov SI, Ha ison DG, Sung H-J, Rong Y and Galis ZS. Vascular oxidant stress enhances progression and angiogenesis of experimental atheroma. Circ 109: 520-525, 2004. Ref ID: 22845

'. Kojda G and Harrison D. Interactions between NO and reactive oxygen species: pathophysiological importance in atherosclerosis, hypertension, diabetes and heart failure. Cardiovasc Res 43: 562-571, 1999. Ref ID: 9594

'. Spiekermann S, Landmesser U, Dikalov S, Bredt M, Gamez G, Tatge H, Reepschlager N, Homig B, Drexler H and Harrison DG. Electron spin resonance characterization of vascular xanthine and NAD(P)H oxidase activity in patients with coronary artery disease. Circ 107: 1383-1389, 2003. Ref ID: 11538

'. Lassegue B and Clempus RE. Vascular NAD(P)H oxidases: specific features, expression, and regulation. Am J Physiol 285: R277-R297, 2003. Ref ID: 23105

'. Persson PB. Nitric oxide in the kidney. Am J Physiol 283: R1005-R1007, 2002. Ref ID: 11291

'. Wilcox CS. L-arginine-nitric oxide pathway. In: The Kidney: Physiology and Pathophysiology, edited by Seldin DW and Giebisch G. New York: Raven Press, 2000, p. 851-873. Ref ID: 7460 '. Griendling KK and FitzGerald Ga. Oxidative stress and cardiovascular injury: Part II: Animal and human studies. Circ 108: 2034-2040, 2003. Ref ID: 22987

'. Wolin MS, Gupte S A and Oeckler RA. Superoxide in the vascular system. J Vase Res 39: 191-207, 2002. Ref ID: 23065

'. Hamilton CA, Brosnan MJ, Mcfrityre M, Graham D and Dominiczak AF. Superoxide excess in hypertension and aging: a common cause of endothelial dysfunction. Hypertens 37: 529-534, 2001. Ref ID: 10412

'. Berey C, Brosnan MJ, Fennell J, Hamilton CA and Dominiczak AF. Oxidative sterss and vascular damage in hypertension. Curr Opin Nephrol Hypertens 10: 247-255, 2001. Ref ID: 10351

'. Wilcox CS and Gutterman DD. Focus on oxidative stress in the cariovascular and renal system. Am J Physiol 288: H3-H6, 2005. Ref ID: 23108

'. Elmarakby AA, Loomis ED, Pollock JS and Pollock DM. NADPH oxidase inhibition attenuates oxidative stress but not hypertension produced by chronic ET-1. Hypertens 45: 283-287, 2005. Ref ID: 23422

'. Welch WJ and Wilcox CS. ATi receptor antagonist combats oxidative stress and restores nitric oxide signaling in the SHR. Kidney Int 59: 1257-1263, 2001. Ref ID: 9940 '. Wilcox CS and Welch WJ. Oxidative stress: cause or consequence of hypertension? Exp BiolMed 226: 619-620, 2001. Ref ID: 10289

'. Chabrashvih T, Tojo A, Onozato M, Kitiyalcara C, Quinn MT, Fujita T, Welch WJ and Wilcox CS. Expression and cellular localization of classic NADPH oxidase subunits in the spontaneously hypertensive rat kidney. Hypertens 39: 269-274, 2002. Ref ID: 10500

'. Lacy F, Kailasam MT, O'Connor DT, Schmid-Schonbein GW and Parmer RJ. Plasma hydrogen peroxide production in human essential hypertension: role of heredity, gender, and ethnicity. Hypertens 36: 878-884, 2000. Ref ID: 10353

'. Garcia CE, Kilcoyne CM, CardiUo C, Cannon RO, III, Quyyumi AA and Panza JA. Effect of copper-zinc superoxide dismutase on endothelium- dependent vasodilation in patients with essential hypertension. Hypertens 26: 863-868, 1995. Ref ID: 7100

'. Panza JA, Quyyumi AA, Brush JrJE and Epstein SE. Abnormal endothelium-dependent vascular relaxation in patients with essential hypertension. NEngl JMed 323(1): 22-27, 1990. Ref ID: 898

'. Wang D, Iversen J, Wilcox CS and Sfrandgaard S. Endothelial dysfunction and reduced nitric oxide in resistance arteries in autosomal-dominant polycystic kidney disease. Kidney Int 64: 1381-1388, 2003. Ref ID: 11590 '. Hamilton CA, Brosnan MJ, Al-Benna S, Berg G and Dominiczak AF. NAD(P)H oxidase inhibition improves endothelial function in rat and human blood vessels. Hypertens 40: 755-762, 2002. Ref ID: 23168

'. Haynes WG, Noon JP, Walker BR and Webb DJ. L-NMMA increases blood pressure in man. Lancet 342: 931-932, 1993. Ref ID: 874

'. Calver A, Collier J, Leone A, Moncada S and Vallance P. Effect of local intra-arterial asymmetric dimethylarginine (ADMA) on the forearm arteriolar bed of healthy volunteers 11632. J Human Hypertens 1: 193-194, 1993. Ref ID: 13199

'. Vallance P, Collier J and Moncada S. Nitric oxide synthesised from L- arginine mediates endothelium dependent dilatation in human veins in vivo. Cardiovasc Res 23: 1053-1057, 1989. Ref ID: 901

'. Cowley AW, Jr. and Roman RJ. The role of the kidney in hypertension. JAMA 275: 1581-1589, 1996. Ref ID: 4688

'. Guyton AC, Hall JE, Coleman TG, Manning RD, Jr. and Norman RA. The dominant role of the kidneys in long-term arterial pressure regulation in normal and hypertensive states. Hypertens 1311-1326, 2000. Ref ID: 9938

'. Hogg N, Darley-Usmar VM, Wilson MT and Moncada S. Production of hydroxyl radicals from the simultaneous generation of superoxide and nitric oxide. Biochem J 281: 419-424, 1992. Ref ID: 1060

'. Koo JR and Vamai P. Effects of diabetes, insulin and antioxidants on NO synthase abundance and NO interaction with reactive oxygen species. Kidney Int 63: 195-201, 2002. Ref ID: 23307

'. Gryglewski RJ, Palmer RMJ and Moncada S. Superoxide anion is involved in breakdown of endothelium-derived vascular relaxing factor. Nature 320: 454-456, 1986. Ref ID: 1059

'. Rubanyi GM and Vanhoutte PM. Superoxide anion and hyperoxia inactivate endothelium-derived relaxing factor. Am J Physiol 250: H822-H827, 1986. Ref ID: 6859

'. Villa LM, Salas E, Darley-Usmar V, Radomski MW and Moncada S. Peroxynitrite induces both vasodilatation and impaired vascular relaxation in the isolated perfused rat heart. Proc Natl Acad Sci USA 91 : 12383-12387, 1994. Ref ID: 5388

'. Ullrich V and Bachschmid M. Superoxide as a messenger of endothelial function. Biochem Biophys Res Comm 278: 1-8, 2000. Ref ID: 9914

'. Eiserich JP, Baldus S, Brennan ML, Ma W, Zhang C, Tousson A, Castro L, Lusis AJ, Nauseef WM, White CR and Freeman BA. Myeloperoxidase, a leukocyte-derived vascular NO oxidase. Science 296: 2391-2394, 2002. Ref ID: 23423 INCORPORATION BY REFERENCE All publications and patents mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference.

EQUIVALENTS While specific embodiments of the subject invention have been discussed, the above specification is illustrative and not restrictive. As those skilled in the art will appreciate, numerous changes and modifications may be made to the embodiments of the invention without departing from the spirit of the invention. It is intended that all such variations fall within the scope of the invention.

Claims

CLAMS:

1. A method of identifying an agent that inhibits oxidative stress, comprising: a) determining the level of p22phox in a cell in the presence of a test agent; and b) comparing the level of p22phox determined in (a) with the level of p22phox determined in a control cell, wherein if the level of p22phox in (a) is less than the level of p22phox in the control cell, the test agent is an agent that inhibits oxidative stress.

2. A method of identifying an agent that inhibits NADPH oxidase activity, comprising: a) determining the level of p22phox in a cell in the presence of a test agent; and b) comparing the level of p22phox detennined in (a) with the level of p22phox determined in a control cell, wherein if the level of p22phox in (a) is less than the level of p22phox in the control cell, the test agent is an agent that inhibits NADPH oxidase activity.

3. A method of identifying an agent that inhibits p22phox expression in a cell, comprising: a) determining the level of p22phox in a cell in the presence of a test agent; and b) comparing the level of p22phox determined in (a) with the level of p22phox determined in a control cell, wherein if the level of p22phox in (a) is less than the level of p22phox in the control cell, the test agent is an agent that inhibits p22phox expression in a cell.

4. The method of any one of claims 1-3, wherein determining the level of p22phox in (b) comprises detecting the level of p22phox mRNA in the cell.

5. The method of any one of claims 1 -3 , wherein determining the level of p22phox in (b) comprises detecting the level of p22phox protein in the cell.

6. The method of any one of claims 1 -3 , wherein the cell is a kidney cell.

7. The method of any one of claims 1-3, wherein the cell is a cultured cell.

8. The method of any one of claims 1-3, wherein the cell is situated in an animal model.

9. A method of identifying an agent that inhibits oxidative stress, comprising: a) forming a mixture comprising a p22phox polypeptide and one or more components of NADPH oxidase; b) contacting the mixture with a test agent; c) determining the association of p22phox with one or more NADPH components in the presence of the test agent; d) determining the association of p22phox with one or more NADPH components in a control mixture in the absence of the test agent; and e) comparing the association of p22phox determined in (c) with the association of p22phox determined in (d), wherein if p22phox association with one or more NADPH components in (c) is less than the level of p22phox association with one or more NADPH components in (d), the test agent is an agent that inhibits oxidative stress.

10. The method of claim 9, wherein the mixture in (a) is formed in cell culture.

11. The method of claim 9, further comprising: f) determining NADPH oxidase activity in the presence of the test agent; g) determining NADPH oxidase activity in a control mixture in the absence of the test agent; and h) comparing NADPH oxidase activity determined in (f) with NADPH oxidase activity determined in (g), wherein if NADPH oxidase activity in (f) is less than NADPH oxidase activity in (g), the test agent is an agent that inhibits oxidative stress.

12. A pharmaceutical composition comprising an agent that inhibits p22phox.

13. The composition of claim 12, wherein the agent decreases p22phox mRNA levels.

14. The composition of claim 12, wherein the agent decreases p22phox protein levels.

15. The composition of claim 12, wherein the agent inhibits p22phox association with one or more components of NADPH oxidase.

16. The composition of claim 15, wherein the one or more NADPH oxidase components is selected from the group consisting of: gp91phox, Noxl, Nox3, Nox4, p47phox, p41nox, p40phox, p67phox, p51nox, Rac-1, and Rac- 2.

17. The composition of claim 12, wherein the agent associates with the carboxy terminal proline-rich domain of p22phox.

18. The composition of claim 12, wherein the agent is selected from the group consisting of: a nucleic acid, a small molecule, an antibody, and a peptide.

19. The composition of claim 18, wherein the nucleic acid is an siRNA construct.

20. The composition of claim 19, wherein the siRNA constract decreases p22phox mRNA levels.

21. The composition of claim 19, wherein the siRNA construct inhibits p22phox protein expression.

22. The composition of claim 19, wherein the siRNA constract is selected from the group consisting of: 5'-AUUACUACGUCCGGGCUGU-3' (SEQ ID NO: 1) and 5'-ACAGCCCGGACGUAGUAAU-3' (SEQ ID NO: 2).

23. A method of treating or preventing oxidative stress in an individual in need thereof, comprising administering to the individual an agent that inhibits p22phox, thereby treating or preventing oxidative stress in the individual.

24. The method of claim 23, wherein the agent decreases p22phox mRNA levels.

25. The method of claim 23, wherein the agent inhibits p22phox protein expression.

26. The method of claim 23, wherein the agent inhibits p22phox association with one or more components of NADPH oxidase.

27. The method of claim 23, wherein the agent associates with the carboxy terminal proline-rich domain of p22phox.

28. The method of claim 23, wherein the agent is an siRNA constract.

29. The method of claim 28, wherein the siRNA constract decreases p22phox mRNA levels.

30. The method of claim 28, wherein the siRNA construct inhibits p22phox protein expression.

31. The method of claim 28, wherein the siRNA construct is selected from the group consisting of: 5'-AUUACUACGUCCGGGCUGU-3' (SEQ ID NO: 1) and 5'-ACAGCCCGGACGUAGUAAU-3' (SEQ ID NO: 2).

32. The method of claim 23, further comprising detecting the level of a marker of oxidative stress in the individual, wherein if the level of the marker of oxidative stress in the presence of the agent is less than the level of the marker of oxidative stress in the absence of the agent, the agent treats or prevents oxidative stress in the individual.

33. The method of claim 32, wherein the marker is 8-isoprostane.

34. The method of claim 33, wherein the levels of 8-isoprostane are detected in the urine of the individual.

35. The method of claim 23, wherein the oxidative stress is associated with a condition selected from the group consisting of: damage caused by acute ischemia; contrast associated with nephropathy; oxidative damage complicating surgical or medical procedures; blood pressure and organ damage in hypertensive emergencies, malignant hypertension, or hypertension accompanying vasculitis; heart failure; hypercholesterolemia; smoking; kidney failure; aging; and atherosclerosis.

36. The method of claim 23, wherein the agent is administered following angina, following a transient ischemic attack, during vascular surgery, during coronary artery by-pass surgery, after organ transplantation, during malignant hypertension, in the treatment of diabetes mellitus, in the treatment of hyperglycemia, following drug poisoning, following drug overdose, in the treatment of hyperoxia, and in the treatment of oxygen toxicity.

37. A method of inhibiting the activity of a target polypeptide in a rat, comprising administering to the rat an RNAi constract that decreases mRNA levels of the target polypeptide in the rat.

38. A method of inhibiting the activity of a target polypeptide in a rat, comprising administering to the rat an RNAi constract that decreases protein levels of the target polypeptide in the rat.