WO2005100605A1 - Orphan receptor tyrosine kinase as a target in breast cancer - Google Patents

Abstract

Methods and materials relating to the orphan receptor tyrosine kinase (ROR1) are described. ROR1 exhibits restricted tissue expression in normal adult tissue and is overexpressed in certain breast cancer subtypes. ROR1 provides a diagnostic and/or therapeutic target for breast cancers.

Description

ORPHAN RECEPTOR TYROSINE KINASE AS A TARGET IN BREAST CANCER

CROSS REFERENCE TO RELATED APPLICATIONS This application claims priority under Section 119(e) from U.S. Provisional Application Serial No. 60/559,762 filed April 6, 2004, the contents of which are incorporated herein, by reference. FIELD OF THE INVENTION The invention described herein relates to methods and compositions useful in the diagnosis, treatment and management of cancers that express orphan receptor tyrosine kinase (RORl), particularly breast cancers. BACKGROUND OF THE INVENTION Cancer is the second leading cause of human death next to coronary disease. Worldwide, millioi s of people die from cancer every year. In the United States alone, cancer causes the death of well over a half-million people annually, with some 1.4 million new cases diagnosed per year. While deaths from heart disease have been declining significantly, those resulting from cancer generally are on the rise. Worldwide, several cancers stand out as the leading killers. In particular, carcinomas of the breast, lung, prostate, colon, pancreas, and ovary represent the primary causes of cancer death. These and virtually all other carcinomas share a corπu-αon lethal feature. With very few exceptions, metastatic disease from a carcinoma is fatal. Moreover, even for those cancer patients who initially survive their primary cancers, common experience has shown that their lives are dramatically altered and many cancer patients experience a recurrence. Cancers of the breast are one of the leading causes of death among women, with the cumulative lifetime risk of a woman developing breast cancer estimated to be 1 in 9. Consequently, understanding the origins and subtypes of these malignancies as well as models for the identification of new diagnostic and therapeutic modalities is of significant interest to health care professionals. Most women that die from breast cancer succumb not to the original primary disease, which is usually amenable to various therapies, but rather from metastatic spread of the breast cancer to distant sites. This fact underscores the need to develop both additional diagnostic methods as well as noveL anticancer agents or more aggressive forms of therapy directed specifically against breast tumor subtypes.

SUMMARY OF THE INVENTION The present invention relates to the gene designated orphan receptor tyrosine. kinase RORl, which is aberrantly-expressed in cancers including cancers of the breast- Breast cancer tumors that over-express RORl are associated with a poor prognosis and the percentage of poor prognosis tumors in the RORl group (70% of sporadic) is higher: than for any other single prognostic gene analyzed including Her-2, epidermal growtfc__ factor receptor (EGFR), vascular endothelial cell growth factor (VΕGF), Fms-like tyrosine kinase-3 (Flt3), C-MYC, urokinase plasminogen activator (uPA) and plasminogen activator inhibitor 1 (PAI-1). Moreover, cancers of the breast can be grouped into a number of distinct subtypes and RORl is specifically upregulated in the basal and BRCA 1 subtypes. The expression profile of RORl in normal adult tissues ., combined with the aberrant-expression observed in various breast cancer subtypes ., demonstrate that RORl can serve as a useful diagnostic target for such cancers. The invention provides polynucleotides corresponding or complementary to aU or part of RORl genes, mRNAs, and/ or coding sequences, preferably in isolated form-, including polynucleotides encoding RORl proteins and fragments thereof, DNA, RNλ, DNA/RNA hybrid, and related molecules, polynucleotides or oligonucleotides complementary to the RORl genes or mRNA sequences or parts thereof, and polynucleotides or oligonucleotides that hybridize to the RORl genes, mRNAs, or to RORl -encoding polynucleotides. Also provided are means for isolating cDNAs and the genes encoding RORl. Recombinant DNA molecules containing RORl polynucleotides, cells transformed or transduced with such molecules, and host-vector systems for die expression of RORl gene products are also provided. The invention further provides RORl proteins and polypeptide fragments thereof. The invention further provides antibodies that bind to RORl proteins and polypeptide fragments thereof, including polyclonal and monoclonal antibodies, murine and other mammalian antibodies, chimeric antibodies, humanized and fully human antibodies, and antibodies labeled with a detectable marker. The invention further provides methods for detecting the presence and status of RORl polynucleotides and proteins in various biological samples (e.g. breast cancer biopsies), as well as methods for identifying cells that express RORl. A typical embodiment of this invention provides methods for monitoring RORl gene products in a tissue sample having or suspected of having some form of growth disregulation such as that found in various breast cancers, for example the basal and BRCA 1 subtypes as described in Sorlie et al., PNAS (2001), 98(19): 10869-10874, which is incorporated herein by reference. An illustrative embodiment of die invention is a method of examining a test biological sample comprising a human breast cell for evidence of altered cell growth that is indicative of a breast cancer by evaluating the levels of orphan receptor tyrosine kinase (RORl) polynucleotides that encode the RORl polypeptide shown in SEQ ID NO: 2 in the biological sample, wherein an increase in the levels of the RORl polynucleotides in the test sample relative to a normal breast tissue sample provide evidence of altered cell growth that is indicative of a breast cancer; and wherein the levels of the RORl polynucleotides in the cell are evaluated by contacting the sample with a RORl complementary polynucleotide that hybridizes to a RORl nucleotide sequence shown in SEQ ID NO: 1, or a complement thereof, and evaluating the presence of a hybridization complex formed by the hybridization of the RORl complementary polynucleotide with the RORl polynucleotides in the test biological sample. In certain embodiments of the invention, the breast cancer is of the basal subtype. In other embodiments of the invention, the breast cancer is of the BRCAl subtype. A related embodiment is a method of examining a human breast cell for evidence of altered cell growth that is associated with or provides evidence of a breast cancer by evaluating the levels of orphan receptor tyrosine kinase (RORl) polynucleotides that encode the RORl polypeptide shown in SEQ ID NO: 2 in the human breast cell, wherein an increase in the levels of the RORl polynucleotides (e.g. mRNAs and genomic sequences) in the human breast cell relative to a normal human breast cell provides evidence of altered cell growth that is associated with or provides evidence of a breast cancer; and wherein the levels of the RORl polynucleotides in the human breast cell are evaluated by contacting the endogenous RORl polynucleotide sequences in the human breast cell with a RORl complementary polynucleotide the RORl complementary polynucleotide (e.g. a probe labelled witli a detectable marker or a PCR primer) and which specifically hybridizes to a RORl nucleotide sequence shown in SEQ ID NO: 1 and evaluating the presence of a hybridization complex formed by the hybridization of the RORl complementary polynucleotide with the RORl polynucleotides in the sample (e.g. via Northern analysis or PCR) so that evidence of altered cell growth that is associated with or provides evidence of a breast cancer is examined. Certain embodiments of the invention further include the step of examining the expression and/or sequences of Her-2 (SEQ ID NO: 3), EGFR (SEQ ID NO: 4), NEGF (SEQ ID NO: 5), FMS-Hke tyrosine kinase (SEQ ID NO: 6), MYC (SEQ ID NO: 7), urokinase plasminogen activator (SEQ ID NO: 8), plasminogen activator inhibitor (SEQ ID NO: 9), BRCAl (SEQ ID NO: 10) or BRCA2 (SEQ ID NO: 11) polynucleotides or polypeptides in the test biological sample. Another embodiment of the invention is a method of examining a test biological sample comprising a human breast cell for evidence of altered cell growth that is indicative of a breast cancer, the method comprising evaluating the levels of orphan receptor tyrosine kinase (RORl) polypeptides having the sequence shown in SEQ ID NO: 2 in tlie biological sample, wherein an increase in the levels of the RORl polypeptides in the test sample relative to a normal breast tissue sample provide evidence of altered cell growth that is indicative of a breast cancer; and wherein die levels of the RORl polypeptides in the cell are evaluated by contacting the sample with an antibody that imrniinospecifically binds to a RORl polypeptide sequence shown in SEQ ID NO: 2 and evaluating the presence of a complex formed by the binding of the antibody with the RORl polypeptides in the sample. A related embodiment of the invention is a method of examining a human breast cell (e.g. from a biopsy) that is suspected of being cancerous for evidence of altered cell growth that is indicative of a breast cancer, the method comprising evaluating die levels of orphan receptor tyrosine kinase (RORl) polypeptides having the sequence shown in SEQ ID NO: 2 in the breast cell, wherein an increase in the levels of the RORl polypeptides in the human breast cell relative to a normal breast cell (e.g. a normal cell from the individual providing the human breast cell) provide evidence of altered cell growth that is indicative of a breast cancer; and wherein the levels of the RORl polypeptides in the cell are evaluated by contacting the sample with an antibody (e.g. one labelled with a detectable marker) that immunospecifically binds to a RORl polypeptide sequence shown in SEQ ID NO: 2 and evaluating the presence of a complex formed by the binding of the antibody with the RORl polypeptides in the sample. Typically the presence of a complex is evaluated by a method selected from the group consisting of ELISA analysis, Western analysis and immunoHstochemistry. Optionally, the breast cancer is of the basal or the BRCA 1 subtype. Yet another embodiment of the invention is a method of examining a test human cell for evidence of a chromosomal abnormality that is indicative of a human cancer by comparing orphan receptor tyrosine kinase (RORl) polynucleotide sequences from band p31 of chromosome 1 in a normal cell to RORl polynucleotide sequences from band p31 of chromosome 1, band p31 on chromosome 1 in the test human ceE to identify an amplification or an alteration of the RORl polynucleotide sequences in the test human cell, wherein an amplification or an alteration of the RORl polynucleotide sequences in the test human cell provides evidence of a chromosomal abnormality that is indicative of a human cancer. In such methods chromosome 1, band p31 in the test human cell is typically evaluated by contacting the RORl polynucleotide sequences in the test human cell sample with a RORl complementary polynucleotide that specifically hybridizes to a RORl nucleotide sequence shown in SEQ ID NO: 1, or a complement thereof, and evaluating the presence of a hybridization complex formed by the hybridization of the RORl complementary polynucleotide with the RORl polynucleotide sequences in the test human ceE (e.g. by Northern analysis, Southern analysis or polymerase chain reaction analysis). Another embodiment of the invention is a kit comprising a container, a label on said container, and a composition contained within said container; wherein the composition includes a RORl specific antibody and/or a polynucleotide tiiat hybridizes to a complement of the RORl polynucleotide shown in SEQ ID NO: 1 under stringent conditions (or binds to a RORl polypeptide encoded by the polynucleotide shown in

SEQ ID NO: 1), the label on said container indicates that the composition can be used to evaluate the presence of RORl protein, RNA or DNA in at least one type of mammalian ceU, and instructions for using the RORl antibody and/ or polynucleotide for evaluating the presence of RORl protein, RNA or DNA in at least one type of mammalian ceE. The invention further provides various therapeutic compositions and strategies for treating cancers that express RORl such as breast cancers, including antibody based therapies aimed at inhibiting the function of RORl .

BRIEF DESCRIPTION OF THE FIGURES FIG. IA shows the complete nucleotide (SEQ ID NO: 1) and FIG. IB shows the complete amino acid (SEQ ID NO: 2) sequences of RORl. See e.g. Masiakowski et al, J. Biol. Chem. 267 (36), 26181-26190 (1992); NP_005003 (gi:4826868); and M97675 (gi:337464). FIG. 2A shows how similar breast cancer subtypes (e.g. having a consteEation of shared characteristics) are identified in both the Rosetta/Netherlands (Van't Veer, L. J., et al. (2002) Nature 415, 530-536) and Stanford/Norway (Sorlie et al., Proc Natl Acad Sci USA. 2001 Sep ll;98(19):10869-74) data sets. The Rosetta/Netherlands data set is a constrained definition of classes based on expression level of ESR1 and ERBB2, as weE as the identification of a BRCA mutation. The Stanford/Norway data set is a cluster- based definition of classes. Markers are a subset of those selected by authors as exemplars for clusters. The expression levels in these data sets are measured a loglO intensity ratio of sample to a reference. FIG. 2B uses different reference RNAs (firom those in FIG. 2A) to show a comparison of the profiles (e.g. gene expression patterns, cytological characteristics etc.) of a variety of ceE lines selected to represent the wide spectrum of properties found in primary breast cancers. FIG. 3A shows that RORl mRNA expression is specificaEy upregulated in breast cancer tumors of the basal and BRCAl subtypes identified in Nan't Veer, L. J., et al. (2002) Nature 415, 530-536 (groups 4 and 6). FIG. 3B shows ESR1, HER2 and BRCAl /2 mRNA expression in breast cancer subtypes identified in Nan't Neer et al, supra. FIG. 3C provides a schematic showing the expression of RORl mRΝA as weE as a variety of other markers in various ceE lines. FIG. 4A is a scatter plot of ESR1 and RORl by prognosis showing that RORl expressing tumors are associated witii a poor prognosis (metastasis in less than 5 years) in breast cancer subtypes identified in Nan't Neer, L. J., et al. (2002) Nature 415, 530-536. Out of 17 overexpressing RORl samples, only 3 have a good prognosis. 7 of the samples have BRCAl mutation but no prognosis data, however BRCAl mutations is typicaEy associated witli a poor outcome. Of the remaining 10 samples, 7 have a poor prognosis. This percentage of poor prognosis for a single gene is the worse of 13 genes studied so far. The percentage (70% of sporadic) of poor prognosis tumors in the RORl group is higher than that for any other single prognostic gene analyzed including HER-2, EGFR, NEGF, FLT3, MYC, UPA and PAL FIG. 4B, is a Scatterplot of HER2 by prognosis showing that fifty-four percent of HER-2 overexpressing tumors are poor prognosis samples. Out of 13 HER2 overexpressing tumors, 6 are associated with a good prognosis. No BRCAl samples overexpress HER2. Even though aE samples are associated with node-negative, early-stage disease, more than 50% of the HER2 samples have poor prognosis. FIG. 5A shows a Northern blot analysis of RORl mRNA expression in a variety of breast cancer ceE lines. 5 breast cancer ceE lines overexpress RORl significantly as compared to normal human mammary epitheUal ceEs (HMECs). RORl is also detectable in immortalized HMECs and BT20s. This expression pattern is particularly interesting in that none of the luminal ceE lines express detectable RORl. The overexpressing ceE lines have been characterized as either basal or mesenchymal/stromal analogous to the basal tumor group that shows high RORl expression. This data confirms the expression of RORl in tumor ceEs. FIG. 5B shows a bar graph of RORl mRNA expression by Northern (Phosphoimager units) in a variety of cancer ceEs. FIG. 5C shows a bar graph of RORl mRNA expression by Northern expressed as log ratio (RORl /mixed reference) in a variety of cancer ceEs. FIG. 5D shows a bar graph of RORl nRNA expression by microarray expressed as log ratio (RORl /mixed reference) in a variety of cancer ceEs. FIG. 5E shows comparative graph of RORl mRNA expression by Northern versus RORl mRNA expression by microarray. FIG. 5F and FIG. 5G show the detection of endogenous RORl protein in CAL51 ceEs using rabbit polyclonal sera (left panels show ceEs exposed to this anti-RORl antibody) with SKBR ceEs serving as a comparative ceE line. FIG. 6A provides a schematic of RORl and related gene expression data in primary tumors generated at UCLA. Briefly, core biopsies from 42 primary breast cancers were snap frozen and assayed. The selection criteria for these biopsies was a tumor > 2 cm. The expression profiles utilized 60-mer AgEent oUgonucleotide arrays with tumor cRNA labeEed with Cy5 Cy3 reference cRNA. FIG. 6B provides a chart of RORl expression data in basal, HER-2 overexpressing and luminal cancer subtypes which shows that RORl is the best marker of the basal subtype. FIG. 6C provides a graph of RORl expression in various ceEs which shows that RORl is exclusively expressed in estrogen receptor (ER) negative breast cancers. FIG. 6D provides a graph of RORl expression in various ceEs which shows that RORl is exclusively expressed in basal (androgen receptor negative) breast cancers. DETAILED DESCRIPTION OF THE INVENTION Unless otherwise defined, aE terms of art, notations and otiier scientific terminology used herein are intended to have the meanings commonly understood by diose of skiE in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and/ or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generaEy understood in the art. The techniques and procedures described or referenced herein are generaEy weE understood and commonly employed using conventional methodology by those skiEed in the art, such as, for example, the widely utilized molecular cloning methodologies described in Ausubel et al., eds., 1995, Current Protocols in Molecular Biology, WEey and Sons). As appropriate, procedures involving the use of commercially avaEable kits and reagents are generaEy carried out in accordance with manufacturer defined protocols and/ or parameters unless oti erwise noted. As used herein, the term "polynucleotide" means a polymeric form of nucleotides of at least about 10 bases or base pairs in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide, and is meant to include single and double stranded forms of DNA. As used herein, the term "polypeptide" means a polymer of at least about 6 amino acids. Throughout the specification, standard three letter or single letter designations for amino acids are used. As used herein, the terms "hybridize", "hybridizing", "hybridizes" and the like, used in the context of polynucleotides, are meant to refer to conventional hybridization conditions, preferably such as hybridization in 50% formamide/6XSSC/0.1% SDS/100 μg/ml ssDNA, in which temperatures for hybridization are above 37 degrees C and temperatures for washing in 0.1X SSC/0.1% SDS are above 55 degrees C, and most preferably to stringent hybridization conditions. "Stringency" of hybridization reactions is readily determinable by one of ordinary skiE in the art, and generaEy is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generaEy depends on the abiHty of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher d e degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, it foEows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional detaEs and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, WEey Interscience PubEshers, (1995). "Stringent conditions" or "high stringency conditions", as defined herein, may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% FicoE/0.1% polyvinylpyrroUdone/50mM sodium, phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC (sodium chloride/sodium, citrate) and 50% formamide at 55°C, foEowed by a high-stringency wash consisting of 0.1 x SSC controlling EDTA at 55°C. "Moderately stringent conditions" may be identified as described by Sambrook et al, 1989, Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, and include die use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent than those described above. An example of moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 nig/niL denatured sheared salmon sperm DNA, foEowed by washing the filters in 1 x SSC at about 37-50°C. The skiEed artisan wiE recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like. In the context of amino acid sequence comparisons, the term "identity" is used to express the percentage of amino acid residues at the same relative positions that are the same. Also in this context, d e term "homology" is used to express the percentage of amino acid residues at the same relative positions that are either identical or are similar, using the conserved amino acid criteria of BLAST analysis, as is generaEy understood in the art. For example, % identity values may be generated by WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology 266:460-480; blast.wusd/edu/blast/README.html). Further detaEs regarding amino acid substitutions, which are considered conservative under such criteria, are provided below. Additional definitions are provided tiiroughout the subsections that foEow. The foEowing sections describe methods and materials useful in the practice of various embodiments of the invention disclosed herein. The Examples provided below include disclosure that aEows the further characterization of the significance of RORl in breast cancer subtypes.

RORl POLYNUCLEOTIDES One aspect of the invention provides polynucleotides corresponding or complementary to aE or part of a RORl gene, mRNA, and/or coding sequence, preferably in isolated form, including polynucleotides encoding a RORl protein and fragments thereof, DNA, RNA, DNA/R NLA hybrid, and related molecules, polynucleotides or oHgonucleotides complementary to a RORl gene or mRNA sequence or a part thereof, and polynucleotides or oligonucleotides that hybridize to a RORl gene, mRNA, or to a RORl encoding polynucleotide (coEectively, "RORl polynucleotides"). As used herein, the RORl gene and protein is meant to include the RORl genes and proteins specifically described herein (see, e.g. FIG. 1) and the genes and proteins corresponding to other RORl proteins and stn cturaEy similar variants of the foregoing. Such other RORl proteins and variants will generaEy have coding sequences that are highly homologous to the RORl coding sequence, and preferably wiE share at least about 80% amino acid identity and at least about 90% amino add homology (using BLAST criteria), more preferably sharing 95% or greater homology (using BLAST criteria). One embodiment of a RORl polynucleotide is a RORl polynucleotide having the sequence shown in FIG. 1. A RORl polynucleotide may comprise a polynucleotide having die nucleotide sequence of human ROR.1 as shown in FIG. 1, wherein T can also be U; a polynucleotide that encodes aE or part of the RORl protein; a sequence complementary to the foregoing; or a polynucleotide fragment of any of the foregoing. Another embodiment comprises a polynucleotide having the sequence as shown in FIG. 1, from nucleotide residue number 376 through nucleotide residue number 3189, wherein T can also be U. Another embodiment comprises a polynucleotide that is capable of hybridizing under stringent hybridization conditions to the human RORl cDNA shown in FIG. 1 or to a polynucleotide fragment thereof. Typical embodiments of the invention disclosed herein include RORl polynucleotides containing specific portions of the RORl mRNA sequence (and those which are complementary to such sequences) such as those that encode the protein and fragments thereof. For example, representative embodiments of the invention disclosed herein include: polynucleotides encoding about amino acid 1 to about amino acid 10 of the RORl protein shown in FIG. 1, polynucleotides encoding about amino acid 20 to about amino acid 30 of the RORl protein shown in FIG. 1, polynucleotides encoding about amino acid 30 to about amino acid 40 of the RORl protein shown in FIG. 1, polynucleotides encoding about amino acid 40 to about amino acid 50 of die RORl protein shown in FIG. 1, polynucleotides encoding about amino acid 50 to about amino acid 60 of the RORl protein shown in FIG. 1, polynucleotides encoding about amino acid 60 to about amino acid 70 of d e RORl protein shown in FIG. 1, polynucleotides encoding about amino acid 70 to about amino acid 80 of the RORl protein shown in FIG. 1, polynucleotides encoding about amino acid 80 to about amino acid 90 of the RORl protein shown in FIG. 1 and polynucleotides encoding about amino acid 90 to about amino acid 100 of the RORl protein shown in FIG. 1, etc. FoEowing this scheme, polynucleotides encoding portions of the amino acid sequence of amino acids 100-937 of the RORl protein are typical embodiments of the invention. Polynucleotides encoding larger portions of the RORl protein are also contemplated. For example polynucleotides encoding from about amino acid 1 (or 20 or 30 or 40 etc.) to about amino acid 20, (or 30, or 40 or 50 etc.) of the RORl protein shown in FIG. 1 may be generated by a variety of techniques weE known in the art. Additional iEustrative embodiments of RORl polynucleotides include embodiments consisting of a polynucleotide having the sequence as shown in FIG. 1 from, about nucleotide residue number 1 tiirough about nucleotide residue number 500, from, about nucleotide residue number 500 through about nucleotide residue number 100O, from about nucleotide residue number 1000 through about nucleotide residue number 1500, from about nucleotide residue number 1500 through about nucleotide residue number 2000, from about nucleotide residue number 2000 through about nucleotide residue number 2500 and from about nucleotide residue number 2500 through about nucleotide residue number 3358. These polynucleotide fragments can include any portion of the RORl sequence as shown in FIG. 1, for example a polynucleotide having the sequence as shown in FIG. 1 from about nucleotide residue number 376 through nucleotide residue number 3189. The polynucleotides of the preceding paragraphs have a number of different specific uses. For example, because the human RORl gene maps to chromosome lp31 .3, polynucleotides encoding different regions of the RORl protein can be used to characterize cytogenetic abnormaHties on chromosome 1, band p31 that have been identified as being associated with various cancers. In particular, a variety of chromosomal abnormaEti.es in lp31.3 including loss of heterozygosity have been identified as frequent cytogenetic abnormalities in a number of different cancers (see, e.g., JMatdiew et al., 1989, Cancer Res. 1994 Dec l;54(23):6265-9; Chunder et al., Pathol Res Pract. 2003;199(5):313-21. Consequendy, polynucleotides encoding specific regions of the RORl protein provide new tools that can be used to delineate with a greater precision than previously possible, the specific nature of the cytogenetic abnormaHties in ti is aregion of chromosome 1 that may contribute to the maUgnant phenotype. In this context, these polynucleotides satisfy a need in the art for expanding the sensitivity of chromosomal screening in order to identify more subtie and less common chromosomal abnormaHties (see, e.g., Evans et al, 1994, Am. J. Obstet. Gynecol. 171(4):1055-1057). Alternatively, as RORl is shown to be aberrandy expressed in breast cancers, in particular the BRCA 1 and basal subtypes, the polynucleotides disclosed herein may be used in methods assessing the status of RORl gene products in normal versus cancerous tissues and/or to characterize breast cancer subtypes. TypicaEy, polynucleotides encoding specific regions of die RORl protein may be used to a.ssess the levels of RORl mRNA in a ceE as weE as the presence of perturbations (such as deletions, insertions, point irtutations etc.) in specific regions of the RORl gene products. Exemplary assays include both RT-PCR assays as weE as single-strand conformation polymorphism (SSCP) analysis (see, e.g., Marrogi et al, 1999, J. Cutan. Pathol. 26(8): 369-378), both of which utilize polynucleotides encoding specific regions of a protein to examine these regions within the protein. Other spedficaEy contemplated embodiments of the invention disclosed herein are genomic DNA, cDNAs, ribozymes, and antisense molecules, as weE as nucleic acid molecules based on an alternative backbone or including alternative bases, whether derived from natural sources or synthesized. For example, antisense molecules can be RNAs or other molecules, including peptide nucleic adds (PNAs) or non-nucleic acid molecules such as phosphorothioate derivatives, tiiat spedficaEy bind DNA or RNA in a base pair- dependent manner. A skiEed artisan can readily obtain tiiese classes of nucldc add molecules using the RORl polynucleotides and polynucleotide sequences disclosed herein. Antisense technology entaEs the administration of exogenous oHgonucleotides that bind to a target polynucleotide located within the ceEs. The term "antisense" refers to the fact that such oHgonucleotides are complementary to their intraceEular targets, e.g., RORl. See for example, Jack Cohen, 1988, OLIGODEOXYNUCLEOTIDES, Antisense Inhibitors of Gene Expression, CRC Press; and Synthesis 1: 1-5 (1988). The RORl antisense oHgonucleotides of the present invention include derivatives such as S- oHgom-Lcleotides (phosphorothioate derivatives or S-oHgos, see, Jack Cohen, supra), which exhibit enhanced cancer ceE growth inhibitory action. S-oϋgos (nucleoside phosphorothioates) are isoelectronic analogs of an oHgonucleoti.de (O-oHgo) in which a nonbtidging oxygen atom of the phosphate group is replaced by a sulfur atom. The S- oHgos of the present invention may be prepared by treatment of the corresponding O- oHgos with 3H-l,2-benzodithiol-3-one-l,l-dioxide, which is a sulfur transfer reagent. See Iyer, R. P. et al, 1990, J. Org. Chem. 55:4693-4698; and Iyer, R. P. et al., 1990, J. Am. Chem. Soc. 112:1253-1254, the disclosures of which are fuEy incorporated by reference herein. Additional RORl antisense oHgonucleotides of the present invention include morpholino antisense oligonucleotides known in the art (see e.g. Partridge et al., 1996, Antisense & Nucleic Acid Drug Development 6: 169-175). The RORl antisense oHgonucleotides of the present invention typically may be RNA or DNA that is complementary to and stably hybridizes with the first 100 N- terminal codons or last 100 C-terminal codons of the RORl genomic sequence or the corresponding mRNA. WhHe absolute complementarity is not required, high degrees of complementarity are desirable. Use of an oHgonucleotide complementary to this region aEows for the selective hybridization to RORl mRNA and not to mRNA specifying other regulatory subunits of protein kinase. Preferably, the RORl antisense oHgonucleotides of the present invention are a 15 to 30-mer fragment of the antisense DNA molecule having a sequence that hybridizes to RORl mRNA. Optionally, RORl antisense oHgonucleotide is a 30-mer oHgonucleotide that is complementary to a region in the first 10 N-terminal codons and last 10 C-terminal codons of RORl. Alternatively, the antisense molecules are modified to employ ribozymes in the inhibition of RORl expression (L. A. Coutu_re & D. T. Stinchcomb, 1996, Trends Genet. 12: 510-515). Further specific embodiments of tiiis aspect of the invention include primers and primer pairs, which allow the specific ampHfication of the polynucleotides of the invention or of any specific parts thereof, and probes that selectively or spedficaEy hybridize to nucleic acid molecules of the invention or to any part thereof. Probes may be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemEuminescent compound, metal chelator or enzyme. Such probes and primers can be used to detect the presence of a RORl polynucleotide in a sample and as a means for detecting a ceE expressing a RORl protein. Examples of such probes include polypeptides comprising aE or part of die human RORl cDNA sequences shown in FIG. 1. Examples of primer pairs capable of spedficaEy ampHfying RORl n__R-NAs are easEy made by tiiose of skiE in the art. As wiE be understood by the skilled artisan, a great many different primers and probes may be prepared based on the sequences provided herein and used effectively to ampHfy and/ or detect a RORl mRNA. As used herein, a polynucleotide is said to be "isolated" when it is substantiaEy separated from cont_aminant polynucleotides that correspond or are complementary to genes other than the RORl gene or that encode polypeptides other than RORl gene product or fragments thereof. A skiEed artisan can readEy employ nuckic acid isolation procedures to obtain an isolated RORl polyn icleotide. The RORl polynucleotides of the invention are useful for a variety of purposes, including but not limited to their use as probes and primers for the ampHfication and/ or detection of the RORl gene(s), mRNA(s), or fragments thereof; as reagents for the diagnosis and/ or prognosis of breast cance_t (e.g. specific breast cancer subtypes) and other cancers; as coding sequences capable of directing the expression of RORl polypeptides; as tools for modulating or inhibiting the expression of the RORl gene(s) and/ or translation of the RORl transcript(s) - and as therapeutic agents.

ISOLATION OF ROR1-ENCODING NUCLEIC ACID MOLECULES The RORl cDNA sequences described herein enable the isolation of other polynucleotides encoding RORl gene product(s), as weE as the isolation of polynucleotides encoding RORl gene product homologs, alternatively spHced isoforms, aEeHc variants, and mutant forms of the RORl gene product. Various molecular cloning methods tiiat can be employed to isolate fuE length cDNAs encoding a RORl gene are weE known (See, e.g., Sambrook, J. et al., 1989, Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Press, New York; Ausubel et al., eds., 1995, Current Protocols in Molecular Biology, WEey and Sons). For example, lambda phage cloning methodologies may be conveniendy employed, using commerciaEy available cloning systems (e.g., Lambda ZAP Express, Stratagene). Phage clones containing RORl gene cDNAs may be identified by probing with a labeled RORl cDNA or a fragment thereof. For example, in one embodiment, the RORl cDNA (FIG. 1) or a portion thereof can be synthesized and used as a probe to retrieve overlapping and full length cDNAs corresponding to a RORl gene. The RORl gene itself may be isolated by screening genomic DNA Hbra ies, bacterial artifidal chromosome Hbraries (BACs), yeast artificial chromosome Hbraries (YACs), and the Hke, with RORl DNA probes or primers. RECOMBINANT DNA MOLECULES AND HOST-VECTOR SYSTEMS The invention also provides recombinant DNA or RNA molecules containing a RORl polynucleotide, including but not limited to phages, plasmids, phagemids, cosmids, YACs, BACs, as weE as various viral and non-viral vectors weE known in the art, and ceEs transformed or transfected with such recombinant DNA or RNA molecules. As used herein, a recombinant DNA or RNA molecule is a DNA or RNA molecule that has been subjected to molecular manipulation in vitro. Methods for generating such molecules are weE known (see, e.g., Sambrook et al, 1989, supra). The invention further provides a host- vector system comprising a recombinant

DNA molecule containing a RORl polynucleotide within a suitable prokaryotic or eukaryotic host ceE. Examples of suitable eukaryotic host ceEs include a yeast ceE, a plant ceE, or an animal ceE, such as a -tnammaHan ceE or an insect ceE (e.g., a baculovirus- infectible ceE such as an Sf9 or HigfciFive ceE). Examples of suitable mammaHan ceEs include various breast cancer ceE lines such as MDA 231, MCF-7, other transfectable or transducible breast cancer ceE lines, as weE as a number of mammaHan ceEs routinely used for the expression of recombinant proteins (e.g., COS, CHO, MCF-7 ceEs). More particularly, a polynucleotide comprising the coding sequence of RORl may be used to generate RORl proteins or fragments thereof using any number of host-vector systems routinely used and widely known in the art. A wide range of host-vector systems suitable for the expression of RORl proteins or fragments thereof are avaEable (see, e.g., Sambrook et al., 1989, supra; Current Protocols in Molecular Biology, 1995, supra). Common vectors for mammaHan expression include but are not limited to pcDNA 3.1 myc-His-tag (Invitrogen) and the retroviral vector pSRαtkneo (MuEer et al, 1991, MCB 11:1785). Using tiiese expression vectors, RORl may be preferably expressed in several breast cancer and non-breast ceE lines, including for example, MCF-7, rat-1, NIH 3T3 and TsuPrl. The host-vector systems of the invention are useful for the production of a RORl protein or fragment thereof. Such host-vector systems may be employed to study the functional properties of RORl and RORl mutations. Recombinant human RORl protein may be produced by mammaHan ceEs transfected with a construct encoding RORl . In an illustrative embodiment described in the Examples, MCF-7 ceEs can be transfected witli an expression plasmid encoding RORl, the RORl protein is expressed in the MCF-~7 ceEs, and the recombinant RORl protein can be isolated using standard purification methods (e.g., affinity purification using anti-RORl antibodies). In another embodiment, also described in the Examples herein, the RORl coding sequence is subcloned into the retroviral vector pSRαMSNtkneo and used to infect various mammaHan ceE Hnes, such as ΝIH 3T3, MCF-7 and rat-1 in order to estabHsh RORl expressing ceE lines. Various other expression systems weE known in the art may also be employed. Expression constructs encoding a leader peptide joined in frame to the ROR-.1 coding sequence may be used for the generation of a secreted form of recombinant RO R1 protein. Proteins encoded by the RORl genes, or by fragments thereof, wiE have a variety of uses, including but not limited to generating antibodies and in methods for identifying Hgands and other agents and ceEular constituents that bind to a RORl gene product. Antibodies raised against a RORl protein or fragment thereof may be useful in diagnostic and prognostic assays, and imaging methodologies in the management of human cancers characterized by expression of RORl protein, including but not limited to cancers of the breast. Such antibodies may be expressed intraceEularly and used in methods of treating patients with such cancers. Various immunological assays useful for the detection of RORl proteins are contemplated, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme- linked immunofluorescent assays (ELIFA), immunocytochemical methods, and the like. Such antibodies may be labeled and used as immunological imaging reagents capable of detecting RORl expressing ceEs (e.g., in radioscintigtaphic imaging methods). RORl proteins may also be particularly useful in generating cancer vaccines, as further described below. RORl POLYPEPTIDES Another aspect of the present invention provides RORl proteins and polypeptide fragments thereof. The RORl proteins of the invention irxclude those spedficaEy identified herein, as weE as aEeHc variants, conservative substitution variants and homologs tiiat can be isolated/generated and characterized without undue experimentation foEowing die methods outlined below. Fusion proteins that combine parts of different RORl proteins or fragments diereof, as weE as fusion proteins of a RORl protein and a heterologous polypeptide are also included. Such RORl proteins will be coEectively referred to as the RORl proteins, the proteins of the invention, or RORl . As used herein, the term "RORl polypeptide" refers to a polypeptide fragment or a RORl protein of at least 6 amino acids, preferably at least 15 amino acids. Spedfic embodiments of RORl proteins comprise a polypeptide having the amino acid sequence of human RORl as shown in FIG. 1. Alternatively-, embodiments of RORl proteins comprise variant polypeptides having alterations in the amino acid sequence of human RORl as shown in FIG. 1. In general, naturaEy occurring aEeHc variants of human RORl wiE share a high degree of structural identity and homology (e.g., 90% or more identity). TypicaEy, aEeHc variants of the RORl proteins wiE contain conservative amino add substitutions within the RORl sequences described herein or wiE contain a substitution of an amino add from a corresponding position in a RORl homologue. One class of ROH1 aEeHc variants wiE be proteins that share a high degree of homology witii at least a small region of a particular RORl amino acid sequence, but wiE further contain a radical depa-etute from the sequence, such as a non-conservative substitution, truncation, insertion or frame shift. Conservative amino acid substitutions can frequently be made in a protein without altering either the conformation or the function of the protein. Such changes include substituting any of isoleucine (I), valine (V), and leucine (X) for any other of these hydrophobic amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (I) and vice versa. Other substitutions can also be considered conservative, depending on die environment of the particular amino acid and its role in the three-dimensional structure of the protein. For example, glycine (G) and alanine (A) can frequentiy be interchangeable, as can alanine (A) and valine (V). Methionine (M), which is relatively hydrophobic, can frequentiy be interchanged with leucine and isoleucine, and sometimes with valine. Lysine (K) and arginine (R) are frequentiy interchangeable in locations in which the significant feature of the amino acid residue is its charge and the differing pK's of these two amino add residues are not significant. StiE other changes can be considered "conservative" in particular environments. Embodiments of the invention disclosed herein include a wide variety of art accepted variants of RORl proteins such as polypeptides having amino acid insertions, deletions and substitutions. RORl variants can be made using methods known in the art such as site-directed mutagenesis, alanine scanning, and PCR mutagenesis . Site-directed mutagenesis (Carter et al, 1986, Nucl. Acids Res. 13:4331; ZoEer et al., 1987, Nucl. Acids Res. 10:6487), cassette mutagenesis (WeEs et al., 1985, Gene 34:315), restriction selection mutagenesis (WeEs et al., 1986, PhEos. Trans. R. Soc. London Ser. A, 31~7:415) or otiier known techniques can be performed on the cloned DNA to produce the RORl variant DNA. Scanning amino acid analysis can also be employed to identify- one or more amino acids along a contiguous sequence. Among the common scanning amino acids are relatively smaE, neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is typicaEy a common scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant. Alanine is also typically "used because it is the most common amino acid. Further, it is frequentiy found in both buried and exposed positions (Creighton, The Proteins, ( .H. Freeman & Co., I.Y.); Chotiiia, 1976, J. Mol. Biol., 150:1). If alanine substitution does not yield adequate amounts of variant, an isosteric amino acid can be used. As discussed above, embodiments of the claimed invention include polypeptides containing less than the 937 amino acid sequence of the RORl protein shown in FIG. 1 (and the polynucleotides encoding such polypeptides). For example, representative embodiments of the invention disclosed herein include polypeptides consisting of about amino acid 1 to about amino acid 10 of die RORl protein shown in FIG. 1, polypeptides consisting of about amino acid 20 to about amino acid 30 of the RORl protein shown in FIG. 1, polypeptides consisting of about amino add 30 to about amino acid 40 of die RORl protein shown in FIG. 1, polypeptides consisting of about amino acid 40 to abouLt amino acid 50 of the RORl protein shown in FIG. 1, polypeptides consisting of about amino acid 50 to about amino acid 60 of the RORl protein shown in FIG. L , polypeptides consisting of about amino acid 60 to about amino acid 70 of the ROR^'l protein shown in FIG. 1, polypeptides consisting of about amino acid 70 to about amino acid 80 of the RORl protein shown in FIG. 1, polypeptides consisting of about amino acid 80 to about amino acid 90 of the RORl protein shown in FIG. 1 and polypeptides consisting of about amino acid 90 to about amino acid 100 of the RORl protein showaα in FIG. 1, etc. FoEowing this scheme, polypeptides consisting of portions of the amino acid sequence of amino acids 100-937 of the RORl protein are typical embodiments of the invention. Polypeptides consisting of larger portions of the RORl protein are als o contemplated. For example polypeptides consisting of about amino acid 1 (or 20 or 3 O or 40 etc.) to about amino acid 20, (or 30, or 40 or 50 etc.) of the RORl protein showaa in FIG. 1 may be generated by a variety of techniques weE lαiown in the art. The polypeptides of the preceding paragraphs have a number of different specific uses. As RORl is shown to be highly expressed in certain breast cancer subtypes a.s compared to corresponding normal breast tissue, these polypeptides may be used in methods assessing the status of RORl gene products in normal versus cancerous tissues and elucidating the maHgnant phenotype. TypicaEy, polypeptides encoding specific regions of the RORl protein may be used to assess the presence of perturbations (sucli as deletions, insertions, point mutations etc.) in specific regions of the RORl gene products. Exemplary assays can utilize antibodies targeting a RORl polypeptide containing the amino acid residues of one or more of the biological motifs contained within the RORl polypeptide sequence in order to evaluate the characteristics of this region in normal versus cancerous tissues. Alternatively, RORl polypeptides containing the amino acid residues of one or more of the biological motifs contained witiiin tfcie RORl polypeptide sequence can be used to screen for factors that interact with that region of RORl. As discussed above, redundancy in the genetic code permits variation in RORl gene sequences. In particular, one skiEed in the art wiE recognize specific codoxi preferences by a specific host species and can adapt die disclosed sequence as preferred for a desired host. For example, certain codon sequences typicaEy have rare codons (i.e ., codons having a usage frequency of less than about 20% in known sequences of th-e desired host) replaced with higher frequency codons. Codon preferences for a specific organism may be calculated, for example, by utiHzing codon usage tables avaHable on th-e Internet at the foEowing address: www.dna.affrc.go.jp/~nakam.ura/codon.htm_l. Nucleotide sequences that have been optimized for a particular host species by replaciixg any codons having a usage frequency of less than about 20% are referred to herein a-s "codon optimized sequences." Additional sequence modifications are known to enhance protein expression in a ceEular host. These include elimination of sequences encoding spurious polyadenylation. signals, exon/intron spHce site signals, transposon-like repeats, and/ or other such well- characterized sequences that may be deleterious to gene expression. The GC content of the sequence may be adjusted to levels average for a given ceEular host, as calculated by reference to known genes expressed in the host ceE. Where possible, die sequence may also be modified to avoid predicted hairpin secondary mRNA structures. Other useful modifications include the addition of a translational initiation consensus sequence at the start of the open reading frame, as described in Kozak, 1989, Mol. CeE Biol., 9:5073- 5080. Nucleotide sequences that have been optimized for expression in a given host species by elimination of spurious polyadenylation sequences, elimination of exon/intron spHcing signals, elimination of transposon-like repeats and/ or optimization of GC content in addition to codon optimization are referred to herein as an "expression enhanced sequence." RORl proteins may be embodied in many forms, preferably in isolated form. A-s used herein, a protein is said to be "isolated" when physical, mechanical or chemical methods are employed to remove the RORl protein from ceEular constituents that atre normaEy associated with the protein. A skiEed artisan can read y employ standard purification methods to obtain an isolated RORl protein. A purified RORl protein molecule wiE be substantiaEy free of other proteins or molecules that impair the binding of RORl to antibody or other Hgand. The nature and degree of isolation and purification wiE depend on the intended use. Embodiments of a RORl protein include a purified RORl protein and a functional, soluble RORl protein. In one form, such functional, soluble RORl proteins or fragments thereof retain the abiHty to bind antibody or other Hgand. The invention also provides RORl polypeptides comprising biologicaEy active fragments of the RORl amino acid sequence, such as a polypeptide corresponding to part of the amino acid sequence for RORl as shown in FIG. 1. Such polypeptides of the invention exhibit properties of the RORl protein, such as the abiHty to eHcit the generation of antibodies that spedficaEy bind an epitope associated with the RORl protein. RORl polypeptides can be generated using standard peptide synthesis technology or using chemical cleavage methods weE known in the art based on the amino add sequences of the human RORl proteins disclosed herein. Alternatively, recombinant methods can be used to generate nucldc add molecules that encode a polypeptide fragment of a RORl protein. In this regard, the RORl -encoding nucleic add molecules described herein provide means for generating defined fragments of RORl proteins. RORl polypeptides are particularly useful in generating and characterizing domain spedfic antibodies (e.g., antibodies recognizing an extraceEular or intraceEular epitope of a RORl protein), in identifying agents or ceEular factors that bind to RORl or a particular structural domain thereof, and in various therapeutic contexts, including but not limited to cancer vaccines. RORl polypeptides containing particulady interesting structures can be predicted and/or identified using various analytical techniques weE known in the art, including, for example, the methods of Chou-Fasman, Garnier-Robson, Kyte-DooHtde, Eisenberg, Katplus-Schultz or Jameson-Wolf analysis, or on the basis of immunogenidty. Fragments containing such structures are particularly useful in generating subunit specific anti-RORl antibodies or in identifying ceEular factors that bind to RORl. In an embodiment described in the examples that foEow, RORl can be convenientiy expressed in ceEs (such as MCF-7 ceEs) transfected with a commerciaEy avaHable expression vector such as a CMV-driven expression vector encoding RORl with a C-terminal 6XHis and MYC tag (pcDNA3.1/mycHIS, Invitrogen or Tag5, GenHunter Corporation, NashviEe TN). The Tag5 vector provides an IgGK secretion signal that can be used to faciHtate the production of a secreted RORl protein in transfected ceEs. The secreted HIS-tagged RORl in the culture media may be purified using a nickel column using standard techniques. The RORl of the present invention may also be modified in a way to form a chimeric molecule comprising RORl fused to anotiier, heterologous polypeptide or amino acid sequence. In one embodiment, such a chimeric molecule comprises a fusion of the RORl with a polyhistidine epitope tag, which provides an epitope to which immobilized nickel can selectively bind. The epitope tag is generaEy placed at the amino- or carboxyl- terminus of the RORl. In an alternative embodiment, the chimeric molecule may comprise a fusion of the RORl with an HnmunoglobuHn or a particular region of an iminunoglobulin. For a bivalent form of the chimeric molecule (also referred to as an "immunoadhesin"), such a fusion could be to the Fc region of an IgG molecule. The Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a RORl polypeptide in place of at least one variable region within an Ig molecule. In particular embodiments, the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGl molecule. For the production of immunoglobulin fusions see also U,S. Patent No. 5,428,130 issued June 27, 1995. In some embodiments of the invention, the fusion protein includes only the Ig- like C2-type domain of RORl (Q73-V139 of SEQ ID NO: 2). In some embodiments of the invention, the fusion protein includes only the frizzled domain of RORl (El 65-1299 of SEQ ID NO: 2). In some embodiments of the invention, the fusion protein includes only the kringle domain of RORl (K312-C391 of SEQ ID NO: 2). In other embodiments of the invention, the fusion protein includes 2 or alternatively 3 of these RORl domains. RORl ANTIBODIES The term "antibody" is used in the broadest sense and spedficaEy covers single anti-RORl monoclonal antibodies (including agonist, antagonist and neutralizing antibodies) and anti-RORl antibody compositions witii polyepitopic specificity. The term "monoclonal antibody" (mAb) as used herein refers to an antibody obtained from a population of substantiaEy homogeneous antibodies, ie. the antibodies comprising the individual population are identical except for possible naturaHy-occurring mutations that may be present in minor amounts. Another aspect of the invention provides antibodies tiiat bind to RORl proteins and polypeptides. The most common antibodies wiE spedficaEy bind to a RORl protein and wiE not bind (or wiE bind weakly) to non-RORl proteins and polypeptides. Anti- RORl antibodies that are particulady contemplated include monoclonal and polyclonal antibodies as weE as fragments containing die antigen binding domain and/or one or more complementarity detemiining regions of these antibodies. As used herein, an antibody fragment is defined as at least a portion of the variable region of the imrnunoglobulin molecule that binds to its target, ie., tlie antigen binding region. RORl antibodies of the invention may be particularly useful in breast cancer diagnostic and prognostic assays, and imaging methodologies. IntraceEularly expressed antibodies (e.g., single chain antibodies) may be therapeuticaEy useful in treating cancers in which the expression of RORl is involved, such as for example advanced and metastatic breast cancers. Such antibodies may be useful in the treatment, diagnosis, and/ or prognosis of other cancers, to the extent RORl is also expressed or overexpressed in other types of cancers such as breast cancers. The invention also provides various immunological assays useful for d e detection and quantification of RORl and mutant RORl proteins and polypeptides. Such assays generaEy comprise one or more RORl antibodies capable of recognizing and binding a RORl or mutant RORl protein, as appropriate, and may be performed within various immunological assay formats weE known in the art, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme- linked immunofluorescent assays (ELIFA), and the like. In addition, immunological imaging methods capable of detecting breast cancer and other cancers expressing RORl are also provided by the invention, including but limited to radioscintigraphic imaging methods using labeled RORl antibodies. Such assays may be clinicaEy useful in the detection, monitoring, and prognosis of RORl expressing cancers such as breast cancer. RORl antibodies may also be used in methods for purifying RORl and mutant RORl proteins and polypeptides and for isolating RORl homologues and related molecules. For example, in one embodiment, the method of purifying a RORl protein comprises incubating a RORl antibody, which has been coupled to a soHd matrix, witii a lysate or other solution containing RORl under conditions that permit the RORl antibody to bind to RORl; washing the soHd matrix to eliminate impurities; and eluting the RORl from the coupled antibody. Other uses of the RORl antibodies of the invention include generating anti-idiotypic antibodies that mimic the RORl protein. Various methods for the preparation of antibodies are weE known in the art. For example, antibodies may be prepared by immunizing a suitable mammaHan host using a RORl protein, peptide, or fragment, in isolated or immunoconjugated form (Harlow, and Lane, eds., 1988, Antibodies: A Laboratory Manual, CSH Press; Harlow, 1989, Antibodies, Cold Spring Harbor Press, NY). In addition, fusion proteins of RORl may also be used, such as a RORl GST-fusion protein. In a particular embodiment, a GST fusion protein comprising aE or most of the open reading frame amino add sequence of FIG. 1 may be produced and used as an immunogen to generate appropriate antibodies. In another embodiment, a RORl peptide may be syntiiesized and used as an immunogen. In addition, naked DNA immunization techniques known in the art may be used (with or without purified RORl protein or RORl expressing ceEs) to generate an immune response to the encoded immunogen (for review, see DonneEy et al., 1997, Ann. Rev. Immunol. 15:617-648). The amino acid sequence of the RORl as shown in FIG. 1 may be used to select spedfic regions of the RORl protein for generating antibodies. For example, hydrophobidty and hydrophiHcity analyses of the RORl amino acid sequence may be used to identify hydrophiHc regions in the RORl structure. Regions of the RORl protein that show immunogenic structure, as weE as other regions and domains, can readEy be identified using various odier mediods known in the art, such as Chou-Fasman, Garnier- Robson, Kyte-DooHttle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis. Methods for preparing a protein or polypeptide for use as an immunogen and for preparing immunogenic conjugates of a protein with a carrier such as BSA, KLH, or other carrier proteins are weE known in die art. In some circumstances, direct conjugation using, for example, carboά___mide reagents may be used; in other instances linking reagents such as those suppHed by Pierce Chemical Co., Rockford, IL, may be effective. Administration of a RORl immunogen is conducted generaEy by injection over a suitable time period and with use of a suitable adjuvant, as is generaEy understood in the art. During the ii rmunization schedule, titers of antibodies can be taken to determine adequacy of antibody formation. RORl monoclonal antibodies may be produced by various means weE known in the art. For example, immortalized ceE Hnes that secrete a desired monoclonal antibody may be prepared using the standard hybridoma technology of Kohler and MEstein or modifications that immortalize producing B ceEs, as is generaEy known. The immortalized ceE Hnes secreting die desired antibodies are screened by immunoassay in which the antigen is the RORl protein or a RORl fragment. When the appropriate imrnortalized ceE culture secreting the desired antibody is identified, the ceEs may be expanded and antibodies produced either from in vitro cultures or from ascites fluid. The antibodies or fragments may also be produced, using current technology, by recombinant means. Regions that bind spedficaEy to the desired regions of the RORl protein can also be produced in the context of chkneric or CDR grafted antibodies of multiple spedes origin. Humanized or human RORl antibodies may also be produced for use in therapeutic contexts. Methods for humanizing murine and other non-human antibodies by substituting one or more of the non-human antibody CDRs for corresponding human antibody sequences are weE known (see for example, Jones et al., 1986, Nature 321:522-525; Riechmann et al., 1988, Nature 332:323-327; Verhoeyen et al., 1988, Sdence 239:1534-1536). See also, Carter et al., 1993, Proc. Nad. Acad. Sci. USA 89:4285 and Sims et al., 1993, J. Immunol. 151:2296. Methods for producing fuEy human monoclonal antibodies include phage display and transgenic methods (for review, see Vaughan et al., 1998, Nature Biotechnology 16:535-539). FuEy human RORl monoclonal antibodies may be generated using cloning technologies employing large human Ig gene combinatorial Hbraries (ie., phage display) (Griffiths and Hoogenboom, BuEding an in vitro immune system: human antibodies from phage display Hbraries. In: Clark, M., ed., 1993, Protein Engineering of Antibody Molecules for Prophylactic and Therapeutic AppHcations in Man, Nottingham Academic, pp 45-64; Burton and Barbas, Human Antibodies from combinatorial Hbraries. Id., pp 65-82). FuEy human RORl monoclonal antibodies may also be produced using transgenic mice engineered to contain human immunoglobulin gene lod as described in PCT Patent AppHcation W098/24893, Kucherlapati and Jakobovits et al., pubHshed December 3, 1997 (see also, Jakobovits, 1998, Exp. Opin. Invest. Drugs 7(4):607-614). This method avoids the in vitro manipulation required with phage display technology and efficientiy produces high affinity authentic human antibodies. Reactivity of RORl antibodies with a RORl protein may be estabHshed by a number of weE known means, including western blot, immunoprecipitation, ELISA, and FACS analyses using, as appropriate, RORl proteins, peptides, RORl -expressing ceEs or extracts thereof. A RORl antibody or fragment thereof of the invention may be labeled with a detectable marker or conjugated to a second molecule. Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a bioluminescent compound, chemHuminescent compound, a metal chelator or an enzyme. A second molecule for conjugation to the RORl antibody can be selected in accordance witii die intended use. For example, for therapeutic use, the second molecule can be a toxin or therapeutic agent. Further, bi-specific antibodies specific for two or more RORl epitopes may be generated using methods generaEy known in the art. Homodimeric antibodies may also be generated by cross-linking techniques known in the art (e.g., Wolff et al., 1993, Cancer Res. 53: 2560-2565). An illustrative embodiment of the invention is an isolated antibody which spedficaEy binds to an RORl polypeptide sequence shown in FIG. 1 (SEQ ID NO: 2). OptionaEy this isolated antibody specificaEy binds to the extraceEular region of RORl (M1-V406 of SEQ ID NO: 2). In certain embodiments of the invention, the isolated antibody specificaEy binds to the Ig-Hke C2-type domain of RORl (Q73-V139 of SEQ ID NO: 2). In other embodiments of the invention, the isolated antibody specificaEy binds to the frizzled domain of RORl (El 65-1299 of SEQ ID NO: 2). In other embodiments of the invention, the isolated antibody specificaEy binds to die kringle domain of RORl (K312-C391 of SEQ ID NO: 2). Another embodiment of the invention is an immunotoxin which is a conjugate of a cytotoxic moiety and one of these antibodies. OptionaEy, the antibody is an antibody fragment comprising an antigen binding region which specificaEy binds to RORl (e.g. a Fab fragment). TypicaEy one or more of these antibodies wiE down regulates d e RORl and/or is capable of activating complement in a patient treated with an effective amount of the antibodies and/ or is capable of mediating antibody dependent ceEular cytotoxicity in a patient treated with an effective amount of the antibody. In certain embodiments of the invention, one or more of these antibodies eliminates and/ or reduces tumor burden in a patient treated with an effective amount of the antibody. In certain embodiments of the invention, the tumor ceE is a human breast carcinomas of the BRCAl and/ or basal subtype. Another related embodiment of the invention is a hybridoma that produces one of these antibodies which specificaEy binds to RORl . Another related embodiment of the invention is a composition comprising one of these antibodies which specificaEy binds to RORl and a pharmaceuticaEy acceptable carrier. Yet another embodiment of the invention is an assay for detecting a tumor (e.g. a breast cancer) comprising the steps of exposing a ceE to one of these antibodies and then determining the extent of binding of the antibody to the ceE. A related embodiment of die invention is an antibody which specificaEy binds to die extraceEular domain of die RORl and inhibits growth of tumor ceEs which overexpress RORl in a patient treated with an effective amount of the antibody. In certaήi embodiments of the invention, the tumor ceE is a human breast carcinomas of d e BRCAl and/or basal subtype. OptionaEy the antibody is a murine monoclonal antibody. TypicaEy the antibody down regulates the RORl and/ or is capable of activating complement in a patient and/ or is capable of mediating antibody dependent ceEular cytotoxicity in the patient. A related embodiment of the invention is an immunotoxin which is a conjugate of a cytotoxic moiety and this antibody. Another related embodiment of the invention is a hybridoma producing this antibody. Another embodiment of the invention is an antibody which specificaEy binds to

RORl and inhibits the growth of HCC1187, Cal51, MB468, MDA-MB-231, HCC1395, HS578T, HCC70, HCC1143, HCC1937, HCC2157, MDA-MB-436, BT-20, 184A1, MB157, MCF12A, 184B5, or Colo824 tumor ceEs (see, e.g. FIG. 5) in ceE culture by greater than 20%, at an antibody concentration of about 0.5, 1, 5, 10, or 30 μg/ml. TypicaEy tiiese tumor cells are cultured in culture medium comprising 10% fetal bovine serum and the growth inhibition is determined approximately six days after exposure of the tumor ceEs to the antibody. TypicaEy this antibody is a monoclonal antibody. OptionaEy this monoclonal antibody binds to the extraceEular region of RORl (Ml- V406 or Q30N406 of SEQ ID NO: 2). In certain embodiments of the invention, the monoclonal antibody binds to the Ig-Hke C2-type domain of RORl (Q73-V139 of SEQ ID NO: 2). In other embodiments of the invention, the monoclonal antibody binds to the frizzled domain of RORl (El 65-1299 of SEQ ID NO: 2). In other embodiments of the invention, the monoclonal antibody binds to the kringle domain of RORl (K312- C391 of SEQ ID NO: 2). In some embodiments of the invention, this antibody downregulates RORl on a tumor ceE that overexpresses this polypeptide and inhibits growth of tumor ceEs in a patient treated with a therapeuticaEy effective amount of this antibody. In certain embodiments of the invention, the tumor ceE is a human breast carcinomas of the BRCAl and/ or basal subtype. TypicaEy the antibody is capable of activating complement in a patient and/or is capable of mediating antibody dependent ceEular cytotoxicity in the patient. A related embodiment of the invention is an immunotoxin which is a conjugate of a cytotoxic moiety and this antibody. Another related embodiment of the invention is a hybridoma producing this antibody. Yet another embodiment of the invention is a method of inhibiting the growth of tumor ceEs that overexpress RORl comprising administering to a patient an antibody which binds specificaEy to the extraceEular domain of the RORl in an amount effective to inhibit growth of the tumor cells in the patient. In certain embodiments of the invention, the tumor ceE is a human breast carcinomas of the BRCAl and/ or basal subtype. TypicaEy the antibody is capable of activating complement in a patient and/ or is capable of mediating antibody dependent ceEular cytotoxicity in the patient. A related embodiment of the invention is an irnn unotoxin which is a conjugate of a cytotoxic moiety and this antibody. Another related embodiment of the invention is a hybridoma producing this antibody. Yet another embodiment of the invention is a method of inhibiting the growth of tumor ceEs that overexpress RORl comprising administering to a patient an antibody comprising an antigen binding region 'which specificaEy binds to an extraceEular domain of the RORl in an amount effective to inhibit growth of the tumor ceEs in the patient, wherein the antibody is not conjugated to a cytotoxic moiety. In certa embodiments of the invention, the tumor ceE is a human breast carcinomas of the BRCAl and/ or basal subtype. A related embodiment of the invention is a method of treating cancer that overexpresses RORl comprising administering to a patient an antibody comprising an antigen binding region which specifically binds to an extraceEular domain of the RORl in an amount effective to eliminate or reduce the patient's tumor burden, wherein the antibody is not conjugated to a cytotoxic moiety. OptionaEy the patient has breast cancer. Yet another embodiment of the invention is a method of treating cancer comprising identifying a patient with cancer characterized by ampHfication of the HER2 gene and/ or overexpression of the RORl and administering to the patient thus identified an antibody comprising an antigen binding region which specificaEy binds to an extraceEular domain of die RORl in an amount effective to inhibit growth of the cancer of the patient. Another embodiment of the invention is a method of treating a patient having a carcinoma that overexpresses RORl comprising administering to die patient an antibody which binds specificaEy to the extracellular domain of the RORl in an amount effective to eliminate or reduce the patient's tumor burden. In certain embodiments of the invention, the tumor ceE is a human breast carcinomas of the BRCAl and/ or basal subtype. TypicaEy this antibody is a monoclonal antibody. In some embodiments of the invention, this antibody downregulates the RORl on a tumor ceE that overexpresses this polypeptide and inhibits growth of tumor ceEs in a patient treated with a therapeuticaEy effective amount of this antibody. TypicaEy the antibody is capable of activating complement in a patient and/ or is capable of mediating antibody dependent ceEular cytotoxicity in the patient. A related embodiment of the invention is an i____munotoxin which is a conjugate of a cytotoxic moiety and this antibody. Another related embodiment of the invention is a hybridoma producing tiiis antibody. Other related embodiments of the invention include methods for the preparation of a medication for the treatment of pathological conditions including breast cancer by preparing an anti-RORl antibody composition for administration to a mammal havmg the pathological condition. A related method is the use of an effective amount of an anti-RORl antibody in the preparation of a medicament for die treatment of a breast cancer. Another related method is the use of an effective amount of an anti-RORl antibody in the preparation of a medicament for the treatment of a basal breast cancer. A related method is the use of an effective amount of an anti-RORl antibody in the preparation of a medicament for the treatment of a BRCAl breast cancer. Yet another related embodiment is a use of a anti-RORl antibody the manufacture of a medicament for inhibiting RORl action in a patient. Such, methods typicaEy involve the steps of including an amount of anti-RORl antibody sufficient to inhibit RORl signaling in vivo and an appropriate amount of a physiologicaEy acceptable carrier. As is known in the art, OptionaEy other agents can be included in these preparations.

RORl TRANSGENIC ANIMALS Nucleic acids that encode RORl or its modified forms can also be used to generate either transgenic animals or "knock out" animals wliich, in turn, are useful in the development and screening of therapeuticaEy useful reagents. A transgenic animal (e.g., a mouse or rat) is an animal having ceEs that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage. A transgene is a DNA that is integrated into the genome of a ceE from which a transgenic animal develops. In one embodiment, cDNA encoding RORl can be used to clone genomic DNA encoding RORl in accordance witli estabHshed techniques and the genomic sequences used to generate transgenic animals that contain ceEs that express DNA encoding RORl. Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009. TypicaEy, particular ceEs would be targeted for RORl transgene incorporation with tissue-specific enhancers. Transgenic animals that include a copy of a transgene encoding RORl introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding RORl. Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression. In accordance with this facet of the invention, an animal is treated with the reagent and a reduced inddence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition. Alternatively, non-human homologues of RORl can be used to construct a

RORl "knock out" animal that has a defective or altered gene encoding RORl as a result of homologous recombination between the endogenous gene encoding RORl and altered genomic DNA encoding RORl introduced into an embryonic ceE of die animal. For example, cDNA encoding RORl can be used to clone genomic DNA encoding RORl in accordance witli estabHshed techniques. A portion of the genomic DNA encoding RORl can be deleted or replaced with another gene, such as a gene encoding a selectable marker that can be used to monitor integration. TypicaEy, several kilobases of unaltered flanldng DNA (both at the 5' and 3' ends) are included in the vector (see e.g., Thomas and Capecchi, 1987, CeE 51:503) for a description of homologous recombination vectors]. The vector is introduced into an embryonic stem ceE line (e.g., by electroporation) and ceEs in which the introduced DNA has homologously recombined with the endogenous DNA are selected (see e.g., Li et al., 1992, CeE 69:915). The selected ceEs are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras (see e.g., Bradley, in Robertson, ed., 1987, Teratocarcinomas and Embryonic Stem CeEs: A Practical Approach, (IRL, Oxford), pp. 113-152). A chimeric embryo can then be Hnplanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal. Progeny harboring the homologously recombined DNA in their germ ceEs can be identified by standard techniques and used to breed animals in wliich aE ceEs of the animal contain the homologously recombined DNA. Knockout animals can be characterized for instance, for their abiHty to defend against certain pathological conditions and for their development of pathological conditions due to absence of the RORl polypeptide.

METHODS FOR THE DETECTION OF RORl -Another aspect of the present invention relates to methods for detecting RORl polynucleotides and RORl proteins and variants thereof, as weE as methods for identifying a ceE that expresses RORl. The expression profile of RORl makes it a potential diagnostic marker for breast cancer and breast cancer subtype. In this context, the status of RORl gene products may provide infonnation useful for predicting a variety of factors including susceptibEity to advanced stage disease, rate of progression, and/ or tumor aggressiveness. As discussed in detaE below, the status of RORl gene products in patient samples may be analyzed by a variety protocols that are weE known in the art including immunoHstochemical analysis, the variety of Northern blotting techniques including in situ hybridization, RT-PCR analysis (for example on laser capture micro-dissected samples), western blot analysis and tissue array analysis. 3More particularly, tlie invention provides assays for the detection of RORl polynucleotides in a biological sample, such as a breast biopsy and the like. Detectable RORl polynucleotides include, for example, a RORl gene or fragments thereof, RORl mRNA, alternative spHce variant RORl mRNAs, and recombinant DNA or RNA molecules containing a RORl polynucleotide. A number of methods for ampHfying and/ or detecting the presence of RORl polynucleotides are weE known in the art and may be employed in the practice of this aspect of the invention. In one embodiment, a method for detecting a RORl mRNA in a biological sample comprises producing cDNA from the sample by reverse transcription using at least one primer; ampHfying the cDNA so produced using a RORl polynucleotides as sense and antisense primers to arπipHfy RORl cDNAs therein; and detecting the presence of the ampHfied RORl cDNA. OptionaEy, the sequence of the ampHfied RORl cDNA can be determined. In another embodiment, a method of detecting a RORl gene in a biological sample comprises first isolating genomic DNA from the sample; ampHfying the isolated genomic DNA using RORl polynucleotides as sense and antisense primers to ampHfy the RORl gene therein- and detecting the presence of the ampHfied RORl gene. Any number of appropriate sense and antisense probe combinations may be designed from the nucleotide sequences provided for the RORl (FIG. 1) and used for this purpose. The invention also provides assays for detecting the presence of a RORl protein in a tissue of other biological sample such as breast ceE preparations, and the like. Mediods for detecting a RORl protein are also weE known and include, for example, immunopredpitation, i__x_munohistochemical analysis, Western Blot analysis, molecular binding assays, ELISA, ELIFA and the like. For example, in one embodiment, a method of detecting the presence of a RORl protein in a biological sample comprises first contacting the sample vith a RORl antibody, a RORl -reactive fragment thereof, or a recombinant protein containing an antigen binding region of a RORl antibody; and then detecting the binding of RORl protein in the sample thereto. In some embodiments of the invention, the expression of RORl proteins in a sample is examined using Immunohistochemical staining protocols. Ittimunohistochemical staining of tissue sections has been shown to be a reHable method of assessing alteration of proteins in a heterogeneous tissue. Immunohistochemistry (IHC) techniques utilize an antibody to probe and visualize ceEular antigens in situ, generaEy by chromogenic or fluorescent methods. This technique excels because it avoids the unwanted effects of disaggregation and aEows for evaluation of individual ceEs in the context of morphology. In addition, the target protein is not altered by the freezing process. Certain protocols that examine the expression of RORl proteins in a sample typicaEy involve the preparation of a tissue sample foEowed by imπiunohistochemistry. Illustrative protocols aare provided below. For sample preparation, any tissue sample from a subject may be used. Examples of tissue samples that may be used include, but are not Hmited to breast tissue. The tissue sample can be obtained by a variety of procedures including, but not limited to surgical excision, aspiration or biopsy. The tissue may be fresh or frozen. In one embodiment, the tissue sample is fixed and embedded in paraffin or the like. The tissue sample may be fixed (i.e. preserved) by conventional methodology (See e.g., "Manual of Histological Staining Method of the Armed Forces Institute of Pathology," 3^rd edition (1960) Lee G. Luna, HT (ASCP) Editor, The Blakston Division McGraw-Hill Book Company, New York; The Artned Forces Institute of Pathology Λdvanced Laboratory Methods in Histology and Pathology (1994) Ulreka V. Mikel, Editor, Armed Forces Institute of Pathology, American Registry of Pathology, Washington, D.C.). One of skiE in the art wiE appreciate that the choice of a fixative is determined by the purpose for which the tissue is to be histologicaEy stained o_t otherwise analyzed. One of skiE in the art wiE also appreciate that the length of fixation depends upon the size of the tissue sample and the fixative used. By way of example, neutral buffered formalin, Bouin's or paraformaldehyde, may be used to fix a tissue sample. GeneraEy, the tissue sample is first fixed and is then dehydrated through an ascending series of alcohols, infiltrated and embedded with paraffin or other sectioning media so that the tissue sample may be sectioned. Alternatively, one may section the tissue and fix the sections obtained. By way of example, the tissue sample may be embedded and processed in paraffin by conventional methodology (See e.g., "Manual of Histological Staining Method of the Armed Forces Institute of Pathology", supra) . Examples of paraffin that may be used include, but are not limited to, Paraplast, Broloid, and Tissuemay. Once the tissue sample is embedded, the sample may be sectioned by a microtome or die like (See e.g., "Manual of Histological Staining Method of the Armed Forces Institute of Pathology", supra). By way of example for tiiis procedure, sections may range from about three microns to about five microns in thickness. Once sectioned, the sections may be attached to slides by several standard methods. Examples of sHde adhesives include, but are not limited to, sEane, gelatin, poly-L-lysine and the like. By way of example, the paraffin embedded sections may be attached to positively charged sHdes and/ or sHdes coated with poly-L-lysine. If paraffin has been used as the embedding material, the tissue sections are generaEy deparaffinized and rehydrated to water. The tissue sections may be deparaffinized by several conventional standard methodologies. For example, xylenes and a graduaEy descending series of alcohols may be used (See e.g., "Manual of Histological Staining Method of the Armed Forces Institute of Pathology", supra). Alternatively, commerciaEy avaEable deparaffinizing non-organic agents such as Hemo- De7 (CMS, Houston, Texas) may be used. Subsequent to tissue preparation, a tissue section may be subjected to imrnunohistochemistry (IHC). IHC may be performed in combination with additional techniques such as morphological staining and/or fluorescence in-situ hybridization. Two general mediods of IHC are avaEable; direct and indirect assays. According to the first assay, binding of antibody to the target antigen is determined directly. This direct assay uses a labeled reagent, such as a fluorescent tag or an enzyme-labeled primary antibody, which can be visualized without further antibody interaction. In a typical indirect assay, unconjugated primary antibody binds to the antigen and then a labeled secondary antibody binds to the primary antibody. Where the secondary antibody is conjugated to an enzymatic label, a chromogenic or fluorogenic substrate is added to provide visualization of the antigen. Signal ampHfication occurs because several secondary antibodies may react with different epitopes on the primary antibody. The primary and/ or secondary antibody used for immunoltistochemistry typicaEy wiE be labeled with a detectable moiety. Numerous labels are avaEable which can be generaEy grouped into the foEowing categories: (a) Radioisotopes, such as ³⁵S, ¹⁴C, ^X25I, ³H, and ¹³¹I. The antibody can be labeled with the radioisotope using the techniques described in Current Protocols in Immunology, Volumes 1 and 2, CoHgen et al., Ed. WHey-Interscience, New York, New York, Pubs. (1991) for example and radioactivity can be measured using scintiEation counting. (b) CoEoidal gold particles. (c) Fluorescent labels including, but are not limited to, rare earth chelates (europium chelates), Texas Red, rhodamine, fluorescein, dansyl, Lissamine, umbelHferone, phycocrytherin, phycocyanin, or commercially avaEable fluorophores such SPECTRUM ORANGE7 and SPECTRUM GREEN7 and/or derivatives of any one or more of the above. The fluorescent la els can be conjugated to the antibody using the techniques disclosed in Current Protocols in Immunology, supra, for example. Fluorescence can be quantified using a fluorimete___. (d) Various enzyme-substrate labels are avaEable and U.S. Patent No. 4,275,149 provides a review of some of these. Th-e enzyme generaEy catalyzes a chemical alteration of the chromogenic substrate that can be measured using various techniques. For example, the enzyme may catalyze a color change in a substrate, which can be measured spectrophotometticaEy. Alternatively, tHe enzyme may alter the fluorescence or chemHuminescence of the substrate. Techniques for quantifying a change in fluorescence are described above. The chemEuminescent substrate becomes electronicaEy excited by a chemical reaction and may then emit Hght which can be measured (using a chemEuminottieter, for example) or donates energy to a fluorescent acceptor. Examples of enzymatic labels include luciferases (e.g., firefly- luciferase and bacterial luciferase; U.S. Patent No. 4,737,456), luciferin, 2,3-dihydropht-aalazinediones, malate dehydrogenase, urease, peroxidase such as horseradish peroxidase (HRPO), alkaline phosphatase, β- galactosidase, glucoamylase, lysozyme, saccha-ride oxidases (e.g., glucose oxidase, galactose oxidase, and glucose-6-phosphate dehydrogenase), heterocycHc oxidases (such as uricase and xanthine oxidase), lactoperoxidase, microperoxidase, and the like. Techniques for conjugating enzymes to antibodies are described in O'SuEivan et al., Methods for the Preparation of Enzyme-Antibody Conjugates for use in Enzyme Immunoassay, in Methods in En^ym. (ed. J. Langorie & H. Van Vunakis), Academic press, New York, 73:147-166 (1981). Examples of enzyme-substrate combinations include, for example: (i) Horseradish peroxidase (HRPO) vith hydrogen peroxidase as a substrate, wherein the hydrogen peroxidase oxidizes a dye precursor (e.g., orthophenylene diamine (OPD) or 3,3',5,5'-tetramethyl benzidine hydrochloride (TMB)); (H) alkaline phosphatase (AP) with para-Nitrophenyl phosphate as chromogenic substrate; and (Hi) β-D-galactosidase (β-D-Gal) with a chromogenic substrate (e.g., p- nitrophenyl-β-D-galactosidase) or fluorogenic substrate (e.g., 4-met_hylumbelHferyl-β-D- galactosidase). Numerous other enzyme-substrate combinations are available to those skEled in the art. For a general review of these, see U.S. Patent Nos. 4,275,149 and 4,318,980. Sometimes, the label is indirectly conjugated with the antibody. The skiEed artisan will be aware of various techniques for achieving this. For example, the antibody can be conjugated witii biotin and any of the four broad categories of labels mentioned above can be conjugated with avidin, or vice versa. Biotin binds selectively to avidin and thus, the label can be conjugated with the antibody in this indirect manner. Alternatively, to achieve indirect conjugation of the label with the antibody, the antibody is conjugated with a s aE hapten and one of the different types of labels mentioned above is conjugated with an anti-hapten antibody. Thus, indirect conjugation, of the label with the antibody can be achieved. Aside from the sample preparation procedures discussed above, further treatment of the tissue section prior to, during or foEowing IHC may be desired, For example, epitope retrieval methods, such as heating the tissue sample in citrate buffer may be carried out (see, e.g., Leong et al. Appl. Immunohistochem. 4(3):201 (1996)). FoEowing an optional blocking step, the tissue section is exposed to primary antibody for a sufficient period of time and under suitable conditions such that the primary antibody binds to the target protein antigen in the tissue sample. Appropriate conditions for achieving this can be determined by routine experirrxentation. The extent of binduig of antibody to the sample is determined by using any one of the detectable labels discussed above. Preferably, the label is an enzymatic label, (e.g. HRPO) which catalyzes a chemical alteration of the chromogenic substrate such as 3,3'- diaminobenzidine chromogen. Preferably the enzymatic label is conjugated to antibody which binds specificaEy to the primary antibody (e.g. the primarty antibody is rabbit polyclonal antibody and secondary antibody is goat anti-rabbit antibody). Specimens thus prepared may be mounted and coversHpped. SHde evaluation is then determined, e.g. using a microscope. WliHe not being bound by the foEowing parameters, protein staining intensity criteria may be evaluated as iEustrated by the foEowing chart:

Protein Staining Intensity Criteria

Other methods for identifying a ceE that expresses RORl are also available to the skiEed artisan. In one embodiment, an assay for identifying a ceE that expresses a RORl gene comprises detecting the presence of RORl mRNA in the ceE. Methods for the detection of particular mRNAs in ceEs are weE known and include, for example, hybridization assays using complementary DNA probes (such as in situ hybridizatiorn using labeled RORl riboprobes, Northern blot and related techniques) and various nucleic add ampHfication assays (such as RT-PCR using complementary primers specific for RORl, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like). Alternatively, an assay for identifying a ceE that expresses a RORl gene comprises detecting tlie presence of RORl protein in the ceE or secreted by die ceU. Various methods for the detection of proteins are weE known in the art a_tιd may be employed for the detection of RORl proteins and RORl expressing ceEs. RORl expression analysis may also be useful as a tool for identifying and evaluating agents that modulate RORl gene expression. For example, RORl expression is significantly upregulated in breast cancer, is also aberrantiy expressed in other cancers. Identification of a molecule or biological agent that could inhibit RORl expres sion or over-expression in cancer ceEs may be of therapeutic value. Such an agent _t_nay be identified by using a screen that quantifies RORl expression by RT-PCR, nucleic acid hybridization or antibody binding. MONITORING THE STATUS OF RORl AND ITS PRODUCTS Assays that evaluate the status of the RORl gene and RORl gene products in an individual may provide information on the growth or oncogenic potential of a biological sample from this individud. For example, because RORl mRNA is so highly expressed in certain breast cancer ceEs as compared to normal breast tissue, assays that evaluate die relative levels of RORl mRNA transcripts or proteins in a biological sample can be used to diagnose a disease associated witii RORl disregulation such as cancer and may provide prognostic information that can for example be useful in defining appropriate therapeutic options. Similarly, assays that evaluate die integrity RORl nucleotide and asmao acid sequences in a biological sample, can also be used in this context. The finding that RORl mRNA is so highly expressed in certain breast cancer subtypes provides evidence that this gene is associated with disregulated ceE growtli and therefore identifies this gene and its products as targets that the skiEed artisan can use to evaluate biological samples from individuals suspected of having a disease associated with RORl disregulation. In this context, the evaluation of the status of RORl gene aαtid its products can be used to gain information on the disease potential of a tissue sample. The term "status" in this context is used according to its art accepted meaniα-g and refers to die condition a gene and its products including, but not limited to the integrity and/ or methylation of a gene including its regulatory sequences, the location of expressed gene products (including the location of RORl expressing ceEs), the presence, level, and biological activity of expressed gene products (such as RORl mRNA polynucleotides and polypeptides), the presence or absence of transcriptional and translational modifications to expressed gene products as weE as assodations of expressed gene products with other biological molecules such as protein binding partners. Alterations in the status of -RORl can be evaluated by a wide variety of methodologies weE known in the art, typicaEy those discussed below. TypicaEy an alteration in the status of RORl comprises a change in tlie location of RORl expressing ceEs, an increase in RORl mRNA and/or p-rotein expression and/ or the association or dissociation of RORl with a binding partner. The expression profile of RORl makes it a potential diagnostic marker for local and/ or metastasized breast cancer disease. In particular, the status of RORl may provide information useful for predicting susceptibEity to particular disease stage or subtype, progression, and/ or tumor aggressiveness. The invention provides methods and assays for determining RORl status and diagnosing cancers that express RORl, such as cancers of the breast. RORl status in patient samples may be analyzed by a number of means weE known in the art, including without limitation, immunohistochemical analysis, in situ hybridization, RT-PCR analysis on laser capture micro-dissected samples, western blot analysis of clinical samples and ceE lines, and tissue array analysis. Typical protocols for evaluating the status of the RORl gene and gene products can be found, for example in Ausubul et al. eds., 1995, Current Protocols In Molecular Biology, Units 2 [Northern Blotting], 4 [Southern Blotting], 15 [Immunoblotting] and 18 [PCR Analysis]. As described above, the status of RORl in a biological sample can be examined by a number of weE known procedures in the art. For example, the status of RORl in a biological sample taken from a specific location in the body can be examined by evaluating the sample for the presence or absence of RORl expressing ceEs (e.g. those that express RORl mRNAs or proteins). This examination can provide evidence of disregulated ceEular growth for example, when RORl expressing breast ceEs are found in a biological sample that does not normaEy contain such ceEs (such as a lymph node, bone or spleen). Such alterations in the status of RORl in a biological sample are often associated with disregulated ceEular growth. SpecificaEy, one indicator of disregulated ceEular growth is the metastases of cancer ceEs from an organ of origin (such as the breast gland) to a different area of the body (such as a lymph node). In this context, evidence of disregulated ceEular growth is important for example because occult lymph node metastases can be detected in a substantial proportion of patients with breast cancer, and such metastases are associated with lαiown predictors of disease progression (see, e.g. Gipponni et al, J Surg Oncol. 2004 Mar 1;85(3):102-111). In one aspect, the invention provides methods for monitoring RORl gene products by determining the status of RORl gene products expressed by ceEs in a test tissue sample from an individual suspected of having a disease associated with disregulated ceE growth (such as hyperplasia or cancer) and then comparing the status so determined to the status of RORl gene products in a corresponding normal sample, the presence of aberrant RORl gene products in die test sample relative to the normal sample providing an indication of the presence of disregulated ceE growth within the ceEs of the individual. In another aspect, the invention provides assays useful in determining the presence of cancer in an individual, comprising detecting a significant increase in RORl mRNA or protein expression in a test ceE or tissue sample relative to expression levels in the corresponding normal ceE or tissue. The presence of RORl mRNA may, for example, be evaluated in tissue samples including but not limited to breast cancer subtypes such as basal and BRCA 1 breast cancer subtypes (see, e.g. Soriie et al., PNAS (2001), 98(19): 10869-10874), etc. The presence of significant RORl expression in any of these tissues may be useful to indicate the emergence, presence and/ or severity of these cancers, since the corresponding normal tissues do not express RORl mRNA or express it at lower levels. In a related embodiment, RORl status may be detemiined at the protein level rather than at the nucleic add level. For example, such a method or assay would comprise deterrriining the level of RORl protein expressed by ceEs in a test tissue sample and comparing the level so detemiined to the level of RORl expressed in a corresponding normal sample. In one embodiment, the presence of RORl protein is evaluated, for example, using immunohistochemical methods. RORl antibodies or binding partners capable of detecting RORl protein expression may be used in a variety of assay formats weE known in the art for this purpose. In other related embodiments, one can evaluate the integrity RORl nucleotide and amino acid sequences in a biological sample in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the Hke. Such embodiments are useful because perturbations in tlie nucleotide and amino acid sequences are observed in a large number of proteins assodated with a growth disregdated phenotype (see, e.g., Marrogi et al, 1999, J. Cutan. Padiol. 26(8):369-378). In this context, a wide variety of assays for observing perturbations in nucleotide and amkio acid sequences are weE known in the art. For example, the size and structure of nucldc add or amino add sequences of RORl gene products may be observed by the Northern, Southern, Western, PCR and DNA sequencing protocols discussed herein. In addition, other methods for observing perturbations in nucleotide and amino add sequences such as single strand conformation polymorphism analysis are weE known in the art (see, e.g., U.S. Patent Nos. 5,382,510 and 5,952,170). In another embodiment, one can examine the methylation status of the RORl gene in a biological sample. Aberrant demetiiylation and/ or hypermethylation of CpG islands in gene 5' regulatory regions frequentiy occurs in immortaHzed and transformed ceEs and can result in altered expression of various genes. For example, promoter hypermethylation of the pi-class glutathione S-transferase (a protein expressed in normal prostate but not expressed in >90% of prostate carcinomas) appears to permanentiy sEence transcription of this gene and is the most frequently detected genomic alteration in prostate carcinomas (De Marzo et al., Am. J. Pathol. 155(6): 1985-1992 (1999)). In addition, this alteration is present in at least 70% of cases of high-grade prostatic intraepitheHal neoplasia (PIN) (Brooks et al, Cancer Epidemiol. Biomarkers Prev., 1998, 7:531-536). In another example, expression of the LAGE-I tumor specific gene (which is not expressed in normal prostate but is expressed in 25-50% of prostate cancers) is induced by deoxy- azacytidine in lymphoblastoid ceEs, suggesting that tumoral expression is due to demetiiylation (Lethe et al., Int. J. Cancer 76(6): 903-908 (1998)). In this context, a variety of assays for examining methylation status of a gene are weE lαiown in the art. For example, one can utilize in Southern hybridization approaches methylation-sensitive restriction enzymes which can not cleave sequences that contain methylated CpG sites in order to assess the overaE methylation status of CpG islands. In addition, MSP (methylation specific PCR) can rapidly profile the methylation status of aE the CpG sites present in a CpG island of a given gene. This procedure involves initial modification of DNA by sodium bisulfite (which wiE convert aE unmethylated cytosines to uracE) foEowed by amplification using primers specific for methylated versus unmethylated DNA. Protocols involving metiiylation interference can also be found for example in Current Protocols In Molecular Biology, Units 12, Frederick M. Ausubul et al. eds., 1995. Gene ampHfication provides an additional method of assessing the status of RORl, a locus that maps to lp31, a region shown to be perturbed in a variety of cancers. Gene ampHfication may be measured in a sample directiy, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, 1980, Proc. Natl. Acad. Sci. USA, 77:5201-5205), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected. In addition to the tissues discussed above, peripheral blood may be conveniently assayed for the presence of cancer ceEs, including but not limited to breast cancers, using for example, Northern or RT-PCR analysis to detect RORl expression. The presence of RT-PCR ampHfiable RORl mRNA provides an indication of the presence of the cancer. RT-PCR detection assays for tumor ceEs in peripheral blood are currently being evduated for use in the diagnosis and management of a number of human soHd tumors. A related aspect of the invention is directed to predicting susceptibEity to developing cancer in an individual. In one embodiment, a method for predicting susceptibEity to cancer comprises detecting RORl mRNA or RORl protein in a tissue sample, its presence indicating susceptibEity to cancer, wherein the degree of RORl mRNA expression present is proportional to the degree of susceptibEity. In a specific embodiment, the presence of RORl in breast tissue is examined, with tlie presence of RORl in die sample providing an indication of breast cancer susceptibEity (or the emergence or existence of a breast tumor and/ or the emergence or existence of a specific breast tumor subtype). In another specific embodiment, the presence of RORl in tissue is examined, with the presence of RORl in the sample providing an indication of cancer susceptibEity (or tlie emergence or existence of a tumor). In a closely related embodiment, one can evaluate the integrity RORl nucleotide and amino acid sequences in a biological sample in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like, with the presence of one or more perturbations in RORl gene products in die sample providing an indication of cancer susceptibEity (or the emergence or existence of a tumor). Yet another related aspect of the invention is directed to methods for gauging tumor aggressiveness. In one embodiment, a method for gauging aggressiveness of a tumor comprises determining the level of RORl mRNA or RORl protein expressed by ceEs in a sample of the tumor, comparing the level so determined to the level of RORl mRNA or RORl protein expressed in a corresponding normal tissue taken from the same individual or a normal tissue reference sample, wherein the degree of RORl mRNA or RORl protein expression in the tumor sample relative to the normal sample indicates the degree of aggressiveness. In a specific embodiment, aggressiveness of a tumor is evaluated by detei-mining the extent to which RORl is expressed in the tumor ceEs, with higher expression levels indicating more aggressive tumors. In a closely related embodiment, one can evaluate the integrity of RORl nucleotide and amino add sequences in a biological sample in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like, with the presence of one or more perturbations indicating more aggressive tumors. Yet another related aspect of the invention is directed to methods for observing the progression of a maHgnancy in an individual over time. In one embodiment, methods for observing the progression of a maHgnancy in an individual over time comprise determining the level of RORl mRNA or RORl protein expressed by ceEs in a sample of the tumor, comparing the level so determined to the level of RORl mRNA or RORl protein expressed in an equivalent tissue sample taken from the same individual at a different time, wherein the degree of RORl mRNA or RORl protein expression in the tumor sample over time provides information on the progression of the cancer. In a spedfic embodiment, the progression of a cancer is evaluated by detemώiing the extent to which RORl expression in the tumor ceEs alters over time, with higher expression levels indicating a progression of the cancer. In a closely related embodiment, one can evaluate the integrity RORl nucleotide and amino acid sequences in a biological sample in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like, with the presence of one or more perturbations indicating a progression of the cancer. Tlie above diagnostic approaches may be combined with any one of a wide variety of prognostic and diagnostic protocols known in d e art. For example, another embodiment of the invention disclosed herein is directed to methods for observing a coinάdence between the expression of RORl gene and RORl gene products (or perturbations in RORl gene and RORl gene products) and a factor that is associated witli maHgnancy as a means of diagnosing and prognosticating the status of a tissue sample. In this context, a wide variety of factors associated with maHgnancy may be utilized such as the expression of genes otherwise associated with maHgnancy (including Her-2 and BRCA

1 and 2 expression) as weE as gross cytological observations (see e.g. Bocking et al., 1984, Anal. Quant. Cytol. 6(2):74-88; Eptsein, 1995, Hum. Pathol. 26(2):223-9; Thorson et al., 1998, Mod. Pathol. 11(6):543-51; Baisden et al., 1999, Am. J. Surg. Pathol. 23(8):918-24). Methods for observing a coinddence between the expression of RORl gene and RORl gene products (or perturbations in RORl gene and RORl gene products) and an additiond factor that is assodated with maHgnancy are useful, for example, because the presence of a set or consteEation of specific factors that coindde provides information crucial for diagnosing and prognosticating tlie status of a tissue sample. In a typical embodiment, methods for observing a coincidence between the expression of RORl gene and RORl gene products (or perturbations in RORl gene and RORl gene products) and a factor that is associated with maHgnancy entaEs detecting the overexpression of RORl mRNA or protein in a tissue sample, detecting the overexpression of BRCA 1 or 2 mRNA or protein in a tissue sample, and observing a coinddence of RORl mRNA or protein and BRCA mRNA or protein overexpression. In another specific embodiment, the expression of RORl and Her-2 mRNA in breast tissue is examined. In a common embodiment, the coincidence of RORl and Her-2 or BRCA 1 or

2 mRNA overexpression in the sample provides an indication of breast cancer, breast cancer subtype, breast cancer susceptibEity or the emergence or existence of a breast tumor. Methods for detecting and quantifying the expression of RORl mRNA or protein are described herein and use of standard nucldc add and protein detection and quantification technologies is weE known in the art. Standard methods for the detection and quantification of RORl mRNA include in situ hybridization using labeled RORl riboprobes, Northern blot and related techniques using RORl polynucleotide probes, RT- PCR analysis using primers specific for RORl, and other ampHfication type detection methods, such as, for example, branched DNA, SISBA, TMA and the like. In a spedfic embodiment, RT-PCR may be used to detect and quantify RORl mRNA expression as described in the Examples. Any number of primers capable of ampHfying RORl may be used for this purpose. Standard methods for the detection and quantification of protein may be used for this purpose. In a specific embodiment, polyclonal or monoclonal antibodies spedficaEy reactive with the wEd-type RORl protein may be used in an immttnohistochemical assay of biopsied tissue. The invention has a number of embodiments. One embodiment is a method of exaιτ___ning a test biological sample comprising a human breast ceE for evidence of altered ceE growth that is indicative of a breast cancer by evaluating the levels of orphan receptor tyrosine kinase (RORl) polynucleotides that encode the RORl polypeptide shown in SEQ ID NO: 2 in the biological sample, wherein an increase in the levels of the RORl polynucleotides in the test sample relative to a normal breast tissue sample provide evidence of altered ceE growth that is indicative of a breast cancer; and wherein the levels of the RORl polynucleotides in the ceE are evaluated by contacting the sample with a RORl complementary polynucleotide that hybridizes to a RORl nucleotide sequence shown in SEQ IE) NO: 1, or a complement thereof, and evaluating the presence of a hybridization complex formed by the hybridization of the RORl complementary polynucleotide with the RORl polynucleotides in the test biological sample. A related embodiment is a method of examining a human breast ceE for evidence of altered ceE growth that is associated with or provides evidence of a breast cancer by evaluating the levels of orphan receptor tyrosine kinase (RORl) polynucleotides that encode the RORl polypeptide shown in SEQ ID NO: 2 in die human breast ceE, wherein an increase in die levels of the RORl polynucleotides (e.g. mRNAs and genomic sequences) in the human breast ceE relative to a normal human breast ceE provides evidence of altered ceE growth that is associated with or provides evidence of a breast cancer; and wherein the levels of the RORl polynucleotides in the human breast ceE are evaluated by contacting the endogenous RORl polynucleotide sequences in the human breast ceE with a RORl complementary polynucleotide the RORl complementary polynucleotide (e.g. a probe labeEed with a detectable marker or a PCR primer) and which specificaEy hybridizes to a RORl nucleotide sequence shown in SEQ ID NO: 1 and evaluating the presence of a hybridization complex formed by the hybridization of the RORl complementary polynucleotide with the RORl polynucleotides in the sample (e.g. via Northern analysis or PCR) so that evidence of altered ceE growth that is assodated with or provides evidence of a breast cancer is examined. Certain embodiments of the invention include the step of examining the expression of Her-2 (SEQ ID NO: 3), EGFR (SEQ ID NO: 4), VEGF (SEQ ID NO: 5), FMS-like tyrosine kinase (SEQ ID NO: 6), MYC (SEQ ID NO: 7), urokinase plasminogen activator (SEQ ID NO: 8), plasminogen activator inhibitor (SEQ ID NO: 9), BRCAl (SEQ ID NO: 10) or BRCA2 (SEQ ID NO: 11) polynucleotides in the test biological sample. In some embodiments of the invention, the increase in the levels of the RORl polynucleotides in the human breast ceE relative to a normal human breast ceE that provides evidence of altered cell growth is quantified, for example, as being at least a 100% (1 fold) increase, or a 200% (2 fold), 4 fold, 8 fold, 15 fold, 30 fold, 60 fold, or a 120 fold increase in the relative levels of the RORl polynucleotides. In the quantitative mRNA analyses disclosed herein (see, e.g. FIG. 5), die increase in the levels of the RORl mRNAs in the ceEs tested ranged from a 15 fold increase (e.g. in the BT-20 ceE line) to a 120 fold increase in the HCC1187 cell line. The average increase in the levels of the RORl polynucleotides in the overexpressing ceE lines as compared to the observed expression in luminal breast cancer ceE lines is 43 fold. The normalized standard that can be used as a comparative reference of RORl expression can for example be obtained from normal breast tissue taken from the same individual, or a normal tissue reference sample taken from a healthy individual. Alternatively, a normalized standard can be a numerical range of normal RORl expression that is obtained from a statistical sampling of normal ceEs from a population of individuals. In certain embodiments of the invention, the normalized standard is derived by comparing RORl expression to a control gene that is expressed in the same ceEular environment at relatively stable levels (e.g. a housekeeping gene such as an actin). Immortalized, non-maHgnant breast ceE Hnes appear to be of basal origin and also express RORl polynucleotides at levels significantly higher than luminal breast cancer ceEs. In this context, the level of RORl polynucleotide expression is observed to be higher in basal breast cancer ceEs as compared to non-maHgnant basal ceEs, with an average increase in RORl polynucleotide expression being a 7 fold increase. While there are no continuously growing non-maHgnant luminal ceEs available, the analyses of luminal breast cancer and normal tissues described herein suggests that the expression of RORl polynucleotides in normal luminal mammary ceEs is very low or undetectable. When RORl expression in primary breast cancer is compares to breast ceE lines are calculated as a log ratio, the average log ratio of the 12 highest RORl expressing ceE lines is 0.40 (with a range from 0.12 to 0.9). The average log ratio of the 5 basal RORl positive primary breast cancers is 0.26 ('with a range from 0.21 to 0.32). The consistency of these calculations is supported by the observation that when compared against the same reference (pure tumor ceE lines) the breast tumors have similar but sHghtiy lower RORl expression levels than those observed in pure ceE lines. Without being bound by a spedfic dieory, these observations are consistent with a simple dEution effect because the tumor ceEs in the primary tumor occur in a complex mixture of ceE types (including those that are known not to express RORl). In certain embodiments of the invention, the breast cancer is of the basal subtype. As is known in the art, cancers of the breast can be group into a number of distinct subtypes, including a basal subtype (see, e.g. see, e.g. SorHe et al., PNAS (2001), 98(19): 10869-10874). In particular, mammary ducts are bEayered structures composed of a luminal layer and a myoepitheHal layer that adhere to a basement membrane. The term basal subtype is an art accepted term that refers to certaύi cancers that arise from the basal layer of the stratified epitheHa (see, e.g. figure 1 in WEson et al. Breast Cancer Research Vol 6 No. 5: 192-200 (2004)). Breast carcinomas of the basal subtype reside in the basal layer of the ductal epitheHum of the breast as opposed to the apical or luminal layers. Such cancers have distinct cytological features and gene expression profiles such as an intermediate filament profile (cytokeratins) first observed in the basal ceEs of the skin. In particular, basal ceEs in the skin are known to express certain cytokeratins (ie. K5/6, K7, K17, K14) which are found in complex epitheHa as opposed to K8, K18, K19 which are found in simple, or glandular epithelia. A subtype of breast cancer (e.g. one with basal ceE properties) can be readily determined via pathology-IHC data and/ or the Stanford breast tumor profiling data disclosed herein. For example, Wetzels et al, Am J Path. (1991) 138: p751-63 which is incorporated herein by reference describe basal ceE-specific and hyperproHferations- related keratins in human breast cancer. This study found that 15% (n=115) of invasive breast cancers were positive for basal cytokeratins 14 and 17. In addition, Bartek et al., Int J. Cancer (1985) 36:299-306 which is incorporated herein by reference also teach the characterization of breast cancer subtypes using patterns of expression of KI 9 in human breast tissues and tumors. Conversely, most meduEary and poorly differentiated ductal carcinomas were negative for cytokeratin 19 while moderately and weE-differentiated ductal, invasive lobular, tubular and most mucinous carcinomas were positive with both K19 Abs. In addition, P-Cadherin (CDH3) (SEQ ID NO: 12) and Desmosomal Cadherins are expressed in Basal Layer of Breast Ducts and P-Cadherin mRNA is overexpressed in die basal and BRCAl subtypes. This provides confirmatory evidence that the Group 4 and BRCAl tumor groups share many molecular properties associated with ceE type origin. Paredes et al., Pathol. Res. Pract. 2002: 198(12): 795-801 wliich is incorporated herein by reference also investigate the expression of P cadheriii in breast carcinoma subtypes and correlate it witli estrogen receptor (ER) status. 73 ductal carcinomas in situ (DOS) and 149 invasive carcinomas of the breast were selected and examined for the expression of P-cadherin as weE as other biologic markers. P-cadherin expression showed a strong inverse correlation with estrogen receptor (ER) expression in both types of breast carcinoma (in situ and invasive). P-cadherin-positive and ER-negative tumors were related to a higher liistologic grade, a high proHferation rate, and expression of c- erbB-2. This demonstrates that P-cadherin identifies a subgroup of breast carcinomas that lacks ER expression, and correlates with higher proHferation rates and other predictors of aggressive behavior. See also, GamaEo et al., Mod. Pathol. 2001: 14(7): 650-4; Kovacs et al, J Clin Pathol 2003 Feb;56(2):139-4l ; and Peralta et al., Cancer 1999 Oct 1;86 (7): 1263-72 which are incorporated herein by reference. In certain embodiments of the invention, the breast cancer is of the BRCAl subtype. In particular, as is known in the art, cancers of the breast can be group into a number of distinct subtypes, including a BRCAl subtype (see, e.g. see, e.g. SorHe et al., PNAS (2001), 98(19): 10869-10874). In this context, a breast cancer of the BRCAl subtype is characterized as having a mutation in the BRCAl gene. A variety of distinct BRCAl mutations are known to occur in multiple tissues and include substitutions, deletions and missense mutations (see, e.g. Wagner et al., Int J Cancer. 1998 Jul 29;77(3):354-60; Chang et al., Breast Cancer Res Treat. 2001 Sep;69(2):101-13; and Foulkes et al., Cancer Res. 2004 Feb 1;64(3): 830-5; and Aghmesheh et al., Gynecol Oncol. 2005 Apr;97(l): 16-25 which are incorporated herein by reference). The Basal and BRCAl cancers are related by ceEular origin and molecular pathogenesis and the over- expression of RORl is an important alteration involved in the pathogenesis of these two tumor groups. FIG. 5F and FIG. 5G show the detection of endogenous RORl protein on the surface of CAL51 ceEs using anti-RORl rabbit polyclonal sera, with SKBR ceEs serving as a comparative ceE line. When compared to die RORl mRNA expression data shown for example in FIG. 5B, these studies with anti-RORl rabbit polyclonal sera demonstrate that RORl mRNA expression levels correlate with RORl protein expression levels. The niRNA/protein expression correlative data presented in these figures is consistent with other observations of RORl mRNA and protein expression. For example, Paganoni et al., in J. Neuroscience Research 73: 429-440 (2003) (which is incorporated herein by reference) teach that observations of RORl mRNA expression examined via in situ hybridization and/ or PCR analyses correlate with observations of RORl protein expression examined via iinmunohistochemical and/ or Western analyses in a variety of ceEs that express RORl. In addition, Paganoni et al., in GLIA 46: 456-466 (2004) (which is incorporated herein by reference) teach that both the RORl and ROR2 mRNA-s and the RORl and ROR2 proteins are expressed in vivo in early stages in brain development. In this GLIA article Paganoni et al. further teach that not only RORl and ROR2 mRNAs, but also ROR proteins, are highly expressed in certain cultured ceEs. The observation that RORl mRNA expression levels correlate with RORl protein expression levels is further supported by data presented herein that breast cancer ceEs that overexpress RORl exhibit for example, a specific basal phenotype and have a poor prognosis as compared to ceEs that do not overexpress RORl (characteristics known in the art to be influenced by the function of translated proteins). Another embodiment of the invention is a method of examining a test biological sample comprising a human breast ceE for evidence of altered ceE growth that is indicative of a breast cancer, the method comprising evaluating the levels of orphan receptor tyrosine kinase (RORl) polypeptides having the sequence shown in SEQ ID NO: 2 in the biological sample, wherein an increase in the levels of the RORl polypeptides in the test sample relative to a normal breast tissue sample provide evidence of altered ceE growth that is indicative of a breast cancer; and wherein the levels of the RORl polypeptides in the ceE are evaluated by contacting the sample with an antibody that immunospecificaEy binds to a RORl polypeptide sequence shown in SEQ ID NO: 2 and evaluating the presence of a complex formed by the binding of the antibody with the RORl polypeptides in the sample. A related embodiment of die invention is a method of examining a human breast ceE (e.g. from a biopsy) that is suspected of being cancerous for evidence of altered ceE growth that is indicative of a breast cancer, the method comprising evaluating the levels of orphan receptor tyrosine kinase (RORl) polypeptides having the sequence shown in SEQ ID NO: 2 in the breast ceE, wherein an increase in the levels of the RORl polypeptides in the human breast ceE relative to a normal breast ceE (e.g. a normal ceE from the individual providing the human breast ceE) provide evidence of altered ceE growth that is indicative of a breast cancer; and wherein the levels of the RORl polypeptides in the ceE are evaluated by contacting the sample with an antibody (e.g. one labeEed with a detectable marker) that immunospecificaEy binds to a RORl polypeptide sequence shown in SEQ ID NO: 2 and evaluating the presence of a complex formed by the binding of the antibody with the RORl polypeptides in the sample. TypicaEy the presence of a complex is evaluated by a method selected from the group consisting of ELISA. analysis, Western analysis and irnmunohistochemistry. OptionaEy, the breast cancer is of the basal or the BRCA 1 subtype. Yet another embodiment of the invention is a method of examining a test human ceE for evidence of a chromosomal abnormaHty d at is indicative of a human cancer by comparing orphan receptor tyrosine kinase (RORl) polynucleotide sequences from band p31 of chromosome 1 in a normal ceE to RORl polynucleotide sequences from band p31 of chromosome 1, band p31 on chromosome 1 in the test human ceE to identify an ampHfication or an alteration (e.g. a deletion, insertion, substitution or missense mutation) of the RORl polynucleotide sequences in the test human ceE, wherein an ampHfication or an alteration of the RORl polynucleotide sequences in the test human ceE provides evidence of a chromosomal abnormaHty that is indicative of a human cancer. In such methods chromosome 1, band p31 in the test human ceE is typicaEy evaluated by contacting the RORl polynucleotide sequences in the test human cell sample with a RORl complementary polynucleotide that specificaEy hybridizes to a RORl nucleotide sequence shown in SEQ ID NO: 1, or a complement thereof, and evaluating the presence of a hybridization complex formed by the hybridization of the RORl complementary polynucleotide with the RORl polynucleotide sequences in die test human ceE (e.g. by Northern analysis, Southern analysis or polymerase chain reaction analysis).

IDEN IFYING MOLECULES THAT INTERACT WITH RORl The RORl protein sequences disclosed herein aEow the skEled artisan to identify molecules that interact with them via any one of a variety of art accepted protocols. For example one can utilize one of the variety of so-caEed interaction trap systems (also referred to as the "two-hybrid assay"). In such systems, molecules that interact reconstitute a transcription factor and direct expression of a reporter gene, the expression of which is then assayed. Typical systems identify protein-protein interactions in vivo through reconstitution of a eukaryotic transcriptional activator and are disclosed for example in U.S. Patent Nos. 5,955,280, 5,925,523, 5,846,722 and 6,004,746. Alternatively one can identify molecules that interact with RORl protein sequences by screening peptide Hbraries. In such methods, peptides that bind to selected receptor molecules such as RORl are identified by screening Hbraries that encode a random or controEed coEection of amino acids. Peptides encoded by the Hbraries are expressed as fusion proteins of bacteriophage coat proteins, and bacteriophage particles are then screened against the receptors of interest. Peptides having a wide variety of uses, such as therapeutic or diagnostic reagents, may thus be identified without any prior information on the structure of the expected Hgand or receptor molecule. Typical peptide Hbraries and screening methods that can be used to identify molecules that interact with RORl protein sequences are disclosed for example in U.S. Patent Nos. 5,723,286 and 5,733,731. Alternatively, ceE lines expressing RORl can be used to identify protein-protein interactions mediated by RORl. This possibiHty can be examined using immunoprecipitation techniques as shown by others (HamEton, B.J., et al., 1999, Biochem. Biophys. Res. Commun. 261:646-51). TypicaEy RORl protein can be imrnunoprecipitated from RORl expressing breast cancer ceE lines using anti-RORl antibodies. Alternatively, antibodies against His-tag can be used Hi ceE line engineered to express RORl (vectors mentioned above). The imrnunoprecipitated complex can be examined for protein association by procedures such as western blotting, ³⁵S-metl_ion__ne labeling of protems, protein microsequencing, sEver staining and two dimensional gel electrophoresis . Related embodiments of such screening assays include methods for identifying smaE molecules that interact with RORl . Typical metiiods are discussed for example in U.S. Patent No. 5,928,868 and include methods for forming hybrid Hgands in which at least one Hgand is a smaE molecule. In an Elustrative embodiments, the hybrid Hgand is introduced into ceEs that in turn contain a first and a second expression vector. Each expression vector includes DNA for expressing a hybrid protein that encodes a target protein linked to a coding sequence for a transcriptional module. The ceEs further contains a reporter gene, the expression of ^w liich is conditioned on the proximity of the first and second hybrid protems to each other, an event that occurs only if the hybrid Hgand binds to target sites on both hybrid proteins. Those ceEs that express the reporter gene are selected and the unknown small molecule or the unknown hybrid protein is identified. A typical embodiment of this invention consists of a method of screening for a molecule that interacts with a RORl amino acid sequence shown in FIG. 1, comprising the steps of contacting a population of molecules with the RORl amino acid sequence, aEowing the population of molecules and the RORl amino acid sequence to interact under conditions that faciHtate an interaction, determining the presence of a molecule that interacts with the RORl amino acid sequence and then separating molecules that do not interact with the RORl amino acid sequence from molecules that do interact with the RORl amino acid sequence. In a specific embodiment, the method further includes purifying a molecule that interacts with the RORl amino acid sequence. In one embodiment, the RORl amino acid sequence is contacted witii a Hbrary of peptides.

THERAPEUTIC METHODS AND COMPOSITIONS The identification of RORl as a gene that is highly expressed in subtypes of cancers of the breast (and possibly other cancers), opens a number of therapeutic approaches to the treatment of such cancers. As discussed above, it is possible that RORl is secreted from cancer ceEs and in this way modulates proHferation signals. Its potential role as a transcription factor and its high expression in breast cancer makes it a potential target for smaE molecule-mediated therapy. Accordingly, therapeutic approaches aimed at inhibiting the activity of the RORl protein are expected to be useful for patients suffering from breast cancer and other cancers expressing RORl . RORl as a Target for Antibody-Based Therapy As disclosed herein, RORl is a ceE surface protein tiiat is overexpressed in certain pathologies such as cancers of the breast. The structural features of RORl indicate that this molecule is an attractive target for antibody-based therapeutic strategies. Because RORl is expressed by cancer ceEs of various lineages and not by corresponding normal ceEs, systemic adi iinistration of RORl-itramunoreactive compositions would be expected to exhibit exceEent sensitivity without toxic, non-specific and/ or non-target effects caused by binding of die immunothera-peutic molecule to non-target organs and tissues. Antibodies specificaEy reactive with domains of RORl can be useful to treat RORl -expressing cancers systemicaEy, either as conjugates with a toxin or therapeutic agent, or as naked antibodies capable of inhibiting ceE proHferation or function. As is known in the art, antibodies to ceE surface proteins can be used in therapeutic metiiods which preferentiaEy kEl ceEs that these express ceE surface proteins, particularly in situations where ceE surface protein is overexpressed in the pathological ceEs versus the normal ceEs in a patients body (e.g. HER2). WeE known methodologies usuig such antibodies take advantage of the abiHty of such antibodies to activate the complement cascade and/ or mediate antibody dependent ceEular cytotoxicity in a patient treated with an effective amount of the antibody. Alternative methodologies include the use of an immunotoxin which is a conjugate of a cytotoxic moiety and one of these antibodies. The amount of experimentation need to assess the abiHty of an anti-RORl antibody to inhibit the growth of any ceE examined is minor and foEows weE estabHshed protocols in the art. Moreover, the ability of an antibody to kiE a ceE expressing on its surface a protein recognized by that antibody and having the specific characteristics of RORl (e.g. having an expression pattern and structure etc. simEar to proteins such as HER2) foEows weE estabHshed scientific principles. Consequentiy the abiHty of an RORl antibody to inhibit the growth of and/ or kiH any ceE type can be determined with minimal experimentation. RORl antibodies can be introduced into a patient such that the antibody binds to RORl and modulates or perturbs a function such as an interaction with receptors and Hgands of the frizzled famEy and consequently mediates die destruction of the ceEs and the tumor and/ or inhibits the growth of the ceEs or the tunxor. Mechanisms by which such antibodies exert a therapeutic effect may include complement-mediated cytolysis, antibody-dependent ceEular cytotoxicity, modulating the physiological function of RORl, inhibiting Hgand binding or signal transduction pathways, modulating tumor ceE differentiation, altering tumor angiogenesis factor profiles, and./ or by inducing apoptosis. RORl antibodies can be conjugated to toxic or therapeutic agents and used to deHver the toxic or therapeutic agent directly to RORl -bearing tumor ceEs. Examples of toxic agents include, but are not Limited to, calchemicin, maytansiixoids, radioisotopes such as ¹³¹I, ytrium, and bismuth. Cancer Hnmunotherapy using anti-RORl antibodies may foEow the teachings generated from various approaches that have been successfully employed in the treatment of other types of cancer, including but not limited to colon cancer (Arlen et al., 1998, Grit Rev. Immunol. 18:133-138), multiple myeloma (Ozaki et al., 1997, Blood 90:3179-3186; Tsunenari et al., 1997, Blood 90:2437-2444), gastric cancer (Kasprzyk et al, 1992, Cancer Res. 52:2771-2776), B-ceE lymphoma (Funakoshi et al., 1996, J. Immunother. Emphasis Tumor Immunol. 19:93-101), leukemia (Zhong et al, 1996, Leuk. Res. 20:581-589), colorectal cancer (Moun et al., 1994, Cancer Res. 54:6160-6166; Velders et al., 1995, Cancer Res. 55:4398-4403), and breast cancer (Shepard et al., 1991, J. Clin. Immunol. 11:117-127). Some therapeutic approaches rvolve conjugation of naked antibody to a toxin, such as the conjugation of ¹³¹I to a_nti-CD20 antibodies (e.g., Rituxan™, IDEC Pharmaceuticals Corp.), whEe others involve co-administration of antibodies and other therapeutic agents, such as Herceptin™ (trastuzumab) with pacHtaxel (Genentech, Inc.). For treatment of breast cancer, for example, RORl antibodies can be administered in conjunction with radiation, chemotherapy or hormone ablation. Although RORl antibody therapy may be useful for all stages of cancer, antibody therapy may be particularly appropriate in advanced or metastatic cancers. Treatment with the antibody therapy of the invention may be indicated for patients who have received previously one or more chemotherapy, whEe combining the antibody therapy of the invention with a chemotherapeutic or radiation regimen may be preferred for patients who have not received chemotherapeutic treatment. AdditionaEy, antibody therapy may enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxicity of the chemotherapeutic agent very weE. It may be desirable for some cancer patients to be evaluated for the presence and level of RORl expression, preferably using iinmunohistochemical assessments of tumor tissue, quantitative RORl imaging, or other techniques capable of reHably indicating the presence and degree of RORl expression. Immunohistochenxical analysis of tumor biopsies or surgical specimens may be preferred for this purpose. Methods for in niunohistochemical analysis of tumor tissues are weE known in the art. Anti-RORl monoclonal antibodies useful in treating breast and other cancers include those that are capable of initiating a potent immune response against the tumor and those that are capable of direct cytotoxicity. In this regard, anti-RORl monoclonal antibodies (mAbs) may eHcit tumor ceE lysis by either complement-mediated or antibody-dependent ceE cytotoxicity (ADCC) mechanisms, botfci of which require an intact Fc portion of the immunoglobulin molecule for interactiom with effector ceE Fc receptor sites or complement proteins. In addition, anti-RORl mAbs that exert a direct biological effect on tumor growth are useful in the practice of tb_e invention. Potential mechanisms by which such directly cytotoxic mAbs may act include inhibition of ceE growth, modulation of ceEular differentiation, modulation of tumor angiogenesis factor profiles, and die induction of apoptosis. The mechanism by which a particular anti- RORl mAb exerts an anti-tumor effect may be evaluated using any number of in vitro assays designed to determine ADCC, ADMMC, complement-mediated ceE lysis, and so forth, as is generaEy known in the art. The use of murine or other non-human monoclonal antibodies, or human/mouse chimeric mAbs may induce moderate to strong immune responses in some patients. In some cases, this wiE result in clearance of the antibody from circulation and reduced efficacy. In the most severe cases, sucfci an immune response may lead to the extensive formation of immune complexes whichi, potentiaEy, can cause renal faEure. Accordingly, some monoclonal antibodies used in the practice of the therapeutic methods of the invention are those that are either fuEy human or humanized and that bind specificaEy to the target RORl antigen with high affinity but exhibit low or no antigenicity in the patient. Therapeutic methods of the invention contemplate the administration of single anti-RORl mAbs as weE as combinations, or cocktaEs, of different _ bs (e.g. anti- RORl and anti-Her-2 antibodies). Such mAb cocktaEs may have certain advantages inasmuch as they contain mAbs that target different epitopes, exploit different effector mechanisms or combine directly cytotoxic mAbs with mAbs that rely on immune effector functionaHty. Such mAbs in combination may exhibit synergistic therapeutic effects. In addition, the administration of anti-RORl mAbs may be combined with other therapeutic agents, including but not limited to various chemothetapeutic agents, androgen-blockers, and immune modulators (e.g., IL-2, GM-CSF). Ttie anti-RORl mAbs may be administered in their "naked" or unconjugated form, or may have therapeutic agents conjugated to them. The anti-RORl antibody formulations may be administered via any route capable of deHvering the antibodies to die tumor site. PotentiaEy effective routes of administration include, but are not limited to, intravenous, intraperitoneal, intramuscular, intratumor, intradermal, and die like. Treatment wiE generaEy involve the repeated administration of the anti-RORl antibody preparation via an acceptable route of adniinistration such as intravenous injection (TV), typicaEy at a dose in the range of about 0.1 to about 10 mg/kg body weight. Doses in the range of 10-500 mg αt Ab per week may be effective and weE tolerated. Based on clinical experience with the Herceptin mAb in the treatment of metastatic breast cancer, an initial loading dose of approximately 4 mg/kg patient body weight IV foEowed by weekly doses of about 2 mg/kg IN of the anti— RORl mAb preparation may represent an acceptable dosing regimen. Preferably, the initial loading dose is administered as a 90 minute or longer infusion. The periodic maintenance dose may be administered as a 30 minute or longer infusion, provided the initial dose was weE tolerated. However, as one of skEl in the art wiE understand, various factors wiE influence the ideal dose regimen in a particular case. Such factors may include, for example, the binding affinity and half Hfe of the Ab or Abs used, the degree of RORl expression in the patient, the extent of circulating shed RORl antigen, the desired steady-state antibody concentration level, frequency of treatment, and the influence of chemotherapeutic agents used in combination with the treatment method of the invention.

Inhibition of RORl Protein Function The invention includes various methods and compositions for inhibiting the binding of RORl to its binding partner or Hgand, or its association with other protein(s) as weE as methods for inhibiting RORl function.

Inhibition ofROR.1 With Intracellular Antibodies In one approach, recombinant vectors encoding single chain antibodies that specificaEy bind to RORl may be introduced into RORl expressing ceEs via gene transfer technologies, wherein the encoded single chain anti-RORl antibody is expressed intraceEularly, binds to RORl protein, and thereby inhibits its function. Methods for engineering such intraceEular single chain antibodies are weE known. Such intraceEular antibodies, also known as "intrabodies", may be specificaEy targeted to a particular compartment within the ceE, providing control over where the inhibitory activity of the treatment will be focused. This technology has been successfuEy appHed in the art (for review, see Richardson and Marasco, 1995, TIBTECH vol. 13). Intrabodies have been shown to virtuaEy eliminate the expression of otherwise abundant ceE surface receptors. See, for example, Richardson et al, 1995, Proc. Nad. Acad. Sci. USA 92: 3137-3141; BeerH et al, 1994, J. Biol. Chem. 289: 23931-23936; Deshane et al., 1994, Gene Ther. 1: 332-337. Single chain antibodies comprise the variable domains of tl e heavy and Hght chain joined by a flexible linker polypeptide, and are expressed as a single polypeptide. OptionaEy, single chain antibodies may be expressed as a single chain variable region fragment joined to the Hght chain constant region. WeE known intraceEular trafficking signals may be engineered into recombinant polynucleotide vectors encoding such single chain antibodies in order to precisely target the expressed intrabody to the desired intraceEular compartment. For example, intrabodies targeted to the endoplasmic reticulum (ER) may be engineered to incorporate a leader peptide and, OptionaEy, a C- terminal ER retention signal, such as the KDEL amino acid motif. Intrabodies intended to exert activity in the nucleus may be engineered to include a nuclear localization signal. Lipid moieties may be joined to intrabodies in older to tether the intrabody to the cytosoHc side of the plasma membrane. Intrabodies may also be targeted to exert function in the cytosol. For example, cytosoHc intrabodies may be used to sequester factors witiiin the cytosol, thereby preventing them from being transported to their natural ceEular destination. In one embodiment, intrabodies may be used to capture RORl in the nucleus, thereby preventing its activity within the nucleus. Nuclear targeting signals may be engineered into such RORl intrabodies in order to achieve the desired targeting. Such RORl intrabodies may be designed to bind specificaEy to a particular RORl domain. In another embodiment, cytosoHc intrabodies that specificaEy bind to the RORl protein may be used to prevent RORl from gainu g access to the nucleus, thereby preventing it from exerting any biological activity within the nucleus (e.g., preventing RORl from forming transcription complexes with other factors).

Inhibition ofROR.1 With Recombinant Proteins In another approach, recombinant molecules that are capable of binding to RORl or its binding partner(s) thereby preventing RORl from accessing/binding to its binding partner(s) or associating with other protein(s) are used to inhibit RORl function. For example, the recombinant molecule can include the extraceEular domain of RORl or a portion thereof, such as the Ig loop domain of RORl, the frizzled domain of RORl or the kringle domain of RORl . In some embodiments of the invention, the recombinant molecules includes 2 or alternatively 3 of these RORl domains. Alternatively, such recombinant molecules may, for example, contain the reactive part(s) of a RORl specific antibody molecule. In a particular embodiment, the RORl binding domain of a RORl binding partner may be engineered into a dimeric fusion protein comprising two RORl Hgand binding domains linked to the Fc portion of a human IgG, such as human IgGl. Such IgG portion may contain, for example, the CH2 and CH3 domains and the hinge region, but not the Oil domain. Such dimeric fusion proteins may be administered in soluble form to patients suffering from a cancer assodated with the expression of RORl, including but not limited to breast cancers, where the dimeric fusion protein spedficaEy binds to RORl thereby blocking RORl interaction with a binding partner. Such dimeric fusion proteins may be further combined into multimefic proteins using known antibody linking technologies. Inhibition of RORl Transcription or Translation Within another class of therapeutic approaches, the invention provides various methods and compositions for inhibiting the transcription of the RORl gene. SHnEarly, the invention also provides methods and compositions for inhibiting the translation of RORl mRNA into protein. In one approach, a method of inhibiting the transcription of the RORl gene comprises contacting the RORl gene with a RORl antisense polynucleotide. In another approach, a method of inhibiting RORl mRNA translation comprises contacting the RORl mRNA with an antisense polynucleotide. In another approach, a RORl specific ribozyme may be used to cleave tlie RORl message, thereby inhibiting translation. Such antisense and ribozyme based methods may also be directed to the regulatory regions of the RORl gene, such as the RORl promoter and/or enhancer elements. Similarly, proteins capable of inhibiting a RORl gene transcription factor may be used to inhibit RORl mRNA transcription. The various polynucleotides and compositions useful in the aforementioned metiiods have been described above. The use of antisense and ribozyme molecules to inhibit transcription and translation is weE known in the art. Other factors that inhibit the transcription of RORl through interfering with RORl transcriptional activation may also be useful for the treatment of cancers expressing RORl. SimEarly, factors that are capable of interfering with RORl processing may be useful for the treatment of cancers expressing RORl. Cancer treatment methods utilizing such factors are also within the scope of the invention. General Considerations for Therapeutic Strategies Gene transfer and gene therapy technologies may be used for deHvering therapeutic polynucleotide molecules to tumor ceEs synthesizing RORl (ie., antisense, ribozyme, polynucleotides encoding intrabodies and other RORl inhibitory molecules). A number of gene therapy approaches are known in the art. Recombinant vectors encoding RORl antisense polynucleotides, ribozymes, factors capable of interfering with RORl transcription, and so forth, may be deHvered to target tumor ceEs using such gene therapy approaches. The above therapeutic approaches may be combined with any one of a wide variety of chemotherapy or radiation therapy regimens. These therapeutic approaches may also enable the use of reduced dosages of chemotherapy and/ or less frequent administration, particularly in patients that do not tolerate the toxicity of the chemotherapeutic agent weE. The anti-tumor activity of a particular composition (e.g., antisense, ribozyme, intrabody), or a combination of such compositions, may be evaluated using various in vitro and in vivo assay systems. In vitro assays for evaluating therapeutic potential include ceE growth assays, soft agar assays and other assays indicative of tumor promoting activity, binding assays capable of detemiining die extent to which a therapeutic composition wiE inhibit the binding of RORl to a binding partner, etc. In vivo, the effect of a RORl therapeutic composition may be evaluated in a suitable animal model. For example, xenogenic breast cancer models wherein human breast cancer explants or passaged xenograft tissues are introduced into immune compromised animals, such as nude or SCID mice, are appropriate in relation to breast cancer and have been described in the art. Efficacy may be predicted using assays that measure inhibition of tumor formation, tumor regression or metastasis, and the like. In vivo assays that quaHfy the promotion of apoptosis may also be useful in evaluating potential therapeutic compositions. In one embodiment, xenografts from bearing mice treated witli the therapeutic composition may be examined for the presence of apoptotic foci and compared to untreated control xenograft-bearing mice. The extent to which apoptotic foci are found in the tumors of the treated mice provides an indication of the therapeutic efficacy of the composition. The therapeutic compositions used in the practice of the foregoing methods may be formulated into pharmaceutical compositions comprising a carrier suitable for the desired deHvery method. Suitable carriers include any material that when combined witli the therapeutic composition retains the anti-tumor function of the therapeutic composition and is non-reactive with the patient's immune system. Examples include, but are not limited to, any of a number of standard pharmaceutical carriers such as sterile phosphate buffered saline solutions, bacteriostatic water, and the like (see, generaEy, Remington's Pharmaceutical Sciences 16^th Ed., A. Osal, Ed., 1980). Therapeutic formulations may be solubilized and administered via any route capable of deHvering the therapeutic composition to the tumor site. PotentiaEy effective routes of administration include, but are not limited to, intravenous, parenteral, intraperitoneal, Hitramuscular, intratumor, intradermal, Hitraorgan, ortliotopic, and the like. A common formulation for intravenous injection comprises the therapeutic composition in a solution of preserved bacteriostatic water, sterile unpreserved water, and/or dEuted in polyvinylchloride or polyethylene bags containing 0.9% sterile Sodium Chloride for Injection, USP. Therapeutic protein preparations may be lyophilized and stored as sterile powders, preferably under vacuum, and then reconstituted in bacteriostatic water contaH ing, for example, benzyl alcohol preservative, or in sterile water prior to injection. Dosages and administration protocols for the treatment of cancers using the foregoing methods will vary with the method and the target cancer and wiE generaEy depend on a number of other factors appreciated in the art. KITS For use in the diagnostic and therapeutic appHcations described or suggested above, kits are also provided by the invention. Such kits may comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method. For example, one of the container means may comprise a probe that is or can be detectably labeled. Such probe may be an antibody or polynucleotide specific for a RORl protein or a RORl gene or message, respectively. Where the kit utilizes nucleic acid hybridization to detect the target nucleic acid, the kit may also have containers containing nucleotide(s) for ampHfication of the target nucleic acid sequence and/ or a container comprising a reporter-means, such as a biotin-binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label. A typical embodiment of the invention is a kit comprising a container, a label on said container, and a composition contained witltin said container; wherein the composition includes a RORl specific antibody and/ or a polynucleotide that hybridizes to a complement of the RORl polynucleotide shown in SEQ ID NO: 1 under stringent conditions (or binds to a RORl polypeptide encoded by the polynucleotide shown in SEQ ID NO: 1), the label on said container indicates that the composition can be used to evaluate the presence of RORl protein, RNA or DNA in at least one type of mammaHan ceE, and instructions for using the RORl antibody and/or polynucleotide for evaluating the presence of RORl protein, RNA or DNA in at least one type of mammaHan ceE. The kit of the invention wiE typicaEy comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, dEuents, filters, needles, syringes, and package inserts with instructions for use. A label may be present on the container to indicate that the composition is used for a specific therapy or non-therapeutic appHcation, and may also indicate directions for either in vivo or in vitro use, such as those described above.

METHODS FOR DISCOVERING GENES SUCH AS RORl The disclosure also provides optimized methods of data mining including those used to identify RORl as a gene of diagnostic significance. These methodologies include novel experimental analyses as weE as constraint-based pubHc data analyses. These methods of the invention include a number of discreet actions or steps that can occur in a wide variety of sequential orders. These steps are then combined to identify genes of interest such as RORl. In a preliminary step, an artisan can define a working gene set, for example from experimentaEy generated gene Hsts and/ or a Hterature based gene selection. In another step artisans can undertake microarray screens of gene expression in for example, +/- HER-2 ceE lines, +/- Hgands /antagonists, primary breast cancers, breast cancer ceE lines or the like. In another step, artisans can employ candidate selection parameter to identify genes of interest, for example a focus on genes that can be grouped into signaling pathways that are likely to contribute to the progression of breast cancer (e.g. RTKs (receptor tyrosine kinases)). In another step, the artisan can evaluate and/or confirm the expression of gene(s) of interest via weH-known protocols such as quantitative PCR, northerns, and western analyses. In another step, the artisan can develop and test a hypothesis based on the results of the prior steps, for example a hypothesis correlating RORl expression with one or more breast cancer subtypes and/ or with a poor prognosis. In this step, artisans can consider factors such as whether a functional significance of expression patters are measurable using bioassays and ceE line models. For example, one can use human tumor tissues to further evaluate differential expression etc. and use xenograft models to confirm the functional relevance of the observations in vivo. In one such Elustrative data mining method, an initial observation can come from constraints-based analysis of pubHc expression data and ceE line data to, for example, identify interesting characteristics of a gene such as RORl . Using this first observation, one can then develop a hypothesis correlating a breast cancer subtype with poor prognosis and ROR 1 (a potential molecular target). One can then vaHdate RORl overexpression in relevant breast cancer ceE lines and tumors. One can then generate experimental data supporting biological functions of RORl in breast cancer pathogenesis. In an Elustrative embodiment, the initial observation can be from constraints- based analysis of pubHc expression data. In tiiis embodiment, one can select a working gene set comprising receptor tyrosine kinases and their ligands. One can then work to integrate this selection with other studies known in the art, for example by integrating the disclosure in Van't Veer, L. J., et al. (2002) Nature 415, 530-536 ("Rosetta/Netherlands") with that in SorHe et al., Proc Natl Acad Sci USA. 2001 Sep ll;98(19):10869-74. Briefly, Van't Veer et al. (2002) Nature 415, 530-536 notes that breast cancer patients with the same stage of disease can have markedly different treatment responses and overaE outcome. In this study Van't Veer et al. used DNA microarray analysis on primary breast tumours of 117 young patients, and appHed supervised classification to identify a gene expression signature strongly predictive of a short Hiterval to distant metastases ("poor prognosis" signature) in patients without tumor ceEs in local lymph nodes at diagnosis (lymph node negative). In this way they estabHsh a signature that identifies tumors of, for example, BRCAl carriers and teach that this gene expression profile wiE outperform aE currentiy used clinical parameters Hi predicting disease outcome. Van't Veer et al. teach that a three step supervised clustering of 78 sporadic tumors based on strength of correlation coefficient with prognosis identifies a subset of 70 genes from 5000 differentiaEy expressed genes that predict distant metastasis within 5 years with 83% accuracy. SimHarly, the SorHe et al., Proc Natl Acad Sci USA. 2001 Sep ll;98(19):10869-74

Stanford/Norway study also classifies breast carcinomas based on variations in gene expression patterns derived from cDNA microarrays and to correlate tumor characteristics to clinical outcome. This article identifies a number of subtypes of breast carcinoma that are associated with significantly different clinical outcomes. The subtypes of breast carcinoma include basal-like, ERBB2+, and luminal subtypes A and B (see, e.g. FIG. 1 in Sorlie et al. supra). One can employ clustering algorithms that analyze coordinate gene expression patterns as part of a classifications prognosis. This analysis also aEows the identification of therapeutic targets. In some embodiments of the invention, this step can include a pathogenesis constraints based hypothesis buEding where one can focus on genes and pathways Hkely to be important for disease progression such as those involved in (or having domain with homology to proteins know to be involved in) in disease, growth disregulation, ceE cycling and the like. In such constraints based methods for target identification using gene expression profiles one can consider a number of factors such as the observation that breast cancer is heterogeneous, that prognostic markers and molecules have already been shown to be important for subtypes of breast cancers (ie. ER, HER-2), and that it is unlikely that the same set of genes wiH be "prognostic" or serve as appropriate therapeutic targets in aE breast cancers. In an illustrative embodiment of this methodology, one can for example select a data set for analysis (e.g. some number of genes), OptionaEy selected from sporadic and/ or heritable cancers (e.g. BRCA 1 and or 2 tumors). One can then focus on a set of genes for analysis such as breast cancer related genes (e.g. those in known databases such as omim, breast cancer database, ncbi), Stanford tumor type markers, ERBB2 regulated genes from ceE line data, chemokines and receptor tyrosine kinases and Hgands, epitheHal junction proteins and the like. One can then classify samples according to certain gene (e.g. ERBB2 and ESRl etc.) expression levels and/ or BRCAl mutation status etc. to identify a working gene set. For example WEson et al., Breast Cancer Research Vol 6 No. 5: 192-200 (2004) (which is incorporated by reference) teach that estrogen receptor 1 expression and HER2 ampHfication can be used to define breast cancer subtypes. FoEowing these steps, one can then delineate groups with no overlapping samples that are for example, roughly equivalent the Stanford/Norway classifications discussed above. In one embodiment, sporadic tumor samples can first classified on the basis of their HER2 expression and the remaining samples can be grouped by ESRl expression. The sporadic tumor categories can be non-overlapping, since no HER2+ sample had an ESRl ratio > 0. Samples with a BRCA mutation can be classified separately. In such a grouping, aE of the BRCA tumors are shown to have ESRl < 0 and HER2 < 0. The HBR2+ and ESRl" - tumors exhibit the poorest prognosis, foEowed by ESRl ++. In some embodiments of the analysis of this working gene set one can employ "bin" data rather than "cluster" data and can for example build matrices to quantify the frequency of up-regulated and downregulated genes across sample and by group. OptionaEy one can investigate co-expression of members of working gene set across tumor groups. One can also generate hypotheses regarding pathogenesis by tumor group. In this way, one can identify potential targets and test for statistical significance. An exemplary working set includes known breast cancer genes, Stanford tumor type markers, ERBB2 regulated genes, chemokines/RTK and Hgands, and/or epitheHal junction proteins. For bin data, one can then create data matrices, for example: level 1: ratio for each gene/sample; level 2: binary value each gene/sample; level 3: total up or down by gene/group; level 4: co-expression gene fatnEy/group. OptionaEy, one can focus on receptor tyrosine kinases, with the working gene set included aE RTKs and their Hgands that were avaEable in for example, the Rosetta/Netherlands data (147 elements representing 127 out of 130 possible unique RTKs and their Hgands). One can tiien identify tumor group-specific RTK/Hgand expression. Embodiments of this methodology were used in the identification of RORl as a gene of interest. RORl is a receptor tyrosine kinase specificaEy up-regulated in basal and BRCAl tumors. FIG. B shows RORl mRNA expression in Rosetta/Netherlands data. RORl is a novel family of ceE surface receptors with tyrosine kinase-like domain (see, Masiakowski et al., JBC, 267 26181-26190 (1992). WhEe the Hgand(s) for ROR1/2 are not known, the presence of a CRD (cysteine-rich domain) or frizzled domain suggests that RORs may bind WNTs. As disclosed herein, these methods aEow the development of a hypothesis of RORl biology as weE as the design of tests for correlating RORl expression with prognosis, and/ or breast cancer subtype and the like. For example, using this approach we find that basal and BRCAl breast cancers are related by ceEular origin and molecular pathogenesis and that the over-expression of RORl is an important alteration that is involved in the pathogenesis of these two tumor groups. As shown in FIG. 4A, RORl overexpressing tumors ate associated with a poor prognosis in the Rosetta/Netherlands tumors. The percentage (70% of sporadic) of poor prognosis tumors in the RORl group is higher than that for any other single prognostic gene analyzed including HER-2, EGFR, VEGF, FLT3, myc, UPA and PAL As shown in FIG. 4B, this finding is analogous to that observed with HER-2, where fifty-four percent of HER-2 overexpressing tumors are poor prognosis samples The significance of RORl overexpression Hi relevant breast cancer ceE lines and tumors can be further vaHdated in a number of ways. The RORl gene is located at position lp31.3. In addition, RORl over-expressing ceE Hnes have basal or mesenchymal characteristics. Another element AK000776 which is just distal to RORl is also present on DNA microarrays such as the Rosetta chip. RORl and AK000776 show a strong positive linear correlation. The Northern Blot Analysis in FIG. 5A shows RORl mRNA expression in a number of breast cancer ceE Hnes. This data confirms the RORl expression observed in Groups 4 and 6 of Rosetta Tumor Data. The identification of RORl as a gene of interest and the subsequent vaHdation of this observation demonstrate the power of the data n__ining methods disclosed above.

EXAMPLES Various aspects of the invention are further described and Hlustrated by way of the several examples that foEow, none of which are intended to limit the scope of the invention.

Example 1: Production of Recombinant RORl in. a Mammalian System To express recombinant RORl, the full length RORl cDNA can be cloned into an expression vector known in the art such as one that provides a 6His tag at the carboxyl-terminus (pCDNA 3.1 myc-his, Invitrogen). The constructs can be transfected into an appropriate ceE such as MCF-7 ceEs. The RORl genes can also be subcloned into a retroviral expression vector such as pSR MSVtkneo and used to estabHsh RORl expressing ceE lines as foEows. The RORl coding sequence (from translation initiation ATG to the termination codons) can be ampHfied by PCR usHig ds cDNA template from RORl cDNA. The PCR product is subcloned into pSRαMSVtkneo via the EcoRI (blunt-ended) and Xba 1 restriction sites on the vector and transformed into DH5α competent ceEs. Colonies are picked to screen for clones with unique internal restriction sites on the cDNA. The positive clone is confirmed by sequencing of the cDNA insert. Retroviruses may thereafter be used for infection and generation of various ceE lines using, for example, NIH 3T3, TsuPrl, MCF-7 or rat-1 ceEs. Example 2: Generation of RORl Polyclonal and Monoclonal Antibodies Polyclonal antibodies can be raised in a mammal such as a rabbit, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. TypicaEy, tlie imrnunizing agent and/or adjuvant wiE be injected in the mammal by multiple subcutaneous or intraperitoneal injections. TypicaEy an imrnunizing agent may include aE ox portions of tlie ROR protein, or fusion proteins thereof. For example, a portion of RORl comprising the Ig C2 like and frizzled domains (termed "IF") was cloned into the vector pET32A (Novagen) and expressed as a Thio/HIS fusion protein. This protein construct is highly expressed in insoluble inclusion bodies. Upon being solubEized with 6M urea, the fusion protein binds Ni columns efficiently under denaturing conditions. Rabbits were then immunized with this fusion protein and subsequently bled in order to generate polyclonal sera. FIG. 5F and FIG. 5G show the detection of endogenous RORl protein in CAL51 ceEs using this rabbit polyclonal sera, with SKBR ceEs serving as a comparative cancer ceE. Like polyclonal antibodies, monoclonal antibodies can be generated by weE known methods in the art. In order to generate RORl monoclonal antibodies for example, a fusion protein (e.g. glutathione s transferase) encompassing a RORl protein can be synthesized and used as immunogen. In another example of a method for generating RORl antibodies, an immunogen is prepared which consists of a HIS tagged ROR. domain such as the frizzled domain. This construct can be inserted into a baculovirus vector which is then introduced into insect ceEs in a manner that aEows the a native (folded) immunogenic protein to be secreted into the media. OptionaEy immunogens can be conjugated to a second protein known to stimulate the immune response such as KLH prior to immunization. Alternatively, RORl IF immunogen construct can be made in bacteria. In sitaations where the immunogenic protein is insoluble, it can be OptionaEy denatured with Urea prior to i-iαrnunization. Alternatively, a RORl complete ECD immunogen construct can be made as part of a Ig fusion construct and then expressed in mammaHan ceEs (e.g. CHO ceUs) and purified using the Ig portion fusion construct prior to immunization. In an Elustrative embodiment, mice can be initially immunized (e.g. intraperitoneaEy) with an appropriate amount of an immunogen comprising the FRZ domain of ROR . OptionaEy the immunogen can be conjugated to KLH, and/ or mixed in complete Freund's adjuvant. Mice can be subsequently immunized (e.g. every 2 weeks -wi h this RORl immunogen), OptionaEy mixed in Freund's incomplete adjuvant. R-eactivity of serum from immunized mice can be monitored by ELISA using this RORl ir_nmunogen. Mice showing the strongest reactivity can be rested and given a final injection of immunogen and then sacrificed. The spleens of the sacrificed mice can then be harvested and fused to SPO/2 myeloma ceEs using standard procedures. Supernatants fro growth weEs foEowing HAT selection are typicaEy screened by ELISA and western blot to identify RORl specific antibody producing clones. The binding affinity of a RORl monoclonal antibody can be detennined using standard technology. Affinity measurements quantify the strength of antibody to epitope binding and may be used to help define which RORl monoclonal antibodies are preferred for diagnostic or therapeutic use. The BIAcore system (Uppsala, Sweden) is a common method for determining binding affinity. The BIAcore system uses surface phasmon resonance (SPR, Welford, K, 1991, Opt. Quant. Elect. 23:1; Morton and Myszka, 1998, Methods in Enzymology 295:268) to monitor biomolecukr interactions in real time. BIAcore analysis conveniently generates association rate constants, dissociation rate constants, equiEbrium dissociation constants, and affinity constants.

Example 3: RT-PCR Expression Analysis: A variety of PCR protocols for analyzing RORl expression in a ceE are weE known i 'the art. The foEowing provides an iUustration of one typical protocol. First strand cDNAs can be generated from a sufficient amount (e.g. 1 μg) of mRNA with a primer such as oHgo (dT)12-18 priming using a commerciaEy avaEable system such as the Gibco-BRL Superscript PreampHfication system. The manufacturer's protocol can be used. These typicaEy include an incubation for 50 min at 42°C with reverse transcriptase foEowed by RNAse H treatment at 37°C for 20 min. After completing the reaction, the volume can be increased with water prior to normalization. Normalization of the first strand cDNAs from normal and cancer tissues can be performed by using primers to a housekeeping gene such as β-actin. For example, first strand cDNA (5 μl) can be ampHfied H a total volume of 50 μl containing 0.4 μM primers, 0.2 μM each d_ TPs, 1XPCR buffer (Gibco-BRL, 10 mM Tris-HCL, 1.5 mM MgCl₂, 50 mM KC1, pH8.3) and IX Platinum Taq DNA polymerase (Gibco-BRL). PCR can be performed using an thermal cycler under the foEowing conditions: Initial denaturation can be at 4°C for 45 sec, foEowed by a 18, 20, and 22 cycles of 94°C for 45, 58°C for 45 sec, 72°C for 45 sec. A final extension at 72°C can be carried out for 2 min. Five μl of the PCR reaction can be removed at 18, 20, and 22 cycles and used for agarose gel electrophoresis. After agarose gel electrophoresis, the band intensities of the 283 b.p. β-actin bands from multiple tissues can be compared by visual inspection. DEution factors for the first strand cDNAs can be calculated to result in equal β-actin band intensities in aE tissues after 22 cycles of PCR. Three rounds of normalization can be required to achieve equal band intensities in aE tissues after 22 cycles of _PCR. To determine expression levels of the RORl gene, 5 μl of normalized first strand cDNA can be analyzed by PCR using 26, and 30 cycles of ampHfication. Quantitative expression analysis can be achieved by comparing the PCR products at cycle numbers that give Hght band intensities. RT-PCR expression analysis can be performed on first strand cDNAs generated using pools of tissues from multiple normal and cancer samples. The cDNA normalization can be demonstrated in every experiment using a housekeeping gene such as beta-actin.

Example 4: Examining the Role of RORl in Basal. ER-negative Breast Cancer Immunohistochemical and mRNA expression profiling studies of lairge breast cancer cohorts have reproducibly identified a subset of tumors that express markers, such cytokeratin 5, that are characteristic of the basal layer of the mammary gland (see, e.g. SorHe et al., Proc Natl Acad Sci U S A. 2003; 100: 8418-23; SorHe et al, Proc Natl Acad Sci U S A. 2001; 98: 10869-74; and Foulkes et al. Natl Cancer Inst. 2003; 95: 1482-5). It has been suggested that these maHgnancies arise fiom basal or supra-basal progenitor ceEs with stem ceE attributes. This is in contrast to many human breast cancers that uniformly express the simple glandular cytokeratins (K8/18/19) suggesting their origins as transformed luminal epithelial ceEs. Human breast cancers with basal features are invariably estrogen receptor (E R) negative, rarely contain ampHfied HER-2, are generaEy high grade/poorly differentiated and are associated with poor prognosis (see, e.g. SorHe et al, Proc Natl Acad Sci US . 2003; 100: 8418-23; SorHe et aL, Proc Natl Acad Sci U S . 2001; 98: 10869-74; and Foulkes et al. J Natl Cancer Inst. 2003; 95: 1482-5). Although high frequencies of p53 mutations have been associated with basal cancers and tumors arising in -BRCAl carriers faU into to this basal class (see, e.g. SorHe et al., Proc Natl Acad Sci U SA. 2003; 100: 8418-23; SorHe et al., Proc Natl Acad Sci USA.. 2001; 98: 10869-74; and Foulkes et al.,/ Natl Cancer Inst. 2003; 95: 1482-5), the oncogenic molecules and key molecular pathways that drive the progression of these tumors are unknown. As disclosed herein, using microarray profiling and Northern blot confirmation we have demonstrated that the RORl receptor tyrosine kinase is highly expressed in primary human breast cancers with an ER negative, basal phenotype. We have also found high RORl expression in several human breast cancer ceE lines that co- express basal markers, while RORl expression was not detected in any luminal ceE Hnes. Importantly, the level of RORl expression detected in basal, maHgnant ceE lines is significantly higher than in non-maHgnant ceEs. An additional feature of RORl is that it may bind wnt Hgands via an extraceEular frizzled domain thus providing a possible link to a signaling pathway previously shown to regulate progenitor ceEs (see, e.g. Saldanha et al., Protein Sci. 1998 ; 7: 1632-5). The disclosure provided herein aEows those of skEl in the art to identify candidate genes that drive the progression of these poorly understood basal, ER negative human breast cancers. Wliile not being bound by a specific scientific theory, the highly suggestive expression pattern of RORl in combination with the estabHshed importance of receptor tyrosine kinases (e.g. HER2, EGFR, VEGFR) in tumor formation prompted us to propose the hypothesis that RORl plays a critical role in the pathogenesis of basal tumors. The oncogenic potential of RORl has not previously been explored. A first set of experiments test the hypothesis that RORl preferentiaEy transforms basal/progenitor ceEs of the mouse mammaiy gland. Determining if inducible over-expression of RORl can transform mouse mammary epitheHal ceEs. Transgenic, conditional TetO-ROR mice can be generated and crossed to existing MMTV-rtTA mice (see, e.g. Gunther et al., FASEB J. 2002; 16: 283-92) to achieve doxycycline-dependent (tet-on) expres sion of RORl specificaEy in the mammary gland. Determining if RORl over-exp_eession preferentiaEy transforms the basal/progenitor ceE lineages of the mammary gland. These TetO-RORl mice wiE then be crossed to strains expressing rtTA under the control of the keratin 5 (K5) promote* to drive expression specificaEy in the basal/progenitor compartments of the mammary gland and other tissues. IEustrative Methods: Transgene expression in MMTV-rtTA JTetO-RORl and K5-rtTA/TetO-RORl mice can be induced with doxycycline beginning at 6 weeks of age. Expression of RORl can be examined by in situ hybridization, northern blotting and i____munohistochemistry.

Changes in tissue architecture and the presence of pre-maHgnant or maHgnant lesions can be assessed at increasing intervals foEowing transgene induction by the analysis of carmine-stained mammary whole mounts and hematoxylin - eosin stained tissue sections. The ceEular origin of any hyperphstic lesions or overt carcinomas can be investigated using immunohistochemical staining with intermediate filament markers, adhesion proteins and putative stem ceE makers (K8/K18/K19 for luminal ceEs,

K5/K6/K14/ P-cadherin/Sca-1 for basal/progenitor ceEs). As a backup, K14-rtTa mice can be considered to drive RORl expression. Relevance: Human breast cancers with basal properties are aggressive maHgnancies that are not responsive to estabHshed targeted therapies such as anti-estrogens or Herceptin since they are invariably ER negative and rarely contain ampHfied HER-2. The RORl ceE surface receptor is a tractable therapeutic target accessible by monoclonal antibodies or smaE molecule tyrosine kinase inhibitors. The demonstration that RORl over-expression drives basal breast cancers in the mouse provid-es a rationale for the development of RORl targeted therapeutics that specificaEy treat ^"basal breast cancers.

Example 5: A Novel Receptor Tyrosine Kin-ase and the Control of Multipotent Mammary Progenitor Cells

Human estrogen receptor (ER) positive tumors and mouse mammary tumors induced by oncogenic Neu or H-Ras express ceE type markers consistent with a differentiated luminal origHi (e.g. cytokeratins K/18/K19). In contrast, aggressive ER- negative human cancers and murine tumors induced by tl e Wnt-1 oncogene, display a much more heterogeneous pattern of ceE type markers including the basal cytokeratins K5, K17, K14, and stem ceE antigen (Seal) (see, e.g. Li et al., Proc Natl Acad Sci U S A. 2003; 100: 15853-8). This is consistent with the icdea that multipotent progenitor ceEs are the targets of transformation in these breast cancers. Immortalized progenitor ceEs have been described that are capable of differentiating into both luminal and myoepitheHal lineages (see, e.g. Gudjonsson et al., Genes Dev. 2002; 16: 693-706; and Deugnier et al., / CeilBiol. 2002; 159: 453-63). Although most human breast cancer ceE lines express homogeneous luminal markers, we have recently identified multiple t za/ignant breast ceE Hnes that appear to have progenitor properties in that they produce both K18/K19 and smooth muscle actin (SMA) positive ceEs. Strikingly, we have discovered that both the non-maHgnant and the cancer Hnes with progenitor properties consistently express the RORl receptor tyrosine kinase while luminal mammary ceEs have no detectable expression. We also found liigh- level expression of RORl in a subset of primary human breast cancers with basal/progenitor properties. AdditionaEy, RORl may bind Wnt Hgands via its extraceEular frizzled domain thus providing a lin_k to a signaling pathway that is known to regulate progenitor ceEs (see, e.g. Saldanha et al., Protein Sci. 1998 ; 7: 1632-5; and Brittan et al.,/ Pathol. 2002; 197: 492-509). The highly suggestive RORl expression pattern combined with the intriguing possibiHty that it may bind Wnt Hgands which ha e estabHshed roles as critical mediators of stem ceE renewal, led us to hypothesize that RORl signaling participates in the control of mammary progenitor ceE proHferation and/or self renewal. We further hypothesize that since maHgnant ceEs with similar progenitor properties have even higher levels of RORl, ceEs may up-regulate this pathway during maHgnant progression. The disclosure provided herein aEows one to test the hypothesis that signaling through the RORl receptor tyrosine kinase controls the proHferation, self-renewal and/or differentiation of multipotent mammary progenitor ceEs. Determine RORl sEencing in mammary ceEs with progenitor properties criticaEy affects their proHferation, morphogenesis and/or differentiation capacity. RORl expression can be sEenced by RNA interference in non-maHgnant and maHgnant ceEs with progenitor properties and the effects assayed in morphogenic and tumorigenic assays. Determine if increased signaling firom the RORl receptor specificaEy transforms or increases the maHgnancy of mammary epitheHal basal/progenitor ceEs compared to luminal breast ceEs. The effects of RORl over-expression or constitutively activation on the proHferation and maHgnant potential of basal/progenitor and luminal ceE Hnes can be compared. IEustrative Methods: SEencing of RORl can be accompHshed by stable of expression hpRNA RORl sequences using the pSIREN-retroQ retarviral system (BD Clontech). Overexpression of RORl constructs including wEd type, constitutively activated and deletion mutants missing the CRD or kinase domain can be achieved using retroviral infection (pLPCX; BD Clontech) can be monitored by using recentiy generated RORl polyclonal antibodies. The effects of depleted or ove expressed RORl can be assayed using in vitro matrigel TDLU formation assays (human ceEs), in vivo mammary epitheHal reconstitution assays in cleared mammary fat pads (mouse ceEs) and in vivo xenograft tumor formation (maHgnant ceEs) as weE as standard proHferation assays. The differentiation or ceE type composition can be assessed by immunohistochemical staining using signature markers that regulate the growth and differentiation of mammary stem ceEs are not weE understood and they may be critical for the pathogenesis of a particular class of aggressive ER-negative, basal breast cancers. Evidence that signaling through the RORl receptor tyrosine kinase controls die growth of _cnammary progenitor ceEs and the maHgnant ceEs derived from them could help explain, how murine Wnt-1 induced tumors arise. Moreover, the properties of RORl as both ceE surface receptor and a tyrosine kinase make it a particularly attractive therapeutic target.

Throughout this appHcation, various publications are referenced (e.g. within parentheses). The disclosures of these pubHcations a_re hereby incorporated by reference herein in their entireties. Certain methods and materials in this appHcation are analogous to those found in U.S. Patent Nos. 6,767,541, 6,165,4-64, 5,772,997, 5,677,171, 5,770,195, 6,399,063, 5,725,856 and 5,720,954, the contents oF which are incorporated herein by reference. The present invention is not to be limited in scope by die embodiments disclosed herein, which are intended as single Elustrations of individual aspects of the invention, and any that are functionaEy equivalent are within the scope of the invention. Various modifications to the models and methods of the invention, in addition to those described herein, wiE become apparent to those skiEed in the art from the foregoing description and teachings, and are simEarly intended to faE within the scope of the invention. Such modifications or other embodiments can be practiced without departing from the true scope and spirit of the invention.

TABLES

TABLE 1: POLYNUCLEOTIDE SEQUENCES

HUMAN HER2 Polynucleotide Sequence (SEQ ID NO: 3) ATGGAGCTGGCGGCCTTGTGCCGCTGGGGGCTCCTCCTCGCCCTCTTGCCCCCCGGAGCCGCGAGCACC CAAGTGTGCACCGGCACAGACATGAAGCTGCGGCTCCCTGCCAGTCCCGAGACCCACCTGGACATGCTC CGCCACCTCTACCAGGGCTGCCAGGTGGTGCAGGGAAACCTGGAACTCΆCCTACCTGCCCACCAATGCC AGCCTGTCCTTCCTGCAGGATATCCAGGAGGTGCAGGGCTACGTGCTCATCGCTCACAACCAAGTGAGG CAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTC3AGGACAACTATGCCCTGGCC GTGCTAGACAATGGAGACCCGCTGAACAATACCACCCCTGTCACAGGGΘCCTCCCCAGGAGGCCTGCGG GAGCTGCAGCTTCGAAGCCTCACAGAGATCTTGAAAGGAGGGGTCTTGATCCAGCGGAACCCCCAGCTC TGCTACCAGGACACGATTTTGTGGAAGGACATCTTCCACAAGAACAACC-AGCTGGCTCTCACACTGATA GACACCAACCGCTCTCGGGCCTGCCACCCCTGTTCTCCGATGTGTAAGΘGCTCCCGCTGCTGGGGAGAG AGTTCTGAGGATTGTCAGAGCCTGACGCGCACTGTCTGTGCCGGTGGCTGTGCCCGCTGCAAGGGGCCA CTGCCCACTGACTGCTGCCATGAGCAGTGTGCTGCCGGCTGCACGGGCCCCAAGCACTCTGACTGCCTG GCCTGCCTCCACTTCAACCACAGTGGCATCTGTGAGCTGCACTGCCCAΘCCCTGGTCACCTACAACACA GACACGTTTGAGTCCATGCCCAATCCCGAGGGCCGGTATACATTCGGCΘCCAGCTGTGTGACTGCCTGT CCCTACAACTACCTTTCTACGGACGTGGGATCCTGCACCCTCGTCTGCC-CCCTGCACAACCAAGAGGTG ACAGCAGAGGATGGAACACAGCGGTGTGAGAAGTGCAGCAAGCCCTGTSCCCGAGTGTGCTATGGTCTG GGCATGGAGCACTTGCGAGAGGTGAGGGCAGTTACCAGTGCCAATATCC-AGGAGTTTGCTGGCTGCAAG AAGATCTTTGGGAGCCTGGCATTTCTGCCGGAGAGCTTTGATGGGGACCCAGCCTCCAACACTGCCCCG CTCCAGCCAGAGCAGCTCCAAGTGTTTGAGACTCTGGAAGAGATCACASGTTACCTATACATCTCAGCA TGGCCGGACAGCCTGCCTGACCTCAGCGTCTTCCAGAACCTGCAAGTAA_.TCCGGGGACGAATTCTGCAC AATGGCGCCTACTCGCTGACCCTGCAAGGGCTGGGCATCAGCTGGCTGSGGCTGCGCTCACTGAGGGAA CTGGGCAGTGGACTGGCCCTCATCCACCATAACACCCACCTCTGCTTCSTGCACACGGTGCCCTGGGAC CAGCTCTTTCGGAACCCGCACCAAGCTCTGCTCCACACTGCCAACCGGCCAGAGGACGAGTGTGTGGGC GAGGGCCTGGCCTGCCACCAGCTGTGCGCCCGAGGGCACTGCTGGGGTCCAGGGCCCACCCAGTGTGTC AACTGCAGCCAGTTCCTTCGGGGCCAGGAGTGCGTGGAGGAATGCCGAG.TACTGCAGGGGCTCCCCAGG GAGTATGTGAATGCCAGGCACTGTTTGCCGTGCCACCCTGAGTGTCAGC-CCCAGAATGGCTCAGTGACC TGTTTTGGACCGGAGGCTGACCAGTGTGTGGCCTGTGCCCACTATAAGC5--ACCCTCCCTTCTGCGTGGCC CGCTGCCCCAGCGGTGTGAAACCTGACCTCTCCTACATGCCCATCTGGA-AGTTTCCAGATGAGGAGGGC GCATGCCAGCCTTGCCCCATCAACTGCACCCACTCCTGTGTGGACCTGG--ATGACAAGGGCTGCCCCGCC GAGCAGAGAGCCAGCCCTCTGACGTCCATCGTCTCTGCGGTGGTTGGCA-TTCTGCTGGTCGTGGTCTTG GGGGTGGTCTTTGGGATCCTCATCAAGCGACGGCAGCAGAAGATCCGGA-AGTACACGATGCGGAGACTG CTGCAGGAAACGGAGCTGGTGGAGCCGCTGACACCTAGCGGAGCGATGCCCAACCAGGCGCAGATGCGG ATCCTGAAAGAGACGGAGCTGAGGAAGGTGAAGGTGCTTGGATCTGGCGCTTTTGGCACAGTCTACAAG GGCATCTGGATCCCTGATGGGGAGAATGTGAAAATTCCAGTGGCCATCA-AAGTGTTGAGGGAAAACACA TCCCCCAAAGCCAACAAAGAAATCTTAGACGAAGCATACGTGATGGCTGGTGTGGGCTCCCCATATGTC TCCCGCCTTCTGGGCATCTGCCTGACATCCACGGTGCAGCTGGTGACAC-AGCTTATGCCCTATGGCTGC CTCTTAGACCATGTCCGGGAAAACCGCGGACGCCTGGGCTCCCAGGACCTGCTGAACTGGTGTATGCAG ATTGCCAAGGGGATGAGCTACCTGGAGGATGTGCGGCTCGTACACAGGG-ACTTGGCCGCTCGGAACGTG CTGGTCAAGAGTCCCAACCATGTCAAAATTACAGACTTCGGGCTGGCTCGGCTGCTGGACATTGACGAG ACAGAGTACCATGCAGATGGGGGCAAGGTGCCCATCAAGTGGATGGCGCTGGAGTCCATTCTCCGCCGG CGGTTCACCCACCAGAGTGATGTGTGGAGTTATGGTGTGACTGTGTGGGAGCTGATGACTTTTGGGGCC AAACCTTACGATGGGATCCCAGCCCGGGAGATCCCTGACCTGCTGGAAA_?-GGGGGAGCGGCTGCCCCAG CCCCCCATCTGCACCATTGATGTCTACATGATCATGGTCAAATGTTGGAO.GATTGACTCTGAATGTCGG CCAAGATTCCGGGAGTTGGTGTCTGAATTCTCCCGCATGGCCAGGGACCCCCAGCGCTTTGTGGTCATC CAGAATGAGGACTTGGGCCCAGCCAGTCCCTTGGACAGCACCTTCTACCGCTCACTGCTGGAGGACGAT GACATGGGGGACCTGGTGGATGCTGAGGAGTATCTGGTACCCCAGCAGGGCTTCTTCTGTCCAGACCCT GCCCCGGGCGCTGGGGGCATGGTCCACCACAGGCACCGCAGCTCATCTACCAGGAGTGGCGGTGGGGAC CTGACACTAGGGCTGGAGCCCTCTGAAGAGGAGGCCCCCAGGTCTCCAC-TGGCACCCTCCGAAGGGGCT GGCTCCGATGTATTTGATGGTGACCTGGGAATGGGGGCAGCCAAGGGGC-TGCAAAGCCTCCCCACACAT GACCCCAGCCCTCTACAGCGGTACAGTGAGGACCCCACAGTACCCCTGCCCTCTGAGACTGATGGCTAC GTTGCCCCCCTGACCTGCAGCCCCCAGCCTGAATATGTGAACCAGCCAG_A.TGTTCGGCCCCAGCCCCCT TCGCCCCGAGAGGGCCCTCTGCCTGCTGCCCGACCTGCTGGTGCCACTCTGGAAAGGGCCAAGACTCTC TCCCCAGGGAAGAATGGGGTCGTCAAAGACGTTTTTGCCTTTGGGGGTGCCGTGGAGAACCCCGAGTAC TTGACACCCCAGGGAGGAGCTGCCCCTCAGCCCCACCCTCCTCCTGCCTTCAGCCCAGCCTTCGACAAC CTCTATTACTGGGACCAGGACCCACCAGAGCGGGGGGCTCCACCCAGCACCTTCAAAC3GGACACCTACG GCAGAGAACCCAGAGTACCTGGGTCTGGACGTGCCAGTG SEQ ID NO : 3

HUMAN EGFR POLYNUCLEOTIDE SEQUENCE (SEQ ID NO : 4)

CCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGCCGCGGCCGAGGCGGC CGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCT'CGTCGGCGTCC GCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTG ATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCC-GGGGCAGCGCT CCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCAC GAGTAACAAGCTCACGCAGTTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGJATGTTCAATAA CTGTGAGGTGGTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCT'TTCCTTCTTAAA GACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATT7CCTTTGGAAAA CCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTT.VTCTAACTATGA TGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCAT.'GGCGCCGTGCG

GTTCAGCAACAACCCTGCCCTGTGCAATGTGGAGAGCATCCAGTGGCGGGACATAGTCAGCAGTGACTT TCTCAGCAACΆTGTCGATGGACTTCCAGAACCACCTGGGCAGCTGCCAAAAGTGTGAΓCCAAGCTGTCC

CAATGGGAGCTGCTGGGGTGCAGGAGAGGAGAACTGCCAGAAACTGACCAAAATCATCTGTGCCCAGCA GTGCTCCGGGCGCTGCCGTGGCAAGTCCCCCAGTGACTGCTGCCACAACCAGTGTGCΓGCAGGCTGCAC AGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGCAAGGACACCTG CCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAACCCCGAGGGCAAATACAGCTT TGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTGGTGACAGATCACGGCTCG.TGCGTCCGAGC CTGTGGGGCCGACAGCTATGAGATGGAGGAAGACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTG CCGCAAAGTGTGTAACGGAATAGGTATTGGTGAATTTAAAGACTCACTCTCCATAAAΓGCTACGAATAT TAAACACTTCAAAAACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCA-TTTAGGGGTGA CTCCTTCACACATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGTA-AAGGAAATCAC AGGTTTGAGCTGAATTATCACATGAATATAAATGGGAAATCAGTGTTTTAGAGAGAG2_-ΑCTTTTCGACA TATTTCCTGTTCCCTTGGAATAAAAACATTTCTTCTGAAATTTTACCGTTAA

HUMAN VEGF POLYNUCLEOTIDE SEQUENCE (SEQ ID NO : 5)

AAGAGCTCCAGAGAGAAGTCGAGGAAGAGAGAGACGGGGTCAGAGAGAGCGCGCGGGCGTGCGAGCAGC GAAAGCGACAGGGGCAAAGTGAGTGACCTGCTTTTGGGGGTGACCGCCGGAGCGCGGCGTGAGCCCTCC CCCTTGGGATCCCGCAGCTGACCAGTCGCGCTGACGGACAGACAGACAGACACCGCCCCCAGCCCCAGT TACCACCTCCTCCCCGGCCGGCGGCGGACAGTGGACGCGGCGGCGAGCCGCGGGCAGGGGCCGGAGCCC GCCCCCGGAGGCGGGGTGGAGGGGGTCGGAGCTCGCGGCGTCGCACTGAAACTTTTCGTCCAACTTCTG

GGCTGTTCTCGCTTCGGAGGAGCCGTGGTCCGCGCGGGGGAAGCCGAGCCGAGCGGAGCCGCGAGAAGT GCTAGCTCGGGCCGGGAGGAGCCGCAGCCGGAGGAGGGGGAGGAGGAAGAAGAGAAGGJAAGAGGAGAGG GGGCCGCAGTGGCGACTCGGCGCTCGGAAGCCGGGCTCATGGACGGGTGAGGCGGCGGTGTGCGCAGAC AGTGCTCCAGCGCGCGCGCTCCCCAGCCCTGGCCCGGCCTCGGGCCGGGAGGAAGAGTJA.GCTCGCCGAG GCGCCGAGGAGAGCGGGCCGCCCCACAGCCCGAGCCGGAGAGGGACGCGAGCCGCGCGCCCCGGTCGGG CCTCCGAAACCATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACC ATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGT TCATGGATGTCTATCAGCGCAGCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACC CTGATGAGATCGAGTACATCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTCCAATG ACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTC ACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCAG.-A.CCAAAGAAAG ATAGAGCAAGACAΆGAAAATCCCTGTGGGCCTTGCTCAGAGCGGAGAAAGCATTTGTTTGTACAΆGATC CGCAGACGTGTAAATGTTCCTGCAAAAACACACACTCGCGTTGCAAGGCGAGGCAGCTTGAGTTAAACG AACGTACTTGCAGATGTGACAAGCCGAGGCGGTGAGCCGGGCAGGAGGAAGGAGCCTCCCTCAGGGTTT CGGGAACCAGATCTCTCTCCAGGAAAGACTGATACAGAACGATCGATACAGAAACCACGCTGCCGCCAC CACACCATCACCATCGACAGAACAGTCCTTAATCCAGAAACCTGAAATGAAGGAAGAGGAGACTCTGCG CAGAGCACTTTGGGTCCGGAGGGCGAGACTCCGGCGGAAGCATTCCCGGGCGGGTGACCCAGCACGGTC CCTCTTGGAATTGGATTCGCCATTTTATTTTTCTTGCTGCTAAATCACCGAGCCCGGAΆGATTAGAGAG TTTTATTTCTGGGATTCCTGTAGACACACCCACCCACATACATACATTTATATATATA"-TATATTATATA TATATAAAAATAAATATCTCTATTTTATATATATAΆAATATATATATTCTTTTTTTAAΆTTAACAGTGC TAATGTTATTGGTGTCTTCACTGGATGTATTTGACTGCTGTGGACTTGAGTTGGGAGGGGAATGTTCCC ACTCAGATCCTGACAGGGAAGAGGAGGAGATGAGAGACTCTGGCATGATCTTTTTTTTGTCCCACTTGG GGGGCCAGGGTCCTCTCCCCTGCCCAAGAATGTGCAAGGCCAGGGCATGGGGGCAAATATGACCCAGT TTTGGGAACACCGACAAACCCAGCCCTGGCGCTGAGCCTCTCTACCCCAGGTCAGACGGACAGAAAGAC AAATCACAGGTTCCGGGATGAGGACACCGGCTCTGACCAGGAGTTTGGGGAGCTTCAGGACATTGCTGT GCTTTGGGGATTCCCTCCACATGCTGCACGCGCATCTCGCCCCCAGGGGCACTGCCTGGAAGATTCAGG AGCCTGGGCGGCCTTCGCTTACTCTCACCTGCTTCTGAGTTGCCCAGGAGGCCACTGGCAGATGTCCCG GCGAAGAGAAGAGACACATTGTTGGAAGAAGCAGCCCATGACAGCGCCCCTTCCTGGGACTCGCCCTCA TCCTCTTCCTGCTCCCCTTCCTGGGGTGCAGCCTAAAAGGACCTATGTCCTCACACCATTGAAACCACT AGTTCTGTCCCCCCAGGAAACCTGGTTGTGTGTGTGTGAGTGGTTGACCTTCCTCCATCCCCTGGTCCT TCCCTTCCCTTCCCGAGGCACAGAGAGACAGGGCAGGATCCACGTGCCCATTGTGGAGGCAGAGAAAAG AGAAAGTGTTTTATATACGGTACTTATTTAATATCCCTTTTTAATTAGAAATTAGAACAGTTAATTTAA TTAAAGAGTAGGGTTTTTTTTCAGTATTCTTGGTTAATATTTAATTTCAACTATTTATGAGATGTATCT TTTGCTCTCTCTTGCTCTCTTATTTGTACCGGTTTTTGTATATAAAATTCATGTTTCCAATCTCTCTCT CCCTGATCGGTGACAGTCACTAGCTTATCTTGAACAGATATTTAATTTTGCTAACACTCAGCTCTGCCC TCCCCGATCCCCTGGCTCCCCAGCACACATTCCTTTGAAAGAGGGTTTCAATATACATCTACATACTAT ATATATATTGGGCAACTTGTATTTGTGTGTATATATATATATATATGTTTATGTATATATGTGATCCTG AAAAAATAAACATCGCTATTCTGTTTTTTATATGTTCAAACCAAACAAGAAAAAATAGAGAATTCTACA

TACTAAATCTCTCTCCTTTTTTAATTTTAATATTTGTTATCATTTATTTATTGGTGCTACTGTTTATCC GTAATAATTGTGGGGAAAAGATATTAACATCACGTCTTTGTCTCTAGTGCAGTTTTTCGAGATATTCCG TAGTACATATTTATTTTTAAACAACGACAAAGAAATACAGATATATCTTA

HUMAN FLT FMS-LIKE TYROSINE KINASE-3 (FLT3) POLYNUCLEOTIDE SEQUENCE (SEQ ID NO: 6)

CGAGGCGGCATCCGAGGGCTGGGCCGGCGCCCTGGGGGACCCCGGGCTCCGGAGGCCATGCCGGCGTTG GCGCGCGACGCGGGCACCGTGCCGCTGCTCGTTGTTTTTTCTGCAATGATATTTGGGACTATTACAAAT CAAGATCTGCCTGTGATCAAGTGTGTTTTAATCAATCATAAGAACAATGATTCATCAGTGGGGAAGTCA TCATCATATCCCATGGTATCAGAATCCCCGGAAGACCTCGGGTGTGCGTTGAGACCCCAGAGCTCAGGG ACAGTGTACGAAGCTGCCGCTGTGGAAGTGGATGTATCTGCTTCCATCACACTGCAAGTGCTGGTCGAT GCCCCAGGGAACATTTCCTGTCTCTGGGTCTTTAAGCACAGCTCCCTGAATTGCCAGCCACATTTTGAT TTACAAAACAGAGGAGTTGTTTCCATGGTCATTTTGAAAATGACAGAAACCCAAGCTGGAGAATACCTA CTTTTTATTCAGAGTGAAGCTACCAATTACACAATATTGTTTACAGTGAGTATAAGAAATACCCTGCTT TACACATTAAGAAGACCTTACTTTAGAAAAATGGAAAACCAGGACGCCCTGGTCTGCATATCTGAGAGC GTTCCAGAGCCGATCGTGGAATGGGTGCTTTGCGATTCACAGGGGGAAAGCTGTAAAGAAGAAAGTCCA GCTGTTGTTAAAAAGGAGGAAAAAGTGCTTCATGAATTATTTGGGACGGACATAAGGTGCTGTGCCAGA AATGAACTGGGCAGGGAATGCACCAGGCTGTTCACAATAGATCTAAATCAAACTCCTCAGACCACATTG CCACAATTATTTCTTAAAGTAGGGGAACCCTTATGGATAAGGTGCAAAGCTGTTCATGTGAACCATGGA TTCGGGCTCACCTGGGAATTAGAAAACAAAGCACTCGAGGAGGGCAACTACTTTGAGATGAGTACCTAT TCAACAAACAGAACTATGATACGGATTCTGTTTGCTTTTGTATCATCAGTGGCAAGAAACGACACCGGA TACTACACTTGTTCCTCTTCAAAGCATCCCAGTCAATCAGCTTTGGTTACCATCGTAGGAAAGGGATTT ATAAATGCTACCAATTCAAGTGAAGATTATGAAATTGACCAATATGAAGAGTTTTGTTTTTCTGTCAGG TTTAAAGCCTACCCACAAATCAGATGTACGTGGACCTTCTCTCGAAAATCATTTCCTTGTGAGCAAAAG GGTCTTGATAACGGATACAGCATATCCAAGTTTTGCAATCATAAGCACCAGCCAGGAGAATATATATTC CATGCAGAAAATGATGATGCCCAATTTACCAAAATGTTCACGCTGAATATAAGAAGGAAACCTCAAGTG CTCGCAGAAGCATCGGCAAGTCAGGCGTCCTGTTTCTCGGATGGATACCCATTACCATCTTGGACCTGG AAGAAGTGTTCAGACAAGTCTCCCAACTGCACAGAAGAGATCACAGAAGGAGTCTGGAATAGAAAGGCT AACAGAAAAGTGTTTGGACAGTGGGTGTCGAGCAGTACTCTAAACATGAGTGAAGCCATAAAAGGGTTC CTGGTCAAGTGCTGTGCATACAATTCCCTTGGCACATCTTGTGAGACGATCCTTTTAAACTCTCCAGGC CCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCCTCTTCATTGTC GTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTA CAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAA TGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATG AACGCAACAGCTTATGGAATTAGCAΆAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAΆGAA AAAGCAGACAGCTCTGAAAGAGAGGCACTCATGTCAGAACTCAAGATGATGACCCAGCTGGGAAGCCAC GAGAATATTGTGAACCTGCTGGGGGCGTGCACACTGTCAGGACCAATTTACTTGATTTTTGAATACTGT TGCTATGGTGATCTTCTCAACTATCTAAGAAGTAAAAGAGAAAAATTTCACAGGACTTGGACAGAGATT TTCAAGGAACACAATTTCAGTTTTTACCCCACTTTCCAATCACATCCAAATTCCAGCATGCCTGGTTCA_- AGAGAAGTTCAGATACACCCGGACTCGGATCAAATCTCAGGGCTTCATGGGAATTCATTTCACTCTGAA_- GATGAAATTGAATATGAAAACCAAAAAAGGCTGGAAGAAGAGGAGGACTTGAATGTGCTTACATTTGAAs. GATCTTCTTTGCTTTGCATATCAAGTTGCCAAAGGAATGGAATTTCTGGAATTTAAGTCGTGTGTTCAC: AGAGACCTGGCCGCCAGGAACGTGCTTGTCACCCACGGGAAAGTGGTGAAGATATGTGACTTTGGATTGt- GCTCGAGATATCATGAGTGATTCCAACTATGTTGTCAGGGGCAATGCCCGTCTGCCTGTAAAATGGATGΪ- GCCCCCGAAAGCCTGTTTGAAGGCATCTACACCATTAAGAGTGATGTCTGGTCATATGGAATATTACTS- TGGGAAATCTTCTCACTTGGTGTGAATCCTTACCCTGGCATTCCGGTTGATGCTAACTTCTACAAACTS ATTCAAAATGGATTTAAAATGGATCAGCCATTTTATGCTACAGAAGAAATATACATTATAATGCAATC TGCTGGGCTTTTGACTCAAGGAAACGGCCATCCTTCCCTAATTTGACTTCGTTTTTAGGATGTCAGCTS GCAGATGCAGAAGAAGCGATGTATCAGAATGTGGATGGCCGTGTTTCGGAATGTCCTCACACCTACCAA_. AACAGGCGACCTTTCAGCAGAGAGATGGATTTGGGGCTACTCTCTCCGCAGGCTCAGGTCGAAGATTCG5- TAGAGGAACAATTTAGTTTTAAGGACTTCATCCCTCCACCTATCCCTAACAGGCTGTAGATTACCAAAAv. CAAGATTAATTTCATCACTAAAAGAAAATCTATTATCAACTGCTGCTTCACCAGACTTTTCTCTAGAAS CCGTCTGCGTTTACTCTTGTTTTCAAAGGGACTTTTGTAAAATCAAATCATCCTGTCACAAGGCAGGAS GAGCTGATAATGAACTTTATTGGAGCATTGATCTGCATCCAAGGCCTTCTCAGGCCGGCTTGAGTGAAIT TGTGTACCTGAAGTACAGTATATTCTTGTAAATACATAAAACAAAAGCATTTTGCTAAGGAGAAGCTAΪV TATGATTTTTTAAGTCTATGTTTTAAAATAATATGTAAATTTTTCAGCTATTTAGTGATATATTTTATS GGTGGGAATAAAATTTCTACTACAG HUMAN MYC POLYNUCLEOTIDE SEQUENCE (SEQ ID NO : 7) AAGTGCTGGGATTACAGGTGTGAGCCAGGGCACCAGGCTTAGATGTGGCTCTTTGGGGAGATAATTTTS TCCAGAGACCTTTCTAACGTATTCATGCCTTGTATTTGTACAGCATTAATCTGGTAATTGATTATTTTΪ . ATGTAACCTTGCTAAAGGAGTGATTTCTATTTCCTTTCTTAAAGAGGAGGAACAAGAAGATGAGGAAGA_. AATCGATGTTGTTTCTGTGGAAAAGAGGCAGGCTCCTGGCAAAAGGTCAGAGTCTGGATCACCTTCTGC. TGGAGGCCACAGCAAACCTCCTCACAGCCCACTGGTCCTCAAGAGGTGCCACGTCTCCACACATCAGCAV CAACTACGCAGCGCCTCCCTCCACTCGGAAGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACAGTGT7 CAGAGTCCTGAGACAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGA _. TGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGC CCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGC CACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAFV ACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAAGGAAAAGTAAGGA_V AACGATTCCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTTCAAATGCATGATCAAATS

^' CAACCTCACAACCTTGGCTGAGTCTTGAGACTGAAAGATTTAGCCATAATGTAAACTGCCTCAAATTGS ACTTTGGGCATAAAAGAACTTTTTTATGCTTACCATCTTTTTTTTTTCTTTAACAGATTTGTATTTAAGS AATTGTTTTTAAAAAATTTTAAGATTTACACAATGTTTCTCTGTAAATATTGCCATTAAATGTAAATAA_ CTTTAATAAAACGTTTATAGCAGTTACACAGAATTTCAATCCTAGTATATAGTACCTAGTATTATAGGT ACTATAAACCCTAATTTTTTTTATTTAAGTACATTTTGCTTTTTAAAGTTGATTTTTTTCTATTGTTTT? TAGAAAAAATAAAATAACTGGCAAATATATCATTGAGCCAAATCTTAAGTTGTGAATGTTTTGTTTCGT? TTCTTCCCCCTCCCAACCACCACCATCCCTGTTTGTTTTCATCAATTGCCCCTTCAGAGGGTGGTCTTΪV AGAAAGGCAAGAGTTTTCCTCTGTTGAAATGGGTCTGGGGGCCTTAAGGTCTTTAAGTTCTTGGAGGTTR CTAAGATGCTTCCTGGAGACTATGATAACAGCCGAAGTTGACAGTTAGAAGGAATGGCAGAAGGCAGGT_^, GAGAAGGTGAGAGGTAGGCAAΆGGAGATACAAGAGGTCAAAGGTAGCAGTTAAGTACACAAAGAGGCAT AAGGACTGGGGAGTTGGGAGGAAGGTGAGGAAGAAACTCCTGTTACTTTAGTTAACCAGTGCCAGTCCC CTGCTCACTCCAAA

HUMAN UROKINASE PLASMINOGEN ACTIVATOR (UPA) POLYNUCLEOTIDE SEQUENCE (SEQ ID NO: 8) CCCGGGCCAGGGTCCACCTGTCCCCGCAGCGCCGGCTCGCGCCCTCCTGCCGCAGCCACCGAGCCGCCS TCTAGCGCCCCGACCTCGCCACCATGAGAGCCCTGCTGGCGCGCCTGCTTCTCTGCGTCCTGGTCGTG_^_ GCGACTCCAAAGGCAGCAATGAACTTCATCAAGTTCCATCGAACTGTGACTGTCTAAATGGAGGAACAT? GTGTGTCCAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAAAGAAATTCGGAGGGCAGCACTΓ GTGAAATAGATAAGTCAAAAACCTGCTATGAGGGGAATGGTCACTTTTACCGAGGAAAGGCCAGCACTS ACACCATGGGCCGGCCCTGCCTGCCCTGGAACTCTGCCACTGTCCTTCAGCAAACGTACCATGCCCAC?__. GATCTGATGCTCTTCAGCTGGGCCTGGGGAAACATAATTACTGCAGGAACCCAGACAACCGGAGGCGAC CCTGGTGCTATGTGCAGGTGGGCCTAAAGCCGCTTGTCCAAGAGTGCATGGTGCATGACTGCGCAGATG GAAAAAAGCCCTCCTCTCCTCCAGAAGAATTAAAATTTCAGTGTGGCCAAAAGACTCTGAGGCCCCGCT TTAAGATTATTGGGGGAGAATTCACCACCATCGAGAACCAGCCCTGGTTTGCGGCCATCTACAGGAGGC ACCGGGGGGGCTCTGTCACCTACGTGTGTGGAGGCAGCCTCATCAGCCCTTGCTGGGTGATCAGCGCCA CACACTGCTTCATTGATTACCCAAAGAAGGAGGACTACATCGTCTACCTGGGTCGCTCAAGGCTTAACT CCAACACGCAAGGGGAGATGAAGTTTGAGGTGGAAAACCTCATCCTACACAAGGACTACAGCGCTGACA CGCTTGCTCACCACAACGACATTGCCTTGCTGAAGATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCAT CCCGGACTATACAGACCATCTGCCTGCCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGA TCACTGGCTTTGGAAAAGAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTGA AGCTGATTTCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACCAAAATGCTGT GTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGGGGACCCCTCGTCTGTTCCC TCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGGGGCCGTGGATGTGCCCTGAAGGACAAGCCAG GCGTCTACACGAGAGTCTCACACTTCTTACCCTGGATCCGCAGTCACACCAAGGAAGAGAATGGCCTGG CCCTCTGAGGGTCCCCAGGGAGGAAACGGGCACCACCCGCTTTCTTGCTGGTTGTCATTTTTGCAGTAG AGTCATCTCCATCAGCTGTAAGAAGAGACTGGGAAGATAGGCTCTGCACAGATGGATTTGCCTGTGCCA CCCACCAGGGTGAACGACAATAGCTTTACCCTCAGGCATAGGCCTGGGTGCTGGCTGCCCAGACCCCTC TGGCCAGGATGGAGGGGTGGTCCTGACTCAACATGTTACTGACCAGCAACTTGTCTTTTTCTGGACTGA AGCCTGCAGGAGTTAAAAAGGGCAGGGCATCTCCTGTGCATGGGTGAAGGGAGAGCCAGCTCCCCCGAC GGTGGGCATTTGTGAGGCCCATGGTTGAGAAATGAATAATTTCCCAATTAGGAAGTGTAACAGCTGAGG TCTCTTGAGGGAGCTTAGCCAATGTGGGAGCAGCGGTTTGGGGAGCAGAGACACTAACGACTTCAGGGC AGGGCTCTGATATTCCATGAATGTATCAGGAAATATATATGTGTGTGTATGTTTGCACACTTGTGTGTG GGCTGTGAGTGTAAGTGTGAGTAAGAGCTGGTGTCTGATTGTTAAGTCTAAATATTTCCTTAAACTGTG TGGACTGTGATGCCACACAGAGTGGTCTTTCTGGAGAGGTTATAGGTCACTCCTGGGGCCTCTTGGGTC CCCCACGTGACAGTGCCTGGGAATGTATTATTCTGCAGCATGACCTGTGACCAGCACTGTCTCAGTTTC ACTTTCACATAGATGTCCCTTTCTTGGCCAGTTATCCCTTCCTTTTAGCCTAGTTCATCCAATCCTCAC TGGGTGGGGTGAGGACCACTCCTTACACTGAATATTTATATTTCACTATTTTTATTTATATTTTTGTAA TTTTAAATAAAAGTGATCAATAAAATGTGATTTTTCTGATGAA

HUMAN PLASMINOGEN ACTIVATOR INHIBITOR (PAI-1) POLYNUCLEOTIDESEQUENCE SEQ ID NO: 9)

GAATTCCTGCAGCTCAGCAGCCGCCGCCAGAGCAGGACGAACCGCCAATCGCAAGGCACCTCTGAGAAC TTCAGGATGCAGATGTCTCCAGCCCTCACCTGCCTAGTCCTGGGCCTGGCCCTTGTCTTTGGTGAAGGG TCTGCTGTGCACCATCCCCCATCCTACGTGGCCCACCTGGCCTCAGACTTCGGGGTGAGGGTGTTTCAG CAGGTGGCGCAGGCCTCCAAGGACCGCAACGTGGTTTTCTCACCCTATGGGGTGGCCTCGGTGTTGGCC ATGCTCCAGCTGACAACAGGAGGAGAAACCCAGCAGCAGATTCAAGCAGCTATGGGATTCAAGATTGAT GACAAGGGCATGGCCCCCGCCCTCCGGCATCTGTACAAGGAGCTCATGGGGCCATGGAACAAGGATGAG ATCAGCACCACAGACGCGATCTTCGTCCAGCGGGATCTGAAGCTGGTCCAGGGCTTCATGCCCCACTTC TTCAGGCTGTTCCGGAGCACGGTCAAGCAAGTGGACTTTTCAGAGGTGGAGAGAGCCAGATTCATCATC AATGACTGGGTGAAGACACACACAAAAGGTATGATCAGCAACTTGCTTGGGAAAGGAGCCGTGGACCAG CTGACACGGCTGGTGCTGGTGAATGCCCTCTACTTCAACGGCCAGTGGAAGACTCCCTTCCCCGACTCC AGCACCCACCGCCGCCTCTTCCACAAATCAGACGGCAGCACTGTCTCTGTGCCCATGATGGCTCAGACC AACAAGTTCAACTATACTGAGTTCACCACGCCCGATGGCCATTACTACGACATCCTGGAACTGCCCTAC CACGGGGACACCCTCAGCATGTTCATTGCTGCCCCTTATGAAAAAGAGGTGCCTCTCTCTGCCCTCACC AACATTCTGAGTGCCCAGCTCATCAGCCACTGGAAAGGCAACATGACCAGGCTGCCCCGCCTCCTGGTT CTGCCCAAGTTCTCCCTGGAGACTGAAGTCGACCTCAGGAAGCCCCTAGAGAACCTGGGAATGACCGAC ATGTTCAGACAGTTTCAGGCTGACTTCACGAGTCTTTCAGACCAAGAGCCTCTCCACGTCGCGCAGGCG CTGCAGAAAGTGAAGATCGAGGTGAACGAGAGTGGCACGGTGGCCTCCTCATCCACAGCTGTCATAGTC TCAGCCCGCATGGCCCCCGAGGAGATCATCATGGACAGACCCTTCCTCTTTGTGGTCCGGCACAACCCC ACAGGAACAGTCCTTTTCATGGGCCAAGTGATGGAACCCTGACCCTGGGGAAAGACGCCTTCATCTGGG ACAAAACTGGAGATGCATCGGGAAAGAAGAAACTCCGAAGAAAAGAATTTTAGTGTTAATGACTCTTTC TGAAGGAAGAGAAGACATTTGCCTTTTGTTAAAAGATGGTAAACCAGATCTGTCTCCAAGACCTTGGCC TCTCCTTGGAGGACCTTTAGGTCAAACTCCCTAGTCTCCACCTGAGACCCTGGGAGAGAAGTTTGAAGC ACAACTCCCTTAAGGTCTCCAAACCAGACGGTGACGCCTGCGGGACCATCTGGGGCACCTGCTTCCACC CGTCTCTCTGCCCACTCGGGTCTGCAGACCTGGTTCCCACTGAGGCCCTTTGCAGGATGGAACTACGGG GCTTACAGGAGCTTTTGTGTGCCTGGTAGAAACTATTTCTGTTCCAGTCACATTGCCATCACTCTTGTA CTGCCTGCCACCGCGGAGGAGGCTGGTGACAGGCCAAAGGCCAGTGGAAGAAACACCCTTTCATCTCAG AGTCCACTGTGGCACTGGCCACCCCTCCCCAGTACAGGGGTGCTGCAGGTGGCAGAGTGAATGTCCCCC ATCATGTGGCCCAACTCTCCTGGCCTGGCCATCTCCCTCCCCAGAAACAGTGTGCATGGGTTATTTTGG AGTGTAGGTGACTTGTTTACTCATTGAAGCAGATTTCTGCTTCCTTTTATTTTTATAGGAATAGAGGAA GAAATGTCAGATGCGTGCCCAGCTCTTCACCCCCCAATCTCTTGGTGGGGAGGGGTGTACCTAAATATT TATCATATCCTTGCCCTTGAGTGCTTGTTAGAGAGAAAGAGAACTACTAAGGAAAATAATATTATTTAA ACTCGCTCCTAGTGTTTCTTTGTGGTCTGTGTCACCGTATCTCAGGAAGTCCAGCCACTTGACTGGCAC ACACCCCTCCGGACATCCAGCGTGACGGAGCCCACACTGCCACCTTGTGGCCGCCTGAGACCCTCGCGC CCCCCGCGCCCCCCGCGCCCCTCTTTTTCCCCTTGATGGAAATTGACCATACAATTTCATCCTCCTTCA GGGGATCAAAAGGACGGAGTGGGGGGACAGAGACTCAGATGAGGACAGAGTGGTTTCCAATGTGTTCAA TAGATTTAGGAGCAGAAATGCAAGGGGCTGCATGACCTACCAGGACAGAACTTTCCCCAATTACAGGGT GACTCACAGCCGCATTGGTGACTCACTTCAATGTGTCATTTCCGGCTGCTGTGTGTGAGCAGTGGACAC GTGAGGGGGGGGTGGGTGAGAGAGACAGGCAGCTCGGATTCAACTACCTTAGATAATATTTCTGAAAAC CTACCAGCCAGAGGGTAGGGCACAAAGATGGATGTAATGCACTTTGGGAGGCCAAGGCGGGAGGATTGC TTGAGCCCAGGAGTTCAAGACCAGCCTGGGCAACATACCAAGACCCCCGTCTCTTTAAAAATATATATA TTTTAAATATACTTAAATATATATTTCTAATATCTTTAAATATATATATATATTTTAAAGACCAATTTA TGGGAGAATTGCACACAGATGTGAAATGAATGTAATCTAATAGAAGC

HUMAN BRCAl POLYNUCLEOTIDE SEQUENCE (SEQ ID NO : 10) AAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACCCCGCACCAGGCTGTGGGGTTTCTC AGATAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAGTTCATTGGAACAGAAA GAAATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTA GAGTGTCCCATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAA TTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATA ACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGT GCTTTTCAGCTTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCT CCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTT CTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGA ACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGA TCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATCAAGAATTGTTACAA ATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGGCTGCTTGTGAATTTTCT GAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGT GCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGC ACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAAT GTAGAAAAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGG GCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGTAGATCTGAATGCT GATCCCCTGTGTGAGAGAAAAGAATGGAATAAGCAGAAACTGCCATGCTCAGAGAATCCTAGAGATACT GAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGAT GAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATGCCAAAGTAGCTGATGTATTG GACGTTCTAAATGAGGTAGATGAATATTCTGGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCT CATGAGGCTTTAATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTGAAGACAAA ATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAACTTAAGCCATGTAACTGAAAATCTAATT ATAGGAGCATTTGTTACTGAGCCACAGATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAA AGGAGACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTGGCAGTTCAAAAGACT CCTGAAATGATAAATCAGGGAACTAACCAAACGGAGCAGAATGGTCAAGTGATGAATATTACTAATAGT GGTCATGAGAATAAAACAAAAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCACTC GAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAGTATAAGCAATATGGAACTCGAA TTAAATATCCACAATTCAAAAGCACCTAAAAAGAATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATT CATGCGCTTGAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCAAATTGATAGT TGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACCAAATGCCAGTCAGGCACAGCAGAAACCTA CAACTCATGGAAGGTAAAGAACCTGCAACTGGAGCCAAGAAGAGTAACAAGCCAAATGAACAGACAAGT AAAAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTCTTTTACTAAGTGT TCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTA GAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGTTTTG CAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTGGTACTGATTATGGCACTCAGGAA AGTATCTCGTTACTGGAAGTTAGCACTCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAG TGTGCAGCATTTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGAAATGACACAGAA GGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGTCGGGAAACAAGCATAGAAATGGAAGAAAGT GAACTTGATGCTCAGTATTTGCAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCA AATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAACAAAGT CCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCT GTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGATAATGCC AAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTCAGTTCAGAGGCAACGAAACTGGACTC ATTACTCCAAATAAACATGGACTTTTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCA TTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAACATTCAATGTCACCTGAA AGAGAAATGGGAAATGAGAACATTCCAAGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAAAAT GTTTTTAAAGAAGCCAGCTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCAGT ATTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGAACTAGGTAGAAACAGAGGGCCAAAATTG AATGCTATGCTTAGATTAGGGGTTTTGCAACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGT AAGCATCCTGAAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGATTTCTCTCCA TATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTAGTCATGCATCTCAGGTTTGTTCTGAGACA CCTGATGACCTGTTAGATGATGGTGAAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAA AGTTCTGCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCCTAGCCCTTTCACCCAT ACACATTTGGCTCAGGGTTACCGAAGAGGGGCCAAGAAATTAGAGTCCTCAGAAGAGAACTTATCTAGT GAGGATGAAGAGCTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCT ACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAG AATAGCTTAAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAG GAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACA AACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGAGTT GGTCTGAGTGACAAGGAATTGGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAA GAAGAGCAAAGCATGGATTCAAACTTAGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCT GAAGACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGAGGGATACCATGCAACAT AACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCAGCCT TCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGC ACATCAGAAAAAGCAGTATTAACTTCACAGAAAAGTAGTGAATACCCTATAAGCCAGAATCCAGAAGGC CTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAA AGGTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTT CAGAATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAA GAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTAC CTGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAG TCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCAGAA TCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTG AGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCT GGCCTGACCCCAGAAGAATTTATGCTCGTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAAT CTAATTACTGAAGAGACTACTCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAACGGACACTG AAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGGGTGACCCAGTCTATTAAA GAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAA GGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGG CCCTTCACCAACATGCCCACAGATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCTGTGGTGAAG GAGCTTTCATCATTCACCCTTGGCACAGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACA GAGGACAATGGCTTCCATGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTG GACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCAC TACTGACTGCAGCCAGCCACAGGTACAGAGCCCAGGACCCCAAGAATGAGCTTACAAAGTGGCCTTTCC AGGCCCTGGGAGCTCCTCTCACTCTTCAGTCCTTCTACTGTCCTGGCTACTAAATATTTTATGTACATC AGCCTGAAAAGGACTTCTGGCTATGCAAGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAA TCTGCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAGATTTTAAAACCATTTAAACGCCACCA ATTGAGCAAGATGCTGATTCATTATTTATCAGCCCTATTCTTTCTATTCAGGCTGTTGTTGGCTTAGGG CTGGAAGCACAGAGTGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTACTTCTCTAAAACCCT GTGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGGAAGGAGAGTGCTTGGGATCGATTATGTGACTTA AAGTCAGAATAGTCCTTGGGCAGTTCTCAAATGTTGGAGTGGAACATTGGGGAGGAAATTCTGAGGCAG GTATTAGAAATGAAAAGGAAACTTGAAACCTGGGCATGGTGGCTCACGCCTGTAATCCCAGCACTTTGG GAGGCCAAGGTGGGCAGATCACTGGAGGTCAGGAGTTCGAAACCAGCCTGGCCAACATGGTGAAACCCC ATCTCTACTAAAAATACAGAAATTAGCCGGTCATGGTGGTGGACACCTGTAATCCCAGCTACTCAGGTG GCTAAGGCAGGAGAATCACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGCCAAGATCATACCACGGCAC TCCAGCCTGGGTGACAGTGAGACTGTGGCTCAAAAAAAAAAAAAAAAAAGGAAAATGAAACTAGGAAAG GTTTCTTAAAGTCTGAGATATATTTGCTAGATTTCTAAAGAATGTGTTCTAAAACAGCAGAAGATTTTC AAGAACCGGTTTCCAAAGACAGTCTTCTAATTCCTCATTAGTAATAAGTAAAATGTTTATTGTTGTAGC TCTGGTATATAATCCATTCCTCTTAAAATATAAGACCTCTGGCATGAATATTTCATATCTATAAAATGA CAGATCCCACCAGGAAGGAAGCTGTTGCTTTCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGTTGCTGA AACCATACAGCTTCATAAATAATTTTGCTTGCTGAAGGAAGAAAAAGTGTTTTTCATAAACCCATTATC CAGGACTGTTTATAGCTGTTGGAAGGACTAGGTCTTCCCTAGCCCCCCCAGTGTGCAAGGGCAGTGAAG ACTTGATTGTACAAAATACGTTTTGTAAATGTTGTGCTGTTAACACTGCAAATAAACTTGGTAGCAAAC A

HUMAN BRCA2 POLYNUCLEOTIDE SEQUENCE (SEQ ID NO: 11)

GGTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTGCTGCGCCTCTGCTGCG

CCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCGCCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCG CGGTTTTTGTCAGCTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCGGACTTATTTACCAAGCATT GGAGGAATATCGTAGGTAAAAATGCCTATTGGATCCAAAGAGAGGCCAACATTTTTTGAAATTTTTAAG ACACGCTGCAACAAAGCAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCT CCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACATAAAAACAACAATTACGAACCAAACCTATTT AAAACTCCACAAAGGAAACCATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGG CTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAAATTAGACTTAGGAAGGAAT GTTCCCAATAGTAGACATAAAAGTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCC TGTCCACTTCTAAATTCTTGTCTTAGTGAAAGTCCTGTTGTTCTACAATGTACACATGTAACACCACAA AGAGATAAGTCAGTGGTATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAGGGTCGTCAGACACCA AAACATATTTCTGAAAGTCTAGGAGCTGAGGTGGATCCTGATATGTCTTGGTCAAGTTCTTTAGCTACA CCACCCACCCTTAGTTCTACTGTGCTCATAGTCAGAAATGAAGAAGCATCTGAAACTGTATTTCCTCAT GATACTACTGCTAATGTGAAAAGCTATTTTTCCAATCATGATGAAAGTCTGAAGAAAAATGATAGATTT ATCGCTTCTGTGACAGACAGTGAAAACACAAATCAAAGAGAAGCTGCAAGTCATGGATTTGGAAAAACA TCAGGGAATTCATTTAAAGTAAATAGCTGCAAAGACCACATTGGAAAGTCAATGCCAAATGTCCTAGAA GATGAAGTATATGAAACAGTTGTAGATACCTCTGAAGAAGATAGTTTTTCATTATGTTTTTCTAAATGT AGAACAAAAAATCTACAAAAAGTAAGAACTAGCAAGACTAGGAAAAAAATTTTCCATGAAGCAAACGCT GATGAATGTGAAAAATCTAAAAACCAAGTGAAAGAAAAATACTCATTTGTATCTGAAGTGGAACCAAAT GATACTGATCCATTAGATTCAAATGTAGCACATCAGAAGCCCTTTGAGAGTGGAAGTGACAAAATCTCC AAGGAAGTTGTACCGTCTTTGGCCTGTGAATGGTCTCAACTAACCCTTTCAGGTCTAAATGGAGCCCAG ATGGAGAAAATACCCCTATTGCATATTTCTTCATGTGACCAAAATATTTCAGAAAAAGACCTATTAGAC ACAGAGAACAAAAGAAAGAAAGATTTTCTTACTTCAGAGAATTCTTTGCCACGTATTTCTAGCCTACCA AAATCAGAGAAGCCATTAAATGAGGAAACAGTGGTAAATAAGAGAGATGAAGAGCAGCATCTTGAATCT CATACAGACTGCATTCTTGCAGTAAAGCAGGCAATATCTGGAACTTCTCCAGTGGCTTCTTCATTTCAG GGTATCAAAAAGTCTATATTCAGAATAAGAGAATCACCTAAAGAGACTTTCAATGCAAGTTTTTCAGGT CATATGACTGATCCAAACTTTAAAAAAGAAACTGAAGCCTCTGAAAGTGGACTGGAAATACATACTGTT TGCTCACAGAAGGAGGACTCCTTATGTCCAAATTTAATTGATAATGGAAGCTGGCCAGCCACCACCACA CAGAATTCTGTAGCTTTGAAGAATGCAGGTTTAATATCCACTTTGAAAAAGAAAACAAATAAGTTTATT TATGCTATACATGATGAAACATTTTATAAAGGAAAAAAAATACCGAAAGACCAAAAATCAGAACTAATT AACTGTTCAGCCCAGTTTGAAGCAAATGCTTTTGAAGCACCACTTACATTTGCAAATGCTGATTCAGGT TTATTGCATTCTTCTGTGAAAAGAAGCTGTTCACAGAATGATTCTGAAGAACCAACTTTGTCCTTAACT AGCTCTTTTGGGACAATTCTGAGGAAATGTTCTAGAAATGAAACATGTTCTAATAATACAGTAATCTCT CAGGATCTTGATTATAAAGAAGCAAAATGTAATAAGGAAAAACTACAGTTATTTATTACCCCAGAAGCT GATTCTCTGTCATGCCTGCAGGAAGGACAGTGTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGATATA AAAGAAGAGGTCTTGGCTGCAGCATGTCACCCAGTACAACATTCAAAAGTGGAATACAGTGATACTGAC TTTCAATCCCAGAAAAGTCTTTTATATGATCATGAAAATGCCAGCACTCTTATTTTAACTCCTACTTCC AAGGATGTTCTGTCAAACCTAGTCATGATTTCTAGAGGCAAAGAATCATACAAAATGTCAGACAAGCTC AAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAAAATATTCCCATGGAAAAGAATCAAGATGTA TGTGCTTTAAATGAAAATTATAAAAACGTTGAGCTGTTGCCACCTGAAAAATACATGAGAGTAGCATCA CCTTCAAGAAAGGTACAATTCAACCAAAACACAAATCTAAGAGTAATCCAAAAAAATCAAGAAGAAACT ACTTCAATTTCAAAAATAACTGTCAATCCAGACTCTGAAGAACTTTTCTCAGACAATGAGAATAATTTT GTCTTCCAAGTAGCTAATGAAAGGAATAATCTTGCTTTAGGAAATACTAAGGAACTTCATGAAACAGAC TTGACTTGTGTAAACGAACCCATTTTCAAGAACTCTACCATGGTTTTATATGGAGACACAGGTGATAAA CAAGCAACCCAAGTGTCAATTAAAAAAGATTTGGTTTATGTTCTTGCAGAGGAGAACAAAAATAGTGTA AAGCAGCATATAAAAATGACTCTAGGTCAAGATTTAAAATCGGACATCTCCTTGAATATAGATAAAATA CCAGAAAAAAATAATGATTACATGAACAAATGGGCAGGACTCTTAGGTCCAATTTCAAATCACAGTTTT GGAGGTAGCTTCAGAACAGCTTCAAATAAGGAAATCAAGCTCTCTGAACATAACATTAAGAAGAGCAAA ATGTTCTTCAAAGATATTGAAGAACAATATCCTACTAGTTTAGCTTGTGTTGAAATTGTAAATACCTTG GCATTAGATAATCAAAAGAAACTGAGCAAGCCTCAGTCAATTAATACTGTATCTGCACATTTACAGAGT AGTGTAGTTGTTTCTGATTGTAAAAATAGTCATATAACCCCTCAGATGTTATTTTCCAAGCAGGATTTT AATTCAAACCATAATTTAACACCTAGCCAAAAGGCAGAAATTACAGAACTTTCTACTATATTAGAAGAA TCAGGAAGTCAGTTTGAATTTACTCAGTTTAGAAAACCAAGCTACATATTGCAGAAGAGTACATTTGAA GTGCCTGAAAACCAGATGACTATCTTAAAGACCACTTCTGAGGAATGCAGAGATGCTGATCTTCATGTC ATAATGAATGCCCCATCGATTGGTCAGGTAGACAGCAGCAAGCAATTTGAAGGTACAGTTGAAATTAAA CGGAAGTTTGCTGGCCTGTTGAAAAATGACTGTAACAAAAGTGCTTCTGGTTATTTAACAGATGAAAAT GAAGTGGGGTTTAGGGGCTTTTATTCTGCTCATGGCACAAAACTGAATGTTTCTACTGAAGCTCTGCAA AAAGCTGTGAAACTGTTTAGTGATATTGAGAATATTAGTGAGGAAACTTCTGCAGAGGTACATCCAATA AGTTTATCTTCAAGTAAATGTCATGATTCTGTTGTTTCAATGTTTAAGATAGAAAATCATAATGATAAA ACTGTAAGTGAAAAAAATAATAAATGCCAACTGATATTACAAAATAATATTGAAATGACTACTGGCACT TTTGTTGAAGAAATTACTGAAAATTACAAGAGAAATACTGAAAATGAAGATAACAAATATACTGCTGCC AGTAGAAATTCTCATAACTTAGAATTTGATGGCAGTGATTCAAGTAAAAATGATACTGTTTGTATTCAT AAAGATGAAACGGACTTGCTATTTACTGATCAGCACAACATATGTCTTAAATTATCTGGCCAGTTTATG AAGGAGGGAAACACTCAGATTAAAGAAGATTTGTCAGATTTAACTTTTTTGGAAGTTGCGAAAGCTCAA GAAGCATGTCATGGTAATACTTCAAATAAAGAACAGTTAACTGCTACTAAAACGGAGCAAAATATAAAA GATTTTGAGACTTCTGATACATTTTTTCAGACTGCAAGTGGGAAAAATATTAGTGTCGCCAAAGAGTCA TTTAATAAAATTGTAAATTTCTTTGATCAGAAACCAGAAGAATTGCATAACTTTTCCTTAAATTCTGAA TTACATTCTGACATAAGAAAGAACAAAATGGACATTCTAAGTTATGAGGAAACAGACATAGTTAAACAC AAAATACTGAAAGAAAGTGTCCCAGTTGGTACTGGAAATCAACTAGTGACCTTCCAGGGACAACCCGAA CGTGATGAAAAGATCAAAGAACCTACTCTGTTGGGTTTTCATACAGCTAGCGGGAAAAAAGTTAAAATT GCAAAGGAATCTTTGGACAAAGTGAAAAACCTTTTTGATGAAAAAGAGCAAGGTACTAGTGAAATCACC AGTTTTAGCCATCAATGGGCAAAGACCCTAAAGTACAGAGAGGCCTGTAAAGACCTTGAATTAGCATGT GAGACCATTGAGATCACAGCTGCCCCAAAGTGTAAAGAAATGCAGAATTCTCTCAATAATGATAAAAAC CTTGTTTCTATTGAGACTGTGGTGCCACCTAAGCTCTTAAGTGATAATTTATGTAGACAAACTGAAAAT CTCAAAACATCAAAAAGTATCTTTTTGAAAGTTAAAGTACATGAAAATGTAGAAAAAGAAACAGCAAAA AGTCCTGCAACTTGTTACACAAATCAGTCCCCTTATTCAGTCATTGAAAATTCAGCCTTAGCTTTTTAC ACAAGTTGTAGTAGAAAAACTTCTGTGAGTCAGACTTCATTACTTGAAGCAAAAAAATGGCTTAGAGAA GGAATATTTGATGGTCAACCAGAAAGAATAAATACTGCAGATTATGTAGGAAATTATTTGTATGAAAAT AATTCAΆΆCAGTACTATAGCTGAAAATGACAAAAATCATCTCTCCGAAAAACAAGATACTTATTTAAGT AACAGTAGCATGTCTAACAGCTATTCCTACCATTCTGATGAGGTATATAATGATTCAGGATATCTCTCA AAAAATAAACTTGATTCTGGTATTGAGCCAGTATTGAAGAATGTTGAAGATCAAAAAAACACTAGTTTT TCCAAAGTAATATCCAATGTAAAAGATGCAAATGCATACCCACAAACTGTAAATGAAGATATTTGCGTT GAGGAACTTGTGACTAGCTCTTCACCCTGCAAAAATAAAAATGCAGCCATTAAATTGTCCATATCTAAT AGTAATAATTTTGAGGTAGGGCCACCTGCATTTAGGATAGCCAGTGGTAAAATCGTTTGTGTTTCACAT GAAACAATTAAAAAAGTGAAAGACATATTTACAGACAGTTTCAGTAAAGTAATTAAGGAAAACAACGAG AATAAATCAAAAATTTGCCAAACGAAAATTATGGCAGGTTGTTACGAGGCATTGGATGATTCAGAGGAT ATTCTTCATAACTCTCTAGATAATGATGAATGTAGCACGCATTCACATAAGGTTTTTGCTGACATTCAG AGTGAAGAAATTTTACAACATAACCAAAATATGTCTGGATTGGAGAAAGTTTCTAAAATATCACCTTGT GATGTTAGTTTGGAAACTTCAGATATATGTAAATGTAGTATAGGGAAGCTTCATAAGTCAGTCTCATCT GCAAATACTTGTGGGATTTTTAGCACAGCAAGTGGAAAATCTGTCCAGGTATCAGATGCTTCATTACAA AACGCAAGACAAGTGTTTTCTGAAATAGAAGATAGTACCAAGCAAGTCTTTTCCAAAGTATTGTTTAAA AGTAACGAACATTCAGACCAGCTCACAAGAGAAGAAAATACTGCTATACGTACTCCAGAACATTTAATA TCCCAAAAAGGCTTTTCATATAATGTGGTAAATTCATCTGCTTTCTCTGGATTTAGTACAGCAAGTGGA AAGCAAGTTTCCATTTTAGAAAGTTCCTTACACAAAGTTAAGGGAGTGTTAGAGGAATTTGATTTAATC AGAACTGAGCATAGTCTTCACTATTCACCTACGTCTAGACAAAATGTATCAAAAATACTTCCTCGTGTT GATAAGAGAAACCCAGAGCACTGTGTAAACTCAGAAATGGAAAAAACCTGCAGTAAAGAATTTAAATTA TCAAATAACTTAAATGTTGAAGGTGGTTCTTCAGAAAATAATCACTCTATTAAAGTTTCTCCATATCTC TCTCAATTTCAACAAGACAAACAACAGTTGGTATTAGGAACCAAAGTCTCACTTGTTGAGAACATTCAT GTTTTGGGAAAAGAACAGGCTTCACCTAAAAACGTAAAAATGGAAATTGGTAAAACTGAAACTTTTTCT GATGTTCCTGTGAAAACAAATATAGAAGTTTGTTCTACTTACTCCAAAGATTCAGAAAACTACTTTGAA ACAGAAGCAGTAGAAATTGCTAAAGCTTTTATGGAAGATGATGAACTGACAGATTCTAAACTGCCAAGT CATGCCACACATTCTCTTTTTACATGTCCCGAAAATGAGGAAATGGTTTTGTCAAATTCAAGAATTGGA AAAAGAAGAGGAGAGCCCCTTATCTTAGTGGGAGAACCCTCAATCAAAAGAAACTTATTAAATGAATTT GACAGGATAATAGAAAATCAAGAAAAATCCTTAAAGGCTTCAAAAAGCACTCCAGATGGCACAATAAAA GATCGAAGATTGTTTATGCATCATGTTTCTTTAGAGCCGATTACCTGTGTACCCTTTCGCACAACTAAG GAACGTCAAGAGATACAGAATCCAAATTTTACCGCACCTGGTCAAGAATTTCTGTCTAAATCTCATTTG TATGAACATCTGACTTTGGAAAAATCTTCAAGCAATTTAGCAGTTTCAGGACATCCATTTTATCAAGTT TCTGCTACAAGAAATGAAAAAATGAGACACTTGATTACTACAGGCAGACCAACCAAAGTCTTTGTTCCA CCTTTTAAAACTAAATCACATTTTCACAGAGTTGAACAGTGTGTTAGGAATATTAACTTGGAGGAAAAC AGACAAAAGCAAAACATTGATGGACATGGCTCTGATGATAGTAAAAATAAGATTAATGACAATGAGATT CATCAGTTTAACAAAAACAACTCCAATCAAGCAGCAGCTGTAACTTTCACAAAGTGTGAAGAAGAACCT TTAGATTTAATTACAAGTCTTCAGAATGCCAGAGATATACAGGATATGCGAATTAAGAAGAAACAAAGG CAACGCGTCTTTCCACAGCCAGGCAGTCTGTATCTTGCAAAAACATCCACTCTGCCTCGAATCTCTCTG AAAGCAGCAGTAGGAGGCCAAGTTCCCTCTGCGTGTTCTCATAAACAGCTGTATACGTATGGCGTTTCT AAACATTGCATAAAAATTAACAGCAAAAATGCAGAGTCTTTTCAGTTTCACACTGAAGATTATTTTGGT AAGGAAAGTTTATGGACTGGAAAAGGAATACAGTTGGCTGATGGTGGATGGCTCATACCCTCCAATGAT GGAAAGGCTGGAAAAGAAGAATTTTATAGGGCTCTGTGTGACACTCCAGGTGTGGATCCAAAGCTTATT TCTAGAATTTGGGTTTATAATCACTATAGATGGATCATATGGAAACTGGCAGCTATGGAATGTGCCTTT CCTAAGGAATTTGCTAATAGATGCCTAAGCCCAGAAAGGGTGCTTCTTCAACTAAAATACAGATATGAT ACGGAAATTGATAGAAGCAGAAGATCGGCTATAAAAAAGATAATGGAAAGGGATGACACAGCTGCAAAA ACACTTGTTCTCTGTGTTTCTGACATAATTTCATTGAGCGCAAATATATCTGAAACTTCTAGCAATAAA ACTAGTAGTGCAGATACCCAAAAAGTGGCCATTATTGAACTTACAGATGGGTGGTATGCTGTTAAGGCC CAGTTAGATCCTCCCCTCTTAGCTGTCTTAAAGAATGGCAGACTGACAGTTGGTCAGAAGATTATTCTT CATGGAGCAGAACTGGTGGGCTCTCCTGATGCCTGTACACCTCTTGAAGCCCCAGAATCTCTTATGTTA AAGATTTCTGCTAACAGTACTCGGCCTGCTCGCTGGTATACCAAACTTGGATTCTTTCCTGACCCTAGA CCTTTTCCTCTGCCCTTATCATCGCTTTTCAGTGATGGAGGAAATGTTGGTTGTGTTGATGTAATTATT CAAAGAGCATACCCTATACAGTGGATGGAGAAGACATCATCTGGATTATACATATTTCGCAATGAAAGA GAGGAAGAAAAGGAAGCAGCAAAATATGTGGAGGCCCAACAAAAGAGACTAGAAGCCTTATTCACTAAA ATTCAGGAGGAATTTGAAGAACATGAAGAAAACACAACAAAACCATATTTACCATCACGTGCACTAACA AGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCAGCAGACCCA GCTTACCTTGAGGGTTATTTCAGTGAAGAGCAGTTAAGAGCCTTGAATAATCACAGGCAAATGTTGAAT GATAAGAAACAAGCTCAGATCCAGTTGGAAATTAGGAAGGCCATGGAATCTGCTGAACAAAAGGAACAA GGTTTATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGAT TCAGTTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATAC AGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCG ACAAAAAAAACTCAGTATCAACAACTACCGGTTTCAGATGAAATTTTATTTCAGATTTACCAGCCACGG GAGCCCCTTCACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGAGGTGGACCTAATA GGATTTGTCGTTTCTGTTGTGAAAAAAACAGGACTTGCCCCTTTCGTCTATTTGTCAGACGAATGTTAC AATTTACTGGCAATAAAGTTTTGGATAGACCTTAATGAGGACATTATTAAGCCTCATATGTTAATTGCT GCAAGCAACCTCCAGTGGCGACCAGAATCCAAATCAGGCCTTCTTACTTTATTTGCTGGAGATTTTTCT GTGTTTTCTGCTAGTCCAAAAGAGGGCCACTTTCAAGAGACATTCAACAAAATGAAAAATACTGTTGAG AATATTGACATACTTTGCAATGAAGCAGAAAACAAGCTTATGCATATACTGCATGCAAATGATCCCAAG TGGTCCACCCCAACTAAAGACTGTACTTCAGGGCCGTACACTGCTCAAATCATTCCTGGTACAGGAAAC AAGCTTCTGATGTCTTCTCCTAATTGTGAGATATATTATCAAAGTCCTTTATCACTTTGTATGGCCAAA AGGAAGTCTGTTTCCACACCTGTCTCAGCCCAGATGACTTCAAAGTCTTGTAAAGGGGAGAAAGAGATT GATGACCAAAAGAACTGCAAAAAGAGAAGAGCCTTGGATTTCTTGAGTAGACTGCCTTTACCTCCACCT GTTAGTCCCATTTGTACATTTGTTTCTCCGGCTGCACAGAAGGCATTTCAGCCACCAAGGAGTTGTGGC ACCAAATACGAAACACCCATAAAGAAAAAAGAACTGAATTCTCCTCAGATGACTCCATTTAAAAAATTC AATGAAATTTCTCTTTTGGAAAGTAATTCAATAGCTGACGAAGAACTTGCATTGATAAATACCCAAGCT CTTTTGTCTGGTTCAACAGGAGAAAAACAATTTATATCTGTCAGTGAATCCACTAGGACTGCTCCCACC AGTTCAGAAGATTATCTCAGACTGAAACGACGTTGTACTACATCTCTGATCAAAGAACAGGAGAGTTCC CAGGCCAGTACGGAAGAATGTGAGAAAAATAAGCAGGACACAATTACAACTAAAAAATATATCTAAGCA TTTGCAAAGGCGACAATAAATTATTGACGCTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAA ACCACACATTAGTACTTATGTTGCACAATGAGAAAAGAAATTAGTTTCAAATTTACCTCAGCGTTTGTG TATCGGGCAAAAATCGTTTTGCCCGATTCCGTATTGGTATACTTTTGCTTCAGTTGCATATCTTAAAAC TAAATGTAATTTATTAACTAATCAAGAAAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCC CAACACTTTGAGAAGCTGAGGTGGGAGGAGTGCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACAT AGGGAGACCCCCATCTTTACGAAGAAAAAAAAAAAGGGGAAAAGAAAATCTTTTAAATCTTTGGATTTG ATCACTACAAGTATTATTTTACAATCAACAAAATGGTCATCCAAACTCAAACTTGAGAAAATATCTTGC TTTCAAATTGACACTA

HUMAN P-CADHERIN POLYNUCLEOTIDE SEQUENCE (SEQ ID NO: 12) GGCTAGCGCGGGAGGTGGAGAAAGAGGCTTGGGCGGCCCCGCTGTAGCCGCGTGTGGGAGGACGCACGG GCCTGCTTCAAAGCTTTGGGATAACAGCGCCTCCGGGGGATAATGAATGCGGAGCCTCCGTTTTCAGTC GACTTCAGATGTGTCTCCACTTTTTTCCGCTGTAGCCGCAAGGCAAGGAAACATTTCTCTTCCCGTACT GAGGAGGCTGAGGAGTGCACTGGGTGTTCTTTTCTCCTCTAACCCAGAACTGCGAGACAGAGGCTGAGT CCCTGTAAAGAACAGCTCCAGAAAAGCCAGGAGAGCGCAGGAGGGCATCCGGGAGGCCAGGAGGGGTTC GCTGGGGCCTCAACCGCACCCACATCGGTCCCACCTGCGAGGGGGCGGGACCTCGTGGCGCTGGACCAA TCAGCACCCACCTGCGCTCACCTGGCCTCCTCCCGCTGGCTCCCGGGGGCTGCGGTGCTCAAAGGGGCA AGAGCTGAGCGGAACACCGGCCCGCCGTCGCGGCAGCTGCTTCACCCCTCTCTCTGCAGCCATGGGGCT CCCTCGTGGACCTCTCGCGTCTCTCCTCCTTCTCCAGGTTTGCTGGCTGCAGTGCGCGGCCTCCGAGCC GTGCCGGGCGGTCTTCAGGGAGGCTGAAGTGACCTTGGAGGCGGGAGGCGCGGAGCAGGAGCCCGGCCA GGCGCTGGGGAAAGTATTCATGGGCTGCCCTGGGCAAGAGCCAGCTCTGTTTAGCACTGATAATGATGA CTTCACTGTGCGGAATGGCGAGACAGTCCAGGAAAGAAGGTCACTGAAGGAAAGGAATCCATTGAAGAT CTTCCCATCCAAACGTATCTTACGAAGACACAAGAGAGATTGGGTGGTTGCTCCAATATCTGTCCCTGA AAATGGCAAGGGTCCCTTCCCCCAGAGACTGAATCAGCTCAAGTCTAATAAAGATAGAGACACCAAGAT TTTCTACAGCATCACGGGGCCGGGGGCAGACAGCCCCCCTGAGGGTGTCTTCGCTGTAGAGAAGGAGAC AGGCTGGTTGTTGTTGAATAAGCCACTGGACCGGGAGGAGATTGCCAAGTATGAGCTCTTTGGCCACGC TGTGTCAGAGAATGGTGCCTCAGTGGAGGACCCCATGAACATCTCCATCATAGTGACCGACCAGAATGA CCACAAGCCCAAGTTTACCCAGGACACCTTCCGAGGGAGTGTCTTAGAGGGAGTCCTACCAGGTACTTC TGTGATGCAGATGACAGCCACAGATGAGGATGATGCCATCTACACCTACAATGGGGTGGTTGCTTACTC CATCCATAGCCAAGAACCAAAGGACCCACACGACCTCATGTTCACAATTCACCGGAGCACAGGCACCAT CAGCGTCATCTCCAGTGGCCTGGACCGGGAAAAAGTCCCTGAGTACACACTGACCATCCAGGCCACAGA CATGGATGGGGACGGCTCCACCACCACGGCAGTGGCAGTAGTGGAGATCCTTGATGCCAATGACAATGC TCCCATGTTTGACCCCCAGAAGTACGAGGCCCATGTGCCTGAGAATGCAGTGGGCCATGAGGTGCAGAG GCTGACGGTCACTGATCTGGACGCCCCCAACTCACCAGCGTGGCGTGCCACCTACCTTATCATGGGCGG TGACGACGGGGACCATTTTACCATCACCACCCACCCTGAGAGCAACCAGGGCATCCTGACAACCAGGAA GGGTTTGGATTTTGAGGCCAAAAACCAGCACACCCTGTACGTTGAAGTGACCAACGAGGCCCCTTTTGT GCTGAAGCTCCCAACCTCCACAGCCACCATAGTGGTCCACGTGGAGGATGTGAATGAGGCACCTGTGTT TGTCCCACCCTCCAAAGTCGTTGAGGTCCAGGAGGGCATCCCCACTGGGGAGCCTGTGTGTGTCTACAC TGCAGAAGACCCTGACAAGGAGAATCAAAAGATCAGCTACCGCATCCTGAGAGACCCAGCAGGGTGGCT AGCCATGGACCCAGACAGTGGGCAGGTCACAGCTGTGGGCACCCTCGACCGTGAGGATGAGCAGTTTGT GAGGAACAACATCTATGAAGTCATGGTCTTGGCCATGGACAATGGAAGCCCTCCCACCACTGGCACGGG AACCCTTCTGCTAACACTGATTGATGTCAACGACCATGGCCCAGTCCCTGAGCCCCGTCAGATCACCAT CTGCAACCAAAGCCCTGTGCGCCAGGTGCTGAACATCACGGACAAGGACCTGTCTCCCCACACCTCCCC TTTCCAGGCCCAGCTCACAGATGACTCAGACATCTACTGGACGGCAGAGGTCAACGAGGAAGGTGACAC AGTGGTCTTGTCCCTGAAGAAGTTCCTGAAGCAGGATACATATGACGTGCACCTTTCTCTGTCTGACCA TGGCAACAAAGAGCAGCTGACGGTGATCAGGGCCACTGTGTGCGACTGCCATGGCCATGTCGAAACCTG CCCTGGACCCTGGAAAGGAGGTTTCATCCTCCCTGTGCTGGGGGCTGTCCTGGCTCTGCTGTTCCTCCT GCTGGTGCTGCTTTTGTTGGTGAGAAAGAAGCGGAAGATCAAGGAGCCCCTCCTACTCCCAGAAGATGA CACCCGTGACAACGTCTTCTACTATGGCGAAGAGGGGGGTGGCGAAGAGGACCAGGACTATGACATCAC CCAGCTCCACCGAGGTCTGGAGGCCAGGCCGGAGGTGGTTCTCCGCAATGACGTGGCACCAACCATCAT CCCGACACCCATGTACCGTCCTAGGCCAGCCAACCCAGATGAAATCGGCAACTTTATAATTGAGAACCT GAAGGCGGCTAACACAGACCCCACAGCCCCGCCCTACGACACCCTCTTGGTGTTCGACTATGAGGGCAG CGGCTCCGACGCCGCGTCCCTGAGCTCCCTCACCTCCTCCGCCTCCGACCAAGACCAAGATTACGATTA TCTGAACGAGTGGGGCAGCCGCTTCAAGAAGCTGGCAGACATGTACGGTGGCGGGGAGGACGACTAGGC GGCCTGCCTGCAGGGCTGGGGACCAAACGTCAGGCCACAGAGCATCTCCAAGGGGTCTCAGTTCCCCCT TCAGCTGAGGACTTCGGAGCTTGTCAGGAAGTGGCCGTAGCAACTTGGCGGAGACAGGCTATGAGTCTG ACGTTAGAGTGGTTGCTTCCTTAGCCTTTCAGGATGGAGGAATGTGGGCAGTTTGACTTCAGCACTGAA AACCTCTCCACCTGGGCCAGGGTTGCCTCAGAGGCCAAGTTTCCAGAAGCCTCTTACCTGCCGTAAAAT GCTCAACCCTGTGTCCTGGGCCTGGGCCTGCTGTGACTGACCTACAGTGGACTTTCTCTCTGGAATGGA ACCTTCTTAGGCCTCCTGGTGCAACTTAATTTTTTTTTTTAATGCTATCTTCAAAACGTTAGAGAAAGT TCTTCAAAAGTGCAGCCCAGAGCTGCTGGGCCCACTGGCCGTCCTGCATTTCTGGTTTCCAGACCCCAA TGCCTCCCATTCGGATGGATCTCTGCGTTTTTATACTGAGTGTGCCTAGGTTGCCCCTTATTTTTTATT TTCCCTGTTGCGTTGCTATAGATGAAGGGTGAGGACAATCGTGTATATGTACTAGAACTTTTTTATTAA AGAAACTTTTCCC

TABLE 2: Distribution of tumor subtypes in three breast cancer cohorts across groups defined solely by ESRl level

ESRl, ERBB2, and GRB7 values were downloaded for each tumor. We defined HER-2 ampHfied tumors as those that had high expression levels of both ERBB2 and GRB7. Because we did not use ESRl expression levels to define HER-2 or BRCAl tumors, they are not included in these tables. The remaining tumors were divided into four groups based on the level of ESRl, where thresholds were determined relative to each data set, and the number of samples in each of the subtypes defined by the study authors was counted. For each study, 100% of those tumors that were identified as either "Basal" or "Basal 1" feE into the lowest ESRl range. In the SørHe classified data, over 90% of the Luminal A tumors are found in top two ESRl groups. The largest group of "Unknown" or non-classified tumors consistentiy feE in the middle ranges of ESRl expression.

Sørlie classification of set of 84 sporadic tumors without ERBB2 amplification* in van't Veer data.

Sørlie classification of set of 97 sporadic without ERBB2 amplification and 6 non-carcinomas^c

Sortiriou classification of 85 sporadic tumors without ERBB2 amplification .

" Grouping in these tables is such that the first group at the upper left of the charts (shaded black) as strong ESRl positive, with the second group below it as moderate, the third group as weak positive, and the fourth group as ESRl negative. Finally, groups with "Unknown" or non-classified tumors are listed as such. van't Veer data: 78 training samples + 19 test samples - 14 ERBB2 amplified, ratio values are log₁₀. ^cSørlie data: 115 tumors + 7 non malignant tissues — 18 ERBB2 amplified, ratio values are log₂. ^d Sortiriou data: 99 tumors - 14 ERBB2 amplified, ratio values are log₂. ^e Distribution for tumors classified as ERBB2 by the study authors, but not amplified for ERBB2 according to our criteria.

TABLE 3: Prognosis of 97 Sporadic Tumors by Subtype in the van't Neer Study.

The 97 patients with sporadic tumors in this cohort had invasive breast tumors less than 5 cm (TI or T2), no axiEary metastases (Ν0) and were diagnosed before the age of 55 years. Five patients received adjuvant systemic therapy. FoEow-up time in the study was at least 5 years. These 97 samples include the 78 used for a teaining set and the 19 tumors used for testing their prognosis classified. ESRl negative and ERBB2 positive subgroups were associated with the poorest prognosis (69% and 60% respectively). The ESRl weakly positive subtype has the best prognosis (68%), and there is a trend toward worse prognosis witli increasing ESRl levels

^a Good prognosis is defined as no distant metastasis in > 5 years * Poor prognosis is defined as distant metastasis in < 5 years ⁰ Tumor groups are defined as described as above.

Claims

CLAIMS:

1. A method of exaiiώiing a test biological sample comprising a human breast ceE for evidence of altered ceE growth that is indicative of a breast cancer, the method comprising evaluating the levels of orphan receptor tyrosine kinase (RORl) polynucleotides that encode the RORl polypeptide shown in SEQ ID NO: 2 in the biological sample, wherein an increase in the levels of the RORl polynucleotides in the test sample relative to a normal breast tissue sample provide evidence of altered ceE growtii that is indicative of a breast cancer; and wherein the levels of the RORl polynucleotides in the ceE are evaluated by contacting the sample with a RORl complementary polynucleotide that hybridizes to a RORl nucleotide sequence shown in SEQ ID NO: 1, or a complement thereof, and evaluating the presence of a hybridization complex formed by the hybridization of the RORl complementary polynucleotide Λvith the RORl polynucleotides in the test biological sample.

2. The method of claim 1, wherein the RORl complementary polynucleotide is labeEed with a detectable marker.

3. The method of claim 1, wherein the presence of the hybridization complex is evaluated by Northern analysis.

4. The method of clakn 1, wherein the RORl complementary polynucleotide comprises a primer for use in a polymerase chain reaction.

5. The method of claim 1, wherein the presence of a hybridization complex is evaluated by polymerase chain reaction.

6. The method of claim 1, wherein the RORl polynucleotides that are examined in the test sample are mRNA.

7. The method of claim 1, further comprising examining the expression of Her-2 (SEQ ID NO: 3), EGFR (SEQ ID NO: 4), VEGF (SEQ ID NO: 5), FMS-like tyrosine kinase (SEQ ID NO: 6), MYC (SEQ ID NO: 7), urokinase plasminogen activator (SEQ ID NO: 8), plasminogen activator inhibitor (SEQ ID NO: 9), BRCAl (SEQ ID NO: 10) or BRCA2 (SEQ ID NO: 11) polynucleotides in the test biological sample.

8. The method of claim 1, wherein the breast cancer is of the basal subtype.

9. The method of claim 1, wherein the breast cancer is of the BRCA 1 subtype.

10. A method of examining a test biological sample comprising a human breast ceE for evidence of altered ceE growth that is indicative of a breast cancer, the method comprising evaluating the levels of orphan receptor tyrosine kinase (RORl) polypeptides having the sequence shown in SEQ ID NO: 2 in the biological sample, wherein an increase in tlie levels of the RORl polypeptides in the test sample relative to a normal breast tissue sample provide evidence of altered ceE growth that is indicative of a breast cancer; and wherein the levels of the RORl polypeptides in the ceE are evaluated by contacting the sample with an antibody that immunospecificaEy binds to a RORl polypeptide sequence shown in SEQ ID NO: 2 and evaluating the presence of a complex formed by the binding of the antibody with the RORl polypeptides in the sample.

11. The method of claim 10, wherein the presence of a complex is evaluated by a method selected from the group consisting of ELISA analysis, Western analysis and iirLtnunohistochemistry.

12. The method of claim 10, wherein the antibody that immunospecificaEy binds to a RORl polypeptide sequence shown in SEQ ID NO: 2 is labeEed with a detectable marker.

13. The method of claim 10, further comprising examining the expression of Her-2 (SEQ ID NO: 3), EGFR (SEQ ID NO: 4), VEGF (SEQ ID NO: 5), FMS-like tyrosine kinase (SEQ ID NO: 6), MYC (SEQ ID NO: 7), urokinase plasminogen activator (SEQ ID NO: 8), plasminogen activator inhibitor (SEQ ID NO: 9), BRCAl (SEQ ID NO: 10) or BRCA2 (SEQ ID NO: 11) mRNA in tlie test biological sample.

14. The method of claim 10, wherein the breast cancer is of the basal subtype.

15. The method of claim 10, wherein the breast cancer is of the BRCA 1 subtype.

16. A metiiod of examining a test human ceE for evidence of a chromosomal abnormaHty that is indicative of a human cancer, the method comprising: comparing orphan receptor tyrosine kinase (RORl) polynucleotide sequences from band p31 of chromosome 1 in a normal ceE to RORl polynucleotide sequences from band p31 of chromosome 1, band p31 on chromosome 1 in the test human ceE to identify an amplification or an alteration of the RORl polynucleotide sequences in the test human ceE, wherein an ampHfication or an alteration of the RORl polynucleotide sequences in the test human ceE provides evidence of a chromosomal abnormaHty that is indicative of a human cancer; and wherein chromosome 1, band p31 in the test human ceE is evaluated by contacting the RORl polynucleotide sequences in the test human ceE sample with a RORl complementary polynucleotide that specificaEy hybridizes to a RORl nucleotide sequence shown in SEQ ID NO: 1, or a complement thereof, and evaluating the presence of a hybridization complex formed by the hybridization of the RORl complementary polynucleotide with the RORl polynucleotide sequences in the test human ceE.

17. The method of claim 16, wherein tl e presence of the hybridization complex is evaluated by Northern analysis, Southern analysis or polymerase chain reaction analysis.

18. The method of claim 16, wherein the cancer is breast cancer.

19. The method of claim 18, wherein the breast cancer is of tlie basal subtype.

20. The method of claim 18, wherein the breast cancer is of the BRCA 1 subtype.

21. A kit comprising: a container, a label on said container, and a composition contained within said container; wherein the composition includes a RORl specific antibody and/ or a polynucleotide that hybridizes to a complement of ti e RORl polynucleotide shown in SEQ ID NO: 1 under stringent conditions, the label on said container indicates that the composition can be used to evaluate the presence of RORl protein, RNA or DNA in at least one type of mammaHan ceE, and instructions for using the RORl antibody and/ or polynucleotide for evaluating the presence of RORl protein, RNA or DNA in at least one type of mammaHan ceE.