WO2005100356A1 - Inhibitors of akt activity - Google Patents

Inhibitors of akt activity Download PDF

Info

Publication number
WO2005100356A1
WO2005100356A1 PCT/US2005/011561 US2005011561W WO2005100356A1 WO 2005100356 A1 WO2005100356 A1 WO 2005100356A1 US 2005011561 W US2005011561 W US 2005011561W WO 2005100356 A1 WO2005100356 A1 WO 2005100356A1
Authority
WO
WIPO (PCT)
Prior art keywords
phenyl
amino
methyl
naphthyridin
benzyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/011561
Other languages
French (fr)
Inventor
Mark T. Bilodeau
Chixu Chen
Nicholas D. P. Cosford
Brian W. Eastman
John C. Hartnett
Essa H. Hu
Peter J. Manley
Lou Anne Neilson
Lida R. Tehrani
Zhicai Wu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Merck and Co Inc
Original Assignee
Merck and Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck and Co Inc filed Critical Merck and Co Inc
Priority to JP2007507448A priority Critical patent/JP2007532551A/en
Priority to US11/547,113 priority patent/US7750151B2/en
Priority to EP05732864A priority patent/EP1737861A4/en
Priority to AU2005233569A priority patent/AU2005233569B2/en
Priority to CA002561315A priority patent/CA2561315A1/en
Publication of WO2005100356A1 publication Critical patent/WO2005100356A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04Ortho-condensed systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D519/00Heterocyclic compounds containing more than one system of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring system not provided for in groups C07D453/00 or C07D455/00

Definitions

  • the present invention relates to compounds which contain substituted napthyridines that are inhibitors of the activity of one or more of the isoforms of the serine/threonine kinase, Akt (also known as PKB; hereinafter referred to as "Akt").
  • Akt serine/threonine kinase
  • the present invention also relates to pharmaceutical compositions comprising such compounds and methods of using the instant compounds in the treatment of cancer.
  • Apoptosis (programmed cell death) plays essential roles in embryonic development and pathogenesis of. various diseases, such as degenerative neuronal diseases, cardiovascular diseases and cancer. Recent work has led to the identification of various pro- and anti-apoptotic gene products that are involved in the regulation or execution of programmed cell death.
  • anti-apoptotic genes such as Bcl2 or Bcl-x L
  • Bcl2 or Bcl-x L inhibits apoptotic cell death induced by various stimuli.
  • pro-apoptotic genes such as Bax or Bad
  • the execution of programmed cell death is mediated by caspase-1 related proteinases, including caspase-3, caspase-7, caspase-8 and caspase-9 etc (Thornberry et al. Science, 281: 1312-1316 (1998)).
  • PI3K phosphatidylinositol 3'-OH kinase
  • Akt phosphatidylinositol 3'-OH kinase
  • PDGF platelet derived growth factor
  • NEF nerve growth factor
  • IGF-1 insulin-like growth factor-1
  • PI3K phosphatidylinositol (3,4,5)-triphosphate
  • Ptdlns (3,4,5)-P3 phosphatidylinositol (3,4,5)-triphosphate
  • Akt serine/threonine kinase
  • PH pleckstrin homology
  • Aktl Akt2/PKB ⁇
  • Akt3/PKBy Akt3/PKBy
  • Akts are activated by phosphorylation events occurring in response to PI3K signaling.
  • PI3K phosphorylates membrane inositol phospholipids, generating the second messengers phosphatidyl-inositol 3,4,5-trisphosphate and phosphatidylinositol 3,4-bisphosphate, which have been shown to bind to the PH domain of Akt.
  • the current model of Akt activation proposes recruitment of the enzyme to the membrane by 3'-phosphorylated phosphoinositides, where phosphorylation of the regulatory sites of Akt by the upstream kinases occurs (B.A. Hemmings, Science 275:628-630 (1997); B.A.
  • PDK1 phosphorylates not only Akt, but also p70 ribosomal S6 kinase, p90RSK, serum and glucocorticoid-regulated kinase (SGK), and protein kinase C.
  • the upstream kinase phosphorylating the regulatory site of Akt near the carboxy terminus has not been identified yet, but recent reports imply a role for the integrin-linked kinase (ILK-1), a serine/threonine protein kinase, or autophosphorylation.
  • ILK-1 integrin-linked kinase
  • Akt2 is overexpressed in a significant number of ovarian (J. Q. Cheng et al. Proc. Natl.
  • Akt3 was found to be overexpressed in breast and prostate cancer cell lines (Nakatani et al. J. Biol. Chem. 274:21528-21532 (1999).
  • the tumor suppressor PTEN a protein and lipid phosphatase that specifically removes the 3' phosphate of Ptdlns(3,4,5)-P3, is a negative regulator of the PI3K/Akt pathway (Li et al.
  • Germline mutations of PTEN are responsible for human cancer syndromes such as Cowden disease (Liaw et al. Nature Genetics 16:64-67 (1997)). PTEN is deleted in a large percentage of human tumors and tumor cell lines without functional PTEN show elevated levels of activated Akt (Li et al. supra, Guldberg et al. Cancer Research 57:3660-3663 (1997), Risinger et al. Cancer Research 57:4736-4738 (1997)).
  • Akt Akt activation and activity
  • inhibitors such as LY294002 and wortmannin.
  • PI3K inhibition has the potential to indiscriminately affect not just all three Akt isozymes but also other PH domain-containing signaling molecules that are dependent on Pdtlns(3,4,5)-P3, such as the Tec family of tyrosine kinases.
  • Akt can be activated by growth signals that are independent of PI3K.
  • Akt activity can be inhibited by blocking the activity of the upstream kinase PDKl.
  • No specific PDKl inhibitors have been disclosed. Again, inhibition of PDKl would result in inhibition of multiple protein kinases whose activities depend on PDKl, such as atypical PKC isoforms, SGK, and S6 kinases (Williams et al. Curr. Biol. 10:439-448 (2000)).
  • pharmaceutical compositions that comprise the novel compounds that are inhibitors of Akt.
  • It is also an object of the present invention to provide a method for treating cancer that comprises administering such inhibitors of Akt activity.
  • the instant invention provides for compounds which comprise substituted napthyridines that inhibit Akt activity.
  • the compounds disclosed selectively inhibit one or two of the Akt isoforms.
  • the invention also provides for compositions comprising such inhibitory compounds and methods of inhibiting Akt activity by administering the compound to a patient in need of treatment of cancer.
  • the compounds of the instant invention are useful in the inhibition of the activity of the serine/threonine kinase Akt.
  • the inhibitors of Akt activity are illustrated by the Formula A:
  • a second embodiment of the instant invention is a compound as illustrated by Formula A, wherein: Rl is selected from: NH2, halogen, OH, oxo, CN, phenyl, heterocyclyl, CO2H, C(0)H, said alkyl, phenyl and heterocyclyl are optionally substituted with one or more substituents selected from Rz'; all other substituents and variables are as defined in the first embodiment; or a pharmaceutically acceptable salt or stereoisomer thereof.
  • Rl is selected from: NH2, halogen, OH, oxo, CN, phenyl, heterocyclyl, CO2H, C(0)H, said alkyl, phenyl and heterocyclyl are optionally substituted with one or more substituents selected from Rz'; all other substituents and variables are as defined in the first embodiment; or a pharmaceutically acceptable salt or stereoisomer thereof.
  • Rl is selected from: NH2, halogen, OH, oxo, CN
  • Specific compounds of the instant invention include: 3-( ⁇ 4-[2-(methylthio)-6-phenylpyrido [2,3-d]pyrimidin-7-yl]benzyl ⁇ amino)- 1 -phenylpropan- 1 -one (1-5) ; l-(2-an_dnophenyl)-3-( ⁇ 4-[2-(methylthio)-6-phenyl ⁇ yrido[2,3-d]pyrimidin-7-yl]benzyl ⁇ amino)propan-l- one (1-6);
  • TFA salts of the compounds of the instant invention include:
  • TFA salts of the compounds of the instant invention include: 3-( ⁇ 4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrirmdin-7-yl]benzyl ⁇ amino)-l-phenylpropan-l-one (1-5); l-(2-a.n_inophenyl)-3-( ⁇ 4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyri ⁇ rridin-7-yl]benzyl ⁇ arnino)propan-l- one (X-6);
  • HC1 salts of the compounds of the instant invention include:
  • the compounds of the present invention may have asymmetric centers, chiral axes, and chiral planes (as described in: E.L. Eliel and S.H. Wilen, Stereochemistry of Carbon Compounds, John
  • Tetrazoles exist as a mixture of 1H72H tautorners.
  • the tautomeric forms of the tetrazol moiety are also within the scope of the instant invention.
  • Rl is oxo
  • substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure results.
  • the phrase "optionally substituted with one or more substituents” means, in one embodiment, “zero to four substituents" and, in another embodiment, "zero to three substituents".
  • alkyl is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms.
  • C ⁇ -C ⁇ o as in “C ⁇ -C ⁇ o alkyl” is defined to include groups having 1, 2, 3, 4, 5, 6, 7, 8, 9 or lO carbons in a linear or branched arrangement.
  • Ci-Cio alkyl specifically includes methyl, ethyl, ⁇ _-propyl, i- propyl, n-butyl, t-butyl, .-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, and so on.
  • cycloalkyl means a monocyclic saturated aliphatic hydrocarbon group having the specified number of carbon atoms.
  • cycloalkyl includes cyclopropyl, methyl-cyclopropyl, 2,2-dimethyl- cyclobutyl, 2-ethyl-cyclopentyl, cyclohexyl, and so on.
  • Alkoxy represents either a cyclic or non-cyclic alkyl group of indicated number of carbon atoms attached through an oxygen bridge. "Alkoxy” therefore encompasses the definitions of alkyl and cycloalkyl above.
  • alkenyl refers to a non-aromatic hydrocarbon radical, straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon double bond. In an embodiment, one carbon to carbon double bond is present, and up to four non-aromatic carbon-carbon double bonds may be present.
  • C2-C ⁇ alkenyl means an alkenyl radical having from 2 to 6 carbon atoms.
  • Alkenyl groups include ethenyl, propenyl, butenyl, 2- methylbutenyl and cyclohexenyl.
  • alkenyl refers to a hydrocarbon radical straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon triple bond. Up to three carbon- carbon triple bonds may be present.
  • C2-C6 alkynyl means an alkynyl radical having from 2 to 6 carbon atoms.
  • Alkynyl groups include ethynyl, propynyl, butynyl, 3-methylbntynyl and so on.
  • the straight, branched or cyclic portion of the alkynyl group may contain triple bonds and may be substituted if a substituted alkynyl group is indicated.
  • substituents may be defined with a range of carbons that includes zero, such as (C()-C6)a_kylene-aryl. If aryl is taken to be phenyl, this definition would include phenyl itself as well as -CH2PI1, -CH2CH2Ph, -CH(CH3)CH2CH(CH3)Ph, and so on.
  • aryl is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 atoms in each ring, wherein at least one ring is aromatic.
  • aryl elements examples include phenyl, naphthyl, tetrahydro-naphthyl, indanyl and biphenyl.
  • aryl substituent is bicyclic and one ring is non-aromatic, it is understood that attachment is via the aromatic ring.
  • heterocycle or “heterocyclyl” as used herein is intended to mean a 3- to 10- membered aromatic or nonaromatic heterocycle containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S, and includes bicyclic groups.
  • Heterocyclyl therefore includes the above mentioned heteroaryls, as well as dihydro and tetrathydro analogs thereof.
  • heterocyclyl include, but are not limited to the following: benzoimidazolyl, benzoimidazoloixyl, benzofuranyl, benzofurazanyl, benzopyrazolyl, benzotriazolyl, benzothiophenyl, benzoxazolyl, carbazolyl, carbolinyl, cinnolinyl, furanyl, imidazolyl, indolinyl, indolyl, indolazinyl, indazolyL, isobenzofuranyl, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthpyridinyl, oxadiazolyl, oxazolyl, oxazoline, isoxazoline, oxetanyl, pyranyl, pyrazinyl, pyrazolopyrimidinyl, pyrazolyl, pyridazuryl,
  • heterocyclyl is selected from 2-azepinone, benzimidaz;olyl, benzimidazolonyl, 2-diazapinone, imidazolyl, 2-imidazolidinone, indolyl, isoquinolinyl, morp _olinyl, piperidyl, piperazinyl, pyridyl, pyrrolidinyl, 2-piperidinone, 2-pyrimidinone, 2-pyrollidinone, qL"uinolinyl, tetrazolyl, tetrahydrofuryl, tetrahydroisoquinolinyl, thienyl, pyrazolopyrimidinyl, pyrazolyl, thiazolyl, oxadiazolyl and triazolyl.
  • halo or "
  • R6 is independently selected from: H, NH2, phenyl and heterocyclyl, said phenyl and heterocyclyl optionally substituted with 1-3 substituents selected from R z '.
  • R6 is heterocyclyl, said heterocyclyl is selected from:
  • R6 when R6 is heterocyclyl, said heterocyclyl is selected from: optionally substituted with 1-3 substituents selected from R z '.
  • Rb is H.
  • Rz' is selected from: NH2, NO2, oxo, (Cl-C6)alkyl, OH, S(0) 2 NH 2 .
  • the inhibitors of Akt activity are illustrated by the Formula A- 1:
  • the inhibitors of Akt activity are illustrated by the Formula A- 1: wherein:
  • the inhibitors of Akt activity are illustrated by the Formula B-l: wherein: R2' is: H or (C ⁇ -C6)alkyl; all other substituents and variables are as defined in the sixth embodiment; or a pharmaceutically acceptable salt or a stereoisomer thereof.
  • R ' is selected from: H and (C ⁇ -C6)alkyl.
  • R6' is selected from: NH2, NO2, oxo, (C ⁇ -C6)alkyl, OH, S(0) 2 NH 2 .
  • R6' is selected from: NH2, NO2, oxo, (C ⁇ -C6)alkyl, OH, S(0) 2 NH 2 .
  • the encompassed pharmaceutically acceptable salts not only include the isolated salts exemplified for the specific compounds described herein, but also all the typical pharmaceutically acceptable salts of the free form of compounds of Formula A.
  • the free form of the specific salt compounds described may be isolated using techniques known in the art. For example, the free form may be regenerated by treating the salt with a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate.
  • a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate.
  • the free forms may differ from their respective salt forms somewhat in certain physical properties, such as solubility in polar solvents, but the acid and base salts are otherwise pharmaceutically equivalent to their respective free forms for purposes of the invention.
  • the pharmaceutically acceptable salts of the instant compounds can be synthesized from the compounds of this invention which contain a basic or acidic moiety by conventional chemical methods.
  • the salts of the basic compounds are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
  • the salts of the acidic compounds are formed by reactions with the appropriate inorganic or organic base.
  • pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed by reacting a basic instant compound with an inorganic or organic acid.
  • non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like, as well as salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic (TFA) and the like.
  • inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like
  • organic acids such as acetic, propionic, succinic, glyco
  • suitable “pharmaceutically acceptable salts” refers to salts prepared form pharmaceutically acceptable non-toxic bases including inorganic bases and organic bases.
  • Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc and the like. Particularly preferred are the ammonium, calcium, magnesium, potassium and sodium salts.
  • Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as arginine, betaine caffeine, choline, N,N !
  • dibenzylethylenediamine diethylamin, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine tripropylamine, tromethamine and the like.
  • the compounds of the instant invention are inhibitors of the activity of Akt and are thus useful in the treatment of cancer, in particular cancers associated with irregularities in the activity of Akt and downstream cellular targets of Akt.
  • cancers include, but are not limited to, ovarian, pancreatic, breast and prostate cancer, as well as cancers (including glioblastoma) where the tumor suppressor PTEN is mutated (Cheng et al., Proc. Natl. Acad. Sci. (1992) 89:9267-9271; Cheng et al., Proc. Natl. Acad. Sci. (1996) 93:3636-3641; Bellacosa et al., Int. J.
  • cancers that may be treated by the compounds, compositions and methods of the invention include, but are not limited to: Cardiac: sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma; Lung: bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma; Gastrointestinal: esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancre
  • cancer includes a cell afflicted by any one of the above-identified conditions.
  • Akt signaling regulates multiple critical steps in angiogenesis. Shiojima and Walsh, Circ. Res. (2002) 90: 1243-1250.
  • the utility of angiogenesis inhibitors in the treatment of cancer is known in the literature, see J. Rak et al. Cancer Research, 55:4575-4580, 1995 and Dredge et al., Expert Opin. Biol. Tlier. (2002) 2(8):953-966, for example.
  • the role of angiogenesis in cancer has been shown in numerous types of cancer and tissues: breast carcinoma (G. Gasparini and A.L. Harris, J. Clin.
  • cancers include, advanced tumors, hairy cell leukemia, melanoma, advanced head and neck, metastatic renal cell, non-Hodgkin's lymphoma, metastatic breast, breast adenocarcinoma, advanced melanoma, pancreatic, gastric, glioblastoma, lung, ovarian, non-small cell lung, prostate, small cell lung, renal cell carcinoma, various solid tumors, multiple myeloma, metastatic prostate, malignant glioma, renal cancer, lymphoma, refractory metastatic disease, refractory multiple myeloma, cervical cancer, Kaposi's sarcoma, recurrent anaplastic glioma, and metastatic colon cancer (Dredge et al., Expert Opin.
  • the Akt inhibitors disclosed in the instant application are also useful in the treatment of these angiogenesis related cancers. Tumors which have undergone neovascularization show an increased potential for metastasis. In fact, angiogenesis is essential for tumor growth and metastasis. (S.P. Cunningham, et al., Can. Research, 61: 3206-3211 (2001)). The Akt inhibitors disclosed in the present application are therefore also useful to prevent or decrease tumor cell metastasis.
  • a method of treating or preventing a disease in which angiogenesis is implicated which is comprised of administering to a mammal in need of such treatment a therapeutically effective amount of a compound of the present invention.
  • Ocular neovascular diseases are an example of conditions where much of the resulting tissue damage can be attributed to aberrant infiltration of blood vessels in the eye (see WO 00/30651, published 2 June 2000).
  • the undesireable infiltration can be triggered by ischemic retinopathy, such as that resulting from diabetic retinopathy, retinopathy of prematurity, retinal vein occlusions, etc., or by degenerative diseases, such as the choroidal neovascularization observed in age-related macular degeneration.
  • ischemic retinopathy such as that resulting from diabetic retinopathy, retinopathy of prematurity, retinal vein occlusions, etc.
  • degenerative diseases such as the choroidal neovascularization observed in age-related macular degeneration.
  • Inhibiting the growth of blood vessels by administration of the present compounds would therefore prevent the infiltration of blood vessels and prevent or treat diseases where angiogenesis is implicated, such as ocular diseases like retinal vascularization, diabetic retinopathy, age-related macular degeneration, and the like.
  • a method of treating or preventing a non-malignant disease in which angiogenesis is implicated including but not limited to: ocular diseases (such as, retinal vascularization, diabetic retinopathy and age-related macular degeneration), atherosclerosis, arthritis, psoriasis, obesity and Alzheimer's disease (Dredge et al., Expert Opin. Biol. ⁇ ier. (2002) 2(8):953-966).
  • a method of treating or preventing a disease in which angiogenesis is implicated includes: ocular diseases (such as, retinal vascularization, diabetic retinopathy and age-related macular degeneration), atherosclerosis, arthritis and psoriasis.
  • the invention is a method of treating hyperproliferative disorders such as restenosis, inflammation, autoimmune diseases and allergy/asthma. Further included within the scope of the invention is a method of treating hyperinsulinism.
  • the compounds of the invention are also useful in preparing a medicament that is useful in treating the diseases described above, in particular cancer.
  • the instant compound is a selective inhibitor whose inhibitory efficacy is dependent on the PH domain, i this embodiment, the compound exhibits a decrease in in vitro inhibitory activity or no in vitro inhibitory activity against truncated Akt proteins lacking the PH domain.
  • the instant compound is selected from the group of a selective inhibitor of Aktl, a selective inhibitor of Akt2 and a selective inhibitor of both Aktl and Akt2.
  • the instant compound is selected from the group of a selective inhibitor of Aktl, a selective inhibitor of Akt2, a selective inhibitor of Akt3 and a selective inhibitor of two of the three Akt isoforms.
  • the instant compound is a selective inhibitor of all three Akt isoforms, but is not an inhibitor of one, two or all of such Akt isoforms that have been modified to delete the PH domain, the hinge region or both the PH domain and the hinge region.
  • the present invention is further directed to a method of inhibiting Akt activity which comprises administering to a mammal in need thereof a pharmaceutically effective amount of the instant compound.
  • the compounds of this invention may be administered to mammals, including humans, either alone or, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice.
  • the compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration.
  • compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
  • Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
  • excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc.
  • the tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a water soluble taste masking material such as hydroxypropylmethyl-cellulose or hydroxypropylcellulose, or a time delay material such as ethyl cellulose, cellulose acetate buryrate may be employed.
  • Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyleneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
  • Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymettrylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinyl- pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents ay be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene-oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate.
  • dispersing or wetting agents ay be a naturally-occurring phosphatide,
  • the aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame.
  • Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent, for example beeswax:, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation.
  • compositions may be preserved by the addition of an anti-oxidant such as butyl ated hydroxy anisol or alpha-tocopherol.
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present.
  • an anti-oxidant such as ascorbic acid.
  • the pharmaceutical compositions of the invention may also be in the form of an oil-in- water emulsion.
  • the oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these.
  • Suitable emulsifying agents may be naturally- occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
  • the emulsions may also contain sweetening, flavouring agents, preservatives and antioxidants.
  • Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
  • the pharmaceutical compositions may be in the form of sterile injectable aqueous solutions. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • the sterile injectable preparation may also be a sterile injectable oil-in-water microemulsion where the active ingredient is dissolved in the oily phase. For example, the active ingredient may be first dissolved in a mixture of soybean oil and lecithin.
  • the oil solution then introduced into a water and glycerol mixture and processed to form a microemulation.
  • the injectable solutions or microemulsions may be introduced into a patient's bloodstream by local bolus injection. Alternatively, it may be advantageous to administer the solution or microemulsion in such a way as to maintain a constant circulating concentration of the instant compound.
  • a continuous intravenous delivery device may be utilized.
  • An example of such a device is the Deltec CADD-PLUSTM model 540O intravenous pump.
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butane diol.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • Compounds of Formula A may also be administered in the form of suppositories for rectal administration, of the drug.
  • compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritating excipient include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A are employed.
  • topical application shall include mouth washes and gargles.
  • the compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art.
  • the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
  • Compounds of the present invention may also be delivered as a suppository employing bases such as cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • a suitable amount of an inhibitor of Akt is administered to a mammal undergoing treatment for cancer. Administration occurs in an amount of inhibitor of between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, or between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day.
  • Another therapeutic dosage that comprises the instant composition includes from about 0.01 mg to about 1000 mg of inhibitor of Akt. i another embodiment, the dosage comprises from about 1 mg to about 1000 mg of inhibitor of Akt.
  • instant compounds are also useful in combination with known therapeutic agents and anti-cancer agents.
  • instant compounds are useful in combination with known anticancer agents.
  • Combinations of the presently disclosed compounds with other anti-cancer or chemotherapeutic agents are within the scope of the invention. Examples of such agents can be found in Cancer Principles and Practice of Oncology by N.T. Devita and S. Hellman (editors), 6 th edition (February 15, 2001), Lippincott Williams & Wilkins Publishers.
  • a person of ordinary skill in the art would be able to discern which combinations of agents would be useful based on the particular characteristics of the drugs and the cancer involved.
  • anti-cancer agents include the following: estrogen receptor modulators, androgen receptor modulators, retinoid receptor modulators, cytotoxic/cytostatic agents, antiproliferative agents, prenyl-protein transferase inhibitors, HMG-CoA reductase inhibitors and other angiogenesis inhibitors, inhibitors of cell proliferation and survival signaling, and agents that interfere with cell cycle check-points.
  • the instant compounds are particularly useful when co-administered with radiation therapy.
  • the instant compounds are also useful in combination with known anti-cancer agents including the following: estrogen receptor modulators, androgen receptor modulators, retinoid receptor modulators, cytotoxic agents, antiprolif erative agents, prenyl-protein transferase inhibitors, HMG-CoA reductase inhibitors, BQN protease inhibitors, reverse transcriptase inhibitors, and other angiogenesis inhibitors.
  • Estrogen receptor modulators refers to compounds that interfere with or inhibit the binding of estrogen to the receptor, regardless of mechanism.
  • estrogen receptor modulators include, but are not limited to, tamoxifen, raloxifene, idoxifene, LY353381, LY117081, toremifene, fulvestrant, 4-[7-(2,2-dimethyl-l-oxopropoxy-4-methyl-2-[4-[2-(l-piperidinyl)ethoxy]phenyl]-2H-l- benzopyran-3-yl]-phenyl-2,2-dimethylpropanoate, 4,4'-dihydroxybenzophenone-2,4-dinitrophenyl- hydrazone, and SH646.
  • Androgen receptor modulators refers to compounds which interfere or inhibit the binding of androgens to the receptor, regardless of mechanism.
  • Examples of androgen receptor modulators include finasteride and other 5 ⁇ -reductase inhibitors, nilutamide, flutamide, bicalutamide, liarozole, and abiraterone acetate.
  • Retinoid receptor modulators refers to compounds which interfere or inhibit the binding of retinoids to the receptor, regardless of mechanism.
  • retinoid receptor modulators examples include bexarotene, tretinoin, 13-cis-retinoic acid, 9-cis-retinoic acid, ⁇ - difluoromethylomithine, ILX23-7553, trans- ⁇ -(4'-hydroxyphenyl) retinamide, and N-4-carboxyphenyl retinamide.
  • Cytotoxic/cytostatic agents refer to compounds which cause cell death or inhibit cell proliferation primarily by interfering directly with the cell's functioning or inhibit or interfere with cell myosis, including alkylating agents, tumor necrosis factors, intercalators, hypoxia activatable compounds, microtubule inhibitors/ microtubule-stabilizing agents, inhibitors of mitotic kinesins, histone deacetylase inhibitors, inhibitors of kinases involved in mitotic progression, inhibitors of kinases involved in growth factor and cytokine signal transduction pathways, antimetabolites, biological response modifiers, hormonal/anti-hormonal therapeutic agents, haematopoietic growth factors, monoclonal antibody targeted therapeutic agents, topoisomerase inhibitors, proteosome inhibitors and ubiquitin ligase inhibitors.
  • cytotoxic/cytostatic agents include, but are not limited to, sertenef, cachectin, ifosfamide, tasonermin, lonidamine, carboplatin, altretamine, prednimustine, dibromodulcitol, ranimustine, fotemustine, nedaplatin, oxaliplatin, temozolomide, heptaplatin, estramustine, improsulfan tosilate, trofosfamide, nimustine, dibrospidium chloride, pumitepa, lobaplatin, satraplatin, profiromycin, cisplatin, irofulven, dexifosfamide, cis-aminedichloro(2-methyl-pyridine)platinum, benzylguanine, glufosfamide, GPX100, (trans, trans, frans)-bis-mu-(hexane-l,6-
  • microtubule inhibitors/microtubule-stabilising agents include paclitaxel, vindesine sulfate, 3',4'-didehydro-4'-deoxy-8'-norvincaleukoblastine, docetaxol, rhizoxin, dolastatin, mivobulin isethionate, auristatin, cemadotin, RPR109881, BMS 184-476, vinflunine, cryptophycin, 2,3,4,5,6-pentafluoro-N-(3-fluoro-4-methoxyphenyl) benzene sulfonamide, anhydrovinblastine, N,N- dimethyl-L-valyl-L-valyl-N-methyl-L-valyl-L-prolyl-L-proline-t-butylamide, TDX258, the epothilones (see for example U.S.
  • epothilones are not included in the microtubule inhibitors/microtubclude-stabilising agents.
  • topoisomerase inhibitors are topotecan, hycaptamine, irinotecan, rubitecan, 6-ethoxypropionyl-3',4'-0-exo-benzylidene-chartreusin, 9-methoxy-N,N-dimethyl-5- nitropyrazolo[3,4,5-kl]acridine-2-(6H) propanamine, l-amino-9-etl_Lyl-5-fluoro-2,3-dihydro-9-hydroxy-4- methyl-lH,12H-benzo[de]pyrano[3',4':bJ]-indolizino[l,2b]quinoline-10,13(9H,15H)dione, lurtotecan,
  • inhibitors of mitotic kinesins are described in PCT Publications WO 01/30768 and WO 01/98278, and pending U.S. Ser. Nos. 60/338,779 (filed December 6, 2001), 60/338,344 (filed December 6, 2001), 60/338,383 (filed December 6, 2001), 60/338,380 (filed December 6, 2001), 60/338,379 (filed December 6, 2O01) and 60/344,453 (filed November 7, 2001).
  • inhibitors of mitotic kinesins include, but are not limited to inhibitors of KSP, inhibitors of MKLP1, inhibitors of CENP-E, inhibitors of MCAK and inhibitors of Rab6-K_FL.
  • histone deacetylase inhibitors include, but are not limited to, SAHA, TSA, oxamflatin, PXD101, MG98 and scriptaid. Further reference to other histone deacetylase inhibitors may be found in the following manuscript; Miller, T.A. et al. J. Med. Chem. 46(24):5097-5116 (2003).
  • “Inhibitors of kinases involved in mitotic progression” include, but are not limited to, inhibitors of aurora kinase, inhibitors of Polo-like kinases (PLK; in particular inhibitors of PLK-1), inhibitors of bub- 1 and inhibitors of bub-Rl.
  • PLK Polo-like kinases
  • Antiproliferative agents includes antisense RNA and DNA oligonucleotides such as G3139, ODN698, RVASKRAS, GEM231, and INX3001, and antimetabolites s ⁇ ch as enocitabine, carmofur, tegafur, pentostatin, doxifluridine, trimetrexate, fludarabine, capecitab>ine, galocitabine, cytarabine ocfosfate, fosteabine sodium hydrate, raltitrexed, paltitrexid, emitefur, tiazofurin, decitabine, nolatrexed, pemetrexed, nelzarabine, 2'-deoxy-2'-methylidenecytidine, 2'-fluoro>methylene-2'- deoxycytidine, N-[5-(2,3-dihydro-benzofuryl)sulfonyl]-N'-(3,4-dich
  • HMG-CoA reductase inhibitors refers to inhibitors of 3-hydroxy-3-methylglutaryl- CoA reductase.
  • HMG-CoA reductase inhibitors that may be used include but are not limited to lovastatin (MEVACOR®; see U.S. Patent Nos. 4,231,938, 4,294,926 and 4,319,039), simvastatin (ZOCOR®; see U.S. Patent Nos.
  • HMG-CoA reductase inhibitor as used herein includes all pharmaceutically acceptable lactone and open-acid forms (i.e., where the lactone ring is opened to fomi the free acid) as well as salt and ester forms of compounds which have HMG-CoA reductase inhibitory activity, and therefor the use of such salts, esters, open-acid and lactone forms is included within the scope of this invention.
  • Prenyl-protein transferase inhibitor refers to a compound which inhibits any one or any combination of the prenyl-protein transferase enzymes, including farnesyl-protein transferase
  • GGPTase geranylgeranyl-protein transferase type I
  • GGPTase- ⁇ geranylgeranyl-protein transferase type-H
  • prenyl-protein transferase inhibitors can be found in t_he following publications and patents: WO 96/30343, WO 97/18813, WO 97/21701, WO 97/234-78, WO 97/38665, WO 98/28980, WO 98/29119, WO 95/32987, U.S. Patent No. 5,420,245, U.S. Patent No. 5,523,430, U.S. Patent No.
  • Angiogenesis inhibitors refers to compounds that inhibit the formation of new blood vessels, regardless of mechanism.
  • angiogenesis inhibitors include, but are not limited to, tyrosine kinase inhibitors, such as inhibitors of the tyrosine kinase receptors Flt-1 (NEGFRl) and Flk- 1/KDR (NEGFR2), inhibitors of epidermal-derived, fibroblast-derived, or platelet derived growth factors, MMP (matrix metalloprotease) inhibitors, integrin blockers, interferon- , i_nterleukin-12, pentosan polysulfate, cyclooxygenase inhibitors, including nonsteroidal anti-inflairamatories ( ⁇ SAIDs) like aspirin and ibuprofen as well as selective cyclooxy-genase-2 inhibitors like celecoxib and rofecoxib (PNAS, Nol.
  • tyrosine kinase inhibitors such as inhibitors of the tyrosine kinase receptors Flt-1 (NEGFRl)
  • steroidal anti-inflammatories such as corticosteroids, mineralocorticoids, dexamethasone, prednisone, prednisolone, methylpred, betamethasone
  • carboxyamidotriazole combretastatin A-4, squalamine, 6-0-chloroacetyl-carbonyl)-fumagillol, thalidomide, angiostatin, troponin-1, angiotensin II antagonists (see Fernandez et al., J. Lab. Clin. TMed.
  • NEGF neuropeptide derived neuropeptide derived neuropeptide derived neuropeptides
  • Other therapeutic agents that modulate or inhibit angiogenesis and may also be used in combination with the compounds of the instant invention include agents that modulate or inhibit th-e coagulation and fibrinolysis systems (see review in Clin. Chem. La. Med. 38:679-692 (2000)). Examples of such agents that modulate or inhibit the coagulation and fibrinolysis pathways include, but are not limited to, heparin (see Thromb. Haemost.
  • TAFIa inhibitors have been describ»ed in U.S. Ser. ⁇ os. 60/310,927 (filed August 8, 2001) and 60/349,925 (filed January 18, 2002).
  • Agents that interfere with cell cycle checkpoints refer to compounds that inhibit protein kinases that transduce cell cycle checkpoint signals, thereby sensitizing the cancer cell to E> ⁇ A damaging agents.
  • Such agents include inhibitors of ATR, ATM, the Chkl and Chk2 kinases and cdk and cdc kinase inhibitors and are specifically exemplified by 7-hydroxystaurosporin, flavopiridol, CYC202 (Cyclacel) and BMS-387032.
  • “Inhibitors of cell proliferation and survival signalling pathway” refer to compounds that inhibit signal transduction cascades downstream of cell surface receptors.
  • Such agents include inhibitors of serine/threonine kinases (including but not limited to inhibitors of Akt such as described in WO
  • NSAID' s are directed to the use of NS_A_D's which are potent COX-2 inhibiting agents.
  • an NSAID is potent if it possesses an IC 50 for the inhibition of COX-2 of l ⁇ M or less as measured by cell or microsomal assays.
  • the invention also encompasses combinations with NSAID' s which are selective COX-2 inhibitors.
  • NSAID' s which are selective inhibitors of COX-2 are; defined as those which possess a specificity for inhibiting COX-2 over COX-1 of at least 100 fold as measured by the ratio of IC50 for COX-2 over IC50 f° r COX-1 evaluated by cell or microsomal assays.
  • Such compounds include, but are not limited to those disclosed in U.S. Patent 5,474,995, U.S. Patent 5,861,419, U.S. Patent 6,001,843, U.S. Patent 6,020,343, U.S. Patent 5,409,944, U.S. Patent 5,436,265, U.S.
  • Patent 5,536,752 U.S. Patent 5,550,142, U.S. Patent 5,604,260, U.S. 5,698,584, U.S. Patent 5,710,140, WO 94/15932, U.S. Patent 5,344,991, U.S. Patent 5,134,142, U.S. Patent 5,380,738, U.S. Patent 5,393,790, U.S. Patent 5,466,823, U.S. Patent 5,633,272 and U.S. Patent 5,932,598, all of which are hereby incorporated by reference.
  • Inhibitors of COX-2 that are particularly useful in the instant method of treatment are: 3- phenyl-4-(4-(methylsulfonyl)phenyl)-2-(5H)-furanone; and
  • angiogenesis inhibitors include, but are not limited to, endostatin, ukrain, ranpimase, IM862, 5-methoxy-4-[2-methyl-3-(3-methyl-2-butenyl)oxiranyl]-l-oxaspiro[2,5]oct- 6-yl(chloroacetyl)carbamate, acetyldinanaline, 5-amino-l-[[3,5-dichloro-4-(4- chlorobenzoyl)phenyl]methyl]-lH-l,2,3-triazole-4-carboxamide,CM101, squalamine, combretastatin, RPI4610, NX31838, sulfated mannopentaose phosphate, 7J-(carbonyl-bis[imino-N-methyl-4,2- pynolocarbonylimino[N-methyl-4,2-pyrrole]-carbonylimino]-bis-(l)-
  • integrated circuit blockers refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the v ⁇ 3 integrin, to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the ⁇ v ⁇ 5 integrin, to compounds which antagonize, inhibit or counteract binding of a physiological ligand to both the ⁇ 3 integrin and the 0Cy ⁇ 5 integrin, and to compounds which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells.
  • the term also refers to antagonists of the ⁇ v ⁇ 6 > 0ty ⁇ 8 > oq ⁇ i, o ⁇ l, c 5 ⁇ , ⁇ 6 ⁇ l and ⁇ 4 integrins.
  • the term also refers to antagonists of any combination of v ⁇ 3, ⁇ v ⁇ 5, ⁇ v ⁇ 6, o v ⁇ 8, ⁇ i ⁇ l, ⁇ 2 ⁇ l > ⁇ 5 ⁇ l> ⁇ 6 ⁇ l and 0C6 ⁇ 4 integrins.
  • tyrosine kinase inhibitors include N-(trifluoromethylphenyl)- 5-methylisoxazol-4-carboxamide, 3-[(2,4-dimethylpyrrol-5-yl)methylidenyl)indolin-2-one, 17- (allylamino)-17-demethoxygeldanamycin, 4-(3-chloro-4-fluorophenylamino)-7-methoxy-6-[3-(4- morpholinyl)propoxyl]quinazoline, N-(3-ethynylphenyl)-6,7-bis(2-methoxyethoxy)-4-quinazolinamine, BIBX1382, 2,3,9,10,ll,12-hexahydro-10-(hydroxymethyl)-10-hydroxy-9-methyl-9,12-epoxy-lH- diindolo[l,2,3-fg:3',2',l'-kl]pyrrolo[3,4-i]
  • Combinations with compounds other than anti-cancer compounds are also encompassed in the instant methods.
  • combinations of the instantly claimed compounds with PPAR- ⁇ (i.e., PPAR-gamma) agonists and PPAR- ⁇ (i.e., PPAR-delta) agonists are useful in the treatment of certain malingnancies.
  • PPAR- ⁇ and PPAR- ⁇ are the nuclear peroxisome proliferator-activated receptors ⁇ and ⁇ .
  • the expression of PPAR- ⁇ on endothelial cells and its involvement in angiogenesis has been reported in the literature (see J. Cardiovasc. Pharmacol 1998; 31:909-913; J. Biol. Chem. 1999;274:9116-9121; Invest. Ophthalmol Vis.
  • PPAR- ⁇ agonists and PPAR- ⁇ / ⁇ agonists include, but are not limited to, thiazolidinediones (such as DRF2725, CS-011, troglitazone, rosiglitazone, and pioglitazone), fenofibrate, gemfibrozil, clofibrate, GW2570, SB219994, AR-H039242, JTT-501, MCC-555, GW2331, GW409544, ⁇ 2344, KRP297, NP0110, DRF4158, NN622, GI262570, PNU182716, DRF552926, 2- [(5,7-dipropyl-3-trifluoromethyl-l,2-benzisoxazol-6-yl)oxy]-2-methylpropionic acid (disclosed in USSN 09/782,856), and 2(R)-7-(3-(2-chloro-4-(4-fluorophenoxy) phen
  • Another embodiment of the instant invention is the use of the presently disclosed compounds in combination with gene therapy for the treatment of cancer.
  • Gene therapy can be used to deliver any tumor suppressing gene. Examples of such genes include, but are not limited to, p53, which can be delivered via recombinant virus-mediated gene transfer (see U.S. Patent No.
  • a uPA/uPAR antagonist (Adenovirus-Mediated Delivery of a uPA/uPAR Antagonist Suppresses Angiogenesis-Dependent Tumor Growth and Dissemination in Mice," Gene Therapy, August 1998;5(8): 1105-13), and interferon gamma (J. Immunol 2000;164:217-222).
  • the compounds of the instant invention may also be administered in combination with an inhibitor of inherent multidrug resistance (MDR), in particular MDR associated with high levels of expression of transporter proteins.
  • MDR inherent multidrug resistance
  • MDR inhibitors include inhibitors of p-glycoprotein (P-gp), such as LY335979, XR9576, OC144-093, R101922, VX853 and PSC833 (valspodar).
  • P-gp p-glycoprotein
  • a compound of the present invention may be employed in conjunction with anti-emetic agents to treat nausea or emesis, including acute, delayed, late-phase, and anticipatory emesis, which may result from the use of a compound of the present invention, alone or with radiation therapy.
  • a compound of the present invention may be used in conjunction with other anti-emetic agents, especially neurokinin-1 receptor antagonists, 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron, and zatisetron, GABAB receptor agonists, such as baclofen, a corticosteroid such as Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or others such as disclosed in U.S.Patent Nos.
  • neurokinin-1 receptor antagonists especially 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron, and zatisetron, GABAB receptor agonists, such as baclofen, a corticosteroid such as Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or others such as disclosed in U.S.Patent Nos.
  • an antidopaminergic such as the phenothiazines (for example prochlorperazine, fluphenazine, thioridazine and mesoridazine), metoclopramide or dronabinol.
  • phenothiazines for example prochlorperazine, fluphenazine, thioridazine and mesoridazine
  • metoclopramide metoclopramide or dronabinol.
  • conjunctive therapy with an anti-emesis agent selected from a neurokinin-1 receptor antagonist, a 5HT3 receptor antagonist and a corticosteroid is disclosed for the treatment or prevention of emesis that may result upon administration of the instant compounds.
  • Neurokinin-1 receptor antagonists of use in conjunction with the compounds of the present invention are fully described, for example, in U.S. Patent Nos. 5,162,339, 5,232,929, 5,242,930, 5,373,003, 5,387,595, 5,459,270, 5,494,926, 5,496,833, 5,637,699, 5,719,147; European Patent Publication Nos.
  • the neurokinin-1 receptor antagonist for use in conjunction with the compounds of the present invention is selected from: 2-(R)-(l-(R)-(3,5- bis(trifluoromethyl)phenyl)ethoxy)-3-(S)-(4-fluorophenyl)-4-(3-(5-oxo-lH,4H-l,2,4- triazolo)methyl)morpholine, or a pharmaceutically acceptable salt thereof, which is described in U.S. Patent No. 5,719,147.
  • a compound of the instant invention may also be administered with an agent useful in the treatment of anemia.
  • Such anemia treatment agent is, for example, a continuous eythropoiesis receptor activator (such as epoetin alfa).
  • a compound of the instant invention may also be administered with an agent useful in the treatment of neutropenia.
  • a neutropenia treatment agent is, for example, a hematopoietic growth factor which regulates the production and function of neutrophils such as a human granulocyte colony stimulating factor, (G-CSF).
  • G-CSF human granulocyte colony stimulating factor
  • a compound of the instant invention may also be administered with an immunologic- enhancing drug, such as levamisole, isoprinosine and Zadaxin.
  • the scope of the instant invention encompasses the use of the instantly claimed compounds in combination with a second compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxic/cytostatic agent, an antiproliferative agent, a prenyl-protein transferase inhibitor, an HMG-CoA reductase inhibitor, an HIN protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, PPAR- ⁇ agonists, PPAR- ⁇ agonists, an inhibitor of inherent multidrug resistance, an anti-emetic agent, an agent useful in the treatment of anemia, an agent useful in the treatment of neutropenia, an immunologic-enhancing drug, an inhibitor of cell proliferation and survival signaling, and an agent that interferes with a cell cycle checkpoint.
  • a second compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxic/cytostatic agent, an antiprolife
  • administration means introducing the compound or a prodrug of the compound into the system of the animal in need of treatment.
  • a compound of the invention or prodrug thereof is provided in combination with one or more other active agents (e.g., a cytotoxic agent, etc.)
  • administration and its variants are each understood to include concurrent and sequential introduction of the compound or prodrug thereof and other agents.
  • composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts.
  • therapeutically effective amount means that amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician.
  • treating cancer or “treatment of cancer” refers to administration to a mammal afflicted with a cancerous condition and refers to an effect that alleviates the cancerous condition by killing the cancerous cells, but also to an effect that results in the inhibition of growth and/or metastasis of the cancer.
  • the angiogenesis inhibitor to be used as the second compound is selected from a tyrosine kinase inhibitor, an inhibitor of epidermal-derived growth factor, an inhibitor of fibroblast-derived growth factor, an inhibitor of platelet derived growth factor, an MMP (matrix metalloprotease) inhibitor, an integrin blocker, interferon- ⁇ , interleukin-12, pentosan poly sulfate, a cyclooxygenase inhibitor, carboxyamidotriazole, combretastatin A-4, squalamine, 6-O-chloroacetyl- carbonyl)-fumagillol, thalidomide, angiostatin, troponin-1, or an antibody to NEGF.
  • a tyrosine kinase inhibitor an inhibitor of epidermal-derived growth factor, an inhibitor of fibroblast-derived growth factor, an inhibitor of platelet derived growth factor, an MMP (matrix metalloprotease) inhibitor, an integrin block
  • the estrogen receptor modulator is tamoxifen or raloxifene.
  • a method of treating cancer comprises administering a therapeutically effective amount of a compound of Formula A in combination with radiation therapy and/or in combination with a second compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxiccytostatic agent, an antiproliferative agent, a prenyl-protein transferase inhibitor, an HMG-CoA reductase inhibitor, an HUN protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, PPAR- ⁇ agonists, PPAR- ⁇ agonists, an inhibitor of inherent multidrug resistance, an anti-emetic agent, an agent useful in the treatment of anemia, an agent useful in the treatment of neutropenia, an immunologic-enhancing drug, an inhibitor of cell proliferation and survival signaling, and an agent that interferes with a cell cycle checkpoint.
  • Yet another embodiment of the invention is a method of treating cancer that comprises administering a therapeutically effective amount of a compound of Formula A in combination with paclitaxel or trastuzumab.
  • the invention further encompasses a method of treating or preventing cancer that comprises administering a therapeutically effective amount of a compound of Formula A in combination with a COX-2 inhibitor.
  • the instant invention also includes a pharmaceutical composition useful for treating or preventing cancer that comprises a therapeutically effective amount of a compound of Formula A and a second compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxic/cytostatic agent, an antiproliferative agent, a prenyl-protein transferase inhibitor, an HMG-CoA reductase inhibitor, an HIN protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, a PPAR- ⁇ agonist, a PPAR- ⁇ agonist, an inhibitor of cell proliferation and survival signaling, and an agent that interferes with a cell cycle checkpoint.
  • a pharmaceutical composition useful for treating or preventing cancer that comprises a therapeutically effective amount of a compound of Formula A and a second compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxic/cytostatic agent, an antiproliferative agent,
  • AEBSF p-aminoethylbenzenesulfonyl fluoride
  • BSA bovine serum albumin
  • Cul copper iodide
  • CuS04 copper sulfate
  • DMSO dimethyl sulfoxide
  • DTT dithiothreitol
  • EDTA ethylene-diamine- tetra-acetic acid
  • EGTA ethyleneglycol-tetra-acetic acid
  • EtOAc ethyl acetate
  • EtOH ethanol
  • HO Ac acetic acid
  • HPLC high-performance liquid chromatography
  • LCMS liquid chromatograph- mass spectrometer
  • MeOH methanol
  • NaHC ⁇ 3 sodium bicarbonate
  • Na2S ⁇ 4 sodium sulfate
  • NH4OAC ammonium a
  • the compounds of this invention may be prepared by employing reactions as shown in the following Reaction Schemes, in addition to other standard manipulations that are known in the literature or exemplified in the experimental procedures.
  • the illustrative Reaction Schemes below are not limited by the compounds listed or by any particular substituents employed for illustrative purposes.
  • Substituent numbering as shown in the Reaction Schemes does not necessarily correlate to that used in the claims and often, for clarity, a single substituent is shown attached to the compound where multiple substituents are allowed under the definitions of Formula A hereinabove.
  • Reactions used to generate the compounds of this invention are prepared by employing reactions as shown in the Reaction Schemes I-N, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures.
  • SYNOPSIS OF REACTION SCHEMES Reaction Scheme I is illustrative for the synthesis of compounds of the instant invention. Friedlander cyclocondensation of a suitably substituted aryl or heteroaryl aminoaldehyde with a suitably substituted ketone gives intermediates of formula V-l. Conversion of the carboxylic acid functionality to an aldehyde functionality gives intermediate V-2 and is accomplished by methods well known to someone skilled in the art.
  • Reductive alkylation with a suitably substituted amine provides compounds of formula V-3.
  • U, N, W and X can be either a carbon atom or a nitrogen atom.
  • Reaction Scheme II illustrates the preparation of the compounds of the instant invention, starting with a suitably substituted hydroxymethylpyrimidine 1-1. This material can be oxidized with manganese (IV) oxide to give the corresponding aldehyde 1-2. Intermediate 1-2 reacts with methyl phenylacetate followed by treatment with phosphorus oxychloride to produce chloropyridopyrimidine I- 3. 1-3 is subjected to a standard Suzuki coupling with 4-formylphenylboronic acid to deliver 1-4.
  • Reaction Scheme m illustrates the synthesis of the compounds of the instant invention, starting with hydroxypyridopyrimidine II-l which is prepared according to Scheme I. II-l is oxidized to methyl sulfoxide II-2, which is then displaced with sodium cyanide to give II-3.
  • Hydroxypyridopyrimidine II-3 is converted to chloropyridopyrimidine B-4 by treatment with phosphorus oxychloride.
  • II-4 is subjected to a standard Suzuki coupling with 4-formylphenylboronic acid to deliver ⁇ -5.
  • the nitrile II-5 is transformed to carboxamide II-6 by urea-peroxide oxidation.
  • II-6 can then undergo reductive amination with a diverse array of amines to provide E-7.
  • Reaction Scheme IV illustrates the preparation of the compounds of the instant invention, starting with acid IH-1. This material is converted to amide IH-2, followed by reduction to give aldehyde EI-3.
  • Acid catalyzed hydrolysis readily converts the 1,6-naphthyridine to the requisite l,6-naphthyridin-5(6H)- one aldehyde functionality (V-3) and this material can undergo reductive amination with a diverse array of amines to give the l,6-naphthyridin-5(6H)-one compounds (V-6).
  • EXAMPLE 1 Cloning of the human Akt isoforms and ⁇ PH-Aktl
  • the pS2neo vector (deposited in the ATCC on April 3, 2001 as ATCC PTA-3253) was prepared as follows: The pRmHA3 vector (prepared as described in Nucl. Acid Res. 16:1043-1061 (1988)) was cut with Bgi ⁇ and a 2734 bp fragment was isolated. The pUChsneo vector (prepared as described in EMBO J. 4:167-171 (1985)) was also cut with Bgi ⁇ and a 4029 bp band was isolated. These two isolated fragments were ligated together to generate a vector termed pS2neo-l.
  • This plasmid contains a polylinker between a metallotbionine promoter and an alcohol dehydrogenase poly A addition site. It also has a neo resistance gene driven by a heat shock promoter.
  • the pS2neo-l vector was cut with Psp5II and BsiWI. Two complementary oligonucleotides were synthesized and then annealed
  • 5'CGCGAATTCAGATCTACCATGAGCGACGTGGCTATFGTG 3' (SEQ.ID.NO.: 3)
  • the 3' primer 5'CGCTCTAGAGGATCCTCAGGCCGTGCTGCTGGC3' (SEQ.ID.NO.: 4).
  • the 5' primer included an EcoRI and Bgi ⁇ site.
  • the 3' primer included an XZbal and BamHI site for cloning purposes.
  • the resultant PCR product was subcloned into pGEM3Z (Pronnega) as an EcoRI / Xba I fragment.
  • a middle T tag was added to the 5' end of the full length Aktl gene using the PCR primer: 5'GTACGATGCTGAACGATATCTTCG 3' (SEQ.ID.NO.: 5).
  • the resulting PCR product encompassed a 5' Kpnl site and a 3' BamHI site vhich were used to subclone the fragment in frame with a biotin tag containing insect cell expression vector, pS2neo.
  • PCR deletion mutagenesis was done using the full length Aktl gene in the pS2neo vector as t&mplate. The PCR was carried out in 2 steps using overlapping internal primers
  • Human Akt3 gene was amplified by PCR of adult brain cDNA (Clontech) using the amino terminal oligo primer: 5' GAATTCAGATCTACCATGAGCGATGTTACCATTGTG 3' (SEQ.ID.NO.: 8); and the carboxy terminal oligo primer :
  • primers included a 5' EcoRI / Bgi ⁇ site and a 3' Xbal / Bgi ⁇ site for cloning purposes.
  • the resultant PCR product was cloned into the EcoRI and Xbal sites of pGEM4Z (Promega).
  • pGEM4Z Promega
  • a middle T tag was added to the 5' end of the full length _Akt3 clone using the PCR primer: 5' GGTACCATGGAATACATGCCGATGGAAAGCGATGTTACCATTGTGAAG 3 '(SEQ.ID.NO.: 10).
  • the resultant PCR product encompassed a 5' Kpnl site which allowed in frame cloning with the biotin tag containing insect cell expression vector, pS2neo.
  • Human Akt2 gene was amplified by PCR from human thymus cDNA (Clontech) using the amino terminal oligo primer:
  • a middle T tag was added to the 5' end of the full length Akt2 using the PCR primer: 5' GGTACCATGGAATACATGCCGATGGAAAATGAGGTOTCTGTCATCAAAG 3' (SEQ.ID.NO.: 13).
  • the resultant PCR product was subcloned into the pS2neo vector as described above.
  • Akt isoforms and ⁇ PH-Aktl The DNA containing the cloned Aktl, Akt2, Akt3 and ⁇ PH-Akt 1 genes in the pS2neo expression vector was purified and used to transfect Drosophila S2 cells (ATCC) by the calcium phosphate method. Pools of antibiotic (G418, 500 ⁇ g/ml) resistant cells were selected. Cells were expanded to a 1.0 L volume (-7.0 x 10 6 / ml), biotin and CuS0 were added to a final concentration of 50 ⁇ M and 50 mM respectively. Cells were grown for 72 h at 27°C and harvested by centrifugation. The cell paste was frozen at -70°C until needed.
  • EXAMPLE 3 Purification of human Akt isoforms and ⁇ PH-Aktl Cell paste from one liter of S2 cells, described in Example 2, was lysed by sonication with 50 mis 1% CHAPS in buffer A: (50 mM Tris pH 7.4, 1 mM EDTA, 1 mM EGTA, 0.2 mM AEBSF, 10 ⁇ g/ml benzamidine, 5 ⁇ g/ml of leupeptin, aprotinin and pepstatin each, 10% glycerol and 1 mM DTT).
  • buffer A 50 mM Tris pH 7.4, 1 mM EDTA, 1 mM EGTA, 0.2 mM AEBSF, 10 ⁇ g/ml benzamidine, 5 ⁇ g/ml of leupeptin, aprotinin and pepstatin each, 10% glycerol and 1 mM DTT).
  • the soluble fraction was purified on a Protein G Sepharose fast flow (Pharmacia) column loaded with 9mg/ml anti-middle T monoclonal antibody and eluted with 75 ⁇ M EYMP E (SEQ.ID.NO.: 14) peptide in buffer A containing 25% glycerol.
  • Akt containing fractions were pooled and the protein purity evaluated by SDS-PAGE.
  • the purified protein was quantitated using a standard Bradford protocol. Purified protein was flash frozen on liquid nitrogen and stored at -70°C.
  • Akt and Akt pleckstrin homology domain deletions purified from S2 cells required activation. Akt and Akt pleckstrin homology domain deletions was activated (Alessi et al.
  • Akt Kinase Assays Activated Akt isoforms and pleckstrin homology domain deletion constructs were assayed utilizing a GSK-derived biotinylated peptide substrate. The extent of peptide phosphorylation was determined by Homogeneous Time Resolved Fluorescence (HTRF) using a la-xithanide chelate(Lance)-coupled monoclonal antibody specific for the phosphopeptide in combination with a streptavidin-linked allophycocyanin (SA-APC) fiuorophore which will bind to the biotin moiety on the peptide.
  • SA-APC streptavidin-linked allophycocyanin
  • Akt peptide substrate GSK3 ⁇ (S21) Peptide no.3928 biotin-GGRARTSSFAEPG (SEQ.ID.NO.: 15), Macromolecular Resources;
  • C Lance labeled anti-phospho GSK3 ⁇ monoclonal antibody (Cell Signaling Technology, clone # 27);
  • PIC Protease Inhibitor Cocktail
  • H. 10X Assay Buffer 500 mM HEPES, pH 7.5, 1 % PEG, mM EDTA, 1 mM EGTA, 1 %
  • Glycerol 25 mM MgCl 2 , 375 IM ATP;
  • GSK3 biotinylated peptide # 3928 The reaction is assembled by adding 16 TL of the ATP/MgCl 2 working solution to the appropriate wells of a 96-well microtiter plate. Inhibitor or vehicle (1.0 TI ) is added followed by 10 TI of peptide working solution. The reaction is started by adding 13 TI of the enzyme "working solution and mixing. The reaction is allowed to proceed for 50 min and then stopped by the addition of 60 TI HTRF quench buffer. The stopped reactions were incubated at room temperature for at least 30 min and then read on the Discovery instrument.
  • Each individual PKA assay consists of the following components: A. 5X PKA assay buffer (200 mM Tris pH7.5, 100 mM MgCl 2 , 5 ⁇ __M ⁇ -mercaptoethanol,
  • C. 33 P-ATP prepared by diluting 1.0 ⁇ l 33 P-ATP [10 mCi/ml] into _200 TI of a 50 ⁇ M stock of unlabeled ATP; D. 10 ⁇ l of a 70 nM stock of PKA catalytic subunit (UBI catalog # 14-114) diluted in 0.5 mg/ml BSA;
  • PKA/Kemptide working solution equal volumes of 5X PKA assay buffer, Kemptide solution and PKA catalytic subunit.
  • the reaction is assembled in a 96 deep-well assay plate.
  • the inhribitor or vehicle (10 TI) is added to 10 TI of the 33 P-ATP solution.
  • the reaction is initiated by adding 30 TI of the PKA/Kemptide working solution to each well. The reactions were mixed and incubated at room temperature for 20 min.
  • the reactions were stopped by adding 50 TI of 100 mM EDTA and 100 mM sodium pyrophosphate and mixing.
  • the enzyme reaction product (phosphorylated Kemptide) was collected on p81 phosphocellulose 96 well filter plates (Millipore). To prepare the plate, each well of a p81 filter plate was filled with 75 mM phosphoric acid. The wells were emptied through the filter by applying a vacuum to the bottom of the plate. Phosphoric acid (75 mM, 170 ⁇ l) was added to each well. A 30 ⁇ l aliquot from each stopped PKA reaction was added to corresponding wells on the filter plate containing the phosphoric acid.
  • Each PKC assay consists of the following components: A. 10X PKC co-activation buffer: 2.5 mM EGTA, 4mM CaCl 2 ;
  • 5X PKC activation buffer 1.6 mg/ml phosphatidylserine, 0.16 mg/ml diacylglycerol, 100 mM Tris pH 7.5, 50 mM MgCl 2 , 5 mM O-mercaptoethanol;
  • C. 33 P-ATP prepared by diluting 1.0 ⁇ l 33 P-ATP [10 mCi/ml] into lOO ⁇ l of a 100 ⁇ M stock of unlabeled ATP;
  • PKC/Myelin Basic Protein working solution Prepared by mixing 5 volumes eacb_ of PKC co-activation buffer and Myelin Basic protein with 10 volumes each of PKC activation buffer and PKC. The assays were assembled in 96 deep-well assay plates. Inhibitor or vehicle (lO ⁇ ) was added to 5.0 ul of 33 P-ATP. Reactions were initiated with the addition of the PKC/Myelin Basic Protein working solution and mixing. Reactions were incubated at 30°C for 20 min. The reactions were stopped by adding 50 TI of 100 mM EDTA and 100 mM sodium pyrophosphate and mixing.
  • the cell pellet was resuspended in lysis buffer (20 mM Tris pH8, 140 mM ⁇ aCl, 2 mM EDTA, 1% Triton, 1 mM ⁇ a Pyrophosphate, 10 mM O-Glycerol Phosphate, 10 mM ⁇ aF, 0.5 mm ⁇ aVO- 4 , 1 ⁇ M Microsystine, and lx Protease Inhibitor Cocktail), placed on ice for 15 minutes and gently vorte ed to lyse the cells. The lysate was spun in a Beckman tabletop ultra centrifuge at 100,000 x g at 4°C for 20 min.
  • lysis buffer (20 mM Tris pH8, 140 mM ⁇ aCl, 2 mM EDTA, 1% Triton, 1 mM ⁇ a Pyrophosphate, 10 mM O-Glycerol Phosphate, 10 mM ⁇ aF, 0.5 mm
  • IP immunoprecipitated
  • Akt2 lysates were mixed in NETN with anti-Akt-2 agarose (Upstate Biotechnology #16-174) and for Akt3, lysates were mixed in NETN with anti-Akt3 agarose (Upstate Biotechnology #16-175).
  • the IPs were incubated overnight at 4° C, washed and seperated by SDS-PAGE.
  • Western blots were used to analyze total Akt, pThr308 Aktl, pSer473 Aktl, and corresponding phosphorylation sites on Akt2 and Akt3, and downstream targets of Akt using specific antibodies (Cell Signaling Technology): Anti-Total Akt (cat. no. 9272), Anti-Phopho Akt Seri ⁇ e 473 (cat. no.
  • Heregulin Stimulated Akt Activation MCF7 cells (a human breast cancer line that is PTEN*' "1" ) were plated at lxlO 6 cells per 100 mM plate. When the cells were 70 - 80% confluent, they were refed with 5 ml of serum free media and incubated overnight. The following morning, compound was added and the cells were incubated for 1 - 2 hrs, after which time heregulin was added (to induce the activation of Akt) for 30 minutes and the cells were analyzed as described above. EXAMPLE 7 Inhibition Of Tumor Growth In vivo efficacy of an inhibitor of the growth of cancer cells may be confirmed by several protocols well known in the art.
  • Human tumor cell lines which exhibit a deregulation of the PI3K pathway are injected subcutaneously into the left flank of 6-10 week old female nude mice (Harlan) on day 0.
  • the mice are randomly assigned to a v&hicle, compound or combination treatment group.
  • Daily subcutaneous administration begins on day 1 and continues for the duration of the experiment.
  • the inhibitor test compound may be administered by a continuous infusion pump.
  • Compound, compound combination or vehicle is delivered in a total volume of 0.2 ml. Tumors are excised and weighed when all of the vehicle-treated animals exhibited lesions of 0.5 - 1.0 cm in diameter, typically 4 to 5.5 weeks after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Dermatology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention is directed to compounds which contain substituted napthyridines which inhibit the activity of Akt, a serine/threonine protein kinase. The invention is further directed to chemotherapeutic compositions containing the compounds of this invention and methods for treating cancer comprising administration of the compounds of the invention.

Description

TΓΓLE OF THE INVENTION INHIBITORS OF AKT ACTIVITY
BACKGROUND OF THE INVENTION The present invention relates to compounds which contain substituted napthyridines that are inhibitors of the activity of one or more of the isoforms of the serine/threonine kinase, Akt (also known as PKB; hereinafter referred to as "Akt"). The present invention also relates to pharmaceutical compositions comprising such compounds and methods of using the instant compounds in the treatment of cancer. Apoptosis (programmed cell death) plays essential roles in embryonic development and pathogenesis of. various diseases, such as degenerative neuronal diseases, cardiovascular diseases and cancer. Recent work has led to the identification of various pro- and anti-apoptotic gene products that are involved in the regulation or execution of programmed cell death. Expression of anti-apoptotic genes, such as Bcl2 or Bcl-xL, inhibits apoptotic cell death induced by various stimuli. On the other hand, expression of pro-apoptotic genes, such as Bax or Bad, leads to programmed cell death (Aams et al. Science, 281:1322-1326 (1998)). The execution of programmed cell death is mediated by caspase-1 related proteinases, including caspase-3, caspase-7, caspase-8 and caspase-9 etc (Thornberry et al. Science, 281: 1312-1316 (1998)). The phosphatidylinositol 3'-OH kinase (PI3K)/Akt pathway appears important for regulating cell survival/cell death (Kulik et al. Mol. Cell. Biol. 17: 1595-1606 (1997); Franke et al, Cell, 88:435-437 (1997); Kauffrnann-Zeh et al. Nature 385:544-548 (1997) Hemmings Science, 275:628-630 (1997); Dudek et al., Science, 275:661-665 (1997)). Survival factors, such as platelet derived growth factor (PDGF), nerve growth factor (NGF) and insulin-like growth factor-1 (IGF-1), promote cell survival under various conditions by inducing the activity of PI3K (Kulik et al. 1997, Hemmings 1997). Activated PI3K leads to the production of phosphatidylinositol (3,4,5)-triphosphate (Ptdlns (3,4,5)-P3), which in turn binds to, and promotes the activation of, the serine/threonine kinase Akt, which contains a pleckstrin homology (PH)-domain (Franke et al Cell, 81:727-736 (1995); Hemmings Science, 277:534 (1997); Downward, Curr. Opin. Cell Biol. 10:262-267 (1998), Alessi et al., EMBO J. 15: 6541-6551 (1996)). Specific inhibitors of PI3K or dominant negative Akt mutants abolish survival-promoting activities of these growth factors or cytokines. It has been previously disclosed that inhibitors of PI3K
(LY294002 or wortmannirα) blocked the activation of Akt by upstream kinases. In addition., introduction of constitutively active PI3K or Akt mutants promotes cell survival under conditions in which cells normally undergo apoptotic cell death (Kulik et al. 1997, Dudek et al. 1997). Three members of the Akt subfamily of second-messenger regulated serine/threonine protein kinases have been identified and termed Aktl/ PKBα, Akt2/PKBβ, and Akt3/PKBy (hereinafter referred to as "Aktl", "Akt2" and "Akt3"), respectively. The isoforms are homologous, particularly in regions encoding the catalytic domains. Akts are activated by phosphorylation events occurring in response to PI3K signaling. PI3K phosphorylates membrane inositol phospholipids, generating the second messengers phosphatidyl-inositol 3,4,5-trisphosphate and phosphatidylinositol 3,4-bisphosphate, which have been shown to bind to the PH domain of Akt. The current model of Akt activation proposes recruitment of the enzyme to the membrane by 3'-phosphorylated phosphoinositides, where phosphorylation of the regulatory sites of Akt by the upstream kinases occurs (B.A. Hemmings, Science 275:628-630 (1997); B.A. Hemmings, Science 276:534 (1997); J. Downward, Science 279:673-674 (1998)). Phosphorylation of Aktl occurs on two regulatory sites, Thr308 in the catalytic domain activation loop and on Ser473 near the carboxy terminus (D. R. Alessi et al. EMBO J. 15:6541-6551 (1996) and R. Meier et al. J. Biol. Chem. 272:30491-30497 (1997)). Equivalent regulatory phosphorylation sites occur in Akt2 and Akt3. The upstream kinase, which phosphorylates Akt at the activation loop site has been cloned and termed 3'-phosphoinositide dependent protein kinase 1 (PDK1). PDK1 phosphorylates not only Akt, but also p70 ribosomal S6 kinase, p90RSK, serum and glucocorticoid-regulated kinase (SGK), and protein kinase C. The upstream kinase phosphorylating the regulatory site of Akt near the carboxy terminus has not been identified yet, but recent reports imply a role for the integrin-linked kinase (ILK-1), a serine/threonine protein kinase, or autophosphorylation. Analysis of Akt levels in human tumors showed that Akt2 is overexpressed in a significant number of ovarian (J. Q. Cheng et al. Proc. Natl. Acad. Sci. U.S.A. 89:9267-9271(1992)) and pancreatic cancers (J. Q. Cheng et al. Proc. Natl. Acad. Sci. U.S.A. 93:3636-3641 (1996)). Similarly, Akt3 was found to be overexpressed in breast and prostate cancer cell lines (Nakatani et al. J. Biol. Chem. 274:21528-21532 (1999). The tumor suppressor PTEN, a protein and lipid phosphatase that specifically removes the 3' phosphate of Ptdlns(3,4,5)-P3, is a negative regulator of the PI3K/Akt pathway (Li et al. Science 275: 1943-1947 (1997), Stambolic et al. Cell 95:29-39 (1998), Sun et al. Proc. Natl. Acad. Sci. U.S.A. 96:6199-6204 (1999)). Germline mutations of PTEN are responsible for human cancer syndromes such as Cowden disease (Liaw et al. Nature Genetics 16:64-67 (1997)). PTEN is deleted in a large percentage of human tumors and tumor cell lines without functional PTEN show elevated levels of activated Akt (Li et al. supra, Guldberg et al. Cancer Research 57:3660-3663 (1997), Risinger et al. Cancer Research 57:4736-4738 (1997)). These observations demonstrate that the PI3K/Akt pathway plays important roles for regulating cell survival or apoptosis in tumorigenesis. Inhibition of Akt activation and activity can be achieved by inhibiting PI3K with inhibitors such as LY294002 and wortmannin. However, PI3K inhibition has the potential to indiscriminately affect not just all three Akt isozymes but also other PH domain-containing signaling molecules that are dependent on Pdtlns(3,4,5)-P3, such as the Tec family of tyrosine kinases. Furthermore, it has been disclosed that Akt can be activated by growth signals that are independent of PI3K. Alternatively, Akt activity can be inhibited by blocking the activity of the upstream kinase PDKl. No specific PDKl inhibitors have been disclosed. Again, inhibition of PDKl would result in inhibition of multiple protein kinases whose activities depend on PDKl, such as atypical PKC isoforms, SGK, and S6 kinases (Williams et al. Curr. Biol. 10:439-448 (2000)). It is an object of the instant invention to provide novel compounds that are inhibitors of Akt. It is also an object of the present invention to provide pharmaceutical compositions that comprise the novel compounds that are inhibitors of Akt. It is also an object of the present invention to provide a method for treating cancer that comprises administering such inhibitors of Akt activity.
SUMMARY OF THE INVENTION The instant invention provides for compounds which comprise substituted napthyridines that inhibit Akt activity. In particular, the compounds disclosed selectively inhibit one or two of the Akt isoforms. The invention also provides for compositions comprising such inhibitory compounds and methods of inhibiting Akt activity by administering the compound to a patient in need of treatment of cancer.
DETAILED DESCRIPTION OF THE INVENTION The compounds of the instant invention are useful in the inhibition of the activity of the serine/threonine kinase Akt. In a first embodiment of this invention, the inhibitors of Akt activity are illustrated by the Formula A:
Figure imgf000004_0001
A wherein:
Figure imgf000005_0001
a is 0 or 1; b is 0 or 1; c is 0 or 1; m is 0, 1 or 2; and n is 0, 1 or 2; Rl is independently selected from: H, Oa(Cι-C6)perfluoroalkyl, OH, oxo, CN, halogen, Oa(C=0)bOc(Cι-Cιo)alkyl, Oa(C=0)bOc(C2-Cιo)alkenyl, Oa(C=0)bOc(Cι-Cιo)alkynyl,
Oa(C=0)bOc(C3-C8)cycloalkyl, Oa(C=0)bOcaryl, Oa(C=0)bOcheterocyclyl, Oa(C=0)bOcN(Rb)2, (Cι-C6)alkyl-N(Rb)2, (Cι-C6)alkyl-heterocyclyl, C02H, C(0)H, S(O)m(Cι-Cι0)alkyl, S(0)m(C2- Cιo)alkenyl, S(0)m(C2-Cιo)alkynyl, S(0)m(C3-C8)cycloalkyl, S(0)maryl, S(0)mheterocyclyl, and Oa- P=0(OH)2, wherein said alkyl, aryl, alkenyl, alkynyl, heterocyclyl, and cycloalkyl is optionally substituted with one or more substituents selected from Rz; R2 is selected from: H, (Cι-Cg)alkyl and (C3-C8)cycloalkyl; R3 is selected from: (C3-Cs)cycloalkyl, aryl, heterocyclyl, N(R6)2, and (C=0)R6, said cycloalkyl, aryl and heterocyclyl is optionally substituted with one or more Rz; R6 is independently selected from: H, (Cι-Cβ)alkyl, N(Rb)2, aryl and heterocyclyl, said alkyl, aryl and heterocyclyl are optionally substituted with one or more Rz'; Rb is independently selected from: H and (Cι-C6)alkyl; Rz is selected from: Oa(C=0)bN(Rb)2, (C=0)aObaryl, (C=0)aObhe_erocyclyl, halogen, OH, oxo, Oa(Cι-C3)perfluoroalkyl, (C=0)aOb(Cι-C6)alkyl, CHO, CO2H, CN, (Cι-C6)alkyl- heterocyclyl, (Cι-C6)alkyl-N(Rb)2, and O -P=0(OH)2, wherein said aryl, heterocyclyl and alkyl are optionally substituted with one or more substituents selected from Rz'; and Rz' is selected from: (Cι-C6)alkyl, halogen, OH, oxo, CN, phenyl, NH2, NO2, CO2H, S(0)m(Ci-C6)alkyl, S(0)mN(Rb)2, 0(Cι-C6)alkyl, and Oa-P=0(OH)2; or a pharmaceutically acceptable salt or a stereoisomer thereof. In a second embodiment of the instant invention is a compound as illustrated by Formula A, wherein: Rl is selected from: NH2, halogen, OH, oxo, CN, phenyl, heterocyclyl, CO2H, C(0)H,
Figure imgf000006_0001
said alkyl, phenyl and heterocyclyl are optionally substituted with one or more substituents selected from Rz'; all other substituents and variables are as defined in the first embodiment; or a pharmaceutically acceptable salt or stereoisomer thereof. In a third embodiment of the instant invention is a compound as illustrated by Formula B,
Figure imgf000006_0002
B wherein: R3 is selected from: phenyl, heterocyclyl, N(R6)2 and (C=0)R6, wherein said phenyl and heterocyclyl are optionally substituted with one or more subtituents selected from Rz'; all other substituents and variables are as defined in the second embodiment; or a pharmaceutically acceptable salt or stereoisomer thereof. Specific compounds of the instant invention include: 3-( { 4-[2-(methylthio)-6-phenylpyrido [2,3-d]pyrimidin-7-yl]benzyl } amino)- 1 -phenylpropan- 1 -one (1-5) ; l-(2-an_dnophenyl)-3-({4-[2-(methylthio)-6-phenylρyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)propan-l- one (1-6);
N-l-{4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}-N-2-(5-nitropyridin-2-yl)ethane-
1,2-diamine (1-7); 5-[2-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)ethyl]-l,3,4-thiadiazol-2- amine (1-8);
4-[3-({4-[2-(methylthio)-6-phenylpyrido[2,3--flpyrimidin-7-yl]benzyl}amino)propyl]-2,4-dihydro-3H- pyrazol-3-one (1-9);
[3-(lH-imidazol-l-yl)proρyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--Z]pyrimidin-7-yl]benzyl}amine (l- 10);
[3-(4-methylpiperazin-l-yl)propyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--^pyrimidin-7-yl]benzyl}amine
(l-ii);
[2-(lH-imidazol-4-yl)ethyl]{4-[2-(methylthio)-6-phenylpyrido[2,3-_^pyrimidin-7-yl]benzyl}amine (l- 12); 4-[2-({4-[2-(methylthio)-6-phenylpyrido[2,3-_t]pyrimidin-7-yl]benzyl}amino)ethyl]phenol
(1-13);
[2-(l_ϊ-benzimidazol-2-yl)ethyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--/]pyrirmdin-7-yl]benzyl}amine
(1-14); 4-[2-({4-[2-(methylt o)-6-phenylpyrido[2,3-_t]pyrimidin-7-yl]benzyl}amino)ethyl benzenesulfonamide
(1-15);
N-3-{4-[2-(methyltMo)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}-beta-alaninamide (l-16);
7-[4-(3-oxo-3-phenylpropylan_ino)methylphenyl]-6-phenylpyrido[2,3-d]pyrir_ήdine-2-carboxamide (2-7);
7-{4-[3-oxo-3-(2-aminophenyl)propylamino]methylphenyl}-6-phenylpyrido[2,3-d]pyrimidine-2- carboxamide (2-8); and
5-({[4-(3-Phenyl-l,5-naphthyridin-2-yl)benzyl]amino}methyl)-2,4-dihydro-3H-l,2,4-triazol-3-one (3-7) or a pharmaceutically acceptable salt or a stereoisomer thereof. Specific TFA salts of the compounds of the instant invention include:
3-({4-[2-(__nethylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)-l-phenylpropan-l-one (1-5); l-(2-aminophenyl)-3-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)propan-l- one (1-6);
N-l-{4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}-N-2-(5-nitropyridin-2-yl)ethane-
1,2-diamine (1-7);
5-[2-({4-[2-(methyltMo)-6-phenylpyrido[2,3-d]pyrin_idin-7-yl]benzyl}amino)ethyl]-l,3,4-thiadiazol-2- amine (1-8);
4-[3-({4-[2-(methyltMo)-6-phenylpyrido[2,3-J]pyrin_idin-7-yl]benzyl}amino)propyl]-2,4-dihydro-3H- pyrazol-3-one (1-9);
[3-( lH-imidazol- l-yl)propyl] { 4-[2-(methylthio)-6-phenylpyrido[2,3--i]pyrirmdin-7-yl]benzyl } amine (1-
10); [3-(4-methylpiperazin-l-yl)propyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--t]pyrimidin-7-yl]benzyl}amine
(l-ii);
[2-(lH-in_ dazol-4-yl)ethyl]{4-[2-(methylthio)-6-phenylpyrido[2,3-__]pyrirmdin-7-yl]benzyl}amine (1-
12);
4-[2-({4-[2-(methylthio)-6-phenylpyrido[2,3-J]pyrimidin-7-yl]benzyl}amino)ethyl]phenol (1-13);
[2-( l -benzimidazol^-y^ethyl] { 4-[2-(methylthio)-6-phenylpyrido[2,3-_t]pyrimidin-7-yl]benzyl } amine
(1-14);
7-[4-(3-oxo-3-phenylpropylan_ino)methylphenyl]-6-phenylpyrido[2,3-d]pyrimidine-2-carboxamide (2-7);
7-{4-[3-oxo-3-(2-aminophenyl)propylamino]methylphenyl}-6-phenylpyrido[2,3-d]pyrimidine-2- carboxamide (2-8); and 5-({[4-(3-Phenyl-l,5-naphthyridin-2-yl)benzyl]amino}methyl)-2,4-dihydro-3H-l,2,4-triazol-3-one (3-7) or a stereoisomer thereof. Further specific compounds of the instant invention include:
3-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}ai_iino)-l-phenylpropan-l-one (l-5); l-(2-aminophenyl)-3-({4-[2-(methyltWo)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)propan-l- one (1-6);
N-l-{4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}-N-2-(5-nitropyridin-2-yl)ethane-
1,2-diamine (1-7);
5-[2-({4-[2-(methyltl_io)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)ethyl]-l,3,4-thiadiazol-2- amine (1-8);
4-[3-({4-[2-(methylthio)-6-phenylpyrido[2,3-J]pyrirddin-7-yl]benzyl}arnino)propyl]-2,4-dihydro-3H- pyrazol-3-one (1-9);
[3-(lH-i_mdazol-l-yl)propyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--flpyrimidin-7-yl]benzyl}amine (1-
10); [3-(4-methylpiperazin-l-yl)propyl]{4-[2-(methyltMo)-6-phenylpyrido[2,3-d pyrirnidin-7-yl]benzyl}amine
(Ml);
[2-(lH-imidazol-4-yl)ethyl]{4-[2-(methylt o)-6-phenylpyrido[2,3-_flpyrimidin-7-yl]benzyl}amine (1-
12);
4-[2-({4-[2-(methylthio)-6-phenylpyrido[2,3--flpyrimidin-7-yl]benzyl}amino)ethyl]phenol (1-13);
[2-(lH-benzimidazol-2-yl)ethyl]{4-[2-(methyltWo)-6-phenylpyrido[2,3-_i]pyrirr din-7-yl]benzyl}amine
(1-14);
4-[2-({4-[2-(methylthio)-6-phenylpyrido[2,3-^pyrin_idin-7-yl]benzyl}amino)ethyl benzenesulfonamide
(1-15); N-3-{4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}-beta-alaninamide (l-16);
7-[4-(3-oxo-3-phenylpropylan_ino)methylphenyl]-6-phenylpyrido[2,3-d]pyrirmdine-2-carboxamide (2-7);
7-{4-[3-oxo-3-(2-an_inophenyl)propylamino]methylphenyl}-6-phenylpyrido[2,3-d]pyrimidine-2- carboxamide (2-8);
5-({[4-(3-Phenyl-l,5-naphthyridin-2-yl)benzyl]amino}methyl)-2,4-dihydro-3H-l,2,4-triazol-3-one (3-7); 3-[(3-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-6);
[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)phenyl]-N-{ [5-(lH-pyrazol-l-yl)pyridin-2- yl]methyl}methane (4-7);
(6-chloropyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane (4-8); [4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)phenyl]-N-(pyridin-3-ylmethyl)methane (4-9); (6-methoxypyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane (4-
10);
(6-oxo-l,6-dihydropyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane
(4-11); 3-[(2-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-12);
3-[(3-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-13);
3-[(4-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-14);
3-[(2-methoxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-15);
3-[(2-methoxyphenyl)(methyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-16); 3-[(3-hydroxypyridin-2-yl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-17);
3-phenyl-2-[4-({[4-(lH-pyrazol-l-yl)benzyl]amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one (4-18);
2,2,2-trifluoro-N-[4-(6-methyl-5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl] ethanesulfonamide (4-19); 2-[4-({ [3-(2-aminophenyl)-3-oxopropyl] amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-
20);
2-[4-({[3-(5-oxo-4,5-dihydro-lH-pyrazol-4-yl)propyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one (4-21);
2-[4-({[2-(l,3-benzodioxol-5-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4- 22);
4-(2-{[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}ethyl) benzenesulfonamide
(4-23);
2-{4-[({2-[(5-nitropyridin-2-yl)aπ_ino]ethyl} amino)methyl]phenyl}-3-phenyl-l,6-naphthyridin-5(6H)- one (4-24); 3-phenyl-2-[4-({ [4-(l,2,3-thiadiazol-4-yl)benzyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one (4-
25);
2-[4-({[l-(lH-benzimidazol-2-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-
26);
3-phenyl-2-(4-{ [(2-pyridin-3-ylethyl)amino] methyl }phenyl)-l,6-naphthyridin-5(6H)-one (4-27); 2-(4-{ [(3,4-dimethoxybenzyl)arnino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-28); 2-[4-({[2-(5-methyl-4H-l,2,4-triazol-3-yl)ethyl] amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one (4-29);
3-phenyl-2-[4-({[2-(lH-l,2,4-triazol-5-yl)ethyl] amino}methyl)phenylj-l,6-naphthyridin-5(6H)-one (4-
30); 2-[4-({[(5-oxo-4,5-dihydro-lH-l,2,4-triazol-3-yl)methyl]amino}methyl)phenyl]-3-phenyl-l,6- naphthyridin-5(6H)-one (4-31);
3-phenyl-2-[4-({[2-(3-pyridin-4-yl-lH-l,2,4-triazol-5-yl)ethyl]amino}methyl)phenyl]-l,6-naphthyridin-
5(6H)-one (4-32);
2-[4-({[2-(lH-benzimidazol-2-yl)ethyl]a__nino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4- 33);
3-phenyl-2-(4-{ [(2-pyridin-2-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one (4-34);
3-phenyl-2-(4-{ [(2-pyridin-4-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one (4-35);
2-[4-({[2-(2-oxoimidazolidin-l-yl)ethyl] amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-
36); 2-(4-{[(2-morpholin-4-ylethyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-37);
2-(4-{[(2-anilinoethyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-38);
3-phenyl-2-[4-({[2-(pyridin-2-ylamino)ethyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one (4-39);
2-[4-({[3-(2-oxopyrrolidin-l-yl)propyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-
40); 2-[4-({ [4-(dimethylamino)benzyl]amino }methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-41);
2-(4-{[(l,3-benzodioxol-5-ylmethyl)amino] methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-42);
N-(2-{[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}ethyl)-lH-l,2,4-triazole-3- carboxamide (4-43);
2-[4-({[2-(lH-benzimidazol-l-yl)ethyl]arnino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4- 44);
2-(4-{ [(3,5-dimethoxybenzyl)amino]methyl } phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-45);
3-phenyl-2-[4-( { [4-( lH-pyrrol- 1 -yl)benzy 1] amino } methyl)phenyl] - 1 ,6-naphthyridin-5 (6H)-one (4-46) ;
2-[4-({[2-(3,4-dimethoxyphenyl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-
47); 2-[4-({ [2-(6-methoxy-lH-indol-3-yl)ethyl] amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one
(4-48);
2-(4-{[(4-morpholin-4-ylbenzyl)aι_ιino] methyl} phenyl)-3 -phenyl- l,6-naphthyridin-5(6H)-one (4-49);
3-phenyl-2-[4-({[3-(lH-l,2,3-triazol-l-yl)propyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one (4-
50); 2-(4-{ [(4-hydroxybenzyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-51); 3-phenyl-2-(4-{[(2-{[5-(trifluoromethyl)pyridin-2-yl]an_ino}ethyl)amino]methyl}phenyl)-l,6- naphthyridin-5(6H)-one (4-52);
2-(4-{[(imidazo[l,2-a]pyridin-2-ylmethyl)amino] methyl }phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one
(4-53); 4-({[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}methyl) benzenesulfonamide
(4-54);
2-[4-({[2-(2-amino-4-methyl-l,3-thiazol-5-yl)ethyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one (4-55);
2-[4-({[4-(lH-imidazol-4-yl)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-56); 2-[4-({[2-(3,5-dimethyl-lH-pyrazol-4-yl)ethyl] amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)- one (4-57);
2-(4-{ [(l,3-benzothiazol-2-ylmethyl)amino] methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-
58);
3-phenyl-2-(4-{ [(2-pyrazin-2-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one (4-59); 3-phenyl-2-[4-({ [2-(lH-l,2,4-triazol-l-yl)ethyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one (4-
60);
2-(4-{[(3H-in_idazo[4,5-b]pyridin-2-ylmethyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)- one (4-61);
3-phenyl-2-{4-[({ l-[4-(lH-l,2,4-triazol-l-yl)phenyl]ethyl}amino)methyl]phenyl}-l,6-naphthyridin- 5(6#)-one (4-62);
3-phenyl-2-[4-({[2-(5-phenyl-2,5-diazabicyclo [2.2.1]hept-2-yl)ethyl]amino}methyl)phenyl]-l,6- naphthyridin-5(6H)-one (4-63);
2-[4-({[2-(l-methyl-lH-benzimidazol-2-yl) ethyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one (4-64); 3-phenyl-2-[4-({[2-(4-pyrimidin-2-ylpiperazin-l-yl)ethyl]amino}methyl)phenyl]-l,6-naphthyridin-5(6H)- one (4-65);
2-(4-{ [(3-morpholin-4-ylpropyl)amino]methyl } phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-66);
2-[4-({[2-(4-hydroxyphenyl)ethyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-67);
2-[4-({[2-(5-methyl-lH-imidazol-4-yl)ethyl] amino }methyl)pheny l]-3-phenyl-l, 6-naphthyridin-5(6H)- one (4-68);
2-[4-({[2-(lH-imidazol-4-yl)ethyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-69);
2-(4-{[(4-hydroxyphenyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-70);
2-[4-({ [3-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-71);
2-[4-({[2-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-72); 2-[4-({ [2-(dimethylamino)benzyl] amino} methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-73); 2-[4-({ [4-(methylthio)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-74);
2-[4-({ [4-(methylsulfonyl)benzyl]amino}methyl) phenyl]-3-plιenyl-l,6-naphthyridin-5(6H)-one (4-75);
2-[4-({ [4-(methylamino)benzyl] amino} methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-76);
2-(4-{ [(3,4-dihydroxybenzyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-77); 2-[4-({ [(l-methyl-l,2,3,4-tetrahydroquinolin-6-yl)methyl]amino}methyl)phenyl]-3-phenyl-l,6- naphthyridin-5(6H)-one (4-78);
2-(4-{ [(4-chlorobenzyl)amino]methyl}phenyl)-3-phenyl-l ,6-αaphthyridin-5(6H)-one (4-79);
2-[4-({ [(l-methyl-2,3-dihydro-lH-indol-5-yl)methyl]amino}rnethyl)phenyl]-3-phenyl-l,6-naphthyridm-
5(6H)-one (4-80); l,6-naphthyridin-5(6H)-one, 2-[4-[[[(6-methoxy-lH-benzimi azol-2-yl)methyl]amino]methyl] phenyl]-3- phenyl (4-81);
3-phenyl-2-{4-[({[6-(trifluoromethyl)pyridin-3-yl]methyl}amino)methyl]phenyl}-l,6-naphthyridin-
5(6H)-one (4-82);
2-(4-{ [(3-hydroxybenzyl)oxy]methyl }phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-83); 2-(4-{ [(3-hydroxybenzyl)oxy]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-84);
2-[4-({[4-(diethylamino)benzyl]an_ino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-85);
3-[(6-methoxypyridin-3-yl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-86);
3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]-3-(pyridine-2-ylamino)propane (4-87);
2-[(2-hydroxybenzoyl)amino]-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]ethane (4-
88);
3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]-3-(pyridine-4-ylamino)propane
(4-89); 6-methyl-2-[4-({methyl[4-(lH-pyrazol-l-yl)benzyl] amino }methyl)phenyl]-3-phenyl-l,6-naphthyridm-
5(6H)-one (4-90);
2-[4-( { methyl [4-( lH-pyrazol- 1 -yl)benzyl] amino } methyl)phenyl] -3-phenyl- 1 ,6-naphthyridin-5 (6H)-one
(4-91);
6-methyl-3-phenyl-2-[4-({ [4-(lH-pyrazol-l-yl)benzyl]amino} methyl) phenyl]-l,6-naphthyridin-5(6H)- one (4-92); and
3-[(2-hydroxyphenyl)ar_ιino]-N-{4-[2-(4-methylpiperazin-l-yl)-6-phenylpyrido[2,3-d]pyrimidin-7- yl]benzyl}-3-oxopropane (5-6); or a pharmaceutically acceptable salt or a stereoisomer thereof. Further specific TFA salts of the compounds of the instant invention include: 3-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrirmdin-7-yl]benzyl}amino)-l-phenylpropan-l-one (1-5); l-(2-a.n_inophenyl)-3-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyriιrridin-7-yl]benzyl}arnino)propan-l- one (X-6);
N-l-{ 4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}-N-2-(5-nitropyridin-2-yl)ethane- 1,2-diamine (1-7); 5-[2-C{4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)ethyl]-l,3,4-thiadiazol-2- amine (1-8);
4-[3-C{4-[2-(methylthio)-6-phenylpyrido[2,3--t]pyrimidin-7-yl]benzyl}amino)propyl]-2,4-dihydro-3H- pyrazol-3-one (1-9);
[3-(l _?^-iιτ dazol-l-yl)propyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--i lpyrimidin-7-yl]benzyl}amine (1- 10);
[3-(4-ιnethylpiperazin-l-yl)propyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--^pyrirmdm-7-yl]benzyl}amine
(Ml);
[2-(l/_f-imidazol-4-yl)ethyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--flpyriιmdin-7-yl]benzyl}amine (1- 12); 4-[2-C { 4-[2-(methylthio)-6-phenylpyrido[2,3-<i]pyrimidin-7-yl]benzyl } amino)ethyl]phenol (1-13); [2-(l_W-benzin_idazol-2-yl)ethyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--^pyrimidin-7-yl]benzyl}amine
(1-14);
7-[4-C3-oxo-3-phenylpropylamino)methylphenyl]-6-phenylpyrido[2,3-d]pyrimidine-2-carboxamide (2-7); 7-{4-[3-oxo-3-(2-aminophenyl)propylarnino]methylphenyl}-6-phenylpyrido[2,3-d]pyrimidine-2- carboxamide (2-8); and
5-({[4-(3-Phenyl-l,5-naphthyridin-2-yl)benzyl]amino}methyl)-2,4-dihydro-3H-l,2,4-triazol-3-one (3-7)
3-[(3-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propan-l-aminium trifluoroacetate (4-6); [4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)phenyl]-N-{[5-(lH-pyrazol-l-yl)pyridin-2- yl]methyl}methane (4-7);
(6-chloropyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane (4-8);
[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)phenyl]-N-(pyridin-3-ylmethyl)methane(4-9);
(6-methoxypyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane (4- 10);
(6-oxo-l,6-dihydropyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane
(4-11);
3-[(2-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-12); 3-[(3-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-13);
3-[(4-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphtlιyridin-2- yl)benzyl]propane (4-14); 3-[(2-methoxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-15);
3-[(2-methoxyphenyl)(methyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-16);
3-[(3-hydroxypyridin-2-yl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane (4-17);
2-C4-({[3-(2-amirαophenyl)-3-oxopropyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-
20);
2-[4-({[3-(5-oxo-^,5-dihydro-lH-pyrazol-4-yl)propyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one (4-21) ; 2-[4-({ [2-(l,3-benzodioxol-5-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-
22);
4-(2-{[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}ethyl) benzenesulfonamide
(4-23);
2-{4-[({2-[(5-nitropyridin-2-yl)amino]ethyl} amino)methyl]phenyl}-3-phenyl-l,6-naphthyridin-5(6H)- one (4-24);
3-phenyl-2-[4-({[4-(l,2,3-thiadiazol-4-yl)benzyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one (4-
25);
2-[4-({[l-(lH-benzimidazol-2-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-
26); 3-phenyl-2-(4-{[(2-pyridin-3-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one (4-27);
2-(4-{ [(3,4-dimet_hoxybenzyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-28);
2-[4-({[2-(5-meth.yl-4H-l,2,4-triazol-3-yl)ethyl] amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one (4-29);
3-phenyl-2-[4-({[2-(lH-l,2,4-triazol-5-yl)ethyl] amino}methyl)phenyl]-l,6-naρ thyridin-5(6H)-one (4- 30);
2-[4-({[(5-oxo-4,5-dihydro-lH-l,2,4-triazol-3-yl)methyl]amino}methyl)phenyl]-3-phenyl-l,6- naphthyridin-5(6H)-one (4-31);
3-phenyl-2-[4-({[2-(3-pyridin-4-yl-lH-l,2,4-triazol-5-yl)ethyl]amino}methyl)phenyl]-l,6-naphthyridin-
5(6H)-one (4-32); 2-[4-({ [2-(lH-benzimidazol-2-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-
33);
3-phenyl-2-(4-{ [(2-pyrazin-2-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one (4-59);
3-phenyl-2-[4-({[2-(lH-l,2,4-triazol-l-yl)etr__yl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one (4- 60);
2-(4-{[(3H-imidazo[4,5-b]pyridin-2-ylmethyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridirι-5(6it_)- one (4-61);
3 -phenyl-2- { 4-[( { 1 -[4-( IH- 1 ,2,4-triazol-l -yl)phenyl] ethyl } amino)methyl]phenyl } - 1 ,6-naphthyridin-
5(6#)-one (4-62); 3-phenyl-2-[4-({ [2-(5-phenyl-2,5-diazabicyclo [2.2. l]hept-2-yl)ethyl]amino}methyl)phenyl]-l,6- naphthyridin-5(6H)-one (4-63);
2-[4-({ [2-(l -methyl- 1 H-benzimidazol-2-y 1) ethyl] amino } methy l)phenyl] -3 -phenyl- 1 ,6-naphthyrϊdin-
5(6H)-one (4-64);
3-phenyl-2-[4-( { [2-(4-pyrimidin-2-ylpiperazϊn- 1 -yl)ethyl] amino }methyl)phenyl] - 1 ,6-naphthyridin-5 (6H)- one (4-65);
2-(4-{ [(3-morpholin-4-ylpropyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-66);
2-[4-({ [2-(4-hydroxyphenyl)ethyl] amino} methyl) phenyl]-3-phenyl-l ,6-naphthyridin-5(6H)-one (4-67);
2-[4-({ [2-(5-methyl-lH-imidazol-4-yl)ethyl] amino }methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)- one (4-68); 2-[4-({ [2-(lH-imidazol-4-yl)ethyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-69);
2-(4-{ [(4-hydroxyphenyl)amino]methyl }phezιyl)-3-phenyl-l ,6-naphthyridin-5(6H)-one (4-70);
2-[4-({ [3-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-71);
2-[4-({ [2-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-72);
2-[4-({ [2-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-73); 2-[4-({ [4-(methylthio)benzyl]amino}methyl) phenyl] -3-phenyl-l,6-naphthyridin-5(6H)-one (4-74);
2-[4-({ [4-(methylsulfonyl)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-75);
2-[4-({ [4-(methylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-76);
2-(4-{ [(3,4-dihydroxybenzyl)amino]met__yl } phenyl)-3-phenyl-l ,6-naphthyridin-5(6H)-one (4-77);
2-[4-({ [(l-methyl-l,2,3,4-tetrahydroquinoliα-6-yl)methyl]amino}methyl)phenyl]-3-phenyl-l,6- naphthyridin-5(6H)-one (4-78);
2-(4-{[(4-chlorobenzyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-79);
2-[4-({ [(l-methyl-2,3-dihydro-lH-indol-5-yl)methyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one (4-80); l,6-naphthyridin-5(6H)-one, 2-[4-[[[(6-methoxy-lH-benzimidazol-2-yl)methyl]amino]methyl] phenyl]-3- phenyl (4-81); 3-phenyl-2-{ 4-[( { [6-(trifluoromethyl)ρyridin-3-yl]methyl } amino)methyl]phenyl } - 1 ,6-naphthyridin-
5(6H)-one (4-82);
2-(4-{[(3-hydroxybenzyl)oxy]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-83);
2-(4-{ [(3-hydroxybenzyl)oxy]methyl }phenyl)-3-phenyl-l ,6-naphthyridin-5(6H)-one (4-84); 2-[4-({ [4-(diethylamino)benzyl] amino Jnnethyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-85);
3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]-3-(pyridine-2-ylamino)propane
(4-87);
2-[(2-hydroxybenzoyl)amino]-N-[4-(5-oxLO-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]ethane (4-
88); 3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]-3-(pyridine-4-ylamino)propane
(4-89);
6-methyl-2-[4-({methyl[4-(lH-pyrazol-l-yl)benzyl] amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one (4-90);
2-[4-({methyl[4-(lH-pyrazol-l-yl)benzyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-91);
6-methyl-3-phenyl-2-[4-( { [4-( lH-pyrazol - 1 -yl)benzyl] amino } methyl) phenyl] - 1 ,6-naphthyridin-5(6H)- one (4-92); and
3-[(2-hydroxyphenyl)amino]-N-{4-[2-(4--tnethylpiperazin-l-yl)-6-phenylpyrido[2,3-d]pyrimidin-7- yl]benzyl}-3-oxopropane (5-6); or a stereoisomer thereof. Specific HC1 salts of the compounds of the instant invention include:
3-phenyl-2-(4-{ [(2-pyridin-2-ylethyl)ami_αo] methyl}phenyl)-l,6-naphthyridin-5(6H)-one (4-34);
3-phenyl-2-(4-{ [(2-pyridin-4-ylethyl)amir_o] methyl}phenyl)-l,6-naphthyridin-5(6H)-one (4-35);
2-[4-({ [2-(2-oxoimidazolidin-l-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4- 36);
2-(4-{ [(2-morpholin-4-ylethyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-37);
2-(4-{ [(2-anilinoethyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-38);
3-phenyl-2-[4-({[2-(pyridin-2-ylamino)et__ιyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one (4-39);
2-[4-({[3-(2-oxopyrrolidin-l-yl)propyl]ar_nino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4- 40);
2-[4-({ [4-(dimethylamino)benzyl] amino} methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-41);
2-(4-{[(l,3-benzodioxol-5-ylmethyl)amirιo] methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-42);
N-(2-{[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}ethyl)-lH-l,2,4-triazole-3- carboxamide (4-43); 2-[4-({ [2-(lH-benzimidazol-l-yl)ethyl] amino} methyl)phenyl] -3-phenyl-l,6-naphthyridin-5(6H)-one (4-
44);
2-(4-{ [(3,5-dimethoxybenzyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-45);
3-phenyl-2-[4-({[4-(lH-pyrrol-l-yl)benzyl]amino} methyl)ph&nyl]-l,6-naphthyridin-5(6H)-one (4-46); 2-[4-({ [2-(3,4-dimethoxyphenyl)ethyl]amino } methyl)phenyl]-3-phenyl-l ,6-naphthyridin-5(6H)-one (4-
47);
2-[4-({[2-(6-methoxy-lH-indol-3-yl)ethyl] amino} methyl)phe_nyl]-3-phenyl-l,6-naphthyridin-5(6H)-one
(4-48);
2-(4-{ [(4-morpholin-4-ylbenzyl)amino] methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4-49); 3-phenyl-2-[4-({ [3-(lH-l,2,3-triazol-l-yl)propyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one (4-
50);
2-(4-{ [(4-hydroxybenzyl)amino]methyl }phenyl)-3-phenyl-l,6-_naphthyridin-5(6H)-one (4-51);
3-phenyl-2-(4-{ [(2-{[5-(trifluoromethyl)pyridin-2-yl]an_ino}et_hyl)amino]methyl}phenyl)-l,6- naphthyridin-5(6H)-one (4-52); 2-(4-{[(imidazo[l,2-a]pyridin-2-ylmethyl)amino] methyl}pheαyl)-3-phenyl-l,6-naphthyridin-5(6H)-one
(4-53);
4-({[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)ben___yl]amino}methyl) benzenesulfonamide
(4-54);
2-[4-({[2-(2-an_ino-4-methyl-l,3-thiazol-5-yl)ethyl]amino}met_hyl)phenyl]-3-phenyl-l,6-naphthyridin- 5(6H)-one (4-55);
2-[4-({[4-(lH-i__ιidazol-4-yl)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one (4-56);
2-[4-({[2-(3,5-dimethyl-lH-pyrazol-4-yl)ethyl] amino}methyl)phenyl]-3-ρhenyl-l,6-naphthyridin-5(6H)- one (4-57); and
2-(4-{[(l,3-benzothiazol-2-ylmethyl)amino] methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one (4- 58); or a stereoisomer thereof. The compounds of the present invention may have asymmetric centers, chiral axes, and chiral planes (as described in: E.L. Eliel and S.H. Wilen, Stereochemistry of Carbon Compounds, John
Wiley & Sons, New York, 1994, pages 1119-1190), and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers and mixtures thereof, including optical isomers, all such stereoisomers being included in the present invention. In addition, the compounds disclosed herein may exist as tautomers and both tautomeric forms are intended to be encompassed by the scope of the invexition, even though only one tautomeric structure is depicted. For example, any claim to compound A below is understood to include tautomeric structure B, and vice versa, as well as mixtures thereof. The t^ o tautomeric forms of the benzimidazolonyl moiety are also within the scope of the instant invention.
Figure imgf000018_0001
Tetrazoles exist as a mixture of 1H72H tautorners. The tautomeric forms of the tetrazol moiety are also within the scope of the instant invention.
Figure imgf000018_0002
wherein Rl is oxo, encompasses compounds
Figure imgf000018_0003
that have the following moiety: O When any variable (e.g. Rl and Rz', etc.) occurs more than one time in any constituent, its definition on each occurrence is independent at every other occurrence. Also, combinations of substituents and variables are permissible only if such combinations result in stable compounds. Lines drawn into the ring systems from substituents represent that the indicated bond may be attached to any of the substitutable ring atoms. If the ring system is polycyclic, it is intended that the bond be attached to any of the suitable atoms on the polycyclic moiety. It is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure results. The phrase "optionally substituted with one or more substituents" means, in one embodiment, "zero to four substituents" and, in another embodiment, "zero to three substituents". As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms. For example, Cι-Cχo, as in "Cχ-Cιo alkyl" is defined to include groups having 1, 2, 3, 4, 5, 6, 7, 8, 9 or lO carbons in a linear or branched arrangement. For example, "Ci-Cio alkyl" specifically includes methyl, ethyl, τ_-propyl, i- propyl, n-butyl, t-butyl, .-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, and so on. The term
"cycloalkyl" means a monocyclic saturated aliphatic hydrocarbon group having the specified number of carbon atoms. For example, "cycloalkyl" includes cyclopropyl, methyl-cyclopropyl, 2,2-dimethyl- cyclobutyl, 2-ethyl-cyclopentyl, cyclohexyl, and so on. "Alkoxy" represents either a cyclic or non-cyclic alkyl group of indicated number of carbon atoms attached through an oxygen bridge. "Alkoxy" therefore encompasses the definitions of alkyl and cycloalkyl above. If no number of carbon atoms is specified, the term "alkenyl" refers to a non-aromatic hydrocarbon radical, straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon double bond. In an embodiment, one carbon to carbon double bond is present, and up to four non-aromatic carbon-carbon double bonds may be present. Thus, "C2-Cβ alkenyl" means an alkenyl radical having from 2 to 6 carbon atoms. Alkenyl groups include ethenyl, propenyl, butenyl, 2- methylbutenyl and cyclohexenyl. The straight, branched or cyclic portion of the alkenyl group may contain double bonds and may be substituted if a substituted alkenyl group is indicated. The term "alkynyl" refers to a hydrocarbon radical straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon triple bond. Up to three carbon- carbon triple bonds may be present. Thus, "C2-C6 alkynyl" means an alkynyl radical having from 2 to 6 carbon atoms. Alkynyl groups include ethynyl, propynyl, butynyl, 3-methylbntynyl and so on. The straight, branched or cyclic portion of the alkynyl group may contain triple bonds and may be substituted if a substituted alkynyl group is indicated. In certain instances, substituents may be defined with a range of carbons that includes zero, such as (C()-C6)a_kylene-aryl. If aryl is taken to be phenyl, this definition would include phenyl itself as well as -CH2PI1, -CH2CH2Ph, -CH(CH3)CH2CH(CH3)Ph, and so on. As used herein, "aryl" is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 atoms in each ring, wherein at least one ring is aromatic. Examples of such aryl elements include phenyl, naphthyl, tetrahydro-naphthyl, indanyl and biphenyl. In cases where the aryl substituent is bicyclic and one ring is non-aromatic, it is understood that attachment is via the aromatic ring. The term "heterocycle" or "heterocyclyl" as used herein is intended to mean a 3- to 10- membered aromatic or nonaromatic heterocycle containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S, and includes bicyclic groups. "Heterocyclyl" therefore includes the above mentioned heteroaryls, as well as dihydro and tetrathydro analogs thereof. Further examples of "heterocyclyl" include, but are not limited to the following: benzoimidazolyl, benzoimidazoloixyl, benzofuranyl, benzofurazanyl, benzopyrazolyl, benzotriazolyl, benzothiophenyl, benzoxazolyl, carbazolyl, carbolinyl, cinnolinyl, furanyl, imidazolyl, indolinyl, indolyl, indolazinyl, indazolyL, isobenzofuranyl, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthpyridinyl, oxadiazolyl, oxazolyl, oxazoline, isoxazoline, oxetanyl, pyranyl, pyrazinyl, pyrazolopyrimidinyl, pyrazolyl, pyridazuryl, pyridopyridinyl, pyridazinyl, pyridyl, pyrimidyl, pyrrolyl, quinazolinyl, quinolyl, quinoxalinyl, tetrahydropyranyl, tetrazolyl, tetrazolopyridyl, thiadiazolyl, thiazolyl, thienyl, triazolyl, azetidinyl, 1,4- dioxanyl, hexahydroazepinyl, piperazinyl, piperidinyl, pyridin-2-onyl, pyrrolidinyl, morpholinyl, thiomorpholinyl, dihydrobenzoimidazolyl, dihydrobenzofuranyl, dihydrobenzothiophenyl, dihydrobenzoxazolyl, dihydrofuranyl, dihydroimidazolyl, dihydroindolyl, dihydroisooxazolyl, dihydroisothiazolyl, dihydrooxadiazolyl, dihydrooxazolyl, dihydropyrazinyl, dihydropyrazolyL , dihydropyridinyl, dihydropyrimidinyl, dihydropyrrolyl, dihydroquinolinyl, dihydrotetrazolyl, dihydrothiadiazolyl, dihydrothiazolyl, dihydrothienyl, dihydrotriazolyl, dihydroazetidinyl, methylenedioxybenzoyl, tetrahydrofuranyl, and tetrahydrothienyl, and N-oxides thereof. Attaclhment of a heterocyclyl substituent can occur via a carbon atom or via a heteroatom. In another embodiment, heterocyclyl is selected from 2-azepinone, benzimidaz;olyl, benzimidazolonyl, 2-diazapinone, imidazolyl, 2-imidazolidinone, indolyl, isoquinolinyl, morp _olinyl, piperidyl, piperazinyl, pyridyl, pyrrolidinyl, 2-piperidinone, 2-pyrimidinone, 2-pyrollidinone, qL"uinolinyl, tetrazolyl, tetrahydrofuryl, tetrahydroisoquinolinyl, thienyl, pyrazolopyrimidinyl, pyrazolyl, thiazolyl, oxadiazolyl and triazolyl. As appreciated by those of skill in the art, "halo" or "halogen" as used herein is intended to include chloro, fluoro, bromo and iodo.
Figure imgf000020_0001
In anot er em o ment, hi an embodiment, Rl is independently selected from: S(Cχ-C6)alkyl, (C=0)NT_H2> (C - C6)alkyl, CO2H, halo, CN, OH, Oa-P=0(OH)2, oxo, CHO and heterocyclyl, said heterocyclyl is selected from:
Figure imgf000021_0001
optionally substituted with 1-3 substituents selected fromRz . In another embodiment, Rl is selected from: S(Cι-C6)alkyl and (C=0)NH2- In a further embodiment, Rl is selected from: S-CH3. In still a further embodiment, Rl is selected from: (C=0)NH2- In an embodiment, R is selected from: H and CH3. In another embodiment, R is selected from: H. In an embodiment, R3 is selected from: phenyl, heterocyclyl, N(H)-heterocyclyl and (C=0)R6, said phenyl and heterocyclyl optionally substituted with 1-3 substituents selected from Rz'. In another embodiment, when R3 is heterocyclyl, said heterocyclyl is selected from:
Figure imgf000021_0002
optionally substituted with 1-3 substituents selected from Rz'. In a further embodiment, when R3 is heterocyclyl, said heterocyclyl is selected from:
Figure imgf000022_0001
optionally substituted with 1-3 substituents selected fromR2'. In an embodiment, R6 is independently selected from: H, NH2, phenyl and heterocyclyl, said phenyl and heterocyclyl optionally substituted with 1-3 substituents selected from Rz'. In a further embodiment, when R6 is heterocyclyl, said heterocyclyl is selected from:
Figure imgf000022_0002
optionally substituted with 1-3 substituents selected fromRz'. In yet a further embodiment, when R6 is heterocyclyl, said heterocyclyl is selected from:
Figure imgf000022_0003
optionally substituted with 1-3 substituents selected from Rz'. In another embodiment, Rb is H. another embodiment, Rz is selected from: (Cχ-C6)alkyl, (C=0)(Cχ-C6)alkyl, halogen, phenyl, OH, Oa-P=0(OH)2, and oxo. hi another embodiment, Rz' is selected from: NH2, NO2, oxo, (Cl-C6)alkyl, OH, S(0)2NH2. In a fourth embodiment of this invention, the inhibitors of Akt activity are illustrated by the Formula A- 1:
Figure imgf000022_0004
wherein:
Figure imgf000023_0001
a is 0 or 1; b is 0 or 1; m is 0, 1, or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, 4 or 5; Rl is independently selected from: H,
Figure imgf000023_0002
alkyl, (C=0)aOb aryl,
(C=O)aObC2-Ci0 alkenyl, (C=0)aObC2-Cio alkynyl, CO2H, halo, OH, oxo, ObCχ-C6 perfluoroalkyl, (C=0)aNR7R8, CN, (C=0)aObC3-C8 cycloalkyl, S(0)mNR7R8, S(O)m-(Cι-Ci0)alkyl and (C=0)aObheterocyclyl, said alkyl, aryl, alkenyl, alkynyl, cycloalkyl, and heterocyclyl is optionally substituted with one or more substituents selected from R6 ; R2' is independently selected from: H, (C=O)aObCι-Ci0 alkyl, (C=0)aOb aryl,
(C=O)aObC2-Ci0 alkenyl, (C=0)aObC2-Clθ alkynyl, CO2H, halo, OH, oxo, ObCχ-C6 perfluoroalkyl, (C=0)aNR7R8, CN,
Figure imgf000023_0003
cycloalkyl, S(0)mNR7R8, S(O)m-(Cι-Ci0)alkyl and (C=0)aObheterocyclyl, said alkyl, aryl, alkenyl, alkynyl, cycloalkyl, and heterocyclyl is optionally substituted with one or more substituents selected from RO'; R3' is independently selected from: H, (C=0)aObCl-Cιo alkyl, (C=0)aOb aryl,
(C=0)aObC2-Cιo alkenyl, (C=0)aObθ2-Cιo alkynyl, CO2H, halo, OH, oxo, ObCχ-C6 perfluoroalkyl, (C=0)aNR7R8, CN, (C=0)aObC3-C8 cycloalkyl, S(0)mNR7R8, S(O)m-(Cι-Cι0)alkyl and (C=0)aObheterocyclyl, said alkyl, aryl, alkenyl, alkynyl, cycloalkyl, and heterocyclyl is optionally substituted with one or more substituents selected from R6 ; R4' is independently selected from: H, (C=O)aObCi-Cl0 alkyl, (C=0)aOb aryl,
(C=O)aObC2-Ci0 alkenyl,
Figure imgf000023_0004
alkynyl, CO2H, halo, OH, oxo, ObCχ-C6 perfluoroalkyl, (C=0)aNR7R8, CN, (C=0)aObC3-Cs cycloalkyl, S(0)mNR7R8, S(0)m-(Cι-Cιo)alkyl and (C=0)aObheterocyclyl, said alkyl, aryl, alkenyl, alkynyl, cycloalkyl, and heterocyclyl is optionally substituted with one or more substituents selected from R6'; R6' is independently: (C=0)aObCι-Cιo alkyl, (C=0)aObaryl, C2-C10 alkenyl, C2-C10 alkynyl, (C=0)aOb heterocyclyl, CO2H, halo, CN, OH, ObCι-C6 perfluoroalkyl, Oa(C=0)bNR7R8, oxo, CHO, (N=0)R7R8, S(0)mNR7R8, S(0)m-(Cι-Cιo)alkyl or
Figure imgf000024_0001
cycloalkyl, said alkyl, aryl, alkenyl, alkynyl, heterocyclyl, and cycloalkyl optionally substituted with one or more substituents selcted from R6a; R6a is selected from:
Figure imgf000024_0002
Oa(Cι-C3)perfluoroalkyl, (Co- C6)alkylene-S(0)mRa, oxo, OH, halo, CN, NO2, (C2-Cιo)alkenyl, (C2-Cιo)alkynyl, (C3-C6)cycloalkyl, (Co-C6)alkylene-aryl, (Co-C6)alkylene-heterocyclyl, (Co-C6)alkylene-N(Rb)2, C(0)Ra, ( )- C6)alkylene-C02Ra, C(0)H, and (Co-C6)alkylene-C02H, said alkyl, alkenyl, alkynyl, cycloalkyl, aryl, and heterocyclyl is optionally substituted with up to three substituents selected from Rb, OH, (Ci- Ce)alkoxy, halogen, CO2H, CN, 0(C=0)Cι-C6 alkyl, oxo, and N(Rb)2; R7 and R8 are independently selected from: H, (C=0)ObCι-Cιo alkyl, (C=0)ObC3-Cs cycloalkyl, (C=0)Obaryl, (C=0)Obheterocyclyl, Cχ-Cιo alkyl, aryl, C2-C10 alkenyl, C2-C10 alkynyl, heterocyclyl, C3-C8 cycloalkyl, Sθ2Ra, and (C=0)NRb2, said alkyl, cycloalkyl, aryl, heterocylyl, alkenyl, and alkynyl is optionally substituted with one or more substituents selected from R^ , or R and R8 can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 5-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocylcic or bicyclic heterocycle optionally substituted with one or more substituents selected from R6a; Ra is NH2, (Cι-C6)alkyl, (C3-C6)cycloalkyl, aryl, or heterocyclyl; and Rb is independently H, (Cj.-C6)alkyl, aryl, heterocyclyl, (C3-C6)cycloalkyl, (C=0)OCι- C alkyl, (C=0)Cχ-C6 alkyl or S(0)2Ra; or a pharmaceutically acceptable salt or a stereoisomer thereof. In a fifth embodiment of this invention, the inhibitors of Akt activity are illustrated by the Formula A- 1: wherein:
Figure imgf000024_0003
all other substituents and variables are as defined in the fourth embodiment; or a pharmaceutically acceptable salt or a stereoisomer thereof. In a sixth embodiment of this invention, the inhibitors of Akt activity are illustrated by the Formula B-l:
Figure imgf000025_0001
wherein: n is 0, 1 or 2; R2' is independently selected from: H, (Cι-C6)alkyl and (C3-C8)cycloalkyl; all other substituents and variables are as defined in the fifth embodiment; or a pharmaceutically acceptable salt or a stereoisomer thereof. In a seveth embodiment of this invention, the inhibitors of Akt activity are illustrated by the Formula B-l: wherein: R2' is: H or (Cι-C6)alkyl; all other substituents and variables are as defined in the sixth embodiment; or a pharmaceutically acceptable salt or a stereoisomer thereof. In an embodiment, Rl is independently selected from: S(Cι-C6)alkyl, (C=0)NH2, (Ci- Cβ)alkyl, CO2H, halo, CN, OH, Oa-P=0(OH)2, oxo, CHO and heterocyclyl, said heterocyclyl is selected from:
Figure imgf000025_0002
optionally substituted with 1-3 substituents selected from R6'. In another embodiment, R ' is selected from: H and (Cι-C6)alkyl. In another embodiment, R6' is selected from: NH2, NO2, oxo, (Cι-C6)alkyl, OH, S(0)2NH2. Included in the instant invention is the free form of compounds of Formula A, as well as the pharmaceutically acceptable salts and stereoisomers thereof. Some of the isolated specific compounds exemplified herein are the protonated salts of amine compounds. The term "free form" refers to the amine compounds in non-salt form. The encompassed pharmaceutically acceptable salts not only include the isolated salts exemplified for the specific compounds described herein, but also all the typical pharmaceutically acceptable salts of the free form of compounds of Formula A. The free form of the specific salt compounds described may be isolated using techniques known in the art. For example, the free form may be regenerated by treating the salt with a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate. The free forms may differ from their respective salt forms somewhat in certain physical properties, such as solubility in polar solvents, but the acid and base salts are otherwise pharmaceutically equivalent to their respective free forms for purposes of the invention. The pharmaceutically acceptable salts of the instant compounds can be synthesized from the compounds of this invention which contain a basic or acidic moiety by conventional chemical methods. Generally, the salts of the basic compounds are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents. Similarly, the salts of the acidic compounds are formed by reactions with the appropriate inorganic or organic base. Thus, pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed by reacting a basic instant compound with an inorganic or organic acid. For example, conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like, as well as salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic (TFA) and the like. When the compound of the present invention is acidic, suitable "pharmaceutically acceptable salts" refers to salts prepared form pharmaceutically acceptable non-toxic bases including inorganic bases and organic bases. Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc and the like. Particularly preferred are the ammonium, calcium, magnesium, potassium and sodium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as arginine, betaine caffeine, choline, N,N!- dibenzylethylenediamine, diethylamin, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine tripropylamine, tromethamine and the like. The preparation of the pharmaceutically acceptable salts described above and other typical pharmaceutically acceptable salts is more fully described by Berg et al., "Pharmaceutical Salts," J. Pharm. Set, 1977:66:1-19. It will also be noted that the compounds of the present invention are potentially internal salts or zwitterions, since under physiological conditions a deprotonated acidic moiety in the compound, such as a carboxyl group, may be anionic, and this electronic charge might then be balanced off internally against the cationic charge of a protonated or alkylated basic moiety, such as a quaternary nitrogen atom. UTILITY The compounds of the instant invention are inhibitors of the activity of Akt and are thus useful in the treatment of cancer, in particular cancers associated with irregularities in the activity of Akt and downstream cellular targets of Akt. Such cancers include, but are not limited to, ovarian, pancreatic, breast and prostate cancer, as well as cancers (including glioblastoma) where the tumor suppressor PTEN is mutated (Cheng et al., Proc. Natl. Acad. Sci. (1992) 89:9267-9271; Cheng et al., Proc. Natl. Acad. Sci. (1996) 93:3636-3641; Bellacosa et al., Int. J. Cancer (1995) 64:280-285; Nakatani et al., J. Biol. Chem. (1999) 274:21528-21532; Graff, Expert. Opin. Ther. Targets (2002) 6(1): 103-113; and Yamada and
Araki, J. Cell Science. (20O1) 114:2375-2382; Mischel and Cloughesy, Brain Pathol. (2003) 13(1):52- 61). The compounds, compositions and methods provided herein are particularly deemed useful for the treatment of cancer including solid tumors such as skin, breast, brain, cervical carcinomas, testicular carcinomas, etc. More particularly, cancers that may be treated by the compounds, compositions and methods of the invention include, but are not limited to: Cardiac: sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma; Lung: bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma; Gastrointestinal: esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, vipoma), small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large bowel (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma); Genitourinary tract: kidney (adenocarcinoma, Wilm's tumor [nephroblastoma], lymphoma, leukemia), bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate (adenocarcinoma, sarcoma), testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma); Liver: hepatoma (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, hemangioma; Bone: osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant cell tumor chordoma, osteochronfroma (osteocartilaginous exostoses), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors; Nervous system: skull (osteoma, hemangioma, granuloma, xanthoma, osteitis deformans), meninges (meningioma, meningiosarcoma, gliomatosis), brain (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma [pinealoma], glioblastoma multiform, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors), spinal cord neurofibroma, meningioma, glioma, sarcoma); Gynecological: uterus (endometrial carcinoma), cervix (cervical carcinoma, pre-tumor cervical dysplasia), ovaries (ovarian carcinoma [serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma], granulosa-thecal cell tumors, Sertoli-Leydig cell tumors, dysgerminoma, malignant teratoma), vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma (embryonal rhabdomyosarcoma), fallopian tubes (carcinoma); Hematologic: blood (myeloid leukemia [acute and chronic], acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, non-Hodgkin's lymphoma [malignant lymphoma]; Skin: malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi's sarcoma, moles dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, psoriasis; and Adrenal glands: neuroblastoma. Thus, the term "cancerous cell" as provided herein, includes a cell afflicted by any one of the above-identified conditions. Akt signaling regulates multiple critical steps in angiogenesis. Shiojima and Walsh, Circ. Res. (2002) 90: 1243-1250. The utility of angiogenesis inhibitors in the treatment of cancer is known in the literature, see J. Rak et al. Cancer Research, 55:4575-4580, 1995 and Dredge et al., Expert Opin. Biol. Tlier. (2002) 2(8):953-966, for example. The role of angiogenesis in cancer has been shown in numerous types of cancer and tissues: breast carcinoma (G. Gasparini and A.L. Harris, J. Clin. Oncol, 1995, 13:765-782; M. Toi et al., Japan. J. Cancer Res., 1994, 85:1045-1049); bladder carcinomas (A.J. Dickinson et al., Br. J. Urol, 1994, 74:762-766); colon carcinomas (L.M. Ellis et al., Surgery, 1996, 120(5): 871-878); and oral cavity tumors (J.K. Williams et al., Am. J. Surg., 1994, 168:373-380). Other cancers include, advanced tumors, hairy cell leukemia, melanoma, advanced head and neck, metastatic renal cell, non-Hodgkin's lymphoma, metastatic breast, breast adenocarcinoma, advanced melanoma, pancreatic, gastric, glioblastoma, lung, ovarian, non-small cell lung, prostate, small cell lung, renal cell carcinoma, various solid tumors, multiple myeloma, metastatic prostate, malignant glioma, renal cancer, lymphoma, refractory metastatic disease, refractory multiple myeloma, cervical cancer, Kaposi's sarcoma, recurrent anaplastic glioma, and metastatic colon cancer (Dredge et al., Expert Opin. Biol. Ther. (2002) 2(8):953-966). Thus, the Akt inhibitors disclosed in the instant application are also useful in the treatment of these angiogenesis related cancers. Tumors which have undergone neovascularization show an increased potential for metastasis. In fact, angiogenesis is essential for tumor growth and metastasis. (S.P. Cunningham, et al., Can. Research, 61: 3206-3211 (2001)). The Akt inhibitors disclosed in the present application are therefore also useful to prevent or decrease tumor cell metastasis. Further included within the scope of the invention is a method of treating or preventing a disease in which angiogenesis is implicated, which is comprised of administering to a mammal in need of such treatment a therapeutically effective amount of a compound of the present invention. Ocular neovascular diseases are an example of conditions where much of the resulting tissue damage can be attributed to aberrant infiltration of blood vessels in the eye (see WO 00/30651, published 2 June 2000). The undesireable infiltration can be triggered by ischemic retinopathy, such as that resulting from diabetic retinopathy, retinopathy of prematurity, retinal vein occlusions, etc., or by degenerative diseases, such as the choroidal neovascularization observed in age-related macular degeneration. Inhibiting the growth of blood vessels by administration of the present compounds would therefore prevent the infiltration of blood vessels and prevent or treat diseases where angiogenesis is implicated, such as ocular diseases like retinal vascularization, diabetic retinopathy, age-related macular degeneration, and the like. Further included within the scope of the invention is a method of treating or preventing a non-malignant disease in which angiogenesis is implicated, including but not limited to: ocular diseases (such as, retinal vascularization, diabetic retinopathy and age-related macular degeneration), atherosclerosis, arthritis, psoriasis, obesity and Alzheimer's disease (Dredge et al., Expert Opin. Biol. Ηier. (2002) 2(8):953-966). In another embodiment, a method of treating or preventing a disease in which angiogenesis is implicated includes: ocular diseases (such as, retinal vascularization, diabetic retinopathy and age-related macular degeneration), atherosclerosis, arthritis and psoriasis. Further included within the scope of the invention is a method of treating hyperproliferative disorders such as restenosis, inflammation, autoimmune diseases and allergy/asthma. Further included within the scope of the invention is a method of treating hyperinsulinism. The compounds of the invention are also useful in preparing a medicament that is useful in treating the diseases described above, in particular cancer. i an embodiment of the invention, the instant compound is a selective inhibitor whose inhibitory efficacy is dependent on the PH domain, i this embodiment, the compound exhibits a decrease in in vitro inhibitory activity or no in vitro inhibitory activity against truncated Akt proteins lacking the PH domain. In a further embodiment, the instant compound is selected from the group of a selective inhibitor of Aktl, a selective inhibitor of Akt2 and a selective inhibitor of both Aktl and Akt2. In another embodiment, the instant compound is selected from the group of a selective inhibitor of Aktl, a selective inhibitor of Akt2, a selective inhibitor of Akt3 and a selective inhibitor of two of the three Akt isoforms. In another embodiment, the instant compound is a selective inhibitor of all three Akt isoforms, but is not an inhibitor of one, two or all of such Akt isoforms that have been modified to delete the PH domain, the hinge region or both the PH domain and the hinge region. The present invention is further directed to a method of inhibiting Akt activity which comprises administering to a mammal in need thereof a pharmaceutically effective amount of the instant compound. The compounds of this invention may be administered to mammals, including humans, either alone or, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice. The compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. The pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a water soluble taste masking material such as hydroxypropylmethyl-cellulose or hydroxypropylcellulose, or a time delay material such as ethyl cellulose, cellulose acetate buryrate may be employed. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyleneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil. Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymettrylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinyl- pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents ay be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene-oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame. Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax:, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as butyl ated hydroxy anisol or alpha-tocopherol. Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid. The pharmaceutical compositions of the invention may also be in the form of an oil-in- water emulsion. The oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifying agents may be naturally- occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening, flavouring agents, preservatives and antioxidants. Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant. The pharmaceutical compositions may be in the form of sterile injectable aqueous solutions. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. The sterile injectable preparation may also be a sterile injectable oil-in-water microemulsion where the active ingredient is dissolved in the oily phase. For example, the active ingredient may be first dissolved in a mixture of soybean oil and lecithin. The oil solution then introduced into a water and glycerol mixture and processed to form a microemulation. The injectable solutions or microemulsions may be introduced into a patient's bloodstream by local bolus injection. Alternatively, it may be advantageous to administer the solution or microemulsion in such a way as to maintain a constant circulating concentration of the instant compound. In order to maintain such a constant concentration, a continuous intravenous delivery device may be utilized. An example of such a device is the Deltec CADD-PLUS™ model 540O intravenous pump. The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration. This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butane diol. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. hi addition, fatty acids such as oleic acid find use in the preparation of injectables. Compounds of Formula A may also be administered in the form of suppositories for rectal administration, of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol. For topical use, creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A are employed. (For purposes of this application, topical application shall include mouth washes and gargles.) The compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. Compounds of the present invention may also be delivered as a suppository employing bases such as cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol. When a composition according to this invention is administered into a human subject, the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, and response of the individual patient, as well as the severity of the patient's symptoms. In an embodiment, a suitable amount of an inhibitor of Akt is administered to a mammal undergoing treatment for cancer. Administration occurs in an amount of inhibitor of between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, or between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day. Another therapeutic dosage that comprises the instant composition includes from about 0.01 mg to about 1000 mg of inhibitor of Akt. i another embodiment, the dosage comprises from about 1 mg to about 1000 mg of inhibitor of Akt. The instant compounds are also useful in combination with known therapeutic agents and anti-cancer agents. For example, instant compounds are useful in combination with known anticancer agents. Combinations of the presently disclosed compounds with other anti-cancer or chemotherapeutic agents are within the scope of the invention. Examples of such agents can be found in Cancer Principles and Practice of Oncology by N.T. Devita and S. Hellman (editors), 6th edition (February 15, 2001), Lippincott Williams & Wilkins Publishers. A person of ordinary skill in the art would be able to discern which combinations of agents would be useful based on the particular characteristics of the drugs and the cancer involved. Such anti-cancer agents include the following: estrogen receptor modulators, androgen receptor modulators, retinoid receptor modulators, cytotoxic/cytostatic agents, antiproliferative agents, prenyl-protein transferase inhibitors, HMG-CoA reductase inhibitors and other angiogenesis inhibitors, inhibitors of cell proliferation and survival signaling, and agents that interfere with cell cycle check-points. The instant compounds are particularly useful when co-administered with radiation therapy. i an embodiment, the instant compounds are also useful in combination with known anti-cancer agents including the following: estrogen receptor modulators, androgen receptor modulators, retinoid receptor modulators, cytotoxic agents, antiprolif erative agents, prenyl-protein transferase inhibitors, HMG-CoA reductase inhibitors, BQN protease inhibitors, reverse transcriptase inhibitors, and other angiogenesis inhibitors. "Estrogen receptor modulators" refers to compounds that interfere with or inhibit the binding of estrogen to the receptor, regardless of mechanism. Examples of estrogen receptor modulators include, but are not limited to, tamoxifen, raloxifene, idoxifene, LY353381, LY117081, toremifene, fulvestrant, 4-[7-(2,2-dimethyl-l-oxopropoxy-4-methyl-2-[4-[2-(l-piperidinyl)ethoxy]phenyl]-2H-l- benzopyran-3-yl]-phenyl-2,2-dimethylpropanoate, 4,4'-dihydroxybenzophenone-2,4-dinitrophenyl- hydrazone, and SH646. "Androgen receptor modulators" refers to compounds which interfere or inhibit the binding of androgens to the receptor, regardless of mechanism. Examples of androgen receptor modulators include finasteride and other 5α-reductase inhibitors, nilutamide, flutamide, bicalutamide, liarozole, and abiraterone acetate. "Retinoid receptor modulators" refers to compounds which interfere or inhibit the binding of retinoids to the receptor, regardless of mechanism. Examples of such retinoid receptor modulators include bexarotene, tretinoin, 13-cis-retinoic acid, 9-cis-retinoic acid, α- difluoromethylomithine, ILX23-7553, trans-Ν-(4'-hydroxyphenyl) retinamide, and N-4-carboxyphenyl retinamide. "Cytotoxic/cytostatic agents" refer to compounds which cause cell death or inhibit cell proliferation primarily by interfering directly with the cell's functioning or inhibit or interfere with cell myosis, including alkylating agents, tumor necrosis factors, intercalators, hypoxia activatable compounds, microtubule inhibitors/ microtubule-stabilizing agents, inhibitors of mitotic kinesins, histone deacetylase inhibitors, inhibitors of kinases involved in mitotic progression, inhibitors of kinases involved in growth factor and cytokine signal transduction pathways, antimetabolites, biological response modifiers, hormonal/anti-hormonal therapeutic agents, haematopoietic growth factors, monoclonal antibody targeted therapeutic agents, topoisomerase inhibitors, proteosome inhibitors and ubiquitin ligase inhibitors. Examples of cytotoxic/cytostatic agents include, but are not limited to, sertenef, cachectin, ifosfamide, tasonermin, lonidamine, carboplatin, altretamine, prednimustine, dibromodulcitol, ranimustine, fotemustine, nedaplatin, oxaliplatin, temozolomide, heptaplatin, estramustine, improsulfan tosilate, trofosfamide, nimustine, dibrospidium chloride, pumitepa, lobaplatin, satraplatin, profiromycin, cisplatin, irofulven, dexifosfamide, cis-aminedichloro(2-methyl-pyridine)platinum, benzylguanine, glufosfamide, GPX100, (trans, trans, frans)-bis-mu-(hexane-l,6-diarnine)-mu-[diamine- platinum(π)]bis[diamine(chloro)platinum (II)]tetrachloride, diarizidinylspermine, arsenic trioxide, 1-(11- dodecylamino-10-hydroxyundecyl)-3J-dimethylxanthine, zorubicin, idarubicin, daunorubicin, bisantrene, mitoxantrone, pirarubicin, pinafide, valrubicin, amrubicin, antineoplaston, 3'-deamino-3'- morpholino-13-deoxo-10-hydroxycarminomycin, annamycin, galarubicin, elinafide, MEN10755, 4- demethoxy-3-deamino-3-aziridinyl-4-methylsulphonyl-daunorubicin (see WO 00/50032), Raf kinase inhibitors (such as Bay43-9006) and mTOR inhibitors (such as Wyeth's CCI-779). An example of a hypoxia activatable compound is tirapazamine. Examples of proteosome inhibitors include but are not limited to lactacystin and MLN-
341 (Velcade). Examples of microtubule inhibitors/microtubule-stabilising agents include paclitaxel, vindesine sulfate, 3',4'-didehydro-4'-deoxy-8'-norvincaleukoblastine, docetaxol, rhizoxin, dolastatin, mivobulin isethionate, auristatin, cemadotin, RPR109881, BMS 184-476, vinflunine, cryptophycin, 2,3,4,5,6-pentafluoro-N-(3-fluoro-4-methoxyphenyl) benzene sulfonamide, anhydrovinblastine, N,N- dimethyl-L-valyl-L-valyl-N-methyl-L-valyl-L-prolyl-L-proline-t-butylamide, TDX258, the epothilones (see for example U.S. Pat. Nos. 6,284,781 and 6,288,237) and BMS 188797. In an embodiment the epothilones are not included in the microtubule inhibitors/microtubiile-stabilising agents. Some examples of topoisomerase inhibitors are topotecan, hycaptamine, irinotecan, rubitecan, 6-ethoxypropionyl-3',4'-0-exo-benzylidene-chartreusin, 9-methoxy-N,N-dimethyl-5- nitropyrazolo[3,4,5-kl]acridine-2-(6H) propanamine, l-amino-9-etl_Lyl-5-fluoro-2,3-dihydro-9-hydroxy-4- methyl-lH,12H-benzo[de]pyrano[3',4':bJ]-indolizino[l,2b]quinoline-10,13(9H,15H)dione, lurtotecan, 7-[2-(N-isopropylamino)ethyl]-(20S)camptothecin, BNP1350, BNPHIOO, BN80915, BN80942, etoposide phosphate, teniposide, sobuzoxane, 2'-dimethylamino-2'-deoxy-etoposide, GL331, N-[2- (dimethylamino)ethyl] -9-hydroxy-5 ,6-dimethyl-6H-pyrido [4,3-b] c rbazole- 1 -carboxamide, asulacrine, (5a, 5aB, 8aa,9b)-9-[2-[N-[2-(dimethylamino)ethyl]-N-methylamino]ethyl]-5-[4-hydroOxy-3,5- dimethoxyphenyl]-5,5a,6,8,8a,9-hexohydrofuro(3',4':6,7)naphtho(_2,3-d)-l,3-dioxol-6-one, 2,3- (methylenedioxy)-5-methyl-7-hydroxy-8-methoxybenzo[c]-phenanthridinium, 6,9-bis[(2- aminoethyl)amino]benzo[g]isoguinoline-5,10-dione, 5-(3-aminopropylaιr_ino)-7,10-dihydroxy-2-(2- hydroxyethylaminomethyl)-6H-pyrazolo[4,5,l-de]acridin-6-one, N-[l-[2(diethylamino)ethylamino]-7- methoxy-9-oxo-9H-thioxanthen-4-ylmethyl]formamide, N-(2-(dimethylammo)ethyl)acridine-4- carboxamide, 6-[[2-(dimethylamino)ethyl]amino]-3-hydroxy-7H-indeno[2,l-c] quinolin-7-one, and dimesna. Examples of inhibitors of mitotic kinesins, and in particular the human mitotic kinesin KSP, are described in PCT Publications WO 01/30768 and WO 01/98278, and pending U.S. Ser. Nos. 60/338,779 (filed December 6, 2001), 60/338,344 (filed December 6, 2001), 60/338,383 (filed December 6, 2001), 60/338,380 (filed December 6, 2001), 60/338,379 (filed December 6, 2O01) and 60/344,453 (filed November 7, 2001). In an embodiment inhibitors of mitotic kinesins include, but are not limited to inhibitors of KSP, inhibitors of MKLP1, inhibitors of CENP-E, inhibitors of MCAK and inhibitors of Rab6-K_FL. Examples of "histone deacetylase inhibitors" include, but are not limited to, SAHA, TSA, oxamflatin, PXD101, MG98 and scriptaid. Further reference to other histone deacetylase inhibitors may be found in the following manuscript; Miller, T.A. et al. J. Med. Chem. 46(24):5097-5116 (2003). "Inhibitors of kinases involved in mitotic progression" include, but are not limited to, inhibitors of aurora kinase, inhibitors of Polo-like kinases (PLK; in particular inhibitors of PLK-1), inhibitors of bub- 1 and inhibitors of bub-Rl. "Antiproliferative agents" includes antisense RNA and DNA oligonucleotides such as G3139, ODN698, RVASKRAS, GEM231, and INX3001, and antimetabolites sαch as enocitabine, carmofur, tegafur, pentostatin, doxifluridine, trimetrexate, fludarabine, capecitab>ine, galocitabine, cytarabine ocfosfate, fosteabine sodium hydrate, raltitrexed, paltitrexid, emitefur, tiazofurin, decitabine, nolatrexed, pemetrexed, nelzarabine, 2'-deoxy-2'-methylidenecytidine, 2'-fluoro>methylene-2'- deoxycytidine, N-[5-(2,3-dihydro-benzofuryl)sulfonyl]-N'-(3,4-dichlorophenyl)v-_.rea, N6-[4-deoxy-4- [N2-[2(E),4(E)-tetradecadienoyl]glycylamino]-L-glycero-B-L-manno-heptopyraπosyl]adenine, aplidine, ecteinascidin, troxacitabine, 4-[2-armno-4-oxo-4,6,7,8-tetrahydro-3H-pyrir__idino [5,4-b] [ 1 ,4]thiazin-6-yl- (S)-ethyl]-2,5-thienoyl-L-glutamic acid, aminopterin, 5-flurouracil, alanosine, lL -acetyl-8- (carbamoyloxymethyl)-4-formyl-6-methoxy-14-oxa-l,ll-diazatetracyclo(7.4.1.0_0)-tetradeca-2,4,6-trien- 9-yl acetic acid ester, swainsonine, lometrexol, dexrazoxane, methioninase, 2'-cyano-2'-deoxy-N4- palmitoyl-1-B-D-arabino furanosyl cytosine, 3-aminopyridine-2-carboxaldehyde thiosemicarbazone and trastuzumab. Examples of monoclonal antibody targeted therapeutic agents in. elude those therapeutic agents which have cytotoxic agents or radioisotopes attached to a cancer cell specific or target cell specific monoclonal antibody. Examples include Bexxar. "HMG-CoA reductase inhibitors" refers to inhibitors of 3-hydroxy-3-methylglutaryl- CoA reductase. Examples of HMG-CoA reductase inhibitors that may be used include but are not limited to lovastatin (MEVACOR®; see U.S. Patent Nos. 4,231,938, 4,294,926 and 4,319,039), simvastatin (ZOCOR®; see U.S. Patent Nos. 4,444,784, 4,820,850 and 4,916,239), pravastatin (PRANACHOL®; see U.S. Patent Νos. 4,346,227, 4,537,859, 4,410,629, 5,030,-447 and 5,180,589), fluvastatin (LESCOL®; see U.S. Patent Νos. 5,354,772, 4,911,165, 4,929,437, 5 ,189,164, 5,118,853, 5,290,946 and 5,356,896), atorvastatin (LPITOR®; see U.S. Patent Νos. 5,273,995, 4,681,893, 5,489,691 and 5,342,952) and cerivastatin (also known as rivastatin and BAYCHOL®; see US Patent No. 5,177,080). The structural formulas of these and additional HMG-CoA reductase inhibitors that may be used in the instant methods are described at page 87 of M. Yalpani, "Cholesterol Lowering Drugs", Chemistry & Industry, pp. 85-89 (5 February 1996) and US Patent Nos. 4,782,084 and 4,885,314. The term HMG-CoA reductase inhibitor as used herein includes all pharmaceutically acceptable lactone and open-acid forms (i.e., where the lactone ring is opened to fomi the free acid) as well as salt and ester forms of compounds which have HMG-CoA reductase inhibitory activity, and therefor the use of such salts, esters, open-acid and lactone forms is included within the scope of this invention. "Prenyl-protein transferase inhibitor" refers to a compound which inhibits any one or any combination of the prenyl-protein transferase enzymes, including farnesyl-protein transferase
(FPTase), geranylgeranyl-protein transferase type I (GGPTase-I), and geranylgeranyl-protein transferase type-H (GGPTase-π, also called Rab GGPTase). Examples of prenyl-protein transferase inhibitors can be found in t_he following publications and patents: WO 96/30343, WO 97/18813, WO 97/21701, WO 97/234-78, WO 97/38665, WO 98/28980, WO 98/29119, WO 95/32987, U.S. Patent No. 5,420,245, U.S. Patent No. 5,523,430, U.S. Patent No. 5,532,359, U.S. Patent No. 5,510,510, U.S. Patent No. 5,589,485, U.S. Patent No. 5,602,098, European Patent Publ. 0618 221, European Patent Publ. 0 675 112, European Patent Publ. 0 604 181, European Patent Publ. 0 696 593, WO 94/19357, WO 95/08542, WO 95/11917, WO 95/12612, WO 95/12572, WO 95/10514, U.S. Patent No. 5,661,152, WO 95/10515, WO 95/10516, WO 95/24612, WO 95/34535, WO 95/25086, WO 96/05529, WO 96/06138, WO 96/06193, WO 96/16443, WO 96/21701, WO 96/21456, WO 96/22278, WO 96/24611, WO 96/24612, WO 96/05168, WO 9*6/05169, WO 96/00736, U.S. Patent No. 5,571,792, WO 96/17861, WO 96/33159, WO 96/34850, WO 96/34851, WO 96/30017, WO 96/30018, WO 96/30362, WO 96/30363, WO 96/31111, WO 96/31477, WO 96/31478, WO 96/31501, WO 97/00252, WO 97/03047, WO 97/03050, WO 97/04785, WO 9*7/02920, WO 97/17070, WO 97/23478, WO 97/26246, WO 97/30053, WO 97/44350, WO 98/02436, and U.S. Patent No. 5,532,359. For an example of the role of a prenyl-protein transferase inhibitor on angiogenesis see European ! of Cancer, Vol. 35, No. 9, pp.1394-1401 (1999). "Angiogenesis inhibitors" refers to compounds that inhibit the formation of new blood vessels, regardless of mechanism. Examples of angiogenesis inhibitors include, but are not limited to, tyrosine kinase inhibitors, such as inhibitors of the tyrosine kinase receptors Flt-1 (NEGFRl) and Flk- 1/KDR (NEGFR2), inhibitors of epidermal-derived, fibroblast-derived, or platelet derived growth factors, MMP (matrix metalloprotease) inhibitors, integrin blockers, interferon- , i_nterleukin-12, pentosan polysulfate, cyclooxygenase inhibitors, including nonsteroidal anti-inflairamatories (ΝSAIDs) like aspirin and ibuprofen as well as selective cyclooxy-genase-2 inhibitors like celecoxib and rofecoxib (PNAS, Nol. 89, p. 7384 (1992); JNCI, Nol. 69, p. 475 (1982); Arch. Opthalmol, ol. 108, p.573 (1990); Anat. Rec, Nol. 238, p. 68 (1994); FEBS Letters, Nol. 372, p. 83 (1995); Clin, Orthop. Nol. 313, p_ 76 (1995); J. Mol EndocrinoL, Nol. 16, p.107 (1996); Jpn. J. Pharmacol, Nol. 75, p. 105 (1997); Cancer Res., Nol. 57, p. 1625 (1997); Cell, Nol. 93, p. 705 (1998); Intl. J. Mol Med., Nol. 2, p. 715 (1998> ; J. Biol Chem., Nol. 274, p. 9116 (1999)), steroidal anti-inflammatories (such as corticosteroids, mineralocorticoids, dexamethasone, prednisone, prednisolone, methylpred, betamethasone), carboxyamidotriazole, combretastatin A-4, squalamine, 6-0-chloroacetyl-carbonyl)-fumagillol, thalidomide, angiostatin, troponin-1, angiotensin II antagonists (see Fernandez et al., J. Lab. Clin. TMed. 105:141-145 (1985)), and antibodies to NEGF (see, Nature Biotechnology, Nol. 17, pp.963-968 (October 1999); Kim et al., Nature, 362, 841-844 (1993); WO 00/44777; and WO 00/61186). Other therapeutic agents that modulate or inhibit angiogenesis and may also be used in combination with the compounds of the instant invention include agents that modulate or inhibit th-e coagulation and fibrinolysis systems (see review in Clin. Chem. La. Med. 38:679-692 (2000)). Examples of such agents that modulate or inhibit the coagulation and fibrinolysis pathways include, but are not limited to, heparin (see Thromb. Haemost. 80:10-23 (1998)), low molecular weight heparins and carboxypeptidase U inhibitors (also known as inhibitors of active thrombin activatable fibrinolysis inhibitor [TAFIa]) (see Thrombosis Res. 101:329-354 (2001)). TAFIa inhibitors have been describ»ed in U.S. Ser. Νos. 60/310,927 (filed August 8, 2001) and 60/349,925 (filed January 18, 2002). "Agents that interfere with cell cycle checkpoints" refer to compounds that inhibit protein kinases that transduce cell cycle checkpoint signals, thereby sensitizing the cancer cell to E>ΝA damaging agents. Such agents include inhibitors of ATR, ATM, the Chkl and Chk2 kinases and cdk and cdc kinase inhibitors and are specifically exemplified by 7-hydroxystaurosporin, flavopiridol, CYC202 (Cyclacel) and BMS-387032. "Inhibitors of cell proliferation and survival signalling pathway" refer to compounds that inhibit signal transduction cascades downstream of cell surface receptors. Such agents include inhibitors of serine/threonine kinases (including but not limited to inhibitors of Akt such as described in WO
02/083064, WO 02/083139, WO 02/083140 and WO 02/083138), inhibitors of Raf kinase (for example BAY-43-9006 ), inhibitors of MEK (for example CI-1040 and PD-098059), inhibitors of mTOR (for example Wyeth CCI-779), and inhibitors of PI3K (for example LY294002). As described above, the combinations with NSAID' s are directed to the use of NS_A_D's which are potent COX-2 inhibiting agents. For purposes of this specification an NSAID is potent if it possesses an IC50 for the inhibition of COX-2 of lμM or less as measured by cell or microsomal assays. The invention also encompasses combinations with NSAID' s which are selective COX-2 inhibitors. For purposes of this specification NSAID' s which are selective inhibitors of COX-2 are; defined as those which possess a specificity for inhibiting COX-2 over COX-1 of at least 100 fold as measured by the ratio of IC50 for COX-2 over IC50 f°r COX-1 evaluated by cell or microsomal assays. Such compounds include, but are not limited to those disclosed in U.S. Patent 5,474,995, U.S. Patent 5,861,419, U.S. Patent 6,001,843, U.S. Patent 6,020,343, U.S. Patent 5,409,944, U.S. Patent 5,436,265, U.S. Patent 5,536,752, U.S. Patent 5,550,142, U.S. Patent 5,604,260, U.S. 5,698,584, U.S. Patent 5,710,140, WO 94/15932, U.S. Patent 5,344,991, U.S. Patent 5,134,142, U.S. Patent 5,380,738, U.S. Patent 5,393,790, U.S. Patent 5,466,823, U.S. Patent 5,633,272 and U.S. Patent 5,932,598, all of which are hereby incorporated by reference. Inhibitors of COX-2 that are particularly useful in the instant method of treatment are: 3- phenyl-4-(4-(methylsulfonyl)phenyl)-2-(5H)-furanone; and
5-chloro-3-(4-methylsulfonyl)phenyl-2-(2-methyl-5-pyridinyl)pyridine; or a pharmaceutically acceptable salt thereof. Compounds that have been described as specific inhibitors of COX-2 and are therefore useful in the present invention include, but are not limited to, the following: parecoxib, BEXTRA® and CELEBREX® or a pharmaceutically acceptable salt thereof. Other examples of angiogenesis inhibitors include, but are not limited to, endostatin, ukrain, ranpimase, IM862, 5-methoxy-4-[2-methyl-3-(3-methyl-2-butenyl)oxiranyl]-l-oxaspiro[2,5]oct- 6-yl(chloroacetyl)carbamate, acetyldinanaline, 5-amino-l-[[3,5-dichloro-4-(4- chlorobenzoyl)phenyl]methyl]-lH-l,2,3-triazole-4-carboxamide,CM101, squalamine, combretastatin, RPI4610, NX31838, sulfated mannopentaose phosphate, 7J-(carbonyl-bis[imino-N-methyl-4,2- pynolocarbonylimino[N-methyl-4,2-pyrrole]-carbonylimino]-bis-(l,3-naphthalene disulfonate), and 3- [(2,4-dimethylpyrrol-5-yl)methylene]-2-indolinone (SU5416). As used above, "integrin blockers" refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the vβ3 integrin, to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the αvβ5 integrin, to compounds which antagonize, inhibit or counteract binding of a physiological ligand to both the αγβ3 integrin and the 0Cyβ5 integrin, and to compounds which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells. The term also refers to antagonists of the αvβ6> 0tyβ8> oqβi, o βl, c 5βχ, α6βl and αββ4 integrins. The term also refers to antagonists of any combination of vβ3, αvβ5, αvβ6, ovβ8, αiβl, α2βl> α5βl> α6βl and 0C6β4 integrins. Some specific examples of tyrosine kinase inhibitors include N-(trifluoromethylphenyl)- 5-methylisoxazol-4-carboxamide, 3-[(2,4-dimethylpyrrol-5-yl)methylidenyl)indolin-2-one, 17- (allylamino)-17-demethoxygeldanamycin, 4-(3-chloro-4-fluorophenylamino)-7-methoxy-6-[3-(4- morpholinyl)propoxyl]quinazoline, N-(3-ethynylphenyl)-6,7-bis(2-methoxyethoxy)-4-quinazolinamine, BIBX1382, 2,3,9,10,ll,12-hexahydro-10-(hydroxymethyl)-10-hydroxy-9-methyl-9,12-epoxy-lH- diindolo[l,2,3-fg:3',2',l'-kl]pyrrolo[3,4-i][l,6]benzodiazocin-l-one, SH268, genistein, STI571, CEP2563, 4-(3-chlorophenylamino)-5,6-dimethyl-7H-pyrrolo[2,3-d]pyrimidinemethane sulfonate, 4-(3- bromo-4-hydroxyphenyl)amino-6,7-dimethoxyquinazoline, 4-(4'-hydroxyphenyl)amino-6J- dimethoxyquinazoline, SU6668, STI571A, N-4-chlorophenyl-4-(4-pyridylmethyl)-l-phthalazinamine, and EMD121974. Combinations with compounds other than anti-cancer compounds are also encompassed in the instant methods. For example, combinations of the instantly claimed compounds with PPAR-γ (i.e., PPAR-gamma) agonists and PPAR-δ (i.e., PPAR-delta) agonists are useful in the treatment of certain malingnancies. PPAR-γ and PPAR-δ are the nuclear peroxisome proliferator-activated receptors γ and δ. The expression of PPAR-γ on endothelial cells and its involvement in angiogenesis has been reported in the literature (see J. Cardiovasc. Pharmacol 1998; 31:909-913; J. Biol. Chem. 1999;274:9116-9121; Invest. Ophthalmol Vis. Sci. 2000; 41:2309-2317). More recently, PPAR-γ agonists have been shown to inhibit the angiogenic response to NEGF in vitro; both troglitazone and rosiglitazone maleate inhibit the development of retinal neovascularization in mice. (Arch. Ophthamol 2001; 119:709-717). Examples of PPAR-γ agonists and PPAR- γ/α agonists include, but are not limited to, thiazolidinediones (such as DRF2725, CS-011, troglitazone, rosiglitazone, and pioglitazone), fenofibrate, gemfibrozil, clofibrate, GW2570, SB219994, AR-H039242, JTT-501, MCC-555, GW2331, GW409544, ΝΝ2344, KRP297, NP0110, DRF4158, NN622, GI262570, PNU182716, DRF552926, 2- [(5,7-dipropyl-3-trifluoromethyl-l,2-benzisoxazol-6-yl)oxy]-2-methylpropionic acid (disclosed in USSN 09/782,856), and 2(R)-7-(3-(2-chloro-4-(4-fluorophenoxy) phenoxy)propoxy)-2-ethylchromane-2- carboxylic acid (disclosed in USSN 60/235,708 and 60/244,697). Another embodiment of the instant invention is the use of the presently disclosed compounds in combination with gene therapy for the treatment of cancer. For an overview of genetic strategies to treating cancer see Hall et al (Am. J. Hum. Genet. 61:785-789, 1997) and Kufe et al (Cancer Medicine, 5th Ed, pp 876-889, BC Decker, Hamilton 2000). Gene therapy can be used to deliver any tumor suppressing gene. Examples of such genes include, but are not limited to, p53, which can be delivered via recombinant virus-mediated gene transfer (see U.S. Patent No. 6,069,134, for example), a uPA/uPAR antagonist ("Adenovirus-Mediated Delivery of a uPA/uPAR Antagonist Suppresses Angiogenesis-Dependent Tumor Growth and Dissemination in Mice," Gene Therapy, August 1998;5(8): 1105-13), and interferon gamma (J. Immunol 2000;164:217-222). The compounds of the instant invention may also be administered in combination with an inhibitor of inherent multidrug resistance (MDR), in particular MDR associated with high levels of expression of transporter proteins. Such MDR inhibitors include inhibitors of p-glycoprotein (P-gp), such as LY335979, XR9576, OC144-093, R101922, VX853 and PSC833 (valspodar). A compound of the present invention may be employed in conjunction with anti-emetic agents to treat nausea or emesis, including acute, delayed, late-phase, and anticipatory emesis, which may result from the use of a compound of the present invention, alone or with radiation therapy. For the prevention or treatment of emesis, a compound of the present invention may be used in conjunction with other anti-emetic agents, especially neurokinin-1 receptor antagonists, 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron, and zatisetron, GABAB receptor agonists, such as baclofen, a corticosteroid such as Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or others such as disclosed in U.S.Patent Nos. 2,789,118, 2,990,401, 3,048,581, 3,126,375, 3,929,768, 3,996,359, 3,928,326 and 3,749,712, an antidopaminergic, such as the phenothiazines (for example prochlorperazine, fluphenazine, thioridazine and mesoridazine), metoclopramide or dronabinol. In another embodiment, conjunctive therapy with an anti-emesis agent selected from a neurokinin-1 receptor antagonist, a 5HT3 receptor antagonist and a corticosteroid is disclosed for the treatment or prevention of emesis that may result upon administration of the instant compounds. Neurokinin-1 receptor antagonists of use in conjunction with the compounds of the present invention are fully described, for example, in U.S. Patent Nos. 5,162,339, 5,232,929, 5,242,930, 5,373,003, 5,387,595, 5,459,270, 5,494,926, 5,496,833, 5,637,699, 5,719,147; European Patent Publication Nos. EP 0 360 390, 0 394 989, 0428 434, 0 429 366, 0430771, 0436 334, 0443 132, 0482 539, 0498 069, 0499 313, 0 512 901, 0 512 902, 0 514 273, 0 514 274, 0 514 275, 0 514 276, 0 515 681, 0 517 589, 0 520 555, 0 522 808, 0 528 495, 0 532456, 0 533 280, 0 536 817, 0 545 478, 0 558 156, 0 577 394, 0 585 913,0 590 152, 0 599 538, 0 610 793, 0 634402, 0 686 629, 0 693 489, 0 694 535, 0 699 655, 0 699 674, 0 707 006, 0 708 101, 0 709 375, 0709 376, 0 714 891, 0723 959, 0 733 632 and 0 776 893; PCT International Patent Publication Nos. WO 90/05525, 90/05729, 91/09844, 91/18899, 92/01688, 92/06079, 92/12151, 92/15585, 92/17449, 92/20661, 92/20676, 92/21677, 92/22569, 93/00330, 93/00331, 93/01159, 93/01165, 93/01169, 93/01170, 93/06099, 93/09116, 93/10073, 93/14084, 93/14113, 93/18023, 93/19064, 93/21155, 93/21181, 93/23380, 93/24465, 94/00440, 94/01402, 94/02461, 94/02595, 94/03429, 94/03445, 94/04494, 94/04496, 94/05625, 94/07843, 94/08997, 94/10165, 94/10167, 94/10168, 94/10170, 94/11368, 94/13639, 94/13663, 94/14767, 94/15903, 94/19320, 94/19323, 94/20500, 94/26735, 94/26740, 94/29309, 95/02595, 95/04040, 95/04042, 95/06645, 95/07886, 95/07908, 95/08549, 95/11880, 95/14017, 95/15311, 95/16679, 95/17382, 95/18124, 95/18129, 95/19344, 95/20575, 95/21819, 95/22525, 95/23798, 95/26338, 95/28418, 95/30674, 95/30687, 95/33744, 96/05181, 96/05193, 96/05203, 96/06094, 96/07649, 96/10562, 96/16939, 96/18643, 96/20197, 96/21661, 96/29304, 96/29317, 96/29326, 96/29328, 96/31214, 96/32385, 96/37489, 97/01553, 97/01554, 97/03066, 97/08144, 97/14671, 97/17362,
97/18206, 97/19084, 97/19942 and 97/21702; and in British Patent Publication Nos. 2266 529, 2 268 931, 2 269 170, 2 269 590, 2 271 774, 2 292 144, 2 293 168, 2 293 169, and 2 302 689. The preparation of such compounds is fully described in the aforementioned patents and publications, which are incorporated herein by reference. In an embodiment, the neurokinin-1 receptor antagonist for use in conjunction with the compounds of the present invention is selected from: 2-(R)-(l-(R)-(3,5- bis(trifluoromethyl)phenyl)ethoxy)-3-(S)-(4-fluorophenyl)-4-(3-(5-oxo-lH,4H-l,2,4- triazolo)methyl)morpholine, or a pharmaceutically acceptable salt thereof, which is described in U.S. Patent No. 5,719,147. A compound of the instant invention may also be administered with an agent useful in the treatment of anemia. Such an anemia treatment agent is, for example, a continuous eythropoiesis receptor activator (such as epoetin alfa). A compound of the instant invention may also be administered with an agent useful in the treatment of neutropenia. Such a neutropenia treatment agent is, for example, a hematopoietic growth factor which regulates the production and function of neutrophils such as a human granulocyte colony stimulating factor, (G-CSF). Examples of a G-CSF include filgrastim. A compound of the instant invention may also be administered with an immunologic- enhancing drug, such as levamisole, isoprinosine and Zadaxin. Thus, the scope of the instant invention encompasses the use of the instantly claimed compounds in combination with a second compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxic/cytostatic agent, an antiproliferative agent, a prenyl-protein transferase inhibitor, an HMG-CoA reductase inhibitor, an HIN protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, PPAR-γ agonists, PPAR-δ agonists, an inhibitor of inherent multidrug resistance, an anti-emetic agent, an agent useful in the treatment of anemia, an agent useful in the treatment of neutropenia, an immunologic-enhancing drug, an inhibitor of cell proliferation and survival signaling, and an agent that interferes with a cell cycle checkpoint. The term "administration" and variants thereof (e.g., "administering" a compound) in reference to a compound of the invention means introducing the compound or a prodrug of the compound into the system of the animal in need of treatment. When a compound of the invention or prodrug thereof is provided in combination with one or more other active agents (e.g., a cytotoxic agent, etc.), "administration" and its variants are each understood to include concurrent and sequential introduction of the compound or prodrug thereof and other agents. As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts. The tenn "therapeutically effective amount" as used herein means that amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician. The term "treating cancer" or "treatment of cancer" refers to administration to a mammal afflicted with a cancerous condition and refers to an effect that alleviates the cancerous condition by killing the cancerous cells, but also to an effect that results in the inhibition of growth and/or metastasis of the cancer. i an embodiment, the angiogenesis inhibitor to be used as the second compound is selected from a tyrosine kinase inhibitor, an inhibitor of epidermal-derived growth factor, an inhibitor of fibroblast-derived growth factor, an inhibitor of platelet derived growth factor, an MMP (matrix metalloprotease) inhibitor, an integrin blocker, interferon-α, interleukin-12, pentosan poly sulfate, a cyclooxygenase inhibitor, carboxyamidotriazole, combretastatin A-4, squalamine, 6-O-chloroacetyl- carbonyl)-fumagillol, thalidomide, angiostatin, troponin-1, or an antibody to NEGF. In an embodiment, the estrogen receptor modulator is tamoxifen or raloxifene. Also included in the scope of the claims is a method of treating cancer that comprises administering a therapeutically effective amount of a compound of Formula A in combination with radiation therapy and/or in combination with a second compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxiccytostatic agent, an antiproliferative agent, a prenyl-protein transferase inhibitor, an HMG-CoA reductase inhibitor, an HUN protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, PPAR-γ agonists, PPAR-δ agonists, an inhibitor of inherent multidrug resistance, an anti-emetic agent, an agent useful in the treatment of anemia, an agent useful in the treatment of neutropenia, an immunologic-enhancing drug, an inhibitor of cell proliferation and survival signaling, and an agent that interferes with a cell cycle checkpoint. And yet another embodiment of the invention is a method of treating cancer that comprises administering a therapeutically effective amount of a compound of Formula A in combination with paclitaxel or trastuzumab. The invention further encompasses a method of treating or preventing cancer that comprises administering a therapeutically effective amount of a compound of Formula A in combination with a COX-2 inhibitor. The instant invention also includes a pharmaceutical composition useful for treating or preventing cancer that comprises a therapeutically effective amount of a compound of Formula A and a second compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxic/cytostatic agent, an antiproliferative agent, a prenyl-protein transferase inhibitor, an HMG-CoA reductase inhibitor, an HIN protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, a PPAR-γ agonist, a PPAR-δ agonist, an inhibitor of cell proliferation and survival signaling, and an agent that interferes with a cell cycle checkpoint. All patents, publications and pending patent applications identified are hereby incorporated by reference. Abbreviations used in the description of the chemistry and in the Examples that follow are: AEBSF (p-aminoethylbenzenesulfonyl fluoride); BSA (bovine serum albumin); Cul (copper iodide); CuS04 (copper sulfate); DMSO (dimethyl sulfoxide); DTT (dithiothreitol); EDTA (ethylene-diamine- tetra-acetic acid); EGTA (ethyleneglycol-tetra-acetic acid); EtOAc (ethyl acetate); EtOH (ethanol); HO Ac (acetic acid); HPLC (high-performance liquid chromatography); LCMS (liquid chromatograph- mass spectrometer); MeOH (methanol); NaHCθ3 (sodium bicarbonate); Na2Sθ4 (sodium sulfate); NH4OAC (ammonium acetate); NBS (N-bromosuccinamide); NMR (nuclear magnetic resonance); PBS (phosphate buffered saline); PCR (polymerase chain reaction); PS-DIEA (polystyrene diisopropylethylamine); THF (tetrahydrofuran); and TFA (trifluoroacteic acid). The compounds of this invention may be prepared by employing reactions as shown in the following Reaction Schemes, in addition to other standard manipulations that are known in the literature or exemplified in the experimental procedures. The illustrative Reaction Schemes below, therefore, are not limited by the compounds listed or by any particular substituents employed for illustrative purposes. Substituent numbering as shown in the Reaction Schemes does not necessarily correlate to that used in the claims and often, for clarity, a single substituent is shown attached to the compound where multiple substituents are allowed under the definitions of Formula A hereinabove. Reactions used to generate the compounds of this invention are prepared by employing reactions as shown in the Reaction Schemes I-N, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures. SYNOPSIS OF REACTION SCHEMES Reaction Scheme I is illustrative for the synthesis of compounds of the instant invention. Friedlander cyclocondensation of a suitably substituted aryl or heteroaryl aminoaldehyde with a suitably substituted ketone gives intermediates of formula V-l. Conversion of the carboxylic acid functionality to an aldehyde functionality gives intermediate V-2 and is accomplished by methods well known to someone skilled in the art. Reductive alkylation with a suitably substituted amine provides compounds of formula V-3. As shown in the Reaction Scheme, U, N, W and X can be either a carbon atom or a nitrogen atom. Reaction Scheme II illustrates the preparation of the compounds of the instant invention, starting with a suitably substituted hydroxymethylpyrimidine 1-1. This material can be oxidized with manganese (IV) oxide to give the corresponding aldehyde 1-2. Intermediate 1-2 reacts with methyl phenylacetate followed by treatment with phosphorus oxychloride to produce chloropyridopyrimidine I- 3. 1-3 is subjected to a standard Suzuki coupling with 4-formylphenylboronic acid to deliver 1-4. This material can then undergo reductive amination, in parallel, with a diverse array of amines (HNR'R", as exemplified in Scheme 1 and the compounds in Table 1) to provide 1-5. Reaction Scheme m illustrates the synthesis of the compounds of the instant invention, starting with hydroxypyridopyrimidine II-l which is prepared according to Scheme I. II-l is oxidized to methyl sulfoxide II-2, which is then displaced with sodium cyanide to give II-3.
Hydroxypyridopyrimidine II-3 is converted to chloropyridopyrimidine B-4 by treatment with phosphorus oxychloride. II-4 is subjected to a standard Suzuki coupling with 4-formylphenylboronic acid to deliver π-5. The nitrile II-5 is transformed to carboxamide II-6 by urea-peroxide oxidation. II-6 can then undergo reductive amination with a diverse array of amines to provide E-7. Reaction Scheme IV illustrates the preparation of the compounds of the instant invention, starting with acid IH-1. This material is converted to amide IH-2, followed by reduction to give aldehyde EI-3. Ifl-3 then undergo a palladium catalyzed reaction with phenyl acetamide to produce hydroxynaphthyridine IU-4. Treatment with phosphorus oxychloride affords chloronaphthyridine DI-5. Chloride DI-5 is subjected to a standard Suzuki coupling with 4-formylphenylboronic acid to deliver _H- 6. This material can then undergo reductive amination with a diverse array of amines to provide IH-7. Reaction Scheme V illustrates the preparation of l,6-naphthyridin-5(6H)-one compounds. In the initial condensation of N-Boc-protected 2-chloro-4-amino-nicotinaldehyde with the (substituted phenyl) benzyl ketone (V-1) in the presence of an alkoxide, such as, sodium methoxide, there is obtained directly the 1,6-naphthyridine (V-2) substituted at the 5-position with the alkoxide group. Acid catalyzed hydrolysis readily converts the 1,6-naphthyridine to the requisite l,6-naphthyridin-5(6H)- one aldehyde functionality (V-3) and this material can undergo reductive amination with a diverse array of amines to give the l,6-naphthyridin-5(6H)-one compounds (V-6).
Figure imgf000046_0001
Reaction Scheme II
Figure imgf000047_0001
Reaction Scheme HI
Figure imgf000047_0002
Reaction Scheme IN 1 ) i-BuOCOCI, TEA, CH2CI2 DIBAL-H 2) MeΝHOMe HCI THF, -78 °C
Figure imgf000048_0002
Figure imgf000048_0001
Figure imgf000048_0003
Reaction Scheme V
Figure imgf000048_0004
EXAMPLES Examples provided are intended to assist in a further understanding of the invention. Particular materials employed, species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope thereof. The reagents utilized in synthesizing the compounds depicted in the following Tables are either commercially available or are readily prepared by one of ordinary skill in the art. SCHEME 1
MeS N NH2 MnQ2 -OH CHCIa
Figure imgf000049_0001
Figure imgf000049_0002
3-( 4-r2-(methylthio)-6-phenylpyridol2 -d]pyrimidin-7-yllbenzyl}amino)-l-phenylpropan-l-one (1-5) 4-amino-2-(methylthio)pyrimidine-5-carbaldehyde (1-2) To the solution of 4-amino-5-hydroxymethyl-2-(methylthio)pyrimidine (1-1; 1.0 g, 5.84 mmol) in CHCI3 (100 mL) was added Mnθ2(2.5 g, 29.2 mmol, 5 equiv). The suspension was stirred at rt overnight. The mixture was filtered through celite and washed with CHCI3. The combined filtrate was concentrated to give the titled compound (1-2). Η-NMR (500 MHz, CDCI3) δ 9.78 (s, IH), 8.42 (s, 1EQ, 8.20 (broad, IH), 5.74 (broad, IH)), 2.55 (3, 3H). 7-cr_loro-2-(methylthioV6-phenylpyrido[2,3-d1pyrimidine (1-3. To the solution of methyl phenylacetate (0.945 g, 6.29 mmol) in THF (20 mL) at -78 °C was added LHMDS (1 M, 6.6 mL) and stirred for 1 h. 4-amino-2-(methylthio)pyrimidine-5-carbaldehyde (1--2; 0.507 g, 3.0 mmol) was added. The mixture was stirred and wanned to rt. The reaction was quenched with saturated NH4CI solution and extracted with CH2CI2. The combined organic layer was dried, filtered and concentrated. The residue was dissolved in CH3CN (5 mL) and phosphorus oxychloride (4.6, 30 mmol) was added. The mixture was heated to reflux overnight. After cooled to rt, the reaction mixture was concentrated. The residue was basified with saturated NaHCθ3 solution and extracted with CH2CI2. The combined organic layer was dried, filtered and concentrated. The residue was purified by silica gel chromatography (0.5 % MeOH in CH2CI2) to give the title compound (1-3). LR-MS m/z (M+H) Calcd: 288.7, found: 288.2. 4-r2-(methylthio)-6-phenylpyridor2.3-dlpyrimidin-7-yllbenzaldehvde (1-4 The mixture of 7-cbdoro-2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidine (1-3; 0.100 g,
0.347 mmol), 4-formylphenylboronϊc acid (0.13 g, 0.87 mmol), Cesium carbonate (0.34 g, 1.04 mmol) and bis(tri-t-butylphosphine)palladi-um (0.018 g, 0.035 mmol) in dioxane (5 mL) was heated to reflux overnight. The reaction mixture was diluted with water and extracted with CH2C12. The combined organic layer was dried, filtered and. concentrated. The residue was purified by silica gel chromatography (20 % EtOAc in hexane) to give the title compound (1-4). LRMS m/z (M+H) Calcd:
358.4, found: 358.2. 3-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}aπ_in.o)-l- phenylpropan-1-one (1-5) A mixture of 4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]ber_tzaldehyde (1-4) (0.030 g, 0.084 mmol), 3-oxo-3-phenylpropan-l-aminium chloride (0.019 g, 0.101 mmol), and TEA (0.014 mL, 0.101 mmol) were stirred in 5% AcOH in DMF for 1 hr. Sodium triacetoxyborohydride (0.027 g, 0.126 mmol) was then added and the reaction was stirred for 2 hr. The reaction was quenched with 3N NaOH and extracted 3x w/ CH2CI2. The combined organics were dried (anhd. -Na2Sθ4), filtered, and concentrated. The residue was purified by reverse phase HPLC (5% CH3CN: 95% H20: 0.01 % TFA to 95% CH3CN: 5% H20: 0.01 % TFA) to give the titled compound (1-5). 'H-NMR (500 MHz, d6 DMSO) δ 9.57 (s, IH), 8.90 (bs, 2H), 8.64 (2, IH), 8.01 (d, 2H, J = 7.3 Hz), 7.72 (t, IH, J = 7.6 Hz), 7.61 (t, 2H, J = 7.6 Hz), 7.55-7.49 (m, 4 H), 7.43-7.27 (m, 5 H), 4.29 (t, 2H, J = 5.62 Hz), 3.51 (t, 2H, J = 6.83 Hz), 3.36-3.26 (m, 2H), 2.69 (s, 3H), HRMS m/z (M+H) calcd: 491.1900, found: 491.1928.
The following compounds were prepared in a similar fashion.
Figure imgf000050_0001
Figure imgf000051_0001
Figure imgf000052_0001
SCHEME 2
Figure imgf000052_0002
7-r4-(3-oxo-3-phenylpropylarmno.methylphenyll-6-ph& ιylpyridor2.3-dlpyrimidine-2-carboxamide (2-7) 2-(methylsulfonyl)-6-phenylpyrido.2,3-d1pyrimidin-7-ol (2-2. To the solution of 2-(methylthio)-6-ph&nylpyrido[2,3-d]pyrimidin-7-ol (2-1; 1.0 g, 3.71 mmol) in MeOH (5 mL) and EtOAc (10 L) was added, sodium tungstate (0.109 g, 0.37 mmol) and 30% H2O2 (4 mL). The mixture was stirred for 10 h and then concentrated in vacuo. The residue obtained was used in the next step. 7-hvdroxy-6-phenylpyridor2,3-d1pyrimidine-2.-carbonitrile (2-3) The residue obtained in the above step was dissolved in DMF (5 mL) and added NaCN (0.400 g). The mixture was stirred at rt for 2 h. Diluted with -water (40 mL) and extracted with CH2CI2
(3X30 mL). The combined organic layer was dried, filtered and concentrated. The residue was purified by silica gel chromatography (50% EtOAc in hexane) to give the title compound (2-3). LRMS m/z (M+H) Calcd: 249.3, found: 249.2. 7-chloro-6-phenylpyridor2.3-dlpyrimid ne-2-carbomtrile (2-4) The solution of 7-hydroxy-6-phenylpyrido[23-d]pyrimidine-2-carbonitrile (2-3; 0.300 g,
1.21 mmol) in CH3CN and POCI3 (2 mL) was heated to 100 °C for 4 h. The mixture was concentrated and the residue was basified with saturated NaHC03 at 0 °C. Extracted with CH2CI2 and the combined organic layer was dried, filtered and concentrated. The residue was purified by silica gel chromatography (10-20% EtOAc in hexane) to give the title compound (2-4). LRMS m/z (M+H) Calcd: 267.7, found: 267.2. 7-(4-formylphenyl)-6-phenylpyridor2,3-dlpyr-tmidine-2-carbonitrile (2-5) A mixture of 7-chloro-6-phenylpyrido[2,3-d]pyrimidine-2-carbonitrile (2-4) (0.350 g, 1.31 mmol), 4-formylphenyl boronic acid (0.492 g, 3.28 mmol), cesium carbonate (1.28 g, 3.94 mmol), and Pd(PtBu3)2 (0.067 g, 0.131 mmol) in anhydrous dioxane (8 mL) was degassed (3x vacuum pump/ refilled with N2) and heated to 95 °C for 18 hr. The mixture was cooled, diluted with water, and extracted 3x with CH2Q2. The combined organics were dried (anhd. Na2S04), filtered, concentrated and purifed by silica gel chromatography (10-30% EtOAc in Hexanes). XH-NMR (500 MHz, CDC13) δ 10.05 (s, IH), 9.61 (s, IH), 8.44 (s, IH), 7.84 (d, 2H, J = 83 Hz), 7.72 (d, 2H, J = 8.3 Hz), 7.46-7.36 (m, 3H), 7.29-7.25 (m, 2H); LRMS, calc'd: 337.0, found: 337.0. 7-(4-formylphenyl)-6-phenylpyridor2.3-d1pyramidine-2-carboxamide (2-6) To a mixture of 7-(4-formylphenyl)-6-phenylpyrido[2,3-d]pyrimidine-2-carbonitrile (2-5) (0.100 g, 0.297 mmol) in 2:1 THF:H2θ (6 mL) was added K2.CO3 (16 mg) and urea peroxide (0.112 g,
1.19 mmol). The mixture was stirred for 1 hr at rt when it was concentrated, diluted with 1:1 H2- 0:saturated aqueous Na2C03, and extracted 3x with CH2CI2- The combined organics were dried (anhd. Na2Sθ4), filtered, and concentrated. The crude material was used directly in the next step. LRMS, calc'd: 355.0, found: 355.0 7-[4-(3-oxo-3-phenylpropylaιτ no)methylphe_αyl]-6-phenylpyrido[2,3-d]pyrirnidine-2- carboxamide (2-7) A mixture of 7-(4-foπnylphenyl)-6-phenylpyrido[2,3-d]pyriπιidine-2-carboxamide (2-6) (0.033 g, 0.093 mmol), 3-oxo-3-phenylpropan-l-aminium chloride (0.031 g, 0.168 mmol), and TEA (0.023 mL, 0.168 mmol) in 5% CH3COOH in DMF (0.5 mL) was stirred for 4 hr at which point NaBH(OAc)3 (0.039 g, 0.186 mmol) was added. The mixture was stirred for a 30 min. further. 2 drops of water were added and the material was purified by reverse phase HPLC. Η-NMR (500 MHz, d6- DMSO) δ 9.90 (s, IH), 8.88 (bs, 2H), 8.79 (s, IH), 8.43 (s, IH), 7.99 (d, 3H, J = 7.3 Hz), 7.70 (t, IH, J = 7.1 Hz), 7.62-7.53 (m, 3H), 7.50 (d, 2H, /= 8.3 Hz), 7.43-7.31 (m, 6H), 4.31-4.34 (m, 2H), 3.50 (t, 2H, J = 6.6 Hz),3.36-3.26 (m, 2H); LRMS, calc'd: 488.1; found 488.1. The following compound was prepared in a similar fashion.
Figure imgf000054_0001
SCHEME 3
Figure imgf000054_0002
5-(i r4-(3-Phenyl- 5-naphthyridin-2-yl)benzvnaminolmethvD-2.4-dihvdro-3_H-L2,4-triazol-3-one (3-7) 3-Bromo-N-methoxy-N-methylpyridine-2-carboxamide (3-2) To a solution of 3-bromopyridine-2-carboxylic acid (3-1; 250 mg, 1.24 mmole) in
CH2CI2 (5 mL) was added E_3N (0.21 mL, 3.72 mmole) then isobutyl chloroformate (0.19 mL, 1.49 mmole) at 0 °C. After 30 minutes N,0-dimethylhydroxylamine hydrochloride (181 mg, 1.86 mmole) was added. After 15 minutes the mixture was warmed to RT. After 18 hr the mixture was diluted with H2O and extracted with CH2CI2 (3x). The combined organic layers were dried (MgS04), filtered, and concentrated. Flash column (50% EtOAc/hexanes) gave the title compound (3-2) as a clear oil: JH- ΝMR (500 MHz, CDCI3) δ 8.56 (m, 1 H), 7.92 (m, 1 H), 7.24 (m, 1 H), 3.58 (s, 3 H), 3.42 (s, 3 H). 3-Phenyl-l.5-naphthyridin-2-ol .3-4. (a) To a solution of 3-bromo-N-methoxy-N-methylpyridine-2-carboxamide (3-_£; 219 mg, 0.89 mmole) in dry THF (4 mL) was added diisobutylaluminum hydride (0.94 mL, 0.94 mmole, IM solution in CH2CI2) slowly at -78 °C. After 3 hr the mixture was quenched with IN HC1 and stirred vigorously. After 4 hr the mixture was neutralized with IM ΝaOH and extracted with CH2CI2 C3x). The combined organic layers were dried (MgSθ4), filtered, and concentrated to give 3-bromopyridine-2- carboxaldehyde and its aminal with N, -dimethylhydroxylamine as a mixture which was used in the next step without purification. (b) The mixture from (a) (134 mg, 0.72 mmole), phenyl acetamide (117 mg, 0.S6 mmole), CS2CO3 (329 mg, 1.01 mmole), Pd2(dba)3 (7 mg, 0.007 mmole), and xantphos (13 mg, 0.022 mmole) were combined in dry toluene (4 mL). The mixture was degassed (3 X pump/Ν2) then tieated to reflux. After 2 hr the mixture was cooled, diluted with H2O, and extracted with EtOAc (3x). T_he combined organic layers were dried (MgSθ4), filtered, and concentrated. Flash column (30% EtOAc/CHCl3) gave the title compound (3-4) as a pale yellow solid: 'H-NMR (500 MHz, CDC13) δ 11.31 (bs, 1 H), 8.60 (m, 1 H), 8.19 (s, 1 H), 7.83 (m, 2 H), 7.65 (d, J = 8.06 Hz, 1 H), 7.53-7.27 (m, 4 H). 2-Chloro-3-phenyl-1.5-naphthyridine (3-5) 3-Phenyl-l,5-naphthyridin-2-ol (3-4; 110 mg, 0.50 mmole) was taken up in CH3CN (3 mL). To this was added POCI3 (0.07 mL, 0.74 mmole) then the mixture was heated to reflux. After 3 hr POCI3 (0.07 mL, 0.74 mmole) was added and heating continued. After 3 hr POCI3 (0.15 mL) was added and heating continued. After 18 hr the mixture was cooled to 0 °C and diluted with saturated NaHCθ3.
After 15 min the mixture was warmed to RT and extracted with EtOAc (3x). The combined organic layers were dried (MgSθ4), filtered through a plug of silica gel, and concentrated to give the title compound (3-5) as a light yellow solid: Η-NMR (500 MHz, CDC13) δ 9.02 (m, 1 H), 8.38 (m, 2 H), 7.69 (m, 1 H), 7.59-7.49 (m, 5 H). 4-(3-Phenyl-1.5-naphthyridin-2-yl)benzaldehyde (3-6) 2-Chloro-3-phenyl-l,5-naphthyridine (3-5; 103 mg, 0.43 mmole), 4-formylphen^ylboronic acid (77 mg, 0.51 mmole), KF (82 mg, 1.4 mmole), and Pd(PtBu3)2 (11 mg, 0.02 mmole) were combined in dry dioxane (2.5 mL). The mixture was degassed (3 X pump/N2) then heated to reflux. Aftex 18 hr the mixture was cooled to RT. 4-Formylphenylboronic acid (77 mg, 0.51 mmole), KF (82 mg, L .4 mmole), and Pd(PtBu3)2 (11 mg, 0.02 mmole) were added. The mixture was degassed (3 X pur_np/N2) then heated to reflux. After 6 hr the mixture was cooled, diluted with saturated NaHC03, an-d extracted with CH2CI2 (3x). The combined organic layers were dried (MgSθ4), filtered, and concentrated. Flash column (20% E-OAC/CHCI3) gave the title compound (3-6) as a pale yellow gum: 'H-NMR. (500 MHz, CDCI3) δ 10.03 (s, 1 H), 9.05 (bs, 1 H), 8.48 (m, 2 H), 7.82 (dd, J = 1.47 and 5.13 Hz, 2 H), 7.71 (m, 1 H), 7.63 (d, J = 8.06 Hz, 2 H), 7.36-7.27 (m, 5 H). 5-({ [4-(3-Phenyl-l,5-naphthyridin-2-yl)benzyl]amino}methyl)-2,4-dihydro-3H- l,2.4-triazol-3-one (3-7) 4-(3-Phenyl-l,5-naphthyridin-2-yl)benzaldehyde (3-6; 36 mg, 0.12 mmole), 5- (aminomethyl)-2,4-dihydro-3H-l,2,4-triazol-3-one hydrochloride (23 mg, 0.15 mmole), E-3_Nr (0.024 mL,
0.17 mmole), and HOAc (0.033 mL, 0.58 mmole) were combined in dry DMF (0.5 mL). After 30 minutes NaBH(OAc)3 (32 mg, 0.15 mmole) was added. After 18 hr H2O (0.2 mL) was added. After 15 minutes the mixture was purified directly by reverse phase HPLC (5-100% CH3CN/H20 + 0.1% TFA) to give the trifluoroacetate salt of the title compound (3-7) as a pale yellow solid: 'H-NMR (5O0 MHz, d6- DMSO) δ 11.74 (s, 1 H), 11.50 (s, 1 H), 9.59 (bs, 2 H), 9.07 (m, 1 H), 8.49 (m, 1 H), 8.42 (s„ 1 H), 7.86 (m, 1 H), 7.47 (m, 2 H), 7.36 (m, 2 H), 7.35 (m, 5 H), 4.26 (s, 2 H), 4.02 (s, 2 H); HRMS, calc'd for C2 H2ιN60 (M+l), 409.1772; found 409.1743. SCHEME 4
Figure imgf000056_0001
3-[(3-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-r__.aphthyridm- 2-yl)benzyllpropan-l-aminium trifluoroacetate (4-6) .2-(3-Hydroxy-phenylcarbamoyl)-ethyH-carbamic acid tert-butyl ester (4-l> To a suspension of 3-tert-Butoxycarbonylamino-propionic acid (4-1) (1.0 g,. 5.3 mmol) and 3-aminophenol (4-2) (578 mg, 5.3 mmol) in dichloromethane (10 mL) was added N, N'-dicyclo hexyl carbodiimide (1.3 g, 6.4 mmol). The resulting mixture was stirred at room temperature overnight. The volatile solvents were removed by rotovap evaporation then the reaction mixture was directly purified by silica gel chromatography (10-100% Hexane/Ethyl Acetate) to recover the desired product (-4-3) as white solid: 'H-ΝMR (500 MHz, d4-CD30D) δ 7.28 (m, IH), 7.09 (m, IH), 6.95 (m, IH), 6.55 (m, IH), 3.42 (m, 2H), 2.53 (m, 2H), 1.43 (s, 9H). 3-[(3-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin- 2-yl)benzyllpropan-l-aminium trifluoroacetate (4-6) To a suspension of [2-(3-hydroxy-phenylcarbamoyl)-ethyl]-carbamic acid tert-butyl ester (4-3) (100 mg, 0.36 mmol) in dichloromethane (2 mL) was added trifluoroacetic acid (1 mL). The suspension immediately turned into clear solution and was stirred at room temperature for lhr. The volatile solvents were removed by rotovap evaporation and the oil residue was further dried by vaccum pump over night. The oil residue was re-solubilized in dichloromethane (1 mL) and de-salted with triethylamine (1 mL). After the resulting solution was stirred at room temperature for lhr, 4-(5-oxo-3- phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzaldehyde (4-5; synthesis shown and described in Reaction Scheme V) (80 mg, 0.25 mmol) was added followed by sodium triacetoxyborohydride (159 mg, 0.75 mmol) after an additional 0.5 hr of stirring at room temperature. The final reaction mixture was stirred at room temperature overnight and then directly purified by HPLC (Phenomenx Synergi column; 20-85% acetonitrile/water + 0.1% TFA) to afford the product (4-6) as bright yellow oil: 'H-NMR (500 MHz, d4- CD3OD) δ 8.64 (s, IH), 7.53-7.48 (m, 5H), 7.30-7.28 (m, 3H), 7.24-7.23 (m, 2H), 7.17 (m, IH), 7.12 (m, IH), 6.96 (m, IH), 6.87 (m, IH), 6.55 (m, IH), 4.28 (s, 2H), 3.34 (m, 2H), 2.83 (m, 2H) ; LRMS, calc'd for C3oH26N403 (M+1), 491.57; found 491.59. The following compounds were prepared in a similar fashion.
Figure imgf000057_0001
Table 3
Figure imgf000057_0002
-9 [4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin- 419.53 2-yl)phenyl]-N-(pyridin-3-ylmethyl)methane (M+1)
-10 (6-methoxypyridin-3-yl)-N-[4-(5-oxo-3-phenyl- 449.68 5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane (M+1) -11 (6-oxo-l,6-dihydropyridin-3-yl)-N-[4-(5-oxo-3- 435.58 phenyl-5 ,6-dihydro- 1 ,6-naphthyridin-2- (M+1) yl)benzyl]methane -12 3-[(2-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3- 491.51 phenyl-5,6-dihydro- 1 ,6-naphthyridin-2- (M+1) yl)benzyl]propane
-13 3-[(3-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3- 491.59 phenyl-5 ,6-dihydro- 1 ,6-naphthyridin-2- (M+1) yl)benzyl]propane
-14 3-[(4-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3- 491.59 phenyl-5 ,6-dihydro- 1 ,6-naphthyridm-2- (M+1) yl)benzyl]propane
Figure imgf000058_0001
Figure imgf000059_0001
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001
-71 2-[4-({ [3-(dimethylamino)benzyl]amino Jmethyl) 461 phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one
-72 2-[4-( { [2-(dimethylamino)benzyl] amino } methyl) 461 phenyl] -3 -phenyl- 1 ,6-naphthyridin-5(6H)-one
-73 2- [4-( { [2-(dimethy lamino)benzy 1] amino } methyl) 434 phenyl]-3-phenyl-l,6-nap___thyridin-5(6H)-one
-74 2-[4-( { [4-(methylthio)benzyl] amino } methyl) 464 phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one -75 2-[4-({ [4-(methylsulfonyl)benzyl]amino}methyl) 496 phenyl] -3-phenyl- 1 ,6-naphthyridin-5 (6H)-one
-76 2-[4-({ [4-(methylamino)benzyl]amino}methyl) 447 phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one
Figure imgf000066_0001
-77 2-(4-{[(3,4-dihydroxybenzyl)amino]methyl} 450 T -OH phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one
OH-78 2-[4-( { [( 1 -methyl- 1 ,2,3 ,4-tetrahydroquinolin-6- 487 y l)methy 1] amino } methy l)pheny 1] -3 -phenyl- 1,6- naphthyridin-5(6H)-one
Figure imgf000066_0002
Figure imgf000067_0001
-87 3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6- 476.5 naphthyridin-2-yl)benzyl] -3 -(pyridine-2- ylamino)propane -88 2-[(2-hydroxybenzoyl)amino]-N-[4-(5-oxo-3- 491.7 phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]ethane
-89 3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6- 476.7 naphthyridin-2-yl)benzyl]-3-(pyridine-4- ylamino)propane
Figure imgf000068_0001
-90 6-methyl-2-[4-( { methyl[4-( 1H- 512.72 pyrazol- 1 -yl)benzyl] (M+1) amino }methyl)phenyl] -3-phenyl-l ,6- naphthyridin-5(6H)-one -91 2-[4-({methyl[4-(lH-pyrazol-l- 498.72 yl)benzy 1] amino } methy l)pheny 1] -3 - (M+1) phenyl-l,6-naphthyridin-5(6__)-one
-92 6-methyl-3-phenyl-2-[4-({ [4-(lH- 498.47 pyrazol- 1 -yl)benzy 1] amino } methyl) (M+1) phenyl] - 1 ,6-naphthyridin-5 (6H)-one
Figure imgf000068_0002
SCHEME 5
Figure imgf000069_0001
3-[(2-hydroxyphenyl)amino]-N-{4-[2-(4-methylpiρerazin-l-yl)-6- phenylpyrido.2.3-d1pyrimidin-7-yπbenzyl 1 -3-oxopropane (5-6) .2-(2-Hydroxy-phenylcarbamoylVethyll-c-ubamic acid tert-butyl ester (5-3 To a suspension o»f 3-tert-Butoxycarbonylamino-propionic acid (5-1) (1.0 g, 5.3 mmol) and 2-aminophenol (5-2) (578 mg, 5.3 mmol) in dichloromethane (10 mL) was added N, N' -dicyclo hexyl carbodiimide (1.3 g, 6.4 miriol). The resulting mixture was stirred at room temperature overnight.
The volatile solvents were removed by rotovap evaporation then the reaction mixture was directly purified by silica gel chromatography (10-100% Hexane Ethyl Acetate) to recover the desired product (5-
3) as white solid: IH-NMR (500 MHz, d4-CD30D) 67.43 (m, IH), 6.88 (m, IH), 6.76 (m, IH), 6.70 (m,
IH), 3.29 (m, 2H), 2.48 (m, 2H), 1 .29 (s, 9H). 4-[2-(4-methylpiperazin-l-yl)-6-phenylpyrido[2,3-d]pyrimidin-7- yllbenzaldehvde ( S-5a) See experimental "below for synthesis of (5-5a). 3-[(2-hydroxyphenyl)aιmno]-N-{4-[2-(4-methylpiperazin-l-yl)-6- phenylpyridor2.3-<npyrimidin-7-yllbenzyl)-3-oxopropane (5-6) To a suspension of [2-(2-hydroxy-phenylcarbamoyl)-ethyl]-carbamic acid tert-butyl ester
(5-3) (100 mg, 0.36 mmol) in dichloromethane (2 mL) was added trifluoroacetic acid (1 mL). The suspension immediately turned into clear solution and was stirred at room temperature for l r. The volatile solvents were removed by rotovap evaporation and the oil residue was further dried by vaccum pump over night. The oil residue was re-solubilized in dichloromethane (1 mL) and de-salted with triethylamine (1 mL). After the resulting solution was stirred at room temperature for lhr, 4-[2-(4- methylpiperazin-l-yl)-6-phenylpyrido[2,3-d]pyri_midin-7-yl]benzaldehyde (5-5a) (60 mg, 0.15 mmol) was added followed by sodium triacetoxyborohydride (159 mg, 0.75 mmol), catalytic amount of acetic acid, and DMF (0.5 mL). The final reaction mixture was stirred at room temperature overnight and then directly purified by HPLC (Phenomenx Synergi column; 20-85% acetonitrile/water + 0.1% TFA) to afford the product (5-6) as bright yellow oil: IH-NMR (500 MHz, d4-CD30D) 6 9.44 (s, IH), 8.51 (s, IH), 7.74 (m, IH), 7.57-7.51 (m, 4H), 7.32-7.30 <m, 3H), 7.26-7.24 (m, 2H), 7.03 (m, IH), 6.88 (m, IH), 6.84 (m, IH), 5.32-5.24 (m, 2H) 4.32 (s, 2H), 3.66-3.23 (m. 8H), 3.37 (m, 2H), 3.01 (s, 3H) 2.95 (m, 2H); LRMS, calc'd for C34H35N702 (M+1), 574.70; found 574.70.
Figure imgf000070_0001
dioxane
4-[2-(4-methylpiperazin-l-yl)-6-phenylpyrido[2,3-Jlpyrimidin-7- yllbenzaldehyde (5-5a) 4-amino-2-(ethylthio ) pyrkridine -5 -carbaldehvde (5-2a) To a solution of 4-amino-5-hydroxymethyl-2-(ethylthio)pyrimidine (5-la) (9.6 g, 51.89 mmol) in CHCI3 (1 L) was added Mnθ2 (86.9 g, 415 mmol, 8 equiv). The suspension was stirred at rt overnight. The mixture was filtered through celite and washed with CHCI3. The combined filtrate was concentrated to give the titled compound (5-2a). 1H-NMR (500 MHz, CDC13) δ 9J8 (s, IH), 8.42 (s, IH), 8.20 (broad, IH), 5.74 (broad, IH), 2.55 (q, 2H), 1.38 (t, 3H). LRMS m/z (M+H) Calcd. 184.24, found 184.16. 7-chloro-2-(ethylthioV6-phenylpyridor2.3-dlpyrimidine (5-3a) To a solution of methyl phenylacetate (15.5 mL, 110 mmol) in THF (300 mL) at -78 °C was added LHMDS (1 M, 120 mL, 2.3 mmol) and stirred for 1 hr. 4-ammo-2-(ethylthio)pyrimidine-5- carbaldehyde (5-2a) (9.6 g, 52 mmol) was added. The mixture was warmed to room temperature and stirred for 12 hr. The reaction was quenched with saturated NH4CI solution and extracted with CH2C12- The combined organic layer was dried, filtered and concentrated. The resulting solid was triturated with Et20 and the white purified solid was filtered. A portion of the solid (2.5g, 8.8 mmol) was dissolved in CH3CN and phosphorus oxychloride (8.0 mL, 88 mmol) was added. The mixture was heated to reflux for 12 hr. After 12 hr, the solvent and POCl3 were distilled off using a dean stark apparatus until 15 mL remained in the flask. Upon cooling, a white solid formed and was filtered. The solid was washed with Et20 and dried under vacuum to afford the salt of (5-3a). The mother liquor was basified by slowly adding Et3N dropwise until pH = 7, diluted with water, and extracted with CH2C12- The combined organic layer was dried, filtered and concentrated. The residue was purified by trituration with Et 0 and filtered to yield pure (6-3) as a free base. Η-NMR (500 MHz, C__>C13) δ 9.20 (s, IH), 8.1 (s, IH), 7.50 (s, 5H), 3.4 (m, 2H), 1.38 (t, 3H) LRMS m/z (M+H) Calcd: 302.05, found: 302.04. 4-r2-(ethylthio -6-phenylpyridor2.3-dlpyrimidin-'7-yl1benzaldehyde (5-4a~) Either the salt or free base of 7-chloro-2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidine (5-3a) (0.80 g, 2.66 mmol) was combined with 4-formylphenylboxonic acid (1.0 g, 6.64 mmol), cesium carbonate (4.30 g, 13 mmol), and bis(tri-t-butylphosphine)palladium (0.136 g, 0.266 mmol) in dioxane (10 mL) and heated in a microwave reactor at 150 °C for 60 min. The reaction mixture was diluted with water and extracted with CH2CI2. The combined organic layer w^as dried, filtered and concentrated.
The residue was purified by silica gel chromatography (35% EtOAc in hexane) to give the title compound (5-4a). LRMS m/z (M+H) Calcd: 372.5, found: 372.5 4-[2-(4-methylpiperazine- 1 -yl)-6-phenylpyrido [2,3 --f|pyrimidm-7- yllbenzaldehvde (5-5a. To a solution of 4-[2-(ethylthio)-6-phenylpyrido[_2,3-d]pyrimidine-7-yl]benzaldehyde (5-
4a) (l.Og, 2.69 mmol) in CH2CI2 (30 mL) was added m-chloroperoxy benzoic acid (.660 g, 3.0 mmol).
The solution was stirred for 1 hr then quenched with sat. NaHC0 and 10% Na2S203 and stirred for 30 min. The reaction mixture was diluted with CH2CI2, extracted, dried with MgS0 , and filtered. A portion of the resulting sulfoxide (.700 g, 1.81 mmol) was dissolved in dioxane (7 mL) with methyl piperazine (181 mg, 1.81 mmol) and heated to 100 °C for 20 min. in a microwave reactor. The mixture was concentrated under reduced pressure and the residue was purified by HPLC (Phenomenx Synergi column; 20-85% acetonitrile/water + 0.1% TFA) to give the title compound (5-5a). Η-NMR (500 MHz, d4-CD3OD) δ 10 (s, IH), 9.48 (s, IH), 8.65 (s, IH), 7.88 (d, 2H), 7.64 (d, 2H), 7.46 (m, 6H), 7.33 (m, 3H), 7.26 (m, 3H), 3.6-3.4 (m, 8H), 3.00 (s, 3H) LRMS m/z (M+_H) Calcd: 410.5, found 410.5. EXAMPLE 1 Cloning of the human Akt isoforms and ΔPH-Aktl The pS2neo vector (deposited in the ATCC on April 3, 2001 as ATCC PTA-3253) was prepared as follows: The pRmHA3 vector (prepared as described in Nucl. Acid Res. 16:1043-1061 (1988)) was cut with Bgiπ and a 2734 bp fragment was isolated. The pUChsneo vector (prepared as described in EMBO J. 4:167-171 (1985)) was also cut with Bgiπ and a 4029 bp band was isolated. These two isolated fragments were ligated together to generate a vector termed pS2neo-l. This plasmid contains a polylinker between a metallotbionine promoter and an alcohol dehydrogenase poly A addition site. It also has a neo resistance gene driven by a heat shock promoter. The pS2neo-l vector was cut with Psp5II and BsiWI. Two complementary oligonucleotides were synthesized and then annealed
(CTGCGGCCGC (SEQ.ID.NO.: 1) and GTACGCGGCCGCA J (SEQ.ID.NO.: 2)). The cut pS2neo-l and the annealed oligonucleotides were ligated together to generate a second vector, pS2neo. Added in this conversion was a Notl site to aid in the linearization prior to transfection into S2 cells. Human Aktl gene was amplified by PCR (Clo_tιtech) out of a human spleen cDNA (Clontech) using the 5' primer:
5'CGCGAATTCAGATCTACCATGAGCGACGTGGCTATFGTG 3' (SEQ.ID.NO.: 3), and the 3' primer: 5'CGCTCTAGAGGATCCTCAGGCCGTGCTGCTGGC3' (SEQ.ID.NO.: 4). The 5' primer included an EcoRI and Bgiπ site. The 3' primer included an XZbal and BamHI site for cloning purposes. The resultant PCR product was subcloned into pGEM3Z (Pronnega) as an EcoRI / Xba I fragment. For expression / purification purposes, a middle T tag was added to the 5' end of the full length Aktl gene using the PCR primer: 5'GTACGATGCTGAACGATATCTTCG 3' (SEQ.ID.NO.: 5). The resulting PCR product encompassed a 5' Kpnl site and a 3' BamHI site vhich were used to subclone the fragment in frame with a biotin tag containing insect cell expression vector, pS2neo. For the expression of a pleckstrin homology domain (PH) deleted (Δaa 4-129, which includes deletion of a portion of the Akt 1 hinge region) version of Akt 1 , PCR deletion mutagenesis was done using the full length Aktl gene in the pS2neo vector as t&mplate. The PCR was carried out in 2 steps using overlapping internal primers
(5'GAATACATGCCGATGGAAAGCGACGGGGCTGAAG_AGATGGAGGTG 3' (SEQ.ID.NO.: 6), and 5'CCCCTCCATCTCTTCAGCCCCGTCGCTTTCCATCGGCATG TATTC 3' (SEQ.ID.NO.: 7)) which encompassed the deletion and 5' and 3' flanking primers which encompassed the Kpnl site and middle T tag on the 5' end. Tine final PCR product was digested with Kpnl and Smal and ligated into the pS2neo full length Aktl Kpnl / Sma I cut vector, effectively replacing the 5' end of the clone with the deleted version. Human Akt3 gene was amplified by PCR of adult brain cDNA (Clontech) using the amino terminal oligo primer: 5' GAATTCAGATCTACCATGAGCGATGTTACCATTGTG 3' (SEQ.ID.NO.: 8); and the carboxy terminal oligo primer :
5' TCTAGATCTTATTCTCGTCCACTTGCAGAG 3'(SEQ.ID.NO.: 9).
These primers included a 5' EcoRI / Bgiπ site and a 3' Xbal / Bgiπ site for cloning purposes. The resultant PCR product was cloned into the EcoRI and Xbal sites of pGEM4Z (Promega). For expression / purification purposes, a middle T tag was added to the 5' end of the full length _Akt3 clone using the PCR primer: 5' GGTACCATGGAATACATGCCGATGGAAAGCGATGTTACCATTGTGAAG 3 '(SEQ.ID.NO.: 10). The resultant PCR product encompassed a 5' Kpnl site which allowed in frame cloning with the biotin tag containing insect cell expression vector, pS2neo. Human Akt2 gene was amplified by PCR from human thymus cDNA (Clontech) using the amino terminal oligo primer:
5' AAGCTTAGATCTACCATGAATGAGGTGTCTGTC 3' (SEQ._D.NO.: 11); and the carboxy terminal oligo primer: 5' GAATTCGGATCCTCACTCGCGGATGCTGGC 3' CSEQ.ID.NO.: 12). These primers included a 5' HindHI / BglH site and a 3' EcoRI / BamHI site for cloning purposes. The resultant PCR product was subcloned into the HindHI / EcoRI sites of pGem3Z (Promega). For expression / purification purposes, a middle T tag was added to the 5' end of the full length Akt2 using the PCR primer: 5' GGTACCATGGAATACATGCCGATGGAAAATGAGGTOTCTGTCATCAAAG 3' (SEQ.ID.NO.: 13). The resultant PCR product was subcloned into the pS2neo vector as described above. EXAMPLE 2
Expression of human Akt isoforms and ΔPH-Aktl The DNA containing the cloned Aktl, Akt2, Akt3 and ΔPH-Akt 1 genes in the pS2neo expression vector was purified and used to transfect Drosophila S2 cells (ATCC) by the calcium phosphate method. Pools of antibiotic (G418, 500 μg/ml) resistant cells were selected. Cells were expanded to a 1.0 L volume (-7.0 x 106 / ml), biotin and CuS0 were added to a final concentration of 50 μM and 50 mM respectively. Cells were grown for 72 h at 27°C and harvested by centrifugation. The cell paste was frozen at -70°C until needed. EXAMPLE 3 Purification of human Akt isoforms and ΔPH-Aktl Cell paste from one liter of S2 cells, described in Example 2, was lysed by sonication with 50 mis 1% CHAPS in buffer A: (50 mM Tris pH 7.4, 1 mM EDTA, 1 mM EGTA, 0.2 mM AEBSF, 10 μg/ml benzamidine, 5 μg/ml of leupeptin, aprotinin and pepstatin each, 10% glycerol and 1 mM DTT). The soluble fraction was purified on a Protein G Sepharose fast flow (Pharmacia) column loaded with 9mg/ml anti-middle T monoclonal antibody and eluted with 75 μM EYMP E (SEQ.ID.NO.: 14) peptide in buffer A containing 25% glycerol. Akt containing fractions were pooled and the protein purity evaluated by SDS-PAGE. The purified protein was quantitated using a standard Bradford protocol. Purified protein was flash frozen on liquid nitrogen and stored at -70°C. Akt and Akt pleckstrin homology domain deletions purified from S2 cells required activation. Akt and Akt pleckstrin homology domain deletions was activated (Alessi et al. Current Biology 7:261-269) in a reaction containing 10 nM PDKl (Upstate Biotechnology-, Inc.), lipid vesicles (10 μM phosρhatidylinositol-3,4,5-trisphosphate - Metreya, Inc, 100 μM phosphatidylcholine and 100 μM phosphatidylserine - Avanti Polar lipids, Inc.) and activation buffer (50 mM Tris pH7.4, 1.0 mM DTT, 0.1 mM EGTA, 1.0 μM Microcystin-LR, 0.1 mM ATP, 10 mM MgCl2, 333 μg/ml BSA and O.lmM EDTA). The reaction was incubated at 22°C for 4 hours. Aliquots were flash frozen in liquid nitrogen. EXAMPLE 4
Akt Kinase Assays Activated Akt isoforms and pleckstrin homology domain deletion constructs were assayed utilizing a GSK-derived biotinylated peptide substrate. The extent of peptide phosphorylation was determined by Homogeneous Time Resolved Fluorescence (HTRF) using a la-xithanide chelate(Lance)-coupled monoclonal antibody specific for the phosphopeptide in combination with a streptavidin-linked allophycocyanin (SA-APC) fiuorophore which will bind to the biotin moiety on the peptide. When the Lance and APC are in proximity (i.e. bound to the same phospliopeptide molecule), a non-radiative energy transfer takes place from the Lance to the APC, followed by emission of light from APC at 665 nm.
Materials required for the assay:
A. Activated Akt isozyme or pleckstrin homology domain deleted construct
B. Akt peptide substrate: GSK3α (S21) Peptide no.3928 biotin-GGRARTSSFAEPG (SEQ.ID.NO.: 15), Macromolecular Resources; C. Lance labeled anti-phospho GSK3α monoclonal antibody (Cell Signaling Technology, clone # 27);
D. SA-APC (Prozyme catalog no. PJ25S lot no. 896067);
E. Microfluor®B U Bottom Microtiter Plates (Dynex Technologies, Catalog no. 7205);
F. Discovery® HTRF Microplate Analyzer, Packard Instrument Company; G. 100 X Protease Inhibitor Cocktail (PIC): 1 mg/ml benzamidine, 0.5 mg/ml pepstatin, 0.5 mg/ml leupeptin, 0.5 mg/ml aprotinin;
H. 10X Assay Buffer: 500 mM HEPES, pH 7.5, 1 % PEG, mM EDTA, 1 mM EGTA, 1 %
BSA, 20 mM ^--Glycerol phosphate;
I. Quench Buffer: 50 mM HEPES pH 7.3, 16.6 mM EDTA, 0.1% BSA, 0.1% Triton X- 100, 0.17 nM Lance labeled monoclonal antibody clone # 27, 0.0067 mg/ml SA-A PC; J. ATP/MgCl2 working solution: IX Assay buffer, 1 mM DTT, IK PIC, 125 mM KC1, 5%
Glycerol, 25 mM MgCl2, 375 IM ATP;
K. Enzyme working solution: IX Assay buffer, 1 mM DTT, IX PIC, 5% Glycerol, active
Akt. The final enzyme concentrations were selected so that the assay was in a linear; response range. L. Peptide working solution: IX Assay buffer, 1 mM DTT, IX PIC, 5% Glycerol, 2 TM
GSK3 biotinylated peptide # 3928. The reaction is assembled by adding 16 TL of the ATP/MgCl2 working solution to the appropriate wells of a 96-well microtiter plate. Inhibitor or vehicle (1.0 TI ) is added followed by 10 TI of peptide working solution. The reaction is started by adding 13 TI of the enzyme "working solution and mixing. The reaction is allowed to proceed for 50 min and then stopped by the addition of 60 TI HTRF quench buffer. The stopped reactions were incubated at room temperature for at least 30 min and then read on the Discovery instrument.
PKA assay:
Each individual PKA assay consists of the following components: A. 5X PKA assay buffer (200 mM Tris pH7.5, 100 mM MgCl2, 5π__M Φ-mercaptoethanol,
0.5 mM EDTA);
B. 50 μM stock of Kemptide (Sigma) diluted in water;
C. 33P-ATP prepared by diluting 1.0 μl 33P-ATP [10 mCi/ml] into _200 TI of a 50 μM stock of unlabeled ATP; D. 10 μl of a 70 nM stock of PKA catalytic subunit (UBI catalog # 14-114) diluted in 0.5 mg/ml BSA;
E. PKA/Kemptide working solution: equal volumes of 5X PKA assay buffer, Kemptide solution and PKA catalytic subunit. The reaction is assembled in a 96 deep-well assay plate. The inhribitor or vehicle (10 TI) is added to 10 TI of the 33P-ATP solution. The reaction is initiated by adding 30 TI of the PKA/Kemptide working solution to each well. The reactions were mixed and incubated at room temperature for 20 min.
The reactions were stopped by adding 50 TI of 100 mM EDTA and 100 mM sodium pyrophosphate and mixing. The enzyme reaction product (phosphorylated Kemptide) was collected on p81 phosphocellulose 96 well filter plates (Millipore). To prepare the plate, each well of a p81 filter plate was filled with 75 mM phosphoric acid. The wells were emptied through the filter by applying a vacuum to the bottom of the plate. Phosphoric acid (75 mM, 170 μl) was added to each well. A 30 μl aliquot from each stopped PKA reaction was added to corresponding wells on the filter plate containing the phosphoric acid. The peptide was trapped on the filter following the application of a vacuum and the filters were washed 5 times with 75 mM phosphoric acid. After the final wash, the filters were allowed to air dry. Scintillation fluid (30 μl) was added to each well and the filters counted on a TopCoun-t (Packard). PKC assay:
Each PKC assay consists of the following components: A. 10X PKC co-activation buffer: 2.5 mM EGTA, 4mM CaCl2;
B. 5X PKC activation buffer: 1.6 mg/ml phosphatidylserine, 0.16 mg/ml diacylglycerol, 100 mM Tris pH 7.5, 50 mM MgCl2, 5 mM O-mercaptoethanol;
C. 33P-ATP prepared by diluting 1.0 μl 33P-ATP [10 mCi/ml] into lOOμl of a 100 μM stock of unlabeled ATP; D. Myelin basic protein (350 μg/ml, UBI) diluted in water;
E. PKC (50 ng/ml, UBI catalog # 14-115) diluted into 0.5 mg/ml BSA;
F. PKC/Myelin Basic Protein working solution: Prepared by mixing 5 volumes eacb_ of PKC co-activation buffer and Myelin Basic protein with 10 volumes each of PKC activation buffer and PKC. The assays were assembled in 96 deep-well assay plates. Inhibitor or vehicle (lO Η) was added to 5.0 ul of 33P-ATP. Reactions were initiated with the addition of the PKC/Myelin Basic Protein working solution and mixing. Reactions were incubated at 30°C for 20 min. The reactions were stopped by adding 50 TI of 100 mM EDTA and 100 mM sodium pyrophosphate and mixing. Phosphoryla ed Mylein Basic Protein was collected on PNDF membranes in 96 well filter plates and quantitated "by scintillation counting. Specific compounds of the instant invention were tested in the assay described above and were found to have IC50 of < 50 μM against one or more of Aktl, Akt2 and Akt3. EXAMPLE 5 Cell based Assays to Determine Inhibition of Akt Cells (for example LnCaP or a PTEΝ^tumor cell line with activated Akt) were plated in
100 mM dishes. When the cells were approximately 70 to 80% confluent, the cells were refed with 5 mis of fresh media and the test compound added in solution. Controls included untreated cells, vehicle treated cells and cells treated with either LY294002 (Sigma) or wortmanin (Sigma) at 20 μM or 200 nM, respectively. The cells were incubated for 2, 4 or 6 hrs and the media removed. The cells were washed with PBS, scraped and transferred to a centrifuge tube. They were pelleted and washed again witli PBS. Finally, the cell pellet was resuspended in lysis buffer (20 mM Tris pH8, 140 mM ΝaCl, 2 mM EDTA, 1% Triton, 1 mM Νa Pyrophosphate, 10 mM O-Glycerol Phosphate, 10 mM ΝaF, 0.5 mm ΝaVO-4, 1 μM Microsystine, and lx Protease Inhibitor Cocktail), placed on ice for 15 minutes and gently vorte ed to lyse the cells. The lysate was spun in a Beckman tabletop ultra centrifuge at 100,000 x g at 4°C for 20 min. The supernatant protein was quantitated by a standard Bradford protocol (BioRad) and stored at - 70° C until needed. Proteins were immunoprecipitated (IP) from cleared lysates as follows: For A tl, lysates are mixed with Santa Cruz sc-7126 (D-17) in NETN (100 mM NaCl, 20 mM Tris pH 8.0, 1 m- EDTA, 0.5% NP-40) and Protein A/G Agarose (Santa Cruz sc-2003) was added. For Akt2, lysates were mixed in NETN with anti-Akt-2 agarose (Upstate Biotechnology #16-174) and for Akt3, lysates were mixed in NETN with anti-Akt3 agarose (Upstate Biotechnology #16-175). The IPs were incubated overnight at 4° C, washed and seperated by SDS-PAGE. Western blots were used to analyze total Akt, pThr308 Aktl, pSer473 Aktl, and corresponding phosphorylation sites on Akt2 and Akt3, and downstream targets of Akt using specific antibodies (Cell Signaling Technology): Anti-Total Akt (cat. no. 9272), Anti-Phopho Akt Seriαe 473 (cat. no. 9271), and Anti-Phospho Akt Threonine 308 (cat. no. 9275). After incubating with the appropriate primary antibody diluted in PBS + 0.5% non-fat dry milk (NFDM) at 4 °C overniglit, blots were washed, incubated with Horseradish peroxidase (HRP)-tagged secondary antibody in PBS + 0.5% NFDM for 1 hour at room temperature. Proteins were detected with ECL Reagents (Amersham/Pharmacia Biotech RPN2134). EXAMPLE 6
Heregulin Stimulated Akt Activation MCF7 cells (a human breast cancer line that is PTEN*'"1") were plated at lxlO6 cells per 100 mM plate. When the cells were 70 - 80% confluent, they were refed with 5 ml of serum free media and incubated overnight. The following morning, compound was added and the cells were incubated for 1 - 2 hrs, after which time heregulin was added (to induce the activation of Akt) for 30 minutes and the cells were analyzed as described above. EXAMPLE 7 Inhibition Of Tumor Growth In vivo efficacy of an inhibitor of the growth of cancer cells may be confirmed by several protocols well known in the art. Human tumor cell lines which exhibit a deregulation of the PI3K pathway (sucli as LnCaP, PC3, C33a, OVCAR-3, MDA-MB-468 or the like) are injected subcutaneously into the left flank of 6-10 week old female nude mice (Harlan) on day 0. The mice are randomly assigned to a v&hicle, compound or combination treatment group. Daily subcutaneous administration begins on day 1 and continues for the duration of the experiment. Alternatively, the inhibitor test compound may be administered by a continuous infusion pump. Compound, compound combination or vehicle is delivered in a total volume of 0.2 ml. Tumors are excised and weighed when all of the vehicle-treated animals exhibited lesions of 0.5 - 1.0 cm in diameter, typically 4 to 5.5 weeks after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated.

Claims

WHAT IS CLAIMED IS:
1. A compound of the Formula A- 1 :
Figure imgf000079_0001
wherein:
Figure imgf000079_0002
a is 0 or 1; b is 0 or 1; m is 0, 1, or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, 4 or 5;
Rl is independently selected from: H, (C=O)aObCι-Cl0 alkyl, (C=0)aOb aryl, (C=0)aObC2-Cιo alkenyl, (C=0)aObC2-Cιo alkynyl, CO2H, halo, OH, oxo, ObCι-C6 perfluoroalkyl, (C=0)aNR7R8, CN, (C=0)aObC3-C8 cycloalkyl, S(0)mNRVR8, S(0)m-(Cι-Cιo)alkyl and (C=0)aObheterocyclyl, said alkyl, aryl, alkenyl, alkynyl, cycloalkyl, and heterocyclyl is optionally substituted with one or more substituents selected from Rδ ;
R2' is independently selected from: H, (C=O)aObCι-Ci0 alkyl, (C=0)aOb aryl,
Figure imgf000079_0003
alkenyl, (C=0)aObC2-Cι 0 alkynyl, CO2H, halo, OH, oxo, O Ci-Ce perfluoroalkyl, (C=0)aNR7R8, CN, (C=0)aObC3-C8 cycloalkyl, S(0)mNR7R8, S(0)m-(Cι-Cιo)alkyl and (C=0)aObheterocyclyl, said alkyl, aryl, alkenyl, alkynyl, cycloalkyl, and heterocyclyl is optionally substituted with one or more substituents selected from R6'; R3' is independently selected from: H, (C=0)aObCι-Cιo alkyl, (C=0)aOb aryl, (C=0)aObC2-Cιo alkenyl,
Figure imgf000080_0001
alkynyl, CO2H, halo, OH, oxo, ObCι-C6 perfluoroalkyl, (C=0)aNR7R8, CN, (C=0)aObC3-C8 cycloalkyl, S(0)mNR7R8, S(0)m-(Cι-Cιo)alkyl and (C=0)aObheterocyclyl, said alkyl, aryl, alkenyl, alkynyl, cycloalkyl, and heterocyclyl is optionally substituted with one or more substituents selected from R6';
R4' is independently selected from: H, (C=0)aObCι-Cιo alkyl, (C=0)aOb aryl,
Figure imgf000080_0002
alkenyl,
Figure imgf000080_0003
alkynyl, CO2H, halo, OH, oxo, ObCi-C6 perfluoroalkyl, (C=0)aNR7R8, CN, (C=0)a0bC3-C8 cycloalkyl, S(0)mNR7R8, S(O)m-(Cι-Cl0)alkyl and (C=0)aObheterocyclyl, said alkyl, aryl, alkenyl, alkynyl, cycloalkyl, and heterocyclyl is optionally substituted with one or more substituents selected fromR6';
R6' is independently: (C=0)aObCι-Cιo alkyl, (C=0)aObaryl, C2-C10 alkenyl, C2-C10 alkynyl, (C=0)aOb heterocyclyl, CO2H, halo, CN, OH, ObCι -C6 perfluoroalkyl, Oa(C=0)bNR7R8, oxo, CHO, (N=0)R7R8, S(0)mNR7R8, S(0)m-(Cι-Cιo)alkyl or (C=0)aObC3-C8 cycloalkyl, said alkyl, aryl, alkenyl, alkynyl, heterocyclyl, and cycloalkyl optionally substituted with one or more substituents selcted from R6 ;
R6 is selected from: (C=0)aOb(Cι-Cι o)alkyl, Oa(Cι-C3)perfluoroalkyl, (C()-C6)alkylene-S(0)mRa oxo, OH, halo, CN, NO2, (C2-Cιo)alkenyl, (C2-Cιo)alkynyl, (C3-C6)cycloalkyl, (Co-C6)alkylene-aryl, (Co-C6)alkylene-heterocyclyl, (Co-C6)alkylene-N(Rb)2, C(0)Ra, (Co-C6)alkylene-Cθ2Ra, C(0)H, and (Co-C6)alkylene-Cθ2H, said alkyl, alkenyl, alkynyl, cycloalkyl, aryl, and heterocyclyl is optionally substituted with up to three substituents selected fromRb, OH, (Cι-C6)alkoxy, halogen, CO2H, CN, 0(C=0)C 1 -C6 alkyl, oxo, and N(Rb)2;
R7 and Rδ are independently selected from: H, (C=0)ObCι-Cιo alkyl, (C=0)O C3-Cs cycloalkyl, (C=0)Obaryl, (C=0)Obheterocyclyl, C1-C10 alkyl, aryl, C2-C10 alkenyl, C2-C10 alkynyl, heterocyclyl, C3-C8 cycloalkyl, Sθ2Ra, and
Figure imgf000080_0004
s id alkyl, cycloalkyl, aryl, heterocylyl, alkenyl, and alkynyl is optionally substituted with one or more substituents selected from Roa, or R and R°> can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 5-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocylcic or bicyclic heterocycle optionally substituted with one or more substituents selected from R6 ; Ra is NH2, (Cι-CD)alkyl, (C3-C6)cycloalkyl, aryl, or heterocyclyl; and
Rb is independently H, (Cι-C6)alkyl, aryl, heterocyclyl, (C3-C6)cycloalkyl, (C=0)OC].-C6 alkyl, (C=0)Cι-C6 alkyl or S(0)2Ra;
or a pharmaceutically acceptable salt or a stereoisomer thereof.
2. The compound according to Claim 1 of the Formula A-l :
wherein:
Figure imgf000081_0001
and all other substituents and variables are as defined in Claim 1 ;
or a pharmaceutically acceptable salt or a stereoisomer thereof.
3. The compound according to Claim 2 of the Formula B-l :
Figure imgf000081_0002
wherein:
n is 0, 1 or 2; R2' is independently selected from: H, (Cι-C6)alkyl and (C3-C8)cycloalkyl;
and all substituents and variables are as defined in Claim 2;
or a pharmaceutically acceptable salt or a stereoisomer thereof.
4. The compound according to Claim 3 of the Formula B-l : wherein:
R2' is: H or (Cι-C6)alkyl;
and all substituents and variables are as defined in Claim 3;
or a pharmaceutically acceptable salt or a stereoisomer thereof.
5. A compound which is selected from:
3-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)-l-phenylpropan-l-one; l-(2-aminophenyl)-3-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)propan-l- one;
N-l-{4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrirnidin-7-yl]benzyl}-N-2-(5-nitropyridin-2-yl)ethane-
1,2-diamine;
5-[2-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrir din-7-yl]benzyl}amino)ethyl]-l,3,4-thiadiazol-2- amine; 4-[3-({4-[2-(methylthio)-6-phenylpyrido[2,3-J]pyrirmdin-7-yl]benzyl}amino)propyl]-2,4-dihydro-3H- pyrazol-3-one;
[3-(lH-imidazol-l-yl)propyl]{4-[2-(methylthio)-6-phenylpyrido[2,3-_/]pyrin_idin-7-yl]benzyl}amine;
[3-(4-methylpiperazin-l-yl)propyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--i]pyrimidin-7- yl]benzyl} amine; [2-( lH-imidazol-4-yl)ethyl] { 4-[2-(methylthio)-6-phenylpyrido[2,3-J]pyrimidin-7-yl]benzyl } amine;
4-[2-({4-[2-(methylthio)-6-phenylpyrido[2,3--i]pyrimidin-7-yl]benzyl}amino)ethyl]phenol;
[2-(lH-benzinτidazol-2-yl)ethyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--/]pyrimidin-7-yl]benzyl}an_ine;
4-[2-({4-[2-(methylthio)-6-phenylpyrido[2,3-_t]pyrir din-7-yl]benzyl}amino)ethyl benzenesulfonamide;
N-3-{4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}-beta-alaninamide; 7-[4-(3-oxo-3-phenylpropylaιmno)methylphenyl]-6-phenylpyrido[2,3-d]pyrimidine-2-carboxamide; 7-{4-[3-oxo-3-(2-aminophenyl)propylamino]methylphenyl}-6-phenylpyrido[2,3-d]pyrimidine-2- carboxamide;
5-({[4-(3-Phenyl-l,5-naphthyridin-2-yl)benzyl]amino}methyl)-2,4-dihydro-3H-l,2,4-triazol-3-one;
3-[(3-hydroxyρhenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)phenyl]-N-{[5-(lH-pyrazol-l-yl)pyridin-2- yl]methyl}methane;
(6-chloropyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane;
[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)phenyl]-N-(pyridin-3-ylmethyl)methane; (6-methoxypyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane;
(6-oxo-l,6-dihydropyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]methane;
3-[(2-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane; 3-[(3-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
3-[(4-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
3-[(2-methoxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
3-[(2-methoxyphenyl)(methyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
3-[(3-hydroxypyridin-2-yl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane; 3-phenyl-2-[4-( { [4-( lH-pyrazol- 1 -yl)benzyl] amino } methyl)phenyl] - 1 ,6-naphthyridin-5(6H)-one;
2,2,2-trifluoro-N-[4-(6-methyl-5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl] ethanesulfonamide;
2-[4-({[3-(2-aminophenyl)-3-oxopropyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({[3-(5-oxo-4,5-dihydro-lH-pyrazol-4-yl)propyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin- 5(6H)-one;
2-[4-({[2-(l,3-benzodioxol-5-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
4-(2-{ [4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}ethyl) benzenesulfonamide;
2-{4-[({2-[(5-nitropyridin-2-yl)amino]ethyl} amino)methyl]phenyl}-3-phenyl-l,6-naphthyridin-5(6H)- one; 3-phenyl-2-[4-({[4-(l,2,3-thiadiazol-4-yl)benzyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one; 2-[4-({[l-(lH-benzimidazol-2-yl)ethyl]amino} methyl)phenyl]-3-ρhenyl-l,6-naphthyridin-5(6H)-one;
3-phenyl-2-(4-{[(2-pyridin-3-ylethyl)amino] methyl }phenyl)-l,6-naphthyridin-5(6H)-one;
2-(4-{[(3,4-dimethoxybenzyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({[2-(5-methyl-4H-l,2,4-triazol-3-yl)ethyl] amino }methyl)phenyl]-3-phenyl-l,6-naphthyridin- 5(6H)-one;
3-phenyl-2-[4-({[2-(lH-l,2,4-triazol-5-yl)ethyl] amino }methyl)phenyl]-l,6-naphthyridin-5(6H)-one;
2-[4-({ [(5-oxo-4,5-dihydro-lH-l,2,4-triazol-3-yl)methyl]amino}methyl)phenyl]-3-phenyl-l,6- naphthyridin-5(6H)-one;
3-phenyl-2-[4-({[2-(3-pyridin-4-yl-lH-l,2,4-triazol-5-yl)ethyl]amino}methyl)phenyl]-l,6-naphthyridin- 5(6H)-one;
2-[4-({[2-(lH-benzimidazol-2-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
3-phenyl-2-(4-{[(2-pyridin-2-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one;
3-phenyl-2-(4-{ [(2-pyridin-4-ylethyl)amino] methyl }phenyl)-l ,6-naphthyridin-5(6H)-one;
2-[4-( { [2-(2-oxoimidazolidin- 1 -yl)ethyl] amino } methyl)phenyl] -3-phenyl- 1 ,6-naphthyridin-5 (6H)-one; 2-(4-{ [(2-morpholin-4-ylethyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-(4-{[(2-anilinoethyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
3-phenyl-2-[4-({[2-(pyridin-2-ylamino)ethyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one;
2-[4-({ [3-(2-oxopyrrolidin-l-yl)propyl]amino } methyl)phenyl]-3-phenyl-l ,6-naphthyridin-5(6H)-one;
2-[4-({[4-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one; 2-(4-{[(l,3-benzodioxol-5-ylmethyl)amino] methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
N-(2-{[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}ethyl)-lH-l,2,4-triazole-3- carboxamide;
2-[4-( { [2-( lH-benzimidazol- 1 -yl)ethyl] amino } methyl)phenyl] -3-phenyl- 1 ,6-naphthyridin-5 (6H)-one;
2-(4-{[(3,5-dimethoxybenzyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one; 3-phenyl-2-[4-({ [4-(lH-pyrrol-l-yl)benzyl] amino} methyl)phenyl]-l,6-naphthyridin-5(6H)-one;
2-[4-({ [2-(3,4-dimethoxyphenyl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({ [2-(6-methoxy-lH-indol-3-yl)ethyl] amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-(4-{ [(4-morpholin-4-ylbenzyl)amino] methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
3-phenyl-2-[4-({[3-(lH-l,2,3-triazol-l-yl)propyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one; 2-(4-{[(4-hydroxybenzyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
3-phenyl-2-(4-{ [(2-{[5-(trifluoromethyl)pyridin-2-yl]amino}ethyl)amino]methyl}phenyl)-l,6- naphthyridin-5 (6H)-one;
2-(4-{ [(imidazo[ 1 ,2-a]pyridin-2-ylmethyl)amino] methyl }phenyl)-3-phenyl-l ,6-naphthyridin-5(6H)-one;
4-({[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}methyl) benzenesulfonamide; 2-[4-({[2-(2-amino-4-methyl-l,3-thiazol-5-yl)ethyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyrϊdin-
5(6H)-one;
2-[4-({[4-(lH-imidazol-4-yl)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-onei (4-56);
2-[4-({[2-(3,5-dimethyl-lH-pyrazol-4-yl)ethyl] amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)- one;
2-(4-{ [(l,3-benzothiazol-2-ylmethyl)amino] methyl} phenyl)-3-phenyl-l,6-naph_hyridin-5(6H)-on_e;
3-phenyl-2-(4-{ [(2-pyrazin-2-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one;
3-phenyl-2-[4-({[2-(lH-l,2,4-friazol-l-yl)ethyl] a_mno}methyl)phenyl]-l,6-naphthyridin-5(6H)-orιe;
2-(4-{[(3H-imidazo[4,5-_7]pyridin-2-ylmethyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)- one;
3-phenyl-2-{4-[({ l-[4-(lH-l,2,4-triazol-l-yl)phenyl]ethyl}amino)methyl]phenyl}-l,6-naphthyridiιι-
5(6H)-one;
3-phenyl-2-[4-({[2-(5-phenyl-2,5-diazabicyclo [2.2.1]hept-2-yl)ethyl]amino}methyl)phenyl]-l,6- naphthyridin-5 (6H)-one;
2-[4-({[2-(l -methyl- 1 H-benzimidazol-2-yl) ethyl] amino } methy l)pheny 1] -3 -phenyl- 1 ,6-naphthyridin-
5(6H)-one;
3-phenyl-2-[4-({[2-(4-pyrirmdin-2-ylpiperazin-l-yl)ethyl]amino}methyl)phenyl]-l,6-naphthyridir__-5(6H)- one;
2-(4-{ (3-morpholin-4-ylpropyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-( [2-(4-hydroxyphenyl)ethyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-( [2-(5-methyl-lH-imidazol-4-yl)ethyl] amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)- one;
2-[4-( [ [2-( lH-imidazol-4-yl)ethyl]amino }methyl) phenyl] -3-phenyl- 1 ,6-naphthyridin-5(6H)-one;
2-(4-{ [(4-hydroxyphenyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-( [ [3-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-( [ [2-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-( ( [2-(dimethylarrdno)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-( [[4-(methylthio)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-( [ [4-(methylsulfonyl)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-( [ [4-(methylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-(4-{ [(3,4-dihydroxybenzyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-( [ [( 1 -methyl- 1,2,3 ,4-tetrahydroquinolin-6-yl)methyl] amino } methyl)phenyl] -3 -phenyl-1 ,6- naphthyridin-5(6H)-one; 2-(4-{ [(4-chlorobenzyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one; 2-[4-({[(l-methyl-2,3-dihydro-lH-indol-5-yl)methyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one; l,6-naphthyridin-5(6H)-one, 2-[4-[[[(6-methoxy-lH-benzimidazol-2-yl)methyl]amino]methyl] phenyl]-3- phenyl; 3-phenyl-2-{4-[({ [6-(trifluoromethyl)pyridin-3-yl]methyl}amino)methyl]phenyl}-l,6-naphthyridin-
5(6H)-one;
2-(4-{ [(3-hydroxybenzyl)oxy]methyl }phenyl)-3-phenyl-l ,6-naphthyridin-5(6H)-one;
2-(4-{[(3-hydroxybenzyl)oxy]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({ [4-(diethylan_ino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one; 3-[(6-methoxypyridin-3-yl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]-3-(pyridine-2-ylamino)propane;
2-[(2-hydroxybenzoyl)amino]-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]ethane;
3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]-3-(pyridine-4-ylamino)propane; 6-methyl-2-[4-({methyl[4-(lH-pyrazol-l-yl)benzyl] amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one;
2-[4-( { methyl [4-( lH-pyrazol- 1 -yl)benzyl] amino } methyl)phenyl] -3 -phenyl- 1 ,6-naphthyridin-5 (6H)-one ;
6-methyl-3 -phenyl-2-[4-( { [4-( lH-pyrazol- 1 -yl)benzyl] amino } methyl) phenyl] - 1 ,6-naphthyridin-5(6H)- one; and 3-[(2-hydroxyphenyl)amino]-N-{4-[2-(4-methylpiperazin-l-yl)-6-phenylpyrido[2,3-d]pyrimidin-7- yl]benzyl } -3-oxopropane;
or a pharmaceutically acceptable salt or a stereoisomer thereof. 6. The TFA salt of a compound according to Claim 1 which is selected from:
3-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)-l-phenylpropan-l-one; l-(2-aminophenyl)-3-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)propan-l- one; N-l-{4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}-N-2-(5-nitropyridin-2-yl)ethane-
1,2-diamine;
5-[2-({4-[2-(methylthio)-6-phenylpyrido[2,3-d]pyrimidin-7-yl]benzyl}amino)ethyl]-l,3,4-thiadiazol-2- amine;
4-[3-({4-[2-(methylthio)-6-phenylpyrido[2,3-J]pyrimidin-7-yl]benzyl}amino)propyl]-2,4-dihydro-3_!_r- pyrazol-3-one; [3-(lH-imidazol-l-yl)propyl]{4-[2-(methylthio)-6-phenylpyrido[2,3-_t]ρyriιmdin-7-yl]benzyl}a_π_ine;
[3-(4-methylpiperazin-l-yl)propyl]{4-[2-(methylthio)-6-phenylpyrido[2,3-J]pyrimidin-7- yl]benzyl} amine;
[2-( lH-imidazol-4-yl)ethyl] { 4-[2-(methylthio)-6-phenylpyrido[2,3-_ ]pyrimidin-7-yl]benzyl } ainine; 4-[2-({4-[2-(methylthio)-6-phenylpyrido[2,3--t]pyrimidin-7-yl]benzyl}amino)ethyl]phenol;
[2-(lH-benzimidazol-2-yl)ethyl]{4-[2-(methylthio)-6-phenylpyrido[2,3--t]pyrirnidin-7-yl]benzy'l}-umne;
7-[4-(3-oxo-3-phenylpropylamino)methylphenyl]-6-phenylpyrido[2,3-d]pyrirmdine-2-carboxarr_ide;
7-{4-[3-oxo-3-(2-aminophenyl)propylamino]methylphenyl}-6-phenylpyrido[2,3-d]pyrimidine-_2- carboxamide; 5-({ [4-(3-Phenyl-l,5-naphthyridin-2-yl)benzyl]amino}methyl)-2,4-dihydro-3H-l,2,4-triazol-3-one;
3-[(3-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propan-l-aminium trifluoroacetate;
[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)phenyl]-N-{[5-(lH-pyrazol-l-yl)pyridin— 2- yl]methyl }methane; (6-chloropyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane;
[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)phenyl]-N-(pyridin-3-ylmethyl)methane-
(6-methoxypyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]methane;
(6-oxo-l,6-dihydropyridin-3-yl)-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]methane; 3-[(2-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
3-[(3-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
3-[(4-hydroxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
3-[(2-methoxyphenyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
3-[(2-methoxyphenyl)(methyl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane; 3-[(3-hydroxypyridin-2-yl)amino]-3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2- yl)benzyl]propane;
2-[4-({ [3-(2-aminophenyl)-3-oxopropyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6_H)-one;
2-[4-({ [3-(5-oxo-4,5-dihydro-lH-pyrazol-4-yl)propyl]amino}methyl)phenyl]-3-phenyl-l,6-napt thyridin-
5(6H)-one; 2-[4-({ [2-(l,3-benzodioxol-5-yl)ethyl] amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one; 4-(2-{[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}ethyl) benzenesulfonamid_e;
2-{4-[({2-[(5-nitropyridin-2-yl)amino]ethyl} amino)methyl]phenyl}-3-phenyl-l,6-naphthyridin-5(6I - one;
3-phenyl-2-[4-({[4-(l,2,3-thiadiazol-4-yl)benzyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one- 2-[4-({[l-(lH-benzimidazol-2-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one-
3-phenyl-2-(4-{[(2-pyridin-3-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one;
2-(4-{[(3,4-dimethoxybenzyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridm-5(6H)-one;
2-[4-({[2-(5-methyl-4H-l,2,4-triazol-3-yl)ethyl] amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-
5(6H)-one; 3-phenyl-2-[4-({[2-(lH-l,2,4-triazol-5-yl)ethyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one;
2-[4-({[(5-oxo-4,5-dihydro-lH-l,2,4-triazol-3-yl)methyl]amino}methyl)phenyl]-3-phenyl-l,6- naphthyridin-5(6H)-one;
3-phenyl-2-[4-({ [2-(3-pyridin-4-yl-lH-l,2,4-triazol-5-yl)ethyl]amino}methyl)phenyl]-l,6-naphthyridLιι-
5(6H)-one; 2-[4-({ [2-(lH-benzimidazol-2-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one-
3-phenyl-2-(4-{[(2-pyrazin-2-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one;
3-phenyl-2-[4-({[2-(lH-l,2,4-triazol-l-yl)ethyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one;
2-(4-{[(3H-iιmdazo[4,5-b]pyridin-2-ylmethyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6_ _ - one; 3-phenyl-2-{4-[({ l-[4-(lH-l,2,4-triazol-l-yl)phenyl]ethyl}amino)methyl]phenyl}-l,6-naphthyridin-
5(6H)-one;
3-phenyl-2-[4-({[2-(5-phenyl-2,5-diazabicyclo [2.2.1]hept-2-yl)ethyl]amino}methyl)phenyl]-l,6- naphthyridin-5(6H)-one;
2-[4-({[2-(l-methyl-lH-benzimidazol-2-yl) ethyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin- 5(6H)-one;
3-phenyl-2-[4-( { [2-(4-pyrimidin-2-ylpiperazin- 1 -yl)ethyl] amino } methy l)phenyl] - 1 ,6-naphthyridin-5 (6H)- one;
2-(4-{[(3-morpholin-4-ylpropyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({ [2-(4-hydroxyphenyl)ethyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one; 2-[4-({ [2-(5-methyl-lH-imidazol-4-yl)ethyl] amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H>- one;
2-[4-({[2-(lH-imidazol-4-yl)ethyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-(4-{[(4-hydroxyphenyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({[3-(dimethylamino)benzyl]amino}methyl) ρhenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one; 2-[4-({ [2-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one; 2-[4-({[2-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({[4-(methylthio)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naρhthyridin-5(6H)-one;
2-[4-({[4-(methylsulfonyl)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({[4-(methylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one; 2-(4-{ [(3,4-dihydroxybenzyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({ [(l-methyl-l,2,3,4-tetrahydroquinolin-6-yl)methyl]amino}methyl)phenyl]-3-phenyl-l,6- naphthyridin-5(6H)-one;
2-(4-{[(4-chlorobenzyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({[(l-methyl-2,3-dihydro-lH-indol-5-yl)methyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyr-idin- 5(6H)-one; l,6-naphthyridin-5(6H)-one, 2-[4-[[[(6-methoxy-lH-benzimidazol-2-yl)methyl]amino]methyl] phe_nyl]-3- phenyl;
3-phenyl-2-{ 4-[( { [6-(trifluoromethyl)pyridin-3-yl]methyl } amino)methyl]phenyl } -1 ,6-naphthyridin—
5(6H)-one; 2-(4-{[(3-hydroxybenzyl)oxy]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-(4-{[(3-hydroxybenzyl)oxy]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({[4-(diethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]-3-(pyridine-2-ylamino)propane;
2-[(2-hydroxybenzoyl)amino]-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]eth__ine; 3-oxo-N-[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]-3-(pyridine-4-ylamino)propane;
6-methyl-2-[4-({methyl[4-(lH-pyrazol-l-yl)benzyl] amino}methyl)phenyl]-3-phenyl-l,6-naphthyri_din-
5(6H)-one;
2-[4-({methyl[4-(lH-pyrazol-l-yl)benzyl]amino}methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)— one;
6-methyl-3-phenyl-2-[4-({[4-(lH-pyrazol-l-yl)benzyl]amino}methyl) phenyl]-l,6-naphthyridin-5(6H)- one; and
3-[(2-hydroxyphenyl)amino]-N-{4-[2-(4-methylpiperazin-l-yl)-6-phenylpyrido[2,3-d]pyrimidin-7- yl]benzyl } -3-oxopropane;
or a stereoisomer thereof.
The HC1 salt of a compound according to Claim 1 which is selected from:
3-phenyl-2-(4-{ [(2-pyridin-2-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one; 3-phenyl-2-(4-{[(2-pyridin-4-ylethyl)amino] methyl}phenyl)-l,6-naphthyridin-5(6H)-one; 2-[4-({[2-(2-oxoimidazolidin-l-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-<->ne; 2-(4-{ [(2-morpholin-4-ylethyl)amino]methyl } phenyl)-3-phenyl-l ,6-naphthyridin-5(6H)-one;
2-(4-{ [(2-anilinoethyl)amino]methyl }phenyl)-3-phenyl-l ,6-naphthyridin-5(6H)-one;
3-phenyl-2-[4-({[2-(pyridin-2-ylamino)ethyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one;
2-[4-({ [3-(2-oxopyrrolidin-l-yl)propyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6>H)-one; 2-[4-({ [4-(dimethylamino)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-orιe;
2-(4-{ [( 1 ,3-benzodioxol-5-ylmethyl)amino] methyl }phenyl)-3-phenyl-l ,6-naphthyridin-5(6H) -one;
N-(2-{ [4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}ethyl)-lH-l,2,4-triazole-3- carboxamide;
2-[4-({ [2-(lH-benzimidazol-l-yl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(( H)-one; 2-(4-{ [(3,5-dimethoxybenzyl)amino]methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
3-phenyl-2-[4-({ [4-(lH-pyrrol-l-yl)benzyl]amino} methyl)phenyl]-l,6-naphthyridin-5(6H)-or_ιe;
2-[4-({[2-(3,4-dimethoxyphenyl)ethyl]amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({[2-(6-methoxy-lH-indol-3-yl)ethyl] amino} methyl)phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-(4-{ [(4-morpholin-4-ylbenzyl)amino] methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one; 3-phenyl-2-[4-({[3-(lH-l,2,3-triazol-l-yl)propyl] amino}methyl)phenyl]-l,6-naphthyridin-5(6H)-one;
2-(4-{[(4-hydroxybenzyl)amino]methyl}phenyl)-3-phenyl-l,6-naphthyridin-5(6H)-one;
3-phenyl-2-(4-{ [(2-{ [5-(trifluoromethyl)pyridin-2-yl]amino }ethyl)amino]methyl }phenyl)-l ,6- naphthyridin-5 (6H)-one;
2-(4-{[(imidazo[l,2-a]pyridin-2-ylmethyl)amino] methyl}phenyl)-3-phenyl-l,6-naphthyridin-.5(6H)-one; 4-({[4-(5-oxo-3-phenyl-5,6-dihydro-l,6-naphthyridin-2-yl)benzyl]amino}methyl) benzenesulf namide;
2-[4-({[2-(2-amino-4-methyl-l,3-thiazol-5-yl)ethyl]amino}methyl)phenyl]-3-phenyl-l,6-naph"thyridin-
5(6H)-one;
2-[4-({ [4-(lH-imidazol-4-yl)benzyl]amino}methyl) phenyl]-3-phenyl-l,6-naphthyridin-5(6H)-one;
2-[4-({ [2-(3,5-dimethyl-lH-pyrazol-4-yl)ethyl] an_ino}methyl)phenyl]-3-phenyl-l,6-naphthyrάdin-5(6H)- one; and
2-(4-{[(l,3-benzothiazol-2-ylmethyl)amino] methyl} phenyl)-3-phenyl-l,6-naphthyridin-5(6HE)-one;
or a stereoisomer thereof.
8. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 1.
9. The use of the compound according to Claim 1 for the preparation of a medicament useful in the treatment or prevention of cancer in a mammal in need of such treatment.
10. A pharmaceutical composition made by combining the compound of Claim 1 and a pharmaceutically acceptable carrier.
PCT/US2005/011561 2004-04-09 2005-04-05 Inhibitors of akt activity Ceased WO2005100356A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2007507448A JP2007532551A (en) 2004-04-09 2005-04-05 Inhibitor of Akt activity
US11/547,113 US7750151B2 (en) 2004-04-09 2005-04-05 Inhibitors of Akt activity
EP05732864A EP1737861A4 (en) 2004-04-09 2005-04-05 INHIBITORS OF AKT ACTIVITY
AU2005233569A AU2005233569B2 (en) 2004-04-09 2005-04-05 Inhibitors of Akt activity
CA002561315A CA2561315A1 (en) 2004-04-09 2005-04-05 Inhibitors of akt activity

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US56119404P 2004-04-09 2004-04-09
US60/561,194 2004-04-09

Publications (1)

Publication Number Publication Date
WO2005100356A1 true WO2005100356A1 (en) 2005-10-27

Family

ID=35149937

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/011561 Ceased WO2005100356A1 (en) 2004-04-09 2005-04-05 Inhibitors of akt activity

Country Status (7)

Country Link
US (1) US7750151B2 (en)
EP (1) EP1737861A4 (en)
JP (1) JP2007532551A (en)
CN (1) CN1942470A (en)
AU (1) AU2005233569B2 (en)
CA (1) CA2561315A1 (en)
WO (1) WO2005100356A1 (en)

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006123182A2 (en) 2005-05-17 2006-11-23 Merck Sharp & Dohme Limited Cyclohexyl sulphones for treatment of cancer
WO2006091395A3 (en) * 2005-02-14 2007-02-22 Merck & Co Inc Inhibitors of akt activity
WO2007087246A2 (en) 2006-01-24 2007-08-02 Merck & Co., Inc. Jak2 tyrosine kinase inhibition
US7544677B2 (en) 2004-08-23 2009-06-09 Merck & Co., Inc. Inhibitors of Akt activity
US7576209B2 (en) 2006-12-06 2009-08-18 Merck & Co., Inc. Inhibitors of Akt activity
US7655649B2 (en) 2004-04-09 2010-02-02 Merck Sharp & Dohme Corp. Inhibitors of Akt activity
US20100063032A1 (en) * 2007-03-28 2010-03-11 Debenham John S Substituted pyrido[2,3-d]pyrimidine derivatives as cannabinoid-1 receptor modulators
US7705014B2 (en) 2005-04-12 2010-04-27 Merck Sharp & Dohme Corp. Inhibitors of AKT activity
WO2010114780A1 (en) 2009-04-01 2010-10-07 Merck Sharp & Dohme Corp. Inhibitors of akt activity
US7910561B2 (en) 2004-12-15 2011-03-22 Merck Sharp & Dohme Corp. Inhibitors of Akt activity
WO2011046771A1 (en) 2009-10-14 2011-04-21 Schering Corporation SUBSTITUTED PIPERIDINES THAT INCREASE p53 ACTIVITY AND THE USES THEREOF
WO2011075628A1 (en) 2009-12-18 2011-06-23 Amgen Inc. Heterocyclic compounds and their uses
EP2154965A4 (en) * 2007-05-29 2011-08-17 Glaxosmithkline Llc Naphthyridine, derivatives as p13 kinase inhibitors
US8008317B2 (en) 2005-06-10 2011-08-30 Merck Sharp & Dohme Corp. Inhibitors of akt activtiy
US20110288090A1 (en) * 2009-02-02 2011-11-24 Armstrong Donna J Inhibitors of AKT Activity
WO2011163330A1 (en) 2010-06-24 2011-12-29 Merck Sharp & Dohme Corp. Novel heterocyclic compounds as erk inhibitors
WO2012018754A2 (en) 2010-08-02 2012-02-09 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF CATENIN (CADHERIN-ASSOCIATED PROTEIN), BETA 1 (CTNNB1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012024170A2 (en) 2010-08-17 2012-02-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012030685A2 (en) 2010-09-01 2012-03-08 Schering Corporation Indazole derivatives useful as erk inhibitors
WO2012058210A1 (en) 2010-10-29 2012-05-03 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACIDS (siNA)
WO2012087772A1 (en) 2010-12-21 2012-06-28 Schering Corporation Indazole derivatives useful as erk inhibitors
WO2013063214A1 (en) 2011-10-27 2013-05-02 Merck Sharp & Dohme Corp. Novel compounds that are erk inhibitors
WO2013165816A2 (en) 2012-05-02 2013-11-07 Merck Sharp & Dohme Corp. SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS
WO2014052563A2 (en) 2012-09-28 2014-04-03 Merck Sharp & Dohme Corp. Novel compounds that are erk inhibitors
WO2014085216A1 (en) 2012-11-28 2014-06-05 Merck Sharp & Dohme Corp. Compositions and methods for treating cancer
WO2014100065A1 (en) 2012-12-20 2014-06-26 Merck Sharp & Dohme Corp. Substituted imidazopyridines as hdm2 inhibitors
WO2014120748A1 (en) 2013-01-30 2014-08-07 Merck Sharp & Dohme Corp. 2,6,7,8 substituted purines as hdm2 inhibitors
WO2015034925A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Circular polynucleotides
US9408885B2 (en) 2011-12-01 2016-08-09 Vib Vzw Combinations of therapeutic agents for treating melanoma
WO2018058022A1 (en) 2016-09-26 2018-03-29 Merck Sharp & Dohme Corp. Anti-cd27 antibodies
WO2018071283A1 (en) 2016-10-12 2018-04-19 Merck Sharp & Dohme Corp. Kdm5 inhibitors
WO2018190719A2 (en) 2017-04-13 2018-10-18 Aduro Biotech Holdings, Europe B.V. Anti-sirp alpha antibodies
WO2019094311A1 (en) 2017-11-08 2019-05-16 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2019094312A1 (en) 2017-11-08 2019-05-16 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2019152642A1 (en) 2018-02-01 2019-08-08 Merck Sharp & Dohme Corp. Anti-pd-1/lag3 bispecific antibodies
US10550114B2 (en) * 2015-05-05 2020-02-04 Technische Universität Dortmund Kinase inhibitors and their use in cancer therapy
WO2020033288A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2020033284A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2020033282A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2021126731A1 (en) 2019-12-17 2021-06-24 Merck Sharp & Dohme Corp. Prmt5 inhibitors
EP4076459A1 (en) 2019-12-17 2022-10-26 Merck Sharp & Dohme LLC Prmt5 inhibitors
US12441730B2 (en) 2019-12-17 2025-10-14 Merck Sharp & Dohme Llc PRMT5 inhibitors
WO2026027944A1 (en) 2024-07-30 2026-02-05 Sairopa B.V. Anti-sirp alpha antibody formulations and uses thereof
US12552826B2 (en) 2018-08-07 2026-02-17 Merck Sharp & Dohme Llc PRMT5 inhibitors
US12583871B2 (en) 2019-12-17 2026-03-24 Merck Sharp & Dohme Llc PRMT5 inhibitors

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SI2076508T1 (en) * 2006-10-18 2011-04-29 Pfizer Prod Inc Biaryl ether urea compounds
US20100048524A1 (en) 2008-03-14 2010-02-25 Angela Brodie Novel C-17-Heteroaryl Steroidal CYP17 Inhibitors/Antiandrogens;Synthesis In Vitro Biological Activities, Pharmacokinetics and Antitumor Activity
CA2726358A1 (en) * 2008-06-03 2009-12-10 Merck Sharp & Dohme Corp. Inhibitors of akt activity
AU2009255358A1 (en) * 2008-06-03 2009-12-10 Msd K.K. Inhibitors of Akt activity
WO2010091306A1 (en) 2009-02-05 2010-08-12 Tokai Pharmaceuticals Novel prodrugs of steroidal cyp17 inhibitors/antiandrogens
EP2405756B1 (en) * 2009-03-12 2013-07-03 Merck Sharp & Dohme Corp. Inhibitors of akt activity
EP2513059A4 (en) * 2009-12-17 2013-06-05 Merck Sharp & Dohme INHIBITORS OF AKT ACTIVITY
AU2010339444A1 (en) * 2009-12-30 2012-07-19 Arqule, Inc. Substituted pyrrolo-aminopyrimidine compounds
CA2827214C (en) 2011-04-01 2017-07-18 Sri International Lipoxygenase inhibitors
EP2968370A4 (en) 2013-03-14 2016-09-21 Univ Maryland ANDROGEN RECEPTOR DECREASING AGENTS AND USES THEREOF
EP3033088A4 (en) 2013-08-12 2017-03-08 Tokai Pharmaceuticals, Inc. Biomarkers for treatment of neoplastic disorders using androgen-targeted therapies
CN114981298B (en) 2019-12-12 2024-08-20 听治疗有限责任公司 Compositions and methods for preventing and treating hearing loss

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2789118A (en) 1956-03-30 1957-04-16 American Cyanamid Co 16-alpha oxy-belta1, 4-pregnadienes
US2990401A (en) 1958-06-18 1961-06-27 American Cyanamid Co 11-substituted 16alpha, 17alpha-substituted methylenedioxy steroids
US3048581A (en) 1960-04-25 1962-08-07 Olin Mathieson Acetals and ketals of 16, 17-dihydroxy steroids
US3126375A (en) 1964-03-24 Chioacyl
US3749712A (en) 1970-09-25 1973-07-31 Sigma Tau Ind Farmaceuti Triamcinolone acetonide esters and process for their preparation
US3928326A (en) 1972-05-19 1975-12-23 Bofors Ab Process for the separation of stereoisomeric mixtures into their components and components obtained hereby
US3929768A (en) 1972-05-19 1975-12-30 Bofors Ab Steroids, processes for their manufacture and preparations containing same
US3996359A (en) 1972-05-19 1976-12-07 Ab Bofors Novel stereoisomeric component A of stereoisomeric mixtures of 2'-unsymmetrical 16,17-methylenedioxy steroid 21-acylates, compositions thereof, and method of treating therewith

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE400274T1 (en) * 2001-04-10 2008-07-15 Merck & Co Inc ACT ACTIVITY INHIBITORS
WO2003086279A2 (en) * 2002-04-08 2003-10-23 Merck & Co., Inc. Inhibitors of akt activity
US7273869B2 (en) * 2002-04-08 2007-09-25 Merck & Co., Inc. Inhibitors of Akt activity
WO2003086394A1 (en) * 2002-04-08 2003-10-23 Merck & Co., Inc. Inhibitors of akt activity
US20060142178A1 (en) * 2002-04-08 2006-06-29 Barnett Stanley F Method of treating cancer
WO2003086403A1 (en) * 2002-04-08 2003-10-23 Merck & Co., Inc. Inhibitors of akt activity
US7399764B2 (en) * 2002-10-30 2008-07-15 Merck & Co., Inc. Inhibitors of Akt activity
CN1809351A (en) * 2003-04-24 2006-07-26 麦克公司 Inhibitors of Akt activity
JP4679514B2 (en) 2003-04-24 2011-04-27 メルク・シャープ・エンド・ドーム・コーポレイション Inhibitor of Akt activity
WO2004096131A2 (en) * 2003-04-24 2004-11-11 Merck & Co., Inc. Inhibitors of akt activity
DE602004026047D1 (en) 2003-04-24 2010-04-29 Merck Sharp & Dohme HEMMER OF ACT ACTIVITY
EP1737843B1 (en) 2004-04-09 2011-02-23 Merck Sharp & Dohme Corp. Inhibitors of akt activity

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3126375A (en) 1964-03-24 Chioacyl
US2789118A (en) 1956-03-30 1957-04-16 American Cyanamid Co 16-alpha oxy-belta1, 4-pregnadienes
US2990401A (en) 1958-06-18 1961-06-27 American Cyanamid Co 11-substituted 16alpha, 17alpha-substituted methylenedioxy steroids
US3048581A (en) 1960-04-25 1962-08-07 Olin Mathieson Acetals and ketals of 16, 17-dihydroxy steroids
US3749712A (en) 1970-09-25 1973-07-31 Sigma Tau Ind Farmaceuti Triamcinolone acetonide esters and process for their preparation
US3928326A (en) 1972-05-19 1975-12-23 Bofors Ab Process for the separation of stereoisomeric mixtures into their components and components obtained hereby
US3929768A (en) 1972-05-19 1975-12-30 Bofors Ab Steroids, processes for their manufacture and preparations containing same
US3996359A (en) 1972-05-19 1976-12-07 Ab Bofors Novel stereoisomeric component A of stereoisomeric mixtures of 2'-unsymmetrical 16,17-methylenedioxy steroid 21-acylates, compositions thereof, and method of treating therewith

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
AA_MS ET AL., SCIENCE, vol. 281, 1998, pages 1322 - 1326
ALESSI ET AL., EMBO J., vol. 15, 1996, pages 6541 - 6551
DOWNWARD, CURR. OPIN. CELL BIOL., vol. 10, 1998, pages 262 - 267
DUDEK ET AL., SCIENCE, vol. 275, 1997, pages 661 - 665
FRANKE ET AL., CELL, vol. 81, 1995, pages 727 - 736
FRANKE ET AL., CELL, vol. 88, 1997, pages 435 - 437
HEMMINGS, SCIENCE, vol. 275, 1997, pages 628 - 630
HEMMINGS, SCIENCE, vol. 277, 1997, pages 534
KAUFFMANN-ZEH ET AL., NATURE, vol. 385, 1997, pages 544 - 548
KULIK ET AL., MOL. CELL. BIOL., vol. 17, 1997, pages 1595 - 1606
MANDAL M. ET AL: "The Akt inhibitors KP372-1 supresses Akt activity and cell proliferation and induces apoptosis in thyroid cancer cells.", BRITISH JOURNAL OF CANCER., vol. 92, no. 10, 23 May 2005 (2005-05-23), pages 1899 - 1905, XP002990090 *
MARTELLI A.M. ET AL: "A new selective AKT pharmacological inhibitor resuces resistance to chemotherapeutic drugs, TRAIL, all-trans-retinoic acid, and ionizing radiation of human leukemia cells.", LEUKEMIA., vol. 17, no. 9, September 2003 (2003-09-01), pages 1794 - 1805, XP002990091 *
See also references of EP1737861A4
THONIBERRY ET AL., SCIENCE, vol. 281, 1998, pages 1312 - 1316

Cited By (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7655649B2 (en) 2004-04-09 2010-02-02 Merck Sharp & Dohme Corp. Inhibitors of Akt activity
US8003643B2 (en) 2004-04-09 2011-08-23 Merck Sharp & Dohme Corp. Inhibitors of Akt activity
US7544677B2 (en) 2004-08-23 2009-06-09 Merck & Co., Inc. Inhibitors of Akt activity
US7910561B2 (en) 2004-12-15 2011-03-22 Merck Sharp & Dohme Corp. Inhibitors of Akt activity
WO2006091395A3 (en) * 2005-02-14 2007-02-22 Merck & Co Inc Inhibitors of akt activity
US7589068B2 (en) 2005-02-14 2009-09-15 Merck & Co., Inc. Inhibitors of Akt activity
US7705014B2 (en) 2005-04-12 2010-04-27 Merck Sharp & Dohme Corp. Inhibitors of AKT activity
WO2006123182A2 (en) 2005-05-17 2006-11-23 Merck Sharp & Dohme Limited Cyclohexyl sulphones for treatment of cancer
US8008317B2 (en) 2005-06-10 2011-08-30 Merck Sharp & Dohme Corp. Inhibitors of akt activtiy
WO2007087246A2 (en) 2006-01-24 2007-08-02 Merck & Co., Inc. Jak2 tyrosine kinase inhibition
US8288407B2 (en) 2006-12-06 2012-10-16 Merck Sharp & Dohme Corp. Substituted naphthyridine compounds as inhibitors of Akt activity
US7576209B2 (en) 2006-12-06 2009-08-18 Merck & Co., Inc. Inhibitors of Akt activity
EP2139332A4 (en) * 2007-03-28 2010-04-21 Merck Sharp & Dohme SUBSTITUTED PYRIDO [2,3-D] PYRIMIDINE DERIVATIVES AS CANNABINOID-1 RECEPTOR MODULATORS
US20100063032A1 (en) * 2007-03-28 2010-03-11 Debenham John S Substituted pyrido[2,3-d]pyrimidine derivatives as cannabinoid-1 receptor modulators
EP2154965A4 (en) * 2007-05-29 2011-08-17 Glaxosmithkline Llc Naphthyridine, derivatives as p13 kinase inhibitors
US20110288090A1 (en) * 2009-02-02 2011-11-24 Armstrong Donna J Inhibitors of AKT Activity
WO2010114780A1 (en) 2009-04-01 2010-10-07 Merck Sharp & Dohme Corp. Inhibitors of akt activity
WO2011046771A1 (en) 2009-10-14 2011-04-21 Schering Corporation SUBSTITUTED PIPERIDINES THAT INCREASE p53 ACTIVITY AND THE USES THEREOF
WO2011075628A1 (en) 2009-12-18 2011-06-23 Amgen Inc. Heterocyclic compounds and their uses
WO2011163330A1 (en) 2010-06-24 2011-12-29 Merck Sharp & Dohme Corp. Novel heterocyclic compounds as erk inhibitors
WO2012018754A2 (en) 2010-08-02 2012-02-09 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF CATENIN (CADHERIN-ASSOCIATED PROTEIN), BETA 1 (CTNNB1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP3330377A1 (en) 2010-08-02 2018-06-06 Sirna Therapeutics, Inc. Rna interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (ctnnb1) gene expression using short interfering nucleic acid (sina)
WO2012024170A2 (en) 2010-08-17 2012-02-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP4079856A1 (en) 2010-08-17 2022-10-26 Sirna Therapeutics, Inc. Rna interference mediated inhibition of hepatitis b virus (hbv) gene expression using short interfering nucleic acid (sina)
WO2012030685A2 (en) 2010-09-01 2012-03-08 Schering Corporation Indazole derivatives useful as erk inhibitors
EP3327125A1 (en) 2010-10-29 2018-05-30 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using short interfering nucleic acids (sina)
EP3766975A1 (en) 2010-10-29 2021-01-20 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
WO2012058210A1 (en) 2010-10-29 2012-05-03 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACIDS (siNA)
WO2012087772A1 (en) 2010-12-21 2012-06-28 Schering Corporation Indazole derivatives useful as erk inhibitors
WO2013063214A1 (en) 2011-10-27 2013-05-02 Merck Sharp & Dohme Corp. Novel compounds that are erk inhibitors
US9408885B2 (en) 2011-12-01 2016-08-09 Vib Vzw Combinations of therapeutic agents for treating melanoma
WO2013165816A2 (en) 2012-05-02 2013-11-07 Merck Sharp & Dohme Corp. SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS
EP3919620A1 (en) 2012-05-02 2021-12-08 Sirna Therapeutics, Inc. Short interfering nucleic acid (sina) compositions
WO2014052563A2 (en) 2012-09-28 2014-04-03 Merck Sharp & Dohme Corp. Novel compounds that are erk inhibitors
WO2014085216A1 (en) 2012-11-28 2014-06-05 Merck Sharp & Dohme Corp. Compositions and methods for treating cancer
WO2014100065A1 (en) 2012-12-20 2014-06-26 Merck Sharp & Dohme Corp. Substituted imidazopyridines as hdm2 inhibitors
WO2014120748A1 (en) 2013-01-30 2014-08-07 Merck Sharp & Dohme Corp. 2,6,7,8 substituted purines as hdm2 inhibitors
WO2015034925A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Circular polynucleotides
US10550114B2 (en) * 2015-05-05 2020-02-04 Technische Universität Dortmund Kinase inhibitors and their use in cancer therapy
WO2018058022A1 (en) 2016-09-26 2018-03-29 Merck Sharp & Dohme Corp. Anti-cd27 antibodies
WO2018071283A1 (en) 2016-10-12 2018-04-19 Merck Sharp & Dohme Corp. Kdm5 inhibitors
WO2018190719A2 (en) 2017-04-13 2018-10-18 Aduro Biotech Holdings, Europe B.V. Anti-sirp alpha antibodies
WO2019094311A1 (en) 2017-11-08 2019-05-16 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2019094312A1 (en) 2017-11-08 2019-05-16 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2019152642A1 (en) 2018-02-01 2019-08-08 Merck Sharp & Dohme Corp. Anti-pd-1/lag3 bispecific antibodies
WO2020033282A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
US12173026B2 (en) 2018-08-07 2024-12-24 Merck Sharp & Dohme Llc PRMT5 inhibitors
WO2020033284A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
US12552826B2 (en) 2018-08-07 2026-02-17 Merck Sharp & Dohme Llc PRMT5 inhibitors
WO2020033288A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
US11981701B2 (en) 2018-08-07 2024-05-14 Merck Sharp & Dohme Llc PRMT5 inhibitors
US11993602B2 (en) 2018-08-07 2024-05-28 Merck Sharp & Dohme Llc PRMT5 inhibitors
WO2021126731A1 (en) 2019-12-17 2021-06-24 Merck Sharp & Dohme Corp. Prmt5 inhibitors
US12441730B2 (en) 2019-12-17 2025-10-14 Merck Sharp & Dohme Llc PRMT5 inhibitors
EP4076459A1 (en) 2019-12-17 2022-10-26 Merck Sharp & Dohme LLC Prmt5 inhibitors
US12583871B2 (en) 2019-12-17 2026-03-24 Merck Sharp & Dohme Llc PRMT5 inhibitors
US12595262B2 (en) 2019-12-17 2026-04-07 Merck Sharp & Dohme Llc PRMT5 inhibitors
US12595248B2 (en) 2019-12-17 2026-04-07 Merck Sharp & Dohme Llc PRMT5 inhibitors
WO2026027944A1 (en) 2024-07-30 2026-02-05 Sairopa B.V. Anti-sirp alpha antibody formulations and uses thereof

Also Published As

Publication number Publication date
US7750151B2 (en) 2010-07-06
JP2007532551A (en) 2007-11-15
CA2561315A1 (en) 2005-10-27
AU2005233569A1 (en) 2005-10-27
EP1737861A4 (en) 2010-04-28
CN1942470A (en) 2007-04-04
EP1737861A1 (en) 2007-01-03
US20080280899A1 (en) 2008-11-13
AU2005233569B2 (en) 2010-08-19

Similar Documents

Publication Publication Date Title
US7750151B2 (en) Inhibitors of Akt activity
US7544677B2 (en) Inhibitors of Akt activity
US8003643B2 (en) Inhibitors of Akt activity
US7579355B2 (en) Inhibitors of Akt activity
US7414055B2 (en) Inhibitors of Akt activity
US7638530B2 (en) Inhibitors of Akt activity
US7589068B2 (en) Inhibitors of Akt activity
WO2004096129A2 (en) Inhibitors of akt activity
EP1827436A2 (en) Inhibitors of akt activity
WO2006110638A2 (en) Inhibitors of akt activity
US20080015212A1 (en) Inhibitors Of Akt Activity
US20120252806A1 (en) Inhibitors of akt activity

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2561315

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 11547113

Country of ref document: US

Ref document number: 2005732864

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2007507448

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 200580011984.2

Country of ref document: CN

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Ref document number: DE

WWE Wipo information: entry into national phase

Ref document number: 2005233569

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 6435/DELNP/2006

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2005233569

Country of ref document: AU

Date of ref document: 20050405

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2005233569

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2005732864

Country of ref document: EP