WO2005085196A2 - Inhibitors of dna methylation in tumor cells - Google Patents
Inhibitors of dna methylation in tumor cells Download PDFInfo
- Publication number
- WO2005085196A2 WO2005085196A2 PCT/EP2005/002437 EP2005002437W WO2005085196A2 WO 2005085196 A2 WO2005085196 A2 WO 2005085196A2 EP 2005002437 W EP2005002437 W EP 2005002437W WO 2005085196 A2 WO2005085196 A2 WO 2005085196A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- group
- alkyl
- substituted
- carcinoma
- carry
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
- C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
- C07D209/44—Iso-indoles; Hydrogenated iso-indoles
- C07D209/48—Iso-indoles; Hydrogenated iso-indoles with oxygen atoms in positions 1 and 3, e.g. phthalimide
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D233/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings
- C07D233/54—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members
- C07D233/66—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
- C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
- C07D471/04—Ortho-condensed systems
Definitions
- the present invention relates to compounds of the general formula (I), with the definitions of R 1 to R 2 given below in the text, and the use of these compounds and/or pharmaceutically acceptable salts thereof as a pharmaceutical.
- the compounds according to formula (I) lend themselves in particular as Miibitors of DNA methylation in cells, particularly tumor cells.
- DNA can be methylated through covalent methylation of cytosine residues at their carbon- 5 position. It has been found that DNA methylation is an important mechanism of gene regulation, particularly gene silencing. Gene regulation by DNA methylation is an "epigenetic" form of gene regulation, as the DNA sequence information itself remains unaltered.
- Aberrant DNA methylation patterns are closely associated with epigenetic mutations or epimutations, which can have the same consequences as genetic mutations. For example, many tumors show hypermethylation and concomitant silencing of tumor suppressor genes. Several developmental disorders are also associated with aberrant DNA methylation.
- DNA methylation reaction is catalyzed by DNA methyl transferases (DNMTs).
- DNMTs DNA methyl transferases
- Establishment and maintenance of DNA methylation patterns require the activity of several DNMTs.
- DNA methylation is established during early embryogenesis by the de novo DNA methyl transferases (DNMT3A and DNMT3B).
- DNMT1 de novo DNA methyl transferases
- DNMT1 is therefore also responsible for maintenance of epimutations.
- cytosine such as 5-azacytidine, 5-aza 2'deoxycytidine (decitabine), and 5,6-dihydro-5- azacytidine (US 4,058,602; DE 198 23 484 Al).
- 5-azacytidine 5-aza 2'deoxycytidine (decitabine)
- 5-aza 2'deoxycytidine decitabine
- 5,6-dihydro-5- azacytidine US 4,058,602; DE 198 23 484 Al.
- inhibitors of DNA methylation particularly inhibitors of DNMTs.
- such inhibitors should have a different mode of action than structural analogues of cytidine, and they should be more specific and less toxic than other inhibitors of DNA methylation.
- the object of the present invention is to provide compounds and pharmaceuticals showing said abilities.
- Ar denotes a substituted or unsubstituted mononuclear aryl group having 6 or 7 members, which aryl group is annulated to the neighbouring 5-membered cycle, and which may carry 1, 2 or 3 heteroatoms from the group N, O and S in its cycle;
- Y, Z denote independently from each other a nitrogen atom, an oxygen atom, a sulfur atom or a methylene group
- X is a nitrogen atom, an oxygen atom, a sulfur atom, or a methylene group
- R 3 , R 4 are independently selected from the group consisting of: H; substituted and unsubstituted methyl and ethyl which, if substituted, can carry one or more substituents from the group OH, halogens, pseudohalogens,;
- R 5 independently has the same meaning as R 3 ;
- R 6 and R 7 independently have the same meaning as R 3 , R 4 ;
- R 8 is H or C Cs-al yl which can be unsubstituted or carry one or more substituents firom the group consisting of OH, C(O)H, C(O)CH 3 , C(O)C 2 H 5 , halogens, pseudohalogens, TH 2 , mono(C 1 -C -alkyl)amino, di(C ⁇ -C 3 -alkyl)axnino;
- R 9 is H or CrC -alkyl which can be unsubstituted or carry one or more substituents firom the group consisting of OH, C(O)H, C(O)C ⁇ 3 , C(O)C 2 H 5 , halogens, pseudohalogens, TH 2 , mono(C ⁇ -C 3 -alkyl)amino, di(CrC 3 -alkyl)arnino;
- R , R independently have the same meaning as R , R
- R 12 , R 13 independently are H or unsubstituted and at least monosubstituted C ⁇ -C 12 -alkyl which can carry in its chain one or more non-adjacent heteroatoms from the group nitrogen and oxygen, and which, if substituted, carry one or more substituents from the group consisting of: OH, C(O)H, C(O)CH 3 , C(O)C 2 H 5 , halogens, pseudohalogens, NTH 2 , mono(C ⁇ -C 3 -alkyl)amino, di(C ⁇ -C 3 -alkyl)amino, and unsubstituted and at • least monosubstituted aryl and heteroaryl, which, if substituted, carry at least one substituent from the group consisting of C ⁇ -C 3 -alkyl, C ⁇ -C -alkoxy, halogens, pseudohalogens, and CF 3 ;
- R 14 has the same meaning as R 12
- R , R independently have the same meaning as R , R ;
- R 17 has the same meaning as R 12 ;
- R 18 has the same meaning as R 12
- R , R independently have the same meaning as R , R ;
- R 21 has the same me-tning as R 12 ;
- R 22 has the same meaning as R 12 ;
- aryl is 5 to 10-membered, mono- or bicyclic aromatic cycle
- heteroaryl is a 5 to 10-membered, mono- or bicyclic aromatic heterocycle containing one or more heteroatoms from the group consisting of N, O and S;
- n 1, 2 or 3.
- Alkyl residues can be linear or branched, acyclic or cyclic. This also applies when they are part of other groups, for example in alkoxy groups, alkoxycarbonyl groups or amino groups, or when they are substituted.
- alkyl groups are methyl, ethyl, propyl, butyl, pentyl, hexyl, the n-isomers of these residues, isopropyl, isobutyl, isopentyl, sec-butyl, tert-butyl, neopentyl, 3,3- dimethylbutyl.
- alkyl here also expressly includes cycloalkyl residues and cycloalkyl-alkyl-residues (alkyl substituted by cycloalkyl) containing at least three carbon atoms.
- cycloalkyl residues examples are cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl. All cycloalkyl groups can be substituted by one or more identical or different (C ⁇ -C 4 )-alkyl residues, in particular by methyl.
- alkyl here also includes unsubstituted alkyl residues as well as alkyl residues which are substituted by one or more, for example one, two, three or four, identical or different residues, for example aryl groups.
- substituted alkyl residues for example arylalkyl, hydroxyalkyl such as -(C ⁇ -C 3 )-alkyl-OH or alkoxyalkyl such as -(C 1 -C 3 )-alkyl-O-(C ⁇ -C 4 )- alkyl, the substituents can be present in any desired position.
- methylene group denotes a -CH - unit or a unit derived therefrom by replacing one or both H atom for a substituent.
- aryl as used in the context of the present invention comprises mononuclear, binuclear or trinuclear aryl groups having no heteroatoms in its cycle. If not stated otherwise, the aryl groups can carry one or more substituents for example alkyl groups, alkoxy groups, halogens or OH groups. Examples for aryl groups include phenyl, 1- naphthyl, 2-naphthyl, indanyl, toluyl.
- heteroaryl residues which are formed by two groups bonded to a nitrogen are preferably derived from heterocycles which contain one, two, three or four heteroatoms which can be identical or different; more preferably they are derived from heterocycles which contain one, two, or three, in particular one or two, heteroatoms which can be identical or different.
- the heterocycles can be mononuclear or polynuclear, for example mononuclear, binuclear or trinuclear. Preferably they are mononuclear or binuclear.
- the rings preferably are 5-membered rings, 6-membered rings or 7-membered rings. Examples of mononuclear and.
- suitable heterocycles also include, for example, the saturated heterocycles pyrrolidine, piperidine, piperazine, morpholine and thiomorpholine.
- the degree of saturation of heterocyclic groups is indicated in their individual definitions.
- Unsaturated heterocycles can contain, for example, one, two or three double bonds within the ring system. 5-membered rings and 6- membered rings can in particular also be aromatic.
- Halogen is fluorine, chlorine, bromine or iodine, preferably fluorine or chlorine.
- pseudohalogens examples are CN and N 3 , a preferred pseudohalogen is CN.
- Preferred compounds of the formula (I) are those compounds in which one or more of the residues contained therein have the meanings given in the following, with all combinations of preferred substituent definitions being a subject of "the present invention. With respect to all preferred compounds of the formula (I) the present invention also includes all stereoisomeric forms and mixtures thereof in all ratios, and their pharmaceutically acceptable salts.
- Ar denotes an unsubstituted mononuclear aryl group having 6 or 7 members, which aryl group is annulated to the neighbouring 5-membered cycle, and which may carry 1, 2 or 3 heteroatoms from the group N, O and S in its cycle;
- Y, Z denote independently from each other a nitrogen atom or a. methylene group
- X is a nitrogen atom or a methylene group
- R 5 is selected from H; substituted and unsubstituted methyl and ethyl which, if substituted, can carry one or more substituents from the group OH, halogens, pseudohalogens,;
- R 8 is H or CrC 3 -alkyl which can be unsubstituted or carry one or more substituents from the group consisting of OH, C(O)H, C(O)CH 3 , C(O)C 2 H 5 , halo .gens, pseudohalogens; NH 2 , mono(C ⁇ -C 3 -alky ⁇ )amino, di(C ⁇ -C 3 -alkyl)amino;
- R 9 is H or C ⁇ -C 3 -alkyl which can be unsubstituted or carry one or more substituents from the group consisting of OH, C(O)H, C(O)CH 3 , C(O)C 2 H 5 , halo .gens, pseudohalogens; NH 2 , mono(C ⁇ -C 3 -alkyl)amino, di(C ⁇ -C 3 -alkyl)amino; R 12 , R 13 independently are H or unsubstituted and at least monosubstituted C ⁇ -C ⁇ 2 -alkyl which can carry in its chain one or more non-adjacent heteroatoms from the group nitrogen and oxygen, and which, if substituted, carry one or more substituents from the group consisting of: OH, C(O)H, C(O)CH 3 , C(O)C 2 H 5 , halogens, pseudohalogens, NH 2 , mono(C ⁇ -C 3 -alkyl
- R 14 has the same meaning as R 12
- R , R independently have the same meaning as R , R ;
- R 17 has the same meaning as R 12 ;
- R 18 has the same meaning as R 12
- R , R independently have the same meaning as R , R ;
- R 21 has the same meaning as R 12 ;
- R 22 has the same meaning as R 12 ;
- aryl is phenyl, naphth-1 -yl or naphth-2-yl.
- heteroaryl is preferably selected from the group consisting of 5- and 6- membered monocyclic and 9- or 10-membered bicyclic heterocycles containing one or more heteroatoms from the group consisting of N, O, and S; heteroaryl is in particular selected from the group consisting of indolyl, furyl, pyrrolyl, thienyl, thiazolyl, oxazolyl, pyrazolyl, imidazolyl, pyrazinyl, pyridyl and pyrimidinyL;
- n 1, 2 or 3.
- the carbon atom in ⁇ -position to X carries at least 1 H-atom.
- Ar denotes an unsubstituted mononuclear aryl group having 6 or 7 members, which aryl group is annulated to the neighbouring 5-membered cycle, and which may carry 1 or 2 heteroatoms from the group N, O.and S in its cycle;
- Y, Z denote independently from each other a nitrogen atom or a methylene group
- X is a nitrogen atom or a methylene group
- A is an at least monosubstituted CrC 3 -alkyl having a H-atom in position ⁇ to X, which alkyl can carry in its chain one or more non-adjacent heteroatoms from the group nitrogen and oxygen, wherein the at least one substituent is selected from the group consisting of: C(O)R 17 , C(O)OR 18 , and substituted and non-substituted aryl and substituted and non- substituted heteroaryl which aryl and heteroaryl, if substituted, carry at least one substituent from the group consisting of C ⁇ -C 3 -alkyl, -Cs-alko y- halogens, pseudohalogens, and CF 3 ;
- R , 17 . is selected from H and unsubstituted C ⁇ -C 3 -alkyl
- R 18 has the same meaning as R 17
- aryl is phenyl, naphth-1-yl or naphth-2-yl.
- heteroaryl is selected from the group consisting of indolyl, furyl, pyrrolyl-, thienyl, thiazolyl, oxazolyl, pyrazolyl, imidazolyl, pyrazinyl, pyridyl and pyrimidinyl.
- Ar denotes an unsubstituted mononuclear aryl group having 6 or 7 members, which aryl group is annulated to the neighbouring 5-membered cycle, and which may carry 1 or 2 nitrogen atoms in its cycle;
- Y, Z denote independently from each other a nitrogen atom or a methylene group, preferably Y, Z are both methylene;
- X is a nitrogen atom or a methylene group, preferably X is a nitrogen atom;
- A is an at least bisubstituted C ⁇ -C 3 -alkyl having a H-atom in position ⁇ to X, wherein the at least two substituents are selected from the group consisting of: C(O)OR 18 , and substituted and non-substituted aryl and substituted and non-substituted heteroaryl which aryl and heteroaryl, if substituted, carry at least one substituent from the group consisting of C 1 -C3- alkyl, C ⁇ -C 3 -alkoxy, halogens, pseudohalogens, and CF 3 ;
- R 18 is selected from H and unsubstituted C ⁇ -C 3 -alkyl
- aryl is phenyl, naphth-1-yl or naphth-2-yl.
- heteroaryl is selected from the group consisting of indolyl, furyl, pyrrolyl, thienyl, thiazolyl, oxazolyl, pyrazolyl, imidazolyl, pyrazinyl, pyridyl and pyrimidinyl.
- Ar denotes an unsubstituted mononuclear aryl group having 6 or 7 members, which aryl group is annulated to the neighbouring 5-membered cycle, and which may carry 1 nitrogen atom in its cycle;
- Y, Z are both methylene;
- X is a nitrogen atom
- A is a bisubstituted C ⁇ -C 3 -alkyl having a H-atom in position ⁇ to X, wherein one substituent is selected from the group consisting of C(O)OR ls , and the other substituent is selected from substituted and non-substituted aryl and substituted and non-substituted heteroaryl which aryl and heteroaryl, if substituted, carry at least one substituent from the group consisting of C ⁇ -C 3 -alkyl, C ⁇ -C 3 -alkoxy, halogens, pseudohalogens, and CF 3 ;
- R 18 is selected from H and unsubstituted C ⁇ -C 3 -alkyl
- aryl is phenyl, naphth-1-yl or naphth-2-yl.
- heteroaryl is indolyl.
- Ar denotes an unsubstituted mononuclear aryl group having 6 or 7 members-, which aryl group is annulated to the neighbouring 5-membered cycle, and which may carry 1 or 2 nitrogen atoms in its cycle;
- Y, Z denote independently from each other a nitrogen atom or a methylene group, preferably Y, Z are both methylene;
- X is a nitrogen atom or a methylene group, preferably X is a nitrogen, atom;
- A is an at least monosubstituted Cr -alkyl having a H-atom in position ⁇ to X, wherein the at least one substituent is selected from the group consisting of: C(O)OR 18 , C(S)OR 22 ;
- R 18 is selected from H and unsubstituted C ⁇ -C 3 -alkyl; R ,22 is selected from H and unsubstituted C ⁇ -C 3 -alkyl.
- Ar denotes an unsubstituted mononuclear aryl group having 6 or 7 members, which aryl group is annulated to the neighbouring 5-membered cycle, and which may carry 1 nitrogen atom in its cycle;
- Y, Z are both methylene
- X is a nitrogen atom
- A is a monosubstituted C ⁇ -C 3 -alkyl having a H-atom in position ⁇ to X, wherein the substituent is C(O)OR 18 ;
- R 18 is selected from H and unsubstituted C ⁇ -C 3 -alkyl.
- Preferred compounds of the formula (I) for use as a pharmaceutical are those compounds in which one or more of the residues contained therein have the meanings given above as being preferred, with all combinations of preferred substituent definitions being a subject of the present invention.
- the present invention also includes all stereoisomeric forms and mixtures thereof in all ratios, and their pharmaceutically acceptable salts.
- the object of the present invention is furthermore attained by the use of a compound of formula (I)
- Preferred compounds of the formula (I) which can be used for the manufacture of the said pharmaceuticals are those compounds in which one or more of the residues contained therein have the meanings given above as being preferred, with all combinations of preferred substituent definitions being a subject of the present invention.
- the present invention also includes all stereoisomeric forms and mixtures thereof in all ratios, and their pharmaceutically acceptable salts.
- the present invention includes all stereoisomeric forms of the compounds of the formula (I). Centers of asymmetry that are present in the compounds of formula (I) all independently of one another have S configuration or R configuration.
- the invention includes all possible enantiomers and diastereomers and mixtures of two or more stereoisomers, for example mixtures of enantiomers and/or diastereomers, in all ratios.
- compounds according to the present invention which can exist as enantiomers can be present in enantiomerically pure form, both as levorotatory and as dextrorotatory antipodes, in the form of racemates and in the form of mixtures of the two enantiomers in all ratios.
- the invention includes both the cis form and the trans form as well as mixtures of these forms in all ratios. All these forms are an object of the present invention.
- the preparation of individual stereoisomers can be carried out, if desired, by separation of a mixture by customary methods, for example by chromatography or crystallization, by the use of stereochemically uniform starting materials for the synthesis or by stereoselective synthesis.
- a derivatization can be carried out before a separation of stereoisomers.
- the separation of a mixture of stereoisomers can be carried out at the stage of the compounds of the formula (I) or at the stage of an intermediate during the synthesis.
- the present invention also includes all tautomeric forms of the compounds of formula (I).
- the invention also comprises their corresponding pharmaceutically or toxicologically acceptable salts, in particular their pharmaceutically utilizable salts.
- the compounds of the formula (I) which contain acidic groups can be present on these groups and can be used according to the invention, for example, as alkali metal salts, alkaline earth metal salts or as ammonium salts. More precise examples of such salts include sodium salts, potassium salts, calcium salts, magnesium salts or salts with ammonia or orgamc amines such as, for example, ethylamine, ethanolamine, triethanolamine or amino acids.
- Compounds of the formula (I) which contain one or more basic groups i.e.
- acids which can be protonated, can be present and can be used according to the invention in the form of their addition salts with inorganic or organic acids.
- suitable acids include hydrogen chloride, hydrogen bromide, phosphoric acid, sulfuric acid, nitric acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acids, oxalic acid, acetic acid, tartaric acid, lactic acid, salicylic acid, benzoic acid, formic acid, propionic acid, pivalic acid, diethylacetic acid, malonic acid, succinic acid, pimelic acid, fumaric acid, maleic acid, malic acid, sulfaminic acid, phenylpropionic acid, gluconic acid, ascorbic acid, isonicotinic acid, citric acid, adipic acid, and other acids known to the person skilled in the art.
- the invention also includes, in addition to the salt forms mentioned, inner salts or betaines (zwitterions).
- the respective salts according to the formula (I) can be obtained by customary methods which are known to the person skilled in the art like, for example by contacting these with an organic or inorganic acid or base in a solvent or dispersant, or by anion exchange or cation exchange with other salts.
- the present invention also includes all salts of the compounds of the formula (I) which, owing to low physiological compatibility, are not directly suitable for use in pharmaceuticals but which can be used, for example, as intermediates for chemical reactions or for the preparation of pharmaceutically acceptable salts.
- the present invention furthermore includes all solvates of compounds of the formula (I), for example hydrates or adducts with alcohols, active metabolites of the compounds of the formula (II), and also derivatives and prodrugs of the compounds of the formula (I) which contain physiologically tolerable and cleavable groups, for example esters, amides and compounds in which the N-H group depicted in formula (I) is replaced with an N-alkyl group, such as N-methyl, or with an N-acyl group, such as N-acetyl or N-argininyl, including pharmaceutically acceptable salts formed on functional groups present in the N- acyl group.
- physiologically tolerable and cleavable groups for example esters, amides and compounds in which the N-H group depicted in formula (I) is replaced with an N-alkyl group, such as N-methyl, or with an N-acyl group, such as N-acetyl or N-argininyl, including pharmaceutically acceptable salt
- the compounds of the formula (I) can be purified by customary purification procedures, for example by recrystallization or chromatography.
- the starting compounds for the preparation of the compounds of the formula (I) are commercially available or can be prepared according to or analogously to literature procedures.
- the compounds obtained with the above-mentioned synthesis methods are a further object of the present invention.
- the compounds according to the general formula (I) can be used to inhibit DNA methylation in cells.
- said compounds inhibit DNMTs, more particularly DNMT1 , even more particularly human DNMT1.
- treatment includes the therapy as well as the prophylaxis of the respective diseases.
- Aberrant DNA methylation preferably relates to any kind of hypermethylation, be it genome- wide or limited to distinct genomic or chromosomal regions or genes.
- DNA methylation can be measured by any of the methods known in the art (e.g. Okamoto, A., et al. (2002). Site-specific discrimination of cytosine and 5-methylcytosine in duplex DNA by peptide nucleic acids. J Am. Chem. Soc. 124, 10262-10263), methylation sensitive arbitrarily primed PCR (Gonzalgo, M.L., Liang, G., et al. (1997). Identification and characterization of differentially methylated regions of genomic DNA by methylation- sensitive arbitrarily primed PCR. Cancer Res.
- diseases which can be treated with the compounds according to the present invention include developmental disorders and proliferative diseases.
- Examples for developmental disorders which can be treated with the compounds according to the present invention include Prader-Willi-Syndrome, Angelman-Syndrome (Happy Puppet Syndrome), and Beckwith-Wiedemann-Syndrome.
- proliferative diseases which can be treated with the compounds according to the present invention include coronary restenosis and neoplastic diseases.
- Said neoplastic diseases include neuroblastoma, intestine carcinoma such as rectum carcinoma, colon carcinoma, familiary adenomatous polyposis carcinoma and hereditary non-polyposis colorectal cancer, esophageal carcinoma, labial carcinoma, larynx carcinoma, hypopharynx carcinoma, tong carcinoma, salivary gland carcinoma, gastric carcinoma, adenocarcinoma, medullary thyroidea carcinoma, papillary thyroidea carcinoma, renal carcinoma, kidney parenchym carcinoma, ovarian carcinoma, cervix carcinoma, uterine corpus carcinoma, endometrium carcinoma, chorion carcinoma, pancreatic carcinoma, prostate carcinoma, testis carcinoma, breast carcinoma, urinary carcinoma, melanoma, brain tumors such as glioblastoma, astrocytoma, meningioma, medulloblastoma and peripheral neuroectodermal tumors, Hodgkin lymphoma, non- Hodgkin lymphoma, Burkitt
- Preferred indications are colon carcinoma, familiary adenomatous polyposis carcinoma and hereditary non-polyposis colorectal cancer, prostate carcinoma, melanoma, non-Hodgkin lymphoma, acute lymphatic leukemia (ALL), chronic lymphatic leukemia (CLL), acute -myeolid leukemia (AML), chronic myeloid leukemia (CML), or hepatocellular carcinoma.
- ALL acute lymphatic leukemia
- CLL chronic lymphatic leukemia
- AML acute -myeolid leukemia
- CML chronic myeloid leukemia
- compoimds according to the formula (I) can also be used in combination with other pharmaceutically active compounds, preferably compounds which are able to enhance the effect of the compounds according to the general formula (I).
- examples of such compounds include: (i) antimetabolites, cytarabine, fludarabine, 5-fluoro-2'-deoxyuridine, gemcitabine, hydroxyurea or methofrexate; (ii) DNA-fragmenting agents, bleomycin, (iii) DNA-crosslinking agents, chlorambucil, cisplatin, fotemustine, cyclophosphamide or nitrogen mustard; (iv) intercalating agents, adriamycin (doxorubicin) or mitoxantrone; (v) protein synthesis inhibitors, L-asparaginase, cycloheximide, puromycin or diphteria toxin; (vi) topoisomerase I poisons, camptothecin or topotecan; (vii)
- the compounds of the formula (I) and their pharmaceutically acceptable salts can be administered to animals, preferably to mammals, and in particular to humans, as pharmaceuticals by themselves, in mixtures with one another or in the form of pharmaceutical preparations. Further subjects of the present invention therefore also are the compounds of the formula (I) and their pharmaceutically acceptable salts for use as pharmaceuticals, their use as inhibitors of DNMTs and/or DNA methylation, and in particular their use in the therapy and prophylaxis of the above-mentioned syndromes as well as their use for preparing pharmaceuticals for these purposes.
- subjects of the present invention are pharmaceutical preparations (or pharmaceutical compositions) which comprise an effective dose of at least one compound of the formula (I) and/or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier, i.e. one or more pharmaceutically acceptable carrier substances and/or additives.
- a pharmaceutically acceptable carrier i.e. one or more pharmaceutically acceptable carrier substances and/or additives.
- the pharmaceuticals according to the invention can be administered orally, for example in the form of pills, tablets, lacquered tablets, sugar-coated tablets, granules, hard and soft gelatin capsules, aqueous, alcoholic or oily solutions, syrups, emulsions or suspensions, or rectally, for example in the form of suppositories.
- Administration can also be carried out parenterally, for example subcutaneously, intramuscularly or intravenously in the form of solutions for injection or infusion.
- suitable administration forms are, for example, percutaneous or topical administration, for example in the form of ointments, tinctures, sprays or transdermal therapeutic systems, or the inhalative administration in the form of nasal sprays or aerosol mixtures, or, for example, microcapsules, implants or rods.
- the preferred administration form depends, for example, on the disease to be treated and on its severity.
- the amount of compounds of the formula (I) and/or its pharmaceutically acceptable salts in the pharmaceutical preparations normally ranges from 0.2 to 800 mg, preferably from
- the pharmaceutical preparations usually comprise 0.5 to 90 percent by weight of the compounds of the formula (I) and/or their pharmaceutically acceptable salts.
- the preparation of the pharmaceutical preparations can be carried out in a manner known per se. To this end, one or more compounds of the formula (I) and/or their pharmaceutically acceptable salts, together with one or more solid or liquid pharmaceutical carrier substances and/or additives (or auxiliary substances) and, if desired, in combination with other pharmaceutically active compounds having therapeutic or prophylactic action, are brought into a suitable administration form or dosage form which can then be used as a pharmaceutical in human or veterinary medicine.
- Carriers for soft gelatin capsules and suppositories are, for example, fats, waxes, semisolid and liquid polyols, natural or hardened oils, etc.
- Suitable carriers for the preparation of solutions, for example of solutions for injection, or of emulsions or syrups are, for example, water, physiologically sodium chloride solution, alcohols such as ethanol, glycerol, polyols, sucrose, invert sugar, glucose, mannitol, vegetable oils, etc.
- Suitable carriers for microcapsules, implants or rods are, for example, copolymers of glycolic acid and lactic acid.
- the pharmaceutical. preparations can also contain additives, for example fillers, disintegrantSj - binders, lubricants, wetting agents, stabilizers, emulsifiers, dispersants, preservatives, sweeteners, colorants, flavorings, aromatizers, thickeners, diluents, buffer substances, solvents, solubilizers, agents for achieving a depot effect, salts for altering the osmotic pressure, coating agents or antioxidants.
- additives for example fillers, disintegrantSj - binders, lubricants, wetting agents, stabilizers, emulsifiers, dispersants, preservatives, sweeteners, colorants, flavorings, aromatizers, thickeners, diluents, buffer substances, solvents, solubilizers, agents for achieving a depot effect, salts for altering the osmotic pressure, coating agents or antioxidants.
- the dosage of the compound of the formula (I) to be administered and/or of a pharmaceutically acceptable salt thereof depends on the individual case and is, as is customary, to be adapted to the individual circumstances to achieve an optimum effect. Thus, it depends on the nature and the severity of the disorder to be treated, and also on the sex, age, weight and individual responsiveness of the human or animal to be treated, on the efficacy and duration of action of the compounds used, on whether the therapy is acute or chronic or prophylactic, or on whether other active compounds are administered in addition to compounds of the formula (I).
- a daily dose of approximately 0.01 to 100 mg/kg, preferably 0.1 to 10 gkg, in particular 0.3 to 5 mg/kg (in each case mg per kg of bodyweight) is appropriate for administration to an adult weighing approximately 75 kg in order to obtain the desired results.
- the daily dose can be administered in a single dose or, in particular when larger amounts are administered, be divided into several, for example two, three or four individual doses. In some cases, depending on the individual response, it may be necessary to deviate upwards or downwards from the given daily dose.
- the compounds of the formula (I) may also be used to induce cellular differentiation in vivo and in vitro.
- Cellular differentiation relates to any differentiation of a cell from a less differentiated (specialized) state to a more differentiated (specialized) state.
- Cell types which can be treated include, but are not limited to, embryonic and adult stdm cells, totipotent, omnipotent, pluripotent, multipotent, oligopotent, or monopotent stem cells, progenitor cells,- committed progenitor cells, as well as stem cells derived from bone marrow, peripheral blood, umbilical cord blood, adipose tissue, heart muscle, intestine, small intestine, or brain.
- MPCs multipotent adult progenitor cells
- mesenchymal stem cells mesenchymal stem cells
- hematopoetic stem cells intestinal stem cells
- hepatic stem cells oval cells
- neuronal stem cells epidermal stem cells
- myoblasts myoblasts
- cardiomyoblasts osteoblasts
- chondroblasts basal cells of epithelia, e.g. the respiratory epithelium.
- the compounds according to formula (I) are capable of binding to DNMTs, particularly human DNMT1, and inhibiting their catalytic activity.
- GenBank accession numbers of selected DNMTs of human, mouse, Drosphila melanogaster, Haemophilus haemolyticus and Haemophilus aegyptius are given below: human DNMT1 protein (GenBank Ace. No. NP_001370) human DNMT2 protein (GenBank Ace. No. AAC39764) human DNMT3A protein (GenBank Ace. No. AAD33084) human DNMT3B protein (GenBank Ace. No. AAD53063) mouse DNMT1 protein (GenBank Ace. No. NP_034196) D. melanogaster dDNMT2 protein (GenBank Ace. No. AAF03835) H.
- the present invention explicitly includes the use of the compounds according to formula (I) for inhibition of DNA methylation or inhibition of DNMTs in cells of prokaryotes, eukaryotes, invertebrates, vertebrates, particularly mammals, more particularly rodents and primates, even more particularly humans.
- DNMTs in different species are highly conserved, i.e. structurally similar, particularly with respect to their C-terminal catalytic domains (see SEQ ID No. 1-8). Therefore, the compounds according to formula (I) are capable of binding and inhibiting different DNMTs in different species.
- One advantage of the compounds according to the present invention is that they are able to substantially demethylate and reactivate Vietnamese genes (e.g. tumor suppressor genes), but not centromeric satellite sequences. This is an advantage for treatment of cells or patients, as demethylation of satellite sequences has been shown to promote tumorigenesis by destabilizing chromosome organization. This will have a positive effect on maintenance of genome stability in cells or patients treated with the compounds according to the present invention.
- euchror- ⁇ atic genes e.g. tumor suppressor genes
- RG108 was used at 0, 10, 200, and 500 ⁇ M concentrations, Sssl methylase was present at 5 ⁇ M concentration, (c) Trapping assay. HCTl 16 cells were incubated with equal concentrations of RG108, 5-azacytidine, or no inhibitor. Protein extracts were then probed for the presence of DNMT1, DNMT3B and Actin by Western blotting. This revealed the covalent trapping of DNA methyltransferase proteins by 5- azacytidine. This effect was not observed with RG108.
- DNA methylation levels were determined after 5 and 15 days, as indicated. DNA from NALM-6 cells incubated with 5-azacytidine for 15 days could not be analyzed due to degradation. All results were obtained from multiple experiments. Standard deviations for panels (a) and (b) were negligible. Fig. 4
- the carboxyl-group of RG108 is important for its interaction with DNA methyltransferases.
- (b) Calculated binding energies of ⁇ C-RG108 (grey bar) docked into the DNMT1 active site are compared to cytidine (white bar) and RG108 (black bar),
- (c) Genomic cytosine methylation levels of HCTl 16 cells incubated with ⁇ C-RG108 (black bar) are compared to methylation levels of corresponding cells incubated with no inhibitor (white bar) or RG108 (grey bar).
- RG108 causes complete demethylation of the human hMLHl gene in cells treated with 10 micromolar RG108, while no demethylation was observed in control experiments without inhibitor or with 10 micromolar 5-azacytidine (Sigma), respectively (Fig. 5).
- M indicates amplification products from methylated templates
- U indicates amplification from unmethylated control templates.
- Methylation-specific PCR was used to analyze the methylation status of pl6 m ⁇ 4a , SFRP1 and TIMP-3 in DNA from cells incubated with 10 ⁇ M RG108.
- RT-PCT RTP
- ⁇ - Amyloid ⁇ Am
- HCTl 16 cells were incubated with variable concentrations of RG108 (RG) or 5-azacytidine (aza), as indicated.
- the methylation status was analyzed by methylation-sensitive Southern analysis.
- the size of marker fragments (in kbp) is indicated on the sides of the panels, respectively. pop.doub. after 5d, number of the cell population doublings after 5 days; ctrl., control; ⁇ - sat, ⁇ -satellite; sat. 2, satellite 2. Fi . 7
- Bisulfite sequencing analysis of the TIMP-3 CpG island reveals significant demethylation of CpG dinucleotides in RG108-treated cells (P ⁇ 0.05, as determined by a t-test). Filled circles represent methylated CpG dinucleotides, open circles represent unmethylated CpG dinucleotides.
- RG108 was synthesized in two steps with an overall yield of 90%.
- the intermediate product, a phthalic acid derivative with a protected and an activated ester group, methyl 2-((succinimidooxy)carbonyl)benzoate (MSB) was obtained according to Casimir, J.R., Guichard, G. & Briand, J.P. Methyl 2-((succinimidooxy)carbonyl)benzoate (MSB): a new, efficient reagent for N-phthaloylation of amino acid and peptide derivatives. J. Org. Chem.
- RG108 was obtained by the reaction of MSB with L-tryptophan under basic conditions (Na 2 CO 3 ) in water/acetonitrile, acidification with 2N HCl, extraction in ethyl acetate and evaporation of the solvent with an excellent yield of 100%.
- the pure yellow powder was analysed by mass spectrometry (ESI) and 1H- and 13 C-NMR to confirm the structure of RG108.
- tryptamine dissolved in acetonitrile
- RG108 was analyzed in an in vitro DNA methylation assay.
- the purified recombinant CpG methylase M.SssI was used. This enzyme is distinguished by a robust activity and also shows significant structural similarities with the DNMT1 catalytic domain.
- a 798 bp PCR fragment from the promoter region of the human pl6/CDKN2A gene was used as a substrate and DNA methylation was visualized by digestion with the methylation-sensitive restriction enzyme R-.tUI.
- R-.tUI methylation-sensitive restriction enzyme
- Inhibitors like 5-azacytidine and zebularine have been shown to covalently trap DNA methyltransferases, which can can be visualized by concomitant depletion of the enzymes from cell extracts (Liu, K., Wang, Y.F., Cantemir, C. & Muller, M.T. (2003). Endogenous assays of DNA methyltransferases: Evidence for differential activities of DNMTl, DNMT2, and DNMT3 in mammalian cells In vivo. Mol. Cell. Biol. 23, 2709-2719 and Cheng, J.C. et al. (2004). Continuous zebularine treatment effectively sustains demethylation in human bladder cancer cells. Mol Cell Biol 24, 1270-1278.
- HCTl 16 was chosen, a colon carcinoma line that has been frequently used for DNA methylation analysis (Brattain, M.G., Fine, W.D., Khaled, F.M., Thompson, J. & Brattain, D.E. Heterogeneity of malignant cells from a human colonic carcinoma. Cancer Res 41, 1751-1756 (1981)), and NALM-6, a leukemic B cell precursor line (Hurwitz, R. et al. Characterization of a leukemic cell line of the pre-B phenotype. Int. J. Cancer 23, 174-180 (1979)).
- tissue culture media was supplemented with 10 ⁇ M RG108 and the cells were incubated over 15 days. Unsupplemented media and media supplemented with 10 ⁇ MC 5- azacytidine were used for controls. At this concentration, RG108 had no effect on the growth and viability of either cell line (Fig. 3 a, b). In contrast, 5-azacytidine showed an intermediate effect on HCTl 16 cells and appeared to be highly toxic for NALM-6 cells (Fig. 3a, b). To analyze the effect of RG108 on DNA methylation, genomic DNA was isolated from cells and the cytosine methylation level was determined by capillary electrophoresis.
- ⁇ C-RG108 was synthesized, which is a derivative that lacks the central carboxyl-group (Fig. 4a). Docking of this compound into the DNMTl active site revealed a strongly reduced binding energy (Fig. 4b). When tested in the in vitro assay, ⁇ C-RG108 failed to inhibit DNA methylation. Similarly, ⁇ C-RG108 failed to demethylate genomic DNA of HCTl 16 and NALM-6 cells (Fig. 4c). The results confirm an important role for the carboxyl-group of RG108 in the interaction with the active site of the enzyme and suggest a considerable specificity in the interaction between RG108 and the DNA methyltransferase active site.
- the substrate DNA for the in vitro methylation assay was generated by PCR amplification of a 798 bp fragment from the promoter region of the huma pl6/CDKN2 gene.
- the methylation reaction contained 350-400 ng substrate DNA (13-15 nM DNA, corresponding to 1.6-1.8 ⁇ M CpGs) in reaction buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl 2 , ImM dithiothreitol, pH 7.9), 80 ⁇ M S-adenosylmethionine, and 4 U of M.SssI methylase (0.5 ⁇ M, New England Biolabs) in a Snal volume of 50 ⁇ l.
- Inhibitors were added in concentrations of 10, 100, 200, and 5O0 ⁇ M, respectively. Reactions were performed at 37 °C for 2 hours. After completion, tfcie reaction was inactivated at 65 °C for 15 min and the DNA was purified using the QIAquick PCR Purification Kit (Qiagen). 250 ng of purified DNA was digested for 3 h at 60 °Cwith 30 units of BstUI (New England Biolabs) and analyzed on 2 % agarose gels.
- Trapping assay Frozen cell pellets (10 -10 cells) ere thawed on ice and resuspended in 1 ml ice-cold lx PBS. After centrifugation ( ⁇ lOOOg) at 4 °C for 5 minutes, the supernatant was removed and discarded. The pellet was resuspended with 100-200 ⁇ l ice-cold lysis buffer (150 mM NaCl, 5 mM EDTA, 50 mM Tris ⁇ Cl (pH 8.0), 2 mM PMSF, and 1 % Igepal) and incubated on ice for 40 minutes. The lysate was centrifuged at 4 °C for 15 minutes with 14,000 rpm.
- Supernatants were frozen in liquid nitrogen and stored at -80 °C. Equal amounts of protein were then separated on SDS polyacrylamide gel and analyzed by Western blotting using standard procedures.
- the primary antibodies used were: anti- DNMT1 (New England Biolabs), 1:2000; anti-DNMT3b (Abgent), 1 :250; anti-actin (Abeam), 1 :5000. Primary antibodies were visulaized by ECL chemiluminescence (Perkin- Elmer) according to the manufacturer's protocol.
- NALM-6 and HCTl 16 cells were cultured under standard conditions in RPMI 1640 and McCoy's 5a medium, respectively.
- cells were continuously cultivated in media supplemented with 10 ⁇ M 5- azacytidine, RG108 or ⁇ C-RG108, as indicated. Cells were diluted 1:10 in fresh media every 3 or 4 days. For the determination of cellular growth and viability, cells were stained with trypan blue and counted using a standard counting grid.
- RG108 causes demethylation in HCTl 16 cells.
- methylation-specific PCR Herman, J.G., Graff, J.R., Myohanen, S., Nelkin, B.D., Baylin, S.B. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA. 1996, 93:9821-9826) to determine the effect of RG108 on the methylation of the human hMLHl gene in HCTl 16 cells. This revealed a complete demethylation of hMLHl in cells treated with 10 micromolar RG108, while no demethylation was observed in control experiments without inhibitor or with 10 micromolar 5-azacytidine (Sigma), respectively (Fig. 5).
- RG108 reduces the proliferation of HCTl 16 cells (Fig. 6a), which can be partially attributed to the reactivation of the pl6 Ink4a tumor suppressor gene (Fig. 6b).
- RG108 substantially demethylates and reactivates Vietnamese genes (e.g. tumor suppressor genes, Fig. 6c), but not the cenfromeric satellite sequences (Fig. 6d). This might be important for the maintenance of genome stability in cells/patients treated with RG108, because demethylation of satellite sequences has been shown to promote tumorigenesis by destabilizing chromosome organization (Ehrlich, M. DNA methylation in cancer: too much, but also too little. Oncogene 21, 5400-5413. (2002)).
- methylation status of satellite sequences was analyzed by methylation-sensitive Southern blots, as described previously (Rhee, I. et al. DNMTl and DNMT3b cooperate to silence genes in human cancer cells. Nature, vol. 416, pp. 552-556 (2002)).
- Methylation-specific PCR analysis was performed as described previously (Myohanen, S.K., Baylin, S.B. & Herman, J.G. Hypermethylation can selectively silence individual pl6ink4A alleles in neoplasia. Cancer Res, vol. 58, pp. 591-593 (1998). Suzuki, H. et al. Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal cancer. Nat Genet, vol. 36, pp. 417-422 (2004). Bachman, K.E. et al. Methylation- associated silencing of the tissue inhibitor of metalloproteinase-3 gene suggest a suppressor role in kidney, brain, and other human cancers. Cancer Res, vol. 59, pp. 798- 802X1999)).
- Bisulfite sequencing was performed under standard conditions (Frommer, M., et al., 1992. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. USA, 89 : 1827-1831) with genomic DNA from HCTl 16 cells treated with 30 ⁇ M RG108 or no inhibitor for 5 days.
- the primers used and the PCR conditions were as follows: forward TTTGTTTTTTTAGTTTTTGTTTTTTTT, reverse AATCCCCCAAACTCCAACTAC, 95 °C 3 min., 38 cylces (95 °C 30 s, 58 °C 30 s, 72 °C 30 s), 72 °C 5 min.
- PCR products were purified using the QIAquick Gel Extraction Kit (Qiagen), sub cloned into the pCR 4-Topo plasmid vector (Invifrogen) and subjected to automated sequencing. The results are shown in Fig. 7.
- the analysis revealed significant demethylation of the CpG dinucleotides of the TIMP-3 CpG island in RG108 treated cells (P ⁇ 0.05, as determined by a t-test).
Landscapes
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP05715834A EP1725531A2 (en) | 2004-03-08 | 2005-03-08 | Inhibitors of dna methylation in tumor cells |
| CA002557581A CA2557581A1 (en) | 2004-03-08 | 2005-03-08 | Inhibitors of dna methylation in tumor cells |
| US10/591,867 US20080138329A1 (en) | 2004-03-08 | 2005-03-08 | Inhibitors of Dna Methylation in Tumor Cells |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP04005498.3 | 2004-03-08 | ||
| EP04005498A EP1574499A1 (en) | 2004-03-08 | 2004-03-08 | Inhibitors of DNA methylation in tumor cells |
| EP04014619.3 | 2004-06-22 | ||
| EP04014619 | 2004-06-22 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2005085196A2 true WO2005085196A2 (en) | 2005-09-15 |
| WO2005085196A3 WO2005085196A3 (en) | 2005-12-08 |
Family
ID=34921305
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2005/002437 Ceased WO2005085196A2 (en) | 2004-03-08 | 2005-03-08 | Inhibitors of dna methylation in tumor cells |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20080138329A1 (en) |
| EP (2) | EP1574499A1 (en) |
| CA (1) | CA2557581A1 (en) |
| WO (1) | WO2005085196A2 (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007007054A1 (en) * | 2005-07-08 | 2007-01-18 | Cancer Research Technology Limited | Phthalamides, succinimides and related compounds and their use as pharmaceuticals |
| WO2009032194A1 (en) | 2007-08-31 | 2009-03-12 | Whitehead Institute For Biomedical Research | Wnt pathway stimulation in reprogramming somatic cells |
| WO2008054767A3 (en) * | 2006-10-30 | 2009-05-07 | Univ Southern California | N4 modifications of pyrimidine analogs and uses thereof |
| WO2011018435A1 (en) | 2009-08-10 | 2011-02-17 | Institut Curie | Method for predicting the sensitivity of a tumor to an epigenetic treatment |
| EP2626416A2 (en) | 2007-04-07 | 2013-08-14 | The Whitehead Institute for Biomedical Research | Reprogramming of somatic cells |
| CN107847485A (en) * | 2015-01-13 | 2018-03-27 | 财团法人卫生研究院 | 5-methoxytryptophan and derivatives and application thereof |
| CN109207590A (en) * | 2018-09-12 | 2019-01-15 | 黄映辉 | The island TIMP3 gene promoter region CPG methylation detecting method based on pyrosequencing techniques |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0610804D0 (en) * | 2006-05-31 | 2006-07-12 | Portela & Ca Sa | New crystal forms |
| US20110053997A1 (en) * | 2007-12-05 | 2011-03-03 | Alexander Beliaev | Salts and Crystal Forms |
| US9714427B2 (en) | 2010-11-11 | 2017-07-25 | The University Of North Carolina At Chapel Hill | Methods and compositions for unsilencing imprinted genes |
| TW201522337A (en) | 2013-03-12 | 2015-06-16 | Arqule Inc | Substituted tricyclic pyrazolo-pyrimidine compounds |
| CN116621843B (en) * | 2022-06-13 | 2024-05-24 | 四川大学华西医院 | A DNA methyltransferase 1 inhibitor and its preparation method and use |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4058602A (en) * | 1976-08-09 | 1977-11-15 | The United States Of America As Represented By The Department Of Health, Education And Welfare | Synthesis, structure, and antitumor activity of 5,6-dihydro-5-azacytidine |
| US5238950A (en) * | 1991-12-17 | 1993-08-24 | Schering Corporation | Inhibitors of platelet-derived growth factor |
| US5578716A (en) * | 1993-12-01 | 1996-11-26 | Mcgill University | DNA methyltransferase antisense oligonucleotides |
| JPH08217747A (en) * | 1995-02-10 | 1996-08-27 | Yasuo Kikukawa | Production of 3-substituted indole compound |
| MXPA02011079A (en) * | 2000-05-11 | 2004-08-19 | Consejo Superior Investigacion | Heterocyclic inhibitors of glycogen synthase kinase gsk 3. |
| GB0028367D0 (en) * | 2000-11-21 | 2001-01-03 | Celltech Chiroscience Ltd | Chemical compounds |
| US7893071B2 (en) * | 2001-04-23 | 2011-02-22 | University Of Virginia Patent Foundation | Synthesis and evaluation of novel phthalimide mimics as anti-angiogenic |
-
2004
- 2004-03-08 EP EP04005498A patent/EP1574499A1/en not_active Withdrawn
-
2005
- 2005-03-08 EP EP05715834A patent/EP1725531A2/en not_active Withdrawn
- 2005-03-08 US US10/591,867 patent/US20080138329A1/en not_active Abandoned
- 2005-03-08 WO PCT/EP2005/002437 patent/WO2005085196A2/en not_active Ceased
- 2005-03-08 CA CA002557581A patent/CA2557581A1/en not_active Abandoned
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007007054A1 (en) * | 2005-07-08 | 2007-01-18 | Cancer Research Technology Limited | Phthalamides, succinimides and related compounds and their use as pharmaceuticals |
| WO2008054767A3 (en) * | 2006-10-30 | 2009-05-07 | Univ Southern California | N4 modifications of pyrimidine analogs and uses thereof |
| EP2626416A2 (en) | 2007-04-07 | 2013-08-14 | The Whitehead Institute for Biomedical Research | Reprogramming of somatic cells |
| EP3878949A1 (en) | 2007-04-07 | 2021-09-15 | Whitehead Institute for Biomedical Research | Reprogramming of somatic cells |
| WO2009032194A1 (en) | 2007-08-31 | 2009-03-12 | Whitehead Institute For Biomedical Research | Wnt pathway stimulation in reprogramming somatic cells |
| EP3078738A1 (en) | 2007-08-31 | 2016-10-12 | Whitehead Institute for Biomedical Research | Wnt pathway stimulation in reprogramming somatic cells |
| WO2011018435A1 (en) | 2009-08-10 | 2011-02-17 | Institut Curie | Method for predicting the sensitivity of a tumor to an epigenetic treatment |
| CN107847485A (en) * | 2015-01-13 | 2018-03-27 | 财团法人卫生研究院 | 5-methoxytryptophan and derivatives and application thereof |
| CN107847485B (en) * | 2015-01-13 | 2023-11-10 | 台湾卫生研究院 | 5-methoxy tryptamine acid and its derivative and use |
| CN109207590A (en) * | 2018-09-12 | 2019-01-15 | 黄映辉 | The island TIMP3 gene promoter region CPG methylation detecting method based on pyrosequencing techniques |
Also Published As
| Publication number | Publication date |
|---|---|
| US20080138329A1 (en) | 2008-06-12 |
| WO2005085196A3 (en) | 2005-12-08 |
| EP1725531A2 (en) | 2006-11-29 |
| EP1574499A1 (en) | 2005-09-14 |
| CA2557581A1 (en) | 2005-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111606969B (en) | PARP1 protein degradation agent and application thereof in tumor resistance | |
| US20080138329A1 (en) | Inhibitors of Dna Methylation in Tumor Cells | |
| WO2021236475A1 (en) | Compounds that inhibit asparagine synthetase and their methods of use | |
| KR20120028893A (en) | Thiophene derivatives | |
| EP2604610A1 (en) | Phthalazinone ketone derivative, preparation method thereof, and pharmaceutical use thereof | |
| HUP0301514A2 (en) | Benzimidazole derivatives, process for their preparation and pharmaceutical compositions containing the same | |
| EP1622893A1 (en) | New alicyclic-amine-substituted 4-carboxamido-benzimidazoles as parp-inhibitors and antioxidants | |
| Radulović et al. | Synthesis, spectral characterization, cytotoxicity and enzyme-inhibiting activity of new ferrocene–indole hybrids | |
| ES2335092T3 (en) | PIPERAZINONA COMPOUNDS AS ANTITUMOR AND ANTICANCER AGENTS. | |
| EP1232147A1 (en) | Triazoles as farnesyl transferase inhibitors | |
| WO2017039318A1 (en) | Benzimidazole derivatives for dna methylation inhibitors | |
| MX2009000492A (en) | 2-arylindole derivatives as npges-i inhibitors. | |
| CN115490671A (en) | PARP7 inhibitors and process for preparing the same | |
| Wang et al. | Discovery of a new class of valosine containing protein (VCP/P97) inhibitors for the treatment of non-small cell lung cancer | |
| MXPA06013953A (en) | Aromatic biaryl products, compositions containing same and use as medicines. | |
| Yu et al. | Structure optimization and preliminary bioactivity evaluation of N-hydroxybenzamide-based HDAC inhibitors with Y-shaped cap | |
| EP3355888B1 (en) | Hemi-synthetic trilobine analogs for use as a drug | |
| JP2005516031A (en) | Dibenzodiazepine derivatives, their production and use | |
| CN113735830B (en) | Hydroxamic acid derivative and application thereof | |
| EP3426638B1 (en) | Inhibitors of indoleamine 2,3-dioxygenase | |
| AU2005221959B2 (en) | Novel indole derivative for alkylating specific base sequence of DNA and alkylating agent and drug each comprising the same | |
| CN116444501B (en) | Quinazoline derivative, preparation method thereof, pharmaceutical composition and application | |
| Guo et al. | Synthesis of reversible PAD4 inhibitors via copper-catalyzed C− H arylation of benzimidazole | |
| Zhou et al. | Discovery of a tetrahydroisoquinoline-based HDAC inhibitor with improved plasma stability | |
| CN110759891A (en) | SET8 lysine methyltransferase inhibitor and intermediate, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2557581 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005715834 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005715834 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10591867 Country of ref document: US |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2005715834 Country of ref document: EP |












