WO2005080601A2 - Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling - Google Patents

Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling Download PDF

Info

Publication number
WO2005080601A2
WO2005080601A2 PCT/NL2005/000134 NL2005000134W WO2005080601A2 WO 2005080601 A2 WO2005080601 A2 WO 2005080601A2 NL 2005000134 W NL2005000134 W NL 2005000134W WO 2005080601 A2 WO2005080601 A2 WO 2005080601A2
Authority
WO
WIPO (PCT)
Prior art keywords
aml
cluster
genes
subject
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/NL2005/000134
Other languages
French (fr)
Other versions
WO2005080601A3 (en
Inventor
Michael John Moorhouse
Petrus Jacobus Maria Valk
Hendrik Rudolf Delwel
Bob Lowenberg
Petrus Johannes Van Der Spek
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Erasmus Universiteit Rotterdam
Original Assignee
Erasmus Universiteit Rotterdam
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Erasmus Universiteit Rotterdam filed Critical Erasmus Universiteit Rotterdam
Priority to JP2007500702A priority Critical patent/JP4980878B2/en
Priority to US10/590,385 priority patent/US8142994B2/en
Priority to AU2005214286A priority patent/AU2005214286A1/en
Priority to CA002558366A priority patent/CA2558366A1/en
Priority to EP05710909.2A priority patent/EP1723257B1/en
Publication of WO2005080601A2 publication Critical patent/WO2005080601A2/en
Anticipated expiration legal-status Critical
Publication of WO2005080601A3 publication Critical patent/WO2005080601A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B25/00ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
    • G16B25/10Gene or protein expression profiling; Expression-ratio estimation or normalisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B25/00ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression

Definitions

  • the present invention is in the field of medicine.
  • the invention relates in particular to methods of genetic analysis for the classification, diagnosis and prognosis of acute myeloid leukemia.
  • the invention relates to nucleic acid expression profiles as obtained from cells of AML patients, which profiles by similarity group into a plurality of distinct and defined clusters that characterize different classes of AML.
  • the invention relates to the use of such expression profiles and compositions in diagnosis and therapy of AML and specifically in the prediction of prognostically important AML classes.
  • the invention further relates to methods for the diagnosis of AML and for the determination ofthe prognosis of a subject affected by AML and to kits of parts comprising sets of nucleic acid probes suitable for performing methods ofthe invention either by means of genomics or proteomics.
  • Acute myeloid leukemia is a collection of neoplasms with heterogeneous pathophysiology, genetics and prognosis. Based on cytogenetics and molecular analysis, AML patients are presently classified into groups or subsets of AML with markedly contrasting prognosis.
  • the genetic translocations inv(16), t(8;21) and t(15;17) characterize AML with a relatively favourable prognosis
  • the cytogenetically bad-risk leukemia's include patients with abnormalities involving Hq23, loss of 5(q) or 7(q), t(6;9) and t(9;22) (L ⁇ wenberg et al, 1999).
  • the most common molecular abnormality in AML is the internal tandem duplication (ITD) in the fms-like tyrosine kinase-3 gene (FLT3), a hematopoietic growth factor receptor (Levis & Small, 2003).
  • FLT3 ITD mutations confer a bad prognosis to AML patients (Levis & Small, 2003).
  • AML patients with mutations in the transcription factor cEBP ⁇ have been associated with good outcome (Preud Subscribe et al., 2002; van Waalwijk van Doorn-Khosrovani et al, 2003), while elevated expression of the transcription factor EVTl predicts for notoriously poor survival (van Waalwijk van Doorn- Khosrovani et al, 2003).
  • These examples of novel molecular prognostic markers underscore the importance of an extension of molecular analyses in AML.
  • Approximately thirty percent of all patients with acute myeloid leukemia (AML) are currently classified based on specific abnormal karyotypes in groups with either good or bad prognosis.
  • One of the aims ofthe present invention is to provide more accurate risk assessment tools for the diagnosis of AML. It is another aim to classify AML patients in which specific abnormal karyotypes have not been found and to distinguish these groups not only from the molecularly well-defined AML classes, but also to define prognostic subgroups within these unclassified AML types. The presence of additional prognostic classes in AML, not recognizable with currently available methods, may provide important insights into their pathophysiology. Therefore, it is an aim of the present invention to provide a more complete way of prognostication to patients with AML.
  • the present invention is based on the discovery that unique correlations within gene expression profiles and also with cytogenetic aberrations can be recognized with high accuracy within a representative cohort of AML patients. It has for instance been found that gene expression profiles obtained from a large number of AML patients can be clustered according to similarity. This enables the recognition of distinct classes of AML with similar expression profiles characterising such a class. It was thus found that AML could be classified into distinct subclasses, each subclass being characterised by a specific clustering of gene expression profiles.
  • the present invention now provides in a first aspect a method for producing a classification scheme for AML comprising the steps of: a) providing a plurality of reference samples, said reference samples comprising cell samples from a plurality of reference subjects affected by AML; b) providing reference profiles by establishing a gene expression profile for each of said reference samples individually; c) clustering said individual reference profiles according to similarity, and d) assigning an AML class to each cluster.
  • the clustering of reference profiles is performed based on the information of genes that are differentially-expressed between profiles, and in an even more preferred embodiment of such a method, the clustering of said reference profiles is performed on the basis ofthe information of the genes of table 1, still more preferably of the genes of table 2, which tables are provided hereinbelow.
  • the present invention provides a method for classifying the AML of an AML affected subject, comprising the steps of: a) providing a classification scheme for AML by producing such a scheme according to the method of any one of claims 1-3; b) providing a subject profile by establishing a gene expression profile for said subject; c) clustering the subject profile together with the reference profiles; d) determining in said scheme the clustered position of said subject profile among the reference profiles, and e) assigning to said AML of said subject the AML class that corresponds to said clustered position in case said subject profile is within any cluster of reference profiles, or assigning to said AML of said subject a new AML class.
  • the present invention provides a method for diagnosing AML in an AML affected subject comprising: a) producing a classification scheme for AML according to a method of the invention; b) defining cluster-specific genes for each cluster by selecting those genes of which the expression level characterizes the clustered position of the corresponding AML class among the various AML classes within said scheme; c) determining the level of expression of a sufficient number of said cluster- specific genes in an AML affected subject; d) establishing whether the level of expression of said cluster-specific genes in said subject shares sufficient similarity to the level of expression that characterizes an individual AML class to thereby determine the presence of AML corresponding to said class in said subject.
  • said cluster-specific genes may comprise all genes comprised in said gene expression profile.
  • said cluster- specific genes comprise a set of 1 to 3000 genes of the genes of table 1, more preferably 1 to 600 genes ofthe genes of table 1, still more preferably 1 to 50 genes of the genes of table 1.
  • said cluster-specific genes comprise a set of 1 to 600 genes ofthe genes of table 2, still more preferably 1 to 50 genes of the genes of table 2, and even more preferably 1 to 25 genes ofthe genes of table 2.
  • Most preferred in such a method is the use of the differentially-expressed genes as shown in Table 3 for the diagnosis of a specific AML class in a subject.
  • the present invention provides a method of determining the prognosis for an AML affected subject, said method comprising the steps of: a) providing a classification scheme for AML by producing such a scheme according to a method of the invention; b) determining the prognosis for each AML class in said scheme based on clinical records for the AML subjects comprised in said class; c) establishing the AML class of an AML affected subject by diagnosing and/or classifying AML in said subject according to a method of the invention, and d) assigning to said subject the prognosis corresponding to the established AML class of said AML affected subject.
  • the present invention further provides a classification scheme for
  • said scheme comprising a plurality of distinct AML classes that are differentiated on the basis of similarity clustering of gene expression profiles obtained from a plurality of reference subjects affected by AML.
  • Said classification scheme is for instance obtainable by a method of the invention for producing such a scheme.
  • said classification scheme is obtained by a method involving K-means clustering of gene expression profiles based on, for instance, gene chip array-acquired values for hybridization intensities for each gene, such as for instance those obtainable by using an Affymetrix gene chip.
  • Analysis of gene expression profiles obtained by using such gene chips preferably involves log 2 transformation of all intensity values in order to detect subtle modulations between the various genes. For each gene the geometric mean (i.e.
  • the mean expression value determined for all individual genes in all profiles to be analysed is calculated. Deviation from this geometric mean is termed differential expression. Genes that are expressed at values allowing assignment of being differentially-expressed are used for hierarchical clustering. Subsequently the gene signatures (characteristic expression profiles) of all samples/patients are compared with each other by means of a Pearson correlation coefficient analysis showing the (pathway) resemblance within clinical distinct groups of the total patient population.
  • the present invention further provides genes that are modulated (up- and down- regulated) in AML compared to the geometric mean calculated from all patients. Such genes and the proteins they encode are useful for diagnostic and prognostic purposes, and may also be used as targets for screening therapeutic compounds that modulate AML, such as antibodies.
  • the methods of detecting nucleic acids of the invention or their encoded proteins can be used for a number of purposes. Examples include early detection of AML, monitoring and early detection of relapse following treatment of AML, monitoring response to therapy of AML, determining prognosis of AML, directing therapy of AML, selecting patients for postoperative chemotherapy or radiation therapy, selecting therapy, determining tumor prognosis, treatment, or response to treatment, and early detection of precancerous condition. Other aspects of the invention will become apparent to the skilled artisan by the following description of the invention.
  • the present invention provides a method of detecting an AML- associated transcript in one or more cells from a patient, the method comprising contacting a biological sample from the patient with a polynucleotide, such as an oligonucleotide, that selectively hybridizes to a sequence at least 80% identical to a sequence of a gene as shown in Tables 1 or 2.
  • a polynucleotide such as an oligonucleotide
  • the polynucleotide selectively hybridizes to a sequence at least 95% identical to a sequence of a gene as shown in Tables 1 or 2.
  • the polynucleotide comprises a sequence of a gene as shown in Tables 1 or 2.
  • the biological sample used in such methods of detection is a tissue sample.
  • the biological sample comprises isolated nucleic acids, e.g., mRNA.
  • the polynucleotide is labeled, e.g., with a fluorescent label.
  • the polynucleotide is immobilized on a solid surface.
  • FIG. 1 shows, in panel (A), a Correlation View of 286 AML patients.
  • the Correlation Visualization tool displays pair -wise correlations between the samples.
  • the patient samples in the visualization are colored by Pearson's correlation coefficient values with deeper colors indicating higher positive (red) or negative (blue) correlations, indicating similarity in the underlying pathway indicative for the subgroups reflecting the heterogeneity within the patient population.
  • the scale bar indicates 100% correlation (red) towards 100% anti correlation (blue).
  • a matrix ordering method is applied to rearrange the samples. The ordering algorithm starts with the most correlated sample pair and, through an iterative process, sorts all the samples into correlated blocks.
  • Panel (B) of Figure 1 shows an adapted Correlation View of 286 AML patients (right panel) and top40 genes defining the 16 individual clusters of patients (left panel). All 16 clusters identified on th.e basis of the Correlation View are indicated (1 to 16). FAB classification and karyotype based on cytogenetics are depicted in the columns along the original diagonal of the
  • FIG. 3 provides a guideline on how to read the Omniviz Correlation View.
  • the figure shows the Correlation View and FAB classification (right-hand edge of figure) of the cohort of 286 AML patients (2856 probe sets). A total of 16 distinct cluster can be identified on the right edge of the figure.
  • X-axis and Y-axis show the regions of the various clusters 1- 16 from top to bottom and from left to right, respectively.
  • An exemplary correlation between cluster #5 and #16 is indicated by rectangle. Both clusters predominantly consist of AML-M5 (not visible) and correlate. However, they do form separate clusters. Anti-correlation for instance between cluster 5 and cluster #13, which merely contains AML-M2, is indicated by the dashed rectangle. Correlation and anti-correlation between every individual (sub)cluster can be extracted from the Correlation View and (sub)clusters can subsequently be assigned, e.g., cluster #6, #7 and #8 (dotted lines).
  • FAB M0- bright green, Ml-green, M2-pink, M3-orange, M4-purple, M5-turquoise, M6- yellow (with number).
  • Figures 4-10 provide supporting results of the Pearson's correlation coefficient analyses using Omniviz with different probe subsets. In the Correlation View all 286 patients are plotted against all 286 AML patients.
  • FAB classification and karyotype based on cytogenetics are depicted in the columns along the original diagonal (left-hand edge) ofthe Correlation View (FAB MO-red, Ml-green, M2-purple, M3-orange, M4-yellow, M5-blue, MI6-grey; karyotype: normal-green, inv(16)-yellow, t(8;21)-purple, t(15;17)-orange, llq23 abnormahtiesblue, 7(q) abnormalities -red, +8-pink, complex -black, other-grey).
  • FAB MO-red Ml-green, M2-purple, M3-orange, M4-yellow, M5-blue, MI6-grey
  • karyotype normal-green, inv(16)-yellow, t(8;21)-purple, t(15;17)-orange, llq23 abn
  • M3 t(15;17) patients FAB M2-purple, M3-orange, M4-yellow.
  • Karyotype normal-green, t(15;17)-orange, other-grey.
  • the AML-M3 t(15;17) patients are divided into two groups, i.e., low white blood cell count (WBC) and FLT3 ITD negative (green bar) versus high WBC/ FLT3 ITD positive (red bar).
  • WBC white blood cell count
  • FLT3 ITD negative green bar
  • red bar high WBC/ FLT3 ITD positive
  • Karyotype is based on cytogenetics and WBC is depicted as 10 (cells/1).
  • Figure 14 shows the Expression of ETO as determined by Affymetrix GeneChip analyses in 286 cases of AML and controls.
  • classifying is used in its art-recognized meaning and thus refers to arranging or ordering items, i.e. gene expression profiles, by classes or categories or dividing them into logically hierarchical classes, subclasses, and sub -subclasses based on the characteristics they have in common and/or that distinguish them. In particular "classifying” refers to assigning, to a class or kind, an unclassified item.
  • a “class” then being a grouping of items, based on one or more characteristics, attributes, properties, qualities, effects, parameters, etc., which they have in common, for the purpose of classifying them according to an established system or scheme.
  • classification scheme is used in its art-recognized meaning and thus refers to a list of classes arranged according to a set of pre- established principles, for the purpose of organizing items in a collection or into groups based on their similarities and differences.
  • clustering refers to the activity of collecting, assembling and/or uniting into a cluster or clusters items with the same or similar elements, a “cluster” referring to a group or number of the same or similar items, i.e.
  • Clustering indicates an item has been subjected to clustering.
  • the term “clustered position” refers to the location of an individual item, i.e. a gene expression profile, in amongst a number of clusters, said location being determined by clustering said item with at least a number of items from known clusters.
  • the process of clustering used in a method of to the present invention may be any mathematical process known to compare items for similarity in characteristics, attributes, properties, qualities, effects, parameters, etc.. Statistical analysis, such as for instance multivariance analysis, or other methods of analysis may be used.
  • Preferably methods of analysis such as self-organising maps, hierarchical clustering, multidimensional scaling, principle component analysis, supervised learning, k-nearest neighbours, support vector machines, discriminant analyse, partial least square methods and/or Pearson's correlation coefficient analysis are used.
  • Pearson's correlation coefficient analysis significance analysis of microarrays (SAM) and/or prediction analysis of microarrays (PAM) are used to cluster gene expression profiles according to similarity.
  • a highly preferred method of clustering comprises similarity clustering of gene expression profiles wherein the expression level of differentially -expressed genes, having markedly lower or higher expression than the geometric mean expression level determined for all genes in all profiles to be clustered, is log(2) transformed, and wherein the transformed expression levels of all differentially-expressed genes in all profiles to be clustered is clustered by using K-means.
  • a numerical query may then be used to select a subset of genes used in the process of hierarchical clustering (Eisen et al., 1998), thus, numerical queries may be run to select differentially expressed genes relative to the calculated geometric mean to select a smaller group of genes for hierarchical clustering.
  • Unsupervised sample clustering using genes obtained by numerical or threshold filtering is used to identify discrete clusters of samples as well as the gene-signatures associated with these clusters.
  • gene signatures is used herein to refer to the set of genes that define the discrete position of the cluster apart from all other clusters, and includes cluster-specific genes.
  • a numerical or threshold filtering is used to select genes for the analysis that are most likely of diagnostic relevance.
  • Hierarchical clustering allows for visualization of large variation in gene expression across samples or present in most samples, and these genes could be used for unsupervised clustering so that clustering results are not affected by the noise from absent or non- changed genes.
  • K-means clustering may be performed on all genes, the Pearson correlation is preferably calculated based on a subset of genes and patients.
  • Different cut-off or threshold values were used to prepare lists with different numbers of genes. The higher the number of genes selected and included on such fists, the more noise is generally encountered within the dataset, because there will be a relatively large contribution of non- leukemia pathway related genes in such lists.
  • the filtering and selection procedure is preferably optimized such that the analysis is performed on as much genes as possible, while minimizing the noise. All genes with changed expression values higher than or equal to 1.5 times the log(2) transformed expression values and genes with changed expression values lower than or equal to -1.5 times the log(2) transformed expression values are selected for hierarchical clustering.
  • the subset of genes showing a markedly higher or lower expression than the geometric mean may for instance be a value that is more than 1.5 times the geometric mean value, preferably more than 2 times the geometric mean value, even more preferably more than 3 times the geometric mean value.
  • a markedly lower expression than the geometric mean expression level may for instance be a value that is less than 0.8 times the geometric mean value, preferably less than 0.6 times the geometric mean value, more preferably less than 0.3 times the geometric mean value.
  • the present invention now provides several methods to accurately identify known as well as newly discovered diagnostically, prognostically and therapeutically relevant subgroups of acute myeloid leukemia (AML), herein below also addressed as AML classes, as well as methods that can predict which approaches in treatment are likely to be effective.
  • AML acute myeloid leukemia
  • the basis of these methods resides in the measurement of (AML-specific) gene expression in AML-affected subjects.
  • the methods and compositions of the invention thus provide tools useful in choosing a therapy for AML patients, including methods for assigning an AML patient to an AML class or AML cluster, methods of choosing a therapy for an AML patient, methods of determining the efficacy of a therapy in an AML patient, and methods of determining the prognosis for an AML patient.
  • the methods of the invention comprise in various aspects the steps of establishing a gene expression profile of subject samples, for instance of reference subjects affected by AML or of a subject diagnosed or classified for AML.
  • the expression profiles of the present invention are generated from samples from subjects affected by AML, including subjects having AML, subjects suspected of having AML, subjects having a propensity to develop AML, or subjects who have previously had AML, or subjects undergoing therapy for AML.
  • the samples from the subject used to generate the expression profiles of the present invention can be derived from a variety of sources including, but not limited to, single cells, a collection of cells, tissue, cell culture, bone marrow, blood, or other bodily fluids.
  • the tissue or cell source may include a tissue biopsy sample, a cell sorted population, cell culture, or a single cell.
  • Sources for the sample ofthe present invention include cells from peripheral blood or bone marrow, such as blast cells from peripheral blood or bone marrow.
  • the percentage of the sample ttiat constitutes cells having differential gene expression in AML classes should be considered.
  • Samples may comprise at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, at least 60 ", at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% cells having differential expression in AML classes, with a preference for samples having a high percentage of such cells.
  • these cells are blast cells, such as leuke ⁇ iic cells.
  • the percentage of a sample that constitutes blast cells may be deteirniined by methods well known in the art; see, for example, the methods described in WO 03/083140.
  • Gene expression profiling or “expression profiling” is used herein in its art-recognised meaning and refers to a method for measuring the transcriptional state (mRNA) or the translational state (protein) of a plurality of genes in a cell.
  • an "expression profile” comprises one or more values corresponding to a measurement of the relative abundance of a gene expression product. Such values may include measurements of RNA levels or protein abundance.
  • the expression profile can comprise values representing the measurement of tfcie transcriptional state or the translational state of the gene.
  • the transcriptional state of a sample includes the identities and relative abundance of the RNA species, especially mRNAs present in the sample. Preferably, a substantial fraction of all constituent RNA species in the sample are measured, but at least a sufficient fraction to chara terize the transcriptional state of the sample is measured.
  • the transcriptional state can be conveniently determined by measuring transcript abundance by any of several existing gene expression technologies.
  • Translational state includes the identities and relative abundance of the constituent protein species in the sample. As is known to those of skill in the art, the transcriptional state and translational state are related. Each value in the expression profiles as determined and embodied in the present invention is a measurement representing the absolute or the relative expression level of a differentially-expressed gene.
  • the expression levels of these genes may be determined by any method known in the art for assessing the expression level of an RNA or protein molecule in a sample.
  • expression levels of RNA may be monitored using a membrane blot (such as used in hybridization analysis such as Northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Patent Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, to which explicit reference is made.
  • the gene expression monitoring system may also comprise nucleic acid probes in solution.
  • microarrays are used to measure the values to be included in the expression profiles.
  • Microarrays are particularly well suited for this purpose because of the reproducibility between different experiments.
  • DNA microarrays provide one method for the simultaneous measurement of the expression levels of large numbers of genes. Each array consists of a reproducible pattern of capture probes attached to a solid support. Labeled RNA or DNA is hybridized to complementary probes on the array and then detected by laser scanning. Hybridization intensities for each probe on the array are determined and converted to a quantitative value representing relative gene expression levels. See, the Experimental section. See also, U.S. Pat. Nos. 6,040,138, 5,800,992 and 6,020,135, 6,033,860, and 6,344,316, to which explicit reference is made.
  • High-density oligonucleotide arrays are particularly useful for determining the gene expression profile for a large number of RNAs in a sample.
  • total mRNA isolated from the sample is converted to labeled cRNA and then hybridized to an oligonucleotide array.
  • Each sample is hybridized to a separate array.
  • Relative transcript levels are calculated by reference to appropriate controls present on the array and in the sample. See, for example, the Experimental section.
  • the values in the expression profile are obtained by measuring the abundance of the protein products of the differentiall -expressed genes. The abundance of these protein products can be determined, for example, using antibodies specific for the protein products of the differentially -expressed genes.
  • antibody refers to an immunoglobulin molecule or immunologically active portion thereof, i.e., an antigen-binding portion.
  • immunologically active portions of immunoglobulin molecules include F(ab) and F(ab')2 fragments which can be generated by treating the antibody with an enzyme such as pepsin.
  • the antibody can be a polyclonal, monoclonal, recombinant, e.g., a chimeric or humanized, fully human, non-human, e.g., murine, or single chain antibody. In a preferred embodiment it has effector function and can fix complement.
  • the antibody can be coupled to a toxin or imaging agent.
  • a full-length protein product from a differentially-expressed gene, or an antigenic peptide fragment of the protein product can be used as an immunogen.
  • Preferred epitopes encompassed by the antigenic peptide are regions of the protein product of the differentially-expressed gene that are located on the surface of the protein, e.g., hydrophilic regions, as well as regions with high antigenicity.
  • the antibody can be used to detect the protein product of the differentially- expressed gene in order to evaluate the abundance and pattern of expression of the protein. These antibodies can also be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, e.g., to, for example, determine the efficacy of a given therapy.
  • Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance (i.e., antibody labeling).
  • detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, (3- galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125 I, 131 I, 35 S or 3 H.
  • the subject profile is compared to the reference profile to determine whether the subject expression profile is sufficiently similar to the reference profile.
  • the subject expression profile is compared to a plurality of reference expression profiles to select the reference expression profile that is most similar to the subject expression profile. Any method known in the art for comparing two or more data sets to detect similarity between them may be used to compare the subject expression profile to the reference expression profiles.
  • the subject expression profile and the reference profile are compared using a supervised learning algorithm such as the support vector machine (SVM) algorithm, prediction by collective likelihood of emerging patterns (PCL) algorithm, the k-nearest neighbour algorithm, or the Artificial Neural Network algorithm.
  • SVM support vector machine
  • PCL collective likelihood of emerging patterns
  • a subject expression profile shows "statistically significant similarity” or "sufficient similarity” to a reference profile
  • statistical tests may be performed to determine whether the similarity between the subject expression profile and the reference expression profile is likely to have been achieved by a random event. Any statistical test that can calculate the likelihood that the similarity between the subject expression profile and the reference profile results from a random event can be used.
  • the accuracy of assigning a subject to an AML class based on similarity between differentially-expressed genes is affected largely by the heterogeneity within the patient population, as is reflected by the deviation from the geometric mean. Therefore, when more accurate diagnoses are required, the stringency in evaluating the similarity between the subject and the reference profile should be increased by changing the numerical query.
  • the method used for comparing a subject expression profile to one or more reference profiles is preferably carried out by re-running the subsequent analyses in a (n+1) modus by performing clustering methods as described herein. Also, in order to identify the AML class reference profile that is most similar to the subject expression profile, as performed in the methods for establishing the AML class of an AML affected subject, i.e. by diagnosing AML in a subject or by classifying the AML in a subject, profiles are clustered according to similarity and it is determined whether the subject profile corresponds to a known class of reference profiles.
  • this method is used wherein the clustered position of the subject profile, obtained after performing the clustering analysis of the present invention, is compared to any known AML class. If the clustered position of the subject profile is within a cluster of reference profiles, i.e. forms a cluster therewith after performing the similarity clustering method, it is said that the AML of the subject corresponds to the AML class of reference profiles. If a subject profile is not within a cluster of reference profiles, i.e. does not form a cluster therewith after performing the similarity clustering method, then a new AML class may be assigned to that subject profile, one of such classes being subjects not having AML.
  • the expression profiles comprise values representing the expression levels of genes that are differentially -expressed in AML classes.
  • the term "differentially-expressed” as used herein means that the measured expression level of a particular gene in the expression profile of one subject differs at least n-fold from the geometric mean calculated from all patient profiles.
  • the expression level may be also be up-regulated or down-regulated in a sample from a subject having a particular form of AML in comparison with a sample from a subject having a different form of AML.
  • the differentially-expressed genes of the present invention may be expressed at different levels in different AML classes. Examples of genes that are differentially-expressed in the various AML classes are shown in Tables 1 and 2.
  • This confirmation may for instance be obtained by performing the method for classifying an AML in an AML-affected subject according to the present invention, or by any other test.
  • the present invention provides groups of genes that are differentially -expressed in diagnostic AML samples of patients in different AML classes. Some of these genes were identified based on gene expression levels for 13,000 probes in 286 AML samples. Values representing the expression levels of the nucleic acid molecules detected by the probes were analyzed as described in the Experimental section using Omniviz, SAM and PAM analysis tools. Omniviz software was used to perform all clustering steps such as K-means, Hierarchical and Pearson correlation tests. SAM was used specifically to identify the genes underlying the clinically relevant groups identified in the Pearson correlation analysis.
  • PAM is used to decide the minimum number of genes necessary to diagnose all individual patients within the given groups of the Pearson correlation.
  • expression profiling was carried out on AML blasts from 286 de novo AML patients.
  • Unsupervised clustering was used to identify novel (sub)groups within the Pearson correlation following the hierarchical clustering.
  • the Pearson correlation test resulted in the identification of 16 groups or classes of AML patients with distinct molecular signatures.
  • the hierarchical clustering and Pearson correlation allow the detection of the genetic heterogeneity (16 clusters). This may provide for a mechanistic signature of AML.
  • the diagnostic gene -signatures incl. cluster-specific genes
  • AML subgroups AMLl/ETO, PML/RARa and CBF ⁇ /MYHll could be identified based on measurement of the expression level of only one or two genes in a cell sample
  • AML classes were defined on the basis of differential expression of a plurality of genes.
  • Genes that define an AML class are hereinafter also termed cluster-specific genes or signature genes.
  • Prediction Analysis of Microarrays (PAM) was applied to determine the minimal gene sets that predict these prognostically important clusters with high accuracy. In one of the novel clusters half of the AML patients had unfavourable markers, such as elevated expression oiEVIl and/or loss of chromosome 7(q).
  • the present invention thus provides a method of classifying AML. Using this method, a total of 286 AML samples analysed on a DNA microarray consisting of 22283 probe sets, representing approximately 13,000 genes could be classified into at least 16 distinct clusters. These 16 distinct clusters of AML patients were assigned on the basis of strong correlation between their individual differential expression profiles for 2856 probe sets (Table 1; Figure 1).
  • the methods used to analyze the expression level values to identify differentiall -expressed genes were employed such that optimal results in clustering, i.e. unsupervised ordering, were obtained. This then resulting in the definition of the 16 clusters of reference profiles based on molecular signature.
  • the genes that defined the position or clustering of these 16 individual clusters could be determined and the minimal sets of genes required to accurately predict the prognostically important AML classes corresponding to these clusters could be derived. It should be understood that the method for classifying AML according to the present invention may result in a distinct clustering pattern and therefore in a different classification scheme when other (numbers of) subjects are used as reference, or when other types of oligonucleotide microarrays for establishing gene expression profiles are used.
  • the present invention thus provides a comprehensive classification of AML covering various previously identified genetically defined classes. Further analysis of classes by prediction analysis of microarrays (PAM) to determine the minimum number of genes that defined or predicted these prognostically important classes resulted in the establishment of cluster- specific genes or signature genes. The presence of distinct gene expression profiles defining the novel classes suggests the presence of yet unknown common gene defects or pathway defects among AML cases in those classes. Several classes could be distinguished on the basis of the expression level of a single gene, whereas others could only be distinguished on the basis of 20 or more differentially-expressed genes (Table 3).
  • PAM microarrays
  • the methods of the present invention comprise in some aspects the step of defining cluster-specific genes by selecting those genes of which the expression level characterizes the clustered position of the corresponding AML class among the various AML classes within a classification scheme of the present invention.
  • cluster-specific genes are selected preferably on the basis of PAM analysis.
  • This method of selection comprises the following.
  • PAM or partition round medoids, is one of the k-medoids methods. Different from usual k-means approach, it also accepts a dissimilarity matrix, and it is more robust because it minimizes a sum of dissimilarities instead of a sum of squared Euclidean distances.
  • the PAM-algorithm is based on the search for 'k' representative objects or medoids among the observations of the dataset, which should represent the structure of the data. After finding a set of 'k' medoids, 'k' clusters are constructed by assigning each observation to the nearest medoid. The goal is to find 'k' representative objects which minimize the sum of the dissimilarities of the observations to their closest representative object.
  • the distance metric to be used for calculating dissimilarities between observations are "euclidean" and "manhattan”. Euclidean distances are root sum-of-squares of differences, and manhattan distances are the sum of absolute differences.
  • PAM calculates how many genes are necessary to identify all members (patients) belonging to a certain cluster.
  • the methods of the present invention comprise in some aspects the step of establishing whether the level of expression of cluster-specific genes in a subject shares sufficient similarity to the level of expression that is characteristic for an individual AML class. This step is necessary in determining the presence of that particular AML class in a subject under investigation, in which case the expression of that gene is used as a disease marker. Whether the level of expression of cluster-specific genes in a subject shares sufficient similarity to the level of expression of that particular gene in an individual AML class may for instance be determined by setting a threshold value.
  • the present invention also reveals genes with a high differential level of expression in specific AML classes compared the geometric mean of all reference subjects. These highly differentially-expressed genes are selected from the genes shown in Table 2.
  • genes and their expression products are useful as markers to detect the presence of AML in a patient. Antibodies or other reagents or tools may be used to detect the presence of these markers of AML.
  • the present invention also reveals gene expression profiles comprising values representing the expression levels of genes in the various identified AML classes. In a preferred embodiment, these expression profiles comprise the values representing the differential expression levels.
  • the expression profiles ofthe invention comprise one or more values representing the expression level of a gene having differential expression in a defined AML class. Each expression profile contains a sufficient number of values such that the profile can be used to distinguish one AML class from another. In some embodiments, the expression profiles comprise only one value.
  • the expression profile comprises two values corresponding to two differentially-expressed genes.
  • the expression profile comprises more than one or two values corresponding to a differentially-expressed gene, for example at least 3 values, at least 4 values, at least 5 values, at least 6 values, at least 7 values, at least 8 values, at least 9 values, at least 10 values, at least 11 values, at least 12 values, at least 13 values, at least 14 values, at least 15 values, at least 16 values, at least 17 values, at least 18 values, at least 19 values, at least 20 values, at least 22 values, at least 25 values, at least 27 values, at least 30 values, at least 35 values , at least 40 values, at least 45 values, at least 50 values, at least 75 values, at least 100 values, at least 125 values, at least 150 values, at least 175 values, at least 200 values, at least 250 values, at least 300 values, at least 400 values, at least 500 values, at least 600 values, at least 700 values, at least 800 values, at least 900 values, at least 1000 values, at least 1200 values, at least 1500 values, or at least 2000 or more
  • the diagnostic accuracy of assigning a subject to an AML class will vary based on the number of values contained in the expression profile. Generally, the number of values contained in the expression profile is selected such that the diagnostic accuracy is at least 85%, at least 87%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, as calculated using methods described elsewhere herein, with an obvious preference for higher percentages of diagnostic accuracy. It is recognized that the diagnostic accuracy of assigning a subject to an AML class will vary based on the strength of the correlation between the expression levels of the differentially-expressed genes within that specific AML class.
  • the values in the expression profiles represent the expression levels of genes whose expression is strongly correlated with that specific AML class, it may be possible to use fewer number of values (genes) in the expression profile and still obtain an acceptable level of diagnostic or prognostic accuracy.
  • the strength of the correlation between the expression level of a differentially -expressed gene and a specific AML class may be determined by a statistical test of significance. For example, the chi square test used to select genes in some embodiments ofthe present invention assigns a chi square value to each differentially-expressed gene, indicating the strength of the correlation of the expression of that gene to a specific AML class.
  • the T-statistics metric and the Wilkins' metric both provide a value or score indicative of the strength ofthe correlation between the expression of the gene and its specific AML class. These scores may be used to select the genes of which the expression levels have the greatest correlation with a particular AML class to increase the diagnostic or prognostic accuracy o the methods of the invention, or in order to reduce the number of values contained in the expression profile while maintaining the diagnostic or prognostic accuracy of the expression profile.
  • a database is kept wherein the expression profiles of reference subjects are collected and to which database new profiles can be added and clustered with the already existing profiles such as to provide the clustered position of said new profile among the already present reference profiles.
  • the addition of new profiles to the database will improve the diagnostic and prognostic accuracy of the methods of the invention.
  • SAM or PAM analysis tools are used to determine the strength of such correlations.
  • the methods ofthe invention comprise the steps of providing an expression profile from a sample from a subject affected by AML and comparing this subject expression profile to one or more reference profiles that are associated with a particular AML class, a class with a known prognosis, or a class with a favourable response to therapy.
  • the AML class assigned is that with which the reference profile(s) are associated.
  • the prognosis of a subject affected by AML can be predicted by determining whether the expression profile from the subject is sufficiently similar to a reference profile associated with an established prognosis, such as a good prognosis or a bad prognosis.
  • a preferred intervention strategy, or therapeutic treatment can then be proposed for said subject, and said subject can be treated according to said assigned strategy.
  • treatment of a subject with AML can be optimized according to the specific class of AML with which the subject is affected.
  • the AML class belonging to cluster # 12 may be treated with retinoic acid.
  • further division may be made according to responders and non-responders to treatment or therapy.
  • Such divisions may provide for further detailed characterisation of AML subjects.
  • the subject expression profile is from a subject affected by AML who is undergoing a therapy to treat the AML.
  • the subject expression profile is compared to one or more reference expression profiles to monitor the efficacy of the therapy.
  • the assignment of a subject affected by AML to an AML class is used in a method of choosing a therapy for the subject affected by AML.
  • a therapy refers to a course of treatment intended to reduce or eliminate the affects or symptoms of a disease, in this case AML.
  • a therapy regime will typically comprise, but is not limited to, a prescribed dosage of one or more drugs or hematopoietic stem cell transplantation. Therapies, ideally, will be beneficial and reduce the disease state but in many instances the effect of a therapy will have non-desirable effects as well.
  • the present invention provides a method of determining the prognosis for an AML affected subject, said method comprising the steps of providing a classification scheme for AML by producing such a scheme according to a method of the invention and determining the prognosis for each AML class in said scheme based on clinical records for the AML subjects comprised in said class.
  • the present invention provides for the assignment o the various clinical data recorded with reference subjects affected by AML to the various AML classes as defined herein. This assignment preferably occurs in a database.
  • compositions that are useful in determining the gene expression profile for a subject affected by AML and selecting a reference profile that is similar to the subject expression profile. These compositions include arrays comprising a substrate having capture probes that can bind specifically to nucleic acid molecules that are differentially-expressed in AML classes. Also provided is a computer-readable medium having digitally encoded reference profiles useful in the methods of the claimed invention.
  • arrays comprising capture probes for detection of polynucleotides (transcriptional state) or for detection of proteins (translational state) in order to detect differentially-expressed genes of the invention.
  • array is intended a solid support or substrate with peptide or nucleic acid probes attached to said support or substrate.
  • Arrays typically comprise a plurality of different nucleic acid or peptide capture probes that are coupled to a surface of a substrate in different, known locations.
  • arrays may generally be produced using mechanical synthesis methods or light directed synthesis methods which incorporate a combination of photolithographic methods and solid phase synthesis methods.
  • oligonucleotide microarrays will be used for determining the transcriptional state
  • peptide microarrays will be used for determining the translational state of a cell.
  • Nucleic acid or “oligonucleotide” or “polynucleotide” or grammatical equivalents used herein means at least two nucleotides covalently linked together. Oligonucleotides are typically from about 5, 6, 7, 8, 9, 10, 12, 15, 25, 30, 40, 50 or more nucleotides in length, up to about 100 nucleotides in length. Nucleic acids and polynucleotides are a polymers of any length, including longer lengths, e.g., 200, 300, 500, 1O00, 2000, 3000, 5000, 7000, 10,000, etc.
  • a nucleic acid ofthe present invention will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have alternate backbones, comprising, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O- methylphophoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press); and peptide nucleic acid backbones and linkages.
  • Other analog nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones, including those described in U.S. Pat. Nos.
  • nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids. Modifications of the ribose-phosphate backbone may be done for a variety of reasons, e.g. to increase the stability and half-life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.
  • PNA peptide nucleic acids
  • These backbones are substantially non- ionic under neutral conditions, in contrast to the highly charged phosphodiester backbone of naturally occurring nucleic acids. This results in two advantages.
  • the PNA backbone exhibits improved hybridization kinetics. PNAs have larger changes in the melting temperature (T m ) for mismatched versus perfectly matched basepairs. DNA and RNA typically exhibit a 2-4 °C drop in T m for an internal mismatch. With the non-ionic PNA backbone, the drop is closer to 7-9°C.
  • hybridization of the bases attached to these backbones is relatively insensitive to salt concentration.
  • the nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence. As will be appreciated by those in the art, the depiction of a single strand also defines the sequence of the complementary strand; thus the sequences described herein also provide the complement ofthe sequence.
  • the nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc.
  • Transcript typically refers to a naturally occurring RNA, e.g., a pre-mRNA, hnRNA, or mRNA.
  • nucleoside includes nucleotides and nucleoside and nucleotide analogs, and modified nucleosides such as amino modified nucleosides.
  • nucleoside includes non- naturally occurring analog structures. Thus, e.g. the individual units of a peptide nucleic acid, each containing a base, are referred to herein as a nucleoside.
  • a nucleic acid probe or oligonucleotide is defined as a nucleic acid capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation.
  • a probe may include natural (i.e., A, G, C, or T) or modified bases (7-deazaguanosine, inosine, etc.).
  • the bases in a probe may be joined by a linkage other than a phosphodiester bond, so long as it does not functionally interfere with hybridization.
  • probes may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages. It will be understood by one of skill in the art that probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions.
  • the probes are preferably directly labeled such as with isotopes, chromophores, lumiphores, chromogens, or indirectly labeled such as with biotin to which a streptavidin complex may later bind or with enzymatic labels.
  • an assaying for the hybridization of the probe to its target nucleic acid sequence one can detect the presence or absence of the select sequence or subsequence.
  • Diagnosis or prognosis may be based at the genomic level, or at the level of RNA or protein expression.
  • the skilled person is capable of designing oligonucleotide probes that can be used in diagnostic methods of the present invention.
  • such probes are immobilised on a solid surface as to form an oligonucleotide microarray of the invention.
  • the oligonucleotide probes useful in methods of the present invention are capable of hybridizing under stringent conditions to AML-associated nucleic acids, such as to one or more ofthe genes selected from Table 1, preferably to one or more of the genes selected from Table 2, more preferably to one or more of the genes selected from Table 3.
  • AML-associated nucleic acids such as to one or more ofthe genes selected from Table 1, preferably to one or more of the genes selected from Table 2, more preferably to one or more of the genes selected from Table 3.
  • Arrays may be peptides or nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate, for the purpose of which reference is made to U.S. Pat. Nos. 5,770,358, 5,789, 162, 5,708,153, 6,040,193 and 5,800,992. Arrays may be packaged in such a manner as to allow for diagnostics or other manipulation of an all-inclusive device. Reference is for example made to U.S. Pat. Nos. 5,856,174 and 5,922,591.
  • the arrays provided by the present invention comprise capture probes that can specifically bind a nucleic acid molecule that is differentially - expressed in AML classes.
  • each capture probe in the array detects a nucleic acid molecule selected from the nucleic acid molecules designated in Tables 1 and 2.
  • the designated nucleic acid molecules include those differentially-expressed in AML classes selected from cluster #l-cluster #16 as depicted in figure 1.
  • the arrays of the invention comprise a substrate having a plurality of addresses, where each address has a capture probe that can specifically bind a target nucleic acid molecule.
  • the number of addresses on the substrate varies with the purpose for which the array is intended.
  • the arrays may be low-density arrays or high-density arrays and may contain 4 or more, 8 or more, 12 or more, 16 or more, 20 or more, 24 or more, 32 or more, 48 or more, 64 or more, 72 or more 80 or more, 96, or more addresses, or 192 or more, 288 or more, 384 or more, 768 or more, 1536 or more, 3072 or more, 6144 or more, 9216 or more, 12288 or more, 15360 or more, or 18432 or more addresses.
  • the substrate has no more than 12, 24, 48, 96, or 192, or 384 addresses, no more than 500, 600, 700, 800, or 900 addresses, or no more than 1000, 1200, 1600, 2400, or 3600 addresses.
  • the invention also provides a computer-readable medium comprising one or more digitally encoded expression profiles, where each profile has one or more values representing the expression of a gene that is differentially -expressed in an AML class. The preparation and use of such profiles is well within the reach of the skilled person (see e.g. WO 03/083140).
  • the digitally-encoded expression profiles are comprised in a database. See, for example, U.S. Patent No. 6,308,170.
  • kits useful for diagnosing, treating, and monitoring the disease state in subjects affected by AML comprise an array and a computer readable medium.
  • the array comprises a substrate having addresses, where each address has a capture probe that can specifically bind a nucleic acid molecule (by using an oligonucleotide array) or a peptide (by using a peptide array) that is differentially -expressed in at least one AML class.
  • the results are converted into a computer-readable medium that has digitally-encoded expression profiles containing values representing the expression level of a nucleic acid molecule detected by the array.
  • mRNA in the sample is labeled, or labeled cDNA is prepared by using mRNA as a template, and the labeled mRNA or cDNA is subjected to hybridization with the array, so that mRNAs being expressed in the sample are simultaneously detected, whereby their expression levels can be determined.
  • Genes each of which expression is altered due to AML can be found by determining expression levels of various genes in the AML affected cells and classified into certain types as described above and comparing the expression levels with the expression level in a control tissue.
  • the method for determining the expression levels of genes is not particularly limited, and any of techniques for confirming alterations of the gene expressions mentioned above can be suitably used. Among all, the method using the array is especially preferable because the expressions of a large number of genes can be simultaneously determined.
  • Suitable arrays are commercially available, e.g., from Affymetrix. For instance, mRNA is prepared from blast cells, and then reverse transcription is carried out with the resulting mRNA as a template. During this process, labeled cDNA can be obtained by using, for instance, any suitable labeled primers or labeled nucleotides.
  • the labeling substance used for labeling there can be used substances such as radioisotopes, fluorescent substances, chemiluminescent substances and substances with fluophor, and the like.
  • the fluorescent substance includes Cy2, FluorX, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, fluorescein isothiocyanate (FITC), Texas Red, Rhodamine and the like.
  • FITC fluorescein isothiocyanate
  • samples to be tested cancer samples to be tested in the present selection method
  • a sample to be used as a control are each labeled with different fluorescent substances, using two or more fluorescent substances, from the viewpoint of enabling simultaneous detection.
  • labeling ofthe samples is carried out by labeling mRNA in the samples, cDNA derived from the mRNA, or nucleic acids produced by transcription or amplification from cDNA.
  • the hybridization is carried out between the above-mentioned labeled cDNA and the array to which a nucleic acid corresponding to a suitable gene or its fragment is immobilized.
  • the hybridization may be performed according to any known processes under conditions that are appropriate for the array and the labeled cDNA to be used. For instance, the hybridization can be performed under the conditions described in Molecular Cloning, A laboratory manual, 2nd ed., 9.52-9.55 (1989).
  • the hybridization between the nucleic acids derived from the samples and the array is carried out, under the above-mentioned hybridization conditions.
  • the degradation of mRNA may take place due to actions of ribonuclease.
  • the mRNA levels in both of these samples are adjusted using a standard gene with relatively little alterations in expressions. Thereafter, by comparing the hybridization results ofthe samples to be tested with those of the control sample, genes exhibiting differential expression levels in both samples can be detected.
  • a signal which is appropriate depending upon the method of labeling used is detected for the array which is subjected to hybridization with the nucleic acid sample labeled by the method as described above, whereby the expression levels in the samples to be tested can be compared with the expression level in the control sample for each of the genes on the array.
  • the genes thus obtained which have a significant difference in signal intensities are genes each of which expression is altered specifically for certain AML classes.
  • the present invention also provides a computer-readable medium comprising a plurality of digitally-encoded expression profiles wherein each profile of the plurality has a plurality of values, each value representing the expression of a gene that is differentially-expressed in at least one AML class.
  • the invention also provides for the storage and retrieval of a collection of data relating to AML specific gene expression data of the present invention, including sequences and expression levels in a computer data storage apparatus, which can include magnetic disks, optical disks, magneto-optical disks, DRAM, SRAM, SGRAM, SDRAM, RDRAM, DDR RAM, magnetic bubble memory devices, and other data storage devices, including CPU registers and on-CPU data storage arrays.
  • a computer data storage apparatus can include magnetic disks, optical disks, magneto-optical disks, DRAM, SRAM, SGRAM, SDRAM, RDRAM, DDR RAM, magnetic bubble memory devices, and other data storage devices, including CPU registers and on-CPU data storage arrays.
  • the data records are stored as a bit pattern in an array of magnetic domains on a magnetizable medium or as an array of charge states or transistor gate states, such as an array of cells in a DRAM device (e.g., each cell comprised of a transistor and a charge storage area, which
  • kits are also provided by the invention.
  • such kits may include any or all ofthe following: assay reagents, buffers, AML class-specific nucleic acids or antibodies, hybridization probes and/or primers, antisense polynucleotides, ribozymes, dominant negative AML polypeptides or polynucleotides, small molecules inhibitors of AML-associated sequences, arrays, antibodies, Fab fragments, capture peptides etc.
  • the kits may include instructional materials containing directions (i.e., protocols) for the practice of the methods of this invention. While the instructional materials typically comprise written or printed materials, they are not limited to such.
  • Any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention.
  • Such media include, but are not limited to electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like.
  • Such media may include addresses to internet sites that provide such instructional materials.
  • One such internet site may provide a database of AML reference expression profiles useful for performing similarity clustering of a newly determine subject expression profiles with a large set of reference profiles of AML subjects comprised in said database.
  • the database includes clinically relevant data such as patient prognosis, successful methods of treatment and cytogenetic characteristics for the various AML classes in the database.
  • kits comprising an array of the invention and a computer-readable medium having digitally-encoded reference profiles with values representing the expression of nucleic acid molecules detected by the arrays. These kits are useful for assigning a subject affected by AML to an AML class and for diagnosing AML in a subject.
  • kits for screening for modulators of AML-associated sequences can be prepared from readily available materials and reagents.
  • kits can comprise one or more of the following materials: an AML-associated polypeptide or polynucleotide, reaction tubes, and instructions for testing AML-associated activity.
  • the kit may comprise an array for detecting AML- associated genes, specifically cluster-defining genes according to the invention.
  • kits and components can be prepared according to the present invention, depending upon the intended user of the kit and the particular needs of the user. Diagnosis would typically involve evaluation of a plurality of genes or products. The genes will be selected based on correlations with important parameters in disease which may be identified in historical or outcome data.
  • a kit-of-parts according to the invention comprises an oligonucleotide microarray according to the invention and means for comparing a gene expression profile determined by using said microarray with a database of AML reference expression profiles.
  • the present invention also comprises kits of parts suitable for performing a method of the invention as well as the use of the various products of the invention, including databases, microarrays, oligonucleotide probes and classification schemes in diagnostic or prognostic methods of the invention.
  • the methods and compositions of the invention may be used to screen test compounds to identify therapeutic compounds useful for the treatment of AML.
  • the test compounds are screened in a sample comprising primary cells or a cell line representative of a particular AML class.
  • the expression levels in the sample of one or more of the differentially-expressed genes of the invention are measured using methods described elsewhere herein. Values representing the expression levels of the differentially -expressed genes are used to generate a subject expression profile.
  • test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection.
  • Candidate compounds include, for example, 1) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e.g., Lam et al. (1991) Nature 354:82-84; Houghten et al.
  • antibodies e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies as well as Fab, F(ab')Z, Fab expression library fragments, and epitope binding fragments of antibodies
  • small organic and inorganic molecules e.g., molecules obtained from combinatorial and natural product libraries; 5) zinc analogs; 6) leukotriene A4 and derivatives; 7) classical aminopeptidase inhibitors and derivatives of such inhibitors, such as bestatin and arphamenine A and B and derivatives; 8) and artificial peptide substrates and other substrates, such as those disclosed herein above and derivatives thereof.
  • the present invention discloses a number of genes that are differentially-expressed in AML classes. These differentially-expressed genes are shown in Tables 1 and 2. Because the expression of these genes is associated with AML risk factors, these genes may play a role in leukemogenesis. Accordingly, these genes and their gene products are potential therapeutic targets that are useful in methods of screening test compounds to identify therapeutic compounds for the treatment of AML. Genes that are common between a number of AML classes are preferred as targets for therapeutic treatment, since a broader working over the patient population can be expected. It is very likely that genes that are present in more than one AML class, as defined in the present invention, are involved in general processes underlying AML.
  • the differentially-expressed genes of the invention may be used in cell-based screening assays involving recombinant host cells expressing the differentially-expressed gene product. The recombinant host cells are then screened to identify compounds that can activate the product of the differentially-expressed gene (i.e. agonists) or inactivate the product of the differentially-expressed gene (i.e. antagonists).
  • any of the leukemogenic functions mediated by the product ofthe differentially-expressed gene may be used as an endpoint in the screening assay for identifying therapeutic compounds for the treatment of AML.
  • Such endpoint assays include assays for cell proliferation, assays for modulation of the cell cycle, assays for the expression of markers indicative of AML, and assays for the expression level of genes differentially-expressed in AML classes as described above. Modulators of the activity of a product of a differentially- expressed gene identified according to these drug-screening assays provided above can be used to treat a subject with AML.
  • Gene profiling and quality control 286 newly diagnosed cases of AML were analyzed by gene profiling using the Affymetrix U133A GeneChip.
  • the U133A GeneChips contain 22283 probe sets representing approximately 13000 distinct genes.
  • Ten microgram of total RNA was used for the production of antisense biotinylated RNA.
  • Single-stranded cDNA and double -stranded cDNA were synthesized according to the manufactures protocol (Invitrogen Life Technologies, Breda, The Netherlands) using the T7-(dT)24-primer (Genset Corp, Paris France).
  • Ratio ratio between measured intensity and geometric mean intensity by which probe sets were selected. SAM ® (version 1.21) Trustees of Leland Stanford Junior University
  • RT-PCR and sequence analyses Reverse trancriptase - polymerase chain reactions (RT-PCR) and sequence analyses for mutations in FLT3-ITO, FLT3-TKD, N-i S, K-RAS and cEBPa, as well as real-time PCR for EVI1 were performed as described previously (van Waalwijk van Doorn-Khosrovani et al, 2003a; van Waalwijk van Doorn-Khosrovani et al, 2003b; Valk et al, 2004; Care et al, 2003).
  • PML/RARa - Cluster #12 contains all cases of acute promyelocytic leukemia (APL) with t(15;17) ( Figure IB and Supplemental Data (Table L)), including two patients previously recognized as APL with PML/RARaby RT- PCR only.
  • SAM analyses (Supplemental Data (Table LI)) revealed that genes encoding growth factors such as hepatocyte growth factor (HGF), macrophage- stimulating 1 (hepatocyte growth factor-like (MSTl)) and fibroblast growth factor 13 (FGF13) were specific for this cluster.
  • HGF hepatocyte growth factor
  • MSTl macrophage- stimulating 1
  • FGF13 fibroblast growth factor 13
  • AML ⁇ ith llq23 abnormalities AML patients with Hq23 abnormalities were intermingled within the 286 AML patients, although two subgroups were apparent, i.e., cluster #1 and cluster #16 ( Figure IB and Supplemental Data (Tables A and P)).
  • Cluster #16 contains four cases of t(9;ll) and one case of t(ll;19) (5/11 cases (45%)).
  • SAM analyses identified a strong signature with a group of genes specifically upregulated in the majority of cases in this cluster ( Figure IB and Supplemental data (Table PI)). Although seven of 14 (50%) cases within cluster #1 have chromosome 11 abnormalities as well, this subgroup appears quite heterogeneous with a less uniform signature (Figure IB).
  • cluster #4 two separate clusters (#4 and #15) comprise AML patients with predominantly normal karyotypes and a high frequency of mutations in cEBPa ( Figure IB (Clusters #4 (8/15 cases (53%)) and #15 (5/8 cases (62%))).
  • Figure IB Clusters #4 (8/15 cases (53%)) and #15 (5/8 cases (62%)
  • cluster #4 a set of up- and down regulated genes could be defined (Supplemental data (Table Dl)), which appeared to discriminate the AML cases in cluster #4 from cluster #15.
  • the upregulated genes represent certain T-cell genes, such as the CD7 antigen (CD7) and the T cell receptor delta locus (TRD@), which are known to be expressed on immature subsets of AML as well (Lo Coco et al, 1989; Boeckx et al, 2002). All but one of the top40 genes of cluster #15 are downregulated (Supplemental data (Table Ol)). Interestingly, these genes are similarly downregulated in cluster #4 ( Figure IB). The genes encoding alphal-catenin (CTNNA1), tubulin beta-5 (TUBBS) and Nedd4 family interacting protein 1 (NDFIP ⁇ ) were the only genes down modulated and among the top40 in both cluster #4 and #15.
  • CD7 antigen CD7 antigen
  • TRD@ T cell receptor delta locus
  • a separate cluster (#10) of AML was identified in which 44% (10/22 cases, Supplemental data (Table J)) showed increased expression of EVIl.
  • Aberrant expression of EVIl in cluster #10 correlated with chromosome 7 abnormalities (6/10 EVIl -positive cases). This complete group of patients could be discriminated based on a selection of genes, suggesting that all patients, even the EVIl negative cases, carry abnormalities in a common pathway.
  • Cluster # 8 also contains a relatively high number of chromosome 7 aberrations (5/13 cases, Supplemental data (Table H)), but it displays a different molecular signature compared to cluster #10 ( Figure IB).
  • AML with FLT3 mutations Groups of patients with mutations in the FLT3 receptor gene were recognized within the Correlation View ( Figure IB). In fact, clusters #2 and #6 merely consist of patients with a FLT3 ITD. Interestingly, almost all of these patients have a normal karyotype. In addition, the FLT3 ITD mutation status seems to divide several clusters into two groups, e.g., clusters #3, #5 and AML with t(15;17) (#12). Other individual cases of AML with FLT3 ITD were more dispersed over the whole group of AML patients. AML patients with mutations in the tyrosine kinase domain (TKD) of FLT3 did not cluster. Likewise patients with mutations in codons 12, 13 or 61 of the small GTPase RAS (N- RAS and K-RAS) do not have apparent signatures and do not aggregate in the Correlation View ( Figure IB).
  • TKD tyrosine kinase domain
  • Cluster #5 mainly contains AML patients that belong to the French-American-British (FAB) classification M4 or M5 subtypes ( Figure IB), suggesting that the morphology was the main determinant for classifying these cases within this subgroup.
  • Clusters #3, #7, #8, #11 and #14 contain AML cases, that do not belong to one FAB subtype, but can be discriminated based on distinct gene expression profiles.
  • OS overall survival
  • EFS event free survival
  • the discriminative genes identified by SAM and PAM may in addition reveal specific functional pathways critical for the pathophysiology of AML. This is suggested by the identification of several functionally important genes implicated in specific subtypes of AML, such as the IL5R ⁇ in AML with t(8;21) (Touw et al, 1991) and the bona fide FLT3/STAT5 targets IL2Ra (Kim et al, 2001) and PIMl (Lilly et al, 1992) in AML with FLT3 ITD mutations.
  • clusters #9 CBF ⁇ /MYHll
  • #12 PML/RARa
  • #13 AMLl/ETO
  • cases that belong to cluster #10 showed a distinct poor outcome.
  • Patients in this cluster could be predicted with high accuracy in an independent validation set with a minimal set of genes.
  • the high frequency of poor prognostic markers, e.g., -7(q), -5(q), t(9;22) or high EVIl is in agreement with the observation that this cluster represents a bad- risk AML group.
  • AML patients in cluster #5 showed an intermediate survival estimate. Since these cases belong to AML FAB-M4 or -M5 subtype, it is possible that monocyte/macrophage related genes mainly drove clustering of these cases. Unsupervised clustering of larger numbers of only AML FAB-M4 or -M5 cases with a normal karyotype may result in the identification of specific subgroups with unique gene expression profiles and perhaps variable prognosis. Three clusters mainly consisting of patients with normal karyotype were identified. The majority of patients in two of those clusters (#2 and #6) were also characterized by FLT3 ITD mutations, whereas patients in cluster #11, with a discriminative molecular signature, did not contain any consistent abnormality.
  • clusters #11 and #16 Two clusters (#1 and #16) were recognized, which harbored llq23 abnormahties, representing defects involving the mixed-lineage leukemia gene. The reason for the separation of these two subgroups is most likely caused by different additional genetic defects in the cases of the distinct clusters, causing different gene expression profiles. In cluster #1 this abnormality may be the frequently observed high expression of EVIl, which is not apparent in AML cases from cluster #16. A similar explanation may hold for AML cases in clusters #4 and # 15, both comprising cEBPa mutant cases, AML patients in clusters #1 and #10 (high EVIl expression), or patients in clusters # 8 and #10 with frequent monosomy 7.
  • Eligible patients have a diagnosis of primary AML, confirmed by cytological examination of blood and bone marrow.
  • Blasts and mononuclear cells should be purified by Ficoll-Hypaque (Nygaard, Oslo, Norway) centrifugation. Add 1:1 diluted peripheral blood or bone marrow 1:4 diluted both in PBS up to 20-25 ml on to 15 ml Ficoll-Hypaque. Spin 15 minutes at 1880rpm. Collect interphase with mononuclear cells and wash twice with PBS (total volume 50ml, 8 minutes 2000 rpm). The pellet contains the mononuclear cells, including the blast cells. As a result, the AML samples should contain 80-100 percent blast cells, regardless of the blast count at diagnosis. 30.10 6 cells/ml should be frozen in lvol PBS/1 vol heat inactivated FCS/0.5 vol DMSO stored in liquid nitrogen.
  • RNA degradation 28S/18S rRNA ratio > 2 or contamination by DNA.
  • RNA Ten ⁇ g of total RNA should be used to prepare antisense biotinylated RNA.
  • Single -stranded cDNA and double-stranded cDNA should be synthesized according to the manufacturer's protocol (Invitrogen Life Technologies, Breda, The Netherlands) using the T7-(dT)24-primer (Genset Corp, Paris, France).
  • In vitro transcription should be performed with biotin-11-CTP and biotin-16-UTP (Perkin Elmer, Hoofddorp, The Netherlands) and the MEGAScript T7 labeling kit (Ambion, Cambridgeshire, UK).
  • Double-stranded cDNA and cRNA should be purified and fragmented with the GeneChip® Sample Cleanup Module
  • Biotinylated RNA should be hybridized to the Affymetrix U133A GeneChip® (45°C for 16 hours). Samples should be analyzed using Affymetrix U133A or U133 Plus2.0 GeneChips®.
  • a reference data set (gene expression data and detailed clinical and molecular data) of 285 AML patients should be downloaded from the Gene Expression Omnibus (www.ncbi.nlm.nih.gov/geo, accession number GSE1159). Data normalization, analysis and. visualization
  • the geometric mean of the hybridization intensities of all patient samples should calculated.
  • the level of expression of each probe set in every sample was determined relative to this geometric mean and transformed to log 2 to ascribe equal weight to gene-expression levels with similar relative distances to the geometric mean.
  • the transformed expression data should be subsequently imported into Omniviz.
  • the Omniviz package should be used to perform and visualize unsupervised cluster analysis.
  • Ig/TCR gene rearrangements are complementary but infrequent targets for PCR-based detection of minimal residual disease in acute myeloid leukemia. Leukemia 2002; 16:368-75. Care RS, Valk PJ, Goodeve AC, et al. Incidence and prognosis of c-KIT and
  • CBF core binding factor
  • Tusher VG Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 2001; 98:5116-21.
  • Valk PJM BD Frew ME, Goodeve AC, Lowenberg B, Reilly JTW. 'Second hit' mutations in the RTK/RAS signalling pathway in acute myeloid leukaemia and inv(16). Haematologica 2004; 89:In press.
  • _s_at EGR1 Hs.326035 201694 _s_at EGR1 Hs.326035 201695.
  • s_at ANK1 Hs.443711 205390 The s_at ANK1 Hs.443711 205391. x_at ANK1 Hs.443711 205392. .s_at CCL15 Hs.272493 205400. .at WAS Hs.2157 205402. x_at PRSS2 Hs.367767 205403. at IL1R2 Hs.25333 205409. at F0SL2 Hs.301612 205414. s_at KIAA0672 Hs.6336 205419. at EBI2 Hs.784 205445. .at PRL Hs.1905 205453. at H0XB2 Hs.290432 205456.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pathology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Theoretical Computer Science (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Microbiology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Medical Informatics (AREA)
  • Evolutionary Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

The present invention relates to methods of genetic analysis for the classification, diagnosis and prognosis of acute myeloid leukemia (AML). The invention provides a method for producing a classification scheme for AML comprising the steps of a) providing a plurality of reference samples, said reference samples comprising cell samples from a plurality of reference subjects affected by AML; b) providing reference profiles by establishing a gene expression profile for each of said reference samples individually; c) clustering said individual reference profiles according to similarity, and d) assigning an AML class to each cluster. The invention further relates to a method for classifying the AML of an AML affected subject, to a method for diagnosing AML in a subject, and to a method of determining the prognosis for an AML affected subject.

Description

Title: Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling.
TECHNICAL FIELD The present invention is in the field of medicine. The invention relates in particular to methods of genetic analysis for the classification, diagnosis and prognosis of acute myeloid leukemia. Also, the invention relates to nucleic acid expression profiles as obtained from cells of AML patients, which profiles by similarity group into a plurality of distinct and defined clusters that characterize different classes of AML. The invention relates to the use of such expression profiles and compositions in diagnosis and therapy of AML and specifically in the prediction of prognostically important AML classes. The invention further relates to methods for the diagnosis of AML and for the determination ofthe prognosis of a subject affected by AML and to kits of parts comprising sets of nucleic acid probes suitable for performing methods ofthe invention either by means of genomics or proteomics.
BACKGROUND OF THE INVENTION Acute myeloid leukemia (AML) is a collection of neoplasms with heterogeneous pathophysiology, genetics and prognosis. Based on cytogenetics and molecular analysis, AML patients are presently classified into groups or subsets of AML with markedly contrasting prognosis. For instance, the genetic translocations inv(16), t(8;21) and t(15;17) characterize AML with a relatively favourable prognosis, whereas the cytogenetically bad-risk leukemia's include patients with abnormalities involving Hq23, loss of 5(q) or 7(q), t(6;9) and t(9;22) (Lδwenberg et al, 1999). The most common molecular abnormality in AML is the internal tandem duplication (ITD) in the fms-like tyrosine kinase-3 gene (FLT3), a hematopoietic growth factor receptor (Levis & Small, 2003). FLT3 ITD mutations confer a bad prognosis to AML patients (Levis & Small, 2003). AML patients with mutations in the transcription factor cEBPα have been associated with good outcome (Preudhomme et al., 2002; van Waalwijk van Doorn-Khosrovani et al, 2003), while elevated expression of the transcription factor EVTl predicts for notoriously poor survival (van Waalwijk van Doorn- Khosrovani et al, 2003). These examples of novel molecular prognostic markers underscore the importance of an extension of molecular analyses in AML. Approximately thirty percent of all patients with acute myeloid leukemia (AML) are currently classified based on specific abnormal karyotypes in groups with either good or bad prognosis. The remaining seventy percent of patients, however, are not classifiable because of the lack of cytogenetic markers. One of the aims ofthe present invention is to provide more accurate risk assessment tools for the diagnosis of AML. It is another aim to classify AML patients in which specific abnormal karyotypes have not been found and to distinguish these groups not only from the molecularly well-defined AML classes, but also to define prognostic subgroups within these unclassified AML types. The presence of additional prognostic classes in AML, not recognizable with currently available methods, may provide important insights into their pathophysiology. Therefore, it is an aim of the present invention to provide a more complete way of prognostication to patients with AML.
SUMMARY OF THE INVENTION The present invention is based on the discovery that unique correlations within gene expression profiles and also with cytogenetic aberrations can be recognized with high accuracy within a representative cohort of AML patients. It has for instance been found that gene expression profiles obtained from a large number of AML patients can be clustered according to similarity. This enables the recognition of distinct classes of AML with similar expression profiles characterising such a class. It was thus found that AML could be classified into distinct subclasses, each subclass being characterised by a specific clustering of gene expression profiles. Further it was found that truly discriminative genes for most of these classes or clusters could be identified, a cluster for instance being characterized therein that the expression of multiple genes is up-regulated or down-regulated in that cluster whereas their expression in another cluster is unaffected. Based on these findings, the present invention now provides in a first aspect a method for producing a classification scheme for AML comprising the steps of: a) providing a plurality of reference samples, said reference samples comprising cell samples from a plurality of reference subjects affected by AML; b) providing reference profiles by establishing a gene expression profile for each of said reference samples individually; c) clustering said individual reference profiles according to similarity, and d) assigning an AML class to each cluster. In a preferred embodiment of such a method, the clustering of reference profiles is performed based on the information of genes that are differentially-expressed between profiles, and in an even more preferred embodiment of such a method, the clustering of said reference profiles is performed on the basis ofthe information of the genes of table 1, still more preferably of the genes of table 2, which tables are provided hereinbelow. In a further aspect, the present invention provides a method for classifying the AML of an AML affected subject, comprising the steps of: a) providing a classification scheme for AML by producing such a scheme according to the method of any one of claims 1-3; b) providing a subject profile by establishing a gene expression profile for said subject; c) clustering the subject profile together with the reference profiles; d) determining in said scheme the clustered position of said subject profile among the reference profiles, and e) assigning to said AML of said subject the AML class that corresponds to said clustered position in case said subject profile is within any cluster of reference profiles, or assigning to said AML of said subject a new AML class. In yet a further aspect, the present invention provides a method for diagnosing AML in an AML affected subject comprising: a) producing a classification scheme for AML according to a method of the invention; b) defining cluster-specific genes for each cluster by selecting those genes of which the expression level characterizes the clustered position of the corresponding AML class among the various AML classes within said scheme; c) determining the level of expression of a sufficient number of said cluster- specific genes in an AML affected subject; d) establishing whether the level of expression of said cluster-specific genes in said subject shares sufficient similarity to the level of expression that characterizes an individual AML class to thereby determine the presence of AML corresponding to said class in said subject. In one embodiment of such a method for diagnosing AML, said cluster-specific genes may comprise all genes comprised in said gene expression profile. In a preferred embodiment of such a method, said cluster- specific genes comprise a set of 1 to 3000 genes of the genes of table 1, more preferably 1 to 600 genes ofthe genes of table 1, still more preferably 1 to 50 genes of the genes of table 1. In an even more preferred embodiment said cluster-specific genes comprise a set of 1 to 600 genes ofthe genes of table 2, still more preferably 1 to 50 genes of the genes of table 2, and even more preferably 1 to 25 genes ofthe genes of table 2. Most preferred in such a method is the use of the differentially-expressed genes as shown in Table 3 for the diagnosis of a specific AML class in a subject. In yet another aspect, the present invention provides a method of determining the prognosis for an AML affected subject, said method comprising the steps of: a) providing a classification scheme for AML by producing such a scheme according to a method of the invention; b) determining the prognosis for each AML class in said scheme based on clinical records for the AML subjects comprised in said class; c) establishing the AML class of an AML affected subject by diagnosing and/or classifying AML in said subject according to a method of the invention, and d) assigning to said subject the prognosis corresponding to the established AML class of said AML affected subject. The present invention further provides a classification scheme for
AML, said scheme comprising a plurality of distinct AML classes that are differentiated on the basis of similarity clustering of gene expression profiles obtained from a plurality of reference subjects affected by AML. Said classification scheme is for instance obtainable by a method of the invention for producing such a scheme. Preferably, said classification scheme is obtained by a method involving K-means clustering of gene expression profiles based on, for instance, gene chip array-acquired values for hybridization intensities for each gene, such as for instance those obtainable by using an Affymetrix gene chip. Analysis of gene expression profiles obtained by using such gene chips preferably involves log 2 transformation of all intensity values in order to detect subtle modulations between the various genes. For each gene the geometric mean (i.e. the mean expression value determined for all individual genes in all profiles to be analysed) is calculated. Deviation from this geometric mean is termed differential expression. Genes that are expressed at values allowing assignment of being differentially-expressed are used for hierarchical clustering. Subsequently the gene signatures (characteristic expression profiles) of all samples/patients are compared with each other by means of a Pearson correlation coefficient analysis showing the (pathway) resemblance within clinical distinct groups of the total patient population. The present invention further provides genes that are modulated (up- and down- regulated) in AML compared to the geometric mean calculated from all patients. Such genes and the proteins they encode are useful for diagnostic and prognostic purposes, and may also be used as targets for screening therapeutic compounds that modulate AML, such as antibodies. The methods of detecting nucleic acids of the invention or their encoded proteins can be used for a number of purposes. Examples include early detection of AML, monitoring and early detection of relapse following treatment of AML, monitoring response to therapy of AML, determining prognosis of AML, directing therapy of AML, selecting patients for postoperative chemotherapy or radiation therapy, selecting therapy, determining tumor prognosis, treatment, or response to treatment, and early detection of precancerous condition. Other aspects of the invention will become apparent to the skilled artisan by the following description of the invention. In one aspect, the present invention provides a method of detecting an AML- associated transcript in one or more cells from a patient, the method comprising contacting a biological sample from the patient with a polynucleotide, such as an oligonucleotide, that selectively hybridizes to a sequence at least 80% identical to a sequence of a gene as shown in Tables 1 or 2. In one embodiment, the polynucleotide selectively hybridizes to a sequence at least 95% identical to a sequence of a gene as shown in Tables 1 or 2. In another embodiment, the polynucleotide comprises a sequence of a gene as shown in Tables 1 or 2. In one embodiment, the biological sample used in such methods of detection is a tissue sample. In another embodiment, the biological sample comprises isolated nucleic acids, e.g., mRNA. In one embodiment, the polynucleotide is labeled, e.g., with a fluorescent label. In one embodiment, the polynucleotide is immobilized on a solid surface.
DESCRIPTION OF THE DRAWINGS Figure 1 shows, in panel (A), a Correlation View of 286 AML patients. The Correlation Visualization tool displays pair -wise correlations between the samples. The patient samples in the visualization are colored by Pearson's correlation coefficient values with deeper colors indicating higher positive (red) or negative (blue) correlations, indicating similarity in the underlying pathway indicative for the subgroups reflecting the heterogeneity within the patient population. The scale bar indicates 100% correlation (red) towards 100% anti correlation (blue). In order to reveal correlation patterns, a matrix ordering method is applied to rearrange the samples. The ordering algorithm starts with the most correlated sample pair and, through an iterative process, sorts all the samples into correlated blocks. Each sample is joined to a block in an ordered manner so that a correlation trend is formed within a block with the most correlated samples at the centre. The blocks are then positioned along the diagonal of the plot in a similar ordered manner. Panel (B) of Figure 1 shows an adapted Correlation View of 286 AML patients (right panel) and top40 genes defining the 16 individual clusters of patients (left panel). All 16 clusters identified on th.e basis of the Correlation View are indicated (1 to 16). FAB classification and karyotype based on cytogenetics are depicted in the columns along the original diagonal of the
Correlation View (FAB Ml-green, M2-purple, M3-orange, M4-yellow, M5-blue, M6-grey; karyotype: normal-green, inv(16)-yellow, t(8;21)-purple, t(15;17)- orange, llq23 abnormalities-blue, other-grey). FLT3 ITD, FLT3 TKD, N-RAS, K-RAS and cEBPa mutations and EVI1 overexpression are depicted in the same set of columns (red bar: positive and green bar: negative). The expression levels of the top40 genes identified by Significance Analysis of Microarrays (SAM) analyses of each ofthe 16 clusters are visualized in the left panel. The scale bar indicates 4-fold upregulation (red) towards 4-fold downregulation (green) relative to the geometric mean of all samples. Figure 2 shows the overall survival (panel A), event free survival
(panel B) and relapse rate after CR (panel C) of AML patients in cluster #5 (M4/M5), cluster #9 (inv(16)), cluster #10 (EWl/monosomy 7), cluster #12 (t(15;17)) and cluster #13 (t(8;21)), indicating that expression profiles in acute myeloid leukemia associate with diverse genetic aberrations and have prognostic impact. Figure 3 provides a guideline on how to read the Omniviz Correlation View. The figure shows the Correlation View and FAB classification (right-hand edge of figure) of the cohort of 286 AML patients (2856 probe sets). A total of 16 distinct cluster can be identified on the right edge of the figure. X-axis and Y-axis show the regions of the various clusters 1- 16 from top to bottom and from left to right, respectively. An exemplary correlation between cluster #5 and #16 is indicated by rectangle. Both clusters predominantly consist of AML-M5 (not visible) and correlate. However, they do form separate clusters. Anti-correlation for instance between cluster 5 and cluster #13, which merely contains AML-M2, is indicated by the dashed rectangle. Correlation and anti-correlation between every individual (sub)cluster can be extracted from the Correlation View and (sub)clusters can subsequently be assigned, e.g., cluster #6, #7 and #8 (dotted lines). FAB: M0- bright green, Ml-green, M2-pink, M3-orange, M4-purple, M5-turquoise, M6- yellow (with number). Figures 4-10 provide supporting results of the Pearson's correlation coefficient analyses using Omniviz with different probe subsets. In the Correlation View all 286 patients are plotted against all 286 AML patients. FAB classification and karyotype based on cytogenetics are depicted in the columns along the original diagonal (left-hand edge) ofthe Correlation View (FAB MO-red, Ml-green, M2-purple, M3-orange, M4-yellow, M5-blue, MI6-grey; karyotype: normal-green, inv(16)-yellow, t(8;21)-purple, t(15;17)-orange, llq23 abnormahtiesblue, 7(q) abnormalities -red, +8-pink, complex -black, other-grey). FLT3 ITD, FLT3 TKD, N-i2AS, K-RAS and cEBP α mutations and EVL1 overexpression are depicted in the same set of columns (red bar: positive and green bar: negative). Figure 4: 147 probe; Figure 5: 293 probe sets; Figure 6: 569 probe sets; Figure 7: 984 probe sets; Figure 8: 1692 probe sets; Figure 9: 2856 probe sets; Figure 10: 5071 probe sets. Figure 11 shows the Southern blot analyses AML patients with cryptic inv(16). Southern blot analyses was carried out with a myosine lieavy chain 11 specific probe (NT 010393, 136753-137404 nt) on material of AML (WT, no inv(16)), AML with known inv(16) breakpoint (type A and E) and three patients that clustered with all known AML and inv(16) patients in the Correlation View (Figure 1). Figure 12 shows the Expression oiMYHll as determined by
Affymetrix GeneChip analyses in 286 cases of AML and controls. Expression levels oiMYHll were high in AML patients and inv(16), whereas low levels were detected in the other AML patients, CD34-positive cells and normal bone marrow. Figure 13 shows a snapshot of Correlation View showing the AML-
M3 t(15;17) patients. FAB M2-purple, M3-orange, M4-yellow. Karyotype: normal-green, t(15;17)-orange, other-grey. The AML-M3 t(15;17) patients are divided into two groups, i.e., low white blood cell count (WBC) and FLT3 ITD negative (green bar) versus high WBC/ FLT3 ITD positive (red bar). Karyotype is based on cytogenetics and WBC is depicted as 10 (cells/1). Figure 14 shows the Expression of ETO as determined by Affymetrix GeneChip analyses in 286 cases of AML and controls. Expression levels of ETO were high in AML patients and t(8;21), whereas low levels were detected in the other AML patients, CD34-positive cells and normal bone marrow. DETAILED DESCRIPTION OF THE INVENTION The term "classifying" is used in its art-recognized meaning and thus refers to arranging or ordering items, i.e. gene expression profiles, by classes or categories or dividing them into logically hierarchical classes, subclasses, and sub -subclasses based on the characteristics they have in common and/or that distinguish them. In particular "classifying" refers to assigning, to a class or kind, an unclassified item. A "class" then being a grouping of items, based on one or more characteristics, attributes, properties, qualities, effects, parameters, etc., which they have in common, for the purpose of classifying them according to an established system or scheme. The term "classification scheme" is used in its art-recognized meaning and thus refers to a list of classes arranged according to a set of pre- established principles, for the purpose of organizing items in a collection or into groups based on their similarities and differences. The term "clustering" refers to the activity of collecting, assembling and/or uniting into a cluster or clusters items with the same or similar elements, a "cluster" referring to a group or number of the same or similar items, i.e. gene expression profiles, gathered or occurring closely together based on similarity of characteristics. "Clustered" indicates an item has been subjected to clustering. The term "clustered position" refers to the location of an individual item, i.e. a gene expression profile, in amongst a number of clusters, said location being determined by clustering said item with at least a number of items from known clusters. The process of clustering used in a method of to the present invention may be any mathematical process known to compare items for similarity in characteristics, attributes, properties, qualities, effects, parameters, etc.. Statistical analysis, such as for instance multivariance analysis, or other methods of analysis may be used. Preferably methods of analysis such as self-organising maps, hierarchical clustering, multidimensional scaling, principle component analysis, supervised learning, k-nearest neighbours, support vector machines, discriminant analyse, partial least square methods and/or Pearson's correlation coefficient analysis are used. In another preferred embodiment of a method of the present invention Pearson's correlation coefficient analysis, significance analysis of microarrays (SAM) and/or prediction analysis of microarrays (PAM) are used to cluster gene expression profiles according to similarity. A highly preferred method of clustering comprises similarity clustering of gene expression profiles wherein the expression level of differentially -expressed genes, having markedly lower or higher expression than the geometric mean expression level determined for all genes in all profiles to be clustered, is log(2) transformed, and wherein the transformed expression levels of all differentially-expressed genes in all profiles to be clustered is clustered by using K-means. A numerical query may then be used to select a subset of genes used in the process of hierarchical clustering (Eisen et al., 1998), thus, numerical queries may be run to select differentially expressed genes relative to the calculated geometric mean to select a smaller group of genes for hierarchical clustering. Unsupervised sample clustering using genes obtained by numerical or threshold filtering is used to identify discrete clusters of samples as well as the gene-signatures associated with these clusters. The term gene signatures is used herein to refer to the set of genes that define the discrete position of the cluster apart from all other clusters, and includes cluster-specific genes. A numerical or threshold filtering is used to select genes for the analysis that are most likely of diagnostic relevance. Hierarchical clustering allows for visualization of large variation in gene expression across samples or present in most samples, and these genes could be used for unsupervised clustering so that clustering results are not affected by the noise from absent or non- changed genes. Thus, while, K-means clustering may be performed on all genes, the Pearson correlation is preferably calculated based on a subset of genes and patients. Generally speaking the larger the threshold for accepting a deviation or change from the geometric mean, the smaller the number of genes that is selected by this filtering procedure. Different cut-off or threshold values were used to prepare lists with different numbers of genes. The higher the number of genes selected and included on such fists, the more noise is generally encountered within the dataset, because there will be a relatively large contribution of non- leukemia pathway related genes in such lists. The filtering and selection procedure is preferably optimized such that the analysis is performed on as much genes as possible, while minimizing the noise. All genes with changed expression values higher than or equal to 1.5 times the log(2) transformed expression values and genes with changed expression values lower than or equal to -1.5 times the log(2) transformed expression values are selected for hierarchical clustering. The subset of genes showing a markedly higher or lower expression than the geometric mean may for instance be a value that is more than 1.5 times the geometric mean value, preferably more than 2 times the geometric mean value, even more preferably more than 3 times the geometric mean value. Likewise, a markedly lower expression than the geometric mean expression level may for instance be a value that is less than 0.8 times the geometric mean value, preferably less than 0.6 times the geometric mean value, more preferably less than 0.3 times the geometric mean value. The same selection of genes that is used for the hierarchical clustering, is used for clustering of the patients by Pearson correlation coefficient analysis. Gene expression profiling has previously been demonstrated to be useful in distinguishing myeloid from lymphoid malignancies as well as subclasses within these diseases (Alizadeh et al, 2000; Armstrong et al, 2002; Debernardi et αZ., 2003; Ross et al, 2003; Yeoh; Schoch et al, 2002; Golub et al, 1999), but it was hitherto unknown whether suitable distinctions on the basis of gene expression alone could be made between various types of AML, let alone whether such distinctions could bear any relevance to prognosis of the disease. The present invention now provides several methods to accurately identify known as well as newly discovered diagnostically, prognostically and therapeutically relevant subgroups of acute myeloid leukemia (AML), herein below also addressed as AML classes, as well as methods that can predict which approaches in treatment are likely to be effective. The basis of these methods resides in the measurement of (AML-specific) gene expression in AML-affected subjects. The methods and compositions of the invention thus provide tools useful in choosing a therapy for AML patients, including methods for assigning an AML patient to an AML class or AML cluster, methods of choosing a therapy for an AML patient, methods of determining the efficacy of a therapy in an AML patient, and methods of determining the prognosis for an AML patient. The methods of the invention comprise in various aspects the steps of establishing a gene expression profile of subject samples, for instance of reference subjects affected by AML or of a subject diagnosed or classified for AML. The expression profiles of the present invention are generated from samples from subjects affected by AML, including subjects having AML, subjects suspected of having AML, subjects having a propensity to develop AML, or subjects who have previously had AML, or subjects undergoing therapy for AML. The samples from the subject used to generate the expression profiles of the present invention can be derived from a variety of sources including, but not limited to, single cells, a collection of cells, tissue, cell culture, bone marrow, blood, or other bodily fluids. The tissue or cell source may include a tissue biopsy sample, a cell sorted population, cell culture, or a single cell. Sources for the sample ofthe present invention include cells from peripheral blood or bone marrow, such as blast cells from peripheral blood or bone marrow. In selecting a sample, the percentage of the sample ttiat constitutes cells having differential gene expression in AML classes should be considered. Samples may comprise at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, at least 60 ", at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% cells having differential expression in AML classes, with a preference for samples having a high percentage of such cells. In some embodiments, these cells are blast cells, such as leukeαiic cells. The percentage of a sample that constitutes blast cells may be deteirniined by methods well known in the art; see, for example, the methods described in WO 03/083140. "Gene expression profiling" or "expression profiling" is used herein in its art-recognised meaning and refers to a method for measuring the transcriptional state (mRNA) or the translational state (protein) of a plurality of genes in a cell. Depending on the method used, such measurements may involve the genome-wide assessment of gene expression, but also the measurement of the expression level of selected genes, resulting in the establishment of a "gene expression profile" or "expression profile", which terms are used in that meaning hereinbelow. As used herein, an "expression profile" comprises one or more values corresponding to a measurement of the relative abundance of a gene expression product. Such values may include measurements of RNA levels or protein abundance. Thus, the expression profile can comprise values representing the measurement of tfcie transcriptional state or the translational state of the gene. In relation thereto, reference is made to U.S. Pat. Nos. 6,040,138, 5,800,992, 6,020135, 6,344,316, and 6,033,860. The transcriptional state of a sample includes the identities and relative abundance of the RNA species, especially mRNAs present in the sample. Preferably, a substantial fraction of all constituent RNA species in the sample are measured, but at least a sufficient fraction to chara terize the transcriptional state of the sample is measured. The transcriptional state can be conveniently determined by measuring transcript abundance by any of several existing gene expression technologies. Translational state includes the identities and relative abundance of the constituent protein species in the sample. As is known to those of skill in the art, the transcriptional state and translational state are related. Each value in the expression profiles as determined and embodied in the present invention is a measurement representing the absolute or the relative expression level of a differentially-expressed gene. The expression levels of these genes may be determined by any method known in the art for assessing the expression level of an RNA or protein molecule in a sample. For example, expression levels of RNA may be monitored using a membrane blot (such as used in hybridization analysis such as Northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Patent Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, to which explicit reference is made. The gene expression monitoring system may also comprise nucleic acid probes in solution. In one embodiment of the invention, microarrays are used to measure the values to be included in the expression profiles. Microarrays are particularly well suited for this purpose because of the reproducibility between different experiments. DNA microarrays provide one method for the simultaneous measurement of the expression levels of large numbers of genes. Each array consists of a reproducible pattern of capture probes attached to a solid support. Labeled RNA or DNA is hybridized to complementary probes on the array and then detected by laser scanning. Hybridization intensities for each probe on the array are determined and converted to a quantitative value representing relative gene expression levels. See, the Experimental section. See also, U.S. Pat. Nos. 6,040,138, 5,800,992 and 6,020,135, 6,033,860, and 6,344,316, to which explicit reference is made. High-density oligonucleotide arrays are particularly useful for determining the gene expression profile for a large number of RNAs in a sample. In one approach, total mRNA isolated from the sample is converted to labeled cRNA and then hybridized to an oligonucleotide array. Each sample is hybridized to a separate array. Relative transcript levels are calculated by reference to appropriate controls present on the array and in the sample. See, for example, the Experimental section. In another embodiment, the values in the expression profile are obtained by measuring the abundance of the protein products of the differentiall -expressed genes. The abundance of these protein products can be determined, for example, using antibodies specific for the protein products of the differentially -expressed genes. The term "antibody" as used herein refers to an immunoglobulin molecule or immunologically active portion thereof, i.e., an antigen-binding portion. Examples of immunologically active portions of immunoglobulin molecules include F(ab) and F(ab')2 fragments which can be generated by treating the antibody with an enzyme such as pepsin. The antibody can be a polyclonal, monoclonal, recombinant, e.g., a chimeric or humanized, fully human, non-human, e.g., murine, or single chain antibody. In a preferred embodiment it has effector function and can fix complement. The antibody can be coupled to a toxin or imaging agent. A full-length protein product from a differentially-expressed gene, or an antigenic peptide fragment of the protein product can be used as an immunogen. Preferred epitopes encompassed by the antigenic peptide are regions of the protein product of the differentially-expressed gene that are located on the surface of the protein, e.g., hydrophilic regions, as well as regions with high antigenicity. The antibody can be used to detect the protein product of the differentially- expressed gene in order to evaluate the abundance and pattern of expression of the protein. These antibodies can also be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, e.g., to, for example, determine the efficacy of a given therapy. Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance (i.e., antibody labeling). Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, (3- galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125I, 131I, 35S or 3H. Once the values comprised in the subject expression profile and the reference expression profile or expression profiles are established, the subject profile is compared to the reference profile to determine whether the subject expression profile is sufficiently similar to the reference profile. Alternatively, the subject expression profile is compared to a plurality of reference expression profiles to select the reference expression profile that is most similar to the subject expression profile. Any method known in the art for comparing two or more data sets to detect similarity between them may be used to compare the subject expression profile to the reference expression profiles. In some embodiments, the subject expression profile and the reference profile are compared using a supervised learning algorithm such as the support vector machine (SVM) algorithm, prediction by collective likelihood of emerging patterns (PCL) algorithm, the k-nearest neighbour algorithm, or the Artificial Neural Network algorithm. To determine whether a subject expression profile shows "statistically significant similarity" or "sufficient similarity" to a reference profile, statistical tests may be performed to determine whether the similarity between the subject expression profile and the reference expression profile is likely to have been achieved by a random event. Any statistical test that can calculate the likelihood that the similarity between the subject expression profile and the reference profile results from a random event can be used. The accuracy of assigning a subject to an AML class based on similarity between differentially-expressed genes is affected largely by the heterogeneity within the patient population, as is reflected by the deviation from the geometric mean. Therefore, when more accurate diagnoses are required, the stringency in evaluating the similarity between the subject and the reference profile should be increased by changing the numerical query. The method used for comparing a subject expression profile to one or more reference profiles is preferably carried out by re-running the subsequent analyses in a (n+1) modus by performing clustering methods as described herein. Also, in order to identify the AML class reference profile that is most similar to the subject expression profile, as performed in the methods for establishing the AML class of an AML affected subject, i.e. by diagnosing AML in a subject or by classifying the AML in a subject, profiles are clustered according to similarity and it is determined whether the subject profile corresponds to a known class of reference profiles. In assigning a subject AML to a specific AML class for instance, this method is used wherein the clustered position of the subject profile, obtained after performing the clustering analysis of the present invention, is compared to any known AML class. If the clustered position of the subject profile is within a cluster of reference profiles, i.e. forms a cluster therewith after performing the similarity clustering method, it is said that the AML of the subject corresponds to the AML class of reference profiles. If a subject profile is not within a cluster of reference profiles, i.e. does not form a cluster therewith after performing the similarity clustering method, then a new AML class may be assigned to that subject profile, one of such classes being subjects not having AML. In some embodiments ofthe present invention, the expression profiles comprise values representing the expression levels of genes that are differentially -expressed in AML classes. The term "differentially-expressed" as used herein means that the measured expression level of a particular gene in the expression profile of one subject differs at least n-fold from the geometric mean calculated from all patient profiles. The expression level may be also be up-regulated or down-regulated in a sample from a subject having a particular form of AML in comparison with a sample from a subject having a different form of AML. For example, in one embodiment, the differentially-expressed genes of the present invention may be expressed at different levels in different AML classes. Examples of genes that are differentially-expressed in the various AML classes are shown in Tables 1 and 2. It should be noted that many genes will occur, of which the measured expression level differs at least n-fold from the geometric mean expression level for that gene of all reference profiles. This may for instance be due to the different physiological state of the measured cells, to biological variation or to the present of other diseased states. Therefore, the presence of a differentially-expressed gene is not necessarily informative for determining the presence of different AML classes, nor is every differentially-expressed gene suitable for performing diagnostic tests. Moreover, a cluster-specific differential gene expression, as defined herein, is most likely to be informative only in a test among subjects having AML. Therefore, a diagnostic test performed by using cluster-specific gene detection should preferably be performed on a subject in which the presence of AML is confirmed. This confirmation may for instance be obtained by performing the method for classifying an AML in an AML-affected subject according to the present invention, or by any other test. The present invention provides groups of genes that are differentially -expressed in diagnostic AML samples of patients in different AML classes. Some of these genes were identified based on gene expression levels for 13,000 probes in 286 AML samples. Values representing the expression levels of the nucleic acid molecules detected by the probes were analyzed as described in the Experimental section using Omniviz, SAM and PAM analysis tools. Omniviz software was used to perform all clustering steps such as K-means, Hierarchical and Pearson correlation tests. SAM was used specifically to identify the genes underlying the clinically relevant groups identified in the Pearson correlation analysis. PAM is used to decide the minimum number of genes necessary to diagnose all individual patients within the given groups of the Pearson correlation. In short, expression profiling was carried out on AML blasts from 286 de novo AML patients. Unsupervised clustering was used to identify novel (sub)groups within the Pearson correlation following the hierarchical clustering. The Pearson correlation test resulted in the identification of 16 groups or classes of AML patients with distinct molecular signatures. The hierarchical clustering and Pearson correlation allow the detection of the genetic heterogeneity (16 clusters). This may provide for a mechanistic signature of AML. After running the SAM and PAM analysis the diagnostic gene -signatures (incl. cluster-specific genes) were obtained. While several ofthe molecularly assigned classes correspond to the well-defined AML subgroups with favourable cytogenetics, such as the well recognised genetic lesions AMLl/ETO, PML/RARa and CBFβ/MYHll, we identified several additional distinct classes of patients that were not identified as distinct classes of AML before. For instance, new identified AML clusters comprised genetic lesions such as CEBPa mutations, or FLT3 ITD mutations, or Hq23 aberrations, indicating that these cytogenetic markers alone are not sufficient to determine the prognosis of an AML patient or the most optimal intervention strategy (drug treatment). Whereas the well-defined AML subgroups AMLl/ETO, PML/RARa and CBFβ/MYHll, could be identified based on measurement of the expression level of only one or two genes in a cell sample, many o the newly discovered AML classes were defined on the basis of differential expression of a plurality of genes. Genes that define an AML class are hereinafter also termed cluster-specific genes or signature genes. Prediction Analysis of Microarrays (PAM) was applied to determine the minimal gene sets that predict these prognostically important clusters with high accuracy. In one of the novel clusters half of the AML patients had unfavourable markers, such as elevated expression oiEVIl and/or loss of chromosome 7(q). Interestingly, more then 90 percent of patients in this cluster (cluster no. 10, see Example) responded poorly to therapy. The fact that a distinct gene expression signature defines this class of AML patients, suggests the existence of a currently unknown gene- or pathway defect that corresponds with poor treatment outcome. The present invention thus provides a method of classifying AML. Using this method, a total of 286 AML samples analysed on a DNA microarray consisting of 22283 probe sets, representing approximately 13,000 genes could be classified into at least 16 distinct clusters. These 16 distinct clusters of AML patients were assigned on the basis of strong correlation between their individual differential expression profiles for 2856 probe sets (Table 1; Figure 1). The methods used to analyze the expression level values to identify differentiall -expressed genes were employed such that optimal results in clustering, i.e. unsupervised ordering, were obtained. This then resulting in the definition of the 16 clusters of reference profiles based on molecular signature. The genes that defined the position or clustering of these 16 individual clusters could be determined and the minimal sets of genes required to accurately predict the prognostically important AML classes corresponding to these clusters could be derived. It should be understood that the method for classifying AML according to the present invention may result in a distinct clustering pattern and therefore in a different classification scheme when other (numbers of) subjects are used as reference, or when other types of oligonucleotide microarrays for establishing gene expression profiles are used. The present invention thus provides a comprehensive classification of AML covering various previously identified genetically defined classes. Further analysis of classes by prediction analysis of microarrays (PAM) to determine the minimum number of genes that defined or predicted these prognostically important classes resulted in the establishment of cluster- specific genes or signature genes. The presence of distinct gene expression profiles defining the novel classes suggests the presence of yet unknown common gene defects or pathway defects among AML cases in those classes. Several classes could be distinguished on the basis of the expression level of a single gene, whereas others could only be distinguished on the basis of 20 or more differentially-expressed genes (Table 3). The methods of the present invention comprise in some aspects the step of defining cluster-specific genes by selecting those genes of which the expression level characterizes the clustered position of the corresponding AML class among the various AML classes within a classification scheme of the present invention. Such cluster-specific genes are selected preferably on the basis of PAM analysis. This method of selection comprises the following. PAM, or partition round medoids, is one of the k-medoids methods. Different from usual k-means approach, it also accepts a dissimilarity matrix, and it is more robust because it minimizes a sum of dissimilarities instead of a sum of squared Euclidean distances. The PAM-algorithm is based on the search for 'k' representative objects or medoids among the observations of the dataset, which should represent the structure of the data. After finding a set of 'k' medoids, 'k' clusters are constructed by assigning each observation to the nearest medoid. The goal is to find 'k' representative objects which minimize the sum of the dissimilarities of the observations to their closest representative object. The distance metric to be used for calculating dissimilarities between observations are "euclidean" and "manhattan". Euclidean distances are root sum-of-squares of differences, and manhattan distances are the sum of absolute differences. PAM calculates how many genes are necessary to identify all members (patients) belonging to a certain cluster. The methods of the present invention comprise in some aspects the step of establishing whether the level of expression of cluster-specific genes in a subject shares sufficient similarity to the level of expression that is characteristic for an individual AML class. This step is necessary in determining the presence of that particular AML class in a subject under investigation, in which case the expression of that gene is used as a disease marker. Whether the level of expression of cluster-specific genes in a subject shares sufficient similarity to the level of expression of that particular gene in an individual AML class may for instance be determined by setting a threshold value. The present invention also reveals genes with a high differential level of expression in specific AML classes compared the geometric mean of all reference subjects. These highly differentially-expressed genes are selected from the genes shown in Table 2. These genes and their expression products are useful as markers to detect the presence of AML in a patient. Antibodies or other reagents or tools may be used to detect the presence of these markers of AML. The present invention also reveals gene expression profiles comprising values representing the expression levels of genes in the various identified AML classes. In a preferred embodiment, these expression profiles comprise the values representing the differential expression levels. Thus, in one embodiment the expression profiles ofthe invention comprise one or more values representing the expression level of a gene having differential expression in a defined AML class. Each expression profile contains a sufficient number of values such that the profile can be used to distinguish one AML class from another. In some embodiments, the expression profiles comprise only one value. For example, it can be determined whether a subject affected by AML is in the AML class defined by cluster # 9 (inv(16)) based only on the expression level of MYH11 201497_x_at (see Tables 2 and 31). Similarly, it can be determined whether a subject affected by AML is in the AML class defined by cluster # 12 (t(15,17)) based only on the expression level of the cDNA of 2 genes FGF13 205110_s_at and HGF 210997_at and 210998_s_at (see Tables 2 and 34). In this case, the expression profile comprises two values corresponding to two differentially-expressed genes. In other embodiments, the expression profile comprises more than one or two values corresponding to a differentially-expressed gene, for example at least 3 values, at least 4 values, at least 5 values, at least 6 values, at least 7 values, at least 8 values, at least 9 values, at least 10 values, at least 11 values, at least 12 values, at least 13 values, at least 14 values, at least 15 values, at least 16 values, at least 17 values, at least 18 values, at least 19 values, at least 20 values, at least 22 values, at least 25 values, at least 27 values, at least 30 values, at least 35 values , at least 40 values, at least 45 values, at least 50 values, at least 75 values, at least 100 values, at least 125 values, at least 150 values, at least 175 values, at least 200 values, at least 250 values, at least 300 values, at least 400 values, at least 500 values, at least 600 values, at least 700 values, at least 800 values, at least 900 values, at least 1000 values, at least 1200 values, at least 1500 values, or at least 2000 or more values. It is recognized that the diagnostic accuracy of assigning a subject to an AML class will vary based on the number of values contained in the expression profile. Generally, the number of values contained in the expression profile is selected such that the diagnostic accuracy is at least 85%, at least 87%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, as calculated using methods described elsewhere herein, with an obvious preference for higher percentages of diagnostic accuracy. It is recognized that the diagnostic accuracy of assigning a subject to an AML class will vary based on the strength of the correlation between the expression levels of the differentially-expressed genes within that specific AML class. When the values in the expression profiles represent the expression levels of genes whose expression is strongly correlated with that specific AML class, it may be possible to use fewer number of values (genes) in the expression profile and still obtain an acceptable level of diagnostic or prognostic accuracy. The strength of the correlation between the expression level of a differentially -expressed gene and a specific AML class may be determined by a statistical test of significance. For example, the chi square test used to select genes in some embodiments ofthe present invention assigns a chi square value to each differentially-expressed gene, indicating the strength of the correlation of the expression of that gene to a specific AML class. Similarly, the T-statistics metric and the Wilkins' metric both provide a value or score indicative of the strength ofthe correlation between the expression of the gene and its specific AML class. These scores may be used to select the genes of which the expression levels have the greatest correlation with a particular AML class to increase the diagnostic or prognostic accuracy o the methods of the invention, or in order to reduce the number of values contained in the expression profile while maintaining the diagnostic or prognostic accuracy of the expression profile. Preferably, a database is kept wherein the expression profiles of reference subjects are collected and to which database new profiles can be added and clustered with the already existing profiles such as to provide the clustered position of said new profile among the already present reference profiles. Furthermore, the addition of new profiles to the database will improve the diagnostic and prognostic accuracy of the methods of the invention. Preferably, in a method of the present invention SAM or PAM analysis tools are used to determine the strength of such correlations. The methods ofthe invention comprise the steps of providing an expression profile from a sample from a subject affected by AML and comparing this subject expression profile to one or more reference profiles that are associated with a particular AML class, a class with a known prognosis, or a class with a favourable response to therapy. By identifying the AML class reference profile that is most similar to the subject expression profile, e.g. when their clustered positions fall together, the subject can be assigned to an AML class. The AML class assigned is that with which the reference profile(s) are associated. Similarly, the prognosis of a subject affected by AML can be predicted by determining whether the expression profile from the subject is sufficiently similar to a reference profile associated with an established prognosis, such as a good prognosis or a bad prognosis. Whenever a subject's expression profile can be assigned to an established AML class, a preferred intervention strategy, or therapeutic treatment can then be proposed for said subject, and said subject can be treated according to said assigned strategy. As a result, treatment of a subject with AML can be optimized according to the specific class of AML with which the subject is affected. For instance, the AML class belonging to cluster # 12, characterized by the presence of t(15,17), may be treated with retinoic acid. Within one class or cluster, further division may be made according to responders and non-responders to treatment or therapy. Such divisions may provide for further detailed characterisation of AML subjects. In another embodiment, the subject expression profile is from a subject affected by AML who is undergoing a therapy to treat the AML. The subject expression profile is compared to one or more reference expression profiles to monitor the efficacy of the therapy. In some embodiments, the assignment of a subject affected by AML to an AML class is used in a method of choosing a therapy for the subject affected by AML. A therapy, as used herein, refers to a course of treatment intended to reduce or eliminate the affects or symptoms of a disease, in this case AML. A therapy regime will typically comprise, but is not limited to, a prescribed dosage of one or more drugs or hematopoietic stem cell transplantation. Therapies, ideally, will be beneficial and reduce the disease state but in many instances the effect of a therapy will have non-desirable effects as well. In one aspect, the present invention provides a method of determining the prognosis for an AML affected subject, said method comprising the steps of providing a classification scheme for AML by producing such a scheme according to a method of the invention and determining the prognosis for each AML class in said scheme based on clinical records for the AML subjects comprised in said class. In order to predict the progression of the disease in a subject, one has to rely on clinical records. The present invention provides for the assignment o the various clinical data recorded with reference subjects affected by AML to the various AML classes as defined herein. This assignment preferably occurs in a database. This has the advantage that once a new subject is identified as belonging to a particular AML class, either by performing a specific AML diagnostic method of the invention using the cluster-specific genes as disease markers or by performing a method of classifying an AML in an AML affected subject according to the invention, then the prognosis that is assigned to that class may be assigned to that subject. The present invention provides compositions that are useful in determining the gene expression profile for a subject affected by AML and selecting a reference profile that is similar to the subject expression profile. These compositions include arrays comprising a substrate having capture probes that can bind specifically to nucleic acid molecules that are differentially-expressed in AML classes. Also provided is a computer-readable medium having digitally encoded reference profiles useful in the methods of the claimed invention. The present invention provides arrays comprising capture probes for detection of polynucleotides (transcriptional state) or for detection of proteins (translational state) in order to detect differentially-expressed genes of the invention. By "array" is intended a solid support or substrate with peptide or nucleic acid probes attached to said support or substrate. Arrays typically comprise a plurality of different nucleic acid or peptide capture probes that are coupled to a surface of a substrate in different, known locations. These arrays, also described as "microarrays" or colloquially "chips" have been generally described in the art, and reference is made U.S. Patent. Nos. 5,143,854, 5,445,934, 5,744,305, 5,677,195, 6,040,193, 5,424,186,6,329,143, and 6,309,831 and Fodor et al (1991) Science 251:767-77. These arrays may generally be produced using mechanical synthesis methods or light directed synthesis methods which incorporate a combination of photolithographic methods and solid phase synthesis methods. Typically, "oligonucleotide microarrays" will be used for determining the transcriptional state, whereas "peptide microarrays" will be used for determining the translational state of a cell. "Nucleic acid" or "oligonucleotide" or "polynucleotide" or grammatical equivalents used herein means at least two nucleotides covalently linked together. Oligonucleotides are typically from about 5, 6, 7, 8, 9, 10, 12, 15, 25, 30, 40, 50 or more nucleotides in length, up to about 100 nucleotides in length. Nucleic acids and polynucleotides are a polymers of any length, including longer lengths, e.g., 200, 300, 500, 1O00, 2000, 3000, 5000, 7000, 10,000, etc. A nucleic acid ofthe present invention will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have alternate backbones, comprising, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O- methylphophoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press); and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones, including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, Carbohydrate Modifications in Antisense Research, Sanghui & Cook, eds. Nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids. Modifications of the ribose-phosphate backbone may be done for a variety of reasons, e.g. to increase the stability and half-life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made. Particularly preferred are peptide nucleic acids (PNA) which includes peptide nucleic acid analogs. These backbones are substantially non- ionic under neutral conditions, in contrast to the highly charged phosphodiester backbone of naturally occurring nucleic acids. This results in two advantages. First, the PNA backbone exhibits improved hybridization kinetics. PNAs have larger changes in the melting temperature (Tm) for mismatched versus perfectly matched basepairs. DNA and RNA typically exhibit a 2-4 °C drop in Tm for an internal mismatch. With the non-ionic PNA backbone, the drop is closer to 7-9°C. Similarly, due to their non-ionic nature, hybridization of the bases attached to these backbones is relatively insensitive to salt concentration. In addition, PNAs are not degraded by cellular enzymes, and thus can be more stable. The nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence. As will be appreciated by those in the art, the depiction of a single strand also defines the sequence of the complementary strand; thus the sequences described herein also provide the complement ofthe sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc. "Transcript" typically refers to a naturally occurring RNA, e.g., a pre-mRNA, hnRNA, or mRNA. As used herein, the term "nucleoside" includes nucleotides and nucleoside and nucleotide analogs, and modified nucleosides such as amino modified nucleosides. In addition, "nucleoside" includes non- naturally occurring analog structures. Thus, e.g. the individual units of a peptide nucleic acid, each containing a base, are referred to herein as a nucleoside. As used herein a "nucleic acid probe or oligonucleotide" is defined as a nucleic acid capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. As used herein, a probe may include natural (i.e., A, G, C, or T) or modified bases (7-deazaguanosine, inosine, etc.). In addition, the bases in a probe may be joined by a linkage other than a phosphodiester bond, so long as it does not functionally interfere with hybridization. Thus, e.g., probes may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages. It will be understood by one of skill in the art that probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. The probes are preferably directly labeled such as with isotopes, chromophores, lumiphores, chromogens, or indirectly labeled such as with biotin to which a streptavidin complex may later bind or with enzymatic labels. By assaying for the hybridization of the probe to its target nucleic acid sequence, one can detect the presence or absence of the select sequence or subsequence. Diagnosis or prognosis may be based at the genomic level, or at the level of RNA or protein expression. The skilled person is capable of designing oligonucleotide probes that can be used in diagnostic methods of the present invention. Preferably, such probes are immobilised on a solid surface as to form an oligonucleotide microarray of the invention. The oligonucleotide probes useful in methods of the present invention are capable of hybridizing under stringent conditions to AML-associated nucleic acids, such as to one or more ofthe genes selected from Table 1, preferably to one or more of the genes selected from Table 2, more preferably to one or more of the genes selected from Table 3. Techniques for the synthesis of arrays using mechanical synthesis methods are described in, e.g., U.S. Patent No. 5,384,261, to which reference is made herein. Although a planar array surface is preferred, the array may be fabricated on a surface of virtually any shape or even a multiplicity of surfaces. Arrays may be peptides or nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate, for the purpose of which reference is made to U.S. Pat. Nos. 5,770,358, 5,789, 162, 5,708,153, 6,040,193 and 5,800,992. Arrays may be packaged in such a manner as to allow for diagnostics or other manipulation of an all-inclusive device. Reference is for example made to U.S. Pat. Nos. 5,856,174 and 5,922,591. The arrays provided by the present invention comprise capture probes that can specifically bind a nucleic acid molecule that is differentially - expressed in AML classes. These arrays can be used to measure the expression levels of nucleic acid molecules to thereby create an expression profile for use in methods of determining the diagnosis and prognosis for AML patients, and for monitoring the efficacy of a therapy in these patients as described elsewhere herein. In some embodiments, each capture probe in the array detects a nucleic acid molecule selected from the nucleic acid molecules designated in Tables 1 and 2. The designated nucleic acid molecules include those differentially-expressed in AML classes selected from cluster #l-cluster #16 as depicted in figure 1. The arrays of the invention comprise a substrate having a plurality of addresses, where each address has a capture probe that can specifically bind a target nucleic acid molecule. The number of addresses on the substrate varies with the purpose for which the array is intended. The arrays may be low-density arrays or high-density arrays and may contain 4 or more, 8 or more, 12 or more, 16 or more, 20 or more, 24 or more, 32 or more, 48 or more, 64 or more, 72 or more 80 or more, 96, or more addresses, or 192 or more, 288 or more, 384 or more, 768 or more, 1536 or more, 3072 or more, 6144 or more, 9216 or more, 12288 or more, 15360 or more, or 18432 or more addresses. In some embodiments, the substrate has no more than 12, 24, 48, 96, or 192, or 384 addresses, no more than 500, 600, 700, 800, or 900 addresses, or no more than 1000, 1200, 1600, 2400, or 3600 addresses. The invention also provides a computer-readable medium comprising one or more digitally encoded expression profiles, where each profile has one or more values representing the expression of a gene that is differentially -expressed in an AML class. The preparation and use of such profiles is well within the reach of the skilled person (see e.g. WO 03/083140). In some embodiments, the digitally-encoded expression profiles are comprised in a database. See, for example, U.S. Patent No. 6,308,170. The present invention also provides kits useful for diagnosing, treating, and monitoring the disease state in subjects affected by AML. These kits comprise an array and a computer readable medium. The array comprises a substrate having addresses, where each address has a capture probe that can specifically bind a nucleic acid molecule (by using an oligonucleotide array) or a peptide (by using a peptide array) that is differentially -expressed in at least one AML class. The results are converted into a computer-readable medium that has digitally-encoded expression profiles containing values representing the expression level of a nucleic acid molecule detected by the array. By using the array described above, the amounts of various kinds of nucleic acid molecules contained in a nucleic acid sample can be simultaneously determined. In addition, there is an advantage such that the determination can be carried out even with a small amount of the nucleic acid sample. For instance, mRNA in the sample is labeled, or labeled cDNA is prepared by using mRNA as a template, and the labeled mRNA or cDNA is subjected to hybridization with the array, so that mRNAs being expressed in the sample are simultaneously detected, whereby their expression levels can be determined. Genes each of which expression is altered due to AML can be found by determining expression levels of various genes in the AML affected cells and classified into certain types as described above and comparing the expression levels with the expression level in a control tissue. The method for determining the expression levels of genes is not particularly limited, and any of techniques for confirming alterations of the gene expressions mentioned above can be suitably used. Among all, the method using the array is especially preferable because the expressions of a large number of genes can be simultaneously determined. Suitable arrays are commercially available, e.g., from Affymetrix. For instance, mRNA is prepared from blast cells, and then reverse transcription is carried out with the resulting mRNA as a template. During this process, labeled cDNA can be obtained by using, for instance, any suitable labeled primers or labeled nucleotides. As to the labeling substance used for labeling, there can be used substances such as radioisotopes, fluorescent substances, chemiluminescent substances and substances with fluophor, and the like. For instance, the fluorescent substance includes Cy2, FluorX, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, fluorescein isothiocyanate (FITC), Texas Red, Rhodamine and the like. In addition, it is desired that samples to be tested (cancer samples to be tested in the present selection method) and a sample to be used as a control are each labeled with different fluorescent substances, using two or more fluorescent substances, from the viewpoint of enabling simultaneous detection. Here, labeling ofthe samples is carried out by labeling mRNA in the samples, cDNA derived from the mRNA, or nucleic acids produced by transcription or amplification from cDNA. Next, the hybridization is carried out between the above-mentioned labeled cDNA and the array to which a nucleic acid corresponding to a suitable gene or its fragment is immobilized. The hybridization may be performed according to any known processes under conditions that are appropriate for the array and the labeled cDNA to be used. For instance, the hybridization can be performed under the conditions described in Molecular Cloning, A laboratory manual, 2nd ed., 9.52-9.55 (1989). The hybridization between the nucleic acids derived from the samples and the array is carried out, under the above-mentioned hybridization conditions. When much time is needed for the time period required for procedures from the collection of samples to the determination of expression levels of genes, the degradation of mRNA may take place due to actions of ribonuclease. In order to determine the difference in the gene expressions in the samples to be tested (i.e., cell or tissue samples of AML patients) and the gene expressions in a control sample, it is preferable that the mRNA levels in both of these samples are adjusted using a standard gene with relatively little alterations in expressions. Thereafter, by comparing the hybridization results ofthe samples to be tested with those of the control sample, genes exhibiting differential expression levels in both samples can be detected. Concretely, a signal which is appropriate depending upon the method of labeling used is detected for the array which is subjected to hybridization with the nucleic acid sample labeled by the method as described above, whereby the expression levels in the samples to be tested can be compared with the expression level in the control sample for each of the genes on the array. The genes thus obtained which have a significant difference in signal intensities are genes each of which expression is altered specifically for certain AML classes. The present invention also provides a computer-readable medium comprising a plurality of digitally-encoded expression profiles wherein each profile of the plurality has a plurality of values, each value representing the expression of a gene that is differentially-expressed in at least one AML class. The invention also provides for the storage and retrieval of a collection of data relating to AML specific gene expression data of the present invention, including sequences and expression levels in a computer data storage apparatus, which can include magnetic disks, optical disks, magneto-optical disks, DRAM, SRAM, SGRAM, SDRAM, RDRAM, DDR RAM, magnetic bubble memory devices, and other data storage devices, including CPU registers and on-CPU data storage arrays. Typically, the data records are stored as a bit pattern in an array of magnetic domains on a magnetizable medium or as an array of charge states or transistor gate states, such as an array of cells in a DRAM device (e.g., each cell comprised of a transistor and a charge storage area, which may be on the transistor). For use in diagnostic, research, and therapeutic applications suggested above, kits are also provided by the invention. In the diagnostic and research applications such kits may include any or all ofthe following: assay reagents, buffers, AML class-specific nucleic acids or antibodies, hybridization probes and/or primers, antisense polynucleotides, ribozymes, dominant negative AML polypeptides or polynucleotides, small molecules inhibitors of AML-associated sequences, arrays, antibodies, Fab fragments, capture peptides etc. In addition, the kits may include instructional materials containing directions (i.e., protocols) for the practice of the methods of this invention. While the instructional materials typically comprise written or printed materials, they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention. Such media include, but are not limited to electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. Such media may include addresses to internet sites that provide such instructional materials. One such internet site may provide a database of AML reference expression profiles useful for performing similarity clustering of a newly determine subject expression profiles with a large set of reference profiles of AML subjects comprised in said database. Preferably the database includes clinically relevant data such as patient prognosis, successful methods of treatment and cytogenetic characteristics for the various AML classes in the database. The invention encompasses for instance kits comprising an array of the invention and a computer-readable medium having digitally-encoded reference profiles with values representing the expression of nucleic acid molecules detected by the arrays. These kits are useful for assigning a subject affected by AML to an AML class and for diagnosing AML in a subject. The present invention also provides for kits for screening for modulators of AML-associated sequences. Such kits can be prepared from readily available materials and reagents. For example, such kits can comprise one or more of the following materials: an AML-associated polypeptide or polynucleotide, reaction tubes, and instructions for testing AML-associated activity. Optionally the kit may comprise an array for detecting AML- associated genes, specifically cluster-defining genes according to the invention. A wide variety of kits and components can be prepared according to the present invention, depending upon the intended user of the kit and the particular needs of the user. Diagnosis would typically involve evaluation of a plurality of genes or products. The genes will be selected based on correlations with important parameters in disease which may be identified in historical or outcome data. In a preferred embodiment a kit-of-parts according to the invention comprises an oligonucleotide microarray according to the invention and means for comparing a gene expression profile determined by using said microarray with a database of AML reference expression profiles. The present invention also comprises kits of parts suitable for performing a method of the invention as well as the use of the various products of the invention, including databases, microarrays, oligonucleotide probes and classification schemes in diagnostic or prognostic methods of the invention. The methods and compositions of the invention may be used to screen test compounds to identify therapeutic compounds useful for the treatment of AML. In one embodiment, the test compounds are screened in a sample comprising primary cells or a cell line representative of a particular AML class. After treatment with the test compound, the expression levels in the sample of one or more of the differentially-expressed genes of the invention are measured using methods described elsewhere herein. Values representing the expression levels of the differentially -expressed genes are used to generate a subject expression profile. This subject expression profile is then compared to a reference profile associated with the AML class represented by the sample to determine the similarity between the subject expression profile and the reference expression profile. Differences between the subject expression profile and the reference expression profile may be used to determine whether the test compound has anti-leukemogenic activity. The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Res. 12:145). Examples of methods for the synthesis of molecular libraries can be found in the art, for example in DeWitt et al (1993) Proc. Nad. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al. (1994) J. Med. Chem. 37:2678; Cho et al. (1993) Science 261:1303; Carell et al (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and in Gallop et al (1994) J. Med. Chem.
37:1233. Libraries of compounds may be presented in solution (e.g., Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (U.S. Patent No. 5,223,409), spores (U.S. Patent No. 5,223,409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89:1865-1869) or on phage (Scott and Smith (1990) Science 249:386-390; Devlin (1990) Science 249:404-406; Cwirla et al (1990) Proc. Nad. Acad. Sci. U.S.A. 97:6378-6382; Felici (1991) J. Mol. Biol. 222:301-310). Candidate compounds include, for example, 1) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e.g., Lam et al. (1991) Nature 354:82-84; Houghten et al. (1991) Nature 354:84-86) and combinatorial chemistry-derived molecular libraries made of D- and/or L- configuration amino acids; 2) phosphopeptides (e.g., members of random and partially degenerate, directed phosphopeptide libraries, see, e.g., Songyang et al. (1993) Cell 72:767-778); 3) antibodies (e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies as well as Fab, F(ab')Z, Fab expression library fragments, and epitope binding fragments of antibodies); 4) small organic and inorganic molecules (e.g., molecules obtained from combinatorial and natural product libraries; 5) zinc analogs; 6) leukotriene A4 and derivatives; 7) classical aminopeptidase inhibitors and derivatives of such inhibitors, such as bestatin and arphamenine A and B and derivatives; 8) and artificial peptide substrates and other substrates, such as those disclosed herein above and derivatives thereof. The present invention discloses a number of genes that are differentially-expressed in AML classes. These differentially-expressed genes are shown in Tables 1 and 2. Because the expression of these genes is associated with AML risk factors, these genes may play a role in leukemogenesis. Accordingly, these genes and their gene products are potential therapeutic targets that are useful in methods of screening test compounds to identify therapeutic compounds for the treatment of AML. Genes that are common between a number of AML classes are preferred as targets for therapeutic treatment, since a broader working over the patient population can be expected. It is very likely that genes that are present in more than one AML class, as defined in the present invention, are involved in general processes underlying AML. Thus, the expression of these genes is likely to be associated with AML risk factors and thus play a role in leukemogenesis. Genes that are present in several classes or clusters may thus define superclusters, which superclusters may define the processes that play an important role in leukemogenesis in general, and AML in particular. The differentially-expressed genes of the invention may be used in cell-based screening assays involving recombinant host cells expressing the differentially-expressed gene product. The recombinant host cells are then screened to identify compounds that can activate the product of the differentially-expressed gene (i.e. agonists) or inactivate the product of the differentially-expressed gene (i.e. antagonists). Any of the leukemogenic functions mediated by the product ofthe differentially-expressed gene may be used as an endpoint in the screening assay for identifying therapeutic compounds for the treatment of AML. Such endpoint assays include assays for cell proliferation, assays for modulation of the cell cycle, assays for the expression of markers indicative of AML, and assays for the expression level of genes differentially-expressed in AML classes as described above. Modulators of the activity of a product of a differentially- expressed gene identified according to these drug-screening assays provided above can be used to treat a subject with AML. These methods of treatment include the steps of administering the modulators of the activity of a product of a differentially-expressed gene in a pharmaceutical composition as described herein, to a subject in need of such treatment. The following examples are offered by way of illustration and not by way of limitation. EXAMPLE 1
Methods Used
Patients and cell samples Patients with a confirmed diagnosis of de novo AML were included in this study (Table 4). All patients were treated according to the HO VON (Dutch-Belgian Hematology-Oncology Co-operative group) protocols (http://www.hovon.nl). The treatment protocols have been described previously Rombouts et al., 2001). Bone marrow or peripheral blood aspirations of AML patients at diagnosis (n=286) and healthy volunteers (n=5) were taken after informed consent. Blasts and mononuclear cells were purified by Ficoll- Hypaque (Nygaard, Oslo, Norway) centrifugation and cryopreserved. CD34 positive cells of healthy volunteers (n=3) were sorted using the fluorescent activated cell sorter (FACS). According to cytological analysis the AML samples contained 80-100% blast cells after thawing independent of the blast count at diagnosis.
RNA isolation and quality control After thawing, cells were washed once with Hanks balanced salt solution. High quality total RNA was extracted by lyses with guanidinium isothiocyanate followed by cesium chloride gradient purification (Chomczynski & Sacchi, 1987). RNA concentration, quality and purity were examined using the RNA 6000 Nano assay on the Agilent 2100 Bioanalyzer (Agilent, Amstelveen, The Netherlands). None of the samples showed RNA degradation (28S/18S rRNA ratio > 2) or DNA contamination.
Gene profiling and quality control 286 newly diagnosed cases of AML (Table 3) were analyzed by gene profiling using the Affymetrix U133A GeneChip. The U133A GeneChips contain 22283 probe sets representing approximately 13000 distinct genes. Ten microgram of total RNA was used for the production of antisense biotinylated RNA. Single-stranded cDNA and double -stranded cDNA were synthesized according to the manufactures protocol (Invitrogen Life Technologies, Breda, The Netherlands) using the T7-(dT)24-primer (Genset Corp, Paris France). In vitro transcription was performed with biotin-11-CTP and biotin-16-UTP (Perkin Elmer, Hoofddorp, The Netherlands) and the MEGAScript T7 labeling kit (Ambion, Cambridgeshire, UK). Double -stranded cDNA and cRNA were purified and fragmented with the GeneChip Sample Cleanup Module (Affymetrix, Santa Clara, CA). Biotinylated RNA was subsequently hybridized to the Affymetrix U133A GeneChip (45°C for 16 hours). Staining, washing and scanning procedures were carried out as described in the GeneChip Expression Analysis Technical Manual (Affymetrix, Santa Clara, CA). All GeneChips were visually inspected for obvious irregularities. The global method of scahng/normalization was applied and the differences between the scahng/normalization factors of all GeneChips (n=294) were less than 3-fold (0.70, SD 0.26). All additional quality metrics, i.e. percent genes present (50.6, SD 3.8), actin 3' to 5' ratio (1.24, SD 0.19) and GAPDH 3'to 5' ratio (1.05, SD 0.14) indicated high overall sample and assay quality.
Data normalization, analysis and visualization The mean intensity values of all probe sets were calculated by the global method of scaling/normalization using MAS5.0. As most genes with values below 30 are absent (83% of all absent calls), these values were classified as unreliable and set to 30. This process resulted also in the exclusion of possibly unreliable present calls (10% of all present calls). The ratios between measured intensity and geometric mean intensity were calculated for each probe set and log2 transformed to be used for further data analyses with Omniviz©, SAM© and PAM©. Omniviz® (Maynard, MA (version 3.6)) - Different numbers of probe sets were selected by filtering for those genes that in one or more samples differed at least n-fold from the geometric mean expression level of all AML patients. By using various ratios different numbers of differentially-expressed probe sets were selected for the correlation visualization tool (Table 2). For each number of selected probe sets the clustering of the AML patients in specific molecularly recognizable groups was investigated using the
Correlation Visualization tool of Omniviz (Supplemental Data (Figures B to
H)). Table 5 (below) shows the evaluation of the Correlation View results on the basis of the clustering of AML patients with similar molecular abnormalities.). The few AML cases with abnormalities involving chromosome
5 were excluded. Ratio: ratio between measured intensity and geometric mean intensity by which probe sets were selected. SAM ® (version 1.21) Trustees of Leland Stanford Junior University
- All supervised analyses were performed using Significance Analysis of Microarrays (SAM) (Tusher et al, 2001). The criterion to identify the top40 genes for the assigned clusters was: at least a 2-fold difference between selected cluster and the remaining AML samples and a q-value of less than
5%. PAM® (version 1.12) Trustees of Leland Stanford Junior University - All supervised class prediction analyses were performed by applying
Prediction Analysis of Microarrays (PAM) software in R (version 1.7.1)
(Tibshirani et al, 2002).
All genes identified by the SAM and PAM methods are available as
Supplemental Data (Tables Al to Pi and Q).
RT-PCR and sequence analyses Reverse trancriptase - polymerase chain reactions (RT-PCR) and sequence analyses for mutations in FLT3-ITO, FLT3-TKD, N-i S, K-RAS and cEBPa, as well as real-time PCR for EVI1 were performed as described previously (van Waalwijk van Doorn-Khosrovani et al, 2003a; van Waalwijk van Doorn-Khosrovani et al, 2003b; Valk et al, 2004; Care et al, 2003).
Statistical analyses of survival Statistical analyses were performed with Stata Statistical Software, Release 7.0 (Stata, College Station, TX). Actuarial probabilities of overall survival (OS, with failure death due to any cause) and event-free survival (EFS, with failure in case of no complete remission at day 1, at relapse or death in first CR) were estimated by the method of Kaplan and Meier.
Results
Correlation visualization of de novo AML by gene expression The best unsupervised ordering by applying the visualization tool of Omniviz of the AML cases in relation to different molecular markers was reached using 2856 probe sets (representing 2008 annotated genes and 146 ESTs) (Figure 1A and Table 5). Sixteen distinct groups of AML patients were assigned on the basis of strong correlation between adjacent AML patients, i.e., within one red square along the diagonal, as well as the correlation and anti-correlation between the different groups, i.e., between the red squares along the diagonal (Figure 1A and Supplemental data (Figure A)). The final Omniviz Correlation View generated with 2856 probe sets was adapted such that cytological, cytogenetic and molecular parameters could be plotted directly adjacent to the original diagonal. This resulted in a unique way of visualization of the groups of patients with high correlation and related parameters (Figure IB). Distinct clusters of AML t(8;21), AML inv(16) and AML t(15;17) were apparent (Figure IB). Although these distinct clusters were readily identified with less probe sets using the correlation tool, clusters of AML patients with mutations in FLT3 or cEBPa, or with overexpression of EVI1 were only apparent with 2856 probe sets (Table 5 and Figures 4 to 10). When more genes were used for the correlation visualization this compact clustering vanished (Table 5). Unique genes characteristic for each of the 16 identified clusters were obtained by supervised analysis using SAM. The expression profiles of the top4O genes are plotted in Figure IB alongside the Correlation View. The SAM analyses resulted in only 599 discriminating genes (Tables 23-39) since a distinct gene profile for cluster #14 could not be identified, suggesting tight overlap with genes in clusters #7 and #8.
AML and recurrent translocations CBFβ/MYHll - All inv(16) AML patients clustered within cluster #9 (Figure IB and Supplemental Data (Table I)). Of note, 4 patients who were previously not known to harbour an inv(16) were included within this cluster. Molecular analysis and Southern blotting revealed the presence of CBFβ/MΥHll fusion gene in those cases (Figure 11). SAM analysis revealed that MYH11 was the most prominent discriminating gene for this cluster (Supplemental data (Table II and Figure 12). Interestingly, CBFβ anti- correlate d with this cluster, suggesting that the CBFβ/MYHll fusion protein down modulates the expression of the CBFβ allele. PML/RARa - Cluster #12 contains all cases of acute promyelocytic leukemia (APL) with t(15;17) (Figure IB and Supplemental Data (Table L)), including two patients previously recognized as APL with PML/RARaby RT- PCR only. SAM analyses (Supplemental Data (Table LI)) revealed that genes encoding growth factors such as hepatocyte growth factor (HGF), macrophage- stimulating 1 (hepatocyte growth factor-like (MSTl)) and fibroblast growth factor 13 (FGF13) were specific for this cluster. In addition, cluster #12 could be separated into two subgroups with either high or low white blood cell count (WBC) (Supplemental data (Figure 13). This subdivision corresponds with FLT3 ITD mutation status (Figure IB). AMLl/ETO - All patients with a t(8;21) grouped within cluster #13 (Figure IB and Supplemental Data (Table M)), including one patient without a t(8;21) (2496). SAM identified ETO as the most discriminative gene for this cluster (Supplemental data (Table Ml and Figure 14).
AML υυith llq23 abnormalities AML patients with Hq23 abnormalities were intermingled within the 286 AML patients, although two subgroups were apparent, i.e., cluster #1 and cluster #16 (Figure IB and Supplemental Data (Tables A and P)). Cluster #16 contains four cases of t(9;ll) and one case of t(ll;19) (5/11 cases (45%)). SAM analyses identified a strong signature with a group of genes specifically upregulated in the majority of cases in this cluster (Figure IB and Supplemental data (Table PI)). Although seven of 14 (50%) cases within cluster #1 have chromosome 11 abnormalities as well, this subgroup appears quite heterogeneous with a less uniform signature (Figure IB).
AML and cEBPa mutations Interestingly, two separate clusters (#4 and #15) comprise AML patients with predominantly normal karyotypes and a high frequency of mutations in cEBPa (Figure IB (Clusters #4 (8/15 cases (53%)) and #15 (5/8 cases (62%))). In cluster #4 a set of up- and down regulated genes could be defined (Supplemental data (Table Dl)), which appeared to discriminate the AML cases in cluster #4 from cluster #15. The upregulated genes represent certain T-cell genes, such as the CD7 antigen (CD7) and the T cell receptor delta locus (TRD@), which are known to be expressed on immature subsets of AML as well (Lo Coco et al, 1989; Boeckx et al, 2002). All but one of the top40 genes of cluster #15 are downregulated (Supplemental data (Table Ol)). Interestingly, these genes are similarly downregulated in cluster #4 (Figure IB). The genes encoding alphal-catenin (CTNNA1), tubulin beta-5 (TUBBS) and Nedd4 family interacting protein 1 (NDFIPΪ) were the only genes down modulated and among the top40 in both cluster #4 and #15.
AML and EVIl overexpression A separate cluster (#10) of AML was identified in which 44% (10/22 cases, Supplemental data (Table J)) showed increased expression of EVIl. Aberrant expression of EVIl in cluster #10 correlated with chromosome 7 abnormalities (6/10 EVIl -positive cases). This complete group of patients could be discriminated based on a selection of genes, suggesting that all patients, even the EVIl negative cases, carry abnormalities in a common pathway. Cluster # 8 also contains a relatively high number of chromosome 7 aberrations (5/13 cases, Supplemental data (Table H)), but it displays a different molecular signature compared to cluster #10 (Figure IB). This suggests that high expression of EVIl and/or .Erøl-related proteins determines the molecular profile of cluster #10. Four out of 14 cases within the heterogeneous cluster #1 also demonstrated increased EVIl expression. These patients may cluster outside cluster #10 since their molecular signatures are most likely the result of EVIl overexpression and an llq23 abnormality.
AML with FLT3 mutations Groups of patients with mutations in the FLT3 receptor gene were recognized within the Correlation View (Figure IB). In fact, clusters #2 and #6 merely consist of patients with a FLT3 ITD. Interestingly, almost all of these patients have a normal karyotype. In addition, the FLT3 ITD mutation status seems to divide several clusters into two groups, e.g., clusters #3, #5 and AML with t(15;17) (#12). Other individual cases of AML with FLT3 ITD were more dispersed over the whole group of AML patients. AML patients with mutations in the tyrosine kinase domain (TKD) of FLT3 did not cluster. Likewise patients with mutations in codons 12, 13 or 61 of the small GTPase RAS (N- RAS and K-RAS) do not have apparent signatures and do not aggregate in the Correlation View (Figure IB).
Other unique AML clusters AML patients with normal karyotypes clustered in several subgroups within the assigned clusters (Figure IB). In fact, the majority of patients in cluster #11 have normal karyotypes without any consistent additional abnormality. Other unique clusters, i.e., cluster #3, #5, #7, #8 and #14, were identified which could not be annotated with any known cytogenetic or molecular abnormality. Cluster #5 mainly contains AML patients that belong to the French-American-British (FAB) classification M4 or M5 subtypes (Figure IB), suggesting that the morphology was the main determinant for classifying these cases within this subgroup. Clusters #3, #7, #8, #11 and #14 contain AML cases, that do not belong to one FAB subtype, but can be discriminated based on distinct gene expression profiles.
Class prediction of distinct clusters in AML All 286 AML cases were randomised and divided into a training- (n=190) and a validation set (n=96). PAM was applied on the dataset to determine the minimal number of genes to predict distinct abnormahties with prognostic value in AML , i.e., t(8;21), inv(16), t(15;17), llq23 (cluster #16), SWI/ onosomy 7 (cluster #10), cEBPa (clusters #4 and #15) (Table 3). In addition, since FLT3 ITD mutations are frequent abnormahties in AML and associated with poor outcome2, the minimal set of genes to predict FLT3 ITD mutations in AML were identified. All patients with favourable cytogenetics within the validation set were predicted with 100% accuracy and with only few genes (Table 3). As expected from the SAM analyses, ETO for t(8;21), MYHll for inv(16) and HGF for t(15;17) were among the most predictive genes (Supplemental Data (Table Q)). Interestingly, cluster #10 (EVIl/ monosomy 7) was predicted with high accuracy, although with a higher 10-fold cross vahdation error. Cluster #16
(Hq23) was predicted with fairly high accuracy. Since cluster #15 (cEBPα) consists of few patients only, we combined both cEBPα clusters. These two clusters could subsequently be predicted within the vahdation set with fairly high accuracy. A highly predictive signature for the FLT3 ITD cluster could not be defined by means of expression profiling within the AML patient cohort investigated. Table 3 (below) shows the class prediction using PAM (10-fold CV error: 10-fold cross vahdation prediction error on training set (n=190), Error validation set: prediction error on vahdation set (n=96), #Probe sets: Number of probe sets used for prediction, #Genes: number of genes represented by probe sets used for prediction. For identities of the probe sets and genes see
Supplemental Data (Table Q). *After randomization none of the AML patients from cEBPa cluster #15 were included in the vahdation set.
Survival analyses Overall survival (OS), event free survival (EFS) and relapse rate
(RR) of AML patients from clusters containing >20 cases in the Correlation
View, were determined, i.e., clusters #5 (M4/M5), #9 (inv(16)), #10 (EVTl/monosomy 7), #12 (t(15;17)) and #13 (t(8;21)). Patients with a complete clinical data set were included in the survival analyses (Figure 2). The mean actuarial OS and DFS probabilities at 60 months of the patients with favourable cytogenetics were 62% (±8.7%) and 50% (±2.4%), respectively. AML patients included in cluster #5 had intermediate survival (OS 27% and EFS 32%), whereas patients from cluster #10 showed poor treatment response (OS 6% (P=0.001) and EFS 18% (P=0.004)) mainly as a result of increased relapse incidence (Figure 2C).
Discussion The results of the study presented here show profound diagnostic impact of expression profiling. Among AML with considerable genetic diversity, expression profiling provides an approach to distinguish these highly variable genetic subsets into clusters with distinct signatures. Patients with AML were classified in 16 groups based on their gene expression profiles by unsupervised Pearson's correlation coefficient analyses. The results show that each of the assigned clusters represents true AML subgroups with specific molecular signatures. Firstly, all cases with t(8;21) (AMLl/ETO), inv(16) (CBFβ/MYHll) or t(15;17) (PML/RARa), including patients that could not be recognized by karyotyping, could be clustered in three separate clusters with unique gene expression profiles. Unique correlations between gene expression profiles and favourable cytogenetic aberrations have been shown in the prior art (Debernardi et al, 2003; Schoch et al, 2O02), however, here we demonstrate that these patients can even be recognized with high accuracy within a representative cohort of AML patients. Secondly, Significance Analyses of Microarrays (SAM) and Prediction Analyses of Microarrays (PAM), showed a strong concordance between the specific genes identified for the different assigned clusters, demonstrating that we identified truly discriminative genes for all the clusters that we assigned. For instance, we identified two distinct clusters (#4 and #15) with overlapping signatures, which both included cases with normal karyotypes and mutations in cEBPa. Multiple genes appeared to be downregulated in both subclasses but were unaffected in any other AML subgroup. Thirdly, the discriminative genes identified by SAM and PAM may in addition reveal specific functional pathways critical for the pathophysiology of AML. This is suggested by the identification of several functionally important genes implicated in specific subtypes of AML, such as the IL5Rα in AML with t(8;21) (Touw et al, 1991) and the bona fide FLT3/STAT5 targets IL2Ra (Kim et al, 2001) and PIMl (Lilly et al, 1992) in AML with FLT3 ITD mutations. Five clusters (#5, #9, #10, #12 and #13) 20 or more cases were evaluated in relation to outcome of therapy. As expected, clusters #9 (CBFβ/MYHll), #12 (PML/RARa) and #13 (AMLl/ETO), comprised cases with a favorable response to therapy. However, cases that belong to cluster #10 showed a distinct poor outcome. Patients in this cluster could be predicted with high accuracy in an independent validation set with a minimal set of genes. The high frequency of poor prognostic markers, e.g., -7(q), -5(q), t(9;22) or high EVIl is in agreement with the observation that this cluster represents a bad- risk AML group. However, since the cluster contains AML cases with a variety of genetically defined poor risk markers and since a significant portion of the cases did not express any of these lesions, this suggests that a unique pathway represented by the molecular signature of this cluster of AML patients is associated with bad outcome. This hypothesis is further strengthened by the fact that large numbers of cases with the same poo -risk markers were present in other clusters (#1, #2, #8 and #16). Analysis of the genes up- or downregulated in AML cases from cluster #10 may predict the pathway(s) involved the pathophysiology of this subgroup of AML patients. This might also shed light on the findings that the other cases with distinct poor -prognostic markers are grouped in different clusters. Unfortunately, these latter groups were too small for an accurate analysis of treatment outcome. The 44 AML patients in cluster #5 showed an intermediate survival estimate. Since these cases belong to AML FAB-M4 or -M5 subtype, it is possible that monocyte/macrophage related genes mainly drove clustering of these cases. Unsupervised clustering of larger numbers of only AML FAB-M4 or -M5 cases with a normal karyotype may result in the identification of specific subgroups with unique gene expression profiles and perhaps variable prognosis. Three clusters mainly consisting of patients with normal karyotype were identified. The majority of patients in two of those clusters (#2 and #6) were also characterized by FLT3 ITD mutations, whereas patients in cluster #11, with a discriminative molecular signature, did not contain any consistent abnormality. Two clusters (#1 and #16) were recognized, which harbored llq23 abnormahties, representing defects involving the mixed-lineage leukemia gene. The reason for the separation of these two subgroups is most likely caused by different additional genetic defects in the cases of the distinct clusters, causing different gene expression profiles. In cluster #1 this abnormality may be the frequently observed high expression of EVIl, which is not apparent in AML cases from cluster #16. A similar explanation may hold for AML cases in clusters #4 and # 15, both comprising cEBPa mutant cases, AML patients in clusters #1 and #10 (high EVIl expression), or patients in clusters # 8 and #10 with frequent monosomy 7. Given the fact that each of these clusters expressed such a distinct molecular signature most probably means that in the cases without the characteristic genetic lesion, other currently unidentified mutations affecting the same pathways are responsible for the genetic profiles. Internal tandem duplications (ITD) in the FLT3 gene adversely affect clinical outcome (Levis & Small, 2003). The molecular signature induced by the constitutively activated the FLT3 receptor appears not strong enough to distinguish FLT3 ITD carrying AML patients from the other cases. However, the clustering of FLT3 ITD positive patients within assigned clusters, as is the case in the APL subgroup (cluster #12), demonstrates that the presence of FLT3 ITD results in different biological entities within one type of disease. To this end, our study demonstrates that cytogenetically known as well as new clusters of AML with characteristic gene expression signatures can be identified with one single assay. The quality of genome-wide analysis will further advance with the availability of novel whole genome arrays, improved sequence annotation and the development of more sophisticated protocols and software, allowing analysis of subtle differences in gene expression and comprehensive pathway prediction. These studies, while augmenting our understanding of the pathways involved in pathophysiology of AML, will result in improved diagnostics and possibly lead the way to the development anti-cancer drugs that interfere with disease related pathways.
EXAMPLE 2
Analyses of novel AML patients
Patients and cell samples
Eligible patients have a diagnosis of primary AML, confirmed by cytological examination of blood and bone marrow. Blasts and mononuclear cells should be purified by Ficoll-Hypaque (Nygaard, Oslo, Norway) centrifugation. Add 1:1 diluted peripheral blood or bone marrow 1:4 diluted both in PBS up to 20-25 ml on to 15 ml Ficoll-Hypaque. Spin 15 minutes at 1880rpm. Collect interphase with mononuclear cells and wash twice with PBS (total volume 50ml, 8 minutes 2000 rpm). The pellet contains the mononuclear cells, including the blast cells. As a result, the AML samples should contain 80-100 percent blast cells, regardless of the blast count at diagnosis. 30.106 cells/ml should be frozen in lvol PBS/1 vol heat inactivated FCS/0.5 vol DMSO stored in liquid nitrogen.
RNA isolation and quality control
After thawing, cells were washed once with Hanks balanced salt solution. High quality total RNA should extracted by lysis with guanidinium isothiocyanate followed by cesium chloride gradient purification. RNA concentration, quality and purity should be examined using the RNA 6000 Nano assay on the Agilent 2100 Bioanalyzer (Agilent, Amstelveen, The Netherlands). None of the samples should show RNA degradation (28S/18S rRNA ratio > 2) or contamination by DNA. Gene profiling and quality control
Ten μg of total RNA should be used to prepare antisense biotinylated RNA. Single -stranded cDNA and double-stranded cDNA should be synthesized according to the manufacturer's protocol (Invitrogen Life Technologies, Breda, The Netherlands) using the T7-(dT)24-primer (Genset Corp, Paris, France). In vitro transcription should be performed with biotin-11-CTP and biotin-16-UTP (Perkin Elmer, Hoofddorp, The Netherlands) and the MEGAScript T7 labeling kit (Ambion, Cambridgeshire, UK). Double-stranded cDNA and cRNA should be purified and fragmented with the GeneChip® Sample Cleanup Module
(Affymetrix, Santa Clara, CA). Biotinylated RNA should be hybridized to the Affymetrix U133A GeneChip® (45°C for 16 hours). Samples should be analyzed using Affymetrix U133A or U133 Plus2.0 GeneChips®. The U133A
GeneChip® contains 22283 probe sets, representing approximately 13000 genes. These probe sets can also be selected from the U133 Plus2.0 GeneChip®. Staining, washing and scanning procedures should be carried out as described in the GeneChip® Expression Analysis Technical Manual (Affymetrix, Santa Clara, CA). All GeneChips® should be visually inspected for irregularities. The global method of scaling/normalization should be applied and the differences between the scaling/normalization factors of all GeneChips® up to the Target Gene Intensity of 100 (reference value n=285: scaling factor = 0.70, SD 0.26). All additional measures of quality - percent genes present (reference value n=285: 50.6 ±3.8), actin 3' to 5' ratio (reference value n=285: 1.24 ±0.19) and GAPDH 3'to 5' ratio (reference value n=285: 1.05 ±0.14) - should indicate high overall sample and assay quality.
Reference data set
A reference data set (gene expression data and detailed clinical and molecular data) of 285 AML patients should be downloaded from the Gene Expression Omnibus (www.ncbi.nlm.nih.gov/geo, accession number GSE1159). Data normalization, analysis and. visualization
All intensity values (reference set (n=285) and new AML patients to be included) should be scaled to an average value of 100 per GeneChip® according to the method of global scaling/normalization, available in the Affymetrix Microarray Suite (MA 35.0). All other setting should be default according to the manufacturer.
As our methods reliably identify samples with an average intensity value >3O but do not reliably discriminate values from 0 - <30, these values should be set to 30.
For each probe set the geometric mean of the hybridization intensities of all patient samples should calculated. The level of expression of each probe set in every sample was determined relative to this geometric mean and transformed to log2 to ascribe equal weight to gene-expression levels with similar relative distances to the geometric mean. The transformed expression data should be subsequently imported into Omniviz.
Pearson's Correlation Visualization tool of Omniviz (Maynard, MA (version 3.6)) — The Omniviz package should be used to perform and visualize unsupervised cluster analysis. The clustering of molecularly recognizable specific groups of patients should be investigated with the 2856 probe sets (Table 1) taking the reference set (n=285) and new patients to be analysed into account.
References Alizadeh AA, Eisen MB, Davis RE, et al. Distinct types of diffuse large B- cell lymphoma identified by gene expression profiling. Nature 2000; 403:503- 11. Armstrong SA, Staunton JE, Silverman LB, et al. MLL translocations specify a distinct gene expression profile that distinguishes a unique leukemia. Nat Genet 2002; 30:41-7. Boeckx N, Willemse MJ, Szczepanski T, et al. Fusion gene transcripts and
Ig/TCR gene rearrangements are complementary but infrequent targets for PCR-based detection of minimal residual disease in acute myeloid leukemia. Leukemia 2002; 16:368-75. Care RS, Valk PJ, Goodeve AC, et al. Incidence and prognosis of c-KIT and
FLT3 mutations in core binding factor (CBF) acute myeloid leukaemias. Br J Haematol 2003; 121:775-7.
Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156-9.
Debernardi S, Lillington DM, Chaplin T, et al. Genome-wide analysis of acute myeloid leukemia with normal karyotype reveals a unique pattern of homeobox gene expression distinct from those with translocation-mediated fusion events. Genes Chromosomes Cancer 2003; 37:149-58. Eisen MB, Spellman MB, Brown PO, Botstein D. Cluster analysis and display of genomewide expression patterns. Proc. Natl. Acad. Sci. U S A 1998; 95:14863-8.
Golub TR, Slonim DK, Tamayo P, et al. Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science 1999; 286:531-7. Kim HP, Kelly J, Leonard WJ. The basis for TL-2-induced IL-2 receptor alpha chain gene regulation: importance of two widely separated IL-2 response elements. Immunity 2001; 15:159-72. Levis M, Small D. FLT3: ITDoes matter in le ikemia. Leukemia 2003;
17:1738-52.
Lilly M, Le T, Holland P, Hendrickson SL. Sustained expression of the pim-1 kinase is specifically induced in myeloid c&lls by cytokines whose receptors are structurally related. Oncogene 1992; 7:727-32.
Lo Coco F, De Rossi G, Pasqualetti D, et al. CD7 positive acute myeloid leukaemia: a subtype associated with cell immaturity. Br J Haematol 1989; 73:480-5.
Lδwenberg B, Downing JR, Burnett A. Acute myeloid leukemia. N Engl J Med 1999; 341:1051-62.
Preudhomme C, Sagot C, Boissel N, et al. Fa~vorable prognostic significance of CEBPA mutations in patients with de novo acvite myeloid leukemia: a study from the Acute Leukemia French Association (ALFA). Blood 2002; 100:2717- 23.
Rombouts WJ, Lowenberg B, van Putten WL, Ploemacher RE. Improved prognostic significance of cytokine -induced proliferation in vitro in patients with de novo acute myeloid leukemia of intermediate risk: impact of internal tandem duplications in the Flt3 gene. Leukemia 2001; 15:1046-53.
Ross ME, Zhou X, Song G, et al. Classificatiom of pediatric acute lymphoblastic leukemia by gene expression profiling. Blood 2003; 1:1. Schoch C, Kohlmann A, Schnittger S, et al. Acute myeloid leukemias with reciprocal rearrangements can be distinguished by specific gene expression profiles. Proc Natl Acad Sci U S A 2002; 99:10008-13.
Tibshirani R, Hastie T, Narasimhan B, Chu G. Diagnosis of multiple cancer types by shrunken centroids of gene expression. Proc Natl Acad Sci U S A 2002; 99:6567-72. Touw I, Donath J, Pouwels K, et al. Acute myeloid leukemias with chromosomal abnormalities involving the 21q22 region are identified by their in vitro responsiveness to interleukin-5. Leukemia 1991; 5:687-92.
Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 2001; 98:5116-21.
Valk PJM BD, Frew ME, Goodeve AC, Lowenberg B, Reilly JTW. 'Second hit' mutations in the RTK/RAS signalling pathway in acute myeloid leukaemia and inv(16). Haematologica 2004; 89:In press.
Van Waalwijk van Doorn-Khosrovani SB, Erpehnck C, Meijer J, et al. Biallelic mutations in the CEBPA gene and low CEBPA expression levels as prognostic markers in intermediate -risk AML. Hematol J 2003; 4:31-40.
Van Waalwijk van Doorn-Khosrovani SB, Erpehnck C, van Putten WL, et al. High EVIl expression predicts poor survival in acute myeloid leukemia: a study of 319 de novo AML patients. Blood 2003; 101:837-45. Yeoh E J, Ross ME, Shurtleff SA, et al. Classification, subtype discovery, and prediction of outcome in pediatric acute lymphoblastic leukemia by gene expression profiling. Cancer Cell 2002; 1:133-43.
Table 1. About 2856 genes used for classifying AML of 286 patients into defined clusters as identified in Correlation View
Affymetrix probe set id gene symbol unigene ID
117_at HSPA6 Hs.3268
1405_i_at CCL5 Hs.241392
1598_g_at GAS6 Hs.437710
200067_x_at SNX3 Hs.12102
200075_s_at GUK1 Hs.376933
200099_s_at ... ... // ...
200602_at APP Hs.177486
200606_at DSP Hs.349499
200612_s_at AP2B1 Hs.370123
200616_s_at KIAA0152 Hs.181418
200628_s_at WARS Hs.82030
200629_at WARS Hs.82030
200632_s_at NDRG1 Hs.318567
200644_at MLP Hs.75061
200648_s_at GLUL Hs.442669
200660_at S100A11 Hs.417004
20066 l_at PPGB Hs.118126
200665_s_at SPARC Hs.111779
200671_s_at SPTBN1 Hs.205401
200672_x_at SPTBN1 Hs.205401
200675_at CD81 Hs.54457
200678_x_at GRN Hs.180577
200696_s_at GSN Hs.446537
200697_at HK1 Hs.118625
200703_at DNCL1 Hs.5120
200704_at LITAF Hs.76507
200706_s_at LITAF Hs.76507
200736_s_at GPX1 Hs.76686
200762_at DPYSL2 Hs.173381
200765_x_at CTNNA1 Hs.254321
200766_at CTSD Hs.343475
2007 l_at LAMC1 Hs.432855
Table 1 (continued):
200780. x_at GNAS Hs.157307 200782..at ANXA5 Hs.145741 200784_ s_at LRP1 Hs.162757 200785. s_at LRP1 Hs.162757 200791. _s_at IQGAP1 Hs.1742 200795..at SPARCL1 Hs.75445 200796..s_at MCL1 Hs.86386 200799. at HSPA1A Hs.75452 200800. _s_at HSPA1A Hs.75452 200808. _s_at ZYX Hs.75873 200832. _s_at SCD Hs.119597 200838..at CTSB Hs.135226 200839. _s_at CTSB Hs.135226 200853..at H2AFZ Hs.119192 200871. _s_at PSAP Hs.406455 200872..at S100A10 Hs.143873 200878..at EPAS1 Hs.8136 200895. _s_at FKBP4 Hs.848 200897. _s_at KIAA0992 Hs.194431 200907..s_at EAA0992 Hs.194431 200921. _s_at BTG1 Hs.255935 200923..at LGALS3BP Hs.79339 200931. _s_at VCL Hs.75350 200952 _s_at CCND2 Hs.376071 200953 _s_at CCND2 Hs.376071 200962.at RPL31 Hs.375921 200965 _s_at ABLIM1 Hs.442540 200981. _x_at GNAS Hs.157307 200982. _s_at ANXA6 Hs.412117 200983. _x_at CD59 Hs.278573 200985. _s_at CD59 Hs.278573 200986..at SERPING1 Hs.384598 200989..at HIF1A Hs.412416 200991. _s_at SNX17 Hs.278569 200998.s_at CKAP4 Hs.74368 200999..s_at CKAP4 Hs.74368 201005..at CD9 Hs.387579 201008. _s_at TXNIP Hs.179526 201012..at ANXA1 Hs.287558 201013. _s_at PAICS Hs.444439 201015. _s_at UP Hs.2340 201024. _x_at IF2 Hs.158688 201034..at ADD3 Hs.324470 201037..at PFKP Hs.26010 201041. _s_at DUSP1 Hs.171695 201043. _s_at ANP32A Hs.124977 201044. _x_at DUSP1 Hs.171695 201047. _x_at RAB6A Hs.5636 201050..at PLD3 Hs.74573 201052. _s_at PSMF1 Hs.437495 201058. _s_at MYL9 Hs.433814 201060. _x_at ST0M Hs.439776 201061. _s_at STOM Hs.439776 201069.at MMP2 Hs.367877 201105..at LGALS1 Hs.407909 201107. _s_at THBS1 Hs.164226 201108. _s_at THBS1 Hs.164226 201109 _s_at THBS1 Hs.164226 201110. _s_at THBS1 Hs.164226 201123 _s_at EIF5A Hs.310621 201125. _s_at ITGB5 Hs.149846 201131. _s_at CDH1 Hs.194657 201136. _at PLP2 Hs.77422 201137. _s_at HLA-DPB1 Hs.368409 201141 at GPNMB Hs.389964 Table 1 (continued):
201160_s_at CSDA Hs.221889
201161_s_at CSDA Hs.221889
201162_at IGFBP7 Hs.435795
201163_s_at IGFBP7 Hs.435795
201169_s_at BHLHB2 Hs.171825
201170_s_at BHLHB2 Hs.171825
201174_s_at TERF2IP Hs.274428
201178_at FBX07 Hs.5912
201189_s_at ITPR3 Hs.77515
201193_at IDH1 Hs.11223
201195_s_at SLC7A5 Hs.184601
201201_at CSTB Hs.695
201218_at CTBP2 Hs.171391
201220_x_at CTBP2 Hs.171391
201222_s_at RAD23B Hs.159087
201223_s_at RAD23B Hs.159087
201234_ at ILK Hs.6196
201242_s_at ATP IB 1 Hs.78629
201249_at SLC2A1 Hs.169902
201250_s_at SLC2A1 Hs.169902
201251_at PKM2 Hs.198281
201272_at AKR1B1 Hs.75313
201285_at MKRN1 Hs.7838
201291_s_at T0P2A Hs.156346
201294_s_at WSB1 Hs.315379
201295_s_at WSB1 Hs.315379
201300_s_at PRNP Hs.438582
201301_s_at ANXA4 Hs.422986
201302_at ANXA4 Hs.422986
201307_at FLJ10849 Hs.386784
201309_x_at C5orfl3 Hs.508742
201313_at EN02 Hs.146580
201324_at EMP1 Hs.306692
201325_s_at EMP1 Hs.306692
201328_at ETS2 Hs.292477
201329_s_at ETS2 Hs.292477
201333_s_at ARHGEF12 Hs.413112
201334_s_at ARHGEF12 Hs.413112
201348_at GPX3 Hs.386793
201360_at CST3 Hs.304682
201373_at PLEC1 Hs.79706
201389_at ITGA5 Hs.149609
201392_s_at IGF2R Hs.76473
201393_s_at IGF2R Hs.76473
201412_at LRP10 Hs.28368
201416_at SOX4 Hs.357901
201417_at S0X4 Hs.357901
201418_s_at S0X4 Hs.357901
201422_at IFI30 Hs.14623
201425_at ALDH2 Hs.436437
201426_s_at VIM Hs.435800
201427_s_at SEPP1 Hs.275775 201431_s_at DPYSL3 Hs.150358 201445_at CNN3 Hs.194662 201459_at RUVBL2 Hs.6455 201462_at KIAA0193 Hs.75137 201464_x_at JUN Hs.78465 201465_s_at JUN Hs.78465 201466_s_at JUN Hs.78465 201473_at JUNB Hs.400124 201487_at CTSC Hs.128065 201497_x_at MYHll Hs.78344 201506_at TGFBI Hs.421496 201508_at IGFBP4 Hs.1516 201518 at CBX1 Hs.77254 Table 1 (continued):
201522. x_at SNRPN Hs.48375 201531. at ZFP36 Hs.343586 201536. at na Hs.181046 201539. .s_at FHL1 Hs.421383 201540. at FHL1 Hs.421383 201548. .s_at PLU-1 Hs.143323 201549. x_at PLTJ-1 Hs.143323 201550. x_at ACTG1 Hs.14376 201563. at SORD Hs.878 201564. s_at FSCN1 Hs.118400 201565. .s_at ID2 Hs.180919 201566. x_at ID2 Hs.180919 201579. at FAT Hs.166994 201590. _x_at ANXA2 Hs.437110 201596. x_at KRT18 Hs.406013 201599. at OAT Hs.75485 201601. x_at IFITM1 Hs.458414 201631. _s_at IER3 Hs.76095 201644. at TSTA3 Hs.404119 201655. _s_at HSPG2 Hs.211573 201656. at ITGA6 Hs.212296 201666 .at TIMP1 Hs.446641 201667. .at GJA1 Hs.74471 201668. _x_at MARCKS Hs.318603 201669. _s_at MARCKS Hs.318603 201670. .s_at MARCKS Hs.318603 201688 _s_at TPD52 Hs.162089 201689. .s_at TPD52 Hs.162089 201690. .s_at TPD52 Hs.162089 201693. _s_at EGR1 Hs.326035 201694 _s_at EGR1 Hs.326035 201695. _s_at NP Hs.75514 201700. .at CCND3 Hs.83173 201711. _x_at RANBP2 Hs.199179 201714. .at TUBG1 Hs.21635 201720. _s_at LAPTM5 Hs.436200 201734 .at CLCN3 Hs.372528 201735. _s_at CLCN3 Hs.372528 201739. .at SGK Hs.296323 201743. .at CD 14 Hs.75627 201746. .at TP53 Hs.426890 201752. _s_at ADD3 Hs.324470 201753. _s_at ADD3 Hs.324470 201790. _s_at DHCR7 Hs.11806 201791. _s_at DHCR7 Hs.11806 201792. .at AEBP1 Hs.439463 201795. .at LBR Hs.435166 201798. _s_at FER1L3 Hs.362731 201809 _s_at ENG Hs.76753 201810. _s_at SH3BP5 Hs.109150 201811. _x_at SH3BP5 Hs.109150 201824. .at RNF14 Hs.170926 201831, _s_at VDP Hs.325948 201839. _s_at TACSTD1 Hs.692 201841. _s_at HSPB1 Hs.76067 201842 _s_at EFEMP1 Hs.76224 201850. .at CAPG Hs.82422 201852. _x_at COL3A1 Hs.443625 201858. _s_at PRG1 Hs.1908 201859. .at PRG1 Hs.1908 201860. _s_at PLAT Hs.274404 201883. _s_at B4GALT1 Hs.396798 201887. .at IL13RA1 Hs.285115 201888. _s_at IL13RA1 Hs.285115 201890. .at RRM2 Hs.226390 Table 1 (continued):
201893_x_at DCN Hs.156316
201909_at RPS4Y Hs.180911
201912_s_at GSPT1 Hs.2707
201923_at PRDX4 Hs.83383
201938_at CDK2AP1 Hs.433201
201944_at HEXB Hs.69293
201952_at ALCAM Hs.10247
201963_at FACL2 Hs.406678
201968_s_at PGM1 Hs.1869
201995_at EXT1 Hs.184161
202007_at NID Hs.356624
202014_at PPP1R15A Hs.76556
202016_at MEST Hs.416498
202017_at EPHX1 Hs.89649
202018_s_at LTF Hs.437457
202059_s_at KPNA1 Hs.161008
202068_s_at LDLR Hs.213289
20207 l_at SDC4 Hs.252189
202073_at OPTN Hs.390162
202074_s_at OPTN Hs.390162
202083_s_at SEC14L1 Hs.75232
202085_at TJP2 Hs.75608
202086_at MX1 Hs.436836
202087_s_at CTSL Hs.418123
202088_at LIV-1 Hs.79136
202096_s_at BZRP Hs.202
202107_s_at MCM2 Hs.57101
202112_at VWF Hs.440848
202119_s_at CPNE3 Hs.14158
202124_s_at ALS2CR3 Hs.154248
202125_s_at ALS2CR3 Hs.154248
202129_s_at RIOK3 Hs.209061
202130_at RIOK3 Hs.209061
202131_s_at RIOK3 Hs.209061
202145_at LY6E Hs.77667
202153_s_at NUP62 Hs.437023
202177_at GAS6 Hs.437710
202191_s_at GAS7 Hs.226133
202192_s_at GAS7 Hs.226133
202193_at LIMK2 Hs.278027
20220 l_at BLVRB Hs.76289
202203_s_at AMFR Hs.295137
202204_s_at AMFR Hs.295137
202206_at ARL7 Hs.111554
202207_at ARL7 Hs.111554
202208_s_at ARL7 Hs.111554
202219_at SLC6A8 Hs.388375
202234_s_at SLC16A1 Hs.75231
202236_s_at SLC16A1 Hs.75231
202237_at NNMT Hs.364345
202238_s_at NNMT Hs.364345
202241_at C8FW Hs.444947
202242_at TM4SF2 Hs.439586
202252_at RAB13 Hs.151536
202265_at BMI1 Hs.380403
202269_x_at GBP1 Hs.62661
202270_at GBP1 Hs.62661
202283_at SERPINF1 Hs.173594
202284_s_at CDKNIA Hs.370771
202286_s_at TACSTD2 Hs.23582
20229 l_s_at MGP Hs.365706
202295_s_at CTSH Hs.114931
202310_s_at COL1A1 Hs.172928
202336_s_at PAM Hs.352733
202340_x at NR4A1 Hs.1119 Table 1 (continued):
202345_s_at FABP5 Hs.408061
202364_at MXI1 Hs.118630
202379_s_at NKTR Hs.369815
202388_at RGS2 Hs.78944
202391_at BASP1 Hs.79516
202395_at NSF Hs.431279
202403_s_at COL1A2 Hs.232115
202409_at na Hs.251664
20241 l_at IFI27 Hs.278613
202425_x_at PPP3CA Hs.272458
202426_s_at RXRA Hs.20084
202429_s_at PPP3CA Hs.272458
20243 l_s_at MYC Hs.202453
202435_s_at CYP1B1 Hs.154654
202436_s_at CYPIBI Hs.154654
202437_s_at CYP1B1 Hs.154654
202443_x_at N0TCH2 Hs.8121
202452_at ZYG Hs.29285
202456_s_at ZYG Hs.29285
202457_s_at PPP3CA Hs.272458
202459_s_at LPIN2 Hs.437425
202460_s_at LPIN2 Hs.437425
202464_s_at PFKFB3 Hs.195471
202478_at TRB2 Hs.155418
202479_s_at TRB2 Hs.155418
20248 l_at SDR1 Hs.17144
202492_at FLJ22169 Hs.323363
202497_x_at SLC2A3 Hs.419240
202498_s_at SLC2A3 Hs.419240
202499_s_at SLC2A3 Hs.419240
202500_at DNAJB2 Hs.77768
202503_s_at KIAA0101 Hs.81892
202510_s_at TNFAIP2 Hs.101382
202523_s_at SPOCK2 Hs.436193
202524_s_at spociα Hs.436193
202545_at PRKCD Hs.155342
202546_at VAMP8 Hs.172684
202548_s_at ARHGEF7 Hs.172813
202551_s_at CRIMl Hs.170752
202554_s_at GSTM3 Hs.2006
202555_s_at MYLK Hs.386078
202565_s_at SVTL Hs.163111
202566_s_at SVIL Hs.163111
20258 l_at HSPA1A Hs.274402 202587_s_at AK1 Hs.76240 202589_at TYMS Hs.87491 202599_s_at NRIP1 Hs.155017 202600_s_at NRIP1 Hs.155017 202609_at EPS8 Hs.2132 202614_at C4orfl Hs.364615 202624_s_at CABIN1 Hs.435798 202626_s_at LYN Hs.80887 202627_s_at SERPINE1 Hs.414795 202628_s_at SERPINE1 Hs.414795 202637_s_at ICAM1 Hs.168383 202638_s_at ICAM1 Hs.168383 202643_s_at TNFAIP3 Hs.211600 202644_s_at TNFAIP3 Hs.211600 202660_at Hs.406751 202671_s_at MGC15873 Hs.284491 202672_s_at ATF3 Hs.460 202686_s_at AXL Hs.83341 202687_s_at TNFSF10 Hs.387871 202688_at TNFSF10 Hs.387871 202704_at T0B1 Hs.178137 Table 1 (continued):
202708_s_at HIST2H2BE Hs.2178 202718.at IGFBP2 Hs.433326 202720.at TES Hs.129129 202724.s_at F0X01A Hs.170133 202728.s_at LTBP1 Hs.241257 202729.s_at LTBP1 Hs.241257 202741..at PRKACB Hs.156324 202742.s_at PRKACB Hs.156324 202746.at ITM2A Hs.17109 202747. _s_at ITM2A Hs.17109 202748..at GBP2 Hs.386567 202759._s_at AKAP2 Hs.42322 202760._s_at AKAP2 Hs.42322 202761..s_at SYNE2 Hs.444069 202763. at CASP3 Hs.141125 202768. at FOSB Hs.75678 202800. at SLC1A3 Hs.371369 202803. _s_at ITGB2 Hs.375957 202804..at ABCCl Hs.391464 202813..at TARBP1 Hs.151518 202820..at AHR Hs.170087 202833._s_at SERPINA1 Hs.297681 202838..at FUCA1 Hs.576 202845.-S_at RALBPl Hs.75447 202850..at ABCD3 Hs.76781 202855..s_at SLC16A3 Hs.386678 202859._x_at IL8 Hs.624 202861..at PERI Hs.445534 202869..at OAS1 Hs.442936 202871..at TRAF4 Hs.8375 202877..s_at C1QR1 Hs.97199 202878..s_at C1QR1 Hs.97199 202887._s_at RTP801 Hs.111244 202888._s_at ANPEP Hs.1239 202901..x_at CTSS Hs.181301 202902._s_at CTSS Hs.181301 202906._s_at NBS1 Hs.25812 202908..at WFS1 Hs.26077 202912..at ADM Hs.441047 202917._s_at S100A8 Hs.416073 202923._s_at GCLC Hs.414985 202926..at NAG Hs.413771 202944..at NAGA Hs.75372 202947._s_at GYPC Hs.81994 202948..at IL1R1 Hs.82112 202949._s_at FHL2 Hs.8302 202953..at C1QB Hs.8986 202974..at MPP1 Hs.422215 202988._s_at RGS1 Hs.75256 202990..at PYGL Hs.771 203021..at SLPI Hs.251754 203037._s_at MTSS1 Hs.77694 203038..at PTPRK Hs.354262 203040._s_at HMBS Hs.82609 203045.at NINJ1 Hs.11342 203052..at C2 Hs.2253 203056._s_at PRDM2 Hs.413375 203057._s_at PRDM2 Hs.413375 203060._s_at PAPSS2 Hs.274230 203063..at PPM1F Hs.278441 203065._s_at CAV1 Hs.74034 203066..at GALNAC4S-6ST Hs.6079 203069._at SV2A Hs.7979 203074..at ANXA8 Hs.87268 203088. at FBLN5 Hs.11494 Table 1 (continued):
203097. s_at PDZGEF1 Hs.373588 203104. .at CSF1R Hs.174142 203115. .at FECH Hs.443610 203116. .s_at FECH Hs.443610 203126. at IMPA2 Hs.5753 203130. .s_at KIF5C Hs.6641 203139. at DAPK1 Hs.244318 203140. at BCL6 Hs.155024 203146. ,s_at GABBRl Hs.167017 203151. at MAP1A Hs.194301 203153. at IFIT1 Hs.20315 203180. .at ALDH1A3 Hs.75746 203184. at FBN2 Hs.79432 203186. -S_at S100A4 Hs.81256 203192. .at ABCB6 Hs.107911 203196. .at ABCC4 Hs.307915 203213. .at CDC2 Hs.334562 203215. _s_at MY06 Hs.118483 203216. _s_at MY06 Hs.118483 203221. .at TLE1 Hs.406491 203234. .at UP Hs.314828 203236. _s_at LGALS9 Hs.81337 203276. .at LMNB1 Hs.89497 203289. _s_at C16orf35 Hs.19699 203290. .at HLA-DQA1 Hs.387679 203299. .s_at AP1S2 Hs.40368 203300. _x_at AP1S2 Hs.40368 203304. .at NMA Hs.348802 203305. .at F13A1 Hs.80424 203308. _x_at HPS1 Hs.404568 203309. .s_at HPS1 Hs.404568 203323. .at CAV2 Hs.139851 203324. -S_at CAV2 Hs.139851 203325. .s_at C0L5A1 Hs.433695 203333. .at KIFAP3 Hs.433442 203349. .s_at ETV5 Hs.43697 203372. -S_at S0CS2 Hs.405946 203373. .at S0CS2 Hs.405946 203381. _s_at APOE Hs.169401 203382. _s_at APOE Hs.169401 203387. .s_at TBC1D4 Hs.173802 203388. .at ARRB2 Hs.435811 203397. _s_at GALNT3 Hs.278611 203402. .at KCNAB2 Hs.440497 203407. .at PPL Hs.192233 203408. _s_at SATB1 Hs.416026 203411. _s_at LMNA Hs.436441 203413. .at NELL2 Hs.79389 203430. .at HEBP2 Hs.439081 203434. _s_at MME Hs.307734 203435 _s_at MME Hs.307734 203440. .at CDH2 Hs.334131 203456. .at JM4 Hs.29595 203470. _s_at PLEK Hs.77436 203471. _s_at PLEK Hs.77436 203476. .at TPBG Hs.82128 203485. .at RTN1 Hs.99947 203502. .at BPGM Hs.198365 203504. _s_at ABCAl Hs.147259 203505. .at ABCAl Hs.147259 203508. .at TNFRSF1B Hs.256278 203509. .at SORL1 Hs.438159 203513. .at FLJ21439 Hs.431338 203518. .at CHS1 Hs.130188 203523 .at LSP1 Hs.56729 Table 1 (continued):
203524_s_at MPST Hs.248267
203535_at S100A9 Hs.112405
203542_s_at BTEB1 Hs.150557
203543_s_at BTEB1 Hs.150557
203544_s_at STAM Hs.441498
203547_at CD4 Hs.17483
203548_s_at LPL Hs.180878
203549_s_at LPL Hs.180878
203555_at PTPN18 Hs.210913
203556_at ZHX2 Hs.30209
203559_s_at ABP1 Hs.437420
203561_at FCGR2A Hs.352642
203562_at FEZ1 Hs.79226
203570_at LOXLl Hs.65436
203574_at NFIL3 Hs.79334
203585_at ZNF185 Hs.16622
20359 l_s_at CSF3R Hs.381027
203627_at IGF1R Hs.239176
203628_at IGF1R Hs.239176
203638_s_at FGFR2 Hs.404081
203641_s_at KIAA0977 Hs.300855
203642_s_at KIAA0977 Hs.300855
203645_s_at CD 163 Hs.74076
20366 l_s_at TMODl Hs.374849
203662_s_at TMODl Hs.374849
203665_at HMOXl Hs.202833
203666_at CXCL12 Hs.436042
203675_at NUCB2 Hs.423095
203676_at GNS Hs.334534
203680_at PRKAR2B Hs.77439
203690_at TUBGCP3 Hs.9884
20369 l_at PI3 Hs.112341
203695_s_at DFNA5 Hs.304365
203708_at PDE4B Hs.188
203710_at ITPR1 Hs.149900
203716_s_at DPP4 Hs.44926
203717_at DPP4 Hs.44926
203725_at GADD45A Hs.80409
203726_s_at LAMA3 Hs.83450
203753_at TCF4 Hs.359289
203757_s_at CEACAM6 Hs.436718
203758_at CTSO Hs.75262
203760_s_at SLA Hs.75367
203761_at SLA Hs.75367
203764_at DLG7 Hs.77695
203767_s_at STS Hs.79876
203768_s_at STS Hs.79876
203795_s_at BCL7A Hs.371758
203796_s_at BCL7A Hs.371758
203799_at DCL-1 Hs.2441
203802_x_at WBSCR20A Hs.272820
203819_s_at IMP-3 Hs.79440
203820_s_at IMP-3 Hs.79440
203821_at DTR Hs.799
203828_s_at NK4 Hs.943
203836_s_at MAP3K5 Hs.151988
203845_at PCAF Hs.203475
203853_s_at GAB2 Hs.30687
203859_s_at PALM Hs.78482
203860_at PCCA Hs.80741
203868_s_at VCAMl Hs.109225
203878_s_at MMP11 Hs.143751
203887_s_at THBD Hs.2030
203888_at THBD Hs.2030
203895_at PLCB4 Hs.151408 Table 1 (continued):
203911_at RAP1GA1 Hs.433797
203913_s_at HPGD Hs.77348
2039l4_x_at HPGD Hs.77348
203915_at CXCL9 Hs.77367
203921_at CHST2 Hs.8786
203922_s_at CYBB Hs.88974
203923_s_at CYBB Hs.88974
203925_at GCLM Hs.315562
203932_at HLA-DMB Hs.1162
203933_at Rabll-FIP3 Hs.119004
203936_s_at MMP9 Hs.151738
203939_at NT5E Hs.153952
203946_s_at ARG2 Hs.172851
203948_s_at MPO Hs.458272
203949_at MPO Hs.458272
203966_s_at PPM1A Hs.130036
203973_s_at KIAA0146 Hs.381058
203979_at CYP27A1 Hs.82568
203980_at FABP4 Hs.391561
203987_at FZD6 Hs.114218-
203989_x_at F2R Hs.128087
204004_at Hs.503576 // est
204006_s_at FCGR3A Hs.372679
204007_at FCGR3A Hs.372679
204011_at SPRY2 Hs.18676
204018_x_at HBA1 Hs.449630
204030_s_at SCHIP1 Hs.61490
204035_at SCG2 Hs.436577
204039_at CEBPA Hs.76171
204044_at QPRT Hs.8935
20405 l_s_at SFRP4 Hs.105700
204057_at ICSBP1 Hs.14453
204059_s_at ME1 Hs.14732
204069_at MEIS1 Hs.170177
204070_at RARRES3 Hs.17466
204073_s_at Cllorf9 Hs.184640
20408 l_at NRGN Hs.232004
204082_at PBX3 Hs.294101
204083_s_at TPM2 Hs.300772
204086_at PRAME Hs.30743
204099_at SMARCD3 Hs.444445
204103_at CCL4 Hs.75703
204112_s_at HNMT Hs.42151
204116_at IL2RG Hs.84
204118_at CD48 Hs.901
204122_at TYROBP Hs.9963
204131_s_at FOX03A Hs.423523
204132_s_at FOX03A Hs.423523
204134_at PDE2A Hs.154437
204141_at TUBB Hs.300701
204147_s_at TFDP1 Hs.79353
204150_at STAB1 Hs.301989
204151_x_at AKR1C1 Hs.295131
204153_s_at MFNG Hs.371768 204158_s_at TCIRG1 Hs.46465 204159_at CDKN2C Hs.4854 204160_s_at ENPP4 Hs.54037 204165_at WASF1 Hs.75850 204170_s_at CKS2 Hs.83758 204172_at CPO Hs.89866 204174_at ALOX5AP Hs.100194 204182_s_at ZNF297B Hs.355581 204187_at GMPR Hs.1435 204192_at CD37 Hs.153053 204197_s_at RUNX3 Hs.170019 Table 1 (continued):
204198_s_at RUNX3 Hs.170019
204203_at CEBPG Hs.2227
204214_s_at RAB32 Hs.32217
204222_s_at GLIPR1 Hs.401813
204224_s_at GCH1 Hs.86724
204232_at FCER1G Hs.433300
204235_s_at CED-6 Hs.107056
204237_at CED-6 Hs.107056
204254_s_at VDR Hs.2062
204257_at FADS3 Hs.21765
204259_at MMP7 Hs.2256
204270_at SKI Hs.2969
204285_s_at PMAIP1 Hs.96
204286_s_at PMAIP1 Hs.96
204298_s_at LOX Hs.102267
20430 l_at KIAA0711 Hs.5333
204304_s_at PROMl Hs.370052
204319_s_at RGS10 Hs.82280
204321_at NEOl Hs.388613
204326_x_at M 1X Hs.374950
204341_at TRIM16 Hs.241305
20435 l_at S100P Hs.2962
204362_at SCAP2 Hs.410745
204363_at F3 Hs.62192
204379_s_at FGFR3 Hs.1420
20438 l_at LRP3 Hs.143641
204385_at KYNU Hs.444471
204388_s_at MAOA Hs.183109
204392_at CAMKl Hs.434875
204396_s_at GPRK5 Hs.211569
204403_x_at KIAA0738 Hs.406492
204409_s_at EIF1AY Hs.205080
204410_at EIF1AY Hs.205080
204415_at G1P3 Hs.287721
204416_x_at APOCl Hs.268571
204419_x_at HBG2 Hs.302145
204420_at FOSLl Hs.283565
204429_s_at SLC2A5 Hs.33084
204430_s_at SLC2A5 Hs.33084
204438_at MRC1 Hs.75182
204439_at Clorf29 Hs.389724
204440_at CD83 Hs.79197
204445_s_at ALOX5 Hs.89499
204446_s_at ALOX5 Hs.89499
204447_at ProSAPiPl Hs.90232
20445 l_at FZD1 Hs.94234
204457_s_at GAS1 Hs.65029
204466_s_at SNCA Hs.76930
204467_s_at SNCA Hs.76930
204468_s_at TIE Hs.78824
204470_at CXCLl Hs.789
204490_s_at CD44 Hs.306278
204494_s_at LOC56905 Hs.306331
204497_at ADCY9 Hs.20196
204498_s_at ADCY9 Hs.20196
20450 l_at NOV Hs.235935
204502_at SAMHD1 Hs.371264
204505_s_at EPB49 Hs.274122
204517_at PPIC Hs.110364
204526_s_at TBC1D8 Hs.442657
204529_s_at TOX Hs.439767
204533_at CXCLIO Hs.413924
204537_s_at GABRE Hs.22785
204540_at EEF1A2 Hs.433839
204547_at RAB40B Hs.302498 Table 1 (continued):
204548_at STAR Hs.440760
204560_at FKBP5 Hs.7557
20456 l_x_at AP0C2 Hs.75615
204562_at IRF4 Hs.127686
204563_at SELL Hs.82848
204581_at CD22 Hs.262150
204588_s_at SLC7A7 Hs.194693
204604_at PFTK1 Hs.57856
204611_s_at PPP2R5B Hs.75199
204614_at SERPINB2 Hs.75716
204619_s_at CSPG2 Hs.434488
204620_s_at CSPG2 Hs.434488
20462 l_s_at NR4A2 Hs.82120
204622_x_at NR4A2 Hs.82120
204623_at TFF3 Hs.82961
204625_s_at ITGB3 Hs.87149
204626_s_at ITGB3 Hs.87149
204627_s_at ITGB3 Hs.87149
204628_s_at ITGB3 Hs.87149
204638_at ACP5 Hs.1211
204639_at ADA Hs.407135
204647_at H0MER3 Hs.410683
204655_at CCL5 Hs.241392
20466 l_at CDW52 Hs.276770
204670_x_at HLA-DRB4 Hs.449633
20467 l_s_at ANKRD6 Hs.30991
204677_at CDH5 Hs.76206
204679_at KCNK1 Hs.376874
204682_at LTBP2 Hs.83337
204684_at NPTX1 Hs.84154
204698_at ISG20 Hs.105434
204713_s_at F5 Hs.30054
204714_s_at F5 Hs.30054
204720_s_at DNAJC6 Hs.44896
204729_s_at STX1A Hs.75671
204736_s_at CSPG4 Hs.436301
204745_x_at MT1G Hs.433391
204747_at IFIT4 Hs.181874
204748_at PTGS2 Hs.196384
204749_at NAP1L3 Hs.21365
204750_s_at DSC2 Hs.95612
204751_x_at DSC2 Hs.95612
204753_s_at HLF Hs.250692
204755_x_at HLF Hs.250692
204774_at EVI2A Hs.70499
204777_s_at MAL Hs.80395
204787_at Z39IG Hs.8904
204788_s_at PPOX Hs.376314
204789_at FMNL Hs.100217
204790_at MADH7 Hs.370849
204793_at GASP Hs.113082
204794_at DUSP2 Hs.1183
204798_at MYB Hs.407830
204806_x_at HLA-F Hs.411958
204808_s_at TMEM5 Hs.112986
204811_s_at CACNA2D2 Hs.389415
204820_s_at BTN3A3 Hs.167741
204823_at NAV3 Hs.306322
204829_s_at FOLR2 Hs.433159
204834_at FGL2 Hs.351808
204848_x_at HBG1 Hs.449631
204858_s_at ECGF1 Hs.435067
204872_at BCE-1 Hs.99824
20488 l_s_at UGCG Hs.432605
204885_s_at MSLN Hs.408488 Table 1 (continued):
204890. s_at LCK Hs.1765 204891..s_at LCK Hs.1765 204896. s_at PTGER4 Hs.199248 204897. at PTGER4 Hs.199248 204899. ,s_at SAP30 Hs.413835 204900. x_at SAP30 Hs.413835 204908. s_at BCL3 Hs.31210 204912. at IL10RA Hs.327 204914. s_at S0X11 Hs.432638 204916..at RAMP1 Hs.32989 204917. s_at MLLT3 Hs.404 204923. at CXorf9 Hs.61469 204924. at TLR2 Hs.439608 204949. at ICAM3 Hs.353214 204951. at ARHH Hs.109918 204959. at MNDA Hs.153837 204961. s_at NCF1 Hs.1583 204971. at CSTA Hs.412999 204972..at OAS2 Hs.414332 204976. _s_at LOC286505 Hs.433256 // - 204984. at GPC4 Hs.58367 204990. _s_at ITGB4 Hs.85266 204992. _s_at PFN2 Hs.91747 204998. _s_at ATF5 Hs.9754 205000..at DDX3Y Hs.99120 205001..s_at DDX3Y Hs.99120 205012. _s_at HAGH Hs.155482 205019. _s_at VIPR1 Hs.348500 205020. _s_at ARL4 Hs.245540 205027. _s_at MAP3K8 Hs.432453 205033..s_at DEFAl Hs.274463 205035. at CTDP1 Hs.4076 205041. _s_at 0RM1 Hs.572 205047..s_at ASNS Hs.446546 205049..s_at CD79A Hs.79630 205051. _s_at KIT Hs.81665 205055..at ITGAE Hs.389133 205067. _at IL1B Hs.126256 205076. _s_at CRA Hs.425144 205081..at CRIP1 Hs.423190 205098..at CCR1 Hs.301921 205099. _s_at CCR1 Hs.301921 205110. _s_at FGF13 Hs.6540 205114. _s_at CCL3 Hs.73817 205118..at FPR1 Hs.753 205119. _s_at FPR1 Hs.753 205130..at RAGE Hs.104119 205131. _x_at SCGF Hs.105927 205157. _s_at KRT17 Hs.2785 205159..at CSF2RB Hs.285401 205174. _s_at QPCT Hs.79033 205179. _s_at ADAM8 Hs.86947 205193..at MAFF Hs.51305 205200..at TNA Hs.65424 205205..at RELB Hs.307905 205207..at IL6 Hs.130210 205213..at CENTB1 Hs.337242 205214..at STK17B Hs.88297 205220..at HM74 Hs.458425 205227..at IL1RAP Hs.143527 205229. _s_at COCH Hs.21016 205230..at RPH3A Hs.21239 205237..at FCN1 Hs.440898 205239..at AREG Hs.270833 205240. at LGN Hs.278338 Table 1 (continued):
205241. at SC02 Hs.410944 205249. .at EGR2 Hs.1395 205254. x_at TCF7 Hs.169294 205255. x_at TCF7 Hs.169294 205262. .at KCNH2 Hs.188021 205266. at LIF Hs.2250 205267. .at P0U2AF1 Hs.2407 205268. s_at ADD2 Hs.113614 205270. ,s_at LCP2 Hs.2488 205278. .at GAD1 Hs.420036 205281. s_at PIGA Hs.51 205289. at BMP2 Hs.73853 205297. .s_at CD79B Hs.89575 205312. at SPI1 Hs.157441 205321. at EIF2S3 Hs.433518 205328. at CLDN10 Hs.26126 205330. at MN1 Hs.268515 205348. s_at DNCI1 Hs.65248 205349. at GNA15 Hs.73797 205353. .s_at PBP Hs.433863 205361. .s_at PFDN4 Hs.91161 205366. s_at H0XB6 Hs.98428 205382. s_at DF Hs.155597 205389. s_at ANK1 Hs.443711 205390. s_at ANK1 Hs.443711 205391. x_at ANK1 Hs.443711 205392. .s_at CCL15 Hs.272493 205400. .at WAS Hs.2157 205402. x_at PRSS2 Hs.367767 205403. at IL1R2 Hs.25333 205409. at F0SL2 Hs.301612 205414. s_at KIAA0672 Hs.6336 205419. at EBI2 Hs.784 205445. .at PRL Hs.1905 205453. at H0XB2 Hs.290432 205456. at CD3E Hs.3003 205463. .s_at PDGFA Hs.376032 205466. _s_at HS3ST1 Hs.40968 205469. s_at IRF5 Hs.334450 205471. s_at DACH Hs.63931 205472. s_at DACH Hs.63931 205476. at CCL20 Hs.75498 205479. s_at PLAU Hs.77274 205483. s_at G1P2 Hs.458485 205484. at SIT Hs.88012 205488. .at GZMA Hs.90708 205495. s_at GNLY Hs.105806 205513. at TCN1 Hs.2012 205528. _s_at CBFA2T1 Hs.90858 205529. _s_at CBFA2T1 Hs.90858 205544. .s_at CR2 Hs.73792 205547. _s_at TAGLN Hs.433401 205550. .s_at BRE Hs.80426 205552. .s_at 0AS1 Hs.442936 205557. .at BPI Hs.303523 205568. at AQP9 Hs.104624 205570. at PIP5K2A Hs.108966 205572. .at ANGPT2 Hs.115181 205582. .s_at GGTLA1 Hs.437156 205590. at RASGRP1 Hs.189527 205592. .at SLC4A1 Hs.443948 205593. .s_at PDE9A Hs.389777 205599. at TRAF1 Hs.438253 205608. .s_at ANGPT1 Hs.2463 205609. at ANGPT1 Hs.2463 Table 1 (continued):
205612_at MMRN Hs.268107
205614_x_at MSTl Hs.349110
205624_at CPA3 Hs.646
205627_at CDA Hs.72924
205632_s_at PIP5K1B Hs.297604
205633_s_at ALAS1 Hs.78712
205653_at CTSG Hs.421724
205660_at OASL Hs.118633
205668_at LY75 Hs.153563
20568 l_at BCL2A1 Hs.227817
205683_x_at TPSB2 Hs.405479
205707_at IL17R Hs.129751
205712_at PTPRD Hs.323079
205715_at BST1 Hs.169998
205717_x_at PCDHGC3 Hs.283794
205718_at ITGB7 Hs.1741
205721_at Hs.441202 // est
205739_x_at ZFD25 Hs.50216
205743_at STAC Hs.56045
205758_at CD8A Hs.85258
205767_at EREG Hs.115263
205769_at SLC27A2 Hs.11729
205780_at BIK Hs.155419
205786_s_at ITGAM Hs.172631
205789_at CD ID Hs.1799
205790_at SCAPl Hs.411942
205798_at IL7R Hs.362807
20580 l_s_at RASGRP3 Hs.24024
205819_at MARCO Hs.67726
20582 l_at D12S2489E Hs.387787
205826_at MYOM2 Hs.443683
205831_at CD2 Hs.89476
205837_s_at GYPA Hs.34287
205838_at GYPA Hs.34287
205839_s_at BZRAP1 Hs.112499
205844_at VNN1 Hs.12114
205848_at GAS2 Hs.135665
205856_at SLC14A1 Hs.101307
205857_at SLC18A2 Hs.50458
205859_at LY86 Hs.184018
205861_at SPIB Hs.437905
205863_at S100A12 Hs.19413
205879_x_at RET Hs.350321
205882_x_at ADD3 Hs.324470
205884_at ITGA4 Hs.145140
205891_at ADORA2B Hs.45743
205896_at SLC22A4 Hs.441130
205898_at CX3CR1 Hs.78913
205899_at CCNA1 Hs.417050
205900_at KRT1 Hs.80828
20590 l_at PNOC Hs.371809
205919_at HBE1 Hs.117848
205922_at VNN2 Hs.293130
205927_s_at CTSE Hs.1355
205929_at GPA33 Hs.437229
205933_at SETBP1 Hs.201369
205935_at FOXF1 Hs.155591
205936_s_at HK3 Hs.411695
205942_s_at SAH Hs.409501
205944_s_at CLTCLl Hs.184916
205950_s_at CA1 Hs.23118
205960_at PDK4 Hs.8364
205983_at DPEP1 Hs.109
205984_at CRHBP Hs.115617
205987_at CDIC Hs.1311 Table 1 (continued):
206001_at NPY Hs.1832
206011_at CASP1 Hs.2490
206025_s_at TNFAIP6 Hs.407546
206026_s_at TNFAIP6 Hs.407546
206034_at SERPINB8 Hs.368077
206039_at RAB33A Hs.56294
206042_x_at SNRPN Hs.48375
206046_at ADAM23 Hs.432317
206049_at SELP Hs.73800
206059_at ZNF91 Hs.8597
206067_s_at WT1 Hs.1145
206070_s_at EPHA3 Hs.123642
206074_s_at HMGA1 Hs.57301
206077_at KEL Hs.420322
206093_x_at TNXB Hs.411644
206106_at MAPK12 Hs.432642
206108_s_at SFRS6 Hs.6891
206110_at HIST1H3H Hs.70937
206111_at RNASE2 Hs.728
206115_at EGR3 Hs.74088
206118_at STAT4 Hs.80642
206130_s_at ASGR2 Hs.1259
206134_at ADAMDECl Hs.145296
206135_at ST 18 Hs.151449
206145_at RHAG Hs.368178
206146_s_at RHAG Hs.368178
206148_at IL3RA Hs.389251
206150_at TNFRSF7 Hs.355307
206157_at PTX3 Hs.2050
206159_at GDF10 Hs.2171
206167_s_at ARHGAP6 Hs.250830
206169_x_at RoXaN Hs.25347
206177_s_at ARG1 Hs.440934
206187_at PTGIR Hs.393
206196_s_at RPIP8 Hs.6755
206206_at LY64 Hs.87205
206207_at CLC Hs.889
206222_at TNFRSF10C Hs.119684
206232_s_at B4GALT6 Hs.369994
206233_at B4GALT6 Hs.369994
206235_at LIG4 Hs.166091
206244_at CR1 Hs.334019
206245_s_at ΓVNSIABP Hs.197298
206255_at BLK Hs.389900
206277_at P2RY2 Hs.339
206279_at PRKY Hs.183165
20628 l_at ADCYAP1 Hs.68137
206283_s_at TALI Hs.498079
206298_at RhoGAP2 Hs.87241
206302_s_at NUDT4 Hs.355399
206303_s_at NUDT4 Hs.355399
206304_at MYBPH Hs.927
206310_at SPINK2 Hs.98243
206331_at CALCRL Hs.152175
206332_s_at IFI16 Hs.370873
206337_at CCR7 Hs.1652
206341_at IL2RA Hs.130058
206342_x_at IDS Hs.352304
206343_s_at NRG1 Hs.172816
206359_at S0CS3 Hs.436943
206360_s_at SOCS3 Hs.436943
20636 l_at GPR44 Hs.299567
206363_at MAF Hs.134859
206366_x_at XCL1 Hs.174228
206367_at REN Hs.3210 Table 1 (continued):
206371.at F0LR3 Hs.352 206372.at MYF6 Hs.35937 206374.at DUSP8 Hs.41688 206377.at F0XF2 Hs.44481 206380. _s_at PFC Hs.53155 206381. .at SCN2A2 Hs.435796 206390.x_at PF4 Hs.81564 206398.s_at CD19 Hs.96023 206404. .at FGF9 Hs.lll 206420. at IGSF6 Hs.135194 206433. .s_at SP0CK3 Hs.159425 206453. .s_at NDRG2 Hs.243960 206461. _x_at MT1H Hs.438462 206464. at BMX Hs.27372 206471. _s_at PLXNCl Hs.286229 206472. _s_at TLE3 Hs.287362 206478. at E3AA0125 Hs.38365 206485. .at CD5 Hs.58685 206488. .s_at CD36 Hs.443120 206491. _s_at NAPA Hs.75932 206493. at ITGA2B Hs.411312 206494. _s_at ITGA2B Hs.411312 206508. .at TNFSF7 Hs.99899 206513. .at AIM2 Hs.105115 206515. .at CYP4F3 Hs.106242 206519. _x_at SIGLEC6 Hs.397255 206520. _x_at SIGLEC6 Hs.397255 206522. .at MGAM Hs.122785 206545. .at CD28 Hs.1987 206546. .at SYCP2 Hs.202676 206574. _s_at PTP4A3 Hs.43666 206580. _s_at EFEMP2 Hs.381870 206582. _s_at GPR56 Hs.6527 206584. .at LY96 Hs.69328 206589. .at GFI1 Hs.73172 206591. .at RAG1 Hs.73958 206618. .at IL18R1 Hs.159301 206622. .at TRH Hs.182231 206624. .at USP9Y Hs.371255 206631. .at PTGER2 Hs.2090 206632. _s_at AP0BEC3B Hs.226307 206634. .at SIX3 Hs.227277 206637. .at GPR105 Hs.2465 206643. .at HAL Hs.190783 206647. .at HBZ Hs.272003 206655. _s_at PNUTL1 Hs.283743 206660. .at IGLL1 Hs.348935 206662. .at GLRX Hs.28988 206665. _s_at BCL2L1 Hs.305890 206666. .at GZMK Hs.277937 206674. .at FLT3 Hs.385 206676. .at CEACAM8 Hs.41 206682. .at CLECSF13 Hs.54403 206697. _s_at HP Hs.403931 206698. .at XK Hs.78919 206700. _s_at SMCY Hs.80358 206707. _x_at C6orf32 Hs.389488 206710. _s_at EPB41L3 Hs.103839 206724. .at CBX4 Hs.5637 206726. .at PGDS Hs.128433 206752. _s_at DFFB Hs.133089 206759 .at FCER2 Hs.1416 206760. _s_at FCER2 Hs.1416 206761. .at TACTILE Hs.142023 206762. .at KCNA5 Hs.150208 Table 1 (continued):
206765. .at KCNJ2 Hs.1547 206788. .s_at CBFB Hs.179881 206793. at PNMT Hs.1892 206804. at CD3G Hs.2259 206834. at HBD Hs.36977 206851. .at RNASE3 Hs.73839 206857. .s_at FKBP1B Hs.306834 206858. s_at H0XC6 Hs.820 206871. at ELA2 Hs.99863 206877. at MAD Hs.379930 206881. .s_at LILRA3 Hs.113277 206918. .s_at RBM12 Hs.166887 206924. at IL11 Hs.1721 206932. at CH25H Hs.47357 206934. at SIRPB1 Hs.194784 206937. .at SPTA1 Hs.418378 206940. _s_at P0U4F1 Hs.458303 206950. .at SCN9A Hs.2319 206951. .at HIST1H4E Hs.240135 206953. _s_at LPHN2 Hs.24212 206978. .at CCR2 Hs.395 206991. _s_at CCR5 Hs.54443 206999. at IL12RB2 Hs.413608 207001. _x_at DSIPI Hs.420569 207008. at IL8RB Hs.846 207030. _s_at CSRP2 Hs.10526 207031. .at BAPX1 Hs.105941 207034. _s_at GLK Hs.111867 207038. .at SLC16A6 Hs.42645 207043. _s_at SLC6A9 Hs.442590 207067. _s_at HDC Hs.1481 207072. at IL18RAP Hs.158315 207075. at CIAS1 Hs.159483 207076. _s_at ASS Hs.160786 207085. _x_at CSF2RA Hs.227835 207087. _x_at ANK1 Hs.443711 207090. _x_at ZFP30 Hs.276763 207094. .at IL8RA Hs.194778 207104. x_at LILRB1 Hs.149924 207111. at EMR1 Hs.2375 207113. _s_at TNF Hs.241570 207117. .at H-plk Hs.250693 207134. _x_at TPSB2 Hs.405479 207161. at KIAA0087 Hs.69749 207172. _s_at CDH11 Hs.443435 207173. .x_at CDH11 Hs.443435 207206. _s_at AL0X12 Hs.1200 207216. .at TNFSF8 Hs.177136 207224. .s_at SIGLEC7 Hs.274470 207237. .at KCNA3 Hs.169948 207269. .at DEPA4 Hs.2582 207275. _s_at FACL2 Hs.406678 207292. _s_at MAPK7 Hs.150136 207316. .at HAS1 Hs.57697 207329. .at MMP8 Hs.390002 207332. _s_at TFRC Hs.185726 207339. _s_at LTB Hs.376208 207341. .at PRTN3 Hs.928 207357. _s_at GALN 10 Hs.13785 207358. _x_at MACF1 Hs.372463 207376. .at VENTX2 Hs.125231 207384. .at PGLYRP Hs.137583 207387. .s_at GK Hs.1466 207389. .at GP1B Hs.1472 207419. _s_at RAC2 Hs.301175 Table 1 (continued):
207425.s_at MSF Hs.288094 207433.at IL10 Hs.193717 207435.s_at SRRM2 Hs.433343 207459.x_at GYPB Hs.438658 207467.x_at CAST Hs.440961 207496. at MS4A2 Hs.386748 207509. s_at LAIR2 Hs.43803 207511. _s_at CGI-57 Hs.4973 207522. s_at ATP2A3 Hs.5541 207526. s_at IL1RL1 Hs.66 207533. at CCLl Hs.72918 207535. .s_at NFKB2 Hs.73090 207540. -S_at SYK Hs.192182 207542. _s_at A P1 Hs.76152 207550. .at MPL Hs.84171 207571. _x_at Clorf38 Hs.10649 207574. .s_at GADD45B Hs.110571 207605. _x_at H-plk Hs.250693 207610. _s_at EMR2 Hs.137354 207651. .at H963 Hs.159545 207655. _s_at BLNK Hs.167746 207667. _s_at MAP2K3 Hs.180533 207674. .at FCAR Hs.193122 207675. _x_at ARTN Hs.194689 207677. .s_at NCF4 Hs.196352 207691. _x_at ENTPD1 Hs.205353 207695. .s_at IGSF1 Hs.22111 207697. _x_at LILRB3 Hs.306230 207705. _s_at KIAA0980 Hs.227743 207741. _x_at TPSB2 Hs.405479 207793. _s_at EPB41 Hs.37427 207794. .at CCR2 Hs.395 207795. _s_at KLRD1 Hs.41682 207801. _s_at RNF10 Hs.387944 207802. .at SGP28 Hs.404466 207826. _s_at ID3 Hs.76884 207827. _x_at SNCA Hs.76930 207836. _s_at RBPMS Hs.195825 207838. _x_at PBXIP1 Hs.8068 207850. .at CXCL3 Hs.89690 207854. .at GYPE Hs.395535 207857. .at LILRB1 Hs.149924 207872. _s_at LILRB1 Hs.149924 207890. _s_at MMP25 Hs.290222 207911. _s_at TGM5 Hs.129719 207938. .at PI15 Hs.129732 207978. _s_at NR4A3 Hs.279522 207979. _s_at CD8B1 Hs.405667 207983. _s_at STAG2 Hs.8217 208018. _s_at HCK Hs.89555 208029. _s_at LAPTM4B Hs.296398 208034. _s_at PROZ Hs.1011 208056. _s_at CBFA2T3 Hs.110099 208067. _x_at UTY Hs.115277 208071. _s_at LAIRl Hs.407964 208078. _s_at TCF8 Hs.232068 208091. _s_at DKFZP564K0822 Hs.4750 208112. .x_at EHD1 Hs.155119 208116. _s_at MAN1A1 Hs.255149 208120. _x_at ... // ... 208130. _s_at TBXAS1 Hs.444510 208131. _s_at PTGIS Hs.302085 208132. .x_at BAT2 Hs.436093 208146. _s_at CPVL Hs.95594 208151 _x_at DDX17 Hs.349121 Table 1 (continued):
208161_s_at ABCC3 Hs.90786
208187_s_at ... // ...
208248_x_at APLP2 Hs.279518
208255_s_at FKBP8 Hs.173464
208296_x_at GG2-1 Hs.17839
208304_at CCR3 Hs.506190
208306_x_at HLA-DRB4 Hs.449633
208335_s_at FY Hs.183
208352_x_at ANK1 Hs.443711
208353_x_at ANK1 Hs.443711
208370_s_at DSCR1 Hs.282326
208416_s_at SPTB Hs.438514
208436_s_at IRF7 Hs.166120
208438_s_at FGR Hs.1422
208443_x_at SHOX2 Hs.55967
208450_at LGALS2 Hs.113987
20845 l_s_at C4A Hs.150833
208459_s_at XP07 Hs.172685
208470_s_at HP Hs.403931
208476_s_at FLJ10210 Hs.171532
208488_s_at CR1 Hs.334019
208490_x_at HIST1H2BF Hs.182137
208498_s_at AMY1A Hs.274376
208501_at GFI1B Hs.118539
208502_s_at PITX1 Hs.84136
208523_x_at HIST1H2BI Hs.182140
208527_x_at HIST1H2BE Hs.182138
208534_s_at POLR2J2 Hs.433879
208540_x_at ... // ...
208546_x_at HIST1H4G Hs.247815
208553_at HIST1H1E Hs.248133
208579_x_at H2BFS Hs.473961
20858 l_x_at MT1X Hs.374950
208592_s_at CD IE Hs.249217
208594_x_at LILRB3 Hs.306230
20860 l_s_at TUBB1 Hs.303023
208602_x_at CD6 Hs.436949
208605_s_at NTRK1 Hs.406293
208609_s_at TNXB Hs.411644
208613_s_at FLNB Hs.81008
208614_s_at FLNB Hs.81008
20862 l_s_at VIL2 Hs.403997
208622_s_at VIL2 Hs.403997
208623_s_at VIL2 Hs.403997
20863 l_s_at HADHA Hs.75860
208632_at RNF10 Hs.387944
208633_s_at MACF1 Hs.372463
208634_s_at MACF1 Hs.372463
208636_at na Hs.447510 //
208646_at RPS14 Hs.381126
208650_s_at CD24 Hs.375108
208651_x_at CD24 Hs.375108
208653_s_at CD 164 Hs.43910
208657_s_at MSF Hs.288094
208677_s_at BSG Hs.371654
208683_at CAPN2 Hs.350899
208690_s_at PDLIM1 Hs.75807
20869 l_at TFRC Hs.185726
208702_x_at APLP2 Hs.279518
208703_s_at APLP2 Hs.279518
208704_x_at APLP2 Hs.279518
208711_s_at CCND1 Hs.371468
208712_at CCND1 Hs.371468
208719_s_at DDX17 Hs.349121
208729_x_at HLA-B Hs.77961 Table 1 (continued):
208744_x_at HSPH1 Hs.36927
208747_s_at CIS Hs.458355
20875 l_at NAPA Hs.75932
208767_s_at LAPTM4B Hs.296398
208771_s_at LTA4H Hs.81118
208782_at FSTL1 Hs.433622
208789_at PTRF Hs.437191
208791_at CLU Hs.436657
208792_s_at CLU Hs.436657
208797_s_at GOLGIN-67 Hs.182982
208798_x_at GOLGIN-67 Hs.182982
208812_x_at HLA-C Hs.274485
208820_at PTK2 Hs.434281
208827_at PSMB6 Hs.77060
208854_s_at STK24 Hs.168913
208855_s_at STK24 Hs.168913
208869_s_at GABARAPLl Hs.336429
208886_at H1F0 Hs.226117
208890_s_at PLXNB2 Hs.3989
20889 l_at DUSP6 Hs.298654
208892_s_at DUSP6 Hs.298654
208893_s_at DUSP6 Hs.298654
208894_at HLA-DRA Hs.409805
208906_at BSCL2 Hs.438912
208914_at GGA2 Hs.133340
208924_at RNF11 Hs.96334
208928_at POR Hs.354056
208937_s_at ID1 Hs.410900
208949_s_at LGALS3 Hs.411701
208953_at KIAA0217 Hs.192881
208960_s_at COPEB Hs.285313
20896 l_s_at COPEB Hs.285313
208962_s_at FADS1 Hs.132898
208965_s_at IFI16 Hs.370873
208966_x_at IPI16 Hs.370873
208970_s_at UROD Hs.78601
208971_at UROD Hs.78601
208978_at CRIP2 Hs.70327
20898 l_at PECAM1 Hs.78146
208982_at PECAM1 Hs.78146
208983_s_at PECAM1 Hs.78146
208997_s_at UCP2 Hs.80658
209007_s_at DJ465N24.2.1 Hs.259412
209018_s_at PINK1 Hs.439600
209022_at STAG2 Hs.8217
209023_s_at STAG2 Hs.8217
209030_s_at IGSF4 Hs.156682
209031_at IGSF4 Hs.156682
209032_s_at IGSF4 Hs.156682
209035_at MDK Hs.82045
209037_s_at EHD1 Hs.155119
209039_x_at EHD1 Hs.155119
209040_s_at PSMB8 Hs.180062
209046_s_at GABARAPL2 Hs.6518
209047_at AQP1 Hs.76152
209079_x_at PCDHGC3 Hs.283794
209081_s_at COL18A1 Hs.413175
209083_at COROIA Hs.415067
209086_x_at MCAM Hs.211579
209087_x_at MCAM Hs.211579
209094_at DDAH1 Hs.380870
209098_s_at JAG1 Hs.409202
209099_x_at JAG1 Hs.409202
209101_at CTGF Hs.410037
209116_x_at HBB Hs.155376 Table 1 (continued):
209117_at WBP2 Hs.231840
209118_s_at TUBA3 Hs.433394
209122_at ADFP Hs.3416
209129_at TRIP6 Hs.380230
209138_x_at — Hs.505407
209140_x_at HLA-B Hs.77961
209152_s_at TCF3 Hs.371282
209153_s_at TCF3 Hs.371282
209156_s_at COL6A2 Hs.420269
209160_at AKR1C3 Hs.78183
209167_at GPM6B Hs.5422
209168_at GPM6B Hs.5422
209170_s_at GPM6B Hs.5422
209173_at AGR2 Hs.226391
209182_s_at DEPP Hs.93675
209183_s_at DEPP Hs.93675
209184_s_at IRS2 Hs.143648
209185_s_at IRS2 Hs.143648
209189_at FOS Hs.25647
209191_at TUBB-5 Hs.274398
209193_at PIMl Hs.81170
209199_s_at MEF2C Hs.368950
209200_at MEF2C Hs.368950
20920 l_x_at CXCR4 Hs.421986
209205_s_at LM04 Hs.3844
209208_at MPDUl Hs.6710
209216_at JM5 Hs.21753
209217_s_at JM5 Hs.21753
209239_at NFKB1 Hs.160557
209250_at DEGS Hs.299878
209264_s_at TM4SF7 Hs.26518
209267_s_at BIGM103 Hs.284205
209273_s_at MGC4276 Hs.270013
209274_s_at MGC4276 Hs.270013
209276_s_at GLRX Hs.28988
209281_s_at ATP2B1 Hs.20952
209282_at PRKD2 Hs.205431
209285_s_at RAP 140 Hs.23440
209286_at CDC42EP3 Hs.352554
209287_s_at CDC42EP3 Hs.352554
209288_s_at CDC42EP3 Hs.352554
209297_at ITSN1 Hs.66392
20930 l_at CA2 Hs.155097
209304_x_at GADD45B Hs.110571
209305_s_at GADD45B Hs.110571
209312_x_at HLA-DRB3 Hs.308026
209318_x_at PLAGL1 Hs.132911
209325_s_at RGS16 Hs.413297
209339_at SIAH2 Hs.20191
209340_at UAP1 Hs.21293
209344_at TPM4 Hs.250641
209348_s_at MAF Hs.134859
209357_at CITED2 Hs.82071
209360_s_at RUNX1 Hs.410774
209367_at STXBP2 Hs.379204
209369_at ANXA3 Hs.442733
209374_s_at IGHM Hs.153261
209377_s_at HMGN3 Hs.77558
209383_at DDIT3 Hs.392171
209386_at TM4SF1 Hs.351316
209387_s_at TM4SF1 Hs.351316
209392_at ENPP2 Hs.23719
209394_at ASMTL Hs.458420
209395_at CHI3L1 Hs.382202
209396_s_at CHI3L1 Hs.382202 Table 1 (continued):
209398_at HIST1H1C Hs.7644
209436_at SPON1 Hs.5378
209437_s_at SPON1 Hs.5378
209452_s_at VTI1B Hs.419995
209457_at DUSP5 Hs.2128
209458_x_at HBA1 Hs.449630
209473_at ENTPD1 Hs.205353
209474_s_at ENTPD1 Hs.205353
209480_at HLA-DQB1 Hs.409934
209487_at RBPMS Hs.195825
209488_s_at RBPMS Hs.195825
209498_at CEACAMl Hs.434918
209499_x_at TNFSF13 Hs.54673
209500_x_at TNFSF13 Hs.54673
209514_s_at RAB27A Hs.298530
209515_s_at RAB27A Hs.298530
209524_at HDGFRP3 Hs.127842
209526_s_at HDGFRP3 Hs.127842
209536_s_at EHD4 Hs.55058
209540_at IGF1 Hs.308053
209541_at IGF1 Hs.308053
209542_x_at IGF1 Hs.308053
209543_s_at CD34 Hs.374990
209545_s_at RIPK2 Hs.103755
209555_s_at CD36 Hs.443120
209560_s_at DLK1 Hs.169228
20956 l_at THBS3 Hs.169875
209568_s_at RGL Hs.79219
209576_at GNAI1 Hs.203862
20958 l_at HRASLS3 Hs.417630
209582_s_at MOX2 Hs.79015
209583_s_at MOX2 Hs.79015
209585_s_at MINPP1 Hs.95907
209587_at PITX1 Hs.84136
209598_at PNMA2 Hs.7782
209604_s_at GATA3 Hs.169946
209606_at PSCDBP Hs.270
209615_s_at PAK1 Hs.64056
209616_s_at CES1 Hs.278997
209619_at CD74 Hs.446471
209627_s_at OSBPL3 Hs.197955
209628_at NXT2 Hs.25010
209629_s_at NXT2 Hs.25010
209636_at NFKB2 Hs.73090
209651_at TGFB1I1 Hs.25511
209652_s_at PGF Hs.252820
209670_at TRA@ Hs.74647
20967 l_x_at TRA@ Hs.74647
209676_at TFPI Hs.102301
209679_s_at LOC57228 Hs.206501
209686_at S100B Hs.422181
209687_at CXCL12 Hs.436042
209695_at PTP4A3 Hs.43666
209696_at FBP1 Hs.360509
209699_x_at AKR1C2 Hs.201967
209702_at FTO Hs.284741
209706_at NKX3-1 Hs.55999
209710_at GATA2 Hs.367725
209716_at CSF1 Hs.173894
209717_at — Hs.387251
209727_at GM2A Hs.387156
209728_at HLA-DRB4 Hs.449633
209732_at CLECSF2 Hs.85201
209735_at ABCG2 Hs.194720
209757_s_at MYCN Hs.25960 Table 1 (continued):
209763. .at NRLN1 Hs.440324 209771.x_at — Hs.376280 // — 209772. .s_at CD24 Hs.375108 209773.s_at RRM2 Hs.226390 209774.x_at CXCL2 Hs.75765 209790.s_at CASP6 Hs.3280 209791. at PADI2 Hs.33455 209795. at CD69 Hs.82401 209803. s_at TSSC3 Hs.154036 209806. at HIST1H2BK Hs.247817 209813. x_at — Hs.407442 209815. .at na Hs.454253 // — 209822. _s_at VLDLR Hs.370422 209823. x_at HLA-DQB1 Hs.409934 209829. at C6orf32 Hs.389488 209835. _x_at CD44 Hs.306278 209845. at MKRNl Hs.7838 209863. _s_at TP73L Hs.137569 209870. _s_at APBA2 Hs.26468 209875. _s_at SPP1 Hs.313 209879. .at SELPLG Hs.423077 209881. _s_at LAT Hs.437775 209884. _s_at SLC4A7 Hs.250072 209890. .at TM4SF9 Hs.8037 209892. .at FUT4 Hs.390420 209893. _s_at FUT4 Hs.390420 209894. .at LEPR Hs.23581 209900. _s_at SLC16A1 Hs.75231 209901. -X_at AIF1 Hs.76364 209905. .at H0XA9 Hs.127428 209906. .at C3AR1 Hs.155935 209911. _x_at HIST1H2BD Hs.180779 209921. .at SLC7A11 Hs.6682 209930. _s_at NFE2 Hs.75643 209949. .at NCF2 Hs.949 209950. _s_at VILL Hs.103665 209959. .at NR4A3 Hs.279522 209960. .at HGF Hs.396530 209961. _s_at HGF Hs.396530 209962. .at EPOR Hs.127826 209963. _s_at EPOR Hs.127826 209967. .s_at CREM Hs.231975 209968. _s_at NCAM1 Hs.78792 209969. _s_at STATl Hs.21486 209982. _s_at NRXN2 Hs.124085 209993. .at ABCB1 Hs.21330 209994. _s_at ABCBl Hs.21330 209995. _s_at TCL1A Hs.2484 210001. _s_at SOCS1 Hs.50640 210004. .at OLR1 Hs.445299 210016. .at MYT1L Hs.434418 210024. _s_at UBE2E3 Hs.4890 210031. .at CD3Z Hs.97087 210032. _s_at SPAG6 Hs.158213 210033. _s_at SPAG6 Hs.158213 210036. _s_at KCNH2 Hs.188021 210038. .at PRKCQ Hs.408049 210042. _s_at CTSZ Hs.252549 210074. .at CTSL2 Hs.87417 210075. .at LOC51257 Hs.331308 210084. _x_at TPSB2 Hs.405479 210088. _x_at MYL4 Hs.356717 210095. _s_at IGFBP3 Hs.440409 210102. .at LOH11CR2A Hs.152944 210105. _s_at FYN Hs.390567 Table 1 (continued):
210107.at CLCAl Hs.194659 210113.s_at DEFCAP Hs.104305 210116.at SH2D1A Hs.151544 210118.s_at ILIA Hs.1722 210123. .s_at CHRNA7 Hs.2540 210134.x_at SH0X2 Hs.55967 210135.s_at SH0X2 Hs.55967 210139.s_at PMP22 Hs.372031 210140. at CST7 Hs.143212 210142. x_at FL0T1 Hs.179986 210146. x_at LILRB3 Hs.306230 210151. s_at DYRK3 Hs.164267 210152. at LILRB4 Hs.67846 210164. at GZMB Hs.1051 210166. at TLR5 Hs.114408 210172. .at SF1 Hs.440835 210190. .at STX11 Hs.118958 210215. .at TFR2 Hs.63758 210222. _s_at RTN1 Hs.99947 210225. _x_at LILRB3 Hs.306230 210230. .at ... // ... 210237. .at ARTN Hs.194689 210239. .at IRX5 Hs.25351 210244. .at CAMP Hs.51120 210247. .at SYN2 Hs.445503 210254. .at MS4A3 Hs.99960 210260. -S_at GG2-1 Hs.17839 210262. .at TPX1 Hs.2042 210264. .at GPR35 Hs.239891 210269. .s_at DXYS155E Hs.21595 210279. .at GPR18 Hs.88269 210298. _x_at FHL1 Hs.421383 210299. _s_at FHL1 Hs.421383 210313. .at LIR9 Hs.406708 210314. _x_at TNFSF13 Hs.54673 210321. .at GZMH Hs.348264 210340. .s_at CSF2RA Hs.227835 210356. _x_at MS4A1 Hs.438040 210357. _s_at C20orfl6 Hs.433337 210368. .at PCDHGC3 Hs.283794 210387. .at HIST1H2BG Hs.352109 210395. _x_at MYL4 Hs.356717 210397. .at DEFB1 Hs.32949 210422. _x_at SLC11A1 Hs.135163 210423. _s_at SLC11A1 Hs.135163 210425. _x_at GOLGIN-67 Hs.356225 210426. _x_at RORA Hs.388617 210427. _x_at ANXA2 Hs.437110 210429. .at RHD Hs.458333 210430. _x_at RHD Hs.283822 210432. _s_at SCN3A Hs.300717 210446. .at GATA1 Hs.765 210448. _s_at P2RX5 Hs.408615 210461. _s_at ABLIMl Hs.442540 210473. _s_at GPR125 Hs.356876 210479. _s_at RORA Hs.388617 210487. .at DNTT Hs.397294 210495. _x_at FN1 Hs.418138 210504. .at KLF1 Hs.37860 210508. _s_at KCNQ2 Hs.4975 210512 _s_at VEGF Hs.73793 210514. _x_at HLA-A Hs.181244 210517. _s_at AKAP12 Hs.197081 210524. _x_at MT1F Hs.438737 210538. _s_at BIRC3 Hs.127799 Table 1 (continued):
210546_x_at CTAG1 Hs.167379 210548..at CCL23 Hs.169191 210549..s_at CCL23 Hs.169191 210554.s_at CTBP2 Hs.171391 210561.s_at WSB1 Hs.315379 210582.,s_at LIMK2 Hs.278027 210586.x_at RHD Hs.458333 210605.s_at MFGE8 Hs.3745 210606.x_at KLRD1 Hs.41682 210612.s_at SYNJ2 Hs.434494 210638.s_at FBX09 Hs.388387 210640. s_at GPR30 Hs.113207 210649..s_at SMARCFl Hs.170333 210655..s_at F0X03A Hs.14845 210660. at LILRB1 Hs.149924 210663. .s_at KYNU Hs.444471 210664._s_at TFPI Hs.102301 210665..at TFPI Hs.102301 210666. at IDS Hs.352304 210681. _s_at USP15 Hs.339425 210693. at SPPL2B Hs.284161 210724. at EMR3 Hs.438468 210744. _s_at IL5RA Hs.68876 210746._s_at EPB42 Hs.368642 210755..at HGF Hs.396530 210756._s_at N0TCH2 Hs.8121 210762._s_at DLC1 Hs.8700 210772. at FPRL1 Hs.99855 210773. _s_at FPRL1 Hs.99855 210783..x_at SCGF Hs.105927 210784._x_at LILRB3 Hs.306230 210785._s_at Clorf38 Hs.10649 210786._s_at FLU Hs.257049 210794._s_at MEG3 Hs.418271 210796._x_at SIGLEC6 Hs.397255 210815._s_at CALCRL Hs.152175 210825._s_at STOM Hs.439776 210835._s_at CTBP2 Hs.171391 210839..s_at ENPP2 Hs.23719 210840._s_at I GAP1 Hs.1742 210844._x_at CTNNA1 Hs.254321 210845._s_at PLAUR Hs.179657 210854._x_at SLC6A8 Hs.388375 210869._s_at MCAM Hs.211579 210873._x_at APOBEC3A Hs.348983 210889._s_at FCGR2B Hs.126384 210895._s_at CD86 Hs.27954 210904._s_at IL13RA1 Hs.285115 210915._x_at TRB® Hs.419777 210916..s_at CD44 Hs.306278 210948._s_at LEF1 Hs.44865 210951._x_at RAB27A Hs.298530 210972._x_at TRA@ Hs.74647 210973..s_at FGFR1 Hs.748 210976 _s_at PFKM Hs.75160 210982_s_at HLA-DRA Hs.409805 210986._s_at TPM1 Hs.133892 210987._x_at ... // ... 210992_x_at FCGR2B Hs.126384 210993._s_at MADH1 Hs.388294 210997..at HGF Hs.396530 210998,_s_at HGF Hs.396530 210999._s_at GRB10 Hs.81875 211005..at LAT Hs.437775 211024 s at TITF1 Hs.197764 Table 1 (continued):
211025_x_at COX5B Hs.1342
211031_s_at CYLN2 Hs.104717
211052_s_at TBCD Hs.12570
211066_x_at PCDHGC3 Hs.283794
211071_s_at AF1Q Hs.75823
211100_x_at LILRB1 Hs.149924
211101_x_at LILRB1 Hs.149924
211102_s_at LILRB1 Hs.149924
211126_s_at CSRP2 Hs.10526
211133_x_at LILRB3 Hs.306230
211135_x_at LILRB3 Hs.306230
211143_x_at NR4A1 Hs.1119
211144_x_at TRGC2 Hs.385086
211148_s_at ANGPT2 Hs.115181
211163_s_at TNFRSFIOC Hs.119684
211202_s_at PLU-1 Hs.143323
211207_s_at FACL6 Hs.14945
211210_X _at SH2D1A Hs.151544
211254_x_at RHAG Hs.368178
211269_s_at IL2RA Hs.130058
211284_s_at GRN Hs.180577
211286_x_at CSF2RA Hs.227835
211302_s_at PDE4B Hs.188
211307_s_at FCAR Hs.193122
211336_x_at LILRB1 Hs.149924
211339_s_at ITK Hs.211576
211340_s_at MCAM Hs.211579
211341_at POU4F1 Hs.458303
211354_s_at LEPR Hs.23581
211355_x_at LEPR Hs.23581
211356_x_at LEPR Hs.23581
211367_s_at CASP1 Hs.2490
211368_s_at CASP1 Hs.2490
211372_s_at IL1R2 Hs.25333
211395_x_at FCGR2B Hs.126384
211404_s_at APLP2 Hs.279518
211413_s_at PADI4 Hs.397050
211421_s_at RET Hs.350321
211423_s_at SC5DL Hs.434074
211429_s_at SERPINA1 Hs.297681
211430_s_at IGHG3 Hs.413826
211434_s_at CCRL2 Hs.302043
211450_s_at MSH6 Hs.445052
211456_x_at na Hs.456549
211458_s_at GABARAPL3 Hs.334497
211464_x_at CASP6 Hs.3280
211474_s_at SERPINB6 Hs.41072
211478_s_at DPP4 Hs.44926
211495_x_at TNFSF13 Hs.54673
211506_s_at
211517_s_at IL5RA Hs.68876
211521_s_at PSCD4 Hs.7189
211527_x_at VEGF Hs.73793
211529_x_at HLA-A Hs.181244
211535_s_at FGFR1 Hs.748
211546_x_at SNCA Hs.76930
211548_s_at HPGD Hs.77348
211560_s_at ALAS2 Hs.440455
211566_x_at BRE Hs.80426
211571_s_at CSPG2 Hs.434488
211597_s_at HOP Hs.13775
211633_x_at — Hs.406615
211634_x_at — Hs.449011
211635_x_at — Hs.449011
211637_x_at — Hs.383169 Table 1 (continued):
211639_x_at Hs.383438
211641_x_at Hs.64568 // -
211643_x_at na Hs.377975
211644_x_at na Hs.377975
211645_x_at na Hs.377975
211649_x_at Hs.449057
211650_x_at Hs.448957
211653_x_at AKR1C2 Hs.201967
211654_x_at HLA-DQB1 Hs.409934
211656_x_at HLA-DQB1 Hs.409934
211657_at CEACAM6 Hs.436718
211658_at PRDX2 Hs.432121
21166 l_x_at ... // ...
211663_x_at PTGDS Hs.446429
211668_s_at PLAU Hs.77274
211674_x_at CTAG1 Hs.167379
211675_s_at HIC Hs.132739
211682_x_at UGT2B28 Hs.137585
211696_x_at HBB Hs.155376
211699_x_at HBA1 Hs.449630
211709_s_at SCGF Hs.105927
211719_x_at FN1 Hs.418138
211726_s_at FM02 Hs.361155
211732_x_at HNMT Hs.42151
211734_s_at FCER1A Hs.897
211742_s_at EVI2B Hs.5509
211743_s_at PRG2 Hs.99962
211745_x_at HBA1 Hs.449630
211748_x_at PTGDS Hs.446429
211764_s_at UBE2D1 Hs.129683
211776_s_at EPB41L3 Hs.103839
211781_x_at ... // ...
211796_s_at ... // ...
211798_x_at IGLJ3 Hs.102950
211799_x_at HLA-C Hs.274485
211813_x_at DCN Hs.156316
211816_x_at FCAR Hs.193122
211820_x_at GYPA Hs.34287
211821_x_at GYPA Hs.34287
211858_x_at GNAS Hs.157307
211864_s_at FER1L3 Hs.362731
211868_x_at
211876_x_at PCDHGC3 Hs.283794
211881_x_at IGLJ3 Hs.102950
211883_x_at CEACAMl Hs.434918
211893_x_at CD6 Hs.436949
211896_s_at DCN Hs.156316
211900_x_at CD6 Hs.436949
211902_x_at TRA@ Hs.74647
211911_x_at HLA-B Hs.77961
211919_s_at CXCR4 Hs.421986
211922_s_at CAT Hs.395771
211924_s_at PLAUR Hs.179657
211941_s_at PBP Hs.433863
211959_at IGFBP5 Hs.380833
211962_s_at ZFP36L1 Hs.85155
211964_at COL4A2 Hs.407912
211965_at ZFP36L1 Hs.85155
211966_at C0L4A2 Hs.407912
211970_x_at ACTG1 Hs.14376
211983_x_at ACTG1 Hs.14376
211986_at MGC5395 Hs.378738
211990_at HLA-DPA1 Hs.914
211991_s_at HLA-DPA1 Hs.914
211992_at PRKWNK1 Hs.43129 Table 1 (continued):
211993_at PRKWNK1 Hs.43129
211994_at PRKWNK1 Hs.43129
211995_x_at ACTGl Hs.14376
211996_s_at na Hs.406494 // —
212012_at D2S448 Hs.118893 // -
212013„at D2S448 Hs.118893 // -
212014_x_at CD44 Hs.306278
212046_x_at MAPK3 Hs.861
212055_at DKFZP586M1523 Hs.22981
212056_at KIAA0182 Hs.222171
212057_at KIAA0182 Hs.222171
212062_at ATP9A Hs.406434 // -
212067_s_at CIR Hs.376414 // -
212069_s_at MGC10526 Hs.389588
212070_at GPR56 Hs.6527
212077_at CALD1 Hs.443811
212086_x_at LMNA Hs.436441
212089_at LMNA Hs.436441
212090_at GRINA Hs.339697
212091_s_at COL6A1 Hs.415997
212097_at CAV1 Hs.74034
212099_at ARHB Hs.406064
212143_s_at — Hs.450230 // -
212148_at PBX1 Hs.408222
212151_at PBX1 Hs.408222
212154_at SDC2 Hs.1501
212157_at SDC2 Hs.1501
212158_at SDC2 Hs.1501
212166_at XP07 Hs.172685
212172_at AK2 Hs.294008
212173_at AK2 Hs.294008
212181_s_at NUDT4 Hs.355399
212183_at NUDT4 Hs.355399
212185_x_at MT2A Hs.118786
212187_x_at PTGDS Hs.446429
212188_at LOC115207 Hs.109438
212190_at SERPINE2 Hs.21858
212192_at LOC115207 Hs.109438
212203_x_at IFITM3 Hs.374650
212221_x_at na Hs.303154 // -
212223_at na Hs.303154 // -
212224_at ALDHlAl Hs.76392
212225_at sun Hs.150580
212236_x_at KRT17 Hs.2785
212242_at TUBA1 Hs.75318
212254_s_at BPAG1 Hs.443518
212263_at OKI Hs.22248
212265_at OKI Hs.22248
212273_x_at GNAS Hs.157307
212285_s_at AGRN Hs.273330 // -
212311_at KIAA0746 Hs.49500 // —
212312_at BCL2L1 Hs.305890
212314_at KIAA0746 Hs.49500 // —
212330_at TFDP1 Hs.79353
212334_at GNS Hs.334534
212340_at MGC21416 Hs.82719
212341_at MGC21416 Hs.82719
212355_at KIAA0323 Hs.7911
212358_at CLIPR-59 Hs.7357
212363_x_at ACTGl Hs.14376
212372_at MYH10 Hs.280311 // -
212377_s_at NOTCH2 Hs.8121
212382_at TCF4 Hs.359289
212385_at TCF4 Hs.359289
212386_at TCF4 Hs.359289 Table 1 (continued):
212387.at TCF4 Hs.359289 212390. .at PDE4DIP Hs.265848 212414.s_at 38961 Hs.90998 212428.at KIAA0368 Hs.445255 212430.at RNPC1 Hs.236361 212464.s_at FN1 Hs.418138 212467. at KIAA0678 Hs.12707 // — 212472. at MICAL2 Hs.309674 212473. .s_at MICAL2 Hs.309674 212479. s_at FLJ13910 Hs.75277 212488. at C0L5A1 Hs.433695 212489. at C0L5A1 Hs.433695 212492. s_at KIAA0876 Hs.301011 // — 212501. at CEBPB Hs.99029 212509. _s_at ... Hs.356623 // est 212512. .s_at CARM1 Hs.371416 // — 212526. at SPG20 Hs.205088 212531. at LCN2 Hs.204238 212535. at MEF2A Hs.415033 212540. .at CDC34 Hs.423615 212543. at AIM1 Hs.422550 // - 212558. at GDAP1L1 Hs.20977 212560. at S0RL1 Hs.438159 212570. .at KIAA0830 Hs.167115 212586. .at CAST Hs.440961 212589. .at RRAS2 Hs.206097 212592. .at IGJ Hs.381568 212599. .at AUTS2 Hs.296720 212602. .at WDFY3 Hs.105340 212611. .at MPEG1 Hs.62264 // — 212614. .at MRF2 Hs.12702 // — 212624. -S_at CHN1 Hs.380138 212636. .at QKI Hs.22248 212645. _x_at BRE Hs.80426 212646. .at RAFTLIN Hs.436432 // — 212647. .at RRAS Hs.9651 212657. _s_at IL1RN Hs.81134 212659. _s_at IL1RN Hs.81134 212670. .at ELN Hs.252418 212671. _s_at HLA-DQA1 Hs.387679 212680. _x_at PPP1R14B Hs.120197 212681. .at EPB41L3 Hs.103839 212686. .at KIAA1157 Hs.21894 // - 212692. _s_at LRBA Hs.209846 212699. .at SCAMP5 Hs.7934 212713. .at MFAP4 Hs.296049 212719. .at PLEKHE1 Hs.38176 // — 212724. .at ARHE Hs.6838 212732. .at MEG3 Hs.418271 212741. .at MAOA Hs.183109 212750. .at PPP1R16B Hs.45719 212758. _s_at TCF8 Hs.232068 212761. .at TCF7L2 Hs.214039 212762. _s_at TCF7L2 Hs.214039 212764. .at TCF8 Hs.232068 212768. _s_at GW112 Hs.273321 212769. .at TLE3 Hs.287362 212771. .at LOC221061 Hs.66762 // — 212776. _s_at KIAA0657 Hs.6654 // — 212812. .at na Hs.288232 // — 212820. .at RC3 Hs.200828 212827. .at IGHM Hs.153261 212828. .at SYNJ2 Hs.434494 212829. .at — Hs.57079 // — 212830. .at EGFL5 Hs.5599 // — Table 1 (continued):
212831.at EGFL5 Hs.5599 // — 212842.x_at ... Hs.452310 // est 212843. .at NCAMl Hs.78792 212859. x_at MT1E Hs.418241 212865. s_at C0L14A1 Hs.403836 212873. at na Hs.165728 // — 212884. x_at AP0C4 Hs.110675 212895. .s_at ABR Hs.434004 212906. at na Hs.347534 // — 212907. at SLC30A1 Hs.55610 212912. at RPS6KA2 Hs.301664 212915. at SEMACAP3 Hs.177635 212930. .at ATP2B1 Hs.20952 212937. .s_at C0L6A1 Hs.415997 212942. .s_at KIAA1199 Hs.212584 212956. at KIAA0882 Hs.411317 // - 212958. _x_at PAM Hs.352733 212973. .at RPIA Hs.79886 212977. at RDC1 Hs.231853 212987. .at FBX09 Hs.388387 212988. x_at ACTGl Hs.14376 212989. .at MOB Hs.153716 212993. .at na Hs.349356 // — 212998. _x_at HLA-DQB2 Hs.375115 212999. .x_at HLA-DQB1 Hs.409934 213002. .at MARCKS Hs.318603 213005. .s_at KANK Hs.77546 213006. at KIAA0146 Hs.381058 213015. .at na Hs.171553 // — 213035. .at KIAA0379 Hs.273104 // — 213036. x_at ATP2A3 Hs.5541 213038. .at FLJ90005 Hs.128366 213060. _s_at CHI3L2 Hs.154138 213061. _s_at LOC123803 Hs.351573 213075. .at LOC169611 Hs.357004 213089. .at na Hs.166361 // — 213094. .at GPR126 Hs.419170 213095. _x_at AIF1 Hs.76364 213096. .at HUCEP11 Hs.6360 213110. _s_at COL4A5 Hs.169825 213122. .at KIAA1750 Hs.173094 213125. .at DKFZP586L151 Hs.43658 213135. .at TIAM1 Hs.115176 213146. .at KIAA0346 Hs.103915 // — 213147. .at HOXA10 Hs.110637 213150. .at HOXA10 Hs.110637 213182 _x_at CDKNIC Hs.106070 213193. _x_at TRB@ Hs.419777 213194. .at R0B01 Hs.301198 213201. _s_at TNNT1 Hs.73980 213212. _x_at ... Hs.459128 // est 213214. _x_at ACTGl Hs.14376 213217, .at ADCY2 Hs.414591 213236. .at SASH1 Hs.166311 213241, .at PLXNC1 Hs.286229 213258, .at TFPI Hs.102301 213260. .at F0XC1 Hs.348883 213274. _s_at CTSB Hs.135226 213275. _x_at CTSB Hs.135226 213288. .at LOC129642 Hs.90797 213309. .at PLCL2 Hs.54886 213317, .at na Hs.21103 213338. .at RIS1 Hs.35861 213348. .at CDKNIC Hs.106070 213350. .at RPS11 Hs.433529 Table 1 (continued):
213361.at PCTAIRE2BP Hs.416543 213362.at PTPRD Hs.323079 213375.s_at CG018 Hs.277888 213394.at MAPKBPl Hs.376657 // - 213395.at MLC1 Hs.74518 213413..at SBLF Hs.54961 213415. at CLIC2 Hs.54570 213418. at HSPA6 Hs.3268 213428. s_at C0L6A1 Hs.415997 213435. at SATB2 Hs.412327 // — 213437. at RIPX Hs.7972 213439. _x_at — Hs.500197 // est 213446..s_at I GAP1 Hs.1742 213451._x_at TNXB Hs.411644 213478. at KIAA1026 Hs.368823 213479. at NPTX2 Hs.3281 213482. at D0CK3 Hs.7022 213484..at na Hs.66187 // - 213488..at FU00133 Hs.7949 213492..at C0L2A1 Hs.408182 213502..x_at LOC91316 Hs.435211 // — 213503._x_at ANXA2 Hs.437110 213506..at F2RL1 Hs.154299 213515..x_at HBG2 Hs.302145 213521..at PTPN18 Hs.210913 213524._s_at G0S2 Hs.432132 213537..at HLA-DPA1 Hs.914 213539..at CD3D Hs.95327 213541._s_at ERG Hs.45514 213545._x_at SNX3 Hs.12102 213549..at SLC18A2 Hs.50458 213553._x_at AP0C1 Hs.268571 213566..at RNASE6 Hs.23262 213572._s_at SERPINB1 Hs.381167 213605._s_at na Hs.166361 // — 213608 _s_at TFIP11 Hs.20225 213618..at CENTD1 Hs.427719 213624..at ASM3A Hs.277962 213629.-X_at MT1F Hs.438737 213666..at 38961 Hs.90998 213668._s_at S0X4 Hs.357901 213674..x_at ... Hs.439852 213716._s_at SECTM1 Hs.95655 213737._x_at ... Hs.50787 // est 213757..at EIF5A Hs.310621 213791..at PENK Hs.339831 213797..at cigδ Hs.17518 213808..at na Hs.12514 // — 213817..at na Hs.170056 // — 213823..at HOXA11 Hs.249171 213825..at OLIG2 Hs.176977 213830..at TRD@ Hs.2014 213831..at HLA-DQA1 Hs.387679 213841..at na Hs.301281 // — 213842._x_at WBSCR20C Hs.436034 213843._x_at SLC6A8 Hs.388375 213844..at HOXA5 Hs.37034 213848..at DUSP7 Hs.3843 213857_s_at CD47 Hs.446414 213888._s_at DJ434014.3 Hs.147434 213891._s_at TCF4 Hs.359289 213894..at LOC221981 Hs.23799 // - 213906..at MYBL1 Hs.300592 // — 213908..at LOC339005 Hs.212670 // — 213915 at NKG7 Hs.10306 Table 1 (continued):
21393 l_at — _ Hs.502810 // est
213943_at TWIST1 Hs.66744
213958_at CD6 Hs.436949
213960_at na Hs.185701 // -
213975_s_at LYZ Hs.234734
213988_s_at SAT Hs.28491
213994_s_at SPON1 Hs.5378
214016_s_at SFPQ Hs.180610
214020_x_at ITGB5 Hs.149846
214022_s_at IFITM1 Hs.458414
214032_at ZAP70 Hs.234569
214039_s_at LAPTM4B Hs.296398
214040_s_at GSN Hs.446537
214041_x_at RPL37A Hs.433701
214043_at PTPRD Hs.323079
214049_x_at CD7 Hs.36972
214054_at DOK2 Hs.71215
214058_at MYCL1 Hs.437922
214059_at IFI44 Hs.82316
214061_at MGC21654 Hs.95631
214063_s_at TF Hs.433923
214084_x_at na Hs.448231 // —
214085_x_at HRB2 Hs.269857
214093_s_at FUBP1 Hs.118962
214100_x_at WBSCR20C Hs.436034
214121_x_at ENIGMA Hs.436339
214131_at CYorflδB Hs.145010
214146_s_at PPBP Hs.2164
214153_at ELOVL5 Hs.343667
214183_s_at TKTL1 Hs.102866
214203_s_at PRODH Hs.343874
21421 l_at FTH1 Hs.418650
214218_s_at LOC139202 Hs.83623 // —
214228_x_at TNFRSF4 Hs.129780
214230_at CDC42 Hs.355832
214235_at CYP3A5 Hs.150276
214255_at ATP10A Hs.125595
214273_x_at C16orf35 Hs.19699
214290_s_at HIST2H2AA Hs.417332
214295_at KIAA0485 Hs.89121 // —
214297_at CSPG4 Hs.436301
214321_at NOV Hs.235935
214329_x_at TNFSF10 Hs.387871
214349_at ... Hs.464403 // est 214366_s_at ALOX5 Hs.89499 214370_at S100A8 Hs.416073 214407_x_at GYPB Hs.438658 214414_x_at HBA1 Hs.449630 2144 l_x_at CYP2C9 Hs.418127 214428_x_at C4A Hs.150833 214433_s_at SELENBP1 Hs.334841 214446_at ELL2 Hs.192221 214450_at CTSW Hs.416848 214453_s_at IFI44 Hs.82316 214455_at HIST1H2BC Hs.356901 214459_x_at HLA-C Hs.274485 214464_at CDC42BPA Hs.18586 214467_at GPR65 Hs.131924 214469_at HIST1H2AE Hs.121017 214470_at KLRB1 Hs.169824 214472_at HIST1H3D Hs.239458 214481_at HIST1H2AM Hs.134999 214500_at H2AFY Hs.75258 214505_s_at FHL1 Hs.421383 21451 l x at FCGR1A Hs.77424 Table 1 (continued):
214522_x_at HIST1H3D Hs.239458
214523_at CEBPE Hs.426867
214530_x_at EPB41 Hs.37427
214535_s_at ADAMTS2 Hs.120330
214539_at SERPINB10 Hs.158339
214548_x_at GNAS Hs.157307
214551_s_at CD7 Hs.36972
214564_s_at PCDHGC3 Hs.283794
214574_x_at LST1 Hs.410065
214575_s_at AZU1 Hs.72885
214581_x_at TNFRSF21 Hs.159651
214590_s_at UBE2D1 Hs.129683
214614_at HLXB9 Hs.37035
214617_at PRF1 Hs.2200
214620_x_at PAM Hs.352733
214627_at EPX Hs.46295
214637_at OSM Hs.248156
214651_s_at HOXA9 Hs.127428
214657_s_at TncRNA Hs.433324 // —
214667_s_at TP53I11 Hs.433813 // -
214669_x_at na Hs.377975
214677_x_at IGLJ3 Hs.449601
214682_at PKD1 Hs.75813
214696_at MGC14376 Hs.417157
214721_x_at CDC42EP4 Hs.3903
214722_at FLJ21272 Hs.218329
214743_at CUTL1 Hs.438974
214761_at OAZ Hs.158593
214768_x_at na Hs.377975
214770_at MSR1 Hs.436887
214777_at na Hs.377975
214789_x_at SRP46 Hs.155160
214790_at SUSP1 Hs.435628
214805_at EIF4A1 Hs.129673
214836_x_at na Hs.377975
214867_at NDST2 Hs.225129
214870_x_at ... // ...
214875_x_at APLP2 Hs.279518
214903_at na Hs.25422 // —
214909_s_at DDAH2 Hs.247362
214916_x_at ... Hs.448957
214920_at LOC221981 Hs.23799 // —
214950_at ... Hs.459588 // est
214953_s_at APP Hs.177486
214973_x_at — Hs.448982 // —
214983_at na Hs.433656 // —
214989_x_at PEPP2 Hs.242537
215012_at ZNF451 Hs.188662
215016_x_at BPAG1 Hs.443518
215032_at ... Hs.300934 // —
215034_s_at TM4SF1 Hs.351316
215037_s_at BCL2L1 Hs.305890
215047_at BIA2 Hs.323858
215049_x_at CD 163 Hs.74076
21505 l_x_at AIF1 Hs.76364
215054_at EPOR Hs.127826
215071_s_at ... Hs.28777 // —
215076_s_at COL3A1 Hs.443625
215078_at SOD2 Hs.384944
215089_s_at RBM10 Hs.348276
215111_s_at TSC22 Hs.114360
215116_s_at DNM1 Hs.436132
215118_s_at MGC27165 Hs.366
215121_x_at ... Hs.356861
215123_at ... Hs.375005 // — Table 1 (continued):
215137_at ... Hs.467531 // est
215143_at FLJ36166 Hs.351178 // —
215146_s_at KIAA1043 Hs.387856
215150_at DKFZp451J1719 Hs.391944 // —
215163_at ... Hs.203349 // -
215176_x_at ... Hs.503443 // —
215177_s_at ITGA6 Hs.212296
215193_x_at HLA-DRB1 Hs.411726
215200_x_at na Hs.456817 // -
215204_at Hs.288575 // —
215214_at Hs.449579 // -
215222_x_at MACFl Hs.372463
215223_s_at SOD2 Hs.384944
215224_at RPL23 Hs.406300
215242_at PIGC Hs.386487
215248_at GRB10 Hs.81875
215284_at Hs.12432 // -
215288_at TRPC2 Hs.131910 // -
215306_at — Hs.161283 // —
215311_at na Hs.185701 // —
215320_at DKFZP434M131 Hs.189296 // -
215338_s_at NKTR Hs.369815
215342_s_at KIAA0471 Hs.242271
215375_x_at ... Hs.438377 // -
215379_x_at IGLJ3 Hs.449601
215382_x_at TPSB2 Hs.405479
215388_s_at HFL1 Hs.296941
215401_at — Hs.507633 // -
215411_s_at C6orf4 Hs.437508
215415_s_at CHS1 Hs.130188
215438_x_at GSPT1 Hs.2707
215446_s_at
215447_at TFPI Hs.102301
215449_at na Hs.357392 // —
215485_s_at ICAM1 Hs.168383
215489_x_at HOMER3 Hs.410683
215498_s_at MAP2K3 Hs.180533
215499_at MAP2K3 Hs.180533
215501_s_at DUSP10 Hs.177534
215504_x_at — Hs.337534 // -
215537_x_at DDAH2 Hs.247362
215571_at — Hs.287415 // -
215592_at — Hs.464205 // -
215594_at na Hs.296832 // —
215599_at SMA3 Hs.440958
215602_at FGD2 Hs.376059
215621_s_at ... Hs.448957
215623_x_at SMC4L1 Hs.50758
215630_at ... Hs.475611 // -
215640_at KIAA1055 Hs.438702
215646_s_at CSPG2 Hs.434488
215663_at MBNL1 Hs.28578
215666_at HLA-DRB4 Hs.449633
215684_s_at FLJ21588 Hs.436407
215692_s_at CllorfS Hs.432000
215716_s_at ATP2B1 Hs.20952
215733_x_at CTAG2 Hs.87225
215761_at RC3 Hs.200828
215771_x_at RET Hs.350321
215775_at THBS1 Hs.164226
215777_at IGLV@ Hs.381262
215779_s_at HIST1H2BG Hs.352109
215783_s_at ALPL Hs.250769
215784_at CD IE Hs.249217
215806_x_at TRGC2 Hs.385086 Table 1 (continued):
215807_s_at PLXNB1 Hs.278311
215811_at Hs.275706 // -
215812_s_at Hs.499113 // est
215819_s_at RHCE Hs.278994
215836_s_at PCDHGC3 Hs.283794
215838_at LIR9 Hs.406708
215851_at EVIl Hs.436019
215853_at Hs.287427 // -
215874_at Hs.287730 // -
215891_s_at GM2A Hs.387156
215913_s_at CED-6 Hs.107056
215925_s_at CD72 Hs.116481
215933_s_at HHEX Hs.118651
215946_x_at LOC91316 Hs.435211 // —
215949_x_at ... // -
215967_s_at LY9 Hs.403857
215990_s_at BCL6 Hs.155024
216012_at Hs.159901 // -
216015_s_at CIAS1 Hs.159483
216016_at CIAS1 Hs.159483
216022_at Hs.16074 // —
216025_x_at CYP2C9 Hs.418127
216033_s_at FYN Hs.390567
216036_x_at KIAA1037 Hs.172825
216041_x_at GRN Hs.180577
216052_x_at ARTN Hs.194689
216054_x_at MYL4 Hs.356717
216056_at CD44 Hs.306278
216063_at Hs.470084 // est
216080_s_at FADS3 Hs.21765
216109_at KIAA1025 Hs.435249 // —
216129_at ATP9A Hs.406434 // —
216147_at Hs.306504 // —
216180_s_at SYNJ2 Hs.434494
216191_s_at TRD@ Hs.2014
216197_at Hs.434491 // -
216207_x_at IGKV1D-13 Hs.390427
216218_s_at PLCL2 Hs.54886
216236_s_at SLC2A14 Hs.401274
216243_s_at IL1RN Hs.81134
216248_s_at NR4A2 Hs.82120
216268_s_at JAG1 Hs.409202
216286_at Hs.306324 // —
216317_x_at RHCE Hs.278994
216320_x_at MSTl Hs.349110
216331_at ITGA7 Hs.74369
216333_x_at TNXB Hs.411644
216336_x_at ... // ...
216356_x_at BAIAP3 Hs.458427
216370_s_at TKTL1 Hs.102866 216379_x_at ... // ...
216380_x_at ... // ... 216401_x_at ... // ... 216417_x_at HOXB9 Hs.321142 216442_x_at na Hs.287820 // - 216449_x_at TRA1 Hs.192374 216474_x_at TPSB2 Hs.405479 216491_x_at ... // ... 216510_x_at ... // ... 216511_s_at ... // ... 216522_at ... // ... 216526_x_at HLA-C Hs.274485 216541_x_at ... // ... 216557_x_at ... // ... 216560_x_at ... // ... Table 1 (continued):
216565. x_at ... // ... 216576. x_at na Hs.377975 216598..s_at CCL2 Hs.303649 216602..s_at FARSL Hs.23111 216614- at ... // ... 216620. .s_at ARHGEFIO Hs.436196 216667. at 216693. x_at HDGFRP3 Hs.127842 216705. s_at ADA Hs.407135 216733. s_at GATM Hs.75335 216766. at ... // .- 216813. at ... // ... 216832..at CBFA2T1 Hs.90858 216833. x_at GYPE Hs.395535 216834. at RGS1 Hs.75256 216841. _s_at SOD2 Hs.384944 216858. _x_at ... // ... 216860. _s_at GDF11 Hs.432439 216894. _x_at CDKNIC Hs.106070 216913. _s_at KIAA0690 Hs.434251 216920. _s_at TRGC2 Hs.385086 216925..s_at TALI Hs.73828 216950. -S_at FCGR1A Hs.77424 216956. _s_at ITGA2B Hs.411312 216984..x_at Hs.449592 // — 217022. _s_at MGC27165 Hs.366 217023. _x_at ... // ... 217025. _s_at DBN1 Hs.89434 217028..at CXCR4 Hs.421986 217118..s_at KIAA0930 Hs.13255 217143. _s_at TRD@ Hs.2014 217147. _s_at TRIM Hs.138701 217148. _x_at Hs.449592 // — 217157. _x_at Hs.449620 // - 217165. _x_at MT1F Hs.438737 217179. _x_at Hs.440830 217192. _s_at PRDM1 Hs.381140 217227. _x_at Hs.449598 // — 217232..x_at ... // ... 217234..s_at VIL2 Hs.403997 217235. _x_at Hs.449593 // — 217258. _x_at Hs.449599 // — 217274. _x_at ... // ... 217276. _x_at dJ222E13.1 Hs.301947 217281..x_at Hs.448987 // - 217284. _x_at dJ222E13.1 Hs.301947 217286. _s_at NDRG3 Hs.437338 217354. _s_at ... // ... 217378. _x_at ... // ... 217388. _s_at KYNU Hs.444471 217404 _s_at COL2A1 Hs.408182 217414. _x_at ... // ... 217418. _x_at MS4A1 Hs.438040 217419..x_at AGRN Hs.273330 // — 217422. _s_at CD22 Hs.262150 217478. _s_at HLA-DMA Hs.351279 217480. _x_at 217502..at IFIT2 Hs.169274 217507..at SLC11A1 Hs.135163 217520. _x_at na Hs.374397 // — 217521..at HAL Hs.190783 217523..at CD44 Hs.306278 217526..at Hs.502482 // est 217552..x_at CR1 Hs.334019 217572. at ... // - Table 1 (continued):
217591_at SKIL Hs.272108
217593_at SNX11 Hs.15827
217610_at Hs.506223 // est
217649_at ZNF216 Hs.406096
217653_x_at Hs.499531 // est
217655_at Hs.407053 // —
217671_at Hs.279706 // est
217673_x_at GNAS Hs.157307
217678_at Hs.499751 // est
217712_at Hs.369545 // est
217715_x_at Hs.417310 // est
217728_at S10OA6 Hs.275243
217729_s_at AES Hs.446610
217735_s_at HRI Hs.434986
217736_s_at HRI Hs.434986
217738_at PBEF Hs.293464
217739_s_at PBEF Hs.293464
217748_at ADIPORl Hs.5298
217752_s_at CN2 Hs.149185
217757_at A2M Hs.74561
217762_s_at RAB31 Hs.223025
217763_s_at RAB31 Hs.223025
217764_s_at RAB31 Hs.223025
217771_at GOLPH2 Hs.352662
217799_x_at UBE2H Hs.372758
217800_s_at NDFIP1 Hs.9788
217817_at ARPC4 Hs.323342
217818_s_at ARPC4 Hs.323342
217838_s_at EVL Hs.241471
217848_s_at PP Hs.380830
217867_x_at BACE2 Hs.436490
217868_s_at DREV1 Hs.279583
217901_at DSG2 Hs.412597
217911_s_at BAG3 Hs.15259
217941_s_at ERBB2IP Hs.8117
217963_s_at NGFRAP1 Hs.448588
217966_s_at Clorf24 Hs.48778
217967_s_at Clorf24 Hs.48778
217977_at SEPX1 Hs.279623
217979_at TM4SF13 Hs.364544
217983_s_at RNASE6PL Hs.388130
217985_s_at BAZ1A Hs.436488
217986_s_at BAZ1A Hs.436488
217988_at HEIIO Hs.107003
217995_at SQRDL Hs.435468
217996_at PHLDA1 Hs.82101
217997_at PHLDA1 Hs.82101
217999_s_at PHLDA1 Hs.82101
218000_s_at PHLDA1 Hs.82101
218012_at SE20-4 Hs.136164
218034_at TTC11 Hs.423968
218035_s_at FLJ20273 Hs.95549
218039_at ANKT Hs.279905
21805 l_s_at FLJ12442 Hs.84753
218066_at SLC12A7 Hs.172613
218084_x_at FXYD5 Hs.333418
218086_at NPDC1 Hs.105547
218091_at HRB Hs.371589
218094_s_at C20orf35 Hs.256086
218113_at TMEM2 Hs.160417
218116_at LOC51759 Hs.278429
218136_s_at MSCP Hs.283716
218141_at E2-230K Hs.16130
218145_at C20orf97 Hs.344378
218205_s_at MKNK2 Hs.75056 Table 1 (continued):
21821 l_s_at MLPH Hs.297405
218217_at RISC Hs.431107
218224_at PNMA1 Hs.194709
218231_at NAGK Hs.7036
218232_at C1QA Hs.9641
218237_s_at SLC38A1 Hs.132246
218243_at RUFY1 Hs.306769
218273_s_at PPM2C Hs.22265
218280_x_at HIST2H2AA Hs.417332
218284_at DKFZP586N0721 Hs.99843
218298_s_at FLJ20950 Hs.285673
218319_at PELI1 Hs.7886
218332_at BEX1 Hs.334370
218345_at HCA112 Hs.12126
218346_s_at PA26 Hs.14125
218352_at RCBTB1 Hs.58452
218376_s_at NICAL Hs.33476
218394_at FLJ22386 Hs.22795
218400_at OAS3 Hs.56O09
218404_at SNX10 Hs.418132
218417_s_at FLJ20489 Hs.438867
218418_s_at KIAA1518 Hs.284208
218454_at FLJ22662 Hs.178470
218456_at C1QDC1 Hs.234355
218468_s_at CKTSF1B1 Hs.40098
218469_at CKTSF1B1 Hs.40098
218487_at ALAD Hs.1227
218523_at LHPP Hs.20950
218532_s_at FLJ20152 Hs.82273
218559_s_at MAFB Hs.169487
218589_at P2RY5 Hs.123464
218596_at FLJ10743 Hs.3376
218608_at HSA9947 Hs.128866
218614_at FLJ20696 Hs.236844
218618_s_at FAD 104 Hs.299883
218625_at NRN1 Hs.103291
218644_at PLEK2 Hs.170473
218660_at DYSF Hs.408679
218676_s_at PCTP Hs.285218
218686_s_at RHBDF1 Hs.57988
218710_at FLJ20272 Hs.26090
218711_s_at SDPR Hs.26530
218718_at PDGFC Hs.43080
218723_s_at RGC32 Hs.76640
218729_at LXN Hs.124491
218742_at HPRN Hs.22158
218781_at SMC6L1 Hs.424559
218786_at — Hs.374350
218788_s_at SMYD3 Hs.8109
218793_s_at SCML1 Hs.109655
218803_at CHFR Hs.23794
218805_at IAN4L1 Hs.412331
218810_at FLJ23231 Hs.288300
218824_at FLJ10781 Hs.8395
218825_at EGFL7 Hs.91481
218828_at PLSCR3 Hs.433154
218831_s_at FCGRT Hs.111903
218847_at IMP-2 Hs.30299
218853_s_at DJ473B4 Hs.57549
218854_at SART2 Hs.388014
218856_at TNFRSF21 Hs.159651
218858_at FLJ12428 Hs.8 729
218864_at TNS Hs.439442
218865_at FLJ22390 Hs.195345
218872_at TSC Hs.345908 Table 1 (continued):
218876_at CGI-38 Hs.412685
218880_at FOSL2 Hs.301612
218881_s_at FLJ23306 Hs.5890
218899_s_at BAALC Hs.169395
218902_at NOTCHl Hs.311559
218927_s_at CHST12 Hs.25204
218935_at EHD3 Hs.368808
218952_at PCSK1N Hs.429437
218963_s_at KRT23 Hs.9029
218964_at DRIL2 Hs.10431
218974_at FLJ10159 Hs.346203
218978_s_at MSCP Hs.283716
218986_s_at FLJ20035 Hs.109309
218988_at SLC35E3 Hs.445043
219019_at LRDD Hs.438986
219032_x_at OPN3 Hs.170129
219033_at FLJ21308 Hs.310185
219036_at BITE Hs.127217
219049_at C Gn Hs.341073
219054_at FLJ14054 Hs.13528
219059_s_at XLKD1 Hs.17917
219090_at SLC24A3 Hs.439909
219093_at FLJ20701 Hs.424598
219123_at ZNF232 Hs.279914
219183_s_at PSCD4 Hs.7189
219191_s_at BIN2 Hs.14770
219218_at FLJ23058 Hs.415799
219228_at ZNF463 Hs.147644
219243_at HIMAP4 Hs.30822
219247_s_at ZDHHC14 Hs.292541
219255_x_at IL17RB Hs.5470
219256_s_at FLJ20356 Hs.61053
219259_at FLJ12287 Hs.408846
219277_s_at FLJ10851 Hs.17860
219288_at HT021 Hs.47166
219295_s_at PCOLCE2 Hs.8944
219304_s_at SCDGF-B Hs.112885
219308_s_at AK5 Hs.18268
219316_s_at C14orf58 Hs.267566
219332_at FLJ23471 Hs.376617
219339_s_at Eu-HMTasel Hs.416692
219358_s_at CENTA2 Hs.415471
219359_at FLJ22635 Hs.353181
219360_s_at TRPM4 Hs.31608
219371_s_at KLF2 Hs.107740
219373_at DPM3 Hs.110477
219383_at FLJ14213 Hs.183506
219396_s_at NEIL1 Hs.197423
219403_s_at HPSE Hs.44227
219414_at CLSTN2 Hs.12079
219434_at TREM1 Hs.283022
219443_at C20orfl3 Hs.88367
219457_s_at RIN3 Hs.413374
219463_at C20orfl03 Hs.22920
219471_at C13orfl8 Hs.413071
219478_at WFDC1 Hs.36688
219480_at SNAI1 Hs.48029
219489_s_at RHBDL2 Hs.133999
219497_s_at BCL11A Hs.314623
219505_at CECR1 Hs.170310
219506_at FLJ23221 Hs.91283
219511_s_at SNCAIP Hs.24948
219519_s_at SN Hs.31869
219520_s_at KIAA1280 Hs.12913
219528 s at BCL11B Hs.57987 Table 1 (continued):
219534.x_at CDKNIC Hs.106070 219541.at FLJ20406 Hs.149227 219546-at BMP2K Hs.20137 219559.at C20orf59 Hs.353013 219563.at C14orfl39 Hs.41502 219569.s_at MGC3295 Hs.101257 219593. .at PHT2 Hs.237856 219602.s_at FLJ23403 Hs.293907 219607. s_at MS4A4A Hs.325960 219622. at RAB20 Hs.179791 219628. at WIG1 Hs.252406 219629. at FLJ20635 Hs.265018 219630. at MAP17 Hs.431099 219654. _at PTPLA Hs.114062 219666. at MS4A6A Hs.371612 219667. _s_at BANK Hs.193736 219669. .at PRV1 Hs.232165 219672. .at ERAF Hs.274309 219681. _s_at RCP Hs.96125 219686. .at HSA250839 Hs.58241 219695. .at FLJ10640 Hs.91753 219714. _s_at CACNA2D3 Hs.435112 219737. .s_at — Hs.458282 // est 219738. _s_at PCDH9 Hs.404723 219740. .at FLJ12505 Hs.96885 219747. .at FLJ23191 Hs.16026 219753. .at STAG3 Hs.323634 219759. .at LRAP Hs.374490 219777. .at hIAN2 Hs.105468 219788. .at PILRA Hs.122591 219789. .at NPR3 Hs.237028 219790. _s_at NPR3 Hs.237028 219799. _s_at RDHL Hs.179608 219806. _s_at FN5 Hs.416456 219812. .at STAG3 Hs.323634 219814. .at MBNL3 Hs.105134 219837. -S_at C17 Hs.13872 219859. .at CLECSF9 Hs.236516 219870. .at ATF7IP2 Hs.189813 219871. .at FLJ13197 Hs.29725 219872. .at DKFZp434L142 Hs.323583 219884. .at LHX6 Hs.103137 219890. .at CLECSF5 Hs.126355 219892. .at TM6SF1 Hs.151155 219895. .at FLJ20716 Hs.437563 219905. .at ERMAP Hs.427672 219918. _s_at ASPM Hs.121028 219919. _s_at SSH-3 Hs.29173 219922. _s_at LTBP3 Hs.289019 219932. .at VLCS-H1 Hs.49765 219947. .at CLECSF6 Hs.115515 219952. _s_at MC0LN1 Hs.372029 219978. _s_at ANKT Hs.279905 219992. .at TAC3 Hs.9730 220001. .at PADI4 Hs.397050 220005. .at GPR86 Hs.13040 220006. .at FLJ12057 Hs.134807 220010. .at KCNE1L Hs.146372 220014. .at LOC51334 Hs.157461 220017. _x_at CYP2C9 Hs.418127 220037. _s_at XLKD1 Hs.17917 220051. .at PRSS21 Hs.72026 220057. .at GAGED2 Hs.112208 220059. .at BRDG1 Hs.121128 220066 .at CARD15 Hs.135201 Table 1 (continued):
220068. .at VPREB3 Hs.136713 220088.at C5R1 Hs.2161 220091.at SLC2A6 Hs.244378 220110.s_at NXF3 Hs.60386 220122.at FLJ22344 Hs.107716 220173.at C14orf45 Hs.260555 220179..at LOC64180 Hs.302028 220220.at FLJ10120 Hs.378860 220266.s_at KLF4 Hs.376206 220306.at FLJ20202 Hs.356216 220319.s_at MIR Hs.443793 220330. s_at SAMSNl Hs.221851 220335. x_at FLJ21736 Hs.268700 220359._s_at ARPP-21 Hs.412268 220370. s_at KIAA1453 Hs.11387 220377..at C14orfL10 Hs.395486 220404. at GPR97 Hs.383403 220416. at ATP8B4 Hs.313841 220448. at KCNK12 Hs.252617 220485. .s_at SIRPB2 Hs.50716 220496..at CLEC2 Hs.409794 220507._s_at UPB1 Hs.285512 220532. s_at LR8 Hs.190161 220560..at Cllorf21 Hs.272100 220570. at RETN Hs.283091 220591. _s_at FLJ22843 Hs.301143 220595. at DKFZp434B0417 Hs.380044 220617. .s_at FLJ10697 Hs.368756 220646._s_at KLRF1 Hs.183125 220668..s_at DNMT3B Hs.251673 220684..at TBX21 Hs.272409 220704. at ZNFN1A1 Hs.435949 220720. _x_at FLJ14346 Hs.287640 220727. at KCNK10 Hs.365690 220751. _s_at C5orf4 Hs.10235 220757._s_at UBXD1 Hs.435255 220793. at SAGE Hs.195292 220807. at HB 1 Hs.247921 220811. at PRG3 Hs.251386 220832. at TLR8 Hs.272410 220864. _s_at GRIM19 Hs.279574 220898..at 220911._s_at KIAA1305 Hs.496280 220918..at RUNX1 Hs.410774 220937._s_at SIAT7D Hs.3972 220940..at KIAA1641 Hs.503503 220941._s_at C21orf91 Hs.293811 220945._x_at FLJ10298 Hs.5999 220954._s_at PILRB Hs.349256 221004._s_at ITM2C Hs.111577 221011..s_at LBH Hs.57209 221012._s_at TRIM8 Hs.54580 221019._s_at C0LEC12 Hs.29423 221059._s_at CHST6 Hs.157439 221060._s_at TLR4 Hs.174312 221063._x_at RNF123 Hs.406364 221075.-S_at NCR2 Hs.194721 221140..s_at G2A Hs.441131 221205..at ... // — 221210._s_at Clorfl3 Hs.64896 221223._x_at CISH Hs.8257 221234._s_at BACH2 Hs.88414 221237._s_at 0SBP2 Hs.7740 221245._s_at DKFZP434E2135 Hs.17631 221246 x_at TNS Hs.439442 Table 1 (continued):
221261_x_at MAGED4 Hs.376347
221269_s_at SH3BGRL3 Hs.109051
221286_s_at PACAP Hs.409563
221345_at GPR43 Hs.248056
221349_at VPREB1 Hs.247979
221363_x_at GPR25 Hs.248123
221425_s_at MGC4276 Hs.270013
221477_s_at SOD2 Hs.384944
221478_at BNIP3L Hs.132955
221479_s_at BNIP3L Hs.132955
221484_at B4GALT5 Hs.107526
221491_x_at HLA-DRB3 Hs.308026
221520_s_at CDCA8 Hs.48855
221529_s_at PLVAP Hs.107125
221530_s_at BHLHB3 Hs.437282
221541_at DKFZP434B044 Hs.262958
221551_x_at SIAT7D Hs.3972
221558_s_at LEF1 Hs.44865
221563_at DUSP10 Hs.177534
221577_x_at PLAB Hs.296638
221578_at RASSF4 Hs.319124
221581_s_at WBSCR5 Hs.56607
221584_s_at KCNMA1 Hs.354740
221601_s_at TOSO Hs.58831
221602_s_at TOSO Hs.58831
221607_x_at ACTGl Hs.14376
221627_at TRIM10 Hs.274295
221646_s_at ZDHHC11 Hs.50754
221651_XL.at na Hs.377975
221658_s_at IL21R Hs.210546
221666_s_at ASC Hs.197875
221671_x_at na Hs.377975
221675_s_at CHPT1 Hs.225567
221690_s_at NALP2 Hs.369279
221698_s_at CLECSF12 Hs.161786
221704_s_at FLJ12750 Hs.77870
221724_s_at CLECSF6 Hs.115515
221728_x_at LOC139202 Hs.83623 // —
221731_x_at CSPG2 Hs.434488
221747_at TNS Hs.439442
221748_s_at TNS Hs.439442
221756_at MGC17330 Hs.26670
221757_at MGC17330 Hs.26670
221760_at MAN1A1 Hs.255149
221764_at MGC16353 Hs.388956
221765_at UGCG Hs.432605
221766_s_at C6orf37 Hs.10784
221768_at SFPQ Hs.180610
221779_at MIRAB13 Hs.8535
221802_s_at KIAA1598 Hs.98002
221807_s_at PP2447 Hs.33026
221809_at KIAA1464 Hs.441888 // -■
2218l4_at GPR124 Hs.17270
221824_s_at c-MIR Hs.288156
221840_at PTPRE Hs.437980
221841_s_at KLF4 Hs.376206
221861_at ... Hs.12853 // —
221870_at EHD2 Hs.325650
221875_x_at HLA-F Hs.411958
221884_at EVIl Hs.436019
221902_at na Hs.7967 // —
221920_s_at MSCP Hs.283716
221932_s_at C14orf87 Hs.294083
221942_s_at GUCY1A3 Hs.433488
221950_at EMX2 Hs.202095 Table 1 (continued):
221962_s_at UBE2H Hs.37275-8
221969_at ___ Hs.22030" // est
221978_at HLA-F Hs.41195.8
221983_at MGC3035 Hs.22412
22200 l_x_at HS.5035S 5 // est
222040_at HNRPAl Hs.35672t l
222067_x_at HIST1H2BD Hs.18077" 9
222068_s_at LOC123872 Hs.310154
222074_at UROD HS.7860L
222087_at Hs.3245S // est
222088_s_at SLC2A14 Hs.40127'4
222108_at AMIG02 Hs.121520
222125_s_at PH-4 Hs.27122.4
222142_at CYLD Hs.386952
222144_at KIF17 Hs.13041.1 // —
222145_at na Hs.40649>4 // —
222146_s_at TCF4 Hs.3592,59
222154_s_at DKFZP564A2416 Hs.2307S7
222162_s_at ADAMTS1 Hs.8230
222186_at Hs.306329 // —
222218_s_at PILRA Hs.122591
22222 l_x_at EHD1 Hs.15511.9
222222_s_at ... // ...
222258_s_at SH3BP4 Hs.17667
22228 l_s_at Hs.370494 // est
222284_at .... Hs.3735S5 // est
222288_at ... Hs.l30526 // est
222294_s_at RAB27A Hs.298530
222303_at ETS2 Hs.292477
222313_at Hs.293334 // est
222315_at ... Hs.292853 // est
222316_at ... Hs.2926S9 // est
222326_at .._ Hs.432534 // est
222330_at ... Hs.4457Xl // est
222363_at Hs.l326'2O // est
222375_at Hs.372146 // est
266_s_at CD24 Hs.375108
31874_at GAS2L1 Hs.322852
33304_at ISG20 Hs.105434
336_at ...11 —
33646_g_at GM2A Hs.3871S6
34210_at CDW52 Hs.2767'70
35626_at SGSH Hs.31074
35666_at SEMA3F Hs.32981
35820_at GM2A Hs.387156 36553_at Hs.4610S6 // est 36554_at ASMTL Hs.458420 36564_at FLJ90005 Hs.128366 36711_at MAFF Hs.51305 37028_at PPP1R15A Hs.7655G 37145_at GNLY Hs.105806 37986_at EPOR Hs.127826 38037_at DTR Hs.799 38487_at STAB1 Hs.3019S9 38521_at CD22 Hs.262130 39248_at A P3 Hs.2346-42 39318_at TCL1A Hs.2484 39402_at IL1B Hs.126256 396_f_at EPOR Hs.127826 39729_at PRDX2 Hs.4321≤l 40020_at CELSR3 Hs.55173 40093_at LU Hs.155048 40850_at FKBP8 Hs.l734«4 41386_i_at KIAA0346 Hs.1039 3.5 // — 41469_at PI3 Hs.112341 Table 1 (continued):
41577_at PPP1R16B Hs.45719
41644_at SASH1 Hs.166311
44673_at SN Hs.31869
45297_at EHD2 Hs.325650
46665_at SEMA4C Hs.7188
48031_r_at C5orf4 Hs.10235
48106_at FLJ20489 Hs.438867
48808_at DHFR Hs.83765
49306_at RASSF4 Hs.319124
51158_at ... Hs.27373 // —
53987_at na Hs.6343 // —
54037_at HPS4 Hs.441481
55081_at MIRAB13 Hs.8535
55705_at ... Hs.498224 // est
57540_at RBSK Hs.11916
57588_at SLC24A3 Hs.439909
64064_at IAN4L1 Hs.412331
64942_at na Hs.7967 // —
AFFX-HUMISGF3A/M97935_5_at ... ... // ...
AFFX-HUMRGE M10098_3_at ... ... // ...
AFFX-HUMRGE/M10098_5_.at ... ... // ...
AFFX-HUMRGE/M10098_M_at ... ... // ...
AFFX-M27830_5_at ... ... // ...
AFFX-M27830_M_at ... ... // ...
AFFX-r2-Hs 18SrRNA-3_s_at ... ... // ...
AFFX-r2-Hsl8SrRNA-5_at ... ... // ...
AFFX-r2-Hsl8SrRNA-M_x_at ... ... // ...
AFFX-r2-Hs28SrRNA-3_at ... ... // ...
AFFX-r2-Hs28SrRNA.ML.at ... ... // ...
Table 2 About 599 genes defining assigned clusters of AML as identified by SAM.
Affymetrix probe set id Gene symbol Cluster defined Unigene ID
202672_s_at ATF3 cluster 1 Hs.460
201464_x_at JUN cluster 1 Hs.78465
202497_x_at SLC2A3 cluster 1 Hs.419240 204622_x_at NR4A2 cluster 1 Hs.82120
216236_s_at SLC2A14 cluster 1 Hs.401274
216248_s_at NR4A2 cluster 1 Hs.82120
204621_s_at NR4A2 cluster 1 Hs.82120
222088_s_at SLC2A14 cluster 1 Hs.401274 220014_at L0C51334 cluster 1 Hs.157461
206762_at KCNA5 cluster 1 Hs.150208
213094_at GPR126 cluster 1 Hs.419170
218502_s_at TRPS1 cluster 1 Hs.26102
221530_s_at BHLHB3 cluster 1 Hs.437282 221884_at EVIl cluster 1 Hs.436019
203642_s_at KIAA0977 cluster 1 Hs.300855
212827_at IGHM cluster 1 Hs.153261
205612_at MMRN cluster 1 Hs.268107
209200_at MEF2C cluster 1 Hs.368950 214255_at ATP10A cluster 1 Hs.125595
201539_s_at FHL1 cluster 1 Hs.421383
205717_x_at PCDHGC3 cluster 1 Hs.283794
222144_at E3F17 cluster 1 Hs.130411 // -
219922_s_at LTBP3 cluster 1 Hs.289019 215836_s_at PCDHGC3 cluster 1 Hs.283794
205861_at SPIB cluster 1 Hs.437905
203372 s at SOCS2 cluster 1 Hs.405946 Table 2 (continued):
209079_x_at PCDHGC3 cluster 1 Hs.283794
215811_at — cluster 1 Hs.275706 // —
209199_s_at MEF2C cluster 1 Hs.368950
207655_s_at BLNK cluster 1 Hs.167746
203716_s_at DPP4 cluster 1 Hs.44926
219737_s_at ... cluster 1 Hs.458282 // est
204304_s_at PR0M1 cluster 1 Hs.370052
203373_at SOCS2 cluster 1 Hs.405946
218237_s_at SLC38A1 cluster 1 Hs.132246
202265_at BMI1 cluster 1 Hs.380403
210298_x_at FHL1 clusterl Hs.421383
208436_s_at IRF7 cluster 1 Hs.166120
210032_s_at SPAG6 clusterl Hs.158213
206571_s_at MAP4K4 cluster2 Hs.3628
213152_s_at cluster2 Hs.476680 // est
214582_at PDE3B cluster2 Hs.337616
209458_x_at HBA1 cluster2 Hs.449630
208623_s_at VIL2 cluster2 Hs.403997
204018_x_at HBA1 cluster2 Hs.449630
211745_x_at HBA1 cluster2 Hs.449630
211696-.JL.at HBB cluster2 Hs.155376
214414_x_at HBA1 cluster2 Hs.449630
209116_x_at HBB cluster2 Hs.155376
217232_x_at cluster2 ... // ...
211699_x_at HBAl cluster2 Hs.449630
217414_x_at — cluster2 ... // ...
208792_s_at CLU cluster2 Hs.436657
216268_s_at JAG1 cluster2 Hs.409202
208798_x_at GOLGIN-67 cluster2 Hs.182982
213844_at H0XA5 cluster2 Hs.37034
204030_s_at SCHIP1 cluster2 Hs.61490
209193_at PIMl cluster2 Hs.81170
221942_s_at GUCY1A3 cluster2 Hs.433488
208767_s_at LAPTM4B cluster2 Hs.296398
210425_x_at GOLGIN-67 cluster2 Hs.356225
209409_at GRB10 cluster2 Hs.81875
212070_at GPR56 cluster2 Hs.6527
205453_at H0XB2 cluster2 Hs.290432
208797_s_at GOLGIN-67 cluster2 Hs.182982
206582_s_at GPR56 cluster2 Hs.6527
207533_at CCL1 cluster2 Hs.72918
206298_at RhoGAP2 cluster2 Hs.87241
212276_at LPIN1 cluster2 Hs.81412
219615_s_at KCNK5 cluster2 Hs.444448
203187_at D0CK1 cluster2 Hs.437620
206574_s_at PTP4A3 cluster2 Hs.43666
204341_at TRIM16 cluster2 Hs.241305
210145_at PLA2G4A cluster2 Hs.211587
205190_at PLS1 cluster2 Hs.203637
215288_at TRPC2 cluster2 Hs.131910 // —
211269_s_at IL2RA cluster2 Hs.130058
206341_at IL2RA cluster2 Hs.130058
207034_s_at GLI2 cluster2 Hs.111867
212543_at AIM1 cluster3 Hs.422550 // —
204500_s_at AGTPBP1 cluster3 Hs.21542
211729_x_at BLVRA cluster3 Hs.435726
218831_s_at FCGRT cluster3 Hs.111903
221830_at RAP2A cluster3 Hs.48554
203773_x_at BLVRA cluster3 Hs.435726
206034_at SERPINB8 cluster3 Hs.368077
212195_at IL6ST cluster3 Hs.71968
205707_at IL17R cluster3 Hs.129751 203973_s_at KIAA0146 cluster3 Hs.381058 220377_at C14orfll0 cluster3 Hs.395486 201829_at NET1 cluster3 Hs.25155 Table 2 (continued):
207838_x_at PBXIP1 cluster3 Hs.8068
201427_s_at SEPP1 cluster3 Hs.275775
214228_x_at TNFRSF4 cluster3 Hs.129780
201663_s_at SMC4L1 cluster3 Hs.50758
215388_s_at HFL1 cluster3 Hs.296941
203187_at D0CK1 cluster3 Hs.437620
219304_s_at SCDGF-B cluster3 Hs.112885
219602_s_at FLJ23403 cluster3 Hs.293907
215471_s_at MAP7 cluster3 Hs.254605
202890_at MAP7 cluster3 Hs.254605
206582_s_at GPR56 cluster3 Hs.6527
214039_s_at LAPTM4B cluster3 Hs.296398
204341_at TRIM16 cluster3 Hs.241305
204160_s_at ENPP4 cluster3 Hs.54037
213217_at ADCY2 cluster3 Hs.414591
210116_at SH2D1A cluster3 Hs.151544
201664_at SMC4L1 cluster3 Hs.50758
217975_at L0C51186 cluster3 Hs.15984
202889_x_at ANPEP cluster3 Hs.254605
204044_at QPRT cluster3 Hs.8935
208029_s_at LAPTM4B cluster3 Hs.296398
206298_at RhoGAP2 cluster3 Hs.87241
208767_s_at LAPTM4B cluster3 Hs.296398
213110_s_at C0L4A5 cluster3 Hs.169825
205190_at PLS1 cluster3 Hs.203637
207533_at CCL1 cluster3 Hs.72918
205848_at GAS2 cluster3 Hs.135665
206950_at SCN9A cluster3 Hs.2319
210844_x_at CTNNA1 cluster4 Hs.254321
200764_s_at CTNNA1 cluster4 Hs.254321
200765_x_at CTNNAl cluster4 Hs.254321
209191_at TUBB-5 cluster4 Hs.274398
202241_at C8FW cluster4 Hs.444947
217800_s_at NDFIP1 cluster4 Hs.9788
202252_at RAB13 cluster4 Hs.151536
201412_at LRP10 cluster4 Hs.28368
201160_s_at CSDA cluster4 Hs.221889
208683_at CAPN2 cluster4 Hs.350899
205382_s_at DF cluster4 Hs.155597
203233_at IL4R cluster4 Hs.75545
219371_s_at KLF2 cluster4 Hs.107740
208923_at CYFIP1 cluster4 Hs.26704
218627_at FLJ11259 cluster4 Hs.416393
213416_at ITGA4 cluster4 Hs.145140
205884_at ITGA4 cluster4 Hs.145140
214757_at — cluster4 Hs.488749 // est
203987_at FZD6 cluster4 Hs.114218
202242_at TM4SF2 cluster4 Hs.439586
206726_at PGDS cluster4 Hs.128433
54037_at HPS4 cluster4 Hs.441481
216525_x_at PMS2L9 cluster4 Hs.278467
210448_s_at P2RX5 cluster4 Hs.408615
209993_at ABCBl cluster4 Hs.21330
217147_s_at TRIM cluster4 Hs.138701
206233_at B4GALT6 cluster4 Hs.369994
209994_s_at ABCBl cluster4 Hs.21330
220567_at ZNFN1A2 cluster4 Hs.278963
207996_s_at Clδorfl cluster4 Hs.285091
213910_at IGFBP7 cluster4 Hs.435795
214049_x_at CD7 cluster4 Hs.36972
214551_s_at CD7 cluster4 Hs.36972
217143_s_at TRD@ cluster4 Hs.2014
219383_at FLJ14213 cluster4 Hs.183506
211682_x_at UGT2B28 cluster4 Hs.137585
213830 at TRD@ cluster4 Hs.2014 Table 2 (continued):
206232_s_at B4GALT6 cluster4 Hs.369994
216191_s_at TRD@ cluster4 Hs.2014
216286_at — cluster4 Hs.306324 // -
5022 l_at TFEB clusterδ Hs.23391
202895_s_at EPHB4 clusterδ Hs.156114
205099_s_at CCRl clusterδ Hs.301921
200866_s_at PSAP clusterδ Hs.4064δδ
208594_x_at LILRB3 clusterδ Hs.306230
211135_x_at LILRB3 clusterδ Hs.306230
213624_at ASM3A clusterδ Hs.277962
218559_s_at MAFB clusterδ Hs.169487
221578_at RASSF4 clusterδ Hs.319124
212334_at GNS clusterδ Hs.334δ34
203769_s_at STS clusterδ Hs.79876
205686_s_at CD86 clusterδ Hs.27954
205685_at CD86 clusterδ Hs.27954
207104_x_at LILRB1 clusterδ Hs.149924
220066_at CARD15 clusterδ Hs.l3δ201
201642_at IFNGR2 clusterδ Hs.409200
204487_s_at KCNQ1 clusterδ Hs.367809
217992_s_at MGC4342 clusterδ Hs.301342
211732_x_at HNMT clusterδ Hs.42151
210660_at LILRB1 clusterδ Hs.149924
204858_s_at ECGF1 clusterδ Hs.435067
203768_s_at STS clusterδ Hs.79876
222218_s_at PILRA clusterδ Hs.122591
210146_x_at LILRB3 clusterδ Hs.306230
220832_at TLR8 clusterδ Hs.272410
219593_at PHT2 clusterδ Hs.237856
204619_s_at CSPG2 clusterδ Hs.434488
206278_at PTAFR clusterδ Hs.46
207224_s_at SIGLEC7 clusterδ Hs.274470
203767_s_at STS clusterδ Hs.79876
204254_s_at VDR clusterδ Hs.2062
214590_s_at UBE2D1 clusterδ Hs.129683
212681_at EPB41L3 clusterδ Hs.103839
219872_at DKFZp434L142 clusterδ Hs.323583
204392_at CAMKl clusterδ Hs.434876
219788_at PILRA clusterδ Hs.122691
206934_at SIRPB1 clusterδ Hs.194784
211776_s_at EPB41L3 clusterδ Hs.103839
207872_s_at LILRB1 clusterδ Hs.149924
206710_s_at EPB41L3 clusterδ Hs.103839
209083_at COR01A clusterβ Hs.415067
204319_s_at RGS10 clusterβ Hs.82280
217845_x_at HIG1 clusterβ Hs.7917
205672_at XPA clusterβ Hs.288867
217118_s_at KIAA0930 clusterβ Hs.l325δ
211990_at HLA-DPA1 cluster6 Hs.914
210982_s_at HLA-DRA clusterβ Hs.409806
208982_at PECAMl clusterβ Hs.78146
209619_at CD74 clusterβ Hs.446471
215193_x_at HLA-DRB1 clusterβ Hs.411726
201641_at BST2 clusterβ Hs.118110
213266_at ... clusterβ Hs.497941 // est
202729_s_at LTBP1 clusterβ Hs.2412δ7 204751_x_at DSC2 clusterβ Hs.9δ612 215573_at CAT clusterβ Hs.395771 220898_at — clusterβ ... // ... 215388_s_at HFL1 clusterβ Hs.296941 219036_at BITE clusterβ Hs.127217 2047δ0_s_at DSC2 clusterβ Hs.95612 218786_at ... clusterβ Hs.374350 208414_s_at HOXB4 clusterβ Hs.147465 201431_s_at DPYSL3 clusterβ Hs.150358 Table 2 (continued):
21δ623_x_at SMC4L1 clusterβ Hs.δ07δ8
213260_at FOXC1 clusterβ Hs.348883
219932_at VLCS-Hl clusterβ Hs.49765
206377_at FOXF2 clusterβ Hs.44481
202728_s_at LTBP1 clusterβ Hs.241257
2196δl_at FLJ10713 clusterβ Hs.317659
213217_at ADCY2 clusterβ Hs.414591
218710_at FLJ20272 clusterβ Hs.26090
219602_s_at FLJ23403 clusterβ Hs.293907
215807_s_at PLXNB1 clusterβ Hs.278311
212019_at DKFZPδ64M182 clusterβ Hs.lδ899δ
204983_s_at GPC4 clusterβ Hs.58367
204984_at GPC4 clusterβ Hs.58367
221959_at MGC39325 clusterβ Hs.34054
209702_at FTO clusterβ Hs.284741
219511_s_at SNCAIP clusterβ Hs.24948
51158_at ... clusterβ Hs.27373 // —
221880_s_at — clusterβ Hs.27373 // —
201733_at CLCN3 cluster7 Hs.372528
218978_s_at MSCP cluster7 Hs.283716
214433_s_at SELENBP1 cluster7 Hs.334841
201249_at SLC2A1 cluster7 Hs.169902
20δ389_s_at ANK1 cluster7 Hs.443711
207793_s_at EPB41 cluster7 Hs.37427
212804_s_at DKFZP434C212 cluster7 Hs.287266
221237_s_at OSBP2 cluster7 Hs.7740
216925_s_at TALI cluster7 Hs.73828
206077_at KEL cluster7 Hs.420322
213843_x_at SLC6A8 cluster7 Hs.388375
206145_at RHAG cluster7 Hs.368178
217274_x_at — cluster7 ... // ...
216063_at — cluster7 Hs.470084 // est
2207δl_s_at C5orf4 cluster7 Hs.10235
210854_x_at SLC6A8 cluster7 Hs.388375
210586_x_at RHD cluster7 Hs.458333
21039δ_x_at MYL4 cluster7 Hs.356717
20δ262_at KCNH2 cluster7 Hs.188021
208353_x_at ANK1 cluster7 Hs.443711
208416_s_at SPTB cluster7 Hs.438514
219630_at MAP17 cluster7 Hs.431099
208352_x_at ANK1 cluster7 Hs.443711
207087_x_at ANK1 cluster7 Hs.443711
211254_x_at RHAG cluster7 Hs.368178
206647_at HBZ cluster7 Hs.272003
214δ30_x_at EPB41 cluster7 Hs.37427
203911_at RAP1GA1 cluster7 Hs.433797
218864_at TNS cluster7 Hs.439442
207043_s_at SLC6A9 cluster7 Hs.442590
205391_x_at ANK1 cluster7 Hs.443711
210088_x_at MYL4 cluster7 Hs.3δ6717
216054_x_at MYL4 cluster7 Hs.3δ6717
206146_s_at RHAG cluster7 Hs.368178
204720_s_at DNAJC6 cluster7 Hs.44896
20δ390_s_at ANK1 cluster7 Hs.443711
56748_at TRIM10 cluster7 Hs.274295
221577_x_at PLAB cluster7 Hs.296638
207854_at GYPE cluster7 Hs.395535
206116_s_at TPM1 cluster7 Hs.133892
203115_at FECH clusterβ Hs.443610
208352_x_at ANK1 clusterδ Hs.443711
48031_r_at C5orf4 clusterδ Hs.10235
214433_s_at SELENBP1 clusterδ Hs.334841
2188δ3_s_at DJ473B4 clusterδ Hs.57549
209890_at TM4SF9 clusterδ Hs.8037
210686 x_at RHD clusterδ Hs.458333 Table 2 (continued):
213843_x_at SLC6A8 clusterδ Hs.388376
207087_x_at ANK1 clusterβ Hs.443711
204467_s_at SNCA clusterδ HS.76Θ30
216317_x_at RHCE clusterβ Hs.27δθθ4
202124_s_at ALS2CR3 clusterβ Hs.l5424δ
216833_x_at GYPE clusterδ Hs.3θ5635
201886_at WDR23 clusterδ Hs.283θ76
202074_s_at OPTN clusterδ HS.3Θ0162
215312_s_at — clusterδ HS.4ΘΘ113 // est
218864_at TNS clusterδ Hs.439442
211820_x_at GYPA clusterδ Hs.34287
203794_at CDC42BPA clusterδ Hs.l85δβ
216925_s_at TALI clusterδ Hs.73828
202219_at SLC6A8 clusterδ Hs.3δδ37δ
205838_at GYPA clusterβ Hs.342δ7
211649_x_at clusterδ Hs.449057
217572_at clusterδ ... // ...
20212δ_s_at ALS2CR3 clusterδ Hs.lδ424δ
2083δ3_x_at ANK1 clusterδ Hs.443711
206837_s_at GYPA clusterβ Hs.342δ7
202364_at MXI1 clusterδ Hs.118630
22075 l_s_at C5orf4 clusterβ Hs.10236
214464_at CDC42BPA clusterδ Hs.18586
221237_s_at OSBP2 clusterδ Hs.7740
205391_x_at ANK1 clusterδ Hs.443711
210430_x_at RHD clusterδ Hs.283δ22
201333_s_at ARHGEF12 clusterδ Hs.413112
212151_at PBX1 clusterβ Hs.408222
40093_at LU clusterδ Hs.155048
202073_at OPTN clusterδ Hs.390162
209735_at ABCG2 clusterδ Hs.194720
201131_s_at CDH1 clusterδ Hs.194657
213338_at RIS1 clusterδ Hs.3δ861
200675_at CD81 clusterθ Hs.64457
202370_s_at CBFB clusterθ Hs.l798δl
211031_s_at CYLN2 clusterθ Hs.104717
218927_s_at CHST12 cluster9 Hs.25204
206788_s_at CBFB clusterθ Hs.179881
219218_at FLJ23058 clusterθ Hs.4157θ9
211026_s_at MGLL cluster9 Hs.409δ26
204198_s_at RUNX3 cluster9 Hs.l7001θ
213779_at EMU1 cluster9 Hs.289106
218414_s_at NDE1 clusterθ Hs.263925
200984_s_at CD59 clusterθ Hs.278573
204197_s_at RUNX3 clusterθ Hs.l7001θ
203329_at PTPRM cluster9 Hs.154151
218876_at CGI-38 clusterθ Hs.412685
210889_s_at FCGR2B clusterθ Hs.126334
212771_at LOC221061 clusterθ Hs.66762 // —
20248 l_at SDR1 clusterθ Hs.17144
20δ330_at MN1 clusterθ Hs.26δ515
203939_at NT5E clusterθ Hs.l53θ52
212912_at RPS6KA2 clusterθ Hs.301664
201506_at TGFBI clustei'9 Hs.4214θ6
200665_s_at SPARC clusterθ Hs.111779
204787_at Z39IG clusterθ Hs.8904
207194_s_at ICAM4 clusterθ Hs.43562δ 219308_s_at AK5 clusterθ Hs.18268 209395_at CHI3L1 clusterθ Hs.382202 20δ076_s_at CRA clusterθ Hs.42δl44 219694_at FLJ11127 clusterθ Hs.91166 209396_s_at CHI3L1 clusterθ Hs.382202 20488δ_s_at MSLN clusterθ Hs.408488 221019_s_at COLEC12 clusterθ Hs.29423 20δ987_at CD1C clusterθ Hs.1311 Table 2 (continued):
203058_s_at PAPSS2 clusterθ Hs.274230
203060_s_at PAPSS2 clusterθ Hs.274230
206682_at CLECSF13 clusterθ Hs.54403
212298_at NRP1 clusterθ Hs.173546
206135_at ST18 clusterθ HS.15144Θ
2123δ8_at CLIPR-5Θ clusterθ Hs.73δ7
20796 l_x_at MYHll clusterθ Hs.7δ344
2014θ7_x_at MYHll clusterθ Hs.78344
214575_s_at AZU1 clusterlO Hs.728δ5
205382_s_at DF clusterlO Hs.l555θ7
20θθ06_at C3AR1 clusterlO HS.155Θ35
206111_at RNASE2 clusterlO Hs.72δ
212071_s_at SPTBN1 clusterlO Hs.205401
2037θ6_s_at BCL7A clusterlO Hs.371758
218899_s_at BAALC clusterlO HS.16Θ3Θ5
20θ488_s_at RBPMS clusterlO Hs.195825
218086_at NPDC1 clusterlO Hs.105547
20458 l_at CD22 clusterlO Hs.262150
208614_s_at FLNB clusterlO Hs.81008
204540_at EEF1A2 clusterlO Hs.433839
204θl7_s_at MLLT3 clusterlO Hs.404
209437_s_at SPON1 clusterlO Hs.5378
212δ27_at IGHM clusterlO Hs.153261
200672_x_at SPTBN1 clusterlO Hs.205401
203756_at P164RHOGEF clusterlO Hs.45180
220377_at C14orfll0 clusterlO Hs.3θ54δβ
209576_at GNAI1 clusterlO Hs.203862
20δ330_at MN1 clusterlO Hs.268515
212750_at PPP1R16B clusterlO Hs.4571θ
204484_at PIK3C2B clusterlO Hs.34332θ
209436_at SPON1 clusterlO Hs.5378
20θ282_at PRKD2 clusterlO Hs.205431
207836_s_at RBPMS clusterlO Hs.195825
209487_at RBPMS clusterlO Hs.195825
204083_s_at TPM2 clusterlO Hs.300772
207788_s_at SCAM-1 clusterlO Hs.301302
212558_at GDAP1L1 clusterlO Hs.20977
20θ679_s_at L0C57228 clusterlO Hs.206501
41577_at PPP1R16B clusterlO Hs.4δ719
213506_at F2RL1 clusterlO HS.1542ΘΘ
205933_at SETBP1 clusterlO Hs.20136θ
204004_at — clusterlO Hs.503576 // est
213488_at FLJ00133 clusterlO Hs.7949
20067 l_s_at SPTBN1 clusterlO Hs.205401
20θ763_at NRLN1 clusterlO Hs.440324
47560_at FLJ11Θ39 clusterlO Hs.θ4229
202551_s_at CRIM1 clusterlO Hs.170752
21θl45_at FLJ1193Θ clusterlO Hs.94229
201560_at CLIC4 cluster 11 Hs.25035
20440 l_at KCNN4 cluster 11 Hs.10082
212658_at LHFPL2 cluster 11 Hs.79299
221223_x_at CISH clusterl 1 Hs.8257
20155θ_s_at CLIC4 cluster 11 Hs.25035
20142δ_at ALDH2 cluster 11 Hs.436437
20θ543_s_at CD34 cluster 11 Hs.3749ΘO
203217_s_at SIATΘ cluster 11 Hs.415117
215116_s_at DNM1 cluster 11 Hs.436132
213848_at DUSP7 cluster 11 Hs.3843
200665_s_at SPARC cluster 11 Hs.lll77θ
21167δ_s_at HIC cluster 11 HS.13273Θ
20δ873_s_at DPI cluster 11 HS.17311Θ
20δl01_at MHC2TA clusterll Hs.126714
20θ723_at SERPINBΘ cluster 11 Hs.l0437θ
200762_at DPYSL2 clusterll Hs.173381
20127θ_s_at DAB2 clusterll Hs.81θ88 Table 2 (continued):
217δ38_s_at EVL clusterll Hs.241471
21858θ_at P2RY6 clusterll Hs.123464
216033_s_at FYN clusterll Hs.3θ0567
218966_at MYOδC clusterll Hs.111782
31874_at GAS2L1 clusterll Hs.322852
203139_at DAPK1 clusterll Hs.244318
208δ86_at H1F0 clusterll Hs.226117
201656_at ITGA6 clusterll Hs.212296
21θ777_at hIAN2 clusterll Hs.105466
218237_s_at SLC38A1 clusterll Hs.132246
212171_x_at VEGF clusterll Hs.73793
203542_s_at BTEB1 clusterll Hs.150657
203859_s_at PALM clusterll Hs.7δ4δ2
214953_s_at APP clusterll Hs.177486
218805_at IAN4L1 clusterll Hs.412331
204385_at KYNU clusterll Hs.444471
209583_s_at MOX2 clusterll Hs.79015
206042_x_at SNRPN clusterll Hs.48375
201601_x_at IFITM1 clusterll Hs.458414
201522_x_at SNRPN clusterll Hs.46375
218825_at EGFL7 clusterll Hs.914δl
207076_s_at ASS clusterll Hs.160786
20θ07θ_x_at PCDHGC3 clusterll Hs.283794
204425_at ARHGAP4 cluster 12 Hs.3109
203236_s_at LGALS9 cluster 12 Hs.81337
204152_s_at MFNG clusterl2 Hs.37176δ
202600_s_at NRIP1 clusterl2 Hs.155017
204362_at SCAP2 clusterl2 Hs.410745
200θ31_s_at VCL clusterl2 Hs.75350
202599_s_at NRIP1 clusterl2 Hs.166017
204153_s_at MFNG clusterl2 Hs.371768
200935_at CALR clusterl2 Hs.353170
210140_at CST7 cluster 12 Hs.143212
2006δ6_s_at P4HB clusterl2 Hs.410578
2006δ4_at P4HB clusterl2 Hs.410578
214203_s_at PRODH clusterl2 Hs.343874
206105_at FMR2 clusterl2 Hs.54472
211663_x_at PTGDS cluster 12 Hs.44642θ
207031_at BAPX1 cluster 12 Hs.l05θ41
212204_at DKFZP664G2022 clusterl2 HS.2006Θ2
200770_s_at LAMCl clusterl2 Hs.432855
20θθ60_at HGF clusterl2 Hs.3θβδ30
207650_x_at PTGER1 cluster 12 HS.15Θ360
212509_s_at — clusterl2 Hs.356623 // est
201276_at RABδB clusterl2 Hs.776ΘO
20981δ_at na clusterl2 Hs.454253 // —
209θ61_s_at HGF clusterl2 Hs.3θ6530
218043_s_at AZ2 cluster 12 Hs.437336
207895_at NAALADASEL clusterl2 HS.13Θ67
212732_at MEG3 cluster 12 Hs.418271
203397_s_at GALNT3 clusterl2 Hs.278611
2107δ5_at HGF clusterl2 Hs.3θ6530
206634_at SIX3 clusterl2 Hs.227277
203074_at ANXA8 clusterl2 Hs.87268
216320_x_at MSTl clusterl2 Hs.349110
202260_s_at STXBP1 clusterl2 Hs.325662
205663_at PCBP3 clusterl2 Hs.121241
205614_x_at MSTl clusterl2 Hs.349110
204537_s_at GABRE clusterl2 Hs.22735
210794_s_at MEG3 cluster 12 Hs.41δ271
205110_s_at FGF13 clusterl2 Hs.6640
210θθ8_s_at HGF clusterl2 Hs.396530
210θ97_at HGF clusterl2 Hs.396530
221δ81_s_at WBSCR5 clusterl3 Hs.56607
220660 at Cllorf21 cluster 13 Hs.272100 Table 2 (continued):
2080θl_s_at DKFZP564K0822 clusterl3 Hs.4750
204494_s_at LOC56Θ05 cluster 13 Hs.306331
208δ8δ_at LCP1 clusterl3 Hs.3810θθ
203741_s_at ADCY7 clusterl3 Hs.172199
210010_s_at SLC25A1 cluster 13 Hs.111024
214946_x_at FLJ10824 cluster 13 Hs.375174 // --
211685_s_at NCALD clusterl3 Hs.θ0063
206793_at PNMT cluster 13 HS.18Θ2
20θ822_s_at VLDLR cluster 13 Hs.370422
204073_s_at Cllorfθ clusterl3 Hs.184640
219686_at HSA2δ0δ3θ cluster 13 Hs.68241
214920_at LOC221Θ81 cluster 13 Hs.237θ9 // —
218742_at HPRN cluster 13 Hs.22158
201655_s_at HSPG2 clusterl3 Hs.211673
2043θ6_s_at GPRK5 cluster 13 Hs.211569
203038_at FBLN5 clusterl3 Hs.ll4θ4
2138θ4_at LOC221Θ81 clusterl3 HS.237Θ9 // —
201621_at NBL1 cluster 13 Hs.439671
216356_x_at BAIAP3 cluster 13 Hs.4δδ427
206622_at TRH clusterl3 Hs.182231
218613_at DKFZp761K1423 cluster 13 Hs.236438
2124θ2_s_at KIAA0376 cluster 13 Hs.301011 // —
2124θβ_s_at KIAA0876 cluster 13 Hs.301011 // —
203065_s_at CAV1 cluster 13 Hs.74034
204874_x_at BAIAP3 cluster 13 Hs.458427
206128_at ADRA2C cluster 13 Hs.123022
216832_at CBFA2T1 clusterl3 Hs.90868
2120θ7_at CAV1 cluster 13 Hs.74034
204ΘΘO_s_at ITGB4 cluster 13 Hs.85266
211341_at POU4F1 cluster 13 Hs.458303
211δl7_s_at IL5RA clusterl3 Hs.68876
210744_s_at IL5RA clusterl3 Hs.68876
206940_s_at POU4F1 cluster 13 Hs.458303
20481 l_s_at CACNA2D2 clusterl3 Hs.38θ41δ
213194_at ROBOl clusterl3 Hs.301198
21683 l_s_at CBFA2T1 clusterl3 Hs.90858
20552δ_s_at CBFA2T1 clusterl3 Hs.90858
205529_s_at CBFA2T1 clusterl3 HS.Θ0858
221737_at GNA12 cluster 15 Hs.182874
4048θ_at DRPLA cluster 15 Hs.l6θ488
218501_at ARHGEF3 cluster 15 Hs.26951
217853_at TEM6 cluster 15 Hs.12210
220974_x_at BA108L7.2 cluster 15 Hs.283844
2091θl_at TUBB-5 clusterlδ Hs.274398
21245θ_x_at SUCLG2 clusterlδ Hs.446476
212311_at KIAA0746 clusterlδ Hs.4θ500 // -
218847_at IMP-2 clusterlδ Hs.302θ9
215772_x_at SUCLG2 clusterlδ Hs.247309 // -
212314_at KIAA0746 clusterlδ Hs.49500 // —
202236_s_at SLC16A1 clusterlδ Hs.76231
201δ41_s_at HSPB1 clusterlδ Hs.76067
217800_s_at NDFIP1 clusterlδ Hs.θ78δ
217226_s_at PMX1 clusterlδ Hs.443452
2023θl_at BASP1 clusterlδ Hs.7θδl6
200765_x_at CTNNA1 clusterlδ Hs.254321
213400_s_at TBL1X clusterlδ Hs.76536
213147_at HOXAIO clusterlδ Hs.110637
212θ06_at na clusterlδ Hs.347534 // —
218552_at FLJ10Θ48 clusterlδ HS.170Θ15
214651_s_at HOXAΘ clusterlδ Hs.127428
210365_at RUNX1 clusterlδ Hs.410774
209374_s_at IGHM clusterlδ Hs.153261
213150_at HOXAIO clusterlδ Hs.110637
201719_s_at EPB41L2 clusterlδ Hs.440387
218627_at FLJ1125Θ clusterlδ Hs.416393 Table 2 (continued):
219266.s_at FLJ20356 clusterlδ Hs.610δ3 206463.at H0XB2 clusterlδ Hs.290432 208962.s_at FADS1 cluster 15 Hs.l328θ8 205600.x_at H0XB5 clusterlδ Hs.149548 20406Θ. .at MEIS1 clusterlδ Hs.170177 201867.s_at TBL1X clusterlδ Hs.76536 20ΘΘ05.at H0XA9 clusterlδ Hs.127428 214836.s_at SUCLG2 clusterlδ Hs.446476 203542.s_at BTEB1 cluster 15 Hs.lδ05δ7 212827. at IGHM clusterlδ Hs.153261 211182. x_at RUNX1 clusterlδ Hs.410774 204661. .at CDW52 clusterlδ Hs.276770 206676. at CEACAM8 clusterlδ Hs.41 220057. at GAGED2 clusterlβ Hs.112208 21Θ360. _s_at TRPM4 clusterlβ Hs.31608 219414. at CLSTN2 clusterlβ Hs.12079 220116. at KCNN2 clusterlβ Hs.98280 216370. _s_at TKTL1 clusterlβ Hs.102866 205650. _s_at BRE clusterlβ Hs.80426 211566. .x_at BRE clusterlβ Hs.80426 214183. .s_at TKTL1 clusterlβ Hs.102866 209031. .at IGSF4 clusterlβ Hs.lδ6682 212645. _x_at BRE clusterlβ Hs.δ0426 209030. _s_at IGSF4 clusterlβ Hs.166682 213791. .at PENK clusterlβ HS.33Θ831 206508. .at TNFSF7 clusterlβ HS.ΘΘ899 219606. .at FLJ23221 clusterlβ Hs.91283 211421. _s_at RET clusterlβ Hs.350321 203241. .at UVRAG cluster 16 Hs.13137 213908. .at LOC33Θ005 clusterlβ Hs.212670// — 207Θ11. .s_at TGM5 clusterlβ HS.12Θ71Θ 2141Θ0. _x_at GGA2 clusterlβ Hs.133340 204561. _x_at APOC2 clusterlβ Hs.76615 20Θ663. _s_at ITGA7 clusterlβ Hs.7436θ 21425Θ. _s_at AKR7A2 clusterlβ Hs.6980 205472. _s_at DACH cluster 16 Hs.63931 216331. .at ITGA7 clusterlβ Hs.74369 220010. .at KCNE1L clusterlβ Hs.146372 213484 .at na clusterlβ Hs.66187 // — 2044Θ7. .at ADCY9 clusterlβ Hs.201θβ 215771. _x_at RET clusterlβ Hs.350321 20Θ032. _s_at IGSF4 clusterlβ Hs.156682 219714. _s_at CACNA2D3 clusterlβ Hs.435112 219463. .at C20orfl03 clusterlβ Hs.22θ20 202139. .at AKR7A2 clusterlβ Hs.βθδO 219143, _s_at FLJ20374 clusterlβ Hs.8562 205Θ96. _s_at AK2 clusterlβ HS.2Θ4008 219288. .at HT021 cluster 16 Hs.47166 216663. _at MBNL1 cluster 16 Hs.28578 213361. .at PCTAIRE2BP clusterlβ Hs.416643 210658. _s_at GGA2 clusterlβ Hs.133340 213772. _s_at GGA2 clusterlβ Hs.133340 212174. .at AK2 clusterlβ HS.2Θ4008 Table 3
Abnormality 10-fold CV error Error validation set #Probe sets #Genes t(8;21) - AMLl/ETO 0/1Θ0 0/96 3 2 t(15; 17) - PML /RAR 1/190 0/06 3 2 inv(16) - CBFβ/MYHll 0/190 0/Θ6 1 1 llq23 (cluster #16) 3/190 3/θβ 31 25
EVIl (cluster #10) 16/190 0/96 28 26 cEBPcx (cluster #4) 8/190 2/96 13 8 cEBPa (cluster #15) 17/190 6/96* 36 32 cEBPa (cluster #4 and #15) 5/190 2/96 9 5
FLT3 ITD 27/190 21/96 56 41
Table 4. Clinical and molecular characteristics ofthe 286 patients with de novo AML.
Gender # % Male 138 49 Female 148 51
Age groups Younger than 35 77 27 35-60 177 62 60 and older 32 11
Age (median (range) 45.1 (15.2-77.6)
White blood ceU (WBC) count 75,5 (0.3-263) (109/1, median (range))
Blast count (%, median (range)) 70 (0-98)
Platelet count (109/1, median (range)) 57 (3-931)
FAB
M0 6 2
Ml 64 22
M2 66 23 M3 19 7
M4 53 18
M5 65 23
M6 3 1
Mixed 8 3 Unclassified 2 1
Cytogenetic risk groups Favourable 58 20 t(8;21) 22 8 inv(16) 19 7 t(15;17) 17 6 Unfavourable 39 14 llq23 abnormalities 17 6 -5/7 (ςι) abnormalities 22 8 Normal Cytogenetics 118 41
Molecular abnormalities Mutation FLT3 YΪO 78 27 FLT3 TKD 33 12 N-RAS 26 9 K-MAS 9 3 cEBPa 17 6 Overexpression EVIl 24 Table 5.
#Probe sets: 147 293 569 984 1692 2856 5071 Ratio: >32 >22.6 >16 >11.3 >8 >5.6 >4 chromosomal abnormalities t(8;21) +/- + + + ++ inv(16) +/- +/- +/- + ++ t(15;17) +/- + ++ ++ ++ + llq23 +/- +/- +/- +/- + + +/-
7(q) +/- +/- +/- +/- +/- + +/- mutation
FLT3 ITD +/- +/- +/- +/- +/- +/- +/- FLT3 TED Η-RAS K-RAS cEBPa +/- +/- overexpression
EVIl +/- +/-
(++: 100% clustering, +: clustering in < 2 recognizable clusters, +/-: clustering in > 2 recognizable clusters, - : no clustering)
Table 6: Characteristics of cluster #1 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotyp (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT3 ΪΥO FLT3 TKD N-RAS K-RAS EVIl CEBPA
1595 #1 Ml NN +
2187 #1 Ml NN -
3488 #1 Ml Complex -
1401 #1 Ml NN -
2255 #1 Ml llq23 (t(4;ll)) - +
2302 #1 Ml +H/llq23(sMLL) -
2765 #1 Ml +ll/+ll/Other -
2280 #1 M2 NN -
3304 #1 M5 NN +
3328 #1 M5 llq23 (t(ll;19)) - +
2682 #1 M4 Other/llq23 (t(2;9;ll)) - +
2207 #1 Ml llq23 (t(6;ll)) - +
2772 #1 M5 llq23 (t(6;ll)) - +
2196 #1 M5 NN - +
Table 7: Characteristics of cluster #2 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotyp
Figure imgf000117_0001
(NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duphcation in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyot FLT31ΥO FLT3ΥKD N-itaS K-RAS EVIl CEBPA
3330 #2 M4 +8
2681 #2 Ml NN + _ . . .
2688 #2 ND NN + . . . .
2685 #2 M4 -9q + . . .
2689 #2 M4 NN
2498 #2 M4 t(6;9) + - . . .
2183 #2 M4 NN + . . . .
2214 #2 M5 NN + + . . .
2201 #2 M5 NN + . . . .
3100 #2 Ml NN + . . . .
2672 #2 M5 NN + + . . .
2195 #2 M4 NN + . . . .
1747 #2 M2 NN + . . . .
2774 #2 M4 NN + . . . . ND
1551 #2 Ml NN + . . . .
2194 #2 M4 NN + . . . . +
2182 #2 M5 +8 + . . . .
Table 8: Characteristics of cluster #3 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotyp (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT3 ITD FLT3 TKD N-RAS K-RAS EVIl CEBPA
2480 #3 Ml NN + -
3099 #3 M2 NN + -
2236 #3 Ml NN + -
3331 #3 M2 NN + .
2177 #3 M2 NN + -
2306 #3 Ml NN - -
2286 #3 Ml NN + -
2754 #3 Ml NN + -
3320 #3 Ml NN + -
2326 #3 M2 t(9;22) - - +
2270 #3 Ml +8/0ther - +
2241 #3 M4 NN - ND
2288 #3 M4 -7/llq23 - - +
2205 #3 M2 t(6;9)/Other - -
2665 #3 M5 t(6;9) + -
2257 #3 Ml NN - -
2271 #3 M2 NN - +
2299 #3 M2 +21 - +
2676 #3 M2 ND + .
Table 9: Characteristics of cluster #4 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotyp (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT3 IΥT) FLT3ΥK N-RAS K-RAS EVIl CEBPA
3327 #4 Ml NN -
2242 #4 Ml -9q - +
2668 #4 MO Complex -
2238 #4 Ml NN -
3314 #4 ND Complex (+8, +11) -
2686 #4 Ml NN - +
3483 #4 Ml Other -
3491 #4 Ml NN -
2218 #4 Ml NN/llq23 (sMLL) - +
1316 #4 Ml NN + +
2273 #4 Ml NN . +
2545 #4 Ml NN -
2169 #4 Ml NN - + +
2753 #4 Ml -9q - +
2192 #4 Ml NN . +
Table 10: Characteristics of cluster #5 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormahties) and normal karyotyp (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duphcation in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT3 ITD FLT3 KD N-RAS K-RAS EVIl CEBPA
3301 #5 M5 -5/7(q) - + + - +
2228 #5 M4 NN - - + - +
2272 #5 M5 +8/Other + - - - -
2525 #5 M5 NN - - ND ND -
2655 #5 M4 ND . . . + .
2278 #5 M5 NN
2283 #5 M4 +8/Other
2279 #5 M4 NN
2259 #5 M4 Complex
2220 #5 M5 +11
3490 #5 M5 Other
2217 #5 M5 +8/Other + +
3486 #5 M4 NN
3097 #5 M4 +8/Other
2687 #5 M5 NN
3325 #5 M4 NN
2467 #5 M5 ND
2244 #5 M5 +8/3q/Other +
2282 #5 M4 NN
2771 #5 M5 NN +
Table 10 (continued):
Patient Cluster FAB Karyotype FLT31TO FLT3 TKD N-RAS K-RAS EVIl CEBPA
2185 #5 M5 NN +
3484 #5 M4 NN -
2191 #5 ND NN - +
3321 #5' M5 +8 +
3493 #5 M5 Other -
2296 #5 M5 NN +
2231 #5 M4 NN +
2227 #5 M5 NN/llq23 (sMLL) +
2275 #5 M5 NN +
2692 #5 M5 NN +
2174 #5 M5 NN - +
2669 #5 M5 NN +
2175 #5 M5 NN -
2291 #5 M5 +8 +
2670 #5 M5 t(6;9) +
2289 #5 M5 NN + +
2181 #5 M5 NN +
2198 #5 M5 NN -
3482 #5 M5 NN +
1482 #5 M4 NN - + +
2176 M4 NN +
2305 #5 M5 NN +
2534 #5 M2 Complex -
1197 #5 MO Complex -
Table 11: Characteristics of cluster #6 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotyp (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT3 ITD FLT3 KD N-RAS K-RAS EVIl CEBPA
2683 #6 M2 NN + - 1063 #6 Ml NN + - + 3333 #6 M2 NN + - + 2248 #6 Ml NN + - 2203 #6 Ml NN + - 2679 #6 M2 NN + - 2644 #6 Ml NN + - 2173 #6 Ml ND + +
Table 12: Characteristics of cluster #7 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormahties involved) (>3abnormalities) and normal karyotype (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duphcation in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT3 ITO FLT3 TKD N-RAS K-RAS EVIl CEBPA
3310 #7 M2 NN -
3098 #7 M3 NN -
2199 #7 Ml NN +
2769 #7 Ml NN -
2268 #7 Ml NN +
2507 #7 M2 NN +
3489 #7 M2 Other -
2284 #7 M6 NN -
2246 #7 Ml NN -
2224 #7 M6 Other -
2490 #7 M6 NN +
3319 #7 M5 NN -
3334 #7 ND Other -
2544 #7 M2 +8/Other -
2251 #7 M2 Complex(3q/+8) -
2222 #7 Ml NN - +
2252 #7 M2 NN .
3293 #7 M3 ND . +
Table 13: Characteristics of cluster #8 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormahties involved) (>3abnormahties) and normal karyotype (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT3 ITD FLT3 TKD N-RAS K-RAS EVIl CEBPA
2223 #8 M2 +21 - -
2514 #8 M5 Complex (-7(q)/+8) - -
3318 #8 M2 Complex - (llq23 (t(8;ll)), -5, 3q)
3481 #8 ND +ll/Other - -
3485 #8 M2 NN - -
3315 #8 ND +8,-7(q) - - +
2256 #8 M2 NN - -
3326 #8 M2 inv7(q)/other - -
2656 #8 M2 -7 - -
2543 #8 M2 NN - -
2290 #8 M2 Other - -
2304 #8 MO Other - -
2756 #8 M2 NN - .
Table 14: Characteristics of cluster #9 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormalities, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotyp (NN) are indicated, BP:inv(16) breakpoint, RT: real-time PCR for CBF B-MYH11 (Primer CBFβ 5'- AAGACTGGATGGTATGGGCTGT-3' (sense), Primer 126REV 5'-CAGGGCCCGCTTGGA-3' (antisense), Probe CBFB 6- FAM 5'-TGGAGTTTGATGAGGAGCGAGCCC-3' TAMRA); FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or K-RAS; EVIl: EVIl overexpression; CEPBA: mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype BP RT FLT3 ITO FLT3 TKD N-RAS K-RAS EVIl CEBPA
3277 #9 Ml idt(16) A +
3286 #9 M4 idt(16) A + +
3309 #9 M4 idt(16)/-7(q) A + + +
3115 #9 M5 idt(16) A +
2235 #9 M4 idt(16) A +
2293 #9 M4 idt(16) A +
2696 #9 M4 NN A + +
3324 #9 M5 idt(16) A +
2647 #9 M4 idt(16) A + +
2172 #9 M4 NN A + + +
2254 #9 M4 idt(16) A +
2287 #9 M4 idt(16) D + +
2189 #9 M4 idt(16) A + +
2766 #9 M4 idt(16) A + +
2249 #9 M5 -7(q) A + +
2215 #9 M4 idt(16)/+8 A + +
Table 14: (continued)
Patient Cluster FAB Karyotype BP RT FLT3 ITD FLT3 TKD N-RAS K-RAS EVIl CEBPA
2678 #9 M4 idt(16) A + ND
2202 #9 M4 idt(16) A + +
3487 #9 ND idt(16) A + +
3329 #9 M4 idt(16) A +
2274 #9 M4 NN A +
2750 #9 M2 idt(16)/+8 A +
3285 #9 M4 idt(16) A + +
Table 15: Characteristics of cluster #10 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormalities, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotype (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duphcation in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPBA mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT31TO FLT3 ΥKD N-RAS K-RAS EVIl CEBPA
2661 #10 M4 ND +
3102 #10 M2 -7 +
2747 #10 M5 -7/3q +
2327 #10 M2 -i a) + +
2551 #10 M5 Other +
2276 #10 M0 Other +
2226 #10 Ml +11 +
3308 #10 Ml t(9;22) +
2546 #10 Ml +8
2757 #10 M5 -5
3313 #10 M0 Other
2664 #10 M0 -7/3q + +
2666 #10 M5 ND +
1188 #10 Ml -7(q)
2550 #10 Ml Other +
2539 #10 ND ND
2250 #10 Ml -7 +
2773 #10 M2 NN + +
2186 #10 M5 -7 +
2301 #10 Ml NN +
Table 15: (continued)
Patient Cluster FAB Karyotype FLT3 ΪΥO FLT3 ΥKD N-RAS K-RAS EVIl CEBPA
2497 #10 Ml Other + -
2247 #10 Ml Other - .
Table 16: Characteristics of cluster #11 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotype (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT3 ITO FLT3 TKD N-itaS K-RAS EVIl CEBPA
2209 #11 M4 Other 3096 #11 M4 NN + 2239 #11 M5 Other + 2261 #11 M5 NN + 1299 #11 M2 NN + 1432 #11 Ml NN 3311 #11 M5 NN 1766 #11 ND NN + 2206 #11 M5 NN +
Table 17: Characteristics of cluster #12 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotype (NN) are indicated, RT: real-time PCR for PML-RARα (Primer PML3-for 5'-CCCCAGGAGCCCCGT-3' (sense), Primer PM kbr 5'-CCTGCAGGACCTCAGCTCTT-3'(sense), Primer RAR4-rev 5'- AAAGCAAGGCTTGTAGATGCG-3'(antisense), Probe RARA 6-FAM 5ΑGTGCCCAGCCCTCCCTCGC-3' TAMRA); FLT3 ITD: internal tandem duphcation in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or K-RAS; EVIl: EVIl overexpression; CEPBA: mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype RT FLT3 ITD FLT3 ΥKD N-RAS K-RAS EVIl CEBPA
2466 #12 M3 t(15;17) + - -
2509 #12 M3 t(15;17) + - -
2219 #12 M3 t(15;17) + - +
2263 #12 M3 t(15;17) + - -
2307 #12 M3 t(15;17) + - -
2510 #12 M3 t(15;17) + - +
2297 #12 M3 t(15;17) + - +
2265 #12 M3 t(15;17)/Other + - -
2266 #12 M3 t(15;17)/Other + - -
3279 #12 M3 t(15;17) + - -
2170 #12 M3 t(15;17)/Other + - +
2680 #12 M2 t(15;17) + + -
2671 #12 M3 t(15;17) + + -
2516 #12 M3 t(15;17) + - +
2468 #12 M3 t(15;17) + + -
3278 #12 M3 t(15;17) + - -
Table 17: (continued)
Patient Cluster FAB Karyotype RT FLT3 ITD FLT3 KD N-R S K-RAS EVIl CEBPA
322 #12 M3 Other* + + -
2179 #12 M4 t(15;17)/Other + + -
1448 #12 M3 t(15;17)/+8 + + -
Ψull karyotype of patient 322: 46,XX, add(12)(pl?3).
Table 18: Characteristics of cluster #13 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormalities (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotyp (NN) are indicated, RT: real-time PCR for AML1-ETO (Primer 821 For 5'-TCACTCTGACCATCACTGTCTTCA-3' (sense), Primer 821 Rev 5'-ATTGTGGAGTGCTTCTCAGTACGAT -3'(antisense), Probe ETO 6- FAM 5'-
ACCCACCGCAAGTCGCCACCT -3' TAMRA); FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kina domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or K-RAS; EVIl: EVIl overexpression; CEPBA: mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype RT FLT3 YTO FLT3 ΥKD N-RAS K-RAS EVIl CEBPA
2243 #13 M2 t(+8;21)/Other + - +
2658 #13 M4 t(+8;21) + -
2752 #13 M2 t(+8;21) + -
2197 #13 M2 t(+8;21)/Other + +
2245 #13 M2 t(+8;21)/Other + +
3332 #13 M2 t(+8;21) + -
2262 #13 M2 t(+8;21)/Other + -
2178 #13 M2 t(+8;21)/Other + -
2511 #13 M2 t(+8;21)/+8/Other + -
2200 #13 M2 t(+8;21)/Other + -
2208 #13 M2 t(+8;21) + -
3295 #13 M2 t(+8;21) + -
2204 #13 M2 t(+8;21)/Other + - +
3292 #13 M2 t(+8;21) + -
2549 #13 M2 t(+8;21)/Other + -
2267 #13 M2 t(+8;21)/Other + -
2695 #13 Ml t(+8;21) + -
Table 18: (continued)
Patient Cluster FAB Karyotype RT FLT3 ITD FLT3 TKD N-RAS K-RAS EVIl CEBPA
2751 #13 M2 t(+8;21)/Other + - - - +
2211 #13 M2 t(+8;21)/Other + - - - -
2764 #13 M2 t(+8;21)/Other + - - - -
2210 #13 M2 t(+8;21)/Other + - - + -
2762 #13 M2 t(+8;21)/Other + - - + -
Table 19: Characteristics of cluster #14 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3ab normalities) and normal karyotype (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT3 ITD FLT3 ΥKD N-RAS K-RAS EVIl CEBPA
2536 #14 ND ND - - 2704 #14 M2 ND + -
2690 #14 M2 +8/Other - - +
3289 #14 M2 llq23 (ND) + -
2212 #14 M2 -5(g) - -
2233 #14 Ml Complex(-5/-7/+8) - - 1201 #14 M4 Complex - +
2188 #14 M2 +8 - -
3492 #14 M2 NN + +
2260 #14 M5 NN . .
Table 20: Characteristics of cluster #15 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotype (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT31ΥD FLT3 TKD N-RAS K-RAS EVIl CEBPA
2767 #15 Ml ND - + 2748 #15 M4 NN - - +
2240 #15 Ml NN - - +
3101 #15 M2 NN + - + +
2234 #15 M2 Other - - +
2230 #15 M2 NN + . 2253 #15 M2 NN - - +
2237 #15 Ml -7/Other . .
Table 21: Characteristics of cluster #16 (Patient: patient number, Cluster: cluster number (2856 probe sets); FAB: FAB subtype of AML; Karyotype: t(15;17), t(8;21), inv(16)/t(16;16),+8,+ll,+21,-5(q),-7(q),t(9;22),3q abnormahties, llq23 abnormahties (translocation/self fusion (sMLL)), complex(abnormalities involved) (>3abnormalities) and normal karyotype (NN) are indicated, RT: real-time PCR; FLT3 ITD: internal tandem duplication in FLT3; FLT3 TKD: tyrosine kinase domain mutation in FLT3; N- or K-RAS: mutation in codon 12,13 or 61 of N- or KRAS; EVIl: EVIl overexpression; CEPB mutation in CEBPA, ND: not determined).
Patient Cluster FAB Karyotype FLT3 ITD FLT3 TKD N-RAS K-RAS EVIl CEBPA
2225 #16 M4 NN -
2184 #16 M5 Other -
2535 #16 M5 Other -
3322 #16 M5 +8/llq23 (t(ll;19) -
2285 #16 M5 llq23 (t(9;ll)) +
3316 #16 M5 Other/llq23 (t(9;ll)) -
2694 #16 M5 llq23 (t(9;ll)) -
3317 #16 M5 Other -
2749 #16 M5 NN -
2281 #16 Ml NN -
2541 #16 M5 llq23 (t(9;ll))/-7 -
Table 22: Frequency and percentage of cytogenetic and molecular abnormalities of all AML patients within each ofthe assigned clusters. All patients with a specific abnormality were considered, irrespective ofthe presence of additional abnormahties (NC: patients not assigned to any ofthe 16 clusters).
Cluster #1 #2 #3 #4 #δ #6 #7 #8 #9 #10 #11 #12 #13 #14 #15 #16 NC total
Patients in cluster 14 17 lθ 15 44 8 18 13 23 22 9 19 22 10 8 11 13 285
Cvtoεenetics t(lδ;17) 18 (95] 1 18(6) t(8;21) 22 (100) 22(8) inv(16)/t(16;16) 19 (83' ) 19(7)
+8 2(12) 1(5) 1(7) 7(16) 2(11) 2(15) 2(9) 1(5) 1(5) 1(5) 3(30) 1(9) 2(15) 26(9)
+11 2(14) 1(7) 1(2) 1(8) 1(5) 1(8) 7(2)
+21 1(5) 1(8) 2(1)
-5 1(8) 1(5) 1(10) 3(1)
-5(q) 1(10) 1(<1)
-7 1(5) 1(2) 1(8) 5(23) 1(10) 1(13) 1(9) 2(15) 13(5)
-7(q) 3(23) 2(θ) 2(9) 7(2)
3q 1(2) 1(6) 1(8) 1(8) 4(1) t(6;9) 1(6) 2(11) 1(2) 4(1) t(θ;22) 1(5) 1(5) 2(1) t(llq23) 6(43) 1(5) 2(13) 1(2) 1(8) 1(10) 5(46) 2(15) 19(7) complex (>3 abn.) 1(7) 2(13) 3(7) 1(6) 2(15) 2(20) 11(4) other non-complex 2(14) 1(6) 2(11) 3(20) 7(16) 4(22) 4(31) 6(27) 2(22) 4(21) 15 (68) 1 (10) 2(2δ) 4(36) 3(23) 60 (21) normal 6(43) 13 (76) 13 (68) 10 (67) 27 (61) 7 (88) 12 (67) 4 (31) 3(13) 2(9) 7(78) 2(20) 5(63) 3(27) 5(38) 119 (42
ND 2(5) 1(13) 1(6) 3(14) 2(20) 1(13) 10(4)
Cluster #1 #2 #3 #4 #5 #6 #7 #8 #9 #10 #11 #12 #13 #14 #15 #16 NC total
Patients in cluster 14 17 lθ Iδ 44 8 18 13 23 22 9 19 22 10 8 11 13 2δδ
Molecular markers
FLT3-ITO 2(14) 14 (82) 10 (53) 1 (7) 14 (32) 8 (100; 14 (22) 4(18) KH) 6(32) 1(5) 3(30) 2(25) 8(62) 78 (27)
FLT3-TKD 3(18) 3(16) 6(14) 1(13) 6(26), 1(5) 3(33) 5(26) 1(5) 2(20) 1(13) 1(9) 33 (12)
N-RAS 1(7) 4(θ) 1(8) 8(35) 3(14) 2(22) 3(14) 1(10) 1(13) 2(15) 26(9)
K-RAS 1(7) 4(9) 2(25) 1(4) 1(5) 9(3)
EVIl 5(36) 2(11) 2(5) 2(11) 10 (45) 1 2(15) 23(8)
CEBPA 1(6) 8(53) 1(2) 1(5) 1(5) 5(63) 17(6)
Table 23: Top40 genes of cluster #1
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
220014_at LOC51334 51334 NM_016644.1 7,09 1,96
206762_at KCNA5 3741 NM_002234.1 6,68 1,96
213094_at GPR126 57211 AL033377 6,18 1,96
218502_s_at TRPS1 7227 NM_014112.1 5,95 1,96
221530_s_at BHLHB3 79365 AB044088.1 5,63 1,96
221884_at EVIl 2122 BE466525 5,40 1,96
203642_s_at KIAA0977 22837 NM__014900.1 4,96 1,96
212827_at IGHM 3507 X17115.1 4,85 1,96
205612_at MMRN 22915 NM..007351.1 4,72 1,96
209200_at MEF2C 4208 N22468 4,59 1,96
214255_at ATP10A 57194 AB011138.1 4,41 1,96
2QT539_s_at FHL1 2273 U29538.1 4,37 1,96
205717_x_at PCDHGC3 5098 NM .002588.1 4,29 1,96
222144_at KIF17 57576 AA909345 4,25 1,96
219922_s_at LTBP3 4054 NM_021070.1 4,21 1,96
215836_s_at PCDHGC3 5098 AK026188.1 4,20 1,96
205861_at SPIB 6689 NM .003121.1 4,15 1,96
203372_s_at SOCS2 8835 AB004903.1 4,12 1,96
209079_x_at PCDHGC3 5098 AF152318.1 4,11 1,96
215811_at ... ... AF238870.1 4,09 1,96
209199_s_at EF2C " 4208 N22468 4,08 1,96
207655_s_at BLNK 29760 NM_013314.1 4,05 1,96
203716_s_at DPP4 1803 M80536.1 4,03 1,96
219737_s_at ... ... AI524125 4,01 1,96
204304_s_at PROM1 8842 NM_006017.1 3,97 1,96
203373_at SOCS2 8835 NMJ303877.1 3,95 1,96
218237_s_at SLC38A1 81539 NM_030674.1 3,87 1,96
202265_at BMI1 648 NM_005180.1 3,86 1,96
210298_x_at FHL1 2273 AF098518.1 3,83 1,96
208436_s_at IRF7 3665 NM_004030.1 3,77 1,96
210032_s_at SPAG6 9576 AI651156 3,77 1,96
222088_s_at SLC2A14 144195 AA778684 -3,76 1,96
20462 l_s_at NR4A2 4929 AI935096 -3,80 1,96
216248_s_at NR4A2 4929 S77154.1 -3,84 1,96
216236_s_at SLC2A14 144195 AL110298.1 -3,85 1,96
204622_x_at NR4A2 4929 NM_006186.1 -3,85 1,96
202497_x_at SLC2A3 6515 NM_006931.1 -3,91 1,96
201464_x_at JUN 3725 BG491844 -3,92 1,96
202672_s_at ATF3 467 NM_001674.1 -4,11 1,96 Table 24: Top40 genes of cluster #2
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
207034_s_at GLI2 2736 NM_030379.1 10,30 1,04
206341_at IL2RA 3559 NM_000417.1 9,15 1,04
211269_s_at IL2RA 3559 K03122.1 8,24 1,04
215288_at TRPC2 7221 AI769824 7,44 1,04
205190_at PLS1 5357 NM_002670.1 7,34 1,04
210145_at PLA2G4A 5321 M68874.1 7,31 1,04
204341_at TRIM16 10626 NM_006470.1 7,23 1,04
206574_s_at PTP4A3 11156 NM_007079.1 7,01 1,04
203187_at DOCK1 1793 NM_001380.1 6,48 1,04
219615_s_at KCNK5 8645 NM_003740.1 6,29 1,04
212276_at LPIN1 23175 D80010.1 6,05 1,04
206298_at R oGAP2 58504 NM_021226.1 5,82 1,04
207533_at CCL1 6346 NM_002981.1 5,69 1,04
206582_s_at GPR56 9289 NM_005682.1 5,41 1,04
208797_s_at GOLGIN-67 23015 AI829170 5,37 1,04
205453_at HOXB2 3212 NM_002145.1 5,12 1,04
212070_at GPR56 9289 AL554008 5,01 1,04
209409_at GRB10 2887 D86962.1 4,99 1,04
210425_x_at GOLGIN-67 23015 AF164622.1 4,97 1,04
208767_s_at LAPTM4B 55353 AW149681 4,95 1,04
221942_s_at GUCY1A3 2982 AI719730 4,95 1,04
209193_at PIMl 5292 M24779.1 4,94 1,04
204030_s_at SCHIP1 29970 NMJH4575.1 4,89 1,04
213844_at HOXA5 3202 NM_019102.1 4,74 1,04
208798_x_at GOLGIN-67 23015 AF204231.1 4,70 1,04
216268_s_at JAG1 182 U77914.1 4,68 1,04
208792_s_at CLU 1191 M25915.1 4,60 1,04
217414_x_at ... — V00489 -4,62 1,04
211699_x_at HBA1 3039 AF349571.1 -4,67 1,04
217232_x_at ... — AF059180 -4,71 1,04
209116_x_at HBB 3043 M25079.1 -4,71 1,04
214414_x_at HBA1 3039 T50399 -4,72 1,04
211696_x_at HBB 3043 AF349114.1 -4,72 1,04
211745_x_at HBA1 3039 BC005931.1 -4,75 1,04
204018_x_at HBA1 3039 NM_000558.2 -4,83 1,04
208623_s_at VIL2 7430 J05021.1 -4,91 1,04
209458_x_at HBA1 3039 AF105974.1 -4,96 1,04
214582_at PDE3B 5140 NM_000753.1 -5,29 1,04
213152_s_at ... ... AI343248 -5,39 1,04
206571_s_at MAP4K4 9448 NM_004834.1 -6,87 1,04 Table 25: Top40 genes of cluster #3
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
206950_at SCN9A 6335 NM_002977.1 10,09 0,21
205848_at GAS2 2620 NM_005256.1 8,63 0,21
207533_at CCL1 6346 NM_002981.1 8,56 0,21
205190_at PLS1 5357 NM_002670.1 7,94 0,21
213110_s_at COL4A5 1287 AW052179 7,51 0,21
208767_s_at LAPTM4B 55353 AW149681 7,09 0,21
206298_at R oGAP2 58504 NM_021226.1 7,07 0,21
208029_s_at LAPTM4B 55353 NM_018407.1 7,05 0,21
204044_at QPRT 23475 NM_014298.2 7,04 0,21
202889_x_at ANPEP 9053 T62571 6,84 0,21
217975_at LOC51186 51186 NM_016303.1 6,81 0,21
201664_at SMC4L1 1O051 AL136877.1 6,81 0,21
210116_at SH2D1A 4068 AF072930.1 6,74 0,21
213217_at ADCY2 108 AU149572 6,53 0,21
204160_s_at ENPP4 22875 AW194947 6,48 0,21
204341_at TRIM16 10626 NM_006470.1 6,42 0,21
214039_s_at LAPTM4B 55353 T15777 6,41 0,21
206582_s_at GPR56 9289 NM_005682.1 6,28 0,21
202890_at MAP7 9053 T62571 6,28 0,21
215471_s_at MAP7 9053 AJ242502.1 6,23 0,21
219602_s_at FLJ23403 63895 NM_022068.1 6,20 0,21
219304_s_at SCDGF-B 8O310 NM_025208.1 6,05 0,21
203187_at DOCK1 1793 NM_001380.1 6,03 0,21
215388_s_at HFL1 3078 X56210.1 6,00 0,21
201663_s_at SMC4L1 10051 NM_005496.1 6,00 0,21
214228_x_at TNFRSF4 7293 AJ277151 5,96 0,21
201427_s_at SEPP1 6414 NM_005410.1 5,94 0,21
207838_x_at PBXIP1 57326 NM_020524.1 5,92 0,21
201829_at NET1 10276 AW263232 5,85 0,21
220377_at Cl4orfll0 29064 NM_014151.1 5,85 0,21
203973_s_at KIAA0146 23514 NM_005195.1 -5,88 0,21
205707_at IL17R 23765 NM_014339.1 -5,95 0,21
212195_at IL6ST 3572 AL049265.1 -6,03 0,21
206034_at SERPINB8 5271 NM_002640.1 -6,11 0,21
203773_x_at BLVRA 644 iS[M_000712.1 -6,71 0,21
221830_at RAP2A 5911 AI302106 -6,94 0,21
218831_s_at FCGRT 2217 NM_004107.1 -7,10 0,21
211729_x_at BLVRA 644 BC005902.1 -7,18 0,21
204500_s_at AGTPBP1 23287 NM_015239.1 -8,15 0,21
212543_at AIM1 202 U83115.1 -8,19 0,21 Table 26: Top40 genes of cluster #4
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
216286_at — — AV760769 13,34 0,11
216191_s_at TRD@ 6964 X72501.1 13,01 0,11
206232_s_at B4GALT6 9331 NM_004775.1 12,59 0,11
213830_at TRD@ 6964 AW007751 11,85 0,11
211682_x_at UGT2B28 54490 AF177272.1 11,60 0,11
219383_at FLJ14213 79899 NM_024841.1 11,57 0,11
217143_s_at TRD@ 6964 X06557.1 11,55 0,11
214551_s_at CD7 924 NM_006137.2 11,22 0,11
214049_x_at CD7 924 AI829961 11,04 0,11
213910_at IGFBP7 3490 AW770896 10,85 0,11
207996_s_at Clβαrfl 753 NM_004338.1 10,65 0,11
220567_at ZNFN1A2 22807 NM_016260.1 10,27 0,11
209994_s_at ABCBl 5243 AF016535.1 9,90 0,11
206233_at B4GALT6 9331 AF097159.1 9,66 0,11
217147_s_at TRIM 50852 AJ240085.1 9,44 0,11
209993_at ABCBl 5243 AF016535.1 9,40 0,11
210448_s_at P2RX5 5026 U49396.1 9,36 0,11
216525_x_at PMS2L9 5387 D38437.1 9,20 0,11
54037_at HPS4 89781 AL041451 9,16 0,11
206726_at PGDS 27306 NM_014485.1 8,79 0,11
202242_at TM4SF2 7102 NM_004615.1 8,79 0,11
203987_at FZD6 8323 NM_003506.1 8,63 0,11
214757_at ... ... BG178274 8,50 0,11
205884_at ITGA4 3676 NM_000885.2 8,49 0,11
213416_at ITGA4 3676 BG532690 8,37 0,11
218627_at FLJ11259 55332 NM_018370.1 -8,51 0,11
208923_at CYFIP1 23191 BC005097.1 -8,75 0,11
219371_s_at KLF2 10365 NM_016270.1 -8,95 0,11
203233_at IL4R 3566 NM_000418.1 -8,96 0,11
205382_s_at DF 1675 NM_001928.1 -8,98 0,11
208683_at CAPN2 824 M23254.1 -9,08 0,11
201160_s_at CSDA 8531 AL556190 -9,13 0,11
201412_at LRP10 26020 NM_014045.1 -9,19 0,11
202252_at RAB13 5872 NM_002870.1 -9,25 0,11
217800_s_at NDFIP1 80762 NM_030571.1 -9,98 0,11
202241_at C8FW 10221 NM_025195.1 -10,41 0,11
209191_at TUBB-5 84617 BC002654.1 -10,60 0,11
200765_x_at CTNNA1 1495 NM_001903.1 -14,35 0,11
200764_s_at CTNNA1 1495 AI826881 -15,70 0,11
210844_x_at CTNNA1 1495 D14705.1 -15,91 0,11 Table 27: Top40 genes of cluster #5
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
206710_s_at EPB41L3 23136 NM_012307.1 21,03 0,05
207872_s_at LILRB1 10859 NM_006863.1 19,91 0,05
211776_s_at EPB41L3 23136 BC006141.1 19,65 0,05
206934_at SIRPB1 10326 NM .006065- 1 19,55 0,05
219788_at PILRA 29992 NM_013439.1 17,93 0,05
204392_at CAMK1 8536 NM_003656.2 17,41 0,05
219872_at DKFZp434L142 51313 NM_016613.1 17,11 0,05
212681_at EPB41L3 23136 AI770004 17,04 0,05
214590_s_at UBE2D1 7321 AL545760 15,87 0,05
204254_s_at VDR 7421 NM_000376.1 15,69 0,05
203767_s_at STS 412 AU138166 15,64 0,05
207224_s_at SIGLEC7 27036 NM .016543.1 15,61 0,05
206278_at PTAFR 5724 D 10202.1 15,55 0,05
204619_s_at CSPG2 1462 BF590263 15,07 0,05
219593_at PHT2 51296 NM_016582.1 15,04 0,05
220832_at TLR8 51311 NM_01661O.l 14,94 0,05
210146_x_at LILRB3 11025 AF004231.1 14,91 0,05
222218_s_at PILRA 29992 AJ400843.1 14,71 0,05
203768_s_at STS 412 AU138166 14,70 0,05
204858_s_at ECGF1 1890 NM_001953.2 14,70 0,05
210660_at LILRB1 10859 AF025529.1 14,70 0,05
211732_x_at HNMT 3176 BC005907.1 14,69 0,05
217992_s_at MGC4342 79180 NM_024329.1 14,67 0,05
204487_s_at KCNQ1 3784 NM_00021S.l 14,66 0,05
201642_at IFNGR2 3460 NM_005534.1 14,58 0,05
220066_at CARD15 64127 NM_022162.1 14,53 0,05
207104_x_at LILRB1 10859 NM_006669.1 14,46 0,05
205685_at CD86 942 BG236280 14,21 0,05
205686_s_at CD86 942 NM .006889.1 14,15 0,05
203769_s_at STS 412 NM_000351.2 14,05 0,05
212334_at GNS 2799 AW167793 14,03 0,05
221578_at RASSF4 83937 AF260335.L 14,00 0,05
218559_s_at MAFB 9935 NM_005461.1 13,99 0,05
213624_at ASM3A 10924 AA873600 13,96 0,05
211135_x_at LILRB3 11025 AF009644.1 13,91 0,05
208594_x_at LILRB3 11025 NM_024318.1 13,90 0,05
200866_s_at PSAP 5660 M32221.1 13,89 0,05
205099_s_at CCR1 1230 NM_001295.1 13,87 0,05
202895_s_at EPHB4 140885 D86043.1 13,85 0,05
50221_at TFEB 7942 AI524138 13,81 0,05 Table 28: Top40 genes of cluster #6
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
221880_s_at — — AI279819 12,39 0,85
51158_at ... — AI801973 10,99 0,85
219511_s_at SNCAIP 9627 NM_005460.1 8,81 0,85
209702_at FTO 79068 U79260.1 8,51 0,85
221959_at MGC39325 90362 AK026141.1 8,40 0,85
204984_at GPC4 2239 NM_001448.1 8,34 0,85
204983_s_at GPC4 2239 AF064826.1 8,25 0,85
212019_at DKFZP564M182 26156 AK025446.1 7,56 0,85
215807_s_at PLXNB1 5364 AV693216 7,42 0,85
219602_s_at FLJ23403 63895 NM_022068.1 6,93 0,85
218710_at FLJ20272 55622 NM .017735.1 6,80 0,85
213217_at ADCY2 108 AU149572 6,78 0,85
219651_at FLJ10713 55211 NM_018189.1 6,78 0,85
202728_s_at LTBP1 4052 AI986120 6,64 0,85
206377_at FOXF2 2295 NM_001452.1 6,60 0,85
219932_at VLCS-H1 28965 NM_014031.1 6,31 0,85
213260_at FOXC1 2296 AU145890 6,23 0,85
215623_x_at SMC4L1 10051 AK002200.1 6,19 0,85
201431_s_at DPYSL3 1809 NM_001387.1 6,18 0,85
208414_s_at HOXB4 3214 NM_002146.1 6,17 0,85
218786_at ... — NM_016575.1 6,16 0,85
204750_s_at DSC2 1824 BF196457 6,16 0,85
219036_at BITE 80321 NM_024491.1 6,13 0,85
215388_s_at HFL1 3078 X56210.1 6,12 0,85
220898_at ... — NM_024972.1 6,08 0,85
215573_at CAT 847 AU147084 6,04 0,85
204751_x_at DSC2 1824 NM_004949.1 6,01 0,85
202729_s_at LTBP1 4052 NM_000627.1 5,97 0,85
213266_at ... — BF592982 5,61 0,85
201641_at BST2 684 NM_004335.2 -5,55 0,85
215193_x_at HLA-DRBl 3123 AJ297586.1 -5,56 0,85
209619_at CD74 972 K01144.1 -5,58 0,85
208982_at PECAM1 5175 AW574504 -5,62 0,85
210982_s_at HLA-DRA 3122 M60333.1 -5,68 0,85
211990_at HLA-DPAl 3113 M27487.1 -5,84 0,85
217118_s_at KIAA0930 23313 AK025608.1 -5,87 0,85
205672_at XPA 7507 NM_000380.1 -6,10 0,85
217845_x_at HIG1 25994 NM_014056.1 -6,41 0,85
204319_s_at RGS10 6001 NM .002925.2 -6,69 0,85
209083_at COROIA 11151 U34690.1 -6,97 0,85 Table 29: Top40 genes of cluster #7
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM
206116_s_at TPM1 7168 NM_000366.1 15,29 0,11
207854_at GYPE 2996 NM_002102.1 13,28 0,11
221577_x_at PLAB 9518 AF003934.1 12,76 0,11
56748_at TRIM10 10107 X90539 12,56 0,11
205390_s_at ANK1 286 NM_000037.2 11,78 0,11
204720_s_at DNAJC6 9829 AV729634 11,68 0,11
206146_s_at RHAG 6005 AF178841.1 11,40 0,11
216054_x_at MYL4 4635 X58851 11,18 0,11
210088_x_at MYL4 4635 M36172.1 11,16 0,11
205391_x_at ANK1 286 M28880.1 11,09 0,11
207043_s_at SLC6A9 6536 NM_006934.1 11,08 0,11
218864_at TNS 7145 AF116610.1 10,98 0,11
203911_at RAP1GA1 5909 NM_002885.1 10,94 0,11
214530_x_at EPB41 2035 AF156225.1 10,93 0,11
206647_at HBZ 3050 NM_005332.2 10,90 0,11
211254_x_at RHAG 6005 AF031549.1 10,88 0,11
207087_x_at ANK1 286 NM_020478.1 10,84 0,11
208352_x_at ANK1 286 NM_020479.1 10,83 0,11
219630_at MAP17 10158 NM_005764.1 10,71 0,11
208416_s_at SPTB 6710 NM_000347.2 10,70 0,11
208353_x_at ANK1 286 NM_020480.1 10,70 0,11
205262_at KCNH2 3757 NM_000238.1 10,67 0,11
210395_x_at MYL4 4635 AF116676.1 10,65 0,11
210586_x_at RHD 6007 AF312679.1 10,64 0,11
210854_x_at SLC6A8 6535 U17986.1 10,61 0,11
220751_s_at C5orf4 10826 NM_016348.1 10,60 0,11
216063_at N55205 10,60 0,11
217274_x_at X52005.1 10,53 0,11
206145_at RHAG 6005 NM_000324.1 10,51 0,11
213843_x_at SLC6A8 6535 AW276522 10,48 0,11
206077_at KEL 3792 NM_000420.1 10,47 0,11
216925_s_at TALI 6886 X51990.1 10,42 0,11
221237_s_at OSBP2 23762 NM_030758.1 10,37 0,11
212804_s_at DKFZP434C212 26130 AK023841.1 10,27 0,11
207793_s_at EPB41 2035 NM_004437.1 10,24 0,11
205389_s_at ANK1 286 AI659683 10,21 0,11
201249_at SLC2A1 6513 NM_006516.1 10,20 0,11
214433_s_at SELENBPl 8991 NM_003944.1 10,18 0,11
218978_s_at MSCP 51312 NM_018586.1 10,13 0,11
201733_at CLCN3 1182 NM 001829.1 10,12 0,11 Table 30: Top40 genes of cluster #8
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
213338_at RIS1 25907 BF062629 12,86 0,17
201131_s_at CDH1 999 NM_004360.1 12,12 0,17
209735_at ABCG2 9429 AF098951.2 11,01 0,17
202073_at OPTN 10133 AV757675 10,88 0,17
40093_at LU 4059 X83425 10,45 0,17
212151_at PBX1 5087 BF967998 10,14 0,17
201333_s_at ARHGEF12 23365 NM_015313.1 9,95 0,17
210430_x_at RHD 6007 L08429.1 9,72 0,17
20539 l_x_at ANK1 286 M28880.1 9,53 0,17
221237_s_at OSBP2 23762 NM_030758.1 9,53 0,17
214464_at CDC42BPA 8476 NM_003607.1 9,44 0,17
22075 l_s_at C5orf4 10826 NM_016348.1 9,42 0,17
202364_at MXI1 4601 NM_005962.1 9,29 0,17
205837_s_at GYPA 2993 BC005319.1 9,22 0,17
208353_x_at ANK1 286 NM_020480.1 9,20 0,17
202125_s_at ALS2CR3 66008 NM_015049.1 9,10 0,17
217572_at — . ... AA654586 9,06 0,17
211649_x_at — L14456.1 9,04 0,17
205838_at GYPA 2993 NM_002099.2 9,04 0,17
202219_at SLC6A8 6535 NM_005629.1 9,03 0,17
216925_s_at TALI 6886 X51990.1 8,98 0,17
203794_at CDC42BPA 8476 NM_014826.1 8,96 0,17
211820_x_at GYPA 2993 U00179.1 8,95 0,17
218864_at TNS 7145 AF116610.1 8,94 0,17
215812_s_at — ... U41163 8,90 0,17
202074_s_at OPTN 10133 NM_021980.1 8,89 0,17
201886_at WDR23 80344 NM_025230.1 8,86 0,17
216833_x_at GYPE 2996 U05255.1 8,84 0,17
202124_s_at ALS2CR3 66008 AV705253 8,84 0,17
216317_x_at RHCE 6006 X63095.1 8,81 0,17
204467_s_at SNCA 6622 NM .000345.2 8,80 0,17
207087_x_at ANK1 286 NM_020478.1 8,78 0,17
213843_x_at SLC6A8 6535 AW276522 8,78 0,17
210586_x_at RHD 6007 AF312679.1 8,77 0,17
209890_at TM4SF9 10098 AF065389.1 8,75 0,17
218853_s_at DJ473B4 56180 NM_019556.1 8,74 0,17
214433_s_at SELENBPl 8991 NM_003944.1 8,70 0,17
48031_r_at C5orf4 10826 H93077 8,70 0,17
208352_x_at ANK1 286 NM_020479.1 8,69 0,17
203115_at FECH 2235 AU152635 8,66 0,17 Table 31: Top40 genes of cluster #9
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
201497_x_at MYHll 4629 NM .022844.1 89,02 0,18
207961_x_at MYHll 4629 NM_022870.1 26,72 0,18
212358_at CLIPR-59 25999 ALI 17468.1 20,92 0,18
206135_at ST18 9705 NM_014682.1 19,69 0,18
212298_at NRP1 8829 BE620457 18,71 0,18
206682_at CLECSF13 10462 NM _006344.1 15,32 0,18
203060_s_at PAPSS2 9060 AF074331.1 15,04 0,18
203058_s_at PAPSS2 9060 AW299958 14,73 0,18
205987_at CD1C 911 NM_001765.1 12,82 0,18
221019_s_at COLEC12 81035 NM_030781.1 12,69 0,18
204885_s_at MSLN 10232 NM_005823.2 12,36 0,18
209396_s_at CHI3L1 1116 M80927.1 12,06 0,18
219694_at FLJ11127 54491 NM_019018.1 11,59 0,18
205076_s_at CRA 10903 NM .006697.1 11,49 0,18
209395_at CHI3L1 1116 M80927.1 11,07 0,18
219308_s_at AK5 26289 NM_012093.1 10,88 0,18
207194_s_at ICAM4 3386 NM_001544.2 10,76 0,18
204787_at Z39IG 11326 NM_007268.1 10,23 0,18
200665_s_at SPARC 6678 NM_003118.1 10,18 0,18
201506_at TGFBI 7045 NM_000358.1 9,99 0,18
212912_at RPS6KA2 6196 AI992251 9,82 0,18
203939_at NT5E 4907 NM_ 002526.1 9,67 0,18
205330_at MN1 4330 NM_002430.1 9,24 0,18
202481_at SDR1 9249 NM_004753.1 8,92 0,18
212771_at LOC221061 221061 AU150943 8,85 0,18
210889_s_at FCGR2B 2213 M31933.1 8,82 0,18
218876_at CGI-38 51673 NM_016140.1 8,45 0,18
203329_at PTPRM 5797 NM_002845.1 8,25 0,18
204197_s_at RUNX3 864 NM_004350.1 -8,25 0,18
200984_s_at CD59 966 NM_000611.1 -8,33 0,18
218414_s_at NDE1 54820 NM_017668.1 -8,42 0,18
213779_at EMU1 129080 AL031186 -8,56 0,18
204198_s_at RUNX3 864 AA541630 -8,85 0,18
211026_s_at MGLL 11343 BC006230.1 -9,01 0,18
219218_at FLJ23058 79749 NM_024696.1 -9,61 0,18
206788_s_at CBFB 865 AF294326.1 -9,73 0,18
218927_s_at CHST12 55501 NM_018641.1 -9,82 0,18
211031_s_at CYLN2 7461 BC006259.1 -10,24 0,18
202370_s_at CBFB 865 NM_001755.1 -13,01 0,18
200675_at CD81 975 NM_004356.1 -14,28 0,18 Table 32: Top40 genes of cluster #10
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
219145_at FLJ11939 79732 NM_024679.1 12,59 0,21
202551_s_at CRIM1 51232 BG546884 11,82 0,21
47560_at FLJ11939 79732 AI525402 11,75 0,21
209763_at NRLN1 91851 AL049176 8,99 0,21
200671_s_ at SPTBN1 6711 NM_003128.1 8,75 0,21
213488_at FLJ00133 25992 AL050143.1 8,75 0,21
204004_at AI336206 8,74 0,21
205933_at SETBP1 26040 NM_015559.1 8,63 0,21
213506_at F2RL1 2150 BE965369 8,53 0,21
41577_at PPP1R16B 26051 AB020630 8,52 0,21
209679_s_at LOC57228 57228 BC003379.1 8,51 0,21
212558_at GDAP1L1 78997 BF508662 8,43 0,21
207788_s_at SCAM-1 10174 NM_005775.L 8,42 0,21
204083_s_at TPM2 7169 NM_003289.L 8,21 0,21
209487_at RBPMS 11030 D84109.1 8,19 0,21
207836_s_at RBPMS 11030 NM_006867.L 8,14 0,21
209282_at PRKD2 25865 AF309082.1 8,14 0,21
209436_at SPON1 10418 AB018305.1 8,12 0,21
204484_at PIK3C2B 5287 NM_002646.1_ 8,11 0,21
212750_at PPP1R16B 26051 AB020630.1 8,09 0,21
205330_at MN1 4330 NM_002430. 8,03 0,21
209576_at GNAI1 2770 AL049933.1 8,02 0,21
220377_at C14orfll0 29064 NM_014151.L 7,91 0,21
203756_at P164RHOGEF 9828 NM_014786.L 7,89 0,21
200672_x_at SPTBN1 6711 NM_003128.L 7,88 0,21
212827_at IGHM 3507 X17115.1 7,86 0,21
209437_s_at SPON1 10418 AB051390.1 7,74 0,21
204917_s_at MLLT3 4300 AV756536 7,59 0,21
204540_at EEF1A2 1917 NM_001958.L 7,57 0,21
208614_s_at FLNB 2317 M62994.1 7,40 0,21
204581_at CD22 933 NM_001771.L 7,29 0,21
218086_at NPDC1 56654 NM_015392.L 7,25 0,21
209488_s_at RBPMS 11030 D84109.1 7,21 0,21
218899_s_at BAALC 79870 NM_024812.L 7,11 0,21
203796_s_at BCL7A 605 AI950380 7,05 0,21
212071_s_at SPTBN1 6711 BE968833 6,93 0,21
206111_at RNASE2 6036 NM_002934.L -7,00 0,21
209906_at C3AR1 719 U62027.1 -7,34 0,21
205382_s_at DF 1675 NM_001928.L -7,63 0,21
214575 s at AZU1 566 NM_001700.1_ -7,95 0,21 Table 33: Top40 genes of cluster #11
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM
209079_x_at PCDHGC3 5098 AF152318.1 -2,72 1,48
207076_s_at ASS 445 NM_000050.1 -2,74 1,48
218825_at EGFL7 51162 NM_016215.1 -2,74 1,48
201522_x_at SNRPN 6638 NM_003097.2 -2,74 1,48
201601_x_at IFITM1 8519 NM_003641.1 -2,75 1,48
206042_x_at SNRPN 6638 NM_022804.1 -2,80 1,48
209583_s_at MOX2 4345 AF063591.1 -2,81 1,48
204385_at KYNU 8942 NM_003937.1 -2,84 1,48
218805_at IAN4L1 55340 NM_018384.1 -2,90 1,48
214953_s_at APP 351 X06989.1 -2,90 1,48
203859_s_at PALM 5064 NM_002579.1 -2,97 1,48
203542_s_at BTEB1 687 BF438302 -2,97 1,48
212171_x_at VEGF 7422 H95344 -3,03 1,48
218237_s_at SLC38A1 81539 NM_030674.1 -3,05 1,48
219777_at hIAN2 79765 NM_024711.1 -3,07 1,48
201656_at ITGA6 3655 NM_000210.1 -3,13 1,48
208886_at H1F0 3005 BC000145.1 -3,17 1,48
203139_at DAPK1 1612 NM_004938.1 -3,18 1,48
31874_at GAS2L1 10634 Y07846 -3,21 1,48
218966_at MY05C 55930 NM_018728.1 -3,22 1,48
216033_s_at FYN .2534 S74774.1 -3,23 1,48
218589_at P2RY5 10161 NM_005767.1 -3,24 1,48
217838_s_at EVL 51466 NML016337.1 -3,25 1,48
201279_s_at DAB2 1601 BC003064.1 -3,26 1,48
200762_at DPYSL2 1808 NM_001386.1 -3,29 1,48
209723_at SERPINB9 5272 BC002538.1 -3,34 1,48
205101_at MHC2TA 4261 NM_000246.1 -3,37 1,48
208873_s_at DPI 7905 BC000232.1 -3,43 1,48
211675_s_at HIC 29969 AF054589.1 -3,49 1,48
200665_s_at SPARC 6678 NM_003118.1 -3,50 1,48
213848_at DUSP7 1849 AI655015 -3,54 1,48
215116_s_at DNM1 1759 AF035321.1 -3,56 1,48
203217_s_at SIAT9 8869 NM_003896.1 -3,56 1,48
209543_s_at CD34 947 M81104.1 -3,57 1,48
201425_at ALDH2 217 NM_000690.1 -3,63 1,48
201559_s_at CLIC4 25932 AF109196.1 -4,00 1,48
221223_x_at CISH 1154 NM_013324.2 -4,36 1,48
212658_at LHFPL2 10184 N66633 -4,43 1,48
204401_at KCNN4 3783 NM_002250.1 -4,70 1,48
201560_at CLIC4 25932 NM_013943.1 -4,95 1,48 Table 34: Top40 genes of cluster #12
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
210997_at HGF 3082 M77227.1 25,95 0,13
210998_s_at HGF 3082 M77227.1 24,77 0,13
205110_s_at FGF13 2258 NM_004114.1 24,76 0,13
210794_s_at MEG3 55384 AF119863.1 23,54 0,13
204537_s_at GABRE 2564 NM_004961.2 22,89 0,13
205614_x_at MSTl 4485 NM_020998.1 20,74 0,13
205663_at PCBP3 54039 NM_020528.1 20,42 0,13
202260_s_at STXBP1 6812 NM_003165.1 19,36 0,13
216320_x_at MSTl 4485 U37055 18,72 0,13
203074_at ANXA8 244 NM .001630.1 18,42 0,13
206634_at SIX3 6496 NM_005413.1 16,41 0,13
210755_at HGF 3082 U46010.1 16,11 0,13
203397_s_at GALNT3 2591 BF063271 15,29 0,13
212732_at MEG3 55384 AI950273 15,24 0,13
207895_at NAALADASEL 10004 NM_005468.1 14,64 0,13
218043_s_at AZ2 64343 NM_022461.1 14,17 0,13
209961_s_at HGF 3082 M60718.1 13,51 0,13
209815_at na 349352 U43148.1 12,71 0,13
201276_at RAB5B 5869 AF267863.1 12,44 0,13
212509_s_at ... — BF968134 12,27 0,13
207650_x_at PTGER1 5731 NM_000955.1 11,92 0,13
209960_at HGF 3082 X16323.1 11,88 0,13
200770_s_at LAMCl 3915 J03202.1 11,57 0,13
212204_at DKFZP564G2022 25963 AF132733.1 11,55 0,13
20703 l_at BAPX1 579 NM_001189.1 11,44 0,13
211663_x_at PTGDS 5730 M61900.1 11,33 0,13
206105_at FMR2 2334 NM_002025.1 11,28 0,13
214203_s_at PRODH 5625 AA074145 11,27 0,13
200654_at P4HB 5034 J02783.1 11,24 0,13
200656_s_at P4HB 5034 NM_000918.1 11,23 0,13
210140_at CST7 8530 AF031824.1 11,16 0,13
200935_at CALR 811 NM_004343.2 11,12 0,13
204153_s_at MFNG 4242 NM_002405.1 -11,33 0,13
202599_s_at NRIP1 8204 NM_003489.1 -11,33 0,13
20093 l_s_at VCL 7414 NM_014000.1 -11,57 0,13
204362_at SCAP2 8935 NM_003930.1 -11,76 0,13
202600_s_at NRIP1 8204 AI824012 -11,86 0,13
204152_s_at MFNG 4242 AI738965 -12,02 0,13
203236_s_at LGALS9 3965 NM_009587.1 -18,14 0,13
204425_at ARHGAP4 393 NM_001666.1 -21,49 0,13 Table 35: Top40 genes of cluster #13
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
205529_s_at CBFA2T1 (ETO) 862 NM_004349.1 60,36 0,14
205528_s_at CBFA2T1 (ETO) 862 X79990.1 56,08 0,14
216831_s_at CBFA2T1 (ETO) 862 AF018283.1 26,62 0,14
213194_at ROBOl 6091 BF059159 24,74 0,14
204811_s_at CACNA2D2 9254 NM_006030.1 23,53 0,14
206940_s_at POU4F1 5457 NM_006237.1 21,42 0,14
210744_s_at IL5RA 3568 M75914.1 21,09 0,14
211517_s_at IL5RA 3568 M96651.1 20,92 0,14
211341_at POU4F1 5457 L20433.1 20,66 0,14
204990_s_at ITGB4 3691 NM_000213.1 20,55 0,14
212097_at CAV1 857 AU147399 20,47 0,14
216832_at CBFA2T1 862 AF018283.1 17,51 0,14
206128_at ADRA2C 152 AI264306 16,87 0,14
204874_x_at BAIAP3 8938 NM_003933.2 16,41 0,14
203065_s_at CAV1 857 NM_001753.2 16,07 0,14
212496_s_at KIAA0876 23030 AW237172 15,75 0,14
212492_s_at KIAA0876 23030 AW237172 15,66 0,14
218613_at DKFZp761Kl423 55358 NM_018422.1 14,20 0,14
206622_at TRH 7200 NM_007117.1 13,63 0,14
216356_x_at BAIAP3 8938 AB018277.1 13,48 0,14
201621_at NBL1 4681 NM_005380.1 13,45 0,14
213894_at LOC221981 221981 BF447246 13,05 0,14
203088_at FBLN5 10516 NM_006329.1 12,93 0,14
204396_s_at GPRK5 2869 NM_005308.1 12,66 0,14
201655_s_at HSPG2 3339 M85289.1 12,62 0,14
218742_at HPRN 64428 NM_022493.1 12,59 0,14
214920_at LOC221981 221981 R33964 12,55 0,14
219686_at HSA250839 55351 NM_018401.1 12,44 0,14
204073_s_at Cllorfθ 745 NM_013279.1 12,35 0,14
209822_s_at VLDLR 7436 L22431.1 12,29 0,14
206793_at PNMT 5409 NM_002686.1 12,27 0,14
211685_s_at NCALD 83988 AF251061.1 12,16 0,14
214946_x_at FLJ10824 55747 AV728658 12,03 0,14
210010_s_at SLC25A1 6576 U25147.1 11,84 0,14
203741_s_at ADCY7 113 NM_001114.1 -11,89 0,14
208885_at LCP1 3936 J02923.1 -12,03 0,14
204494_s_ at LOC56905 56905 AW516789 -12,21 0,14
20809 l_s_at DKFZP564K0822 81552 NM_030796.1 -13,52 0,14
220560_at Cllorf21 29125 NM_014144.1 -14,30 0,14
221581_s_at WBSCR5 7462 AF257135.1 -17,67 0,14 Table 36: Top40 genes of cluster #14 (No significant genes identified.)
Table 37: Top40 genes of cluster #15
Probe Set Gene Locus Link Accession Score q-value ID symbol number number SAM (%)
206676_at CEACAM8 1088 M33326.1 7,20 1,66
20466 l_at CDW52 1043 NM_001803.1 -3,44 1,07
211182_x_at RUNX1 861 AF312387.1 -3,46 1,07
212827_at IGHM 3507 X17115.1 -3,47 1,07
203542_s_at BTEB1 687 BF438302 -3,49 1,07
214835_s_at SUCLG2 8801 AF131748.1 -3,51 1,07
209905_at HOXA9 3205 AI246769 -3,56 1,07
201867_s_at TBL1X 6907 NM_005647.1 -3,59 1,07
204069_at MEIS1 4211 NM_002398.1 -3,61 1,07
205600_x_at HOXB5 3215 AI052747 -3,62 1,07
208962_s_at FADS1 3992 BE540552 -3,63 1,07
205453_at HOXB2 3212 NM_002145.1 -3,69 1,07
219256_s_at FLJ20356 54436 NM_018986.1 -3,74 1,07
218627_at FLJ11259 55332 NM_018370.1 -3,76 1,07
201719_s_at EPB41L2 2037 NM_001431.1 -3,77 1,07
213150_at HOXAIO 3206 NM_018951.1 -3,77 1,07
209374_s_at IGHM 3507 BC001872.1 -3,89 1,07
210365_at RUNX1 861 D43967.1 -3,90 1,07
214651_s_at HOXA9 3205 U41813.1 -3,92 1,07
218552_at FLJ10948 55268 NM_018281.1 -3,94 1,07
212906_at na 283158 BE044440 -3,97 1,07
213147_at HOXAIO 3206 NM_018951.1 -3,98 1,07
213400_s_at TBL1X 6907 AV753028 -4,01 1,07
200765_x_at CTNNA1 1495 NM_001903.1 -4,02 1,07
202391_at BASP1 10409 NM_006317.1 -4,07 1,07
217226_s_at PMX1 5396 M95929.1 -4,09 1,07
217800_s_at NDFIP1 80762 NM_030571.1 -4,26 1,07
201841_s_at HSPB1 3315 NM_001540.2 -4,34 1,07
202236_s_at SLC16A1 6566 NM_003051.1 -4,34 1,07
212314_at KIAA0746 23231 AB018289.1 -4,43 1,07
215772_x_at SUCLG2 8801 AL050226.1 -4,44 1,07
218847_at IMP-2 10644 NM_006548.1 -4,46 1,07
212311_at KIAA0746 23231 AB018289.1 -4,56 1,07
212459_x_at SUCLG2 8801 BF593940 -4,63 1,07
209191_at TUBB-5 84617 BC002654.1 -4,63 1,07
220974_x_at BA108L7.2 81855 NM_030971.1 -4,75 1,07
217853_at TEM6 64759 NM_022748.1 -5,09 1,07
218501_at ARHGEF3 50650 NM_019555.1 -5,11 1,07
40489_at DRPLA 1822 D31840 -5,57 1,07
221737_at GNA12 2768 NM_007353.1 -5,84 1,07 Table 38: Top40 genes of cluster #16
Probe Set Gene Locus Link Accession Score q-value SAM ID symbol number number SAM (%)
220057_at GAGED2 9503 NM_020411.1 22,48 0,27
219360_s_at TRPM4 54795 NM_017636.1 21,22 0,27
219414_at CLSTN2 64084 NM_022131.1 16,98 0,27
220116_at KCNN2 3781 NM_021614.1 16,31 0,27
216370_s_at TKTL1 8277 Z49258 15,76 0,27
205550_s_at BRE 9577 NLVL004899.1 15,55 0,27
211566_x_at BRE 9577 U19178.1 15,11 0,27
214183_s_at TKTL1 8277 X91817.1 14,70 0,27
209031_at IGSF4 23705 NM_014333.1 13,62 0,27
212645_x_at BRE 9577 AL566299 13,32 0,27
209030_s_at IGSF4 23705 NM_014333.1 13,30 0,27
213791_at PENK 5179 NM_006211.1 13,25 0,27
206508_at TNFSF7 970 NM_001252.1 12,46 0,27
219506_at FLJ23221 79630 NM_024579.1 12,31 0,27
211421_s_at RET 5979 M31213.1 12,03 0,27
203241_at UVRAG 7405 NM_003369.1 11,99 0,27
213908_at LOC339005 339005 AI824078 11,94 0,27
207911_s_at TGM5 9333 NM_004245.1 11,78 0,27
214190_x_at GGA2 23062 AI799984 11,49 0,27
20456 l_x_at APOC2 344 NM_000483.2 11,38 0,27
209663_s_at ITGA7 3679 AF072132.1 11,27 0,27
214259_s_at AKR7A2 8574 AW074911 11,14 0,27
205472_s_at DACH 1602 NM_004392.1 10,91 0,27
216331_at ITGA7 3679 AK022548.1 10,89 0,27
220010_at KCNE1L 23630 NM_012282.1 10,78 0,27
213484_at na 151521 AI097640 10,73 0,27
204497_at ADCY9 115 AB011092.1 10,48 0,27
215771_x_at RET 5979 X15786.1 10,33 0,27
209032_s_at IGSF4 23705 AF132811.1 10,32 0,27
219714_s_at CACNA2D3 55799 NM_018398.1 10,21 0,27
219463_at C20orfl03 24141 NM_012261.1 10,21 0,27
202139_at AKR7A2 8574 NM .003689.1 9,87 0,27
219143_s_at FLJ20374 54913 NM_017793.1 9,66 0,27
205996_s_at AK2 204 NM_013411.1 9,60 0,27
219288_at HT021 57415 NM_020685.1 9,57 0,27
215663_at MBNL1 4154 BC005296.1 9,42 0,27
213361_at PCTAIRE2BP 23424 AW129593 9,23 0,27
210658_s_at GGA2 23062 BC000284.1 8,73 0,27
213772_s_at GGA2 23062 BF196572 8,59 0,27
212174_at AK2 204 AK023758.1 8,59 0,27 Table 39: PAM genes of prognostically important clusters (#13, #12, #9, #16,
#10, #4, #15, #4 and #15, and FLT3ITD)
Probe Set Gene Locus Link Accession Abnormality ID symbol number number
205529_s_at CBFA2T1 (ETO) 862 NM_004349.1 AML and t(8;21)
205528_s_at CBFA2T1 (ETO) 862 X79990.1 AML and t(8;21)
213194_at ROBOl 6091 BF059159 AML and t(8;21)
210997_at HGF 3082 M77227.1 AML and t(15;17)
210998_s_at HGF 3082 M77227.1 AML and t(15;17)
205110_s_at FGF13 2258 NM_004114.1 AML and t(15;17)
201497_x_at MYHll 4629 NM_022844.1 AML and inv(16)
214183_s_at TKTL1 8277 X91817.1 llq23 (cluster 16)
216370_s_at TKTL1 8277 Z49258 llq23 (cluster 16)
220057_at GAGED2 9503 NM_020411.1 llq23 (cluster 16)
209031_at IGSF4 23705 NM_014333.1 llq23 (cluster 16)
209030_s_at IGSF4 23705 NML014333.1 llq23 (cluster 16)
219360_s_at TRPM4 54795 NM_017636.1 llq23 (cluster 16)
216331_at ITGA7 3679 AK022548.1 llq23 (cluster 16)
206508_at TNFSF7 970 NM_001252.1 llq23 (cluster 16)
204561_x_at APOC2 344 NM_000483.2 llq23 (cluster 16)
200989_at HIF1A 3091 NM_001530.1 llq23 (cluster 16)
219506_at FLJ23221 79630 NM_024579.1 llq23 (cluster 16)
213791_at PENK 5179 NM_006211.1 llq23 (cluster 16)
205472_s_at DACH 1602 NM_004392.1 llq23 (cluster 16)
209629_s_at NXT2 55916 AF201942.1 llq23 (cluster 16)
219288_at HT021 57415 NM_020685.1 llq23 (cluster 16)
205471_s_at DACH 1602 AW772082 llq23 (cluster 16)
219463_at C20orfl03 24141 NM_012261.1 llq23 (cluster 16)
209628_at NXT2 55916 AK023289.1 llq23 (cluster 16)
215571_at ... — AK021495.1 llq23 (cluster 16)
209663_s_at ITGA7 3679 AF072132.1 llq23 (cluster 16)
220010_at KCNE1L 23630 NM_012282.1 llq23 (cluster 16)
204885_s_at MSLN 10232 NM_005823.2 llq23 (cluster 16)
207911_s_at TGM5 9333 NM_004245.1 llq23 (cluster 16)
209032_s_at IGSF4 23705 AF132811.1 llq23 (cluster 16)
206277_at P2RY2 5029 NM_002564.1 llq23 (cluster 16)
211421_s_at RET 5979 M31213.1 llq23 (cluster 16)
203241_at UVRAG 7405 NM_003369.1 llq23 (cluster 16)
209616_s_at CES1 1066 S73751.1 llq23 (cluster 16)
219714_s_at CACNA2D3 55799 NM_018398.1 llq23 (cluster 16)
213908_at LOC339005 339005 AI824078 llq23 (cluster 16)
217520_x_at na 219392 BG396614 llq23 (cluster 16)
202551_s_at CRIM1 51232 BG546884 EVI (cluster 10)
213506_at F2RL1 2150 BE965369 EVI (cluster 10)
206111_at RNASE2 6036 NM_002934.1 EVI (cluster 10)
214575_s_at AZU1 566 NM_001700.1 EVI (cluster 10)
209679_s_at LOC57228 57228 BC003379.1 EVI (cluster 10)
41577_at PPP1R16B 26051 AB020630 EVI (cluster 10)
212750_at PPP1R16B 26051 AB020630.1 EVI (cluster 10) Table 39: (continued)
Probe Set Gene Locus Link Accession Abnormality ID symbol number number
204540_at EEF1A2 1917 NM_001958.1 EVI (cluster 10)
205330_at MN1 4330 NM_002430.1 EVE (cluster 10)
200671_s_at SPTBN1 6711 NM_003128.1 EVI (cluster 10)
207788_s_at SCAM-1 10174 NM_005775.1 EVI (cluster 10)
209576_at GNAI1 2770 AL049933.1 EVI (cluster 10)
218086_at NPDC1 56654 NM_015392.1 EVT (cluster 10)
204484_at PIK3C2B 5287 NM_002646.1 EVI (cluster 10)
219145_at FLJ11939 79732 NM_024679.1 EVI (cluster 10)
212820_at RC3 23312 AB020663.1 EVI (cluster 10)
204004_at ... ... AI336206 EVI (cluster 10)
209487_at RBPMS 11030 D84109.1 EVI (cluster 10)
209543_s_at CD34 947 M81104.1 EVI (cluster 10)
205382_s_at DF 1675 NM_001928.1 EVI (cluster 10)
47560_at FLJ11939 79732 AI525402 EVI (cluster 10)
212827_at IGHM 3507 X17115.1 EVI (cluster 10)
217977_at SEPX1 51734 NM .016332.1 EVI (cluster 10)
212558_at GDAP1L1 78997 BF508662 EVI (cluster 10)
206429_at F2RL1 2150 NM_005242.2 EVI (cluster 10)
220377_at Cl4orfll0 29064 NM_014151.1 EVI (cluster 10)
20685 l_at RNASE3 6037 NM_002935.1 EVI (cluster 10)
212012_at D2S448 7837 AF200348.1 EVI (cluster 10)
210844_x_at CTNNA1 1495 D14705.1 cEBPalpha (cluster 4)
200765_x_at CTNNA1 1495 NM_001903.1 cEBPalpha (cluster 4)
200764_s_at CTNNA1 1495 AI826881 cEBPalpha (cluster 4)
214551_s_at CD7 924 NM_006137.2 cEBPalpha (cluster 4)
214049_x_at CD7 924 AI829961 cEBPalpha (cluster 4)
216191_s_at TRD@ 6964 X72501.1 cEBPalpha (cluster 4)
217143_s_at TRD@ 6964 X06557.1 cEBPalpha (cluster 4)
216286_at ... ... AV760769 cEBPalpha (cluster 4)
206232_s_at B4GALT6 9331 NM_004775.1 cEBPalpha (cluster 4)
202241_at C8FW 10221 NM_025195.1 cEBPalpha (cluster 4)
219383_at FLJ14213 79899 NM_024841.1 cEBPalpha (cluster 4)
209191_at TUBB-5 84617 BC002654.1 cEBPalpha (cluster 4)
213830_at TRD@ 6964 AW007751 cEBPalpha (cluster 4)
206676_at CEACAM8 1088 M33326.1 cEBPalpha (clusterlδ)
210244_at CAMP 820 U19970.1 cEBPalpha (clusterlδ)
202018_s_at LTF 4057 NM_002343.1 cEBPalpha (clusterlδ)
217853_at TEM6 64759 NM_022748.1 cEBPalpha (clusterlδ)
204417_at GALC 2581 NM_000153.1 cEBPalpha (clusterlδ)
204039_at CEBPA 1050 NMJ304364.1 cEBPalpha (cluste lδ)
211810_s_at GALC 2581 D25284.1 cEBPalpha (clusterlδ)
210762_s_at DLC1 10395 AF026219.1 cEBPalpha (clusterlδ)
217800_s_at NDFIP1 80762 NM_030571.1 cEBPalpha (cluste lδ)
206726_at PGDS 27306 NM_014485.1 cEBPalpha (clusterlδ)
202236_s_at SLC16A1 6566 NM_003051.1 cEBPalpha (clusterlδ)
202016_at MEST 4232 NM_002402.1 cEBPalpha (cluste lδ)
212531_at LCN2 3934 NM_005564.1 cEBPalpha (clusterlδ)
218847_at IMP-2 10644 NM_006548.1 cEBPalpha (clusterlδ) Table 39: (continued)
Probe Set Gene Locus Link Accession Abnormahty ID symbol number number
205692_s_at CD38 952 NM_00177δ.l cEBPalpha (clusterlδ)
212459_x_at SUCLG2 8801 BFδ93940 cEBPalpha (clusterlδ)
201841_s_at HSPB1 3315 NM_001δ40.2 cEBPalpha (clusterlδ)
207329__at MMP8 4317 NM_002424.1 cEBPalpha (clusterlδ)
220974_x_at BA108L7.2 8185δ NM_030971.1 cEBPalpha (clusterlδ)
207384_at PGLYRP 8993 NM_00δ091.1 cEBPalpha (clusterlδ)
209191_at TUBB-δ 84617 BC0026δ4.1 cEBPalpha (clusterlδ)
202391_at BASP1 10409 NM_006317.1 cEBPalpha (cluste lδ)
21δ772_x_at SUCLG2 8801 AL0δ0226.1 cEBPalpha (clusterlδ)
212314_at KIAA0746 23231 AB018289.1 cEBPalpha (clusterlδ)
221737_at GNA12 2768 NM_0073δ3.1 cEBPalpha (clusterlδ)
214651_s_at HOXA9 3205 U41813.1 cEBPalpha (clusterlδ)
218501_at ARHGEF3 506δ0 NM_019δδδ.l cEBPalpha (clusterlδ)
202747_s_at ITM2A 94δ2 NM_004867.1 cEBPalpha (clusterlδ)
213400_s_at TBL1X 6907 AV7δ3028 cEBPalpha (clusterlδ)
214049_x_at CD7 924 AI829961 cEBPalpha (clusterlδ)
209374_s_at IGHM 3δ07 BC001872.1 cEBPalpha (clusterlδ)
212311_at KIAA0746 23231 AB018289.1 cEBPalpha (clusterlδ)
40489_at DRPLA 1822 D31840 cEBPalpha (clusterlδ)
205453_at HOXB2 3212 NM_002145.1 cEBPalpha (clusterlδ)
214551_s_at CD7 924 NM_006137.2 cEBPalpha (cluste lδ)
206660_at IGLL1 3δ43 NM_020070.1 cEBPalpha (clusterlδ)
210844_x_at CTNNA1 1495 D14705.1 CEBPalpha . (cluster 4 and lδ)
200765_x_at CTNNA1 1495 NM_001903.1 CEBPalpha . (cluster 4 and lδ)
200764_s_at CTNNAl 1495 AI826881 CEBPalpha . (cluster4 and lδ)
214551_s_at CD7 924 NM_006137.2 CEBPalpha . (cluster 4 and lδ)
214049_x_at CD7 924 AI829961 CEBPalpha (cluster 4 and lδ)
209191_at TUBB-5 84617 BC0026δ4.1 CEBPalpha (cluster 4 and 15)
2l7800_s_at NDFIP1 80762 NM_030δ71.1 CEBPalpha (cluster 4 and lδ)
217143_s_at TRD@ 6964 X06δδ7.1 CEBPalpha (cluster 4 and 15)
216191_s_at TRD@ 6964 X72δ01.1 CEBPalpha (cluster 4 and 15)
21961δ_s_at KCNK5 8645 NM_003740.1 FLT3 ITD
204341_at TRIM16 10626 NM_006470.1 FLT3 ITD
201664_at SMC4L1 10051 AL136877.1 FLT3 ITD
201663_s_at SMC4L1 10051 NM_00δ496.1 FLT3 ITD
213110_s_at COL4Aδ 1287 AW0δ2179 FLT3 ITD
213844_at HOXA5 3202 NM_019102.1 FLT3 ITD
204082_at PBX3 5090 NM_00619δ.l FLT3 ITD
2031δl_at MAPI A 4130 AW296788 FLT3 ITD
211269_s_at IL2RA 3δδ9 K03122.1 FLT3 ITD
203708_at PDE4B δl42 NM_002600.1 FLT3 ITD
21042δ_x_at GOLGIN-67 2301δ AF164622.1 FLT3 ITD
212070_at GPR56 9289 ALδ54008 FLT3 ITD
20δ366_s_at HOXB6 3216 NM_0189δ2.1 FLT3 ITD
214039_s_at LAPTM4B δδ3δ3 Tlδ777 FLT3 ITD
203897_at LOC57149 δ7149 BE963444 FLT3 ITD
21δ806_x_at TRGC2 6967 M13231.1 FLT3 ITD
209813_x_at ... ... M16768.1 FLT3 ITD Table 39: (continued)
Probe Set Gene Locus Link Accession Abnormality ID symbol number number
216920_s_at TRGC2 6967 M27331.1 FLT3 ITD
206945_at LCT 3938 NM_002299.1 FLT3 ITD
208029_s_at LAPTM4B δδ3δ3 NM_018407.1 FLT3 ITD
215288_at TRPC2 7221 AI769824 FLT3 ITD
203373_at SOCS2 8835 NM_003877.1 FLT3 ITD
209905_at HOXA9 3205 AI246769 FLT3 ITD
21δ623_x_at SMC4L1 10051 AK002200.1 FLT3 ITD
211144_x_at TRGC2 6967 M30894.1 FLT3 ITD
220813_at CYSLTR2 57105 NM_020377.1 FLT3 ITD
208767_s_at LAPTM4B 5δ3δ3 AW149681 FLT3 ITD
20δ227_at IL1RAP 3δδ6 NM_002182.1 FLT3 ITD
209014_at MAGED1 9500 AF217963.1 FLT3 ITD
206341_at IL2RA 3δδ9 NM_000417.1 FLT3 ITD
20δ4δ3_at HOXB2 3212 NM_00214δ.l FLT3 ITD
209392_at ENPP2 δl68 L35594.1 FLT3 ITD
219304_s_at SCDGF-B 80310 NM_025208.1 FLT3 ITD
208798_x_at GOLGIN-67 2301δ AF204231.1 FLT3 ITD
211302_s_at PDE4B δl42 L20966.1 FLT3 ITD
210839_s_at ENPP2 δl68 D45421.1 FLT3 ITD
20δ600_x_at HOXBδ 321δ AI052747 FLT3 ITD
208414_s_at HOXB4 3214 NM_002146.1 FLT3 ITD
208797_s_at GOLGIN-67 2301δ AI829170 FLT3 ITD
210123_s_at CHRNA7 1139 U62436.1 FLT3 ITD
206289_at HOXA4 3201 NM_002141.1 FLT3 ITD
201069_at MMP2 4313 NM_004530.1 FLT3 ITD
213217_at ADCY2 108 AU149572 FLT3 ITD
2146δl_s_at HOXA9 320δ U41813.1 FLT3 ITD
211402_x_at NR6A1 2649 AF004291.1 FLT3 ITD
204044_at QPRT 2347δ NM_014298.2 FLT3 ITD
204438_at MRC1 4360 NM_002438.1 FLT3 ITD
206042_x_at SNRPN 6638 NM_022804.1 FLT3 ITD
2149δ3_s_at APP 361 X06989.1 FLT3 ITD
201427_s_at SEPP1 6414 NM_005410.1 FLT3 ITD
209193_at PIMl 5292 M24779.1 FLT3 ITD
219218_at FLJ230δ8 79749 NM_024696.1 FLT3 ITD
200923_at LGALS3BP 39δ9 NM_00δδ67.2 FLT3 ITD
210424_s_at GOLGIN-67 2301δ AF163441.1 FLT3 ITD
219602_s_at FLJ23403 63895 NM_022068.1 FLT3 ITD
201δ22_x_at SNRPN 6638 NM_003097.2 FLT3 ITD

Claims

Claims
1. A method for producing a classification scheme for AML comprising the steps of: a) providing a plurality of reference samples, said reference samples comprising cell samples from a plurality of reference subjects affected by AML; b) providing reference profiles by establishing a gene expression profile for each of said reference samples individually; c) clustering said individual reference profiles according to a statistical procedure, comprising: (i) K-means clustering; (ii) hierarchical clustering; and (iii) Pearson correlation coefficient analysis; and d) assigning an AML class to each cluster.
2. Method according to claim 1, wherein the clustering of said gene expression profiles is performed based on the information of differentially- expressed genes.
3. Method according to claim 1 or 2, wherein the clustering of said gene expression profiles is performed based on the information of the genes of Table
1, more preferably of Table 2.
4. A method for classifying the AML of an AML affected subject, comprising the steps of: a) providing a classification scheme for AML by producing such a scheme according to the method of any one of claims 1-3; b) providing a subject profile by estabhshing a gene expression profile for said subject; c) clustering the subject profile together with reference profiles; d) determining in said scheme the clustered position of said subject profile among the reference profiles, and e) assigning to said AML of said subject the AML class that corresponds to said clustered position in case said subject profile is within any cluster of reference profiles, or assigning to said AML of said subject a new AML class.
5. A method for diagnosing AML in a subject comprising the steps of: a) producing a classification scheme for AML according to the method of any one of claims 1-3; b) defining cluster-specific genes for each cluster by selecting those genes of which the expression level characterizes the clustered position of the corresponding AML class among the various AML classes within said scheme; c) determining the level of expression of one or more of said cluster- specific genes in a subject; d) establishing whether the level of expression of said cluster-specific genes in said subject shares sufficient similarity to the level of expression that characterizes an individual AML class to thereby determine the presence of AML corresponding to said class in said subject.
6. Method according to claim 5, wherein said cluster-specific genes comprise a set of 1 to 3000 genes of the genes of table 1, more preferably 1 to 600 genes of the genes of table 1, still more preferably 1 to 50 genes of the genes of table 1.
7. Method according to claim 5, wherein said cluster-specific genes comprise a set of 1 to 600 genes of the genes of table 2, still more preferably 1 to 50 genes of the genes of table 2, and even more preferably 1 to 25 genes of the genes of table 2.
8. Method according to claim 5, wherein said cluster-specific genes are selected from the genes of Table 3.
9. A method of determining the prognosis for an AML affected subject, said method comprising the steps of: a) providing a classification scheme for AML by producing such a scheme according to the method of any one of claims 1-3; b) determining the prognosis for each AML class in said scheme based on clinical records for the AML subjects comprised in said class; c) establishing the AML class of an AML affected subject by diagnosing AML in said subject according to any one of the methods 5-8 or by classifying the AML in said subject according to a method of claim 4, and d) assigning to said subject the prognosis corresponding to the established AML class of said AML affected subject.
10. A method of determining the prognosis for an AML affected subject, said method comprising the steps of: a) isolation of RNA from mononuclear cells of said subject; b) preparation of antisense, biotinylated RNA to the RNA of step a); c) hybridisation of said antisense, biotinylated DNA on Affymetrix U133A or U133 Plus2.0 GeneChips®; d) normalising the measured values for the gene set of Table 1; e) clustering the obtained data together with the reference data, obtainable from (www.ncbi.nlm.nih.gov/geo. accession number GSE1159); and f) determining the prognosis on basis of the subgroup/cluster to which the data of the subject are clustering.
11. Classification scheme for AML, said scheme comprising a plurality of distinct AML classes that are differentiated on the basis of similarity clustering of gene expression profiles obtained from a plurality of reference subjects affected by AML.
12. A method of detecting an AML-associated transcript in a cell from a patient, the method comprising contacting a biological sample from the patient with a polynucleotide that selectively hybridizes to a sequence at least 80%, preferably at least 95% identical to a sequence as shown in Table 1, 2 or 3.
13. Method according to claim 12, wherein said polynucleotide selectively hybridizes to a sequence at least 95% identical to a sequence as shown in Table 1, 2 or 3.
14. Method according to claim 12, wherein said polynucleotide comprises a sequence as shown in Tables 1 or 2.
15. Method according to any one of claims 12-14, wherein said biological sample is a tissue sample.
16. Method according to any one of claims 12-15, wherein the biological sample comprises isolated nucleic acids, e.g., mRNA.
17. Method according to any one of claims 12-16, wherein the polynucleotide is labeled, e.g., with a fluorescent label.
18. Method according to any one of claims 12-17, wherein the polynucleotide is immobilized on a solid surface.
19. Oligonucleotide probe capable of hybridizing under stringent conditions to one or more of the AML-associated genes selected from Table 1, preferably to one or more of the genes selected from Table 2, more preferably to one or more of the genes selected from Table 3.
20. Ohgonucleotide microarray comprising at least 1, preferably at least 2, more preferably at least 25, still more preferably at least 100 oligonucleotide probes according to claim 19.
21. Kit-of-parts comprising an oligonucleotide microarray according to claim 20 and means for comparing a gene expression profile determined by using said microarray with a database of AML reference expression profiles.
PCT/NL2005/000134 2004-02-23 2005-02-23 Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling Ceased WO2005080601A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2007500702A JP4980878B2 (en) 2004-02-23 2005-02-23 Classification, diagnosis, and prognosis of acute myeloid leukemia by gene expression profiling
US10/590,385 US8142994B2 (en) 2004-02-23 2005-02-23 Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling
AU2005214286A AU2005214286A1 (en) 2004-02-23 2005-02-23 Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling
CA002558366A CA2558366A1 (en) 2004-02-23 2005-02-23 Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling
EP05710909.2A EP1723257B1 (en) 2004-02-23 2005-02-23 Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP04075570.4 2004-02-23
EP04075570 2004-02-23

Publications (2)

Publication Number Publication Date
WO2005080601A2 true WO2005080601A2 (en) 2005-09-01
WO2005080601A3 WO2005080601A3 (en) 2007-05-10

Family

ID=34878266

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2005/000134 Ceased WO2005080601A2 (en) 2004-02-23 2005-02-23 Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling

Country Status (8)

Country Link
US (1) US8142994B2 (en)
EP (1) EP1723257B1 (en)
JP (1) JP4980878B2 (en)
CN (1) CN101088089A (en)
AU (1) AU2005214286A1 (en)
CA (1) CA2558366A1 (en)
SG (1) SG155968A1 (en)
WO (1) WO2005080601A2 (en)

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7094572B2 (en) 2003-03-14 2006-08-22 Bristol-Myers Squibb Polynucleotide encoding a novel human G-protein coupled receptor variant of HM74, HGPRBMY74
KR100617467B1 (en) 2005-09-27 2006-09-01 디지탈 지노믹스(주) Prediction Markers for Anticancer Drug Response in Patients with Acute Myeloid Leukemia
WO2006089233A3 (en) * 2005-02-16 2007-03-29 Wyeth Corp Methods and systems for diagnosis, prognosis and selection of treatment of leukemia
WO2006048263A3 (en) * 2004-11-04 2007-04-12 Roche Diagnostics Gmbh Gene expression profiling in acute promyelocytic leukemia
WO2007048866A1 (en) * 2005-10-27 2007-05-03 Fundación Para El Estudio De La Hematología Y Hemoterapia De Aragón (Fehha) Method and device for the in vitro analysis of mrna of genes involved in haematological neoplasias
EP1833990A4 (en) * 2004-12-29 2008-02-13 Digital Genomics Inc MARKERS FOR DIAGNOSIS OF AML, B-ALL AND T-ALL
WO2008137907A1 (en) * 2007-05-07 2008-11-13 Mayo Foundation For Medical Education And Research Pharmacogenomic cell line panel and use thereof
WO2009018303A3 (en) * 2007-07-31 2009-12-30 The Ohio State University Research Foundation Methods for reverting methylation by targeting dnmt3a and dnmt3b
WO2010055147A1 (en) * 2008-11-13 2010-05-20 Erasmus University Medical Center Rotterdam Efficient detection of double mutants of the cebpa gene in acute myeloid leukemia
US20110143946A1 (en) * 2007-09-12 2011-06-16 Siemens Healthcare Diagnostics Inc. Method for predicting the response of a tumor in a patient suffering from or at risk of developing recurrent gynecologic cancer towards a chemotherapeutic agent
US8084199B2 (en) 2006-07-13 2011-12-27 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using microRNA-21
US8148069B2 (en) 2006-01-05 2012-04-03 The Ohio State University MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of solid cancers
EP2458014A1 (en) * 2010-09-07 2012-05-30 Rijksuniversiteit Groningen Prognostic markers for acute myeloid leukemia (AML)
WO2012085188A1 (en) 2010-12-22 2012-06-28 Universite Francois Rabelais De Tours Method for diagnosing hematological disorders
US8349560B2 (en) 2007-06-15 2013-01-08 The Ohio State University Research Method for diagnosing acute lymphomic leukemia (ALL) using miR-222
US8664192B2 (en) 2011-03-07 2014-03-04 The Ohio State University Mutator activity induced by microRNA-155 (miR-155) links inflammation and cancer
US8859202B2 (en) 2012-01-20 2014-10-14 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
US8916533B2 (en) 2009-11-23 2014-12-23 The Ohio State University Materials and methods useful for affecting tumor cell growth, migration and invasion
US8946187B2 (en) 2010-11-12 2015-02-03 The Ohio State University Materials and methods related to microRNA-21, mismatch repair, and colorectal cancer
US9085804B2 (en) 2007-08-03 2015-07-21 The Ohio State University Research Foundation Ultraconserved regions encoding ncRNAs
US9249468B2 (en) 2011-10-14 2016-02-02 The Ohio State University Methods and materials related to ovarian cancer
US9481885B2 (en) 2011-12-13 2016-11-01 Ohio State Innovation Foundation Methods and compositions related to miR-21 and miR-29a, exosome inhibition, and cancer metastasis
WO2017048121A1 (en) 2015-09-15 2017-03-23 Erasmus University Medical Center Rotterdam Il17 related assays
WO2017132749A1 (en) 2016-02-06 2017-08-10 University Health Network Method for identifying high-risk aml patients
EP3411517A4 (en) * 2016-02-06 2020-01-01 University Health Network METHOD FOR IDENTIFYING HIGH-RISK PATIENTS WITH LAM
US10758619B2 (en) 2010-11-15 2020-09-01 The Ohio State University Controlled release mucoadhesive systems
CN118465265A (en) * 2024-04-08 2024-08-09 北京大学人民医院 Biomarker related to clinical outcome after acute myeloid leukemia hematopoietic stem cell transplantation and application thereof
US12391741B2 (en) 2017-09-04 2025-08-19 Mink Therapeutics, Inc. T cell receptors that bind to mixed lineage leukemia (MLL)-specific phosphopeptides and methods of use thereof

Families Citing this family (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030114410A1 (en) 2000-08-08 2003-06-19 Technion Research And Development Foundation Ltd. Pharmaceutical compositions and methods useful for modulating angiogenesis and inhibiting metastasis and tumor fibrosis
CN103820562B (en) 2005-08-01 2015-05-13 俄亥俄州立大学研究基金会 MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer
CA2621441C (en) 2005-09-12 2014-05-20 The Ohio State University Research Foundation Compositions and methods for the diagnosis and therapy of bcl2-associated cancers
EP2502630B1 (en) 2006-01-05 2015-03-11 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer
CN101384273B (en) 2006-01-05 2013-07-10 俄亥俄州立大学研究基金会 Abnormal expression of microRNAs in pancreatic endocrine and acinar tumors
EP2369013A1 (en) 2006-03-20 2011-09-28 The Ohio State University Research Foundation Micro-RNA fingerprints during human megakaryocytopoiesis
CA2663027A1 (en) 2006-09-19 2008-08-14 The Ohio State University Research Foundation Tcl1 expression in chronic lymphocytic leukemia (cll) regulated by mir-29 and mir-181
US8252538B2 (en) 2006-11-01 2012-08-28 The Ohio State University MicroRNA expression signature for predicting survival and metastases in hepatocellular carcinoma
CN103555825B (en) 2007-01-31 2015-09-30 俄亥俄州立大学研究基金会 For the method and composition based on microRNA of the diagnosis of acute myelocytic leukemia (AML), prognosis and treatment
CN101711287B (en) 2007-06-08 2016-04-27 由卫生与公众服务部代表的美利坚合众国政府 Methods for Determining Hepatocellular Carcinoma Subtypes and Detecting Liver Cancer Stem Cells
ES2700141T3 (en) 2007-08-02 2019-02-14 Gilead Biologics Inc LOXL2 inhibitory antibodies and their uses
CA2926831A1 (en) 2007-08-22 2009-02-26 The Ohio State University Research Foundation Methods and compositions for inducing deregulation of epha7 and erk phosphorylation in human acute leukemias
CA2703707A1 (en) 2007-10-26 2009-04-30 The Ohio State University Research Foundation Methods for identifying fragile histidine triad (fhit) interaction and uses thereof
CA2727633A1 (en) 2008-06-11 2009-12-17 Xin W. Wang Use of mir-26 family as a predictive marker for hepatocellular carcinoma and responsiveness to therapy
US9107935B2 (en) 2009-01-06 2015-08-18 Gilead Biologics, Inc. Chemotherapeutic methods and compositions
US20120070450A1 (en) * 2009-03-24 2012-03-22 Riken Leukemia stem cell markers
US11348662B2 (en) 2009-05-20 2022-05-31 Koninklijke Philips N.V. Biomarkers based on sets of molecular signatures
RU2012110585A (en) 2009-08-21 2013-09-27 Джилид Байолоджикс, Инк. CATALYTIC DOMAINS OF LYSYLOXIDASE AND LOXL2
US8680246B2 (en) 2010-02-04 2014-03-25 Gilead Biologics, Inc. Antibodies that bind to lysyl oxidase-like 2 (LOXL2)
WO2012078931A2 (en) * 2010-12-08 2012-06-14 Ravi Bhatia Gene signatures for prediction of therapy-related myelodysplasia and methods for identification of patients at risk for development of the same
WO2012112958A2 (en) * 2011-02-19 2012-08-23 The Broad Institute, Inc High-throughput assays to probe leukemia within the stromal niche
WO2012131564A1 (en) * 2011-03-27 2012-10-04 Oncostem Diagnostics Pvt. Ltd. Markers for identifying tumor cells, methods and kit thereof
WO2012157589A1 (en) * 2011-05-13 2012-11-22 国立大学法人宮崎大学 Cell adhesion inhibitor, cell proliferation inhibitor, and method and kit for testing cancer
WO2012170710A1 (en) * 2011-06-08 2012-12-13 Altheadx Incorporated Disease classification modules
US9696312B2 (en) 2011-09-02 2017-07-04 The Trustees Of Columbia University In The City Of New York Diagnosis and treatment of cancer expressing ILT3 or ILT3 ligand
US9659087B2 (en) * 2012-11-19 2017-05-23 Amplero, Inc. Unsupervised prioritization and visualization of clusters
SG11201606102UA (en) * 2014-01-27 2016-08-30 Medimmune Llc Dipeptidyl peptidase-4 (dpp4/cd26) as a peripheral biomarker of il-13 activation in asthmatic lung
WO2015119570A1 (en) * 2014-02-07 2015-08-13 Agency For Science, Technology And Research Prl-3 as a biomarker for the prognosis of cancer and a target for therapy
GB201408100D0 (en) * 2014-05-07 2014-06-18 Sec Dep For Health The Detection method
WO2016201365A2 (en) * 2015-06-12 2016-12-15 Visani Giuseppe Methods for treating cancers
WO2017015227A1 (en) 2015-07-17 2017-01-26 The Trustees Of Columbia University In The City Of New York Methods of treating cd166-expressing cancer
CN105255896B (en) * 2015-11-21 2019-01-11 长沙绿天生物技术有限公司 A kind of paddy gene promoter, expression cassette, expression vector and its application
CN105837679B (en) * 2016-04-29 2019-04-23 中国人民解放军第四军医大学 Polypeptide and its application for preparing medicine for ischemic stroke
EP3548004A4 (en) * 2016-11-30 2020-08-12 Partha S. Ray DIAGNOSIS, PROGNOSIS, AND TREATMENT OF ACUTE MYELOIC LEUKEMIA
CN109402252A (en) * 2017-08-11 2019-03-01 上海交通大学医学院附属瑞金医院 Acute myeloid leukemia risk assessment gene markers and their applications
US12331320B2 (en) 2018-10-10 2025-06-17 The Research Foundation For The State University Of New York Genome edited cancer cell vaccines
CN109754398A (en) * 2019-01-14 2019-05-14 武汉兰丁医学高科技有限公司 A kind of computer based myeloplast automark method and system
CN111394463B (en) * 2020-04-22 2021-03-30 中国人民解放军联勤保障部队第九六0医院 Thyroid cancer related molecule and application thereof
CN112904005B (en) * 2021-01-26 2023-10-27 李欣 Plasma exosomal protein markers for early screening of nasopharyngeal cancer and their applications
CN112760379A (en) * 2021-01-26 2021-05-07 暨南大学 Application of TOX3 in preparation of AML prognosis prediction kit
CN112980952B (en) * 2021-02-05 2022-11-29 中山大学肿瘤防治中心(中山大学附属肿瘤医院、中山大学肿瘤研究所) Markers used to predict the prognosis of isocitrate dehydrogenase 1 gene wild-type glioma and the efficacy of anti-PD1 therapy and its application
CN116392572B (en) * 2023-03-10 2026-03-24 武汉大学中南医院 Application of integrin protein ITGA5 as a biomarker in the preparation of drugs for the treatment of high leukocyte acute myeloid leukemia
CN120277548B (en) * 2025-06-11 2025-09-02 之江实验室 Acute myelogenous leukemia subtype typing method based on prototype comparison learning

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6647341B1 (en) * 1999-04-09 2003-11-11 Whitehead Institute For Biomedical Research Methods for classifying samples and ascertaining previously unknown classes
WO2003102235A2 (en) * 2002-05-31 2003-12-11 Cancer Research Technology Limited Specific genetic markets for cytogenetically defined acute myeloid leukaemia

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7094572B2 (en) 2003-03-14 2006-08-22 Bristol-Myers Squibb Polynucleotide encoding a novel human G-protein coupled receptor variant of HM74, HGPRBMY74
US7371822B2 (en) 2003-03-14 2008-05-13 Bristol-Myers Squibb Company Human G-protein coupled receptor variant of HM74, HGPRBMY74
WO2006048263A3 (en) * 2004-11-04 2007-04-12 Roche Diagnostics Gmbh Gene expression profiling in acute promyelocytic leukemia
EP1833990A4 (en) * 2004-12-29 2008-02-13 Digital Genomics Inc MARKERS FOR DIAGNOSIS OF AML, B-ALL AND T-ALL
JP2008525047A (en) * 2004-12-29 2008-07-17 デジタル ゲノミックス インコーポレイティッド AML, B-ALL and T-ALL diagnostic markers
WO2006089233A3 (en) * 2005-02-16 2007-03-29 Wyeth Corp Methods and systems for diagnosis, prognosis and selection of treatment of leukemia
WO2007037611A1 (en) * 2005-09-27 2007-04-05 Digital Genomics Inc. Markers for predicting the response of a patient with acute myeloid leukemia to anti-cancer drugs
CN101326290B (en) * 2005-09-27 2012-12-19 数字基因组学株式会社 Markers for predicting response to anticancer drugs in patients with acute myeloid leukemia
JP2009509525A (en) * 2005-09-27 2009-03-12 ディジタルジェノミクスインコーポレーション Markers for predicting anti-cancer drug response in patients with acute myeloid leukemia
KR100617467B1 (en) 2005-09-27 2006-09-01 디지탈 지노믹스(주) Prediction Markers for Anticancer Drug Response in Patients with Acute Myeloid Leukemia
WO2007048866A1 (en) * 2005-10-27 2007-05-03 Fundación Para El Estudio De La Hematología Y Hemoterapia De Aragón (Fehha) Method and device for the in vitro analysis of mrna of genes involved in haematological neoplasias
RU2426786C2 (en) * 2005-10-27 2011-08-20 Фундасион Пара Эль Эстудио Де Ла Хематолохия И Хемотерапия Де Арагон (Фэхха) METHOD AND DEVICE FOR in vitro ANALYSIS OF GENE mRNA INVOLVED IN DEVELOPMENT OF HEMATOLOGIC NEOPLASIAS
ES2324435A1 (en) * 2005-10-27 2009-08-06 Fundacion Para El Estudio De La Hematologia Y Hemoterapia De Aragon (Fehha) Method and device for the in vitro analysis of mrna of genes involved in haematological neoplasias
ES2324435B1 (en) * 2005-10-27 2010-05-31 Fundacion Para El Estudio De La Hematologia Y Hemoterapia De Aragon (Fehha) PROCEDURE AND DEVICE OF IN VITRO MRNA ANALYSIS OF GENES INVOLVED IN HEMATOLOGICAL NEOPLASIAS.
US8148069B2 (en) 2006-01-05 2012-04-03 The Ohio State University MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of solid cancers
US8084199B2 (en) 2006-07-13 2011-12-27 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using microRNA-21
WO2008137907A1 (en) * 2007-05-07 2008-11-13 Mayo Foundation For Medical Education And Research Pharmacogenomic cell line panel and use thereof
US8349560B2 (en) 2007-06-15 2013-01-08 The Ohio State University Research Method for diagnosing acute lymphomic leukemia (ALL) using miR-222
WO2009018303A3 (en) * 2007-07-31 2009-12-30 The Ohio State University Research Foundation Methods for reverting methylation by targeting dnmt3a and dnmt3b
US9085804B2 (en) 2007-08-03 2015-07-21 The Ohio State University Research Foundation Ultraconserved regions encoding ncRNAs
US20110143946A1 (en) * 2007-09-12 2011-06-16 Siemens Healthcare Diagnostics Inc. Method for predicting the response of a tumor in a patient suffering from or at risk of developing recurrent gynecologic cancer towards a chemotherapeutic agent
US20110281270A1 (en) * 2008-11-13 2011-11-17 Erasmus University Medical Center Rotterdam Efficient detection of double mutants of the cebpa gene in acute myeloid leukemia
WO2010055147A1 (en) * 2008-11-13 2010-05-20 Erasmus University Medical Center Rotterdam Efficient detection of double mutants of the cebpa gene in acute myeloid leukemia
US8916533B2 (en) 2009-11-23 2014-12-23 The Ohio State University Materials and methods useful for affecting tumor cell growth, migration and invasion
EP2458014A1 (en) * 2010-09-07 2012-05-30 Rijksuniversiteit Groningen Prognostic markers for acute myeloid leukemia (AML)
US8946187B2 (en) 2010-11-12 2015-02-03 The Ohio State University Materials and methods related to microRNA-21, mismatch repair, and colorectal cancer
US10758619B2 (en) 2010-11-15 2020-09-01 The Ohio State University Controlled release mucoadhesive systems
US11679157B2 (en) 2010-11-15 2023-06-20 The Ohio State University Controlled release mucoadhesive systems
WO2012085188A1 (en) 2010-12-22 2012-06-28 Universite Francois Rabelais De Tours Method for diagnosing hematological disorders
US9493836B2 (en) 2010-12-22 2016-11-15 Universite Francois Rabelais De Tours Method for diagnosing hematological disorders
US8664192B2 (en) 2011-03-07 2014-03-04 The Ohio State University Mutator activity induced by microRNA-155 (miR-155) links inflammation and cancer
US9249468B2 (en) 2011-10-14 2016-02-02 The Ohio State University Methods and materials related to ovarian cancer
US9481885B2 (en) 2011-12-13 2016-11-01 Ohio State Innovation Foundation Methods and compositions related to miR-21 and miR-29a, exosome inhibition, and cancer metastasis
US9434995B2 (en) 2012-01-20 2016-09-06 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
US8859202B2 (en) 2012-01-20 2014-10-14 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
WO2017048121A1 (en) 2015-09-15 2017-03-23 Erasmus University Medical Center Rotterdam Il17 related assays
EP3411517A4 (en) * 2016-02-06 2020-01-01 University Health Network METHOD FOR IDENTIFYING HIGH-RISK PATIENTS WITH LAM
US11111542B2 (en) 2016-02-06 2021-09-07 University Health Network Method for identifying high-risk AML patients
WO2017132749A1 (en) 2016-02-06 2017-08-10 University Health Network Method for identifying high-risk aml patients
US12391741B2 (en) 2017-09-04 2025-08-19 Mink Therapeutics, Inc. T cell receptors that bind to mixed lineage leukemia (MLL)-specific phosphopeptides and methods of use thereof
CN118465265A (en) * 2024-04-08 2024-08-09 北京大学人民医院 Biomarker related to clinical outcome after acute myeloid leukemia hematopoietic stem cell transplantation and application thereof

Also Published As

Publication number Publication date
SG155968A1 (en) 2009-10-29
AU2005214286A1 (en) 2005-09-01
WO2005080601A3 (en) 2007-05-10
US20080305965A1 (en) 2008-12-11
JP4980878B2 (en) 2012-07-18
EP1723257B1 (en) 2019-01-09
CA2558366A1 (en) 2005-09-01
JP2007527238A (en) 2007-09-27
CN101088089A (en) 2007-12-12
EP1723257A2 (en) 2006-11-22
US8142994B2 (en) 2012-03-27

Similar Documents

Publication Publication Date Title
US8142994B2 (en) Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling
US20220112562A1 (en) Prognostic tumor biomarkers
US7711492B2 (en) Methods for diagnosing lymphoma types
US20110166838A1 (en) Algorithms for outcome prediction in patients with node-positive chemotherapy-treated breast cancer
US9953129B2 (en) Patient stratification and determining clinical outcome for cancer patients
US20210062275A1 (en) Methods to predict clinical outcome of cancer
US20110172928A1 (en) Molecular markers for cancer prognosis
US11709164B2 (en) Approach for universal monitoring of minimal residual disease in acute myeloid leukemia
Chen et al. Long noncoding RNA profiles identify five distinct molecular subtypes of colorectal cancer with clinical relevance
US20200270691A1 (en) Diagnosis, prognosis and identification of potential therapeutic targets of multiple myeloma based on gene expression profiling
US20060194211A1 (en) Methods for prognosis and treatment of solid tumors
JP2015503330A (en) Identification of multigene biomarkers
EP2035583A2 (en) Prediction of lung cancer tumor recurrence
CA2695814A1 (en) Methods and tools for prognosis of cancer in her2+ patients
Park et al. Gene expression profile in patients with axial spondyloarthritis: meta-analysis of publicly accessible microarray datasets
US20100055686A1 (en) Methods for diagnosis of pediatric common acute lymphoblastic leukemia by determining the level of gene expression
Class et al. Patent application title: Classification, Diagnosis and Prognosis of Acute Myeloid Leukemia by Gene Expression Profiling Inventors: Michael John Moorhouse (Rotterdam, NL) Petrus Jaobus Maria Valk (Rotterdam, NL) Hendrik Rudolf Delwell (Westmaas, NL) Bob Lowenberg (Rotterdam, NL) Petrus Johannes Van Der Spek (Lille, BE) Assignees: Erasmus Universiteit Rotterdam
Cava et al. Pathway-based expression profile for breast cancer diagnoses
HK40107615A (en) Methods to predict clinical outcome of cancer
Rathnagiriswaran Identifying genomic signatures for predicting breast cancer outcomes
Su Identification of mRNA Signature for Predicting Prognosis Risk of Rectal Adenocarcinoma
Lee Outcome prediction and genome-transcriptome correlation analysis in classical Hodgkin's lymphoma
HK1181817B (en) Method for breast cancer recurrence prediction under endocrine treatment
HK1181817A1 (en) Method for breast cancer recurrence prediction under endocrine treatment

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2558366

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2007500702

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2005214286

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 549551

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2005710909

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2005214286

Country of ref document: AU

Date of ref document: 20050223

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2005214286

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 200580012795.7

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005710909

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10590385

Country of ref document: US