WO2005056051A2

WO2005056051A2 - Hepatitis b vaccines and compositions

Info

Publication number: WO2005056051A2
Application number: PCT/GB2004/005193
Authority: WO
Inventors: Felicity D'mello; Colin Ronald Howard; Jennifer Susan Moynihan
Original assignee: The Royal Veterinary College
Priority date: 2003-12-11
Filing date: 2004-12-10
Publication date: 2005-06-23
Also published as: GB0328753D0; WO2005056051A3

Abstract

This invention relates to compositions, particularly vaccine compositions for the treatment or prophylaxis of hepatitis B virus infections. In particular, this invention relates to multicomponent recombinant DNA and polypeptide compositions for the treatment or prevention of hepatitis B.

Description

HEPATITIS B VACCINES AND COMPOSITIONS

This invention relates to compositions, particularly vaccine compositions for the treatment or prophylaxis of hepatitis B virus infections. In particular, this invention relates to such compositions for the treatment of hepatitis B, especially the treatment of chronic hepatitis B.

Over 350 million people worldwide are chronically infected with hepatitis B virus (HBV) and at least 25% of these will die as a consequence, from chronic liver disease or hepatocellular carcinoma.

Primary HBV infection results from sexual contact with an infected host, or perinatally in infants, or from virus-containing blood or blood products. Once inside the host, the virus is transported through the bloodstream to the liver, which is the main site of infection.

The primary infection may be asymptomatic or may result in acute liver damage (acute hepatitis). Hepatitis B infection initially causes inflammation of the liver owing to the infiltration of lymphocytes specific for viral antigens presented on the surface of the infected liver cells. Most primary infections are resolved by the immune system of the infected individual. However, in 5-10% of adults and 90% of infants, the primary infection is not resolved and chronic infection results. In chronic hepatitis, the virus persists, replicating actively in hepatocytes, and the individual may develop cirrhosis and chronic liver disease and may develop hepatocellular carcinoma.

HBV does not directly kill the cells which it infects, and hepatitis B is therefore regarded as an immunopathologically mediated disease. In the acute phase, the -cellular immune response, in particular cytotoxic T lymphocytes (CTLs), is considered responsible for viral clearance and for much of the pathogenesis of the disease. The CTL response to acutely infected liver cells is vigorous and directed against several antigens expressed on the surface of cells supporting HBV replication. Despite the strength of the CTL response, low levels of HBV persist in the circulation for several decades after complete clinical and serological resolution of disease; This means that there is continual low level stimulation of HBV-specific CTLs that keep the infection under control.

The mechanism whereby CTLs are targeted against HBV infected liver cells has been elucidated using transgenic mice models. These studies indicate that a noncytocidal antiviral process may also be involved in viral clearance. Thus the cytopathic effect of

CTL recognition mediated by HBV antigens on the surface of infected hepatocytes may be augmented by the production of cytokines such as TNF- and interferon-γ. The latter has the effect of eliminating nucleocapsids from infected hepatocytes and degrading viral mRNAs.

In contrast to acute HBV, the CTL responses in chronic HBV patients are rather weak. If the T cell response is thus suboptimal, the virus persists, even if there is a cytokine response, as the latter may not be able to adequately inhibit HBV replication.

Hepatitis B virus is a member of the hepadnavindae and primarily infects the liver, replicating in hepatocytes. HBV has a partially double stranded DNA genome. The infectious particles are the 42-45nm "Dane particles". These consist of an outer lipoprotein envelope which contains the hepatitis B surface antigen (HBsAg) and an inner nucleocapsid, the major structural protein of which is the core protein (C), also known as the hepatitis B core antigen (HBcAg). Within the inner nucleocapsid is a single copy of the DNA genome and a polymerase protein (P).

The genome contains 4 overlapping open reading frames ORFs): C, S, P and X^see Figure 1). The sequences of all of the HBV proteins can be found in Neurath AR and Kent SB (1985). "Antigenic structure of human hepatitis virus" in Immunochemistry of Viruses: The basis for serodiagnosis and vaccines (eds. MHV van Regenmortel and R Neurath) pp 325 to 366. Elsevier Science publishers.

The C ORF encodes the major structural protein of the nucleocapsid (the core protein) and also a soluble protein found in the serum of patients during virus replication known as HBeAg.

The S ORF encodes three HBV envelope proteins all of which have the same €termini but differing N-termini resulting from alternative sites of translation initiation (see Figure

2). The S ORF has three in-frame ATG start codons and these divide the S ORF into three regions: S, pre-S2 and pre-S1. The small surface antigen protein (S) results from translation of the S region; the middle surface antigen protein (M) results from translation of the S region and the pre-S2 region; and the large surface antigen protein (L) results from translation of the S region, the pre-S2 region and the pre-S1 region.

Historically, the protein known as HBV surface antigen (HBsAg) corresponds to the protein now known as the small (S) protein.

The P ORF encodes the viral polymerase and the X ORF contains a protein known as the X protein, which is thought to be a transcriptional activator.

At present, chronic hepatitis B is treated with drugs that inhibit virus replication, or with recombinant interferon alpha. Vaccination approaches have also been investigated.

However, existing vaccine approaches have generally focussed on the use of a single component derived from the hepatitis B virus, usually the S protein (HBsAg) in prophylactic vaccines.

In addition, the use of short peptide epitopes in vaccination has also been proposed:

W093/03753 suggested the use of short synthetic peptides from various components of HBV virus.

Scohel et al. (Scohel et al. (1992) The position of heterologous epitopes inserted in Hepatitis B core particles determines their immunogenicity J. Virol; 6:106-114), used the core protein to express epitopes from the S protein. Some preliminary investigations have been made into the possibility of DNA vaccination, focussing on nucleic acid encoding the S protein alone:

Plasmids containing the'S protein gene(s) have been injected intramuscularly into mice and anti-HBV antibodies were produced (Michel (1995) DNA-mediated immunization: prospects for hepatitis B vaccination. Res. Virol 146:261 -265; Davis et al. (1994) Direct gene transfer in skeletal muscle, plasmid based immunization against the hepatitis B surface antigen Vaccine Vol 12 No 16 pp 1503- 1509).

There is urgent need for a more effective hepatitis B vaccine. Moreover, there is urgent need for an effective therapeutic vaccine. Such a vaccine is highly desirable, in particular for the treatment of chronic hepatitis B infection.

Advantages associated with such a vaccine include: a greater and sustained reduction in hepatitis B virus replication; a therapeutic or prophylactic effect which is sustained once the treatment is withdrawn; substantial elimination of the virus from the liver, especially the elimination of the viral DNA from the nuclei of infected liver cells; and avoidance of virus resistance.

An aim of the present invention is to provide a new vaccine for the treatment or prophylaxis of hepatitis B viral infection e.g., owing to the effective stimulation of the host immune response. For example, the vaccine may stimulate the CTL response.

The present invention is directed to recombinant hepatitis B compositions, particularly vaccine compositions, which contain multiple viral components, and which may be either DNA or polypeptide-based. The present invention also encompasses the use of full length (or substantially full-length) viral components in such compositions.

Thus in a first aspect the present invention provides a recombinant nucleic acid composition (such as a recombinant DNA vaccine composition) which -comprises a plurality of elements selected from: a core DNA element which includes a sequence which encodes an immunogenic region of the HBV core protein; a surface antigen DNA element which includes a sequence which encodes an immunogenic region of the HBV surface antigen -(S, M or L) protein; an X DNA element which includes a sequence which .encodes an immunogenic region of the HBV X protein; a polymerase DNA element which includes a sequence which encodes an immunogenic region of the HBV polymerase protein.

Such a composition may be used for the treatment or prophylaxis of hepatitis B viral infection. More particularly, the composition may be a vaccine composition.

The core, surface antigen, X and polymerase proteins are described in Ganem and Schneider (Hepadnaviridae: The viruses and their replication, Knipe DM et al., eds. Fields Virology, 4th ed. Philadelphia, Lippincott Williams & Wilkins, 2001:2923-2969), and are in any event known and understood by the person of skill in the art. Nucleotide sequences encoding the various viral proteins can be found in Valenzuela et al (1980) (The nucleotide sequence of the hepatitis B viral genome and the identification of the major viral genes. In "Animal Virus Genetics" (eds B. Fields, R. Jaenisch and CF. Fox) pp 57 to 70. Academic Press Inc., New York) and in Vaudin et al (1988) (The complete nucleotide sequence of the genome of a hepatitis B virus isolated from a naturally infected chimpanzee. Journal of General Virology 69, pp 1383-1389).

As used herein, "treatment" or "treating" includes post-infection therapy leading to amelioration of hepatitis B symptoms. "Prophylaxis" (which is used interchangeably with "prevention") includes reducing the severity or intensity of, or preventing the initiation of hepatitis B infection. It will be appreciated that in order to be immunogenic, a protein or polypeptide, designated herein as being "immunogenic" will generally comprise an immunogenically active region, i.e., a region which has the ability to evoke B and/or T-cell mediated immune reactions. This is typically a region which includes one or more T or B .cell epitopes. In particular, it is preferred that the immunogenic region has the ability to evoke a cytotoxic T-cell response.

It will be appreciated that where a sequence is stated in the following description to comprise or encode a certain number of amino acids from (or of) a particular protein (see, e.g. below where it is stated that "it is preferred that the -core DNA element comprises a sequence which encodes at least 146 amino acids of the core protein"), the amino acids referred to may be either contiguous, or non-contiguous. More generally stated, where a sequence is stated in the following description to comprise or encode "at least Y amino acids from (or of) protein Z", (where Y is an integer and protein Z is C protein, S protein, M protein, L protein, X -protein or P protein) then the Y amino acids referred to may be contiguous or non-contiguous.

The term "contiguous" has its normal meaning that the amino acids are in a sequential arrangement as in the hepatitis B virus primary amino acid sequence itself. By non- contiguous is meant that the sequence may include one or more intervening amino acids (i.e. inserted amino acids or groups of amino acids). For example, multiple regions (or segments) of amino acids of a particular hepatitis B viral protein may be separated by one or more other amino acids, provided that the resultant construct or composition comprises or encodes (as appropriate) an immunogenic region. For example, multiple immunogenic regions may be linked by intervening amino acids or codons. These intervening regions preferably comprise not more than 50, more preferably not more than 25 and most preferably not more than 10 amino acids. Generally it is preferred that there should be comparatively few such intervening regions (e.g. not more than 1 to 5).

Nevertheless, it is preferred that, in ail of the aspects discussed herein, the sequences referred to comprise or encode contiguous amino acids. The amino acid sequences referred to herein may also be modified compared to the hepatitis B viral proteins. For example, the amino acid sequences referred to herein may include one or more deletions, insertions or substitutions. In relation to substitutions, these may be conservative or non conservative. For example, a leucine may be substituted by an isoleucine in a conservative substitution, or lysine may be substituted by glutamic acid in a non-conservative substitution. The person skilled in the art is readily able to produce such modified sequences, for example by using a DNA construct with an alternative codon to produce an alternative amino acid. This can be carried out by techniques known in the art (e.g. site directed mutagenesis, PCR using primers carrying the alternative codon, or introducing modified sequences by ligation).

As indicated above each DNA element (core, surface antigen, X or polymerase) includes a sequence which encodes an immunogenic region of the core, surface antigen, X or polymerase protein, respectively. It is preferred that the DNA elements each comprise a sequence which encodes substantially the full length of each protein

(core, surface antigen, X or polymerase). Preferably the elements comprise a sequence which encodes at least 80%, more preferably at least 90%, even more preferably at least 95% of the respective protein.

Therefore, the exact length of the DNA sequence will depend on the full length of the viral component. In wild type hepatitis B virus, the lengths of the viral components is as follows: C protein 183 amino acids S protein 226 amino acids X protein 154 amino acids P protein 843 amino acids

In relation to the S protein; the M protein is 281 amino acids in length (226 + 55 pre S2 amino acids); and the L protein is 401 amino acids (226 + 55 pre S2 + 120 pre S1 amino acids).

In relation to the surface antigen element, it is preferred that this element comprises a sequence which encodes at least 80% of the small (S) protein, more preferably at least 90%, even more preferably at least 95% of the small protein. More preferred is that the surface antigen element encodes at least 80% of the middle (M) protein, more preferably at least 90%, even more preferably at least 95% of the middle protein. Even more preferred is that the surface antigen element encodes at least 80% of the large (L) protein, more preferably at least 90%, even more preferably at least 95% of the large protein.

Thus for the surface antigen element it is preferred that this comprises a sequence which encodes at least 180 amino acids, more preferably at least 203 amino acids, even more preferably at least 214 amino acids of the small protein. More preferred is that the surface antigen element comprises a sequence which encodes at least 224 amino acids of the middle (M) protein, more preferably at least 252 amino acids, even more preferably at least 266 amino acids of the middle (M) protein. Even more preferred is that the surface antigen element comprises a sequence that encodes at least 320 amino acids of the large (L) protein, more preferably at least 360 amino acids, even more preferably at least 380 amino acids of the large (L) protein.

Thus in a preferred embodiment, the core DNA element comprises a sequence which encodes at least 146 amino acids of the core protein, more preferably at least 164 amino acids, even more preferably at least 173 amino acids of the core protein.

For the X element it is preferred that this comprises a sequence which encodes at least 123 amino acids of the X protein, more preferably at least 138 amino acids, even more preferably at least 146 amino acids of the X protein.

For the polymerase element it is preferred that this comprises a sequence which encodes at least 674 amino acids of the polymerase protein, more preferably at least 758 amino acids, even more preferably at least 800 amino acids of the polymerase protein.

It is preferred that at least one of said elements comprises a sequence which encodes a full length HBV core, polymerase, X or surface antigen protein. Most preferred is that all of the elements in the composition encode full length respective proteins. In relation to the surface antigen element, it is preferred that said surface antigen element comprises a sequence which encodes the full length HBV surface antigen middle (M) protein. Even more preferred is that said surface antigen -element comprises a sequence which encodes the full length HBV surface antigen large (L) protein.

The composition may comprise any combination of DNA elements listed above, provided that it comprises a plurality (at least two) of said elements. Thus the composition may comprise: the core element in combination with the surface antigen element; the core element in combination with the X element; the core element in combination with the polymerase element; the surface antigen element in combination with the X element; the surface antigen element in combination with the polymerase element; or the X element in combination with the polymerase element.

Preferably, the compositions of the invention comprise at least three of the -elements selected from: the core DNA element; the surface antigen DNA element; the X DNA element; and the polymerase DNA element. These elements are defined above. Most preferred is that the composition comprises the core element; the surface antigen element; and the X element.

The DNA composition may comprise all four elements. However, in this circumstance it should be structured so as to provide the requisite immune response, whilst not being able to induce a virulent (symptomatic) hepatitis infection in the host. Thus where the DNA composition contains ail four elements this is with the proviso that it does not produce a virulent (or symptomatic) response in the host. It is unlikely that a vaccine comprising all 4 major HBV proteins expressed individually, produces a virulent infection as no template HBV DNA is present and therefore infectious virus particles containing HBV DNA cannot be produced. Nevertheless the elements coding for the X and/or P genes may be altered by one (or a combination) of the following: that at least one of the elements is not full length; that at least one of the elements is modified or attenuated so as to avoid virulent infection (for example one or more coding sequences are modified to produce amino acids different from those found in wild-type). Thus, in an embodiment, each of said plurality of elements is provided in the form of a separate DNA vector.

The vector may be a plasmid, containing a suitable promoter. Appropriate vectors and plasmids are discussed later.

In a second aspect, the present invention provides, a recombinant polypeptide composition (e.g, a multicomponent polypeptide vaccine), comprising a plurality of elements selected from: a core polypeptide element which includes a sequence of a immunogenic region of the HBV core protein; a surface antigen polypeptide element which includes a sequence of an immunogenic region of the HBV surface antigen (S, M or L) protein; an X polypeptide element which includes a sequence of an immunologically active region of the HBV X protein; a polymerase polypeptide element which includes a sequence of an immunogenic region of the HBV polymerase protein; wherein at least one of said elements comprises at least 100 amino acids from the respective HBV protein.

This composition may be used in the treatment or prophylaxis of hepatitis B virus infection. More particularly, the composition may be a vaccine.

It is preferred that said element has at least 100 amino acids that are contiguous (as defined above), e.g., said at least 100 amino acids of the second aspect referred to above are preferably contiguous (as defined above).

The preferred lengths for the polypeptide elements are as indicated above in the context of DNA vaccines, e.g. for the core element it is preferred that this comprises a sequence of at least 146 amino acids of the Oore protein, more preferably at least 164 amino acids, even more preferably at least 173 amino acids of the core protein.

It is preferred that at least one of said elements comprises a full length HBV core, polymerase, X or HBV surface antigen protein. Most preferred is that all of the elements in the composition comprise full length respective proteins.

In relation to the surface antigen element, it is preferred that said surface antigen element comprises the full length HBV surface antigen middle protein. More preferred is that said surface antigen element comprises the full length HBV surface antigen large protein.

It is preferred that the polypeptide compositions of the invention comprise at least three of the elements selected from: the core element; the surface antigen element; the X element; and the polymerase element. These elements are defined above and in relation to this second aspect polypeptide elements are referred to. Most preferred is that the composition comprises: the core element; the surface antigen element; and the X element.

Possible combinations are as discussed above in the context of the DNA aspects. The composition of this (polypeptide) aspect may contain all four of the elements listed above. In such a situation, the composition should be substantially free of DNA so as to avoid a virulent (symptomatic) infection in the host. Thus in an embodiment of the invention each of said plurality of elements is provided in the form of a separate polypeptide construct.

In a further aspect, the present invention relates to the use of hepatitis B X polypeptide in the manufacture of a medicament for the treatment of chronic hepatitis B viral infection. Preferably said medicaments comprise at least 80%, more preferably 90%, even more preferably 95%, most preferably 100% of the X protein. Thus said medicament preferably comprises at least 123 amino acids, more preferably at least 138 amino acids, even more preferably at least 146 amino acids, most preferably 154 amino acids of the X protein. It is preferred that these amino acids are contiguous in the hepatitis B X protein.

The invention also relates to the use of hepatitis B X gene in the manufacture of a medicament for the treatment of chronic hepatitis B viral infection. Preferably -said medicament comprises a sequence which encodes at least 80%, more preferably at least 90%, even more preferably 95%, most preferably 100% of the X protein. Thus said medicament preferably comprises a sequence which encodes at least 123 amino acids, more preferably at least 138 amino acids, even more preferably at least 146 amino acids, most preferably 154 amino acids of the X protein. It is preferred that these amino acids are contiguous in the hepatitis B X protein.

Such medicaments may comprise a further HBV polypeptide or gene.

It is preferred that the vaccines of the above aspects and embodiments are for use in the treatment of hepatitis B viral infection, more preferably in the treatment of chronic hepatitis B viral infection. As an alternative, the vaccines of the invention may be for use in the prophylaxis of hepatitis B viral infection.

The use of multiple viral components and/or the use of full length (or substantially full length) viral components in accordance with the invention preferably maximises the opportunities for stimulating an effective T cell response, in particular a CTL response.

The vaccine formulation would include varying combinations of the four HBV elements. The effective therapeutic dose may vary and will depend on factors such as the weight and health of patient and disease status. Booster immunisations may also be required, depending, for example, on the patients CTL responses to the vaccine.

It is preferred to use the same weight of each component. For example, in the context of DNA vaccine compositions, for a two component vaccine, 10 to 500 μg of each component may be used, more preferably 25 to 250 μg, more preferably 50μg to 100 μg, most preferred about 50 μg of each component's DNA (by way of example 50 μg S + 50 μg C). For a three component vaccine 10 to 500 μg ofeach component may be used, more preferably 25 to 250 μg, more preferably 33 μg to 100 μg, most preferred about 33 μg DNA (by way of examples: 33.3 μg S + 33.3 μg C + 33.3 μg X; or 33.3 μg S+ 33.3 μg C +33.3 μg P). For a four component vaccine 10 to 500 μg of each component may be used, more preferably 20 to 250 μg, more preferably 25μg to 100 μg, most preferred about 25 μg (by way of example, 25 μg S+ 25 μg C +25 μg X+ 25 μg P).

The vaccine may be administered parenterally (intravenously, subcutaneously, intradermally or intramuscularly). For parenteral administration, the vaccine would preferably be suspended in aqueous solution, such as phosphate buffered saline or buffered water. The vaccine formulations may also contain a stabiliser such as serum albumin or a sugar and suitable preservative. In the context of DNA vaccines, the formulation may also contain a delivery vehicle to enhance uptake by antigen presenting cells. Examples of such delivery vehicles include: liposomes and lipids (e.g., phospholipids - charged lipids (cationic or anionic); liposomes - immunostimulatory complexes (ISCOMS, QS21); proteins (e.g., virus like particles, histones); polymers (e.g, poly lactide-co-glycolides PLGs, oligosaccaride esters, polyethyleneimine (PEI), polyvinylpyrrolidone (PVP), hydrogels, polyphophazenes); attentuated strains of invasive bacteria (e.g, Shigella flexneri, Salmonella typhimurium, Listeria monocytogenes); and adjuvants (e.g., Monophosphoryl lipid A (MPL); dendrimers).

The invention further provides a composition according to any one of the above- discussed aspects further comprising a cytokine. Preferred cytokines include interferon Y and TNFα.

The invention also provides a composition according to the above-discussed aspects and embodiments and further comprising a pharmaceutically accepted adjuvant or excipient.

Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the vaccine may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, or pH buffering agents. Examples of adjuvants include but are not limited to: aluminum hydroxide, N-acetyl- muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D- isoglutamine (CGP 11637, referred to as nor-MDP) N-acetylmuramyl-L-alanyl-D- isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)- ethylamine (CGP I 9835A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2% qualene/Tween 80 emulsion.

The vaccines of the present invention may be formulated for intramuscular, oral, intranasal, intradermal, subcutaneous or intravenous administration.

Typically, such vaccines are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. The preparation may also be emulsified, or encapsulated in liposomes.

The vaccines are conventionally administered parenterally, by injection, for example, either subcutaneously or intramuscularly.

For DNA vaccines, preferred methods of administration are needle injection into muscle or skin and the use of "gene-guns" in which particles (e.g. gold particles) are coated with plasmid and propelled by a gas (e.g. helium or CQ2) into a tissue. Non-invasive methods may also be used including intranasal, oral and intravaginal.

Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, oral formulations or formulations suitable for distribution as aerosols. For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably

1%-2%. Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, -sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10%-95% of active ingredient, preferably 25%-

70%.

The vaccines are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically and/or therapeutically effective. The quantity to be administered, which is generally in the range of 5 micrograms to 250 micrograms of polypeptide or DNA per dose, depends on the subject to be treated, capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired.

The vaccine may be given in a single dose schedule or a multiple dose schedule. A multiple dose schedule is one in which a primary course of vaccination may be with 1- 10 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reinforce the immune response, for example, at 1-4 months for a second dose, and if needed, a subsequent dose(s) after several months.

Suitable dosage regimens may be dependent upon the particular patient, e.g, whether child or adult and can be readily determined by the person skilled in the art.

The vaccines of the invention may be prepared according to any suitable means available to the person skilled in the art.

Where the composition is a recombinant DNA composition for vaccination, it is preferably provided in the form of one or more vectors which is introduced into an individual to be vaccinated. In this way, the DNA elements referred to above are operably linked, in said vector, to suitable regulatory elements (including promoters, enhancers, transcription and translation initiation and termination sequences), which direct transcription/translation of said DNA elements. Suitable promoters include the cytomegalovirus promoter, the human β actin promoter, the avian leucosis virus promoter, the Rous sarcoma virus promoter or internal promoters from hepatitis B virus itself. The DNA compositions of the present invention may be prepared by any means known in the art. Typically, the DNA vaccine vectors are in the form of plasmid(s) which comprise the DNA elements referred to above. To prepare such plasmids, a fragment of DNA corresponding to the relevant DNA element may be produced by chemical synthesis using an appropriate commercial oligonucleotide synthesising apparatus, or may be produced using genetic engineering techniques. For example, a suitable restriction fragment may be excised from a source of hepatitis B viral DNA and inserted into an appropriately digested vector plasmid. In another approach, DNA corresponding to the DNA element may be amplified using the polymerase chain reaction and appropriate primers. The resultant PCR amplification product can then be ligated into an appropriate vector, e.g., plasmid. The PCR primers may be designed to incorporate restriction sites to facilitate such ligation, or the ligation may be blunt ended.

DNA e.g., for a DNA vaccine can be produced in large amounts by replication in an appropriate host cell, is purified using techniques known in the art.

Where the invention relates to recombinant polypeptide compositions, the polypeptides may be produced from expression vectors in suitable -cellular hosts. Such expression vectors generally comprise the sequence of interest (e.g., a sequence which encodes the relevant polypeptide element) operably linked to suitable transcriptional and translational regulatory elements, e.g., including promoters, enhancers, transcription and translation initiation and termination sequences. Such vectors when introduced into an appropriate cellular host result in the expression of the polypeptide. The resultant polypeptide is purified using techniques known in the art.

E. coli is a suitable host for the production of DNA (e.g., for DNA vaccines). For polypeptides (e.g., for polypeptide vaccines), E.coli, Bacillus subtilis, yeast, insect cells or mammalian cells may be used. Mammalian cell lines include HeLa, Chinese hamster ovary (CHO) cells, and COS cells. The cell type may be chosen to provide higher expression or to provide an appropriate glycosylation pattern. Εxpression vectors suitable for expression in*each of these hosts are commercially available.

The vectors used may contain suitable selectable markers (i.e, a gene encoding a protein necessary for the survival or growth of cells transformed with the vector).

The presence of such a marker gene ensures growth of onlylhose cells which express the marker gene product. Often, genes which encode proteins that confer resistance to antibiotics or other toxic substances (e.g., ampicillin, neomycin, kanamycin or methotrexate) or that supply critical nutrients not available from complex media are used as selectable markers. The choice of appropriate selectable marker will depend on the cellular host.

DNA, either for the production of DNA for the DNA compositions of the invention Xe.g., large scale plasmid preparations) or for the production of polypeptides for the polypeptide compositions of the invention, may be introduced into a cellular host by any suitable means, dependent upon the host cell type. Such means include: electroporation; transfection using calcium chloride, rubidium chloride, calcium phosphate, DEAE dextran etc; microprojectile bombardment; and lipofection. Following appropriate culture of said cellular host, the DNA or polypeptide may be purified by standard techniques.

The person skilled in the art is well versed in such molecular techniques and further teaching is available in "Molecular Cloning: a Laboratory Manual"^*Sambrook et al 2001.

The invention will now be described in detail with reference to the following non-limiting examples and drawings, in which:

Figure 1 is a genome map of the HBV genome.

Figure 2 is a schematic representation of the three forms of S protein.

Figure 3 (a) shows the DNA sequence of clone 102 which contains the core gene; Figure 3(b) shows the protein sequence of clone 102 which contains the core protein.

Figure 4(a) shows the DNAsequence of clone C28-5 which contains the S gene; Figure 4(b) shows the protein sequence of clone C28-5 which contains the S protein. Figure 5 shows the DNA and protein sequence of pVC-1 (core gene ih pVAX1)

Figure 6 shows the DNA and protein sequence of clone pVS-B (envelope gene in pVAX-1)

EXAMPLES

EXAMPLE 1 : PRODUCTION OF PLASMID EXPRESSING HBV CORE GENE CLONING OF THE CORE GENE INTO pcDNA3.1

Purification of HBV core gene

The starting plasmid pC501 is comprised of the HBV core gene in the cloning vector pUC18 (Pharmacia). The core gene had been isolated after purifying HBV DNA from the serum of a patient with chronic HBV infection, as described below.

The HBV DNA was purified from human serum by digestion with proteinase K (0.5mg/ml) in the presence of 2% sodium dodecyl sulphate ^*(SDS) at 57°C for 10 minutes. The reaction mix was then extracted three times with phenol/chloroform/isoamylalcohol (25:24:1 ) and once with chloroform /isoamylalcohol (24:1 ). The DNA was precipitated in 2 volumes ethanol in the presence of 200mM NaCI. After overnight incubation at -70°C, theONA was pelleted by centrifugation at 13K for 10 minutes at 4°C and then resuspended in 10μl water.

The core gene was amplified from the HBV DNA by the polymerase chain reaction (PCR) and then cloned into the vector pUC18 to generate the clone pC501.

The core gene sequence was removed from the pUCtδ vector DNA by digestion with the restriction enzymes Bam HI and Eco Rl -(Promega UK). Approximately 5 μg DNA was digested with 12 units Eco Rl and 10 units Bam HI at 37°C for 2 hours. Agarose gel electrophoresis revealed a DNA fragment of approximately S50 bp that contained the HBV core gene and a second fragment containing the pUCIδ DNA vector. Purification of the HBV core gene fragment

The restriction enzyme-digested DNA was then loaded onto a I % preparative gel (1 % low melting point agarose ( 3ibco BRL) in Tris acetate buffer). The DNA fragments were 5 then separated by running the gel in Ix TAE buffer (0.04M Tris acetate; 0.001 M EDTA) at 50 volts for 1-2 hours at 4°C The 550 bp band was then excised from the gel using a sterile scalpel and the gel slice containing the DNA was added to 1 ml of PCR resin (Promega Wizard PCR clean up kit; A7170). The gel/resin was mixed gently until the gel had completely dissolved and then was loaded onto a spin column and washed with0 2 ml 80% isopropanol. After drying the resin by spinning briefly in a microfuge, the DNA was eluted from the resin with the addition 50 μl sterile water. After 1 minute at room temperature, the DNA was collected by spinning for 30 seconds at 13,000 rpm in a microfuge. 5 Preparation of pcDNA 3.1 vector (for cloning)

The vector pcDNA 3.1 DNA was digested with the restriction enzymes Eco Rl and Bam HI and gel purified as described above.

:0 Ligation

The restriction enzyme digested 550bp fragment and pcDNA3.1 vector were ligated using 0.5 units T4 DNA ligase (Boehringer, UK) overnight at 16°C, according to the manufacture's conditions. 5 Transformation

The ligated DNA was used to transform TOP10 competent cells (Invitrogen) using the TOP10 one shot kit. Briefly, 1/10 of the ligation mixture (1μl) was added to 50 μl ) competent cells and incubated on ice for 30 minutes. The cells/DNA were then transferred to a 42°C water bath for 30 seconds and then placed immediately on ice for 2 minutes. Pre-warmed (37°C) SOC medium was added and the mixture was incubated for 1 hour at 37°C at 225 rpm in an orbital shaker. The transformed cells were then plated out onto LB plates containing 50 μg/ml ampicillin (Sigma) and incubated overnight at 37°C

Isolation of colonies containing the core gene insert

Individual colonies (12) were amplified overnight in LB media -(5 ml cultures) containing 50 μg/ml ampicillin. The bacterial cells were harvested by spinning at 3,000 rpm for 30 minutes in a centrifuge and the plasmid DNA was isolated from the cell pellet using Wizard Plus miniprep purification kit (Promega). Briefly the cell pellet was resuspended in 300 μl cell resuspension solution (50 mM Tris HCI pH 7.5, 10 mM EDTA, 100 μg/ml RNase A). Then 300 μl cell lysis solution (0.2 M NaOH, 1 % SDS) was added and the mixture mixed by inversion until the cell suspension cleared. ollowing the addition of 300 μl neutralisation solution (4.09 M guanidine-HCI, 0.759 M potassium acetate, 2.12 M glacial acetic acid pH 4.2), the mixture was inverted 4 times and then spun at 13,000 rpm for 10 minutes at room temperature. The supernatant containing the plasmid DNA was added to 1 ml Promega resin which was then loaded onto a 2 ml column. The resin was washed twice with 2 ml wash buffer (60 mM potassium acetate, 10 mM Tris HCI pH 7.5, 60 % ethanol). After drying the resin by spinning at 13,000 rpm for 2 minutes at room temperature, the DNA was eluted from the resin with 100 μl nuclease free water and collected by spinning for 1 minute at room temperature at 13,000 rpm.

Restriction enzyme digestion with Eco Rl and Bam HI identified clones that contained the core DNA insert (clone 102, clone 107).

Cycle seguencing

Cycle sequencing was performed with primers DNA3F and DNA3R using the Thermosequenase Fluorescent labelled primer cycle sequencing kit (Amersham BioSciences). Briefly, 5 μl purified DNA was incubated with 4 pmoles fluorescent primer

(either DNA3F or DN3R) and 2 μl of either ddATP, ddCTP, ddGTP or ddTTP mix. The reaction was overlayed with mineral oil and cycled at 95°C for 36 seconds, 50°C for 36 seconds and 72°C for 84 seconds for 25 cycles. The samples were loaded onto a

6% Sequagel (National Diagnostics) and the gel was run in 0.6x TBE buffer (Tris borate buffer, 0.054 M Tris borate, 0.0012 M EDTA) at 50 volts for 500 minutes at 4°C using the ALF DNA sequencer (Pharmacia). The sequences were analysed using the program DNASTAR which indicated that the insert in clone 102 was identical to the insert in clone pC50l.

EXAMPLE 2: CLONING OF THE S GENE INTO PCDNA3.1

Production and purification of the S gene for cloning

The starting plasmid pC28 contained the coding sequence of the S gene (681 bp) in the vector pGEM 7Z (Promega UK). The source of the S gene in this plasmid was from the serum of a chronic HBV carrier. HBV DNA had been purified from the serum sample as described above. The S gene had then been amplified by the polymerase chain reaction (PCR) and then was cloned into the vector pGEM 7Z to generate the clone pC28.

The plasmid pC28 did not contain the restriction enzyme sites that were required for cloning into the pcDNA 3.1 vector therefore the S gene was amplified by PCR

(polymerase chain reaction) using primers that contained the required restriction enzyme sites.

Primers for PCR

Primer Primer sequence Restriction name enzyme sites

^~C28F 5' ccccGG ACCGAACATGGAAAGCATCACAT 3' Kon I C28R 5'ccccGAA TrCTTAAAATGTATACCCAAAGACA Eco Rl AAAGA 3'

Italicised text is the restriction enzyme site Upper case sequence is from the HBV S gene Lower case text are nucleotides added to the 5' end of the oligo to increase the efficiency of restriction enzyme digestion.

Underlined text: ATG in primer C28F is the start codon of the S gene, TTA is the stop codon in the reverse primer C28R

Polymerase chain reaction /PCR) amplification of the S gene

The PCR reaction was carried out using the Perkin Elmer PCR kit (Applied Biosystems UK) in a reaction volume of 100 μl. Approximately 100 ng of plasmid DNA together with

0.2nmoles/μl of each C28F and C28R primers, 10 mM dATP, dCTP, dGTP and dTTP and 2mM MgCl2 were mixed together, overlayed in mineral oil and denatured at 94°C for 5 minutes. After the addition of 1 μl Taq DNA polymerase -(Perkin Elmer), the PCR reaction was performed (denaturing for 1 minute at 94°C, annealing at 52°C for 1 minute and elongation for 3 minutes at 72°C) for 30 cycles. This was followed by a final elongation step at 72°C for 10 minutes.

Digestion of PCR Products with restriction enzymes Eco Rl and Kpn I

Agarose gel electrophoresis confirmed the presence of a PCR product of the correct size (678 bp), which was then purified on a I % preparative gel as described above. The purified PCR product was digested with the restriction enzymes Eco Rl (20 units) and Kpn 1 (20 units) at 37°C for 2 hours. The DNA was then gel purified in preparation for ligation.

Preparation of Vector DNA

The vector pcDNA3.1 (1 μg) was digested with Eco Rl (8 units) and Kpn 1(8 units) in a final reaction volume of 50 μl at 37°C for 2 hours. After confirmation of digestion, the digested vector was purified on a 1 % preparative gel.

Ligation The digested PCR S gene product and pcDNA3.1 vector were then ligated and then transformed into One shot Top 10 cells (Invitrogen) as described above.

Analysis of recombinants

Recombinant clones were amplified and DNA purified as previously described. The DNA was digested with Eco Rl and Kpn I to confirm the presence of the cloned S gene insert. Two clones were chosen for further analysis, pcD-C28S-3 and pcD-C28-5. Cycle sequencing revealed that clone pcD-C28S-5 was identical in sequence to the -starting plasmid pC28.

EXAMPLE 3: PRODUCTION OF A PLASMID EXPRESSING HBV CORE GENE: CLONING OF THE CORE GENE INTO pVAX 1

Amplification of HBV core gene

The HBV core gene was amplified from HBV DNA isolated from the serum of a patient infected with hepatitis B. Core specific primers CPKpn I and CRNot I were designed, which are complimentary to nucleotide sequences immediately upstream and downstream of the core gene and also contained restriction endonuclease sites -(Kpn I and Not I) that cleave the multiple cloning site of the vector pVAX-1 (Invitrogen) and that did not cleave the HBV core gene.

Primers for PCR

Primer Primer Sequence Restriction Name enzymes CFKpn I 5' tat tgg tac ctt ggg tgg ctt tgg ggc at 3' Kpn I CRNot I 5' taa age ggc cgc aaa ttt ccc ace tta tga gt 3' Not I

Bold text are the restriction enzyme sites The HBV core gene was amplified by the polymerase chain reaction (PCR) using the core specific primers, CFKpn I and CRNot I. The PCR was carried out using the

Perkin Elmer PCR kit (Applied BioSystems) in a reaction volume of 100μl. The HBV

DNA (1μl) together with 0.2nmoles/μl of the HBV core specific primers CFSal I and CRNot I, 10mM dATP, 10mM dTTP, 10mM dCTP, 10mM dGTP and 2mM MgCI₂were mixed together, overlayed with mineral oil and denatured at 94°C for δminutes. After the addition of 1μl Taq DNA polymerase (Applied Biosystems), the PCR reaction was performed (denaturing for 1 minute at 94°C; annealing for 1 minute and elongation for

3 minutes at 72°C) for 30 cycles. This was followed by a final elongation step at 72°C for 10 minutes.

Agarose gel electrophoresis showed a product of approximately 550 bp that contains the entire coding region of the core gene.

Digestion of PCR products with restriction enzymes

The amplified PCR product was purified by loading the PCR product onto a 1% preparative gel (1% low melting point agarose (Gibco βRL) in TAE buffer). The DNA fragments were separated by running the gel in 1x TAE buffer at 50V for 1-2 hours at 4°C The PCR fragment was excised from the gel and purified using Qiagen's QIA gel extraction kit. The DNA fragment was then digested with the restriction enzymes Kpn I and Not I at 37°C for 2 hours. The digested DNA was then gel purified as described above in preparation for ligation.

Preparation of Vector DNA

The vector pVAX-1 was digested with the restriction enzymes Kpn I and Not I at 37°C for 2 hours. After confirming digestion of a 1% agarose gel, the digested vector was gel purified on a preparative 1x TAE gel as described above.

Ligation The restriction digested 550 bp HBV core fragment and the digested pVAX-1 vector were ligated using 0.5 units T4 DNA ligase (Boehringer UK) overnight at 16°C

Transformation

The ligated DNA was used to transform TOP10 cells (Invitrogen) using the TOP10 one shot kit as described above. The transformed cells were then plated out on to LB plates containing 50 μg/ml kanamycin sulphate (Sigma) and incubated at 37°C overnight.

Isolation of colonies containing the core gene insert

Individual colonies (6) were amplified overnight at 37°C in LB media (5ml cultures) containing kanamycin sulphate. The bacterial cultures were harvested and the plasmid DNA was purified using Qiagen's plasmid DNA mini kit using the procedure recommended by the manufacturer. Restriction enzyme digestion of the plasmid DNA with the restriction enzymes Kpn I and Not I confirmed which clones contained the HBV core gene and two clones containing inserts of the correct size were analysed further. DNA sequencing showed that clone pVC- 1 had the expected sequence.

EXAMPLE 4: PRODUCTION OF A PLASMID EXPRESSING HBV S GENE: CLONING OF THE S GENE INTO pVAX 1

Amplification of HBV S gene

The HBV envelope (S) gene was amplified from HBV DNA isolated from the serum of a patient infected with hepatitis B. Surface specific primers SFKpn I and SRNot I were designed, which are complimentary to nucleotide sequences immediately upstream and downstream of the S gene and also contained restriction endonuclease sites (Kpn I and Not I) that cleave the multiple cloning site of the vector pVAX-1

(Invitrogen) and that did not cleave the surface gene. Primers for PCR

Primer Primer Sequence Restriction Name enzymes SFKpn I 5' att ggg tac cct gca ccg aac atg gaa age 3' Kpn I SRNot I 5' ccc cgc ggc cgc ccc ate ttt ttg ttt tgt 1 3' Not I

Bold text are the restriction enzyme sites Italicised text is the ATG codon in the forward SRKpn I primer

The HBV S gene was amplified by the polymerase chain reaction (PCR) using the S specific primers, SFKpn I and SRNot I. The PCR was carried out using the Perkin Elmer PCR kit (Applied BioSystems) in a reaction volume of 100μl. The HBV DNA (1μl) together with 0.2nmoles/μl of the HBV envelope specific primers SFSal I and

SRNot I, 10mM dATP, 10mM dTTP, 10mM dCTP, 10mM dGTP and 2mM MgCI₂ were mixed together, overiayed with mineral oil and denatured at 94°C for 5 minutes. After the addition of 1 μl Taq DNA polymerase (Applied Biosystems), the PCR reaction was performed (denaturing for 1 minute at 94°C; annealing at 48°C for 1 minute and elongation for 3 minutes at 72°C) for 30 cycles. This was followed by a final elongation step at 72°C for 10 minutes.

Agarose gel electrophoresis showed a product of approximately 0.7 kb that contains the entire coding region of the surface gene.

Digestion of PCR products with restriction enzymes

The amplified PCR product was purified by loading the PCR product onto a 1% preparative gel (1% low melting point agarose (Gibco BRL) in 1x TAE buffer). The DNA fragments were separated by running the gel in 1x TAE buffer at 50V for 1-2 hours at 4°C The PCR fragment was excised from the gel and purified using Qiagen's QIA gel extraction kit. The DNA fragment was then digested with the restriction enzymes Kpn I and Not I at 37°C for 2 hours. The digested DNA was then gel purified as described above in preparation for ligation. Preparation of Vector DNA

The vector pVAX-1 was digested with the restriction enzymes Kpn I and Not I at 37°C for 2 hours. After confirming digestion on a 1% agarose gel, the digested vector was gel purified on a preparative 1x TAE gel as described above.

Ligation

The restriction enzyme digested 0.7 kb HBV S gene fragment and the digested pVAX-1 vector were ligated using 0.5 units 74 DNA ligase (Boehringer UK) overnight at 1'6°C.

Transformation

Isolation of colonies containing the envelope gene insert

Individual colonies (6) were amplified overnight at 37°C in LB media (5ml cultures) containing kanamycin sulphate. The bacterial cultures were harvested and the plasmid DNA was purified using <3iagen's plasmid DNA mini kit using the procedure recommended by the manufacturer. Restriction enzyme digestion of the plasmid DNA with the restriction enzymes Kpn I and Not I confirmed which clones contained the HBV

S gene and two clones containing inserts of the correct size were analysed further. DNA sequencing showed that clone pVS- B had the expected sequence.

EXAMPLE 5: CLONING OF THE X GENE INTO pVAX-1 PRODUCTION OF A PLASMID EXPRESSING HBV X GENE

Amplification of HBV X gene The HBV X gene is amplified from HBV DNA isolated from serum from a patient infected with hepatitis B. X gene specific primers were designed that were complimentary to nucleotide sequences immediately upstream and downstream of the

X gene. They contained restriction endonuclease sites Kpn I and Not I that cleave the multiple cloning site of the vector pVAX-1 and that do not cleave the X gene.

Primers for PCR

Primer Primer Sequence Restriction Name enzymes XFKpn I 5' t tgg tac etc tgt cgt tct etc ccg gaa gta ta 3' Kpn I XRNot I 5' aca ggc ggc cgc gaa caa gag atg att a 3' Not I Bold text are the restriction enzyme sites

The HBV X gene is amplified by the polymerase chain reaction (PCR) using the X gene specific primers, XFKpnl and XRNot I. PCR is carried out using the Perkin Elmer PCR kit (Applied BioSystems) in a reaction volume of 100μl. The HBV DNA (1 μl) together with 0.2nmoles/μl of the HBV X gene specific primers, 10mM dATP, 10mM dTTP, 10mM dCTP, 10mM dGTP and 2mM MgCI₂ are mixed together, overiayed with mineral oil and denatured at 94°C for 5 minutes. After the addition of 1 μl Taq DNA polymerase (Applied Biosystems), the PCR reaction is performed (denaturing for 1 minute at 94°C; annealing for 1 minute and elongation for 3 minutes at 72°C) for 30 cycles. This is followed by a final elongation «tep at 72°C for 10 minutes.

Agarose gel electrophoresis is used to check the product size, namely approximately 0.5 kb that contains the entire coding region of the X gene.

Digestion of PCR products with restriction enzymes

The amplified PCR product is purified by loading onto a 1 % preparative gel (1 % low melting point agarose (Gibco BRL) in 1x TAE buffer). The ONA fragments are separated by running the gel in 1x TAE buffer at 50V for 1-2 hours at 4°C The PCR fragment is excised from the gel and purified using Qiagen's QIA gel extraction kit. The DNA fragment is then digested with the restriction enzymes Kpn I and Not I at 37°C for 2 hours. The DNA is then gel purified as described above in preparation for ligation.

Preparation of Vector DNA

The vector pVAX-1 is digested with Kpn I and Not I at 37°C for 2 hours. After confirming digestion of a 1% agarose gel, the digested vector is gel purified on a preparative 1x TAE gel as described above.

Ligation

The restriction digested 0.5 kb HBV X gene fragment and the digested pVAX-1 vector are ligated using 0.5 units T4 DNA ligase (Boehringer UK) overnight at 16°C

Transformation

The ligated DNA is used to transform TOP10 cells (Invitrogen) using the TOP10 one shot kit as described above. The transformed cells are then plated out on to LB plates containing 50 μg/ml kanamycin sulphate (Sigma) and incubated at 37°C overnight.

Isolation of colonies containing the X gene insert

Individual colonies (6) are amplified overnight at 37°C in LB media (5ml cultures) containing kanamycin sulphate. The bacterial cultures are harvested and the plasmid DNA purified using Qiagen's plasmid DNA mini kit using the procedure recommended by the manufacturer. Restriction enzyme digestion of the plasmid DNA with the enzymes Kpn I and Not I confirms which clones contain the HBV X gene. Sequencing is as described above. Example 6: PRODUCTION OF A PLASMID EXPRESSING HBV

POLYMERASE GENE

Amplification of HBV-Polvmerase gene

The HBV polymerase (pol) gene is amplified from HBV DNA isolated from serum from a patient infected with hepatitis B. Polymerase specific primers, PolFKpnl and PolRNotl shown below are complimentary to nucleotide sequences immediately upstream and downstream of the pol gene. They also contain restriction endonuclease sites Kpn I and Not I that cleave the multiple cloning site of the vector pVAX-1 and do not cleave the pol gene.

Primers for PCR

Primer Primer Sequence Restricti Name on enzymes PolFKpn I 5' gggggg tac cAG CTT ATA GAC CAC CAA ATG Kpn I 3' PolRNot I 5' gggggc ggc cgc AAT ATT TGG TGG <3CG 3TT Not I CC 3'

The HBV pol gene is amplified by the polymerase chain reaction (PCR) using the polymerase specific primers. PCR is carried out using the Perkin Elmer PCR kit (Applied BioSystems) in a reaction volume of 100μl. The HBV DNA (1 μl) together with 0.2nmoles/μl of the HBV polymerase specific primers PolFKpnl and PolRNotl, 10mM dATP, 10mM dTTP, 10mM dCTP, 10mM dGTP and 2mM MgCI₂ is mixed together, overiayed with mineral oil and denatured at 94°C for 5 minutes. Afterthe addition of 1 μl Taq DNA polymerase (Applied Biosystems), the PCR reaction is performed (denaturing for 1 minute at 94°C; annealing for 1 minute and elongation for 3 minutes at 72°C) for 30 cycles. This is followed by a final elongation step at 72°C for 10 minutes. Agarose gel electrophoresis shows a product of approximately 2.6 kb that contains the entire coding region of the polymerase gene.

Digestion of PCR products with restriction enzymes

The amplified PCR product is purified by loading onto a 1% preparative gel (1% low melting point agarose (Gibco BRL) in 1x TAE buffer). The DNA fragments are separated by running the gel in 1x TAE buffer at 50V for 1-2 hours at 4°C The PCR fragment is excised from the gel and purified using Qiagen's QIA gel extraction kit. The DNA fragment is then digested with the restriction enzymes Kpn I and Not I at 37°C for

2 hours. The DNA is then gel purified as described above in preparation for ligation.

Preparation of Vector DNA

The vector pVAX-1 is digested with the cloning restriction enzymes Kpn I and Not I at

37°C for 2 hours. After confirming digestion on a 1% agarose gel, the digested vector is gel purified on a preparative 1x TAE gel as described above.

Ligation

The restriction digested 2.6 kb HBV pol fragment and the digested pVAX-1 vector is ligated using 0.5 units T4 DNA ligase (Boehringer UK) overnight at 16°C

Transformation

Isolation of colonies containing the polymerase gene insert

Individual colonies (6) are amplified overnight at 37°C in LB media (5ml cultures) containing kanamycin sulphate. The bacterial cultures are harvested and the plasmid DNA purified using Qiagen's plasmid DNA mini kit using the procedure recommended by the manufacturer. Restriction enzyme digestion of the plasmid DNA with the enzymes Kpn I and Not I confirms which clones contain the HBV pol gene.

Sequencing is as described above.

EXAMPLE 7: FORMULATIONS

Vaccine Amount of various plasmids formulations 1 S (50 μg) + C (50 μg) 2 S (33.3 μg) + C (33.3 μg) + X (33.3 μg) 3 S (33.3 μg) + C (33.3 μg) + P (33.3 μg) 4 S (25 μg)+ C (25 μg) + X (25 μg) + P (25 μg) S represents plasmid containing the HBV S gene, C represents plasmid expressing HBV core gene, X represents plasmid containing the HBV X gene and P represents plasmid containing the HBV polymerase gene. Suitable stabiliser such as serum albumin or a sugar and suitable -preservative may be added. EXAMPLE 8: GENERATION OF ANTIBODIES FOLLOWING IMMUNISATION

Immunisation of mice

On the day prior to the 1^st immunisation (TO), the mice were bled. The blood was collected and allowed to clot for 1 hour at 37°C After overnight incubation at 4°C, the serum was collected by centrifugation and then stored at -20°C until tested.

Female C57 mice were immunised with three DNA preparations containing DNA in saline buffer as indicated below.

Group 1 (6 mice) received 50 μg pcDHS.5 (pcDNA3.1 vector containing the S gene) Group 2 (4 mice) received 50 μg pcDNA3.1 (vector alone - negative control) Group 3 (4 mice) received 50 μg pCMV-S (control plasmid expressing HBV S gene) Two weeks after the 1^st immunisation, blood samples were collected (T1) and serum obtained. The mice also received a second dose of the DNA constructs (as for the 1^st immunisation). The mice were then bled and serum collected every fortnight.

The serum was then tested for the presence of antibodies to the S protein.

Enzyme linked Immunosorbant Assay (ELISA)

Plastic 96 well plates were coated with recombinant HBsAg at a concentration of 1 μg/ml antigen (diluted in carbonate buffer).

After an overnight incubation at 4°C, the plates were washed three times in phosphate buffered saline (PBS) containing 0.05% Tween 20. The plates were blocked with PBS containing 10% foetal calf serum (PCS) and incubated at 37°C for a minimum of 2 hours. The plates were then washed three times in PBS/0.05 % Tween 20. The serum samples were diluted in PBS/10% FCS/0.05% Tween 20. Each sample was tested in duplicate at 1/100, 1/120, 1/400, 1/800, 1/1600 and 1/3200 dilutions.

The plates were incubated for 2-3 hours at 37°C or at 4°C overnight and then washed as before. Bound antibody was detected by incubation with goat anti-mouse IgG peroxidase (Nordic; diluted to 1/500 in PBS/10% FCS/0.05%Tween 20). After incubation at 37°C for 1 hour, the plates were washed and then incubated in orthophenyldiamine (OPD) substrate (15 ml citric acid phosphate buffer, 1 tablet OPD and 50μl H₂O₂) in the dark at room temperature for 10 minutes. The reaction was stopped by adding 25μl/well 2M H₂SO₄ to all wells and the plates were read using an ELISA plate reader at 492nm.

Anti-HBs antibodies were observed in the some of the mice immunised with pcDHS.5 expressing the S gene. Log antibody dilution was estimated at the cut off point (the average of the control reading plus three standard deviations). Highest individual antibody titres in mouse

Time Log ₁₀ antibody dilution point Group 1 Group 2 Group 3 pcDHS.5 pcDNA3.1 vector pCMV-S Negative control Positive control TO 2 2 2 T1¹ 1.9 1.8 2 j₂2 1.8 1.8 3.5 T3³ 3.5 2 3.5

¹Two weeks after first immunisation. Four weeks after first immunisation. ³Six weeks after first immunisation.

Claims

CLAIMS:

A recombinant DNA composition comprising a plurality of elements selected from: a core DNA element which includes a sequence which encodes an immunogenic region of the hepatitis B virus (HBV) core protein; a surface antigen DNA element which includes a sequence which encodes an immunogenic region of the HBV^surface antigen (S, M and/or L) protein; an X DNA element which includes a -sequence which encodes an 15 immunogenic region of the HBV X protein; a polymerase DNA element which includes a sequence which encodes an immunogenic region of the HBV polymerase protein.

2. A composition according to claim 1 wherein at least one of said elements comprises a sequence which encodes a full length HBV core, polymerase, X or surface antigen protein.

3. A composition according to Claim 1 or Claim 2 wherein said surface antigen element includes a sequence which encodes an immunogenic region of at least one of said S, M and L proteins.

4. A composition according to Claim 3 wherein -said surface antigen element includes a sequence which encodes an immunogenic region of said S, M and L proteins.

5. A composition ccording to any one of the preceding claims wherein said surface antigen element comprises a sequence which encodes the HBV surface antigen middle protein.

6. A composition according to Claim 5 wherein said surface antigen element comprises a sequence which encodes the HBV surface antigen large protein.

7. A composition according to any one of the preceding claims comprising at least three of the elements defined in Claim 1.

8. A composition according to Claim 7 comprising all four of the elemenis defined in Claim 1.

9. A composition according to any one of the preceding claims wherein each of said plurality of elements is provided in the form of a separate DNA vector.

10. A composition according to any one of the preceding claims wherein at least one of said elements includes a sequence which encodes amino acids which are contiguous in hepatitis B virus.

11. A recombinant polypeptide composition, comprising a plurality of elements selected from: a core polypeptide element which includes a sequence of an immunogenic region of the HBV core protein; a surface antigen polypeptide element which includes a sequence of an immunogenic region of the HBV -surface antigen (S, M or L) protein; an X polypeptide element which includes a sequence of an immunologically active region of the HBV X protein; a polymerase polypeptide element which includes a sequence of an 5 immunogenic region of the HBV polymerase protein; wherein at least one of said elements comprises at least 100 amino acids from the respective HBV protein.

12. A composition according to Claim 11 wherein at least one of said elements comprises a full length HBV core, polymerase, X or HBV surface antigen protein.

13. A composition according to Claim 11 or Claim 12 wherein said surface antigen element comprises the HBV surface antigen middle protein.

14. A composition according to Claim 13 wherein the surface antigen element comprises the HBV surface antigen large protein.

15. A composition according to any one of Claims 11 to 14 comprising at least three of the elements defined in Claim 11.

16. A composition according to any one of the preceding claims comprising all four of the elements defined in Claim 11.

17. A composition according to any one of Claims 11 to 16 wherein each of said plurality of elements is provided in the form of a separate polypeptide construct.

18. A composition according to any one of Claims 11 to 17 wherein said at least 100 amino acids are contiguous in hepatitis B virus.

19. Use of hepatitis B X polypeptide in the manufacture of a medicament for the treatment of chronic hepatitis B viral infection.

20. Use of hepatitis B X gene in the manufacture of a medicament for the treatment of chronic hepatitis B viral infection.

21. Use according to Claim 19 or Claim 20 wherein the medicament comprises a further HBV polypeptide or gene.

22. A composition according to any one of the preceding claims wherein -said composition is a vaccine.

23. A composition according to any one of the preceding claims for use in the treatment or prophylaxis of hepatitis B viral infection.

24. A composition according to Claim 23 for use in the prophylaxis of hepatitis B viral infection.

25. A composition according to Claim 23 for use in the treatment of hepatitis B viral infection.

26. A composition according to Claim 25 for use in the treatment of chronic hepatitis B viral infection.

27. A composition according to any one of the preceding claims further comprising an adjuvant.

28. A composition according to any one of the preceding claims further comprising a cytokine.

29. A composition according to any one of the preceding claims formulated for intramuscular, oral, intranasal, intradermal, subcutaneous or intravenous administration.