WO2005054483A2 - Enhanced expression - Google Patents

Enhanced expression Download PDF

Info

Publication number
WO2005054483A2
WO2005054483A2 PCT/GB2004/005058 GB2004005058W WO2005054483A2 WO 2005054483 A2 WO2005054483 A2 WO 2005054483A2 GB 2004005058 W GB2004005058 W GB 2004005058W WO 2005054483 A2 WO2005054483 A2 WO 2005054483A2
Authority
WO
WIPO (PCT)
Prior art keywords
organism
nucleotide sequence
target
mars
target nucleotide
Prior art date
Application number
PCT/GB2004/005058
Other languages
French (fr)
Other versions
WO2005054483A3 (en
Inventor
Bruno Philippe Angelo Cammue
Miguel Francesco Coleta De Bolle
Katleen Butaye
Original Assignee
Plant Bioscience Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Plant Bioscience Limited filed Critical Plant Bioscience Limited
Priority to AU2004294508A priority Critical patent/AU2004294508A1/en
Priority to CA002545687A priority patent/CA2545687A1/en
Priority to EP04819725A priority patent/EP1706496A2/en
Priority to US10/581,472 priority patent/US20080092252A1/en
Publication of WO2005054483A2 publication Critical patent/WO2005054483A2/en
Publication of WO2005054483A3 publication Critical patent/WO2005054483A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/822Reducing position variability, e.g. by the use of scaffold attachment region/matrix attachment region (SAR/MAR); Use of SAR/MAR to regulate gene expression

Definitions

  • the present invention relates generally to methods and materials for boosting gene expression.
  • PTGS post-transcriptional gene silencing
  • suppressing PTGS e.g. by mutating or otherwise impairing the function of the mechanistic genes which support it will increase the expression of silenced genes, back to non-silenced levels .
  • the SGS2 and SGS3 genes were found by mutation of a silenced A. thaliana plant line containing nptII/p35S/uidA/tRBC (Elmayan, et al . 1998) . GUS activity was restored after mutation.
  • the SDEl and SDE3 genes were found by mutation of a silenced plant line containing p35S/PVX:GFP amplicon and p35S/GFP (Dalmay, et al . 2000b) . GFP fluorescence was restored after mutation.
  • MARs Matrix Attachment Regions
  • MARs may have a role in shielding sequences from gene silencing.
  • transgene expression dropped when MARs were removed from homozygous, high- expressing transgenic tobacco lines (Mlynarova et al . , 2003 The Plant Cell: 15, 2203-2217).
  • MARs were used to flank vector constructs for transformation of Arabidopsis thaliana , no PTGS- shielding effect was observed in populations of hemizygous, primary transformants (De Bolle & Butaye et al . (2003) ) .
  • the present inventors demonstrated that the influence of MARs on the level and the variability of gene expression in Arabidopsis thaliana differed significantly between wild-type plants and various A. thaliana mutants impaired in the RNA silencing mechanism, with much greater levels of expression being shown by the latter.
  • GUS expression was enhanced to the extent that the protein accumulated to roughly 10% of the total soluble proteins in the vegetative tissues of transgenic plants.
  • the invention provides a method of producing a transgenic organism in which a target nucleotide sequence is expressed at an enhanced level, the method comprising the steps of:
  • the invention provides a method of achieving enhanced expression of a heterologous target nucleotide sequence in an organism which is deficient in one pr more genes required to support PTGS, which method comprises the steps of associating said target nucleotide sequence with one or more MARs.
  • the or each of the MARs may be introduced to and associated at random with a pre-existing gene present in the genome of the organism (e.g. to positions flanking it) .
  • the target nucleotide sequence may be one which is endogenous, but is operably linked to a strong, heterologous promoter or enhancer sequence.
  • Such methods may involve: (i) providing an organism in which PTGS has been, or is suppressed (as discussed herein) , (iia) operably linking said target nucleotide sequence with a heterologous strong promoter or enhancer sequence, and (iib) associating said target nucleotide sequence with one or more MARs.
  • Such methods could be performed analogously to existing studies where e.g. the 35S- promoter is introduced at random into a genome to alter the expression of neighbouring endogenous genes, "endogenes"; or e.g. activation-tagging in which enhancers of the p35S are randomly inserted into a genome to activate/increase the expression of endogenes for selection of altered phenotypes (Weigel, D., et al . (2000) Activation tagging in Arabidopsis. Plant Physiol., 122: 1003- 13.) .
  • MARs Matrix Attachment Regions
  • the target nucleotide sequence and promoter will both be heterologous to the organism.
  • this aspect of the invention provides a method of producing a transgenic organism in which a heterologous target nucleotide sequence is expressed at an enhanced level, the method comprising the steps of:
  • MARs Matrix Attachment Regions
  • the steps of the method may be carried out in any order i.e. the PTGS may be suppressed after introduction of the construct.
  • the invention provides the steps of: (i) providing an organism, (iia) associating the target nucleotide sequence with one or more MARs in a cell of the organism as discussed above,
  • the organism will be one in which PTGS is already suppressed.
  • the invention is used to enhance expression, particularly the level of translation, of a nucleic acid in a cell, particularly a plant cell.
  • Expression may be enhanced, for instance, by at least about 25-50%, preferably about 50-100%, or more. In certain preferred embodiments at least 5, 10, 15, 20, 25, or 30-fold enhancements of expression may be achieved.
  • the organism is one which is deficient in one or more genes required to support PTGS e.g. a plant deficient in one or more of the following:
  • SGS2/SDE1 RdRp (Dalmay et al . , 2000, Mourrain et al . , 2000)
  • SGS3 coiled coil protein with unknown function (Mourrain et al . , 2000)
  • AGOl PAZ-domain protein (Fagard et al . , 2000)
  • PTGS By “deficient” is meant that the activity of the gene (or encoded protein) is impaired.
  • the gene Preferably the gene may be mutated (e.g. a lesion introduced) or otherwise deleted or knocked out. It will be appreciated that such PTGS suppressed organisms may not be entirely PTGS-deficient .
  • the degree of PTGS impairment or deficiency may be assessed using conventional methods e.g. by monitoring the short RNA species (around 25 nt e.g. about 21-23nt RNA) associated with PTGS, or by monitoring mRNA and ⁇ or expressed protein (Northern or Western Blots or a reporter gene such as GFP) the existence and severity of PTGS can be assessed (see Hamilton and Baulcombe 1999) .
  • RNAi RNAi
  • RNAi can be initiated using hairpin constructs that are designed to trigger PTGS of the target gene, based on homology of sequences (Helliwell and Waterhouse 2003) . This technique could therefore also be used to silence genes that play a role in PTGS (e.g. SGS2) in plant lines in which the invention is to be applied.
  • RNAi may be achieved by use of an appropriate vector e.g. a vector comprising part of a nucleic acid sequence encoding a PTGS mechanistic gene, which is suitable for triggering RNAi in the cell.
  • the vector may comprise a nucleic acid sequence in both the sense and antisense orientation, such that when expressed as RNA the sense and antisense sections will associate to form a double stranded RNA.
  • This may for example be a long double stranded RNA (e.g., more than 23nts) which may be processed in the cell to produce siRNAs (see for example Myers (2003) Nature Biotechnology 21 : 324-328) .
  • MARs Optionally only 1 MAR may be associated with the expression cassette, in which case preferably it will be 5' of the cassette (see e.g. Sc ⁇ ffl e.a. 1993, Transgenic Res. 2, 93-100; van der Geest e.a. 1994, Plant J. 6, 413-423) .
  • MARs will be used, which may be the same or different, and which may be from the same or different sources, and these will flank the expression cassette or target nucleotide sequence .
  • the or each MARs will be less than 500, preferably less than 200, and optionally less than 150, 100, or 50 nucleotides upstream of the promoter or downstream of the terminator.
  • the present invention relates to the use of any MAR origin (e.g. animal, plant, yeast) although preferred examples include that from the the chicken lysozyme gene, or from plants such as petunia and tobacco.
  • MAR origin e.g. animal, plant, yeast
  • Other MARs are reviewed in Holmes-Davis and Comai (1998) and Allen, et. al (2000) .
  • the invention may be applied to any organism in which PTGS can be suppressed, particularly eukaryotic organisms including yeasts, fungi, algae, higher plants.
  • Transformed organisms of the present invention will be non-human.
  • the organism is a higher plant e.g. Arabidopsis thaliana.
  • the promoter used to drive the gene of interest will be a strong promoter.
  • strong promoters for use in plants include: (1) p35S: Odell et al . , 1985
  • the target gene may be a transgene or an endogene .
  • Genes of interest include those encoding agronomic traits, insect resistance, disease resistance, herbicide resistance, sterility , grain characteristics, and the like.
  • the genes may be involved in metabolism of oil, starch, carbohydrates, nutrients, etc.
  • genes or traits of interest include, but are not limited to, environmental- or stress- related traits, disease-related traits, and traits affecting agronomic performance.
  • Target sequences also include genes responsible for the synthesis of proteins, peptides, fatty acids, lipids, waxes, oils, starches, sugars, carbohydrates, flavors, odors, toxins, carotenoids, hormones, polymers, flavonoids, storage proteins, phenolic acids, alkaloids, lignins, tannins, celluloses, glycoproteins, glycolipids, etc.
  • the targeted genes in monocots and/or dicots may include those encoding enzymes responsible for oil production in plants such as rape, sunflower, soya bean and maize; enzymes involved in starch synthesis in plants such as potato, maize, cereals; enzymes which synthesise, or proteins which are themselves, natural medicaments such as pharmaceuticals or veterinary products.
  • Heterologous nucleic acids may encode, inter alia, genes of bacterial, fungal, plant or animal origin. The polypeptides may be utilised in planta (to modify the characteristics of the plant e.g.
  • the plant may be an intermediate for producing the polypeptides which can be purified therefrom for use elsewhere.
  • proteins include, but are not limited to retinoblastoma protein, p53, angiostatin, and leptin.
  • the methods of the invention can be used to produce mammalian regulatory proteins.
  • Other sequences of interest include proteins, hormones, growth factors, cytokines, serum albumin, haemoglobin, collagen, etc.
  • target gene or nucleotide sequence preferably encodes a target protein which is : an insect resistance protein; a disease resistance protein; a herbicide resistance protein; a mammalian protein.
  • the target construct is a vector, and preferably it comprises border sequences which permit the transfer and integration of the expression cassette and MARs into the organism genome.
  • the construct is a plant binary vector.
  • the binary transformation vector is based on pPZP (Hajdukiewicz, et al . 1994).
  • Other example constructs include pBinl9 (see Frisch, D. A., L. W. Harris-Haller, et al . (1995). "Complete Sequence of the binary vector Bin 19.” Plant Molecular Biology 27: 405-409).
  • the construct used is substantially similar to pFAJ3163 shown in Figure 1 i.e. comprises the depicted features of that vector (or equivalents as described herein) in the recited order, and the gene of interest in place of the the ⁇ -glucuronidase reporter gene (uidA) .
  • the coding region of the construct may be absent.
  • the invention may further comprise the step of regenerating a plant from a transformed plant cell.
  • Suitable vectors may include plant viral-derived vectors (see e.g.
  • selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibiotics or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate) .
  • antibiotics or herbicides e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate
  • Nucleic acid can be introduced into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transfer ability (EP-A- 270355, EP-A-0116718, NAR 12(22) 8711 - 87215 1984; the floral dip method of Clough and Bent, 1998), particle or microprojectile bombardment (US 5100792, EP-A-444882, EP-A-434616) microinjection (WO 92/09696, WO 94/00583, EP 331083, EP 175966, Green et al .
  • a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transfer ability (EP-A- 270355, EP-A-0116718, NAR 12(22) 8711 - 87215 1984; the floral dip method of Clough and Bent, 1998), particle or microprojectile bombardment (US 5100792, EP-A-444882, EP-A-434616) microin
  • Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous species. However there has also been considerable success in the routine production of stable, fertile transgenic plants in almost all economically relevant monocot plants (see e.g. Hiei et al . (1994) The Plant Journal 6, 271-282)). Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium alone is inefficient or ineffective. Alternatively, a combination of different techniques may be employed to enhance the efficiency of the transformation process, eg bombardment with Agrobacterium coated microparticles (EP- A-486234) or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium (EP-A-486233) .
  • various aspects of the present invention provide a method of transforming a plant cell involving introduction of a construct of the invention into a plant tissue (e.g. a plant cell) and causing or allowing recombination between the vector and the plant cell genome to introduce a nucleic acid according to the present invention into the genome. This may be done so as to effect transient expression.
  • a plant following transformation of plant tissue, a plant may be regenerated, e.g. from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues and organs of the plant.
  • Regenerated plants or parts thereof may be used to provide clones, seed, selfed or hybrid progeny and descendants (e.g. FI and F2 descendants), cuttings (e.g. edible parts) etc.
  • progeny and descendants e.g. FI and F2 descendants
  • cuttings e.g. edible parts
  • the invention further provides a transgenic organism (for example obtained or obtainable by a method described herein) in which an heterologous target nucleotide sequence is expressed at an enhanced level, wherein the organism is deficient in one or more genes required to support PTGS, which organism includes in its genome (a) an expression cassette including the target nucleotide sequence operably linked to a promoter, and (b) one or more heterologous Matrix Attachment Regions (MARs) associated therewith.
  • the invention further comprises a method for generating a target protein, which method comprises the steps of performing a method (or using an organism) as described above, and optionally harvesting, at least, a tissue in which the target protein has been expressed and isolating the target protein from the tissue.
  • MARs Microx attachment region
  • heterologous is used broadly below to indicate that the gene/sequence of nucleotides in question have been introduced into the cells in question (e.g. of a plant or an ancestor thereof) using genetic engineering, i.e. by human intervention.
  • a heterologous gene may replace an endogenous equivalent gene, i.e. one which normally performs the same or a similar function, or the inserted sequence may be additional to the endogenous gene or other sequence.
  • Nucleic acid heterologous to a cell may be non-naturally occurring in cells of that type, variety or species.
  • heterologous nucleic acid may comprise a coding sequence of, or derived from, a particular type of plant cell or species or variety of plant, placed within the context of a plant cell of a different type or species or variety of plant.
  • a nucleic acid sequence may be placed within a cell in which it or a homologue is found naturally, but wherein the nucleic acid sequence is linked and/or adjacent to nucleic acid which does not occur naturally within the cell, or cells of that type or species or variety of plant, such as operably linked to one or more regulatory sequences, such as a promoter sequence, for control of expression.
  • Gene unless context demands otherwise refers to any nucleic acid encoding genetic information for translation into a peptide, polypeptide or protein.
  • Vector is defined to include, inter alia, any plasmid, cosmid, phage, viral or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication) .
  • the constructs used will be wholly or partially synthetic. In particular they are recombinant in that nucleic acid sequences which are not found together in nature (do not run contiguously) have been ligated or otherwise combined artificially.
  • a vector according to the present invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the genome.
  • a binary vector system includes (a) border sequences which permit the transfer of a desired nucleotide sequence into a plant cell genome; (b) desired nucleotide sequence itself, which will generally comprise an expression cassette of (i) a plant active promoter, operably linked to (ii) the target sequence and ⁇ or enhancer as appropriate.
  • the desired nucleotide sequence is situated between the border sequences and is capable of being inserted into a plant genome under appropriate conditions.
  • the binary vector system will generally require other sequence (derived from A. tumefaciens) to effect the integration. Generally this may be achieved by use of so called "agro-infiltration” which uses Agrobacterium-mediated transient transformation.
  • T-DNA Agrobacterium tumefaciens to transfer a portion of its DNA
  • the T-DNA is defined by left and right border sequences which are around 21-23 nucleotides in length.
  • the infiltration may be achieved e.g. by syringe (in leaves) or vacuum (whole plants).
  • the border sequences will generally be included around the desired nucleotide sequence (the T-DNA) with the one or more vectors being introduced into the plant material by agro- infiltration.
  • “Expression cassette” refers to a situation in which a nucleic acid is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial or plant cell.
  • a “promoter” is a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA) .
  • “Operably linked” means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
  • nucleotide sequence e.g. a specific MAR, gene, polypeptide, promoter etc.
  • the invention should not be taken to be limited to use of the recited sequence, but also embraces use of a variants of any of these sequences.
  • a variant sequence will be identical to all or part of the sequence discussed and share the requisite activity, which activity can be confirmed using the methods disclosed or otherwise referred to herein or known to those skilled in the art.
  • variants may be (i) naturally occurring homologous variants of the relevant sequence; (ii) artificially generated variants (derivatives) which can be prepared by the skilled person in the light of the present disclosure, for instance by site directed or random mutagenesis, or by direct synthesis.
  • any variant sequence shares at least about 75%, or 80% identity, most preferably at least about 90%, 95%, 96%, 97%, 98% or 99% identity with that specifically refererred to. Similarity or homology in the case of variants is preferably established via sequence comparisons made using FASTA and FASTP (see Pearson & Lipman, 1988. Methods in Enzymology 183: 63-98).
  • Parameters are preferably set, using the default matrix, as follows: Gapopen (penalty for the first residue in a gap) : -12 for proteins / -16 for DNA; Gapext (penalty for additional residues in a gap) : -2 for proteins / -4 for DNA; KTUP word length: 2 for proteins / 6 for DNA. Homology may also be assessed by use of a probing methodology (Sambrook et al . , 1989).
  • T m 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex.
  • [Na+] [0.368] and 50-% formamide, with GC content of 42% and an average probe size of 200 bases, the T m is 57°C.
  • the T m of a DNA duplex decreases by 1 - 1.5°C with every 1% decrease in homology.
  • targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42°C.
  • GUS activity is expressed in units GUS (nmoles 4-methylumbelliferone per min per mg total soluble protein) in first generation transgenic A. thaliana wild-type, sgs2 and sgs3 background transformed with pFAJ3160 and pFAJ3163.
  • a set of transformation vectors was constructed without and with MARs flanking the genes of interest.
  • the ⁇ -glucuronidase reporter gene ( uidA) driven by the 35S promoter of Cauliflower Mosaic Virus (p35S) was used.
  • p35S Cauliflower Mosaic Virus
  • GUS ⁇ - glucuronidase
  • All plant transformation vectors were introduced in Agrobacterium tumefaciens GV3101 (pMP90) by electroporation.
  • the A. tumefaciens strains with the binary vectors were used to transform A. thaliana wild-type and mutant plants using the floral dip transformation method as described by Clough & Bent (1998) .
  • Transgenic plants were selected based on resistance against phosphinotricin and further grown as described by De Bolle & Butaye et al . (2003) .
  • ⁇ -Glucuronidase (GUS) activity was measured fluorometrically using 4- methylumbelliferyl glucuronide as a substrate and 4- methylubmelliferon as a standard according to Jefferson (1987) .
  • Total protein was determined by the method of Bradford (1976) using bovine serum albumin as a standard.
  • Transformation of wild-type A. thaliana plants with pFAJ3160 yielded an average GUS activity of 320 units (Table 1) .
  • the population of primary transformants consisted of about 80% low GUS expressing primary transformants ( ⁇ 50 units GUS) and about 20% high GUS expressing primary transformants (>100 units GUS) , a bimodal distribution typical for p35S-driven expression (Elmayan & Vaucheret, 1996; De Bolle & Butaye et al . , 2003; Figure 2A) .
  • wild-type plants were transformed with pFAJ3163.
  • A. thaliana sgs2 mutants (Elmayan, et al . , 1998) were used as the recipient for transformation instead of wild-type plants.
  • SGS2 encodes an RNA dependent RNA polymerase, which is presumed to play a key role in RNA silencing of transgenes (Mourrain, et al . 2000) .
  • average GUS activity in primary transformants increased almost 8-fold compared to wild-type plants (Table 1) .
  • the increase in average GUS activity at the population level was not due to an increase in activity of the high-expressing individuals but rather to a reduction of the incidence of individuals with low expression.
  • SGS3 plays a yet unknown key role in the RNA silencing mechanism and shows no similarity with any known or putative protein (Mourrain, et al . , 2000).
  • the average GUS activity was increased 2,5 fold in comparison the wild- type background (Table 1, Figure 2E) . Transformation of sgs3 plants with pFAJ3163 yielded a 30-fold increase of the average GUS activity in comparison to wild-type plants transformed with pFAJ3160.
  • Floral dip a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana . Plant J. 16: 735-43.
  • RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell, 101, 543-553.
  • SDE3 encodes an RNA helicase required for post-transcriptional gene silencing in Arabidopsis. EMBO J. 20, 2069-2078.
  • CVMV cassava vein mosaic virus

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Disclosed herein are methods and means of achieving enhanced expression of a target nucleotide sequence in a transgenic organism, which methods comprise the steps of: (i) providing an organism in which post-transcriptional gene silencing (PTGS) is suppressed, (ii) associating said target nucleotide sequence with one or more heterologous Matrix Attachment Region (MARs), and (iii) causing or permitting expression from the target nucleotide sequence in the organism. Unexpectedly, the MARs do not merely relieve gene silencing, but can actually lead to expression levels higher than can be achieved in wild-type organisms and higher than expression levels in organisms in which PTGS is suppressed but where the MARs are not employed.

Description

ENHANCED EXPRESSION
TECHNICAL FIELD
The present invention relates generally to methods and materials for boosting gene expression.
BACKGROUND ART
In plants, post-transcriptional gene silencing (PTGS) is manifested as the reduction in steady-state levels of specific RNAs after introduction of homologous sequences in the plant genome. This reduction is caused by an increased turnover of target RNA species, with the transcription level of the corresponding genes remaining unaffected.
It is known that suppressing PTGS e.g. by mutating or otherwise impairing the function of the mechanistic genes which support it will increase the expression of silenced genes, back to non-silenced levels .
For example the SGS2 and SGS3 genes were found by mutation of a silenced A. thaliana plant line containing nptII/p35S/uidA/tRBC (Elmayan, et al . 1998) . GUS activity was restored after mutation. The SDEl and SDE3 genes were found by mutation of a silenced plant line containing p35S/PVX:GFP amplicon and p35S/GFP (Dalmay, et al . 2000b) . GFP fluorescence was restored after mutation.
Nevertheless, it will be appreciated that methods of increasing the expression of genes over and above those achieved even in such silencing defective contexts would provide a contribution to the art. DISCLOSURE OF THE INVENTION
The present inventors have discovered that expression of a target gene in a PTGS-suppressed background can be additionally enhanced by the use of Matrix Attachment Regions (MARs) . MARs are non-transcribed regions in eukaryotic genomes that are attached to the proteinaceous matrix in the nucleus (reviewed by Holmes-Davis & Comai, 1998; Allen et al . , 2000) .
It has been hypothesized in the art that MARs may have a role in shielding sequences from gene silencing. In some cases, transgene expression dropped when MARs were removed from homozygous, high- expressing transgenic tobacco lines (Mlynarova et al . , 2003 The Plant Cell: 15, 2203-2217). However, when MARs were used to flank vector constructs for transformation of Arabidopsis thaliana , no PTGS- shielding effect was observed in populations of hemizygous, primary transformants (De Bolle & Butaye et al . (2003) ) .
Irrespective of the results above, it was not known or expected that MARs could further enhance expression in contexts in which silencing was impaired by a different mechanism.
Briefly, the present inventors demonstrated that the influence of MARs on the level and the variability of gene expression in Arabidopsis thaliana differed significantly between wild-type plants and various A. thaliana mutants impaired in the RNA silencing mechanism, with much greater levels of expression being shown by the latter. In one embodiment of the invention it was estimated that GUS expression was enhanced to the extent that the protein accumulated to roughly 10% of the total soluble proteins in the vegetative tissues of transgenic plants.
Particular aspects of, and definitions used in, the invention will now be discussed in more detail. In general the invention provides a method of producing a transgenic organism in which a target nucleotide sequence is expressed at an enhanced level, the method comprising the steps of:
(i) providing an organism in which PTGS has been suppressed (which suppression may be pre-existing, or may require the step of suppressing PTGS in the organism e.g. using the methods discussed below) ,
(ii) associating said target nucleotide sequence with one or more heterologous Matrix Attachment Region (MARs) , and optionally: (iϋ) causing or permitting expression from the target nucleotide sequence in the organism.
Thus, for example, the invention provides a method of achieving enhanced expression of a heterologous target nucleotide sequence in an organism which is deficient in one pr more genes required to support PTGS, which method comprises the steps of associating said target nucleotide sequence with one or more MARs. In one embodiment, the or each of the MARs may be introduced to and associated at random with a pre-existing gene present in the genome of the organism (e.g. to positions flanking it) .
The target nucleotide sequence may be one which is endogenous, but is operably linked to a strong, heterologous promoter or enhancer sequence. Such methods may involve: (i) providing an organism in which PTGS has been, or is suppressed (as discussed herein) , (iia) operably linking said target nucleotide sequence with a heterologous strong promoter or enhancer sequence, and (iib) associating said target nucleotide sequence with one or more MARs.
Such methods could be performed analogously to existing studies where e.g. the 35S- promoter is introduced at random into a genome to alter the expression of neighbouring endogenous genes, "endogenes"; or e.g. activation-tagging in which enhancers of the p35S are randomly inserted into a genome to activate/increase the expression of endogenes for selection of altered phenotypes (Weigel, D., et al . (2000) Activation tagging in Arabidopsis. Plant Physiol., 122: 1003- 13.) .
In one embodiment this may be carried out as follows :
(i) providing an organism in which PTGS has been, or is suppressed (as discussed herein) ,
(iia) providing a target nucleic acid construct comprising (a) a promoter, and (b) one or more Matrix Attachment Regions (MARs) associated therewith,
(iib) introducing said target construct into a cell of the organism, such that the promoter becomes operably linked to an endogenous target nucleotide sequence.
In another, preferred embodiment, the target nucleotide sequence and promoter will both be heterologous to the organism. Thus this aspect of the invention provides a method of producing a transgenic organism in which a heterologous target nucleotide sequence is expressed at an enhanced level, the method comprising the steps of:
(i) providing an organism in which PTGS has been suppressed,
(iia) providing a target nucleic acid construct comprising (a) an expression cassette including the target nucleotide sequence operably linked to a promoter, and (b) one or more Matrix Attachment Regions (MARs) associated therewith, (iib) introducing said target construct into a cell of the organism.
In principle the steps of the method may be carried out in any order i.e. the PTGS may be suppressed after introduction of the construct. Thus the invention provides the steps of: (i) providing an organism, (iia) associating the target nucleotide sequence with one or more MARs in a cell of the organism as discussed above,
(iib) suppressing PTGS in the organism e.g. using the methods discussed below (gene mutation or so on) .
However preferably the organism will be one in which PTGS is already suppressed.
In preferred embodiments, the invention is used to enhance expression, particularly the level of translation, of a nucleic acid in a cell, particularly a plant cell. Expression may be enhanced, for instance, by at least about 25-50%, preferably about 50-100%, or more. In certain preferred embodiments at least 5, 10, 15, 20, 25, or 30-fold enhancements of expression may be achieved.
Some particular preferred embodiments will now be discussed.
PTGS suppression
Preferably the organism is one which is deficient in one or more genes required to support PTGS e.g. a plant deficient in one or more of the following:
1) SGS2/SDE1: RdRp (Dalmay et al . , 2000, Mourrain et al . , 2000) 2) SGS3: coiled coil protein with unknown function (Mourrain et al . , 2000)
3) SDE3: RNA helicase (Dalmay et al . , 2001)
4) AGOl: PAZ-domain protein (Fagard et al . , 2000)
5) EX: RNAse D (Glazov et al . , 2003)
By "deficient" is meant that the activity of the gene (or encoded protein) is impaired. Preferably the gene may be mutated (e.g. a lesion introduced) or otherwise deleted or knocked out. It will be appreciated that such PTGS suppressed organisms may not be entirely PTGS-deficient . The degree of PTGS impairment or deficiency may be assessed using conventional methods e.g. by monitoring the short RNA species (around 25 nt e.g. about 21-23nt RNA) associated with PTGS, or by monitoring mRNA and\or expressed protein (Northern or Western Blots or a reporter gene such as GFP) the existence and severity of PTGS can be assessed (see Hamilton and Baulcombe 1999) .
Other means of generally suppressing or silencing PTGS supporting genes will be known to those skilled in the art, and include the use of viral suppressors of GS such as HC-Pro (Anandalaksh i et al . , 1998) and RNAi, which is widely used as a technique to suppress certain target genes and to create 'knock-outs' e.g. in functional genomic programs.
As is well known to those skilled in the art, RNAi can be initiated using hairpin constructs that are designed to trigger PTGS of the target gene, based on homology of sequences (Helliwell and Waterhouse 2003) . This technique could therefore also be used to silence genes that play a role in PTGS (e.g. SGS2) in plant lines in which the invention is to be applied. RNAi may be achieved by use of an appropriate vector e.g. a vector comprising part of a nucleic acid sequence encoding a PTGS mechanistic gene, which is suitable for triggering RNAi in the cell. For example the vector may comprise a nucleic acid sequence in both the sense and antisense orientation, such that when expressed as RNA the sense and antisense sections will associate to form a double stranded RNA. This may for example be a long double stranded RNA (e.g., more than 23nts) which may be processed in the cell to produce siRNAs (see for example Myers (2003) Nature Biotechnology 21 : 324-328) .
MARs Optionally only 1 MAR may be associated with the expression cassette, in which case preferably it will be 5' of the cassette (see e.g. Scόffl e.a. 1993, Transgenic Res. 2, 93-100; van der Geest e.a. 1994, Plant J. 6, 413-423) .
Preferably however 2 MARs will be used, which may be the same or different, and which may be from the same or different sources, and these will flank the expression cassette or target nucleotide sequence .
In preferred embodiments the or each MARs will be less than 500, preferably less than 200, and optionally less than 150, 100, or 50 nucleotides upstream of the promoter or downstream of the terminator.
The present invention relates to the use of any MAR origin (e.g. animal, plant, yeast) although preferred examples include that from the the chicken lysozyme gene, or from plants such as petunia and tobacco. Other MARs are reviewed in Holmes-Davis and Comai (1998) and Allen, et. al (2000) .
Organism
The invention may be applied to any organism in which PTGS can be suppressed, particularly eukaryotic organisms including yeasts, fungi, algae, higher plants. Transformed organisms of the present invention will be non-human. Preferably the organism is a higher plant e.g. Arabidopsis thaliana.
Promoter
Preferably the promoter used to drive the gene of interest will be a strong promoter. Examples of strong promoters for use in plants include: (1) p35S: Odell et al . , 1985
(2) Cassava Vein Mosaic Virus promoter, pCAS, Verdaguer et al . , 1996
(3) Promoter of the small subunit of ribulose biphosphate carboxylase, pRbcS : Outchkourov et al . , 2003. However other strong promoters include pUbi (for moncots and dicots) and pActin.
Choice of target genes to enhance
As discussed above, the target gene may be a transgene or an endogene .
Genes of interest include those encoding agronomic traits, insect resistance, disease resistance, herbicide resistance, sterility , grain characteristics, and the like. The genes may be involved in metabolism of oil, starch, carbohydrates, nutrients, etc. Thus genes or traits of interest include, but are not limited to, environmental- or stress- related traits, disease-related traits, and traits affecting agronomic performance. Target sequences also include genes responsible for the synthesis of proteins, peptides, fatty acids, lipids, waxes, oils, starches, sugars, carbohydrates, flavors, odors, toxins, carotenoids, hormones, polymers, flavonoids, storage proteins, phenolic acids, alkaloids, lignins, tannins, celluloses, glycoproteins, glycolipids, etc.
Most preferably the targeted genes in monocots and/or dicots may include those encoding enzymes responsible for oil production in plants such as rape, sunflower, soya bean and maize; enzymes involved in starch synthesis in plants such as potato, maize, cereals; enzymes which synthesise, or proteins which are themselves, natural medicaments such as pharmaceuticals or veterinary products. Heterologous nucleic acids may encode, inter alia, genes of bacterial, fungal, plant or animal origin. The polypeptides may be utilised in planta (to modify the characteristics of the plant e.g. with respect to pest susceptibility, vigour, tissue differentiation, fertility, nutritional value etc.) or the plant may be an intermediate for producing the polypeptides which can be purified therefrom for use elsewhere. Such proteins include, but are not limited to retinoblastoma protein, p53, angiostatin, and leptin. Likewise, the methods of the invention can be used to produce mammalian regulatory proteins. Other sequences of interest include proteins, hormones, growth factors, cytokines, serum albumin, haemoglobin, collagen, etc.
Thus the target gene or nucleotide sequence preferably encodes a target protein which is : an insect resistance protein; a disease resistance protein; a herbicide resistance protein; a mammalian protein.
Constructs & organisms
Preferably the target construct is a vector, and preferably it comprises border sequences which permit the transfer and integration of the expression cassette and MARs into the organism genome.
Preferably the construct is a plant binary vector. Preferably the binary transformation vector is based on pPZP (Hajdukiewicz, et al . 1994). Other example constructs include pBinl9 (see Frisch, D. A., L. W. Harris-Haller, et al . (1995). "Complete Sequence of the binary vector Bin 19." Plant Molecular Biology 27: 405-409).
Preferably the construct used is substantially similar to pFAJ3163 shown in Figure 1 i.e. comprises the depicted features of that vector (or equivalents as described herein) in the recited order, and the gene of interest in place of the the β-glucuronidase reporter gene (uidA) . In embodiments in which endogenes are being activated by a promoter or enhancer element, the coding region of the construct may be absent.
In one aspect the invention may further comprise the step of regenerating a plant from a transformed plant cell.
Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology
Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148) .
Suitable vectors may include plant viral-derived vectors (see e.g.
EP-A-194809) . If desired, selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibiotics or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate) .
Nucleic acid can be introduced into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transfer ability (EP-A- 270355, EP-A-0116718, NAR 12(22) 8711 - 87215 1984; the floral dip method of Clough and Bent, 1998), particle or microprojectile bombardment (US 5100792, EP-A-444882, EP-A-434616) microinjection (WO 92/09696, WO 94/00583, EP 331083, EP 175966, Green et al . (1987) Plant Tissue and Cell Culture, Academic Press) , electroporation (EP 290395, WO 8706614 Gelvin Debeyser) other forms of direct DNA uptake (DE 4005152, WO 9012096, US 4684611), liposome mediated DNA uptake (e.g. Freeman et al . Plant Cell Physiol . 29: 1353 (1984)), or the vortexing method (e.g. Kindle, PNAS U. S. A. 87: 1228 (1990d) Physical methods for the transformation of plant cells are reviewed in Oard, 1991, Biotech . Adv. 9: 1-11. Ti-plas ids, particularly binary vectors, are discussed in more detail below.
Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous species. However there has also been considerable success in the routine production of stable, fertile transgenic plants in almost all economically relevant monocot plants (see e.g. Hiei et al . (1994) The Plant Journal 6, 271-282)). Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium alone is inefficient or ineffective. Alternatively, a combination of different techniques may be employed to enhance the efficiency of the transformation process, eg bombardment with Agrobacterium coated microparticles (EP- A-486234) or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium (EP-A-486233) .
The particular choice of a transformation technology will be determined by its efficiency to transform certain plant species as well as the experience and preference of the person practising the invention with a particular methodology of choice.
It will be apparent to the skilled person that the particular choice of a transformation system to introduce nucleic acid into plant cells is not essential to or a limitation of the invention, nor is the choice of technique for plant regeneration. In experiments performed by the inventors, the enhanced expression effect is seen in a variety of integration patterns of the T-DNA.
Thus various aspects of the present invention provide a method of transforming a plant cell involving introduction of a construct of the invention into a plant tissue (e.g. a plant cell) and causing or allowing recombination between the vector and the plant cell genome to introduce a nucleic acid according to the present invention into the genome. This may be done so as to effect transient expression. Alternatively, following transformation of plant tissue, a plant may be regenerated, e.g. from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues and organs of the plant. Available techniques are reviewd in Vasil et al., Cell Cul ture and Somatic Cell Genetics of Plants, Vol I, II and III, Labora tory Procedures and Their Applications, Academic Press, 1984, and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989.
The generation of fertile transgenic plants has been achieved in the cereals rice, maize, wheat, oat, and barley (reviewed in Shimamoto, K. (1994) Current Opinion in Biotechnology 5, 158-162.; Vasil, et al . (1992) Bio/Technology 10, 667-674; Vain et al . , 1995, Biotechnology Advances 13 (4) : 653-671; Vasil, 1996, Nature Biotechnology 14 page 702) .
Regenerated plants or parts thereof may be used to provide clones, seed, selfed or hybrid progeny and descendants (e.g. FI and F2 descendants), cuttings (e.g. edible parts) etc.
The invention further provides a transgenic organism (for example obtained or obtainable by a method described herein) in which an heterologous target nucleotide sequence is expressed at an enhanced level, wherein the organism is deficient in one or more genes required to support PTGS, which organism includes in its genome (a) an expression cassette including the target nucleotide sequence operably linked to a promoter, and (b) one or more heterologous Matrix Attachment Regions (MARs) associated therewith. The invention further comprises a method for generating a target protein, which method comprises the steps of performing a method (or using an organism) as described above, and optionally harvesting, at least, a tissue in which the target protein has been expressed and isolating the target protein from the tissue.
Definitions
"Matrix attachment region" (MARs) are non coding DNA sequences that are thought to mediate the binding of chromatin to the proteinaceous nuclear matrix, thereby creating chromatin domains as topologically isolated units of gene regulation.
The term "heterologous" is used broadly below to indicate that the gene/sequence of nucleotides in question have been introduced into the cells in question (e.g. of a plant or an ancestor thereof) using genetic engineering, i.e. by human intervention. A heterologous gene may replace an endogenous equivalent gene, i.e. one which normally performs the same or a similar function, or the inserted sequence may be additional to the endogenous gene or other sequence. Nucleic acid heterologous to a cell may be non-naturally occurring in cells of that type, variety or species. Thus the heterologous nucleic acid may comprise a coding sequence of, or derived from, a particular type of plant cell or species or variety of plant, placed within the context of a plant cell of a different type or species or variety of plant. A further possibility is for a nucleic acid sequence to be placed within a cell in which it or a homologue is found naturally, but wherein the nucleic acid sequence is linked and/or adjacent to nucleic acid which does not occur naturally within the cell, or cells of that type or species or variety of plant, such as operably linked to one or more regulatory sequences, such as a promoter sequence, for control of expression. "Gene" unless context demands otherwise refers to any nucleic acid encoding genetic information for translation into a peptide, polypeptide or protein.
"Vector" is defined to include, inter alia, any plasmid, cosmid, phage, viral or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication) . The constructs used will be wholly or partially synthetic. In particular they are recombinant in that nucleic acid sequences which are not found together in nature (do not run contiguously) have been ligated or otherwise combined artificially. Unless specified otherwise a vector according to the present invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the genome.
"Binary Vector": as is well known to those skilled in the art, a binary vector system includes (a) border sequences which permit the transfer of a desired nucleotide sequence into a plant cell genome; (b) desired nucleotide sequence itself, which will generally comprise an expression cassette of (i) a plant active promoter, operably linked to (ii) the target sequence and\or enhancer as appropriate. The desired nucleotide sequence is situated between the border sequences and is capable of being inserted into a plant genome under appropriate conditions. The binary vector system will generally require other sequence (derived from A. tumefaciens) to effect the integration. Generally this may be achieved by use of so called "agro-infiltration" which uses Agrobacterium-mediated transient transformation. Briefly, this technique is based on the property of Agrobacterium tumefaciens to transfer a portion of its DNA ("T-DNA") into a host cell where it may become integrated into nuclear DNA. The T-DNA is defined by left and right border sequences which are around 21-23 nucleotides in length. The infiltration may be achieved e.g. by syringe (in leaves) or vacuum (whole plants). In the present invention the border sequences will generally be included around the desired nucleotide sequence (the T-DNA) with the one or more vectors being introduced into the plant material by agro- infiltration.
"Expression cassette" refers to a situation in which a nucleic acid is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial or plant cell.
A "promoter" is a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA) .
"Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
It will be appreciated that where a nucleotide sequence (e.g. a specific MAR, gene, polypeptide, promoter etc.) is referred to or exemplified herein, the invention should not be taken to be limited to use of the recited sequence, but also embraces use of a variants of any of these sequences. A variant sequence will be identical to all or part of the sequence discussed and share the requisite activity, which activity can be confirmed using the methods disclosed or otherwise referred to herein or known to those skilled in the art. Generally speaking, wherever the term is used herein, variants may be (i) naturally occurring homologous variants of the relevant sequence; (ii) artificially generated variants (derivatives) which can be prepared by the skilled person in the light of the present disclosure, for instance by site directed or random mutagenesis, or by direct synthesis. Preferably any variant sequence shares at least about 75%, or 80% identity, most preferably at least about 90%, 95%, 96%, 97%, 98% or 99% identity with that specifically refererred to. Similarity or homology in the case of variants is preferably established via sequence comparisons made using FASTA and FASTP (see Pearson & Lipman, 1988. Methods in Enzymology 183: 63-98). Parameters are preferably set, using the default matrix, as follows: Gapopen (penalty for the first residue in a gap) : -12 for proteins / -16 for DNA; Gapext (penalty for additional residues in a gap) : -2 for proteins / -4 for DNA; KTUP word length: 2 for proteins / 6 for DNA. Homology may also be assessed by use of a probing methodology (Sambrook et al . , 1989). One common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is: Tm = 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex. As an illustration of the above formula, using [Na+] = [0.368] and 50-% formamide, with GC content of 42% and an average probe size of 200 bases, the Tm is 57°C. The Tm of a DNA duplex decreases by 1 - 1.5°C with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42°C.
The invention will now be further described with reference to the following non-limiting Figures and Examples. Other embodiments of the invention will occur to those skilled in the art in the light of these.
The disclosure of all references cited herein, inasmuch as it may be used by those skilled in the art to carry out the invention, is hereby specifically incorporated herein by cross-reference. FIGURES
Figure 1
Schematic representation of the T-DNA region of plant transformation vectors pFAJ3160 and pFAJ3163. Not to scale. UidA: β-glucuronidase coding region; pat : phosphinothricin acetyltransferase coding region; pNOS: nopaline synthase promoter; p35S: cauliflower mosaic virus 35S promoter; tOCS: octopine synthase terminator; tNOS: nopaline synthase terminator; ChilMAR: chicken lysozyme MAR; RB and LB: right and left T-DNA border, respectively.
Figure 2
GUS activity is expressed in units GUS (nmoles 4-methylumbelliferone per min per mg total soluble protein) in first generation transgenic A. thaliana wild-type, sgs2 and sgs3 background transformed with pFAJ3160 and pFAJ3163.
Figure 3
SDS-PAGE analysis of total protein extracts (2μg/lane) from sgs2 mutants transformed with pFAJ3163 (lanes 1 and 2) ; total protein extracts (2μg/lane) from non-transgenic plants (lane 3) ; 500ng bovine serum albumin (lane 4); partially purified β-glucuronidase (lane 5). The position of GUS is indicated by the arrow to the right. The position of molecular weight reference proteins is indicated by arrows to the left. SEQUENCES
Where a DNA sequence is specified, unless context requires otherwise, use of the RNA equivalent, with U substituted for T where it occurs, is encompassed.
Sequence Annex 1 Chicken lysozyme MAR Sequence Annex 2 PFAJ3160 Sequence Annex 3 pFAJ3163
EXAMPLES
Materials and methods
Briefly, a set of transformation vectors was constructed without and with MARs flanking the genes of interest. To quantify transgene expression the β-glucuronidase reporter gene ( uidA) driven by the 35S promoter of Cauliflower Mosaic Virus (p35S) was used. For each plant transformation vector A. thaliana populations consisting of at least 30 primary transformants were obtained. The activity of the β- glucuronidase (GUS) enzyme in leaf extracts was measured and statistically evaluated.
Plant transformation vectors
All plant transformation vectors were constructed using the modular vector system as fully described in Goderis & De Bolle et al . (2002) pFAJ3160 and pFAJ3163 were assembled as previously described in De Bolle & Butaye et al . (2003) (see Sequence Annex).
Mutants sgs2 and sgs3 mutants as described in Elmayan et al . (1998) and Mourrain et al . (2000). Seeds of the mutants were provided by Herve Vaucheret, INRA Versailles.
Plant Transforma tion
All plant transformation vectors were introduced in Agrobacterium tumefaciens GV3101 (pMP90) by electroporation. The A. tumefaciens strains with the binary vectors were used to transform A. thaliana wild-type and mutant plants using the floral dip transformation method as described by Clough & Bent (1998) . Transgenic plants were selected based on resistance against phosphinotricin and further grown as described by De Bolle & Butaye et al . (2003) .
Enzyme Assays
β-Glucuronidase (GUS) activity was measured fluorometrically using 4- methylumbelliferyl glucuronide as a substrate and 4- methylubmelliferon as a standard according to Jefferson (1987) . Total protein was determined by the method of Bradford (1976) using bovine serum albumin as a standard.
SDS-PAGE
Total leaf extracts and GUS standard (Sigma-Aldrich) were separated on a 12.5% SDS-PAGE and visualized by staining with Coomassie brilliant blue R250.
Results
The A element that flanks the chicken lysozyme gene (Phi-Van et al . , 1990; chilMAR) has been shown to reduce transgene expression variability in tobacco (Mlynarova et al . , 1994). To test the effect of chilMAR on transgene expression in A. thaliana plant transformation vectors without and with chilMARs flanking the T-DNA region were constructed, pFAJ3160 and pFAJ3163 respectively (Figurel) .
ChilMAR in ColO
Transformation of wild-type A. thaliana plants with pFAJ3160 yielded an average GUS activity of 320 units (Table 1) . The population of primary transformants consisted of about 80% low GUS expressing primary transformants (< 50 units GUS) and about 20% high GUS expressing primary transformants (>100 units GUS) , a bimodal distribution typical for p35S-driven expression (Elmayan & Vaucheret, 1996; De Bolle & Butaye et al . , 2003; Figure 2A) . To test the influence of chilMARs on transgene expression, wild-type plants were transformed with pFAJ3163. This resulted in a pattern of GUS activity similar to the one obtained with pFAJ3160 (Table 1; Figure 2B) . It was concluded that chilMARs have no significant influence on the level of transgene expression or on the variability of transgene expression in populations of first generation wild-type A. thaliana transformants (De Bolle & Butaye et al . , 2003).
Table 1. GUS activity in first generation transgenic Arabidopsis thaliana wild-type, sgs2 and sgs3 background transformed with pFAJ3160 and pFAJ3163.
GUS activity3 pFAJ3160 (- MAR) PFAJ3163 (+ MAR) Backgrou NoD Mean ± S.E.C Nob Mean ± S.E.C nd ColO 36 320 ± 135 36 186 ± 81 sgs2 36 2280 ± 399 34 11 237 ± 1839 sgs3 33 830 ± 177 30 9994 ± 2006 a GUS activity is expressed in units GUS (nmoles 4-methylumbelliferone per min per mg total soluble protein) . b Number of primary transformants analyzed. °S.E., Standard error.
ChilMAR in sgs2
In a further attempt to elevate and level off transgene expression, A. thaliana sgs2 mutants (Elmayan, et al . , 1998) were used as the recipient for transformation instead of wild-type plants. SGS2 encodes an RNA dependent RNA polymerase, which is presumed to play a key role in RNA silencing of transgenes (Mourrain, et al . 2000) . Using this mutant background for transformation with pFAJ3160, average GUS activity in primary transformants increased almost 8-fold compared to wild-type plants (Table 1) . The increase in average GUS activity at the population level was not due to an increase in activity of the high-expressing individuals but rather to a reduction of the incidence of individuals with low expression. About 80% of the transformants in the wild-type background had a GUS activity below 50 units GUS, whereas all sgs2 transformants had a GUS activity above 180 units GUS (Figure 2C) . Upon transformation of sgs2 mutants with pFAJ3163, chilMARs caused a 5-fold increase in average GUS activity compared to pFAJ3160 in sgs2. Compared to pFAJ3160 in wild-type plants, the chilMARs caused a 40-fold boost of mean GUS activity in sgs2 mutants (Table 1; Figure 2D) .
Some of the sgs2 transformants containing chilMAR-flanked transgenes reached extremely high GUS activity levels, up to 41 000 units GUS. Coomassie blue staining of an SDS-PAGE gel revealed a clear band in the total leaf extracts of extremely high GUS expressing sgs2 mutants (Figure 3, lanes 1 & 2), which is not visible in the total leaf extracts of non-transgenic control plants (Figure 3, lane 3) and which is situated at the same position in the gel as the GUS standard (Figure 3, lane 5) . By densitometric comparison of the intensities of this band to known amounts of bovine serum albumin (BSA; Figure 3, lane 4) we estimate that GUS accumulated to roughly 10% of the total soluble protein in the transgenic sgs2 plants. ChilMAR in sgs3
SGS3 plays a yet unknown key role in the RNA silencing mechanism and shows no similarity with any known or putative protein (Mourrain, et al . , 2000). Using sgs3 mutants for transformation with pFAJ3160, the average GUS activity was increased 2,5 fold in comparison the wild- type background (Table 1, Figure 2E) . Transformation of sgs3 plants with pFAJ3163 yielded a 30-fold increase of the average GUS activity in comparison to wild-type plants transformed with pFAJ3160.
References
Allen, G.C., Spiker, S., Thompson, W.F. (2000). Use of matrix attachment regions (MARs) to minimize transgene silencing. Plant Mol . Biol . 43: 361-376.
Anandalakshmi, R. , Pruss, G.J., Ge, X., Marathe, R. , Mallory, A.C., Smith, T.H., Vance, V.B. (1998) A viral suppressor of gene silencing in plants Proc Na tl Acad Sci U S A, 95, 13079-1384.
Bradford, M.M. (1976) . A rapid and sensitive method for quantification of microgram quantities utilizing the principle of protein-dye binding, Anal . Biochem. 72: 248-254.
Clough, S. J. & Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana . Plant J. 16: 735-43.
Dalmay, T., Hamilton, A., Rudd, S., Angel1, S. and Baulcombe, D.C. (2000) An RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell, 101, 543-553.
Dalmay, T., Horsefield, R. , Braunstein, T.H. and Baulcombe D.C. (2001) SDE3 encodes an RNA helicase required for post-transcriptional gene silencing in Arabidopsis. EMBO J. 20, 2069-2078.
De Bolle, M.F.C., Butaye, K.M.J., Coucke, W.J.W., Goderis, I.J.W.M., Wouters, F.J., van Boxel, N., Broekaert, W.F., Cammue, B.P.A. (2003). Analysis of the influence of promoter elements and a matrix attachment region on the inter-individual variation of transgene expression in populations of Arabidopsis thaliana . Plant Science 165: 169-179. Elmayan, T. & Vaucheret, H. (1996). Expression of single copies of a strongly expressed 35S transgene can be silenced post- transcriptionally. Plant J. 9: 787-797.
Elmayan, T., Balzergue, S., Beon, F., Bourdon, V., Daubremet, J. , Guenet, Y., Mourrain, P., Palauqui, J.-C, Vernhettes, S., Vialle, T., Wostrikoff, K., Vaucheret, H. (1998). Arabidopsis mutants impaired in cosuppression. Plant Cell 10: 1747-1757.
Epinat, J.C., Arnould, S., Chames, P., Rochaix, P., Desfontaines , D., Puzin, 0., Patin, A., Zanghellini, A., Paques, F., Lacroix, E. (2003) . A novel engineered meganuclease induces homologous recombination in yeast and mamalian cells. Nucleic Acids Res . , 31: 2952-2962.
Fagard, M. , Boutet, S., Morel, J.B., Bellini, C. and Vaucheret, H. (2000) AGOl, QDE-2, and RDE-1 are related proteins required for posttranscriptional gene silencing in plants, quelling in fungi, and RNA interference in animals. Proc Natl Acad Sci U S A, 97, 11650-11654.
Glazov, E., Phillips, K., Budziszewski, G.J., Meins, F., Levin, J.Z. (2003) A gene encoding an RNase D exonuclease-like protein is required for post-transcriptional silencing in Arabidopsis . Plant J. 35, 342-349.
Goderis, I.J.W.M., De Bolle, M.F.C., Franςois, I.E.J.A., Wouters, P.F.J., Broekaert, W.F. & Cammue, B.P.A. (2002). A set of modular plant transformation vectors allowing flexible insertion of up to six expression units. Plant Mol . Biol . 50: 17-27. Hajdukiewicz, P., Svab, Z. and Maliga P. 1994. The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol . Biol . 25: 989-994.
Hamilton, A.J. and Baulcombe, D.C. (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science, 286, 950-952.
Holmes-Davis, R., Comai, L. (1998). Nuclear matrix attachment regions and plant gene expression. Trends Plant Sci . 3: 91-97.
Jefferson, R.A. (1987) . Assaying chimeric genes in plants : the GUS gene fusion system, Plant Mol . Biol . Rep. 5: 387-405.
Mlynarova, L., Loonen, A., Heldens, J., Jansen, R.C., Keizer, P.,
Stiekema, W.J., Nap, J.P. (1994). Reduced position effect in mature transgenic plants conferred by the chicken lysozyme matrix-associated region. Plant Cell, 6: 417-426.
Mourrain, P., Beclin, C, Elmayan, T., Feuerbach, F., Godon, C,
Morel, J.-B., Jouette, D. , Lacombe, A.-M., Nikic, S., Picault, N., Remoue, K. , Sanial, M., Vo, T.-A., Vaucheret, H. (2000). Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell, 101: 533-542.
Odell, J.T., Nagy, F. and Chua, N.H. (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature, 313, 810-812.
Outchkourov, N.S., Peters, J., de Jong, J., Rademakers, W. and
Jongsma, M.A. (2003) The promoter-terminator of chrysanthemum rbcSl directs very high expression levels in plants. Planta, 216, 1003- 1012. Phi-Van, L., von Kries, J.P., Ostertag W. & Stratling, W.H. (1990). The chicken lysozyme 5' matrix attachment region increases transcription from a heterologous promoter in heterologous cells and dampens position effects on the expression of transfected genes. Mol . Cell Biol . 10: 2302-2307.
Verdaguer, B., de Kochko, A., Beachy, R.N., Fauquet, C. (1996). Isolation and expression in transgenic tobacco and rice plants, of the cassava vein mosaic virus (CVMV) promoter. Plant Mol . Biol . 31, 1129-1139.
Weigel, D., Ahn, J.H., Blazquez, M.A., Borevitz, J.O., Christensen, S.K., Fankhauser, C, Ferrandiz, C, Kardailsky, I., Malancharuvil, E.J., Neff, M.M., Nguyen, J.T., Sato, S., Wang, Z.Y., Xia, Y., Dixon, R.A., Harrison, M.J., Lamb, C.J., Yanofsky, M.F., Chory, J. (2000). Activation tagging in Arabidopsis. Plant Physiol . 122:1003-1013.
Wesley, S.V., Helliwell, C.A., Smith, N.A., Wang, M.B., Rouse, D.T., Liu, Q., Gooding, P.S., Singh, S.P., Abbott, D., Stoutjesdijk, P.A., Robinson, S.P., Gleave, A. P., Green, A.G., Waterhouse, P.M. (2001) Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J. 27, 581-590.
Sequence Annex 1: Chicken lysozyme MAR
aaaccaatatatttccaaatgaaaaaaaaatctgataaaaagttgactttaaaaaaggtatcaataaat gtatgcatttctcactagccttaaactctgcatgaagtgtttgatgagcagatgaagacaacatcattt ctagtttcagaaataataacagcatcaaaaccgcagctgtaactccactgagctcacgttaagttttga tgtgtgaatatctgacagaactgacataatgagcactgcaaggatatcagacaagtcaaaatgaagaca gacaaaagtattttttaatataaaaatggtctttatttcttcaatacaaggtaaactactattgcagtt taagaccaacacaaaagttggacagcaaattgcttaacagtctcctaaaggctgaaaaaaaggaaccca tgaaagctaaaagttatgcagtatttcaagtataacatctaaaaatgatgaaacgatccctaaaggtag agattaactaagtacttctgctgaaaatgtattaaaatccgcagttgctaggataccatcttaccttgt tgagaaatacaggtctccggcaacgcaacattcagcagactctttggcctgctggaatcaggaaactgc ttactatatacacatataaatcctttggagttgggcattctgagagacatccatttcctgacattttgc agtgcaactctgcattccaactcagacaagctcccatgctgtatttcaaagccatttcttgaatagttt acccagacatccttgtgcaaattgggaatgaggaaatgcaatggtacaggaagacaatacagccttatg tttagaaagtcagcagcgctggtaatcttcataaaaatgtaactgttttccaaataggaatgtatttca cttgtaaaacacctggtcctttttatattacttttttttttttttaaggacacctgcactaatttgcaa tcacttgtatttataaaagcacacgcactcctcattttcttacatttgaagatcagcagaatgtctctt tcataatgtaataatcatatgcacagtttaaaatattttctattacaaaatacagtacacaagagggtg aggccaaagtctattacttgaatatattccaaagtgtcagcactgggggtgtaaaattacattacatgg tatgaataggcggaattcttttacaactgaaatgctcgatttcattgggatcaaaggtaagtactgttt actatcttcaagagacttcaatcaagtcggtgtatttccaaagaagcttaaaagattgaagcacagaca caggccacaccagagcctacacctgctgcaataagtggtgctatagaaaggattcaggaactaacaagt gcataatttacaaatagagatgctttatcatactttgcccaacatgggaaaaaagacatcccatgagaa tatccaactgaggaacttctctgtttcatagtaactcatctactactgctaagatggtttgaaaagtac ccagcaggtgagatatgttcgggaggtggctgtgtggcagcgtgtcccaacacgacacaaagcacccca cccctatctgcaatgctcactgcaaggcagtgccgtaaacagctgcaacaggcatcacttctgcataaa tgctgtgactcgttagcatgctgcaactgtgtttaaaacctatgcactccgttaccaaaataatttaag tcccaaataaatccatgcagcttgcttcctatgccaacatattttagaaagtattcattcttctttaag aatatgcacgtggatctacacttcctgggatctgaagcgatttatacctcagttgcagaagcagtttag tgtcctggatctgggaaggcagcagcaaacgtgcccgttttacatttgaacccatgtgacaacccgcct tactgagcatcgctctaggaaatttaaggctgtatccttacaacacaagaaccaacgacagactgcata taaaattctataaataaaaataggagtgaagtctgtttgacctgtacacacagagcatagagataaaaa aaaaaggaaatcaggaattacgtatttctataaatgccatatatttttactagaaacacagatgacaag tatatacaacatgtaaatccgaagttatcaacatgttaactaggaaaacatttacaagcatttgggtat gcaactagatcatcaggtaaaaaatcccattagaaaaatctaagcctcgccagtttcaaaggaaaaaaa ccagagaacgctcactacttcaaaggaaaaaaaataaagcatcaagctggcctaaacttaataaggtat ctcatgtaacaacagctatccaagctttcaagccacactataaataaaaacctcaagttccgatcaacg ttttccataatgcaatcagaaccaaaggcattggcacagaaagcaaaaagggaatgaaagaaaagggct gtacagtttccaaaaggttcttcttttgaagaaatgtttctgacctgtcaaaacatacagtccagtaga aattttactaagaaaaaagaacaccttacttaaaaaaaaaaaacaacaaaaaaaacaggcaaaaaaacc tctcctgtcactgagctgccaccacccaaccaccacctgctgtgggctttgtctcccaagacaaaggac acacagccttatccaatattcaacattacttataaaaacgctgatcagaagaaataccaagtatttcct cagagactgttatatcctttcatcggcaacaagagatgaaatacaacagagtgaatatcaaagaaggcg gcaggagccaccgtggcaccatcaccgggcagtgcagtgcccaactgccgttttctgagcacgcatagg aagccgtcagtcacatgtaataaaccaaaacctggtacagttatattat
Sequence Annex 2: VpFAJ3160: 11169 bp
agtactttgatccaacccctccgctgctatagtgcagtcggcttctgacgttcagtgcagccgtcttct gaaaacgacatgtcgcacaagtcctaagttacgcgacaggctgccgccctgcccttttcctggcgtttt cttgtcgcgtgttttagtcgcataaagtagaatacttgcgactagaaccggagacattacgccatgaac aagagcgccgccgctggcctgctgggctatgcccgcgtcagcaccgacgaccaggacttgaccaaccaa cgggccgaactgcacgcggccggctgcaccaagctgttttccgagaagatcaccggcaccaggcgcgac cgcccggagctggccaggatgcttgaccacctacgccctggcgacgttgtgacagtgaccaggctagac cgcctggcccgcagcacccgcgacctactggacattgccgagcgcatccaggaggccggcgcgggcctg cgtagcctggcagagccgtgggccgacaccaccacgccggccggccgcatggtgttgaccgtgttcgcc ggcattgccgagttcgagcgttccctaatcatcgaccgcacccggagcgggcgcgaggccgccaaggcc cgaggcgtgaagtttggcccccgccctaccctcaccccggcacagatcgcgcacgcccgcgagctgatc gaccaggaaggccgcaccgtgaaagaggcggctgcactgcttggcgtgcatcgctcgaccctgtaccgc gcacttgagcgcagcgaggaagtgacgcccaccgaggccaggcggcgcggtgccttccgtgaggacgca ttgaccgaggccgacgccctggcggccgccgagaatgaacgccaagaggaacaagcatgaaaccgcacc aggacggccaggacgaaccgtttttcattaccgaagagatcgaggcggagatgatcgcggccgggtacg tgttcgagccgcccgcgcacgtctcaaccgtgcggctgcatgaaatcctggccggtttgtctgatgcca agctggcggcctggccggccagcttggccgctgaagaaaccgagcgccgccgtctaaaaaggtgatgtg tatttgagtaaaacagcttgcgtcatgcggtcgctgcgtatatgatgcgatgagtaaataaacaaatac gcaaggggaacgcatgaaggttatcgctgtacttaaccagaaaggcgggtcaggcaagacgaccatcgc aacccatctagcccgcgccctgcaactcgccggggccgatgttctgttagtcgattccgatccccaggg cagtgcccgcgattgggcggccgtgcgggaagatcaaccgctaaccgttgtcggcatcgaccgcccgac gattgaccgcgacgtgaaggccatcggccggcgcgacttcgtagtgatcgacggagcgccccaggcggc ggacttggctgtgtccgcgatcaaggcagccgacttcgtgctgattccggtgcagccaagcccttacga catatgggccaccgccgacctggtggagctggttaagcagcgcattgaggtcacggatggaaggctaca agcggcctttgtcgtgtcgcgggcgatcaaaggcacgcgcatcggcggtgaggttgccgaggcgctggc cgggtacgagctgcccattcttgagtcccgtatcacgcagcgcgtgagctacccaggcactgccgccgc cggcacaaccgttcttgaatcagaacccgagggcgacgctgcccgcgaggtccaggcgctggccgctga aattaaatcaaaactcatttgagttaatgaggtaaagagaaaatgagcaaaagcacaaacacgctaagt gccggccgtccgagcgcacgcagcagcaaggctgcaacgttggccagcctggcagacacgccagccatg aagcgggtcaactttcagttgccggcggaggatcacaccaagctgaagatgtacgcggtacgccaaggc aagaccattaccgagctgctatctgaatacatcgcgcagctaccagagtaaatgagcaaatgaataaat gagtagatgaattttagcggctaaaggaggcggcatggaaaatcaagaacaaccaggcaccgacgccgt ggaatgccccatgtgtggaggaacgggcggttggccaggcgtaagcggctgggttgtctgccggccctg caatggcactggaacccccaagcccgaggaatcggcgtgacggtcgcaaaccatccggcccggtacaaa tcggcgcggcgctgggtgatgacctggtggagaagttgaaggccgcgcaggccgcccagcggcaacgca tcgaggcagaagcacgccccggtgaatcgtggcaagcggccgctgatcgaatccgcaaagaatcccggc aaccgccggcagccggtgcgccgtcgattaggaagccgcccaagggcgacgagcaaccagattttttcg ttccgatgctctatgacgtgggcacccgcgatagtcgcagcatcatggacgtggccgttttccgtctgt cgaagcgtgaccgacgagctggcgaggtgatccgctacgagcttccagacgggcacgtagaggtttccg cagggccggccggcatggccagtgtgtgggattacgacctggtactgatggcggtttcccatctaaccg aatccatgaaccgataccgggaagggaagggagacaagcccggccgcgtgttccgtccacacgttgcgg acgtactcaagttctgccggcgagccgatggcggaaagcagaaagacgacctggtagaaacctgcattc ggttaaacaccacgcacgttgccatgcagcgtacgaagaaggccaagaacggccgcctggtgacggtat ccgagggtgaagccttgattagccgctacaagatcgtaaagagcgaaaccgggcggccggagtacatcg agatcgagctagctgattggatgtaccgcgagatcacagaaggcaagaacccggacgtgctgacggttc accccgattactttttgatcgatcccggcatcggccgttttctctaccgcctggcacgccgcgccgcag gcaaggcagaagccagatggttgttcaagacgatctacgaacgcagtggcagcgccggagagttcaaga agttctgtttcaccgtgcgcaagctgatcgggtcaaatgacctgccggagtacgatttgaaggaggagg cggggcaggctggcccgatcctagtcatgcgctaccgcaacctgatcgagggcgaagcatccgccggtt cctaatgtacggagcagatgctagggcaaattgccctagcaggggaaaaaggtcgaaaaggtctctttc ctgtggatagcacgtacattgggaacccaaagccgtacattgggaaccggaacccgtacattgggaacc caaagccgtacattgggaaccggtcacacatgtaagtgactgatataaaagagaaaaaaggcgattttt ccgcctaaaactctttaaaacttattaaaactcttaaaacccgcctggcctgtgcataactgtctggcc agcgcacagccgaagagctgcaaaaagcgcctacccttcggtcgctgcgctccctacgccccgccgctt cgcgtcggcctatcgcggccgctggccgctcaaaaatggctggcctacggccaggcaatctaccagggc gcggacaagccgcgccgtcgccactcgaccgccggcgcccacatcaaggcaccctgcctcgcgcgtttc ggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggat gccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggcgcagccatgacc cagtcacgtagcgatagcggagtgtatactggcttaactatgcggcatcagagcagattgtactgagag tgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctcttccg cttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaagg cggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaa aggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatc acaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttcccc ctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcc cttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgct ccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtc ttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagag cgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacag tatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggca aacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggat ctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaaggga ttttggtcatgcatgatatatctcccaatttgtgtagggcttattatgcacgcttaaaaataataaaag cagacttgacctgatagtttggctgtgagcaattatgtgcttagtgcatctaatcgcttgagttaacgc cggcgaagcggcgtcggcttgaacgaatttctagctagacattatttgccgactaccttggtgatctcg cctttcacgtagtggacaaattcttccaactgatctgcgcgcgaggccaagcgatcttcttcttgtcca agataagcctgtctagcttcaagtatgacgggctgatactgggccggcaggcgctccattgcccagtcg gcagcgacatccttcggcgcgattttgccggttactgcgctgtaccaaatgcgggacaacgtaagcact acatttcgctcatcgccagcccagtcgggcggcgagttccatagcgttaaggtttcatttagcgcctca aatagatcctgttcaggaaccggatcaaagagttcctccgccgctggacctaccaaggcaacgctatgt tctcttgcttttgtcagcaagatagccagatcaatgtcgatcgtggctggctcgaagatacctgcaaga atgtcattgcgctgccattctccaaattgcagttcgcgcttagctggataacgccacggaatgatgtcg tcgtgcacaacaatggtgacttctacagcgcggagaatctcgctctctccaggggaagccgaagtttcc aaaaggtcgttgatcaaagctcgccgcgttgtttcatcaagccttacggtcaccgtaaccagcaaatca atatcactgtgtggcttcaggccgccatccactgcggagccgtacaaatgtacggccagcaacgtcggt tcgagatggcgctcgatgacgccaactacctctgatagttgagtcgatacttcggcgatcaccgcttcc cccatgatgtttaactttgttttagggcgactgccctgctgcgtaacatcgttgctgctccataacatc aaacatcgacccacggcgtaacgcgcttgctgcttggatgcccgaggcatagactgtaccccaaaaaaa catgtcataacaagaagccatgaaaaccgccactgcgccgttaccaccgctgcgttcggtcaaggttct ggaccagttgcgtgacggcagttacgctacttgcattacagcttacgaaccgaacgaggcttatgtcca ctgggttcgtgcccgaattgatcacaggcagcaacgctctgtcatcgttacaatcaacatgctaccctc cgcgagatcatccgtgtttcaaacccggcagcttagttgccgttcttccgaatagcatcggtaacatga gcaaagtctgccgccttacaacggctctcccgctgacgccgtcccggactgatgggctgcctgtatcga gtggtgattttgtgccgagctgccggtcggggagctgttggctggctggtggcaggatatattgtggtg taaacaaattgacgcttagacaacttaataacacattgcggacgtttttaatgtactgaattaacgccg aattgaattcaggcctgtcgacgcccgggcggtaccgcgatcgctcgcgacctgcaggcataaagccgt cagtgtccgcataaagaaccacccataatacccataatagctgtttgccatcgctaccttaggaccgtt atagttaaccggtgaattcccgatctagtaacatagatgacaccgcgcgcgataatttatcctagtttg cgcgctatattttgttttctatcgcgtattaaatgtataattgcgggactctaatcataaaaacccatc tcataaataacgtcatgcattacatgttaattattacatgcttaacgtaattcaacagaaattatatga taatcatcgcaagaccggcaacaggattcaatcttaagaaactttattgccaaatgtttgaacgatcgg ccggccgagctcggtagcaattcccgaggctgtagccgacgatggtgccaccaggagagttgttgattc attgtttgcctccctgctgcggtttttcaccgaagttcatgccagtccagcgtttttgcagcagaaaag ccgccgacttcggtttgcggtcgcgagtgaagatccctttcttgttaccgccaacgcgcaatatgcctt gcgaggtcgcaaaatcggcgaaattccatacctgttcaccgacgacggcgctgacgcgatcaaagacgc ggtgatacatatccagccatgcacactgatactcttcactccacatgtcggtgtacattgagtgcagcc cggctaacgtatccacgccgtattcggtgatgataatcggctgatgcagtttctcctgccaggccagaa gttctttttccagtaccttctctgccgtttccaaatcgccgctttggacataccatccgtaataacggt tcaggcacagcacatcaaagagatcgctgatggtatcggtgtgagcgtcgcagaacattacattgacgc aggtgatcggacgcgtcgggtcgagtttacgcgttgcttccgccagtggcgcgaaatattcccgtgcac cttgcggacgggtatccggttcgttggcaatactccacatcaccacgcttgggtggtttttgtcacgcg ctatcagctctttaatcgcctgtaagtgcgcttgctgagtttccccgttgactgcctcttcgctgtaca gttctttcggcttgttgcccgcttcgaaaccaatgcctaaagagaggttaaagccgacagcagcagttt catcaatcaccacgatgccatgttcatctgcccagtcgagcatctcttcagcgtaagggtaatgcgagg tacggtaggagttggccccaatccagtccattaatgcgtggtcgtgcaccatcagcacgttatcgaatc ctttgccacgcaagtccgcatcttcatgacgaccaaagccagtaaagtagaacggtttgtggttaatca ggaactgttcgcccttcactgccactgaccggatgccgacgcgaagcgggtagatatcacactctgtct ggcttttggctgtgacgcacagttcatagagataaccttcacccggttgccagaggtgcggattcaeca cttgcaaagtcccgctagtgccttgtccagttgcaaccacctgttgatccgcatcacgcagttcaacgc tgacatcaccattggccaccacctgccagtcaacagacgcgtggttacagtcttgcgcgacatgcgtca ccacggtgatatcgtccacccaggtgttcggcgtggtgtagagcattacgctgcgatggattccggcat agttaaagaaatcatggaagtaagactgctttttcttgccgttttcgtcggtaatcaccattcccggcg ggatagtctgccagttcagttcgttgttcacacaaacggtgatacgtacacttttcccggcaataacat acggcgtgacatcggcttcaaatggcgtatagccgccctgatgctccatcacttcctgattattgaccc acactttgccgtaatgagtgaccgcatcgaaacgcagcacgatacgctggcctgcccaacctttcggta taaagacttcgcgctgataccagacgttgcccgcataattacgaatatctgcatcggcgaactgatcgt taaaactgcctggcacagcaattgcccggctttcttgtaacgcgctttcccaccaacgctgatcaattc cacagttttcgcgatccagactgaatgcccacaggccgtcgagttttttgatttcacgggttggggttt ctacaggacgtaacataagggactgacctacccggggatcctctagagccatggtgtttaaacgttaac tgtaattgtaaatagtaattgtaatgttgtttgttgtttgttgttgttggtaattgttgtaaaaatact cgaggtcctctccaaatgaaatgaacttccttatatagaggaagggtcttgcgaaggatagtgggattg tgcgtcatcccttacgtcagtggagatatcacatcaatccacttgctttgaagacgtggttggaacgtc ttcttttttccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcggcagaggcatctt caacgatggcctttcctttatcgcaatgatggcatttgtaggagccaccttccttttccactatcttca caataaagtgacagatagctgggcaatggaatccgaggaggtttccggatattaccctttgttgaaaag tctcaattgccctttggtcttctgagactgtatctttgatatttttggagtagacaagtgtgtcgtgct ccaccatgttatcacatcaatccacttgctttgaagacgtggttggaacgtcttcttttttccacgatg ctcctcgtgggtgggggtccatctttgggaccactgtcggcagaggcatcttcaacgatggcctttcct ttatcgcaatgatggcatttgtaggagccaccttccttttccactatcttcacaataaagtgacagata gctgggcaatggaatccgaggaggtttccggatattaccctttgttgaaaagtctcaattgccctttgg tcttctgagactgtatctttgatatttttggagtagacaagtgtgtcgtgctccaccatgttcaagctt gcggccgctcgctaccttaggaccgttatagttaattaccctgttatccctattaattaagagctcgct accttaagagaggatatcggcgcgccgaattcgcgctctatcatagatgtcgctataaacctattcagc acaatatattgttttcattttaatattgtacatataagtagtagggtacaatcagtaaattgaacggag aatattattcataaaaatacgatagtaacgggtgatatattcattagaatgaaccgaaaccggcggtaa ggatctgagctacacatgctcaggttttttacaacgtgcacaacagaattgaaagcaaatatcatgcga tcataggcgtctcgcatatctcattaaagcagctggaagatttgatggatcctcatcagatctcggtga cgggcaggaccggacggggcggtaccggcaggctgaagtccagctgccagaaacccacgtcatgccagt tcccgtgcttgaagccggccgcccgcagcatgccgcggggggcatatccgagcgcctcgtgcatgcgca cgctcgggtcgttgggcagcccgatgacagcgaccacgctcttgaagccctgtgcctccagggacttca gcaggtgggtgtagagcgtggagcccagtcccgtccgctggtggcggggggagacgtacacggtcgact cggccgtccagtcgtaggcgttgcgtgccttccaggggcccgcgtaggcgatgccggcgacctcgccgt ccacctcggcgacgagccagggatagcgctcccgcagacggacgaggtcgtccgtccactcctgcggtt cctgcggctcggtacggaagttgaccgtgcttgtctcgatgtagtggttgacgatggtgcagaccgccg gcatgtccgcctcggtggcacggcggatgtcggccgggcgtcgttctgggctcatggtagatctgttta aacgttaacggattgagagtgaatatgagactctaattggataccgaggggaatttatggaacgtcagt ggagcatttttgacaagaaatatttgctagctgatagtgaccttaggcgacttttgaacgcgcaataat ggtttctgacgtatgtgcttagctcattaaactccagaaacccgcggctgagtggctccttcaatcgtt gcggttctgtcagttccaaacgtaaaacggcttgtcccgcgtcatcggcgggggtcataacgtgactcc cttaattctccgctcatgatcaagcttggcgcgcctctagaatttaaatggatcctacgtactcgagaa gcttagcttgagcttggatcagattgtcgtttcccgccttcagtttaaactatcagtgtttgacaggat atattggcgggtaaacctaagagaaaagagcgtttattagaataacggatatttaaaagggcgtgaaaa ggtttatccgttcgtccatttgtatgtgcatgccaaccacagggttcccctcgggatcaa Sequence Annex 3: VpFAJ3163: 17062 bp .
atttgtatgtgcatgccaaccacagggttcccctcgggatcaaagtactttgatccaacccctccgctg ctatagtgcagtcggcttctgacgttcagtgcagccgtcttctgaaaacgacatgtcgcacaagtccta agttacgcgacaggctgccgccctgcccttttcctggcgttttcttgtcgcgtgttttagtcgcataaa gtagaatacttgcgactagaaccggagacattacgccatgaacaagagcgccgccgctggcctgctggg ctatgcccgcgtcagcaccgacgaccaggacttgaccaaccaacgggccgaactgcacgcggccggctg caccaagctgttttccgagaagatcaccggcaccaggcgcgaccgcccggagctggccaggatgcttga ccacctacgccctggcgacgttgtgacagtgaccaggctagaccgcctggcccgcagcacccgcgacct actggacattgccgagcgcatccaggaggccggcgcgggcctgcgtagcctggcagagccgtgggccga caccaccacgccggccggccgcatggtgttgaccgtgttcgccggcattgccgagttcgagcgttccct aatcatcgaccgcacccggagcgggcgcgaggccgccaaggcccgaggcgtgaagtttggcccccgccc taccctcaccccggcacagatcgcgcacgcccgcgagctgatcgaccaggaaggccgcaccgtgaaaga ggcggctgcactgcttggcgtgcatcgctcgaccctgtaccgcgcacttgagcgcagcgaggaagtgac gcccaccgaggccaggcggcgcggtgccttccgtgaggacgcattgaccgaggccgacgccctggcggc cgccgagaatgaacgccaagaggaacaagcatgaaaccgcaccaggacggccaggacgaaccgtttttc attaccgaagagatcgaggcggagatgatcgcggccgggtacgtgttcgagccgcccgcgcacgtctca accgtgcggctgcatgaaatcctggccggtttgtctgatgccaagctggcggcctggccggccagcttg gccgctgaagaaaccgagcgccgccgtctaaaaaggtgatgtgtatttgagtaaaacagcttgcgtcat gcggtcgctgcgtatatgatgcgatgagtaaataaacaaatacgcaaggggaacgcatgaaggttatcg ctgtacttaaccagaaaggcgggtcaggcaagacgaccatcgcaacccatctagcccgcgccctgcaac tcgccggggccgatgttctgttagtcgattccgatccccagggcagtgcccgcgattgggcggccgtgc gggaagatcaaccgctaaccgttgtcggcatcgaccgcccgacgattgaccgcgacgtgaaggccatcg gccggcgcgacttcgtagtgatcgacggagcgccccaggcggcggacttggctgtgtccgcgatcaagg cagccgacttcgtgctgattccggtgcagccaagcccttacgacatatgggccaccgccgacctggtgg agctggttaagcagcgcattgaggtcacggatggaaggctacaagcggcctttgtcgtgtcgcgggcga tcaaaggcacgcgcatcggcggtgaggttgccgaggcgctggccgggtacgagctgcccattcttgagt cccgtatcacgcagcgcgtgagctacccaggcactgccgccgccggcacaaccgttcttgaatcagaac ccgagggcgacgctgcccgcgaggtccaggcgctggccgctgaaattaaatcaaaactcatttgagtta atgaggtaaagagaaaatgagcaaaagcacaaacacgctaagtgccggccgtccgagcgcacgcagcag caaggctgcaacgttggccagcctggcagacacgccagccatgaagcgggtcaactttcagttgccggc ggaggatcacaccaagctgaagatgtacgcggtacgccaaggcaagaccattaccgagctgctatctga atacatcgcgcagctaccagagtaaatgagcaaatgaataaatgagtagatgaattttagcggctaaag gaggcggcatggaaaatcaagaacaaccaggcaccgacgccgtggaatgccccatgtgtggaggaacgg gcggttggccaggcgtaagcggctgggttgtctgccggccctgcaatggcactggaacccccaagcccg aggaatcggcgtgacggtcgcaaaccatccggcccggtacaaatcggcgcggcgctgggtgatgacctg gtggagaagttgaaggccgcgcaggccgcccagcggcaacgcatcgaggcagaagcacgccccggtgaa tcgtggcaagcggccgctgatcgaatccgcaaagaatcccggcaaccgccggcagccggtgcgccgtcg attaggaagccgcccaagggcgacgagcaaccagattttttcgttccgatgctctatgacgtgggcacc cgcgatagtcgcagcatcatggacgtggccgttttccgtctgtcgaagcgtgaccgacgagctggcgag gtgatccgctacgagcttccagacgggcacgtagaggtttccgcagggccggccggcatggccagtgtg tgggattacgacctggtactgatggcggtttcccatctaaccgaatccatgaaccgataccgggaaggg aagggagacaagcccggccgcgtgttccgtccacacgttgcggacgtactcaagttctgccggcgagcc gatggcggaaagcagaaagacgacctggtagaaacctgcattcggttaaacaccacgcacgttgccatg cagcgtacgaagaaggccaagaacggccgcctggtgacggtatccgagggtgaagccttgattagccgc tacaagatcgtaaagagcgaaaccgggcggccggagtacatcgagatcgagctagctgattggatgtac cgcgagatcacagaaggcaagaacccggacgtgctgacggttcaccccgattactttttgatcgatccc ggcatcggccgttttctctaccgcctggcacgccgcgccgcaggcaaggcagaagccagatggttgttc aagacgatctacgaacgcagtggcagcgccggagagttcaagaagttctgtttcaccgtgcgcaagctg atcgggtcaaatgacctgccggagtacgatttgaaggaggaggcggggcaggctggcccgatcctagtc atgcgctaccgcaacctgatcgagggcgaagcatccgccggttcctaatgtacggagcagatgctaggg caaattgccctagcaggggaaaaaggtcgaaaaggtctctttcctgtggatagcacgtacattgggaac ccaaagccgtacattgggaaccggaacccgtacattgggaacccaaagccgtacattgggaaccggtca cacatgtaagtgactgatataaaagagaaaaaaggcgatttttccgcctaaaactctttaaaacttatt aaaactcttaaaacccgcctggcctgtgcataactgtctggccagcgcacagccgaagagctgcaaaaa gcgcctacccttcggtcgctgcgctccctacgccccgccgcttcgcgtcggcctatcgcggccgctggc cgctcaaaaatggctggcctacggccaggcaatctaccagggcgcggacaagccgcgccgtcgccactc gaccgccggcgcccacatcaaggcaccctgcctcgcgcgtttcggtgatgacggtgaaaacctctgaca catgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcaggg cgcgtcagcgggtgttggcgggtgtcggggcgcagccatgacccagtcacgtagcgatagcggagtgta tactggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccg cacagatgcgtaaggagaaaataccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgc tcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatca ggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcg ttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagagg tggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcct gttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcat agctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccc cccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgac ttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagag ttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaag ccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggt ttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttct acggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgcatgatatatctccc aatttgtgtagggcttattatgcacgcttaaaaataataaaagcagacttgacctgatagtttggctgt gagcaattatgtgcttagtgcatctaatcgcttgagttaacgccggcgaagcggcgtcggcttgaacga atttctagctagacattatttgccgactaccttggtgatctcgcctttcacgtagtggacaaattcttc caactgatctgcgcgcgaggccaagcgatcttcttcttgtccaagataagcctgtctagcttcaagtat gacgggctgatactgggccggcaggcgctccattgcccagtcggcagcgacatccttcggcgcgatttt gccggttactgcgctgtaccaaatgcgggacaacgtaagcactacatttcgctcatcgccagcccagtc gggcggcgagttccatagcgttaaggtttcatttagcgcctcaaatagatcctgttcaggaaccggatc aaagagttcctccgccgctggacctaccaaggcaacgctatgttctcttgcttttgtcagcaagatagc cagatcaatgtcgatcgtggctggctcgaagatacctgcaagaatgtcattgcgctgccattctccaaa ttgcagttcgcgcttagctggataacgccacggaatgatgtcgtcgtgcacaacaatggtgacttctac agcgcggagaatctcgctctctccaggggaagccgaagtttccaaaaggtcgttgatcaaagctcgccg cgttgtttcatcaagccttacggtcaccgtaaccagcaaatcaatatcactgtgtggcttcaggccgcc atccactgcggagccgtacaaatgtacggccagcaacgtcggttcgagatggcgctcgatgacgccaac tacctctgatagttgagtcgatacttcggcgatcaccgcttcccccatgatgtttaactttgttttagg gcgactgccctgctgcgtaacatcgttgctgctccataacatcaaacatcgacccacggcgtaacgcgc ttgctgcttggatgcccgaggcatagactgtaccccaaaaaaacatgtcataacaagaagccatgaaaa ccgccactgcgccgttaccaccgctgcgttcggtcaaggttctggaccagttgcgtgacggcagttacg ctacttgcattacagcttacgaaccgaacgaggcttatgtccactgggttcgtgcccgaattgatcaca ggcagcaacgctctgtcatcgttacaatcaacatgctaccctccgcgagatcatccgtgtttcaaaccc ggcagcttagttgccgttcttccgaatagcatcggtaacatgagcaaagtctgccgccttacaacggct ctcccgctgacgccgtcccggactgatgggctgcctgtatcgagtggtgattttgtgccgagctgccgg tcggggagctgttggctggctggtggcaggatatattgtggtgtaaacaaattgacgcttagacaactt aataacacattgcggacgtttttaatgtactgaattaacgccgaattgaattcaggcctgtcgactcta gaaaaccaatatatttccaaatgaaaaaaaaatctgataaaaagttgactttaaaaaaggtatcaataa atgtatgcatttctcactagccttaaactctgcatgaagtgtttgatgagcagatgaagacaacatcat ttctagtttcagaaataataacagcatcaaaaccgcagctgtaactccactgagctcacgttaagtttt gatgtgtgaatatctgacagaactgacataatgagcactgcaaggatatcagacaagtcaaaatgaaga cagacaaaagtattttttaatataaaaatggtctttatttcttcaatacaaggtaaactactattgcag tttaagaccaacacaaaagttggacagcaaattgcttaacagtctcctaaaggctgaaaaaaaggaacc catgaaagctaaaagttatgcagtatttcaagtataacatctaaaaatgatgaaacgatccctaaaggt agagattaactaagtacttctgctgaaaatgtattaaaatccgcagttgctaggataccatcttacctt gttgagaaatacaggtctccggcaacgcaacattcagcagactctttggcctgctggaatcaggaaact gcttactatatacacatataaatcctttggagttgggcattctgagagacatccatttcctgacatttt gcagtgcaactctgcattccaactcagacaagctcccatgctgtatttcaaagccatttcttgaatagt ttacccagacatccttgtgcaaattgggaatgaggaaatgcaatggtacaggaagacaatacagcctta tgtttagaaagtcagcagcgctggtaatcttcataaaaatgtaactgttttccaaataggaatgtattt cacttgtaaaacacctggtcctttttatattacttttttttttttttaaggacacctgcactaatttgc aatcacttgtatttataaaagcacacgcactcctcattttcttacatttgaagatcagcagaatgtctc tttcataatgtaataatcatatgcacagtttaaaatattttctattacaaaatacagtacacaagaggg tgaggccaaagtctattacttgaatatattccaaagtgtcagcactgggggtgtaaaattacattacat ggtatgaataggcggaattcttttacaactgaaatgctcgatttcattgggatcaaaggtaagtactgt ttactatcttcaagagacttcaatcaagtcggtgtatttccaaagaagcttaaaagattgaagcacaga cacaggccacaccagagcctacacctgctgcaataagtggtgctatagaaaggattcaggaactaacaa gtgcataatttacaaatagagatgctttatcatactttgcccaacatgggaaaaaagacatcccatgag aatatccaactgaggaacttctctgtttcatagtaactcatctactactgctaagatggtttgaaaagt acccagcaggtgagatatgttcgggaggtggctgtgtggcagcgtgtcccaacacgacacaaagcaccc cacccctatctgcaatgctcactgcaaggcagtgccgtaaacagctgcaacaggcatcacttctgcata aatgctgtgactcgttagcatgctgcaactgtgtttaaaacctatgcactccgttaccaaaataattta agtcccaaataaatccatgcagcttgcttcctatgccaacatattttagaaagtattcattcttcttta agaatatgcacgtggatctacacttcctgggatctgaagcgatttatacctcagttgcagaagcagttt agtgtcctggatctgggaaggcagcagcaaacgtgcccgttttacatttgaacccatgtgacaacccgc cttactgagcatcgctctaggaaatttaaggctgtatccttacaacacaagaaccaacgacagactgca tataaaattctataaataaaaataggagtgaagtctgtttgacctgtacacacagagcatagagataaa aaaaaaaggaaatcaggaattacgtatttctataaatgccatatatttttactagaaacacagatgaca agtatatacaacatgtaaatccgaagttatcaacatgttaactaggaaaacatttacaagcatttgggt atgcaactagatca caggtaaaaaatcccattagaaaaatctaagcctcgccagtttcaaaggaaaaa aaccagagaacgctcactacttcaaaggaaaaaaaataaagcatcaagctggcctaaacttaataaggt atctcatgtaacaacagctatccaagctttcaagccacactataaataaaaacctcaagttccgatcaa cgttttccataatgcaatcagaaccaaaggcattggcacagaaagcaaaaagggaatgaaagaaaaggg ctgtacagtttccaaaaggttcttcttttgaagaaatgtttctgacctgtcaaaacatacagtccagta gaaattttactaagaaaaaagaacaccttacttaaaaaaaaaaaacaacaaaaaaaacaggcaaaaaaa cctctcctgtcactgagctgccaccacccaaccaccacctgctgtgggctttgtctcccaagacaaagg acacacagccttatccaatattcaacattacttataaaaacgctgatcagaagaaataccaagtatttc ctcagagactgttatatcctttcatcggcaacaagagatgaaatacaacagagtgaatatcaaagaagg cggcaggagccaccgtggcaccatcaccgggcagtgcagtgcccaactgccgttttctgagcacgcata ggaagccgtcagtcacatgtaataaaccaaaacctggtacagttatattatggatccccgggtaccgcg atcgctcgcgacctgcaggcataaagccgtcagtgtccgcataaagaaccacccataatacccataata gctgtttgccatcgctaccttaggaccgttatagttaaccggtgaattcccgatctagtaacatagatg acaccgcgcgcgataatttatcctagtttgcgcgctatattttgttttctatcgcgtattaaatgtata attgcgggactctaatcataaaaacccatctcataaataacgtcatgcattacatgttaattattacat gcttaacgtaattcaacagaaattatatgataatcatcgcaagaccggcaacaggattcaatcttaaga aactttattgccaaatgtttgaacgatcggccggccgagctcggtagcaattcccgaggctgtagccga cgatggtgccaccaggagagttgttgattcattgtttgcctccctgctgcggtttttcaccgaagttca tgccagtccagcgtttttgcagcagaaaagccgccgacttcggtttgcggtcgcgagtgaagatccctt tcttgttaccgccaacgcgcaatatgccttgcgaggtcgcaaaatcggcgaaattccatacctgttcac cgacgacggcgctgacgcgatcaaagacgcggtgatacatatccagccatgcacactgatactcttcac tccacatgtcggtgtacattgagtgcagcccggctaacgtatccacgccgtattcggtgatgataatcg gctgatgcagtttctcctgccaggccagaagttctttttccagtaccttctctgccgtttccaaatcgc cgctttggacataccatccgtaataacggttcaggcacagcacatcaaagagatcgctgatggtatcgg tgtgagcgtcgcagaacattacattgacgcaggtgatcggacgcgtcgggtcgagtttacgcgttgctt ccgccagtggcgcgaaatattcccgtgcaccttgcggacgggtatccggttcgttggcaatactccaca tcaccacgcttgggtggtttttgtcacgcgctatcagctctttaatcgcctgtaagtgcgcttgctgag tttccccgttgactgcctcttcgctgtacagttctttcggcttgttgcccgcttcgaaaccaatgccta aagagaggttaaagccgacagcagcagtttcatcaatcaccacgatgccatgttcatctgcccagtcga gcatctcttcagcgtaagggtaatgcgaggtacggtaggagttggccccaatccagtccattaatgcgt ggtcgtgcaccatcagcacgttatcgaatcctttgccacgcaagtccgcatcttcatgacgaccaaagc cagtaaagtagaacggtttgtggttaatcaggaactgttcgcccttcactgccactgaccggatgccga cgcgaagcgggtagatatcacactctgtctggcttttggctgtgacgcacagttcatagagataacctt cacccggttgccagaggtgcggattcaccacttgcaaagtcccgctagtgccttgtccagttgcaacca cctgttgatccgcatcacgcagttcaacgctgacatcaccattggccaccacctgccagtcaacagacg cgtggttacagtcttgcgcgacatgcgtcaccacggtgatatcgtccacccaggtgttcggcgtggtgt agagcattacgctgcgatggattccggcatagttaaagaaatcatggaagtaagactgctttttcttgc cgttttcgtcggtaatcaccattcccggcgggatagtctgccagttcagttcgttgttcacacaaacgg tgatacgtacacttttcccggcaataacatacggcgtgacatcggcttcaaatggcgtatagccgccct gatgctccatcacttcctgattattgacccacactttgccgtaatgagtgaccgcatcgaaacgcagca cgatacgctggcctgcccaacctttcggtataaagacttcgcgctgataccagacgttgcccgcataat tacgaatatctgcatcggcgaactgatcgttaaaactgcctggcacagcaattgcccggctttcttgta acgcgctttcccaccaacgctgatcaattccacagttttcgcgatccagactgaatgcccacaggccgt cgagttttttgatttcacgggttggggtttctacaggacgtaacataagggactgacctacccggggat cctctagagccatggtgtttaaacgttaactgtaattgtaaatagtaattgtaatgttgtttgttgttt gttgttgttggtaattgttgtaaaaatactcgaggtcctctccaaatgaaatgaacttccttatataga ggaagggtcttgcgaaggatagtgggattgtgcgtcatcccttacgtcagtggagatatcacatcaatc cacttgctttgaagacgtggttggaacgtcttcttttttccacgatgctcctcgtgggtgggggtccat ctttgggaccactgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatgatggcatttgt aggagccaccttccttttccactatcttcacaataaagtgacagatagctgggcaatggaatccgagga ggtttccggatattaccctttgttgaaaagtctcaattgccctttggtcttctgagactgtatctttga tatttttggagtagacaagtgtgtcgtgctccaccatgttatcacatcaatccacttgctttgaagacg tggttggaacgtcttcttttttccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcg gcagaggcatcttcaacgatggcctttcctttatcgcaatgatggcatttgtaggagccaccttccttt tccactatcttcacaataaagtgacagatagctgggcaatggaatccgaggaggtttccggatattacc ctttgttgaaaagtctcaattgccctttggtcttctgagactgtatctttgatatttttggagtagaca agtgtgtcgtgctccaccatgttcaagcttgcggccgctcgctaccttaggaccgttatagttaattac cctgttatccctattaattaagagctcgctaccttaagagagaccggtgaattcgcgctctatcataga tgtcgctataaacctattcagcacaatatattgttttcattttaatattgtacatataagtagtagggt acaatcagtaaattgaacggagaatattattcataaaaatacgatagtaacgggtgatatattcattag aatgaaccgaaaccggcggtaaggatctgagctacacatgctcaggttttttacaacgtgcacaacaga attgaaagcaaatatcatgcgatcataggcgtctcgcatatctcattaaagcagctggaagatttgatg gatcctcatcagatctcggtgacgggcaggaccggacggggcggtaccggcaggctgaagtccagctgc cagaaacccacgtcatgccagttcccgtgcttgaagccggccgcccgcagcatgccgcggggggcatat ccgagcgcctcgtgcatgcgcacgctcgggtcgttgggcagcccgatgacagcgaccacgctcttgaag ccctgtgcctccagggacttcagcaggtgggtgtagagcgtggagcccagtcccgtccgctggtggcgg ggggagacgtacacggtcgactcggccgtccagtcgtaggcgttgcgtgccttccaggggcccgcgtag gcgatgccggcgacctcgccgtccacctcggcgacgagccagggatagcgctcccgcagacggacgagg tcgtccgtccactcctgcggttcctgcggctcggtacggaagttgaccgtgcttgtctcgatgtagtgg ttgacgatggtgcagaccgccggcatgtccgcctcggtggcacggcggatgtcggccgggcgtcgttct gggctcatggtagatctgtttaaacgttaacggattgagagtgaatatgagactctaattggataccga ggggaatttatggaacgtcagtggagcatttttgacaagaaatatttgctagctgatagtgaccttagg cgacttttgaacgcgcaataatggtttctgacgtatgtgcttagctcattaaactccagaaacccgcgg ctgagtggctccttcaatcgttgcggttctgtcagttccaaacgtaaaacggcttgtcccgcgtcatcg gcgggggtcataacgtgactcccttaattctccgctcatgatcaagcttgcggccgcggcgcgcctcta gaaaaccaatatatttccaaatgaaaaaaaaatctgataaaaagttgactttaaaaaaggtatcaataa atgtatgcatttctcactagccttaaactctgcatgaagtgtttgatgagcagatgaagacaacatcat ttctagtttcagaaataataacagcatcaaaaccgcagctgtaactccactgagctcacgttaagtttt gatgtgtgaatatctgacagaactgacataatgagcactgcaaggatatcagacaagtcaaaatgaaga cagacaaaagtattttttaatataaaaatggtctttatttcttcaatacaaggtaaactactattgcag tttaagaccaacacaaaagttggacagcaaattgcttaacagtctcctaaaggctgaaaaaaaggaacc catgaaagctaaaagttatgcagtatttcaagtataacatctaaaaatgatgaaacgatccctaaaggt agagattaactaagtacttctgctgaaaatgtattaaaatccgcagttgctaggataccatcttacctt gttgagaaatacaggtctccggcaacgcaacattcagcagactctttggcctgctggaatcaggaaact gcttactatatacacatataaatcctttggagttgggcattctgagagacatccatttcctgacatttt gcagtgcaactctgcattccaactcagacaagctcccatgctgtatttcaaagccatttcttgaatagt ttacccagacatccttgtgcaaattgggaatgaggaaatgcaatggtacaggaagacaatacagcctta tgtttagaaagtcagcagcgctggtaatcttcataaaaatgtaactgttttccaaataggaatgtattt cacttgtaaaacacctggtcctttttatattacttttttttttttttaaggacacctgcactaatttgc aatcacttgtatttataaaagcacacgcactcctcattttcttacatttgaagatcagcagaatgtctc tttcataatgtaataatcatatgcacagtttaaaatattttctattacaaaatacagtacacaagaggg tgaggccaaagtctattacttgaatatattccaaagtgtcagcactgggggtgtaaaattacattacat ggtatgaataggcggaattcttttacaactgaaatgctcgatttcattgggatcaaaggtaagtactgt ttactatcttcaagagacttcaatcaagtcggtgtatttccaaagaagcttaaaagattgaagcacaga cacaggccacaccagagcctacacctgctgcaataagtggtgctatagaaaggattcaggaactaacaa gtgcataatttacaaatagagatgctttatcatactttgcccaacatgggaaaaaagacatcccatgag aatatccaactgaggaacttctctgtttcatagtaactcatctactactgctaagatggtttgaaaagt acccagcaggtgagatatgttcgggaggtggctgtgtggcagcgtgtcccaacacgacacaaagcaccc cacccctatctgcaatgctcactgcaaggcagtgccgtaaacagctgcaacaggcatcacttctgcata aatgctgtgactcgttagcatgctgcaactgtgtttaaaacctatgcactccgttaccaaaataattta agtcccaaataaatccatgcagcttgcttcctatgccaacatattttagaaagtattcattcttcttta agaatatgcacgtggatctacacttcctgggatctgaagcgatttatacctcagttgcagaagcagttt agtgtcctggatctgggaaggcagcagcaaacgtgcccgttttacatttgaacccatgtgacaacccgc cttactgagcatcgctctaggaaatttaaggctgtatccttacaacacaagaaccaacgacagactgca tataaaattctataaataaaaataggagtgaagtctgtttgacctgtacacacagagcatagagataaa aaaaaaaggaaatcaggaattacgtatttctataaatgccatatatttttactagaaacacagatgaca agtatatacaacatgtaaatccgaagttatcaacatgttaactaggaaaacatttacaagcatttgggt atgcaactagatcatcaggtaaaaaatcccattagaaaaatctaagcctcgccagtttcaaaggaaaaa aaccagagaacgctcactacttcaaaggaaaaaaaataaagcatcaagctggcctaaacttaataaggt atctcatgtaacaacagctatccaagctttcaagccacactataaataaaaacctcaagttccgatcaa cgttttccataatgcaatcagaaccaaaggcattggcacagaaagcaaaaagggaatgaaagaaaaggg ctgtacagtttccaaaaggttcttcttttgaagaaatgtttctgacctgtcaaaacatacagtccagta gaaattttactaagaaaaaagaacaccttacttaaaaaaaaaaaacaacaaaaaaaacaggcaaaaaaa cctctcctgtcactgagctgccaccacccaaccaccacctgctgtgggctttgtctcccaagacaaagg acacacagccttatccaatattcaacattacttataaaaacgctgatcagaagaaataccaagtatttc ctcagagactgttatatcctttcatcggcaacaagagatgaaatacaacagagtgaatatcaaagaagg cggcaggagccaccgtggcaccatcaccgggcagtgcagtgcccaactgccgttttctgagcacgcata ggaagccgtcagtcacatgtaataaaccaaaacctggtacagttatattatggatcctacgtactcgag aagcttagcttgagcttggatcagattgtcgtttcccgccttcagtttaaactatcagtgtttgacagg atatattggcgggtaaacctaagagaaaagagcgtttattagaataacggatatttaaaagggcgtgaa aaggtttatccgttcgtcc

Claims

1 A method of achieving enhanced expression of a target nucleotide sequence in a transgenic organism, which method comprises the steps of:
(i) providing an organism in which post-transcriptional gene silencing (PTGS) is suppressed,
(ii) associating said target nucleotide sequence with one or more heterologous Matrix Attachment Region (MARs) , and
(iii) causing or permitting expression from the target nucleotide sequence in the organism.
2 A method of producing a transgenic organism in which a target nucleotide sequence is expressed at an enhanced level, which method comprises the steps of:
(i) providing an organism in which post-transcriptional gene silencing (PTGS) is suppressed,
(ii) associating said target nucleotide sequence with one or more heterologous Matrix Attachment Region (MARs) , and optionally:
(iii) causing or permitting expression from the target nucleotide sequence in the organism.
3 A method as claimed in claim 1 or claim 2 wherein in (ii) two MARs are associated with the target nucleotide sequence in positions flanking it.
4 A method as claimed in any one of the preceding claims wherein the target nucleotide sequence is operably linked to a heterologous promoter or enhancer sequence. 5 A method as claimed in claim 4 wherein (ii) comprises the step of operably linking said target nucleotide sequence with a heterologous promoter or enhancer sequence.
6 A method as claimed in any one of the preceding claims wherein in (ii) the or each of the MARs is introduced to and associated with a target nucleotide sequence which is within a pre-existing gene present in the genome of the organism.
7 A method as claimed in claim 6 wherein the or each MAR is less than 500, 200, 150, 100, or 50 nucleotides upstream of a promoter or downstream of a terminator of the gene.
8 A method as claimed in claim 6 wherein (ii) comprises the steps of:
(iia) providing a target nucleic acid construct comprising (a) a promoter, and (b) one or more Matrix Attachment Regions (MARs) associated therewith, (iib) introducing said target construct into a cell of the organism, such that the promoter becomes operably linked to a target nucleotide sequence which is within a pre-existing gene present in the genome of the organism.
9 A method as claimed in any one of the preceding claims wherein the target nucleotide sequence is endogenous to the organism.
10 A method as claimed in any of claims 1 to 5 wherein (ii) comprises the steps of: (iia) providing a target nucleic acid construct comprising (a) an expression cassette including the target nucleotide sequence operably linked to a promoter, and (b) one or more Matrix Attachment Regions (MARs) associated therewith, (iib) introducing said target construct into a cell of the organism, 11 A method as claimed in claim 10 wherein 1 MAR is associated with the expression cassette 5' of the cassette.
12 A method as claimed in claim 10 wherein 2 MARs are associated with the expression cassette which flank the target nucleotide sequence .
13 A method as claimed in claim 11 or claim 12 wherein the or each MAR is less than 500, 200, 150, 100, or 50 nucleotides upstream of a promoter or downstream of a terminator of the expression cassette.
14 A method as claimed in any one of claims 8 or 10 to 13 wherein the target construct is a vector which comprises border sequences which permit the transfer and integration of the MARs into the organism genome.
15 A method as claimed in claim 14 wherein the target construct is a plant binary vector.
16 A method of transforming a plant cell involving introduction of a construct as claimed in claim 14 or claim 15 such as to cause recombination between the vector and the plant cell genome.
17 A method as claimed in claim 16 which comprises the step of regenerating a plant from the transformed plant cell.
18 A method as claimed in any one of the preceding claims wherein (i) comprises the step of suppressing PTGS in the organism.
19 A method as claimed in claim 18 wherein step (ii) precedes step (i) • 20 A method as claimed in any one of the preceding claims wherein the organism in which PTGS is suppressed is one which is deficient in one or more genes required to support PTGS.
21 A method as claimed in any one of claims 1 to 19 wherein one or more genes required to support PTGS are subject to PTGS.
22 A method as claimed in claim 20 or claim 21 wherein the organism is a plant and the genes required to support PTGS are selected from: SGS2; SDE1; SGS3; SDE3; AGOl; WEX.
23 A method as claimed in any one of claims 1 to 19 wherein PTGS is suppressed by one or more viral suppressors of gene silencing.
24 A transgenic non-human organism obtained or obtainable by a method as claimed in any one of the preceding claims .
25 A transgenic organism as claimed in claim 24 in which a heterologous target nucleotide sequence is expressed at an enhanced level, wherein the organism is deficient in one or more genes required to support PTGS, which organism includes in its genome (a) an expression cassette including the target nucleotide sequence operably linked to a promoter, and (b) one or more heterologous Matrix Attachment Regions (MARs) associated therewith.
26 A method as claimed in any one of the claims 1 to 23 wherein expression is enhanced at least 5, 10, 15, 20, 25, or 30-fold.
27 A method for generating a target protein, which method comprises the steps of performing a method as claimed in any one of the claims 1 to 23 or claim 26 wherein the organism is a plant, and harvesting a tissue in which the target protein has been expressed and isolating the target protein from the tissue.
28 A target nucleic acid construct for achieving enhanced levels of expression of said target nucleic acid comprising (a) an expression cassette including the target nucleotide sequence operably linked to a promoter, and (b) one or more Matrix Attachment Regions (MARs) associated therewith, when used in connection with a cell or organism undergoing suppression of PTGS.
29 The construct according to claim 28 wherein 2 MARs are associated with the expression cassette which flank the target nucleotide sequence.
30 The construct according to claim 28 or 29 wherein the target construct is a vector which comprises border sequences which permit the transfer and integration of the MARs into the organism genome.
31 A composition for use in a cell or organism which comprises a target nucleic acid construct for achieving enhanced levels of expression of said target nucleic acid comprising (a) an expression cassette including the target nucleotide sequence operably linked to a promoter, and (b) one or more Matrix Attachment Regions (MARs) associated therewith, when used in connection with a cell or organism undergoing suppression of PTGS.
PCT/GB2004/005058 2003-12-02 2004-11-30 Enhanced expression WO2005054483A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU2004294508A AU2004294508A1 (en) 2003-12-02 2004-11-30 Enhanced expression
CA002545687A CA2545687A1 (en) 2003-12-02 2004-11-30 Enhanced expression
EP04819725A EP1706496A2 (en) 2003-12-02 2004-11-30 Enhanced expression
US10/581,472 US20080092252A1 (en) 2003-12-02 2004-11-30 Enhanced Expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0327919.7 2003-12-02
GBGB0327919.7A GB0327919D0 (en) 2003-12-02 2003-12-02 Enhanced expression

Publications (2)

Publication Number Publication Date
WO2005054483A2 true WO2005054483A2 (en) 2005-06-16
WO2005054483A3 WO2005054483A3 (en) 2007-02-22

Family

ID=29764422

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2004/005058 WO2005054483A2 (en) 2003-12-02 2004-11-30 Enhanced expression

Country Status (6)

Country Link
US (1) US20080092252A1 (en)
EP (1) EP1706496A2 (en)
AU (1) AU2004294508A1 (en)
CA (1) CA2545687A1 (en)
GB (1) GB0327919D0 (en)
WO (1) WO2005054483A2 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11802289B2 (en) 2017-08-03 2023-10-31 Plantform Corporation Transient silencing of ARGONAUTE1 and ARGONAUTE4 to increase recombinant protein expression in plants
US10894812B1 (en) 2020-09-30 2021-01-19 Alpine Roads, Inc. Recombinant milk proteins
AU2021353004A1 (en) 2020-09-30 2023-04-13 Nobell Foods, Inc. Recombinant milk proteins and food compositions comprising the same
US10947552B1 (en) 2020-09-30 2021-03-16 Alpine Roads, Inc. Recombinant fusion proteins for producing milk proteins in plants

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001038512A2 (en) * 1999-11-22 2001-05-31 Plant Bioscience Limited Enhanced transgene expression by co-expression with a suppressor of post-transcriptional gene silencing (ptgs)
WO2002074969A2 (en) * 2001-01-26 2002-09-26 University Of Lausanne Matrix attachment regions and methods for use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001038512A2 (en) * 1999-11-22 2001-05-31 Plant Bioscience Limited Enhanced transgene expression by co-expression with a suppressor of post-transcriptional gene silencing (ptgs)
WO2002074969A2 (en) * 2001-01-26 2002-09-26 University Of Lausanne Matrix attachment regions and methods for use thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LIU J-W ET AL: "THE INFLUENCE OF TWO PLANT NUCLEAR MATRIX ATTACHMENT REGIONS (MARS) ON GENE EXPRESSION IN TRANSGENIC PLANTS" MOLECULAR AND GENERAL GENETICS, SPRINGER VERLAG, BERLIN, DE, vol. 39, no. 1, 1998, pages 115-123, XP002910494 ISSN: 0026-8925 *
VOINNET OLIVIER ET AL: "Suppression of gene silencing: A general strategy used by diverse DNA and RNA viruses of plants" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 96, no. 24, 23 November 1999 (1999-11-23), pages 14147-14152, XP002174430 ISSN: 0027-8424 *
ZAHN-ZABAL M ET AL: "Development of stable cell lines for production or regulated expression using matrix attachment regions" JOURNAL OF BIOTECHNOLOGY, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 87, no. 1, 27 April 2001 (2001-04-27), pages 29-42, XP004231294 ISSN: 0168-1656 *

Also Published As

Publication number Publication date
CA2545687A1 (en) 2005-06-16
AU2004294508A1 (en) 2005-06-16
WO2005054483A3 (en) 2007-02-22
EP1706496A2 (en) 2006-10-04
GB0327919D0 (en) 2004-01-07
US20080092252A1 (en) 2008-04-17

Similar Documents

Publication Publication Date Title
Peremarti et al. Promoter diversity in multigene transformation
Butaye et al. Approaches to minimize variation of transgene expression in plants
Kummari et al. An update and perspectives on the use of promoters in plant genetic engineering
Schünmann et al. A suite of novel promoters and terminators for plant biotechnology
Sawant et al. Designing of an artificial expression cassette for the high-level expression of transgenes in plants
WO2006089950A2 (en) Expression cassettes for seed-preferential expression in plants
US20240254498A1 (en) Regulatory Elements From Lamium Leaf Distortion Associated Virus (LLDAV)
US7169967B2 (en) Globulin-1 promoter from maize and method of using same
ZA200505067B (en) Arificial promoter for the expression of DNA sequences in vegetal cells
Streatfield et al. Analysis of the maize polyubiquitin-1 promoter heat shock elements and generation of promoter variants with modified expression characteristics
US7183109B2 (en) Embryo preferred promoter and method of using same
Streatfield et al. Identification of maize embryo-preferred promoters suitable for high-level heterologous protein production
TWI484906B (en) Method of expression of foreign gene in plant induced by chemical substance
US20080092252A1 (en) Enhanced Expression
US7112723B2 (en) Globulin 2 regulatory region and method of using same
WO2002081695A2 (en) Genes that are modulated by posttranscriptional gene silencing
US9944937B2 (en) Regulatory region having increased expression and method of using same
CA2523471A1 (en) Expression cassettes for seed-preferential expression in plants
US8642749B2 (en) Regulatory region preferentially expressing to seed embryo and method of using same
RU2799014C1 (en) Pro-smamp-d1 promoter from stellaria media l. plant for plant biotechnology
EP1882037A2 (en) Expression cassettes for seed-preferential expression in plants
WO2006125749A2 (en) Expression cassettes for seed-preferential expression in plants
CA2602156A1 (en) Expression cassettes for seed-preferential expression in plants
US20070118926A1 (en) Engineering broad spectrum virus disease resistance in plants based on the regulation of expression of the RNA dependant RNA polymerase 6 gene
CA2526304A1 (en) Expression cassettes for vascular tissue-preferential expression in plants

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2545687

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2004294508

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2004819725

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2004294508

Country of ref document: AU

Date of ref document: 20041130

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004294508

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

WWP Wipo information: published in national office

Ref document number: 2004819725

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10581472

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10581472

Country of ref document: US