WO2005054265A2

WO2005054265A2 - Polyketides and their synthesis

Info

Publication number: WO2005054265A2
Application number: PCT/GB2004/005001
Authority: WO
Inventors: Sabine Gaisser; Stephen Frederik HAYDOCK; Peter Francis Leadlay; Hamish Alastair Irvine Mcarthur
Original assignee: Biotica Technology Limited; Pfizer Inc.
Priority date: 2003-11-28
Filing date: 2004-11-29
Publication date: 2005-06-16
Also published as: US20080044860A1; JP2011147446A; GB0327721D0; JP2007512013A; CA2547560A1; EP1749101A2; MXPA06006022A; WO2005054265A3

Abstract

Macrolides particularly erythromycins and azithromycins, having O-mycaminosyl or O-angolosaminyl groups, particularly at the 5-position, are produced using a gene cassette comprising a combination of genes which, in an appropriate strain background, are able to direct the synthesis of mycaminose or angolosamine and to direct its subsequent transfer to an aglycone or pseudoaglycone. Synthetic genes may comprise one or more of angMIII, angMI, angB, angAI, angAII, angorf14, angorf4, tylMIII, tylMI, tylB, tylAI, tylAII, eryCVI, spnO, eryBVI, eryK, tyl Ia and ery G. Glycosyltransfer genes may comprise one or more of eryCIII, tylMII, angMII, desVII, eryBV, spnP and midI

Description

Polyketides and their synthesis

Field of Invention The present invention relates to processes and materials (including recombinant strains) for the preparation and isolation of macrolide compounds, particularly compounds differing from natural compounds at least in terms of glycosylation. It is particularly concerned with erythromycin and azithromycin analogues wherein the natural sugar at the 5-position has been replaced. The invention includes the use of recombinant cells in which gene cassettes are expressed to generate novel macrolide antibiotics.

Background to the Invention The biosynthetic pathways to the macrolide antibiotics produced by actinomycete bacteria generally involve the assembly of an aglycone structure, followed by specific modifications which may include any or all of: hydroxylation or other oxidative steps, methylation and glycosylation. In the case of the 14-membered macrolide erythromycin A, these modifications consist of the specific hydroxylation of 6-deoxyerythronolide B to erythronolide B which is catalysed by EryF, followed by the sequential attachment of dTDP-L mycarose via the hydroxyl group at C-3 catalysed by the mycarosyltransferase EryBV (Staunton and Wilkinson, 1997). The attachment of dTDP-D-desosamine via the hydroxyl group at C-5, catalysed by EryCIII, then results in the production of erythromycin D, the first intermediate with antibiotic activity. Erythromycin D is subsequently converted to erythromycin A by hydroxylation at C- 12 (EryK) and 0-methylation (EryG) on the mycarosyl group, this order being preferred (Staunton and Wilkinson, 1997). The biosynthesis of dTDP-L-mycarose and dTDP-D-desosamine has been studied in detail (Gaisser et al, 1997; Summers et al, 1997; Gaisser et al., 1998; Salah-Bey et al, 1998). Recently, a 3.1 A high-resolution X-ray investigation of the interaction of ribosomes with macrolides (Schlϋnzen et al. , 2001 , Hansen et al, 2002) has revealed key interactions giving direct insights into ways in which macrolide templates might be adapted, by chemical or biological approaches, for increased ribosomal binding and inhibition and for improved effectiveness against resistant organisms. In particular, previous indications about the importance of the sugar substituent at the C-5 hydroxyl of the macrocycle for ribosomal binding were fully borne out by the structural analysis. This substituent extends towards the peptidyl transferase centre and in the case of 16-membered macrolides, which bear a disaccharide at C-5, reaches further into the peptidyl transferase centre, thus providing a molecular basis for the observation that 16-membered macrolides inhibit ribosomal capacity to form even a single peptide bond (Poulsen et al, 2000). This suggests that erythromycins with alternative substituents at the C-5 positions, for example mycaminosyl and angolosaminyl erythromycins, and in particular mycaminosyl and 4'-0 substituted mycaminosyl erythromycins, are highly desirable as potential anti-bacterial agents. Since post-poly ketide synthase modifications are often critical for biological activity (Liu and

Thorson, 1994; Kaneko et al, 2000), there has been increasing interest in understanding the mechanism and specificity of the enzymes involved to engineer the biosynthesis of diverse novel hybrid macrolides with potentially improved activities. Recent work has demonstrated that the manipulation of sugar biosynthetic genes is a powerful approach to isolate novel macrolide antibiotics. The recently demonstrated relaxed specificity of the glycosyltransferases is crucial for this approach (see Mendez and

Salas, 2001 and references therein). In the pathways to erythromycin A and methymycin / neomethymycin, the production of hybrid macrolides has been observed after inactivation of specific genes involved in the biosynthesis of deoxyhexoses (Gaisser et al, 1997; Summers et al., 1997; Gaisser et al, 1998; Salah-Bey et al, 1998; Zhao et al, 1998a; Zhao et al, 1998b) or after the expression of genes from different biosynthetic gene clusters (Zhao et al, 1999). A relaxed specificity towards the sugar substrate has also been reported for glycosyltransferases that have been expressed in heterologous strains, including glycosyltransferases from the pathways to vancomycin (Solenberg et al, 1997), elloramycin (Wohlert et al, 1998), oleandomycin (Doumith et al, 1999; Gaisser et al, 2000), pikromycin (Tang and McDaniel, 2001), epirubicin (Madduri et al, 1998), avermectin (Wohlert et al, 2001) and spinosyn (Gaisser et al, 2002a). Most of the successful alterations so far reported have involved relaxed specificity towards the activated sugar moiety, while as yet only isolated examples are known where a gly cosy ltransferase targets its deoxysugar to an alternative aglycone substrate (Spagnoli et al, 1983; Trefzer et al, 1999). Both WO 97/23630 and WO 99/05283 describe the production of erythromycins with an altered glycosylation pattern in culture supematants by deletion of a specific sugar biosynthesis gene. Thus WO 99/05283 describes low but detectable levels of 5-0-dedesosaminyl-5-(3-mycarninosyl erythromycin D in the culture supernatant of an eryCIV knockout strain of S. erythraea. It also has been demonstrated that the use of the gene cassette technology described in patent WOO 1/79520 is a powerful and potentially general approach to isolate novel macrolide antibiotics by expressing combinations of genes in mutant strains of S. erythraea (Gaisser et al, 2002b). WO 01/79520 also describes the detection of 5-0-dedesosaminyl-5-<9-mycaminosyl erythromycin A in culture supematants of the S. erythraea strains SGQ2pSGCIII and SGQ2p(mycaminose)CIII, fed with 3-O-mycarosyl erythronolide B. However, the low levels of 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A make this a less than optimal method for producing this valuable material on large scales and similar problems were encountered synthesizing 5-(3-dedesosaminyl-5-Omycaminosyl erythromycin A using chemical methods (Jones et al, 1969). EP 1024145 refers to the isolation of azithromycin analogues carrying a mycaminosyl residue such as 5-0-dedesosaminyl-5-0-mycaminosyl azithromycin and 3"-desmethyl-5-0-dedesosaminyl-5-0- mycaminosyl azithromycin. However the only examples given in this area are "prophetic examples" and there is no evidence that they could actually be put into practice. Therefore, the present invention provides the first demonstration of an efficient and highly effective method for making significant quantities of erythromycins and azithromycins which have non- natural sugars at the C-5 position, in particular mycaminose and angolosamine. In a specific aspect the present invention provides for the synthesis of mycaminose and angolosamine using specific combinations of sugar biosynthetic genes in gene cassettes.

Summary of the Invention The present invention relates to processes, and recombinant strains, for the preparation and isolation of erythromycins and azithromycins, which differ from the corresponding naturally occurring compound in the glycosylation of the C-5 position. In a specific aspect the present invention relates to processes, and recombinant strains, for the preparation and isolation of erythromycins and azithromycins, which incorporate angolosamine or mycaminose at the C-5 position. In particular, the present invention relates to processes and recombinant strains for the preparation and isolation of 5-<9-dedesosaminyl-5-0- mycaminosyl, or angolosaminyl erythromycins and azithromycins, in particular 5-<3-dedesosaminyl-5-0- mycaminosyl erythromycins and 5-0-dedesosaminyl-5-0-mycaminosyl azithromycins, and specifically 5-(9-dedesosaminyI-5-(?-mycaminosyl erythromycin B, 5-0-dedesosaminyl-5-<9-mycaminosyl erythromycin C, 5-0-dedesosaminyl-5-(3-mycaminosyl erythromycin D, 5-<3-dedesosaminyl-5-0- mycaminosyl erythromycin A, and 5-0-dedesosaminyl-5-<9-mycaminosyl azithromycin. The present invention further relates to novel 5-0-dedesosaminyl-5-(3-mycaminosyl, angolosaminyl erythromycins and azithromycins produced thereby.

Detailed description of the Invention The present invention relates to processes, and recombinant strains, for the preparation and isolation of erythromycins and azithromycins which differ from the naturally occurring compound in the glycosylation of the C-5 position. These are referred to herein as "compounds of the invention" and unless the context dictates otherwise, such a reference includes a reference to 5-0-dedesosaminy 1-5-O-mycaminosyl erythromycins, 5-0-dedesosaminyl-5-0-angolosaminyl erythromycins, 5-0-dedesosaminyl-5-O- mycaminosyl azithromycins, and 5-O-dedesosaminyl-5-0-angolosaminyl azithromycins, specifically 5-0- dedesosaminyl-5-O-mycaminosyl erythromycin A, 5-0-dedesosaminyl-5-(9-ιr_ycaminosyl erythromycin C, 5-6>-dedesosaminyl-5-6>-mycaminosyl erythromycin B, 5-<9-dedesosaminyl-5-0-mycaminosyl erythromycin D, 5-0-dedesosaminyI-5-Omycaminosyl azithromycin, 5-O-dedesosaminyl-5-0-angolosaminyl erythromycin A, 5-0-dedesosaminyl-5-< -angolosaminyl erythromycin B, 5-C>-dedesosaminyl-5-0- angolosaminyl erythromycin C, 5-OdedesosaminyI-5-0-angolosaminyl erythromycin D, 5-0- dedesosaminyl-5-ø-angolosaminyl azithromycin and analogues thereof which additionally vary in glycosylation at the C3 position (see WO 01/79520) and which may also vary in the aglycone backbones (see WO 98/01571, EP 1024145, WO 93/13663, WO 98/49315). The invention relates to processes, and recombinant strains, for the preparation and isolation of compounds of the invention. In particular, the present invention provides a process for the production of erythromycins and azithromycins which differ from the naturally occurring compound in the glycosylation of the C-5 position, said process comprising transforming a strain with a gene cassette as described herein and culturing the strain under appropriate conditions for the production of said erythromycin or azithromycin. In a preferred embodiment the strain is an actinomycete, a pseudomonad, a myxobacterium, or an E. coli. In an alternative preferred embodiment the host strain is additionally transformed with the ermE gene from S. erythraea. In a more highly preferred embodiment, the host strain is an actinomycete. In a more highly preferred embodiment the host strain is selected from S. erythraea, Streptomyces griseofuscus, Streptomyces cinnamonensis, Streptomyces albus, Streptomyces lividans, Streptomyces hygroscopicus sp., Streptomyces hygroscopicus var. ascomyceticus, Streptomyces longisporoflavus, Saccharopolyspora spinosa, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces fradiae, Streptomyces rimosus, Streptomyces avermitilis, Streptomyces eurythermus, Streptomyces venezuelae, and Amycolatopsis mediterranei. In a specific embodiment the host strain is S. erythraea. In an alternative specific embodiment the host strain is selected from the SGQ2, Q42/1 or 18A1 strains of S. erythraea. The present invention further relates to novel 5-0-dedesosaminyl-5-<9-angolosaminyl erythromycins and azithromycins produced thereby (Figure 1). The methodology comprises in part the expression of a gene cassette in the S. erythraea mutant strain SGQ2 (which carries genomic deletions in eryA, eryCIII, eryBV and eryCIV (WOO 1/79520)), as described in Example 3 and 6 and in S. erythraea Q42/1 (BIOT-2166) (Examples 1- 4) and S. erythraea 18A1 (BIOT-2634) (Example 6). Detailed descriptions are given in Examples 1 - 11. The invention relates to a process involving the transformation of an actinomycete strain, including but not limited to strains of S. erythraea such as SGQ2, (see WO 01/79520) or Q42/1 or 18A1 (whose preparation is described below) with an expression plasmid containing a combination of genes which are able to direct the biosynthesis of a sugar moiety and direct its subsequent transfer to an aglycone or pseudoaglycone. In a particular embodiment the present invention relates to a gene cassette containing a combination of genes which are able to direct the synthesis of mycaminose or angolosamine in an appropriate strain background. In a particular embodiment the present invention relates to a gene cassette containing a combination of genes which are able to direct the synthesis of mycaminose in an appropriate strain background. The gene cassette may include genes selected from but not limited to angorfl4, tylMIII, tylMI, tylB, tylAI, tylAII, tylla, angAI, angAII, angMIII, angB, angMI, eryG, eryK and glycosyltransferase genes including but not limited to tylMII, angMII, desVII, eryCIII, eryBV, spnP, and midl. In a preferred embodiment the gene cassette comprises tylla in combination with one or more other genes which are able to direct the synthesis of mycaminose. In a preferred embodiment the gene cassette comprises angorfl4 in combination with one or more other genes which are able to direct the synthesis of mycaminose. In an more preferred embodiment the gene cassette comprises angAI, angAII, angorfH, angMIII, angB, angMI, in combination with one or more glycosyltransferases such as but not limited to eryCIII, tylMII, angMII, In an alternative embodiment the gene cassette comprises tylAI, tylΛII, tylMIII, tylB, tylla, tylMI in combination with glycosyltransferases such as but not limited to eryCIII, tylMII and angMII. In a preferred embodiment the strain is an S. erythraea strain. In a particular embodiment the present invention relates to a gene cassette containing combinations of genes which are able to direct the synthesis of angolosamine, including but not limited to angMIII, angMI, angB, angAI, angAII, angorfH, angorf4, tylMIII, tylMI, tylB, tylAI, tylAII, eryCVI, spnO, eryBVI, and eryK and one or more glycosyltransferase genes including but not limited to eryCIII, tylMII, angMII, des VII, eryBV, spnP and midl. In a preferred embodiment the gene cassette contains angMIII, angMI, angB, angAI, angAII, angorfH, spnO in combination with a glycosyltransferase gene such as but not limited to angMII, tylMII or eryCIII. In an alternative preferred embodiment the gene cassette contains comprises angMIII, angMI, angB, angAI, angAII, angorfif, and angorfH, in combination with one or more glycosyltransferases selected from the group consisting of angMII, tylMII and eryCIII. In a preferred embodiment the strain is an S. erythraea strain. In one embodiment, the process of the present invention further involves feeding of an aglycone and/or a pseudoaglycone substrate (for definition see below), to the recombinant strain, said aglycone or pseudoaglycone is selected from the group including (but not limited to) 3-0-mycarosyl erythronolide B, erythronolide B, 6-deoxy erythronolide B, 3-0-mycarosyl-6-deoxy erythronolide B, tylactone, spinosyn pseudoaglycones, 3-0-rhamnosyl erythronolide B, 3-0-rhamnosyl-6-deoxy erythronolide B, 3-0- angolosaminyl erythronolide B, 15-hydroxy-3-0-mycarosyl erythronolide B, 15-hydroxy erythronolide B, 15-hydroxy-6-deoxy erythronolide B, 15-hydroxy-3-0-mycarosyl-6-deoxy erythronolide B, 15-hydroxy- 3-O-rhamnosyl erythronolide B, 15-hydroxy-3-0-rhamnosyl-6-deoxy erythronolide B, 15-hydroxy-3-0- angolosaminyl erythronolide B, 14-hydroxy-3-< -mycarosyl erythronolide B, 14-hydroxy erythronolide B, 14-hydroxy-6-deoxy erythronolide B, 14-hydroxy-3-(9-mycarosyl-6-deoxy erythronolide B, 14-hydroxy- 3-0-rhamnosyl erythronolide B, 14-hydroxy-3-(9-rhamnosyl-6-deoxy erythronolide B, 14-hydroxy-3-0- angolosaminyl erythronolide B to cultures of the transformed actinomycete strains, the bioconversion of the substrate to compounds of the invention and optionally the isolation of said compounds. This process is exemplified in Examples 1-1 1. However, a person of skill in the art will appreciate that in an alternative embodiment the host cell can express the desired aglycone template, either naturally or recombinantly. As used herein, the term "pseudoaglycone" refers to a partially glycosylated intermediate of a multiply-giycosylated product. Those skilled in the art will appreciate that alternative host strains can be used. A preferred cell is a prokaryote or a fungal cell or a mammalian cell. A particularly preferred host cell is a prokaryote, more preferably host cell strains such as actinomycetes, Pseudomonas, myxobacteria, and E. coli. It will be appreciated that if the host cell does not naturally produce erythromycin, or a closely related 14- membered macrolide, it may be necessary to introduce a gene conferring self-resistance to the macrolide product, such as the ermE gene from S. erythraea. Even more preferably the host cell is an actinomycete, even more preferably strains that include but are not limited to S. erythraea, Streptomyces griseofuscus, Streptomyces cinnamonensis, Streptomyces albus, Streptomyces lividans, Streptomyces hygroscopicus sp. , Streptomyces hygroscopicus var. ascomyceticus, Streptomyces longisporoflavus, Saccharopolyspora spinosa, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces fradiae, Streptomyces rimosus, Streptomyces avermitilis, Streptomyces eurythermus, Streptomyces venezuelae, Amycolatopsis mediterranei. In a more highly preferred embodiment the host cell is S. erythraea. It will readily occur to those skilled in the art that the substrate fed to the recombinant cultures of the invention need not be a natural intermediate in erythromycin biosynthesis. Thus, the substrate could be modified in the aglycone backbone (see Examples 8-11) or in the sugar attached at the 3-position or both. WO 01/79520 demonstrates that the desosaminyl transferase EryCIII exhibits relaxed specificity with respect to the pseudoaglycone substrate, converting 3-O-rhamnosyl erythronolides into the corresponding 3-O-rhamnosyl erythromycins. Appropriate modified substrates may also be produced by chemical semi-synthetic methods. Alternatively, methods of engineering the erythromycin-producing polyketide synthase, DEBS, to produce modified erythromycins are well known in the art (for example WO 93/13663, WO 98/01571 , WO 98/01546, WO 98/49315, Kato, Y. et al, 2002 ). Likewise, WO 01/79520 describes methods for obtaining erythronolides with alternative sugars attached at the 3- position. Therefore, the term "compounds of the invention" includes all such non-natural aglycone compounds as described previous additionally with alternative sugars at the C-5 position. All these documents are incorporated herein by reference. It will readily occur to those skilled in the art that the compounds of the invention containing a mycaminosyl moiety at the C-5 position could be modified at the C-4 hydroxyl group of the mycaminosyl moiety, including but not limited to glycosylation (see also WO 01/79520), acylation or chemical modification. The present invention thus provides variants of erythromycin and related macrolides having at the 5-position a non-naturally occurring sugar, in particular an 0-mycaminosyl, or 0-angolosaminyl residue or a derivative or precursor thereof, specifically an 0-angolosaminyl residue or a derivative thereof. The term "variants of erythromycin" encompasses (a) erythromycins A, B, C and D; (b) semi- synthetic derivatives such as azithromycin and other derivatives as discussed in EP 1024145, which is incorporated herein by reference; (c) variants produced by genetic engineering and semi-synthetic derivatives thereof. Variants produced by genetic engineering include variants as taught in, or producible by, methods taught in WO 98/01571, EP 1024145, WO 93/13663, WO 98/49315 and WO 01/79520 which are incorporated herein by reference. The compounds of the invention include variants of erythromycin where the natural sugar at position C-5 has been replaced with mycaminose or angolosamine and also includes compounds of the following formulas (I -erythromycins and II - azithromycins) and pharmaceutically acceptable salts thereof. No stereochemistry is shown in Formula I or II as all possibilities are covered, including "natural" stereochemistries (as shown elsewhere in this specification) at some or all positions. In particular, the stereochemistry of any -CH(OH)- group is generally independently selectable.

Formula I: Formula II

R^,= H, CH₃, C₂H₅ or is selected from i) below;

R², R⁴, R⁵, R⁶, R⁷ and R⁹ are each independently H, OH, CH₃, C₂H₅ or OCH₃;

R³= H or OH;

R° = H,

, rhamnose, 2'-0-methyl rhamnose, 2',3'-bis-0-methyl rhamnose, 2',3',4'-tri-0- methyl rhamnose, oleandrose, oliose, digitoxose, olivose or angolosamine;

R¹⁰ = H, CH₃ or C(=0)R_A, where R_A = C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl; R^{1 1} = H,

, mycarose, C4-0-acyl-mycarose or glucose;

R¹² = H or C(=O)R_A, where R_A = C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl;

R¹³ = H or CH₃;

R¹⁶ = H or OH;

R¹⁴ = H or -C(0)NR^cR^d wherein each of R^c and R^d is independently H, d-Cio alkyl, C₂-C₂₀ alkenyl, C₂- Cio alkynyl, -(CH₂)_m(C6~Cι₀ aryl), or -(CH₂)_m(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4, and wherein each of the foregoing R^c and R^d groups, except H, may be substituted by 1 to 3 Q groups; or wherein R^c and R^d may be taken together to form a 4-7 membered saturated ring or a 5-10 membered heteroaryl ring, wherein said saturated and heteroaryl rings may include 1 or 2 heteroatoms selected from O, S and N, in addition to the nitrogen to which R^c and R^d are attached, and said saturated ring may include 1 or 2 carbon-carbon double or triple bonds, and said saturated and heteroaryl rings may be substituted by 1 to 3 Q groups; or R² and R¹⁷ taken together form a carbonate ring; each Q is independently selected from halo, cyano, nitro, trifluoromethyl, azido, -C(0)Q', - OC(0)Q', -C(0)NQ²Q³, -NQ²Q³, hydroxy, C,-C₆ alkyl, C,-C₆ alkoxy, -(CH₂)_m(C₆-Cιo aryl), and -(CH₂)_m(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4, and wherein said aryl and heteroaryl substituents may be substituted by 1 or 2 substituents independently selected from halo, cyano, nitro, trifluoromethyl, azido, -C(0)Q', -C(0)OQ', -OC(0)OQ',

-C(0)NQ²Q³, -NQ²QΛ hydroxy, C,-C₆ alkyl, and C,-C₆ alkoxy; each Q¹, Q² and Q³ is independently selected from H, OH, CpCi_. alkyl, Ci-Cδ alkoxy, C₂-C₁₀ alkenyl, C₂-C₁₀ alkynyl, -(CH₂)m(C₆-Cιo aryl), and -(CH₂)_m(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4; with the proviso that the compound is not 5-0-dedesosaminyl-5-0- mycaminosyl erythromycin A or D. The present invention also provides compounds according to formulas I or II above in which: i) the substituent R¹ is selected from an alpha-branched C₃-C₈ group selected from alkyl, alkenyl, alkynyl, alkoxyalkyl and alkylthioalkyl groups any of which may be optionally substituted by one or more hydroxyl groups; a C₅- cycloalkylalkyl group wherein the alkyl group is an alpha-branched C₂-C₅ alkyl group; a C₃-C₈ cycloalkyl group or C₅-C₈ cycloalkenyl group, either of which may optionally be substituted by one or more hydroxyl, or one or more C₁-C₄ alkyl groups or halo atoms; a 3 to 6 membered oxygen or sulphur containing heterocyclic ring which may be saturated, or fully or partially unsaturated and which may optionally be substituted by one or more CpC₄ alkyl groups, halo atoms or hydroxyl groups; phenyl which may be optionally substituted with at least one substituent selected from C₁-C₄ alkyl, C₁-C₄ alkoxy and C₁-C₄ alkylthio groups, halogen atoms, trifluoromethyl, and cyano or; - R¹ is R¹⁷-CH₂- where R¹⁷ is H, C_.-C₈ alkyl, C₂-C₈ alkenyl, C₂-C₈ alkynyl, alkoxyalkyl or alkylthioalkyl containing from 1 to 6 carbon atoms in each alkyl or alkoxy group wherein any of said alkyl, alkoxy, alkenyl or alkynyl groups may be substituted by one or more hydroxyl groups or by one or more halo atoms; or a C₃-C₈ cycloalkyl or C₅-C₈ cycloalkenyl either of which may be optionally substituted by one or more CpQ alkyl groups or halo atoms; or a 3 to 6 membered oxygen or sulphur containing heterocyclic ring which may be saturated or fully or partially unsaturated and which may optionally be substituted by one or more C₁-C₄ alkyl groups or halo atoms; or a group of the formula SA₁₆ wherein Aι₆ is C_rC₈ alkyl, C₂-C₈ alkenyl, C₂-C₈ alkynyl, C₃-C₈ cycloalkyl, C₅-Cg cycloalkenyl, phenyl or substituted phenyl wherein the substituent is C₁-C₄ alkyl, C₁-C₄ alkoxy or halo, or a 3 to 6 membered oxygen or sulphur-containing heterocyclic ring which may be saturated, or fully or partially unsaturated and which may optionally be substituted by one or more Cj-C₄ alkyl groups or halo atoms; ii) the -CHOH- at CI 1 (erythromycins) or C12 (azithromycins) is replaced by a methylene group (-CH2-), a keto group (C=0), or by a 10,11-olefinic bond (erythromycins) or 11,12- olefinic bond (azithromycins); iii) the substituent R^u is H or mycarose or C4-0-acyl-mycarose or glucose; or compounds according to formula I or II above which differ in the oxidation state of one or more of the ketide units (i.e. selection of alternatives from the group: -CO-, -CH(OH)-, alkene -CH-, and CH₂) where the stereochemistry of any -CH(OH)- is also independently selectable, with the proviso that the compounds are not selected from the group consisting of 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A, 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin D and 5-0-dedesosaminyl-5-0- mycaminosyl azithromycin. Novel 5-0-dedesosaminyl-5-0-angolosaminyl erythromycins and azithromycins made available by this aspect of the invention include, but are not limited to those where in the R¹⁵ group R¹¹ = R¹⁶ = H, with the proviso that they are not angolamycin or medermycin (Kinumaki and Suzuki, 1972; Ichinose et al., 2003). In a preferred embodiment the present invention provides a compound according to formula I or II where: R¹⁼ H, CH₃, C₂H5 or selected from: an alpha-branched C₃-C₈ group selected from alkyl, alkenyl, alkynyl, alkoxyalkyl and alkylthioalkyl groups any of which may be optionally substituted by one or more hydroxyl groups; a C₅-C₈ cycloalkylalkyl group wherein the alkyl group is an alpha-branched C₂-C₅ alkyl group; a C₃-Cg cycloalkyl group or C₅-C₈ cycloalkenyl group, either of which may optionally be substituted by one or more hydroxyl, or one or more C₁-C₄ alkyl groups or halo atoms; a 3 to 6 membered oxygen or sulphur containing heterocyclic ring which may be saturated, or fully or partially unsaturated and which may optionally be substituted by one or more C₁-C₄ alkyl groups, halo atoms or hydroxyl groups; phenyl which may be optionally substituted with at least one substituent selected from C₁-C₄ alkyl, CpC₄ alkoxy and C₁-C₄ alkylthio groups, halogen atoms, trifluoromethyl, and cyano or R¹ is R¹⁷- CH₂- where R¹⁷ is H, CpCg alkyl, C₂-C₈ alkenyl, C₂-C₈ alkynyl, alkoxyalkyl or alkylthioalkyl containing from 1 to 6 carbon atoms in each alkyl or alkoxy group wherein any of said alkyl, alkoxy, alkenyl or alkynyl groups may be substituted by one or more hydroxyl groups or by one or more halo atoms; or a C₃-C8 cycloalkyl or Cs-Cs cycloalkenyl either of which may be optionally substituted by one or more Cp C alkyl groups or halo atoms; or a 3 to 6 membered oxygen or sulphur containing heterocyclic ring which may be saturated or fully or partially unsaturated and which may optionally be substituted by one or more C₁-C₄ alkyl groups or halo atoms; or a group of the formula SAiβ wherein Aiβ is Cι-C₈ alkyl, C₂- C₈ alkenyl, C₂-C₈ alkynyl, C₃-C₈ cycloalkyl, C₅-C₈ cycloalkenyl, phenyl or substituted phenyl wherein the substituent is C₁-C₄ alkyl, C₁-C₄ alkoxy or halo, or a 3 to 6 membered oxygen or sulphur-containing heterocyclic ring which may be saturated, or fully or partially unsaturated and which may optionally be substituted by one or more CpC₄ alkyl groups or halo atoms R², R⁴, R⁵, R⁶, R⁷ and R⁹ are all CH₃ R³ is H or OH

R = H or

or is selected from rhamnose, 2'-0-methyl rhamnose, 2',3'-bis-0-methyl rhamnose, 2',3',4'-tri-0-methyl rhamnose, oleandrose, oliose, digitoxose, olivose and angolosamine; R10 = H or CH3

R^l2= H or C(=O)R_A, where R_A = C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl R^l3= H or CH₃

R¹⁴ = H or -C(0)NR^cR^d wherein each of R^c and R^d is independently H, d-Cio alkyl, C₂-C₂₀ alkenyl, C₂- C₁0 alkynyl, -(CH₂)_m(C6-Cι₀ aryl), or -(CH₂)_m(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4, and wherein each of the foregoing R^c and R^d groups, except H, may be substituted by 1 to 3 Q groups; or wherein R^c and R^d may be taken together to form a 4-7 membered saturated ring or a

5-10 membered heteroaryl ring, wherein said saturated and heteroaryl rings may include 1 or 2 heteroatoms selected from O, S and N, in addition to the nitrogen to which R° and R^d are attached, and said saturated ring may include 1 or 2 carbon-carbon double or triple bonds, and said saturated and heteroaryl rings may be substituted by 1 to 3 Q groups; or R² and R¹⁷ taken together form a carbonate ring; each Q is independently selected from halo, cyano, nitro, trifluoromethyl, azido, -C(0)Q', -

OC(0)Q',

-OC(O)OθΛ -NQ²C(0)Q³, -C(0)NQ²Q³, -NQ²Q³, hydroxy, C_rC₆ alkyl, C,-C₆ alkoxy, -(CH₂)_m(C₆-Cιo aryl), and -(CH₂)_m(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4, and wherein said aryl and heteroaryl substituents may be substituted by 1 or 2 substituents independently selected from halo, cyano, nitro, trifluoromethyl, azido,

-OC(0)OQ', -NQ²C(0)Q³,

-NQ²Q³, hydroxy, C_rC₆ alkyl, and C_rC₆ alkoxy; each Q¹, Q² and Q³ is independently selected from H, OH, C Cιo alkyl, -Ce alkoxy, C₂-Cι₀ alkenyl, C₂-C]o alkynyl, -(CH )m(C₆-Cιo aryl), and -(CH₂)_m(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4; with the proviso that the compound is not 5-0-dedesosaminyl-5-0- mycaminosyl erythromycin A or D

R^l6 = H or OH with the proviso that the compounds are not selected from the group consisting of 5-0-dedesosaminyl-5-

0-mycaminosyl erythromycin A, 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin D and 5-0- dedesosaminyl-5- -mycaminosyl azithromycin In a further preferred embodiment the present invention provides a compound according to formula I, wherein:

R¹⁼ H, CH₃, C₂H₅ or selected from: an alpha-branched C₃-C₈ group selected from alkyl, alkenyl, alkynyl, alkoxyalkyl and alkylthioalkyl groups any of which may be optionally substituted by one or more hydroxyl groups; a C₅-C₈ cycloalkylalkyl group wherein the alkyl group is an alpha-branched C₂-C₅ alkyl group; a C₃-C₈ cycloalkyl group or C₅-C₈ cycloalkenyl group, either of which may optionally be substituted by one or more hydroxyl, or one or more C₁-C₄ alkyl groups or halo atoms; a 3 to 6 membered oxygen or sulphur containing heterocyclic ring which may be saturated, or fully or partially unsaturated and which may optionally be substituted by one or more C₁-C₄ alkyl groups, halo atoms or hydroxyl groups; phenyl which may be optionally substituted with at least one substituent selected from C C₄ alkyl, C|-C₄ alkoxy and C₁-C₄ alkylthio groups, halogen atoms, trifluoromethyl, and cyano or R¹ is R¹⁷- CH₂- where R¹⁷ is H, Cι-C₈ alkyl, C₂-C₈ alkenyl, C₂-C₈ alkynyl, alkoxyalkyl or alkylthioalkyl containing from 1 to 6 carbon atoms in each alkyl or alkoxy group wherein any of said alkyl, alkoxy, alkenyl or alkynyl groups may be substituted by one or more hydroxyl groups or by one or more halo atoms; or a C₃-C₈ cycloalkyl or C₅-C₈ cycloalkenyl either of which may be optionally substituted by one or more Ci-

C₄ alkyl groups or halo atoms; or a 3 to 6 membered oxygen or sulphur containing heterocyclic ring which may be saturated or fully or partially unsaturated and which may optionally be substituted by one or more C₁-C₄ alkyl groups or halo atoms; or a group of the formula SAι₆ wherein A₁₆ is Cι-C₈ alkyl, C₂- C₈ alkenyl, C₂-C₈ alkynyl, C₃-C₈ cycloalkyl, C₅-C₈ cycloalkenyl, phenyl or substituted phenyl wherein the substituent is C₁-C₄ alkyl, CrC₄ alkoxy or halo, or a 3 to 6 membered oxygen or sulphur-containing heterocyclic ring which may be saturated, or fully or partially unsaturated and which may optionally be substituted by one or more C₁-C₄ alkyl groups or halo atoms

R², R⁴, R⁵, R⁶, R⁷ and R⁹ are all CH₃ R³ is H or OH

R^δ = H or

R¹²= H or C(=0)R_A, where R_A = C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl R¹³= H or CH₃ R^I4 = H

R¹⁶ = H or OH with the proviso that the compounds are not selected from the group consisting of 5-0-dedesosaminyl-5-

O-mycaminosyl erythromycin A, 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin D and 5-0- dedesosaminyl-5-O-mycaminosyl azithromycin In a more preferred embodiment the present invention provides a compound according to formula

I where: R¹⁼ C₂H₅ optionally substituted with a hydroxyl group

R², R⁴, R⁵, R⁶, R⁷ and R⁹ are all CH₃

R³ is H or OH

R . 1^ι0^u - = H or CH₃

R¹²= H or C(=0)R_A, where R_A = C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl

R^l3= H or CH.

R¹⁴ = H

0-mycaminosyl erythromycin A and 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin D In a more preferred embodiment the present invention provides a compound according to formula I where:

R'= C₂H₅ optionally substituted with a hydroxyl group R², R⁴, R⁵, R^δ, R⁷ and R⁹ are all CH₃ R³ is H or OH

R¹⁰ = H or CH₃

R¹²= H

R^l3= H or CH₃

R^,4 = H „ 16 NMe₂

R^l5 = H or A^z °^R

R¹ = H or OH

In a highly preferred embodiment the present invention provides a compound according to formula I where: R'= C₂H₅

R², R⁴, R⁵, R⁶, R⁷ and R⁹ are all CH₃ R³ is H or OH

R^ιυ = H or CH₃ R^I2= H

R^l3= H or CH

R^M = H

0-mycaminosyl erythromycin A and 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin D. Additionally, a person of skill in the art will appreciate that, using the methods of the present invention, mycaminose and angolosamine may be added to other aglycones or pseudoaglycones for example (but without limitation) a tylactone or spinosyn pseudoaglycone. These other aglycones or pseudoaglycones may be the naturally occurring structure or they may be modified in the aglycone backbone, such modified substrates may be produced by chemical semi-synthetic methods (Kaneko et al, 2000 and references cited therein), or, alternatively, via PKS engineering, such methods are well known in the art (for example WO 93/13663, WO 98/01571, WO 98/01546, WO 98/49315, Kato, Y. et l, 2002). Therefore, in a further embodiment the present invention provides 5-O-angolosaminyl tylactone, 5-0-mycaminosyI tylactone, 17-0-angolosaminyl spinosyn and 17-0-mycaminosyl spinosyn. Moreover, the process of the host cell selection further comprises the optional step of deleting or inactivating or adding or manipulating genes in the host cell. This process comprises the improvement of recombinant host strains for the preparation and isolation of compounds of the invention, in particular 5- 0-dedesosaminyl-5-0-mycaminosyl erythromycins and 5-0-dedesosaminyl-5-O-mycaminosyl azithromycins, specifically 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A, 5-0-dedesosaminyI- 5-0-mycaminosyI erythromycin C, 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin B, 5-0- dedesosaminyl-5-0-mycaminosyl erythromycin D and 5-0-dedesosaminyl-5-0-mycaminosyl azithromycin. This approach is exemplified in Example 1 by introducing an eryBVI mutation into the chromosome of S. erythraea SGQ2 in order to optimise the conversion of the substrate 3-0-mycarosyl erythronolide B to 5-0-dedesosaminyl-5-0-mycaminosyl erythromycins. In a further aspect the invention relates to the construction of gene cassettes. The cloning method used to isolate these gene cassettes is analogous to that used in PCT/GB03/003230 and diverges significantly from the approach previously described (WO 01/79520) by assembling the gene cassette directly in an expression vector rather than pre-assembling the genes in pUCl 8/19 plasmids, thus providing a more rapid cloning procedure for the isolation of gene cassettes. The strategy for isolating these gene cassettes is exemplified in Example 1 to Example 11. A schematic overview of the strategy is given in Figure 2. Another aspect of the invention allows the enhancement of gene expression by changing the order of genes in a gene cassette, the genes including but not limited to tylMI, tylMIII, tylB, eryCVI, tylAI, tylAII, eryCIII, eryBV, angAI, angAII, angMIII, angB, angMI, angorfH, angorf4, eryBVI, eryK, eryG, angMII, tylMII, desVII„midI, spnO, spnN, spnP and genes with similar functions, allowing the arrangement of the genes in a multitude of permutations (Figure 2). The cloning strategy outlined in this invention also allows the introduction of a histidine tag in combination with a terminator sequence 3' of the gene cassette to enhance gene expression (see Example

1). Those skilled in the art will appreciate other terminator sequences well known in the art could be used.

See, for example Bussiere and Bastia (1999), Bertram et al (2001) and Kieser et al. (2000), incorporated herein by reference. Another aspect of the invention comprises the use of alternative promoters such as VtipA (Ali et al, 2002) and/or Yptr (Salah-Bey et al, 1995) to express genes and/or assembled gene cassette(s) to enhance expression. Another aspect of the invention describes the multiple uses of promoter sequences in the assembled gene cassette to enhance gene expression as exemplified in Example 6. Another aspect of the invention describes the addition of genes encoding for a NDP-glucose- synthase such as tylAI and a NDP-glucose-4,6-dehydratase such as tylAII to the gene cassette in order to enhance the endogenous production of the activated sugar substrate. Those skilled in the art will appreciate that alternative sources of equivalent sugar biosynthetic pathway genes may be used. In this context alternative sources include but are not limited to: TylAI- homologues: DesIII of Streptomyces venezuelae (accession no AAC68682), GrsD of Streptomyces griseus (accession no AAD31799), AveBIII of Streptomyces avermitilis (accession no BAA84594), Gtt of Saccharopolyspora spinosa (accession no AAK83289), SnogJ of Streptomyces nogalater (accession no AAF01820), AclY of Streptomyces galilaeus (accession no BAB72036), LanG of Streptomyces cyanogenus (accession no AAD13545), Graorf 16(GraD) of Streptomyces violaceoruber (accession no AAA99940), OleS of Streptomyces antibioticus (accession no AAD55453) and StrD of Streptomyces griseus (accession no A26984) and AngAI of S. eurythermus. TylAII- homologues: AprE of Streptomyces tenebrarius (accession no AAG18457), GdH of S. spinosa (accession no AAK83290), DesIV of S. venezuelae (accession no AAC68681), GdH of S. erythraea (accession no AAA68211), AveBII of S. avermitilis (accession no BAA84593), Scf81.08C of Streptomyces coelicolor (accession no CAB61555), LanH of S. cyanogenus (accession no AAD13546), Graorfl7 (GraE) of S. violaceoruber (accession no S58686), OleE of S. antibioticus (accession no AAD55454), StrE of S. griseus (accession no P29782) and AngAII of S. eurythermus. Similarly, alternative sources for activated sugar biosynthesis gene homologues to tylMIII, angAIII, eryCII, tylMII, angMII, tylB, angB, eryCI, tylMI, angMI, eryCVI, tylla, angorfH, angorf4, spnO, eryBVI, eryBV, eryCIII, des VII, midl, spnN andspnP will readily occur to those skilled in the art, and can be used. Another aspect of the invention describes the use of alternative glycosyltransferases in the gene cassettes such as EryCIII. Those skilled in the art will appreciate that alternative glycosyltransferases may be used. In this context alternative glycosyltransferases include but are not limited to: TylMII (Accession no CAA57472), Des VII (Accession noAAC68677), MegCIII (Accession no AAG13921), MegDI (Accession no AAG13908) or AngMII of S. eurythermus. In one aspect of the present invention, the gene cassette may additionally comprise a chimeric glycosyltransferase (GT). This is particularly of benefit where the natural GT does not recognise the combination of sugar and aglycone that is required for the synthesis of the desired analogue. Therefore, in this aspect the present invention specifically contemplates the use of a chimearic GT wherein part of the GT is specific for the recognition of the sugar whose synthesis is directed by the genes in said expression cassette when expressed in an appropriate strain background and part of the GT is specific for the aglycone or pseudoaglycone template (Hu and Walker, 2002). Those skilled in the art will appreciate that different strategies may be used for the introduction of gene cassettes into the host strain, such as site-specific integration vectors (Smovkina et al, 1990; Lee et al, 1991 ; Matsuura et α/., 1996; Van Mellaert et α ., 1998; Kieser et al, 2000). Alternatively, plasmids containing the gene cassettes may be integrated into any neutral site on the chromosome using homologous recombination sites. Further, for a number of actinomycete host strains, including S. erythraea, the gene cassettes may be introduced on self-replicating plasmids (Kieser et al, 2000; WO 98/01571). A further aspect of the invention provides a process for the production of compounds of the invention and optionally for the isolation of said compounds. A further aspect of the invention is the use of different fermentation methods to optimise the production of the compounds of the invention as exemplified in Example 1. Another aspect of the invention is the addition of ery genes such as eryK and/or eryG into the gene cassette. One skilled in the art will appreciate that the process can be optimised for the production of a specific erythromycin (i.e. A, B, C, D) or azithromycin by manipulation of the genes eryG (responsible for the methylation on the mycarose sugar) and/or eryK (responsible for hydroxylation at C12). Thus, to optimise the production of the A-form, an extra copy of eryK may be included into the gene cassette. Conversely, if the erythromycin B analogue is required, this can be achieved by deletion of the eryK gene from the S. erythraea host strain, or by working in a heterologous host in which the gene and/or its functional homologue, is not present. Similarly, if the erythromycin D analogue is required, this can be achieved by deletion of both eryG and eryK genes from the S. erythraea host strain, or by working in a heterologous host in which both genes and/or their functional homologues are not present. Similarly, if the erythromycin C analogue is required, this can be achieved by deletion of the eryG gene from the S. erythraea host strain, or by working in a heterologous host in which the gene and/or its functional homologues are not present. In this context a preferred host cell strain is a mammalian cell strain, fungal cells strain or a prokaryote. More preferably the host cell strain is an actinomycete, a Pseudomonad, a myxobacterium or an E. coli. In a more preferred embodiment the host cell strain is an actinomycete, still more preferably including, but not limited to Saccharopolyspora erythraea, Streptomyces coelicolor, Streptomyces avermitilis, Streptomyces griseofuscus, Streptomyces cinnamonensis, Streptomyces fradiae, Streptomyces eurythermus, Streptomyces longisporoflavus, Streptomyces hygroscopicus, Saccharopolyspora spinosa, Micromonospora griseorubida, Streptomyces lasaliensis, Streptomyces venezuelae, Streptomyces antibioticus, Streptomyces lividans, Streptomyces rimosus, Streptomyces albus, Amycolatopsis mediterranei, Nocardia sp, Streptomyces tsukubaensis and Actinoplanes sp. N902-109. In a still more preferred embodiment the host cell strain is selected from Saccharopolyspora erythraea, Streptomyces griseofuscus, Streptomyces cinnamonensis, Streptomyces albus, Streptomyces lividans, Streptomyces hygroscopicus sp., Streptomyces hygroscopicus var. ascomyceticus, Streptomyces longisporoflavus,

Saccharopolyspora spinosa, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces fradiae, Streptomyces rimosus, Streptomyces avermitilis, Streptomyces eurythermus, Streptomyces venezuelae, Amycolatopsis mediterranei. In the most highly preferred embodiment the host strain is Saccharopolyspora erythraea. The present invention provides methods for the production and isolation of compounds of the invention, in particular of erythromycin and azithromycin analogues which differ from the natural compound in the glycosylation of the C-5 position, for example but without limitation: novel 5-0- dedesosaminyI-5-O-mycaminosyI or angolosaminyl erythromycins and 5-0-dedesosaminyl-5-0- mycaminosyl, or angolosaminyl azithromycins which are useful as anti-microbial agents for use in human or animal health. In further aspects the present invention provides novel products as obtainable by any of the processes disclosed herein. Brief description of Figures

Figure 1A: Structures of 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A, 5-0- dedesosaminyl-5-O-mycaminosyl erythromycin B and 5-0-dedesosaminyl-5-0- mycaminosyl erythromycin C.

Figure IB: Structure of 5-0-dedesosaminyl-5-0-mycaminosyl azithromycin.

Figure 2: Schematic overview over the gene cassette cloning strategy. Vector pSG144 was derived from vector pSG142 (Gaisser et al, 2000). Abbreviations: dam : DNA isolated from dam^' strain background, Xbal^met: Xbal site sensitive to Dam methylation, eryRHS: DNA fragment of the right hand side of the ery-cluster as described previously (Gaisser et al, 2000).

Figure 3: Amino acid comparison between the published sequence of TylAI (below, SEQ ID NO: 1) and the amino acid sequence detected from the sequencing data described in this invention (above, SEQ ID NO: 2). The changes in the amino acid sequence are underlined.

Figure 4: Amino acid comparison between the published sequence of TylAII (below, SEQ ID NO: 3) and the amino acid sequence detected from the sequencing data described in this invention (above, SEQ ID NO: 4). The changes in the amino acid sequence are underlined.

Figure 5: Structure of 5-0-angolosaminyl tylactone.

Figure 6: Shows an overview of the angolamycin polyketide synthase gene cluster.

Figure 7: The DNA sequence which comprises orfH and or/75 (angB) from the angolamycin gene cluster (SEQ ID NO: 5).

Figure 8: The DNA sequence which comprises orβ (angAI), orβ (angAII) and orf4 from the angolamycin gene cluster (SEQ ID NO: 6).

Figure 9: The DNA sequence which comprises orfl * (angMIII), orβ* (angMII), and orβ* (angMI) from the angolamycin gene cluster (SEQ ID NO: 7). Figure 10: The amino acid sequence which corresponds to orβ (angAI, SEQ ID NO: 8).

Figure 1 1 : The amino acid sequence which corresponds to orβ (angAII, SEQ ID NO: 9).

Figure 12: The amino acid sequence which corresponds to orfl (SEQ ID NO: 10)

Figure 13: The amino acid sequence which corresponds to orfl 4 (SEQ ID NO: 11).

Figure 14: The amino acid sequence which corresponds to orfl 5 (angB, SEQ ID NO: 12).

Figure 15: The amino acid sequence which corresponds to orfl* (angMIII, SEQ ID NO: 13).

Figure 16: The amino acid sequence which corresponds to orβ* (angMII, SEQ ID NO: 14).

Figure 17: The amino acid sequence which corresponds to orβ* (angMI, SEQ ID NO: 15).

General Methods Escherichia coli XLl-Blue MR (Stratagene), E. coli DH10B (GibcoBRL) and E. coli ET12567 were grown in 2xTY medium as described by Sambrook et al, (1989). Vector pUC18, pUC19 and Litmus 28 were obtained from New England Biolabs. E. coli transformants were selected with 100 μg/mL ampicilhn. Conditions used for growing the Saccharopolyspora erythraea NRRL 2338-red variant strain were as described previously (Gaisser et al, 1997, Gaisser etal, 1998). Expression vectors in S. erythraea were derived from plasmid pSG142 (Gaisser et al, 2000). Plasmid-containing S. erythraea were selected with 25-40 μg/mL thiostrepton or 50 μg/mL apramycin. To investigate the production of antibiotics, S. erythraea strains were grown in sucrose-succinate medium (Caffrey et al, 1992) as described previously (Gaisser et al, 1997) and the cells were harvested by centrifugation. Chromosomal DNA of Streptomyces rochei ATCC21250 was isolated using standard procedures (Kieser et al, 2000). Feedings of 3-O-mycarosyl erythronolide B or tylactone were carried out at concentrations between 25 to 50 mg /L.

DNA manipulation and sequencing DNA manipulations, PCR and electroporation procedures were carried out as described in Sambrook et al, (1989). Protoplast formation and transformation procedures of S. erythraea were as described previously (Gaisser et al, 1997). Southern hybridizations were carried out with probes labelled with digoxigenin using the DIG DNA labelling kit (Boehringer Mannheim). DNA sequencing was performed as described previously (Gaisser et al, 1997), using automated DNA sequencing on double stranded DNA templates with an ABI Prism 3700 DNA Analyzer. Sequence data were analysed using standard programs.

Extraction and mass spectrometry 1 mL of each fermentation broth was harvested and the pH was adjusted to pH 9. For extractions an equal volume of ethyl acetate, methanol or acetonitrile was added, mixed for at least 30 min and centrifuged. For extractions with ethyl acetate, the organic layer was evaporated to dryness and then re- dissolved in 0.5 mL methanol. For methanol and acetonitrile extractions, supernatant was collected after centrifugation and used for analysis. High resolution spectra were obtained on a Bruker BioApex II FT- ICR (Bruker, Bremen, FRG). Analysis of culture broths An aliquot of whole broth (1 mL) was shaken with CH₃CN (1 mL) for 30 minutes. The mixture was clarified by centrifugation and the supernatant analysed by LCMS. The HPLC system comprised an Agilent HP1 100 equipped with a Luna 5 μm C18 BDS 4.6 x 250 mm column (Phenomenex, Macclesfield, UK) heated to 40 °C. The gradient elution was from 25% mobile phase B to 75% mobile phase B over 19 minutes at a flow rate of 1 mL/min. Mobile phase A was 10% acetonitrile: 90% water, containing 10 mM ammonium acetate and 0.15% formic acid, mobile phase B was 90% acetonitrile: 10% water, containing 10 mM ammonium acetate and 0.15% formic acid. The HPLC system described was coupled to a Bruker Daltonics Esquire3000 electrospray mass spectrometer operating in positive ion mode.

Extraction and purification protocol: For NMR analysis of 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A the fermentation broth was clarified by centrifugation to provide supernatant and cells. The supernatant was applied to a column (16 x 15 cm) of Diaion^® HP20 resin (Supelco), washed with 10% Me₂CO/H₂0 (2 x 2 L) and then eluted with Me₂CO (3.5 L). The cells were mixed to homogeneity with an equal volume of Me₂CO/MeOH (1 :1). After at least 30 minutes the slurry was clarified by centrifugation and the supernatant decanted. The pelleted cells were similarly extracted once more with Me₂CO/MeOH (1:1). The cell extracts were combined with the Me₂CO from the HP20 column and the solvent was removed in vacuo to give an aqueous concentrate. The aqueous was extracted with EtOAc (3 x) and the solvent removed in vacuo to give a crude extract. The residue was dissolved in CH₃CN/MeOH and purified by repeated rounds of reverse phase (C18) high performance liquid chromatography using a Gilson HPLC, eluting a Phenomenex 21.2 x 250 mm Luna 5 μm C18 BDS column at 21 mL/min. Elution with a linear gradient of 32.5% B to 63% B was used to concentrate the macrolides followed by isocratic elution with 30%) B to resolve the individual erythromycins. Mobile phase A was 20 mM ammonium acetate and mobile phase B was acetonitrile. High resolution mass spectra were acquired on a Bruker BioApex II FTICR (Bruker, Bremen, Germany).

For NMR analysis of 5-0-angolosaminyl tylactone bioconversion experiments were performed as previously described with four 2 L flasks containing each 400 mL of SSDM medium inoculated with 5% of pre-cultures. Feedings with tylactone were carried out at 50 mg/L. The culture was centrifuged and the pH of the supernatant was adjusted to about pH 9 followed by extractions with three equal volumes of ethyl acetate. The cell pellet was extracted twice with equal volumes of a mixture of acetone-methanol (50:50, vol/vol). The extracts were combined and concentrated in vacuo. The resulting aqueous fraction was extracted three times with ethyl acetate and the extracts were combined and evaporated until dryness. This semi purified extract was dissolved in methanol and purified by preparative HPLC on a Gilson 315 system using a 21 mm x 250 mm Prodigy ODS3 column (Phenomenex, Macclesfield, UK). The mobile phase was pumped at a flow rate of 21 mL/min as a binary system consisting of 30% CH₃CN, 70% H₂0 increasing linearly to 70%) CH₃CN over 20 min.

Sequence Information Table I - Se uence in ormation or the an olosamine bios nthetic enes included in the ene cassettes

Note : c indicates that the gene is encoded by the complement DNA strand potential functions of the predicted polypeptides (SEQ ID No.8 to 15) were obtained from the NCBI database using a BLAST search.

Example 1: Bioconversion of 3-0-mycarosyl erythronolide B to 5-0-dedesosaminy_-5-0- mycaminosyl erythromycins using gene cassette pSG144tylAItyIAπtylMIIItylBtylIatylMIeryCIII.

Isolation ofpSGH3 Plasmid pSGl 42 (Gaisser et al, 2000) was digested with Xbal and a fill-in reaction was performed using standard protocols. The DNA was re- ligated and used to transform E. coli DH10B. Construct pSG143 was isolated and the removal of the_YbαI site was confirmed by sequence analysis.

Isolation ofpUC18eryBVcas The gene eryBV was amplified by PCR using the primers cas01eG21 (WO01/79520) and 7966 5'- GGGGAATTCAGATCTGGTCTAGAGGTCAGCCGGCGTGGCGGCGCGTGAGTTCCTCCAGTCGC GGGACGATCT -3' (SEQ ID NO: 16) and pSG142 (Gaisser et al, 2000) as template. The PCR fragment was cloned using standard procedures and plasmid pUC 18eryBVcas was isolated with an Ndel site overlapping the start codon of eryBV a d Xbαl and BgRl sites (underlined) following the stop codon. The construct was verified by sequence analysis.

Isolation of vector pSGLitl The isolation of this vector is described in PCT/GB03/003230. Isolation of pSGLitl eryCIII Plasmid pSGCIII (WOO 1/79520) was digested with NdellBglll and the insert fragment was isolated and ligated with the NdellBglll treated vector fragment of pSGLitl . The ligation was used to transform E. coli ET12567 and plasmid pSGLitl eryCIII was isolated using standard procedures. The construct was confirmed using restriction digests and sequence analysis. This cloning strategy allows the introduction of a his-tag C-terminal of EryCIII.

Isolation of pSGLitl tylMII Plasmid pSGTYLM2 (WO01/7952) was digested with NdellBglll and the insert fragment was isolated and ligated with the NdellBglll treated vector fragment of pSGLitl. The ligation was used to transform E. coli ET12567 and plasmid pSGLitl tylMII was isolated using standard procedures. The construct was confirmed using restriction digests and sequence analysis. This cloning strategy allows the introduction of a his-tag C-terminal of TylMII.

Isolation ofpSG144 Plasmid pSGLitl was isolated and digested with NdellBglll and an approximately 1.3 kb insert was isolated. Plasmid pSG143 was digested with NdeVBglll, the vector band was isolated and ligated with the approximately 1.3 kb band from pSGLitl followed by transformation of E. coli DH10B. Plasmid pSG144 (Figure 2) was isolated and the construct was verified by DNA sequence analysis. This vector allows the assembly of gene cassettes directly in an expression vector (Figure 2) without prior assembly in pUC-derived vectors (WO 01/79520) in analogy to PCT/GB03/003230 using vector pSG144 instead of pSGsetl . Plasmid pSG144 differs from pSG142 in that the Xbal site between the thiostrepton resistance gene and the eryRHS has been deleted and the his- tag at the end of eryBV has been removed from pSG142 and replaced in pSG144 with an Xbαl site at the end of eryBV. This is to facilitate direct cloning of genes to replace eryBV and then build up the cassette.

Isolation ofpSGH4eryCIII EryCIII was amplified by PCR reaction using standard protocols, with primers cas01eG21 (WO 01/79520) and caseryCIII2 (WO 01/79520) and plasmid pSGCIII (Gaisser et al, 2000) as template. The approximately 1.3 kb PCR product was isolated and cloned into pUC18 using standard techniques. Plasmid pUCCIIIcass was isolated and the sequence was verified. The insert fragment of plasmid pUCCIIIcass was isolated after NdellXbal digestion and ligated with the NdellXbal digested vector fragment of pSG144. After the transformation of E. coli DH10B plasmid pSG144eryC//7was isolated using standard techniques.

Isolation ofpUC19tylAI Primers BIOSG34 5'-GGGCATATGAACGACCGTCCCCGCCGCGCCATGAAGGG- 3' (SEQ ID NO: 17) and 5'-CCCCTCTAGAGGTCACTGTGCCCGGCTGTCGGCGGCGGCCCCGCGCATGG- 3' (SEQ ID NO: 18) were used with genomic DNA of Streptomyces fradiae as template to amplify tylAI. The amplified product was cloned using standard protocols and plasmid p\JCl9tylAI v/as isolated. The insert was verified by DNA sequence analysis. Differences to the published sequence are shown in Figure

3.

Isolation ofpSGLit2 Plasmid Litmus 28 was digested with SpellXbal and the vector fragment was isolated. Plasmid pSGLitl (dam ) was digested with Xbal and the insert band was isolated and ligated with the SpellXbal digested vector fragment of Litmus 28 followed by the transformation of E. coli DH10B using standard techniques. Plasmid pSGLit2 was isolated and the construct was verified by restriction digest and sequence analysis. This plasmid can be used to add a 5' region containing n Xbal site sensitive to Dam methylation and a Shine Dalgarno region thus converting genes which were originally cloned with an Ndel site overlapping the start codon and an Xbal site 3 ' of the stop codon for the assembly of gene cassettes. This conversion includes the transformation of the ligations into E. coli ET12567 followed by the isolation of dam^' DNA and Xbal digests. Examples for this strategy are outlined below.

Isolation of pSGLU2tylAI Plasmid pSGLit2 and pUC 19tylAI were digested with Ndel lXbal and the insert band of pUCl9tylAI and the vector band of pSGLit2 were isolated, ligated and used to transform E. coli ET12567. Plasmid pSGLitltylAI (dam^') was isolated.

Isolation ofpUC19tylAII Primers 5'-CCCCTCTAGAGGTCATGCGCGCTCCAGTTCCCTGCCGCCCGGGGACCGC TTG- 3' (SEQ ID NO: 19) and 5' -GGGTCTAGATCGATTAATTAAGGAGGACATTCATGCGCGT CCTGGTGACCGGAGGTGCGGGCTTCATCGGCTCGCACTTCA- 3' (SEQ ID NO: 20) and genomic DNA of Streptomyces fradiae as template were used for a PCR reaction applying standard protocols to amplify tylAII. The approximately 1 kb sized DNA fragment was isolated and cloned into Sma -cut pUC19 using standard techniques. The DNA sequencing of this construct revealed that 12 nucleotides at the 5' end had been removed possibly by an exonuclease activity present in the PCR reaction. The comparison of the amino acid sequence of the cloned fragment compared to the published sequence is shown in Figure 4.

Isolation of pSGLit2 tylAII To add the missing 5 '-nucleotides, pSGLit2 was digested with PacllXbal and the vector fragment was isolated and ligated with the PacllXbal digested insert fragment of pUC 19ty/v__7. The ligated DNA was used to transform E. coli ET12567 and plasmid

was isolated. Isolation of plasmid p UC19eryC VI The eiyCVIgQne was amplified by PCR using primer BIOSG28 5 ' -GGGC ATATGTACGAGGG CGGGTTCGCCGAGCTTTACGACC-3' (SEQ ID NO: 21) and BIOSG29 5 '-GGGGTCTAGAGGTCAT CCGCGC AC ACCGACGAACAACCCG-3 ' (SEQ ID NO: 22) and plasmid pNC062 (Gaisser et al,

1997) as a template. The PCR product was cloned into Smαl digested pUC19 using standard techniques and plasmid pGC19eryCVI was isolated and verified by sequence analysis.

Isolation of plasmid pSGLit2 eryCVI Plasmid p\JC19eryCVI was digested with NdellXbal and ligated with the NdellXbal digested vector fragment of pSGLit2 followed by transformation of E. coli ET12567. Plasmid pSGLit2eryCF_^" (dam ) was isolated.

Isolation of plasmid pSG144tylAI Plasmid pSG144 and pUC19ty _47 were digested with NdellXbal and the insert band of pUC 19tylAI and the vector band of pSG144 were isolated, ligated and used to transform E. coli DH10B. Plasmid pSG\44tylAI was isolated using standard protocols.

Isolation of plasmid pSGH4tylAItyl All Plasmid pSGLit2ty/_4_7 (dam ) was digested with Xbal and ligated with Xbal digested plasmid pSG144ty/_i_. The ligation was used to transform E. coli DH10B and plasmid pSG144ty/_4_^"ty/_4_7 was isolated and verified using standard protocols.

Isolation of plasmid pSGLit2tylMIII Plasmid pUCl 8tylM3 (Isolation described in WO01/79520) was digested with NdellXbal and the insert band and the vector band of NdellXbal digested pSGLit2 were isolated, ligated and used to transform E. coli ET12567. Plasmid pSGLit2tylMIII (dam^') was isolated using standard protocols. The construct was verified using restriction digests and sequence analysis.

Isolation of plasmid pSG144tylAItylAIItylMIII Plasmid pSGLit2ty. /_7 (dam ) was digested with Xbal and the insert band was ligated with Xbal digested plasmid pSG 144tylAItylAII. The ligation was used to transform E. coli DH10B and plasmid pSG\ 4tylAItylAIItylMIII no36 was isolated using standard protocols. The construct was verified using restriction digests and sequence analysis. Isolation of plasmid pSGLit2tylB Plasmid pUC18ty/_? (Isolation described in WO01/79520) was digested with PacllXbal and the insert band and the vector band of PacllXbal digested pSGLit2 were isolated, ligated and used to transform E. coli ET12567. Plasmid pSGLit2tv/_3 nol (dam ) was isolated using standard protocols.

Isolation of plasmid pSG144tylAItylAIItylMIIItylB Plasmid pSGL.t2ty._3 (dam ) was digested with_¥δαl and the insert band was ligated with _Ω>αI digested plasmid pSGl44tylAItylAIItylMIII. The ligation was used to transform E. coli DHIOB and plasmid pSGl 44tylAItylAIItylMIIItylB no5 was isolated using standard protocols and verified by restriction digests and sequence analysis.

Isolation of plasmid pUC18tylIa Primers BIOSG 88 5'-GGGCATATGGCGGCGAGCACTACGACGGAGGGGAATGT-3' (SEQ ID NO: 23) and BIOSG 89 5 '-GGGTCTAGAGGTCACGGGTGGCTCCTGCCGGCCCTCAG-3 ' (SEQ ID NO: 24) were used to amplify tylla using a plasmid carrying the tyl region (accession number u08223.em_pro2) comprising ORF1 (cytochrome P450) to the end of ORF2 (TylB) as a template. Plasmid pGCtylla nol was isolated using standard procedures and the construct was verified using sequence analysis.

Isolation of plasmid pSGLit2tylIa Plasmid pGCtylla nol was digested with NdellXbal and the insert band and the vector band of NdellXbal digested pSGLit2 were isolated, ligated and used to transform E. coli ET12567. Plasmid pSGLit2ty// no 54 (dam ) was isolated using standard protocols. The construct was verified using sequence analysis.

Isolation of plasmid pSG144tylAItylAIItylMIIItylBtylIa Plasmid pSGLit2ty/7α (dam ) was digested with Xbal and the insert band was ligated with Xbal digested plasmid pSG\44tylAItylAIItylMIIItylB. The ligation was used to transform E, coli DH10B and plasmid pSG\44tylAItylAIItylMIIItylBtylIa no3 was isolated using standard protocols and verified by restriction digests and sequence analysis.

Isolation of plasmid pSGLitl tylMIeryCIII Plasmid pUCtylMI (Isolation described in WO01/79520) was Pad digested and the insert was ligated with the Pad digested vector fragment of pSGLitl eryCIII using standard procedures. Plasmid pSGLitltv /eryC/_7no20 was isolated and the orientation was confirmed by restriction digests and sequence analysis.

Isolation of gene cassette pSG144tylAItylAIItylMIIItylBtyllatylMIeryCIII Plasmid pSGLitl tylMIeryCIII no20 was digested with Xbal/Bglϊl and the insert band was isolated and ligated with the Xbal/Bglll digested vector fragment of plasmid pSG144tylAItylAIItylMIIItylBtylIa no3. Plasmid pSGl 44tylAItylAIItylMIIItylBtyllatylMIeryCIII was isolated using standard procedures and the construct was confirmed using restriction digests and sequence analysis. Plasmid preparations were used to transform S. erythraea mutant strains with standard procedures.

Isolation of plasmid pSGKC 1 To prevent the conversion of the substrate 3-O-mycarosyl erythronolide B to 3,5-di-O-mycarosyl erythronolide B a further chromosomal mutation was introduced into S. erythraea SGQ2 (Isolation described in WO 01/79520) to prevent the biosynthesis of L-mycarose in the strain background. Plasmid pSGKCl was isolated by cloning the approximately 0.7 kb DNA fragment of the eryBVI gene by using

PCR amplification with cosmid2 or plasmid pGGl (WOOl/79520) as a template and with the primers 646 5'-CATCGTCAAGGAGTTCGACGGT- 3' (SEQ ID NO: 25) and 874 5'-GCCAGCTCGGCGACGTCC ATC- 3 ' (SEQ ID NO: 26) using standard protocols. Cosmid 2 containing the right hand site of the ery- cluster was isolated from an existing cosmid library (Gaisser et al, 1997) by screening with eryBV as a probe using standard techniques. The amplified DNA fragment was isolated and cloned into iϊcoRV digested pKCl 132 (Bierman et al, 1992) using standard methods. The ligated DNA was used to transform E. coli DH10B and plasmid pSGKCl was isolated using standard molecular biological techniques. The construct was verified by DNA sequence analysis.

Isolation ofS. erythraea Q42/1 (Biot-2166) Plasmid pSGKCl was used to transform S. erythraea SGQ2 using standard techniques followed by selection with apramycin. Thiostrepton/apramycin resistant transformant S. erythraea Q42/1 was isolated.

Bioconversion using S. erythraea Q42/lpSG144tylAItylAIItylMIIItylBtyllatylMIeryCIII Bioconversion assays using 3-O-mycarosyl erythronolide B are carried out as described in General Methods. Improved levels of mycaminosyl erythromycin A are detected in bioconversion assays using S. erythraea Q42/lpSG\44tylAItylAIItylMIIItylBtyllatylMIeryCIII compared to bioconversion levels previously observed (WOOl/79520). Example 2: Isolation of mycaminosyl tylactone using gene cassette pSG 4tylAItylAπtylMIIItylBtylIatylMItylMII

Isolation of ^'plasmid pSGLitl tylMItylMII Plasmid pGCtylMI (Isolation described in WOOl/79520) was Pad digested and the insert was ligated with the Pad digested vector fragment of pSGLitl tylMII using standard procedures. Plasmid pSGLitl tylMItylMII nol6 was isolated and the construct was confirmed by restriction digests and sequence analysis.

Isolation of plasmid pSG144tylAItylAIItylMIIItylBtylIatylMItylMII Plasmid pSGLitl tylMItylMII nol 6 was digested with XbaUBglll and the insert band was isolated and ligated with the Xbal/BgHl digested vector fragment of plasmid pSG144tylAItylAIItylMIIItylBtylIa no3. Plasmid pSGl 44tylAItylAIItylMIIItylBtyllatylMItylMII was isolated using standard procedures and the construct was confirmed using restriction digests and sequence analysis. The plasmid was isolated and used for transformation of S. erythraea mutant strains using standard protocols.

Bioconversion using gene cassette pSG144tylAItylAIItylMIIItylBtyllatylMItylMII The conversion of fed tylactone to mycaminosyl tylactone was assessed in bioconversion assays using S. erythraea Q42l\pSG\44tylAItylAIItylMIIItylBtyllatylMItylMII. Bioconversion assays were carried out using standard protocols. The analysis of the culture showed the major ion to be 568.8 [M+H]⁺ consistent with the presence of mycaminosyl tylactone. Fragmentation of this ion gave a daughter ion of m/z 174, as expected for protonated mycaminose. No tylactone was detected during the analysis of the culture extracts, indicating that the bioconversion of the fed tylactone was complete. Recently, a homologue of Tylla was identified in the biosynthetic pathway of dTDP-3-acetamido- 3,6-dideoxy-alpha-D-galactose in Aneurinibacillus thermoaerophilus L420-91^τ (Pfoestl et al, 2003) and the function was postulated as a novel type of isomerase capable of synthesizing dTDP-6-deoxy-D- xylohex-3-ulose from dTDP-6-deoxy-D-xylohex-4-ulose.

Example 3: Bioconversion of 3-O-mycarosyl erythronolide B to 5-0-dedesosaminyl-5-0- mycaminosyl erythromycins using gene cassette pSG1448/27/95/21/44/193/6eryCIII (pSG144angAIangAHorfl4angMIIIangBangMIeryCIH).

Cloning of angMIII by isolating plasmid Lit 1/4 The gene angMIII was amplified by PCR using the primers BIOSG61 5'- GGGCATATGAGCCCCGCACCCGCCACCGAGGACCC -3' (SEQ ID NO: 27) and BIOSG62 5'- GGTCTAGAGGTCAGTTCCGCGGTGCGGTGGCGGGCAGGTCAC -3' (SEQ ID NO: 28).

Cosmid5B2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The

1.4 kb PCR fragment (PCR nol) was cloned using standard procedures and EcoKV digested plasmid

Litmus28. Plasmid LitI/4 was isolated with an Ndel site overlapping the start codon of angMIII and an Xbal site following the stop codon. The construct was verified by sequence analysis.

Isolation of plasm id pSGLit21/4 Plasmid Lι^'tl/4 was digested with NdellXbal and the about 1.4 kb fragment was isolated and ligated to NdellXbal digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLιX21/4 no7 (dam ) was isolated. This construct was digested with Xbal and used for the construction of gene cassettes.

Cloning of angMII by isolating plasmid LU2/8 The gene angMII was amplified by PCR using the primers BIOSG63 5 '-GGGC ATATGCGTATC CTGCTGACGTCGTTCGCGCACAACAC -3' (SEQ ID NO: 29) and BIOSG64 5'-GGTCTAGAGGTCA GGCGCGGCGGTGCGCGGCGGTGAGGCGTTCG -3' (SEQ ID NO: 30) and cosmid5B2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 1.3 kb PCR fragment (PCR no2) was cloned using standard procedures and iϊcoRV digested plasmid Litmus28. Plasmid Lit2/<§ was isolated with an Ndel site overlapping the start codon of angMII and anXbαl site following the stop codon. The construct was verified by sequence analysis.

Cloning of angMII by isolating plasmid pLitangMII(Bglll) The gene angMII was amplified by PCR using primers BIOSG63 5'-GGGCATATGCGTATCCT GCTGACGTCGTTCGCGCACAACAC -3' (SEQ ID NO: 29) and BIOSG80 5 '-GGAGATCTGGCGCG GCGGTGCGCGGCGGTGAGGCGTTCG -3' (SEQ ID NO: 31) and cosmid5B2 containing a fragment of the angolamycin biosynthetic pathway as template. The 1.3 kb PCR fragment was cloned using standard procedures and _ϊcoRV digested plasmid Litmus28. Plasmid LitangMII(BglII)no8 was isolated with an Ndel site overlapping the start codon of angMII and a Bglϊ site instead of a stop codon thus allowing the addition of a his-tag. The construct was verified by sequence analysis.

Isolation of plasmid pSGLitl angMII Plasmid Lι^'tangMII(Bglll) was digested with NdellBglll and ligated with the NdellBglll digested vector fragment of pSGLitl. The ligation was used to transform E. coli ET12567 and plasmid pSGLitl angMII (dam ) was isolated using standard procedures. Cloning of angMI by isolating plasmid Lit3/ 6 The gene angMI was amplified by PCR using the primers BIOSG65 5'-GGGCATATGAAC CTCGAATACAGCGGCGACATCGCCCGGTTG -3' (SEQ ID NO: 32) and BIOSG66 5'- GGTCTAGAGGTCAGGCCTGGACGCCGACGAAGAGTCCGCGGTCG -3' (SEQ ID NO: 33) and cosmid5B2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 0.75 kb PCR fragment (PCR no3) was cloned using standard procedures and .EcoRV digested plasmid Litmus28. Plasmid Lit3/<5 was isolated with an Ndel site overlapping the start codon of angMI and an Xbαl site following the stop codon. The construct was verified by sequence analysis.

Isolation of plasmid pSGlit23/6 no8 Plasmid was digested with NdellXbal and the about 0.8 kb fragment was isolated and ligated to NdellXbal digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit23/<5 no8 (dam ) was isolated. This construct was digested with Xbal and the isolated about 1 kb fragment was used for the assembly of gene cassettes.

Cloning of angB by isolating plasmid Lit4/ 19 The gene angB was amplified by PCR using the primers BIOSG67 5'-GGGCATATGACTACCT ACGTCTGGGACTACCTGGCGG -3' (SEQ ID NO: 34) and BIOSG68 5 '-GGTCTAGAGGTC AG AGC GTGGCCAGTACCTCGTGCAGGGC -3' (SEQ ID NO: 35) and cosmid4H2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 1.2 kb PCR fragment (PCR no4) was cloned using standard procedures and EcoKY digested plasmid Litmus28. Plasmid lλt4/19 was isolated with an Ndel site overlapping the start codon of angB and an Xbal site following the stop codon. The construct was verified by sequence analysis.

Isolation of plasmid pSGlit24/l 9 Plasmid IZA4/19 was digested with NdellXbal and the 1.2 kb fragment was isolated and ligated into NdellXbal digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit2 /79 no24 (dam ) was isolated. This construct was digested with_¥Z>αI and the isolated 1.2 kb fragment was used for the assembly of gene cassettes.

Cloning of orfH by isolating plasmid Lit 5/2 The gene orfl 4 was amplified by PCR using the primers BIOSG69 5 '-GGGC ATATGGTGAA CGATCCGATGCCGCGCGGCAGTGGCAG-3' (SEQ ID NO: 36) and BIOSG70 5'-GGTCTAGAGGT CAACCTCCAGAGTGTTTCGATGGGGTGGTGGG-3' (SEQ ID NO: 37) and cosmid4H2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 1.0 kb PCR fragment (PCR no5) was cloned using standard procedures and .EcoRV digested plasmid Litmus28. Plasmid L^' .5/2 was isolated with an Ndel site overlapping the start codon of ORFH and an Xbal site following the stop codon. The construct was verified by sequence analysis.

Isolation of plasmid pSGlit25/2 no24 Plasmid Lit5/2 was digested with NdellXbal and the approximately 1 kb fragment was isolated and ligated to NdellXbal digested DNA of pSGZ,.t2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit25/2 no24 (dam ) was isolated. This construct was digested with Xbal, the about 1 kb fragment isolated and used for the assembly of gene cassettes.

Isolation of plasmid pSGlit27/9 no 15 Plasmid Lit7/9 was digested with NdellXbal and the approximately 1 kb fragment was isolated and ligated to NdellXbal digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit27/9 no 15 (dam ) was isolated. This construct was digested with Xbal and the isolated 1 kb fragment was used for the assembly of gene cassettes.

Cloning of angAI (orβ) by isolating plasmid LU8/2 The gene angAI was amplified by PCR using the primers BIOSG73 5'-GGGCATATGAAGGGC

ATCATCCTGGCGGGCGGCAGCGGC-3' (SEQ ID NO: 38) and BIOSG74 5 '-GGTCTAG AGGTC AT GCGGCCGGTCCGGACATGAGGGTCTCCGCCAC-3' (SEQ ID NO: 39) and cosmid4H2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The around 1.0 kb PCR fragment (PCR no8) was cloned using standard procedures and iicoRV digested plasmid Litmus28.

Plasmid Litδ/2 was isolated with an Ndel site overlapping the start codon of angAI and an Xbal site following the stop codon. The construct was verified by sequence analysis.

Cloning of angAII (orβ) by isolating plasmid LU7/9 The gene angAII was amplified by PCR using the primers BIOSG71 5 '-GGGC ATATGCGGCTG

CTGGTCACCGGAGGTGCGGGC-3' (SEQ ID NO: 40) and BIOSG72 5 '-GGTCTAGAGGTC AGTCG

GTGCGCCGGGCCTCCTGCG-3' (SEQ ID NO: 41) and cosmid4H2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 1.0 kb PCR fragment was cloned using standard procedures and i_coRV digested plasmid Litmus28. Plasmid lZ\t7/9 was isolated with an Ndel site overlapping the start codon of angAII and an Xbal site following the stop codon. The construct was verified by sequence analysis.

Isolation of plasmid pSGlit28/2 no 18 (pSGLU2angAI) Plasmid LitS/2 was digested with NdellXbal and the 1 kb fragment was isolated and ligated to

NdellXbal digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit2S/2 no 18 (dam ) was isolated.

Isolation of plasmid pSGl 448/2 (pSG144angAI) Plasmid LitS/2 was digested with NdellXbal and the approximately 1 kb fragment was isolated and ligated with NdellXbal digested DNA of pSG144. The ligation was used to transform E. coli DHIOB and plasmid pSG 1448/2 (dam^') (pSG144α«g_4.Z) was isolated using standard procedures. This construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSG 1448/27/9 (pSG144angAIangAII) Plasmid pSGLit27/9 (isolated from E.coli ET12567) was digested withJϊδ l and the 1 kb fragment was isolated and ligated with the Xbal digested vector fragment of pSGl448/2 (pSG\44angAI). The ligation was used to transform E. coli DHIOB and plasmid pSG 1445/27/9 (pSGl 4angAIangAII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSG 1448/27/91/4 (pSG144angAIangAIIangMIII) Plasmid pSGLit2_/¥ (isolated from E. coli ET12567) was digested with _^Yδαl and the 1.4 kb fragment was isolated and ligated with the Xbal digested vector fragment of pSG144§/27/9

(pSGl 44angAIangAII). The ligation was used to transform E. coli DH10B and plasmid pSG144S/27/91/4 (pSG \44angAIangAIIangMIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSG 1448/27/91/44/19 (pSG144angAIangAIIangMIIIangB) Plasmid pSGLit24/19 (isolated from E. coli ET12567) was digested with Xbal and the about 1.2 kb fragment was isolated and ligated with the Xbal digested vector fragment of pSG\448/27/91/4 (pSG\44angAIangAIIangMIII). The ligation was used to transform E. coli DH10B and plasmid pS>G\448/27/91/44/19 (pSGl 44angAIangAIIangMIIIangB) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSG 1448/27/91/44/193/6 (pSG144angAIangAIIangMIIIangBangMI) Plasmid pSGLit23/6 (isolated from E. coli ET12567) was digested with Xbal and the about 0.8 kb fragment was isolated and ligated with theXbal digested vector fragment of pSG1448/27/91/44/19 (pSG\ 44angAIangAIIangMIIIangB). The ligation was used to transform E. coli DH10B and plasmid pSG\448/27/91/44/193/6 (pSG144angAIangAIIangMIIIangBangMI) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSGH48/27/91/44/193/6eryCIII (pSG144angAIangAIIangMIIIangBangMIeryCIII) Plasmid pSGLitl eryCIII (isolated from E. coli ET12567) was digested with Xbal/Bglll and the about 1.2 kb fragment was isolated and ligated with the-Y&αl digested and partially Bglll digested vector fragment of pSGl 448/27/91/44/ 193/6 (pSG144angAIangAIIangMIIIangBangMI). The Bglll partial digest was necessary due to the presence of a Bglll site in angB. The ligation was used to transform E. coli DHI OB and plasmid pSGU48/27/91/44/193/6eryCIII no9 (pSG 1 4angAIangAIIangMIIIangBangMIeryCIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. EryCIII carries a his-tag fusion at the end.

Bioconversion of 3-O-mycαrosyl erythronolide B to 5-0-dedesosαminyl-5-0-mycαminosyl erythromycin

A using S. erythraea Q42/lpSGl448l27/91/44ll93l6eryCIII no9 (pSG 144angAIangAIIangMIIIangBangMIeryCIII) The S. erythraea strain Q42llpSG1448/27/91/44/193/6eryCIII was grown and bioconversions with fed 3-O-mycarosyl erythronolide B were performed as described in the General Methods. The cultures were analysed and a small amount of a compound with m/z 750 was detected consistent with the presence of 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A.

Isolation of plasmid pSG1448/27/95/2 (pSG144angAIangAIIorfl4) Plasmid pSGLit25/2 (isolated from E. coli ET12567) was digested with_Y&αI and the about 1 kb fragment was isolated and ligated with the _Y&αI digested vector fragment of pSG1448/27/°

(pSGl44angAIangAII). The ligation was used to transform E. coli DH10B and plasmid pSGl448/27/95/2 (pSG 44angAIangAIIorf 14) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSGH48/27/95/21/4 (pSG144angAIangAIIorfl4angMIII) Plasmid pSGLit2_7 (isolated from E. coli ET12567) was digested with _Ω>αI and the 1.4 kb fragment was isolated and ligated with the Xbal digested vector fragment of pSG\448/27/95/2 (pSGl 44angAIangAIIorfl 4). The ligation was used to transform E. coli DH10B and plasmid pSG 1448/27/95/21/4 (pSGl44angAIangAIIorfl4angMIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSGl 448/27/95/21/44/19 (pSGH4angAIangAIIorfl4angMIIIangB) Plasmid pSGLit24/19 (isolated from E. coli ET12567) was digested with Xbal and the 1.2 kb fragment was isolated and ligated with the Xbal digested vector fragment of pSG1448/27/95/27/

(pSG \44angAIangAIIorfl4angMIII). The ligation was used to transform E. coli DHIOB and plasmid pSGU48/27/95/21/44/19 (pSGl44angAIangAIIorfI4angMIIIangB) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSGl 448/27/95/21/44/193/6eryCIII (pSGl 44angAIangAIIorfl 4angMIIIangBangMIeryCIII) Plasmid pSG\448/27/91/44/193/6eryCIII no9 was digested with Bglll and the about 2 kb fragment was isolated and ligated with the Bglll digested vector fragment of pSG\448/27/95/21/44/19

(pSG 144angAIangAIIorfl4angMIIIangB). The ligation was used to transform E. coli DHIOB and plasmid pSG\448/27/95/21/44/193/6eryCIII(pSGl44angAIangAIIorfl4angMIIIangBangMIeryCIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. EryCIII carries a his-tag fusion at the end. The construct was used to transform S. erythraea SGQ2 using standard procedures.

Bioconversion of 3-O-mycarosyl erythronolide B to 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A The S. erythraea strain SGQ2pSG1448/27/9-5/ 1/44/193/6eryCIII was grown and bioconversions with fed 3-0-mycarosyl erythronolide B were performed as described in the General Methods. The cultures were analysed and improved amounts of a compound with m/z 750 was detected consistent with the presence of 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A. Similar results were obtained with the S. erythraea strain Q42/1 containing the gene cassette pSG1448/27/95/21/44/193/6eryCIII. 16 mg of the compound with m/z 750 was purified and the structure of 5-0-dedesosaminyl-5-0- mycaminosyl erythromycin A was confirmed by NMR analysis (See Table I and Figure 1).

Table II: Η and ^l3C NMR data for 5-0-dedesosaminyl-5-0-mvcaminosyl erythromycin A (BC156) Position δy Multiplicity Coupling δc 1 175.4 2 2.83 dq 9.6,7.1 44.9 3 3.91 dd 9.7, 1.6 80.0 4 2.00 m 39.1 5 3.53 d 6.8 85.4 6 74.8 7 1.66 dd 14.8,2.2 38.5 1.82 dd 14.8,11.4 8 2.69 dqd 11.3,7.0,2.2 44.9 9 221.6 10 3.06 qd 6.9,1.3 38.0 11 3.81 d 1.3 68.9 Position δ_H Multiplicity Coupling δc 12 74.6 13 5.04 dd 11.0, 2.3 76.8^a 14 1.47 dqd 14.3, 11.0, 7.2 21.1 1.91 ddq 14.3, 7.5, 2.2 15 0.83 dd 7.4, 7.4 10.6 16 1.18 d 7.1 16.0 17 1.03 d 7.4 9.7 18 1.44 s 26.6 19 1.16 d 7.0 18.3 20 1.14 d 7.0 12.0 21 1.12 s 16.2 r 4.87 d 4.8 96.4 2' 1.55 dd 15.2, 4.8 34.9 2.32 dd 15.2, 0.9 3' 72.8 4' 3.01 d 9.3 77.8 5' 3.99 dq 9.3, 6.2 65.6 6' 1.27 d 6.2 18.5 7' 1.23 s 21.4 8' 3.29 s 49.4 1 " 4.43 d 7.4 103.3 2" 3.56 dd 10.5, 7.3 71.3 3" 2.48 dd 10.3, 10.3 70.6 4" 3.09 dd 9.9, 9.0 70.2 5" 3.31 dq 9.0, 6.1 72.9 6" 1.29 d 6.1 18.1 7" 2.58 s 41.7

¹ This carbon was assigned from the HMQC spectrum

Example 4: Isolation of mycaminosyl tylactone

Isolation of plasmid pSG 1448/27/95/21/44/193/6tylMII (pSG144angAIangAIIorfl4angMIIlangB3/6tylMII) Plasmid pSG 1448/27/91/44/193/6tylMII no9 was digested with Bglll and the about 2 kb fragment was isolated and ligated with the Bglll digested vector fragment of pSGl 448/27/95/21/44/19 (pSG\44angAIangAIIorfl4angMIIIangB). The ligation was used to transform E. coli DH10B and plasmid pSG\448/27/95/21/44/193/6tylMII (pSG\44angAIangAIIorfl4angMIIIangBangMItylMII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. TylMII carries a tø-tag fusion at the end.

Bioconversion of tylactone to mycaminosyl tylactone The S. erythraea strain Q42/lpSG1448/27/95/27/^/i93/(5ty 7/ is grown and bioconversions with fed tylactone is performed as described in the General Methods. The cultures are analysed and a compound with m/z 568 is detected consistent with the presence of mycaminosyl tylactone. Example 5: Isolation of 5-0-dedesosaminyl-5-0-angolosaιr_.inyI erythromycins using gene cassette pSG1448/27/91/4spn05/2p4/193/6tylMII by bioconversion of 3-O-mycarosyl erythronolide B.

Isolation of plasmid conv nol For the multiple use of promoter sequences in act-controlled gene cassettes a 240 bp fragment was amplified by PCR using the primers BIOSG78 5'-GGGCATATGTGTCCTCCTTAATTAATCGAT GCGTTCGTCC-3' (SEQ ID NO: 42) and BIOSG79 5'-GGAGATCTGGTCTAGATCGTGTTCCCCTCC CTGCCTCGTGGTCCCTCACGC -3' (SEQ ID NO: 43) and plasmid pSG142 (Gaisser et al, 2000) as template. The 0.2 kb PCR fragment (PCR no5) was cloned using standard procedures and EcoRY digested plasmid Litmus28. Plasmid conv nol was isolated. The construct was verified by sequence analysis.

Isolation ofpSGLit3religl Plasmid conv nol was digested with NdellBglll and the about 0.2 kb fragment was isolated and ligated with the BamHllNdel digested vector fragment of pSGLit2. The ligation was used to transform E. coli DH10B and plasmid pSGLit3religl was isolated using standard procedures. This construct was verified using restriction digests and sequence analysis.

Isolation of plasmid pSGlit34/ 19 Plasmid Lit4/19 was digested with NdellXbal and the 1 .2 kb fragment was isolated and ligated to

NdellXbal digested DNA of pSGLit3. The ligation was used to transform E. coli ET12567 and plasmid pSGLit3 /i9 no23 was isolated. This construct was digested with_¥δαl and the isolated 1.4 kb fragment was used for the assembly of gene cassettes.

Cloning of orfl by isolating plasmid L 6/4 The gene orfl was amplified by PCR using the primers BIOSG75 5 '-GGGC ATATGAGC ACCC CTTCCGCACCACCCGTTCCG-3' (SEQ ID NO: 44) and BIOSG76 5'-GGTCTAGAGGTCAGTACAG CGTGTGGGCACACGCCACCAG-3' (SEQ ID NO: 45) and cosmid4H2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 2.5 kb PCR fragment (PCR no6) was cloned using standard procedures and i_coRV digested plasmid Litmus28. Plasmid

was isolated with an Ndel site overlapping the start codon of orfl and an Xbal site following the stop codon. The construct was verified by sequence analysis.

Isolation of plasmid pSGlit26/4 no9 Plasmid Lit6/4 was digested with NdellXbal and the DNA was isolated and ligated to NdellXbal digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit2<5/ no9 was isolated. This construct was confirmed by restriction digests and sequence analysis.

Cloning ofspnO by isolating plasmid pUC 19spnO The gene spnO from the spinosyn biosynthetic gene cluster of Saccharopolyspora spinosa was amplified by PCR using the primers BIOSG41 5'-GGGCATATGAGCAGTTCTGTCGAAGCTGAGGC AAGTG-3' (SEQ ID NO: 46) and BIOSG42 5'-GGTCTAGAGGTCATCGCCCCAACGCCCACAAGCT ATGCA GG-3' (SEQ ID NO: 47) and genomic DNA of S. spinosa as template. The about 1.5 kb PCR fragment was cloned using standard procedures and Sm l digested plasmid pUC19. Plasmid pUC19_τ_>Hθ no2 was isolated with an Ndel site overlapping the start codon of spnO and an_¥δαl site following the stop codon. The construct was verified by sequence analysis.

Isolation of plasmid pSGlit2spnO no4 Plasmid pGC\9spnO was digested with NdellXbal and the 1.5 kb fragment was isolated and ligated to NdellXbal digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit2_ .«0 no 4 was isolated using standard procedures. This construct was digested with Xbal and the isolated 1.5 kb fragment was used for the assembly of gene cassettes.

Isolation of plasmid pSG 1448/27791/ 4spnO (pSG144angAIangAIIangMIIIspnO) Plasmid pSG ^' 2spnO no4 (isolated from E. coli ET12567) was digested with Xbal and the 1.5 kb fragment was isolated and ligated with theXbal digested vector fragment of pSG 1448/27/91/4 (pSG \44angAIangAIIangMIIl). The ligation was used to transform E. coli DHIOB and plasmid pSG 1448/27/9 l/4spnO (pSG144angAIangAIIangMIIIspnO) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSGl 448/27/91/4spn05/2 (pSG144angAIangAIIangMIIIspnOangorfl4) Plasmid pSGLit25/2 no24 (isolated from E. coli ET 12567) was digested with Xbal and the 1 kb fragment was isolated and ligated with the _ >αl digested vector fragment of pSG 1448/27/91/4spnO (pSG 144angAIangAIIangMIIIspnO). The ligation was used to transform E. coli DH10B and plasmid pSG 1448/27/9 l/4spn05/2 (pSGl44angAIangAIIangMIIIspnOangorfl4) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSG 1448/27/9 l/4spn05/2p4/19 (pSG144angAIangAIIangMIIIspnOangorfl4pangB) Plasmid pSGLύ^' 34/ 19 no23 (isolated from E. coli ET12567) was digested with_ΫδαI and the about

1.4 kb fragment was isolated and ligated with the Xbal digested vector fragment of pSGl 448/27/9 l/4spn05/2 (pSGl44angAIangAIIangMIIIspnOangorfl4). The ligation was used to transform E. coli DHIOB and plasmid pSGU48/27/91/4spn05/2p4/19 (pSG 144angAIangAIIangMIIIspnOangorfHpangB) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis, 'p' indicates the presence of the promoter region in front of angB to emphasize the presence of multiple promoter sites in the construct.

Isolation of plasmid pSGH48/27/91/4spn05/2p4/193/6eryCIII (pSG144angAIangAIIangMIIIspnOorfl4pangBangMIeryCIII) Plasmid pSG 1448/27/91/44/193/6eryCIII no9 was digested with Bglll and the about 2 kb fragment was isolated and ligated with the Bglll digested vector fragment of pSG 1448/27/9 l/4spn05/2p4/19 (pSGl 4angAIangAIIangMIIIspnOorfl4pangB). The ligation was used to transform E. coli DHIOB and plasmid pSGl448/27/91/4spn05/2p4/193/6eryCIII (pSG\44angAIangAIIangMIIIspnOorfl4pangBangMIeryCIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. EryCIII carries a his-tag fusion at the end. 'p' indicates the presence of the promoter region in front of αngB to emphasize the presence of multiple promoter sites in the construct. The plasmid construct was used to transform mutant strains of S. erythraea using standard procedures.

Bioconversion of 3-O-mycarosyl erythronolide B to 5-0-dedesosaminyl-5-0-angolosaminyl erythromycins Strain S. erythraea Q42ll pSG1448/27/91/4spn05/2p4/193/6eryCIII as grown and bioconversions with fed 3-0-mycarosyl erythronolide B were performed as described in the General Methods. The cultures were analysed and peaks with m/z 704, m/z 718 and m/z 734 consistent with the presence of angolosaminyl erythromycin D, B and A, respectively, were observed.

Example 6: Production of 5-0-angolosaminyl tylactone

Isolation of plasmid pSG 1448/27/91/4spn05/2p4/l 93/6tylMII (pSG144angAIangAIIangMIIIspnOorfl4pangBangMItylMII) Plasmid pSG1448/27/91/44/193/6tv/ /Jno9 was digested with Bglll and the about 2 kb fragment was isolated and ligated with the Bglll digested vector fragment of pSGl448/27/91/4spn05/2p4/19

(pSG \44angAIangAIIangMIIIspnOorfl4pangB). The ligation was used to transform E. coli DH10B and plasmid pSGl448/27/91/4spn05/2p4/193/6tylMII (pSG144αngAIαngAIIαngMIIIspnOorfl4pαngBαngMItylMII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. TylMII carries a his-tag fusion at the end. The plasmid was used to transform mutant strains of S. erythraea applying standard protocols, 'p' indicates the presence of the promoter region in front of angB to emphasize the presence of multiple promoter sites in the construct.

Isolation ofS. erythraea 18Al(BIOT-2634) To introduce a deletion comprising the PKS and majority of post PKS genes in S. erythraea a region of the left hand side of the ery- cluster (LHS) containing a portion of eryCI, the complete ermE gene and a fragment of the eryBI gene were cloned together with a region of the right hand side of the ery- cluster (RHS) containing a portion of the eryBVII gene, the complete eryK gene and a fragment of DNA adjacent to eryK. This construct should enable homologous recombination into the genome in both LHS and RHS regions resulting in the isolation of a strain containing a deletion between these two regions of DNA. The LHS fragment (2201 bp) was PCR amplified using S. erythraea chromosomal DNA as template and primers BIdelNde (5 '-CCCATATGACCGGAGTTCGAGGTACGCGGCTTG-3 ' . SEQ ID NO: 48) and BIdelSpe (5'-GATACTAGTCCGCCGACCGCACGTCGCTGAGCC-3', SEQ ID NO: 49). Primer BIdelNde contains an Ndel restriction site (underlined) and primer BIdelSpe contains a Spel restriction site used for subsequent cloning steps. The PCR product was cloned into the Smal restriction site of pUC19, and plasmid pLSB177 was isolated using standard procedures. The construct was confirmed by sequence analysis. Similarly, RHS (2158 bp) was amplified by PCR using S. erythraea chromosomal DNA as template and primers BVIIdelSpe (5'-TGCACTAGTGGCCGGGCGCTCGACGT CATCGTCGACAT-3', SEQ ID NO: 50) and BVIIdelEco (5 '-TCGATATCGTGTCCTGCGGTTTCACC TGCAACGCTG-3', SEQ ID NO: 51). Primer BVIIdelSpe contains a Spel restriction site and primer BVIIdelEco contains an iϊcoRV restriction site. The PCR product was cloned into the Smal restriction site of pUC19 in the orientation with Spel positioned adjacent to Kpnl and iseoRV positioned adjacent to Xbal. The plasmid pLSB178 was isolated and confirmed using sequence analysis. Plasmid pLSB177 was digested with Ndel and Spel, the ~2.2kb fragment was isolated and similarly plasmid pLSB178 was digested with Ndel and Spel and the -4.6 kb fragment was isolated using standard methods. Both fragments were ligated and plasmid pLSB188 containing LHS and RHS combined together at a Spel site in pUC19 was isolated using standard protocols. An NdellXbal fragment (-4.4 kbp) from pLSB188 was isolated and ligated with Spel and Ndel treated pCJR24. The ligation was used to transform E. coli DH10B and plasmid pLSB189 was isolated using standard methods. Plasmid pLSB189 was used to transform S. erythraea P2338 and transformants were selected using thiostrepton. iS^*. erythraea Dell 8 was isolated and inoculated into 6 ml TSB medium and grown for 2 days. A 5% inoculum was used to subculture this strain 3 times. 100 μl of the final culture were used to plate onto R2T20 agar followed by incubation at 30°C to allow sporulation. Spores were harvested, filtered, diluted and plated onto R2T20 agar using standard procedures. Colonies were replica plated onto R2T20 plates with and without addition of thiostrepton. Colonies that could no longer grow on thiostrepton were selected and further grown in

TSB medium. S. erythraea 18A1 was isolated and confirmed using PCR and Southern blot analysis. The strain was designated LB-1 /BIOT-2634. For further analysis, the production of erythromycin was assessed as described in General Methods and the lack of erythromycin production was confirmed. In bioconversion assays this strain did not further process fed erythronolide B and erythromycin D was hydroxylated at C12 to give erythromycin C as expected, indicating that EryK was still functional.

Bioconversion of tylactone to5-0- angolosaminyl tylactone Strain S. erythraea SGQ2pSG 1448/27/91/4spn05/2p4/l 93/6tylMII was grown and byconversions with fed tylactone were performed as described in the General Methods. The cultures were extracted and analysed. A compound consistent with the presence of angolosaminyl tylactone was detected. 20 mg of this compound were purified and the structure was confirmed by NMR analysis. A compound consistent with the presence of angolosaminyl tylactone was also obtained when the gene cassette pSGl448/27/91/4spn05/2p4/193/6tylMII was expressed in the S. erythraea strain Q42/1 or S. erythraea 18A1.

Table III: NMR data for 5-0- βD angolosaminyl Tylactone 6_H (mult., Hz) COSY H-H HMBC H-C 1 174.4 1.91 d (16.8) 2b L 3 2 39.8 2.46 dd(16.8, 10.5) 2a, 3 1 3 66.9 3.68 dd (10.5, 1.2) 2b 1 4 40.4 1.56 m 5, 18 3 5 80.7 3.76 d (10.3) 4 4, 7, 18, 19, 1 ' 6 38.7 2.68 m 7b 1.45 m 7 33.6 1.55 m 6 8 45.0 2.70 m 21 9 203.9 10 1 18.3 6.26 d (15.5) 11 12 1 1 147.7 7.27 d (15.5) 10 9, 12, 13, 22 12 133.5 13 145.4 5.60 d (10.4) 14, 22 π, 14, 22, 23 14 38.3 2.70 m 13, 15, 23 12, 13, 15, 23 15 78.8 4.68 td (9.7, 2.4) 14, 16b 1, 17 1.55 m 15, 16b, 17 15 16 24.7 1.82 ddd 16a, 17 18 # δ_c δπ (mult, Hz) COSY H-H HMBC H-C 17 9.6 0.91 t (7.2) 16 15, 16 18 9.7 0.91 d (7.2) 4 3, 4, 5 19 21.0 1.55 m 20 20 1 1.8 0.83 t (7.2) 19 6, 19 21 17.1 1.15 d (6.8) 8 7, 9 22 13.0 1.76 s 13 11, 12, 1 3 23 16.1 1.05 d (6.5) 14 13, 14, 1 5 r 101.0 4.41 d (8.6) 2' 2' 1.48 m 1 % 2b', 3' r, 3\ 4 ' 2' 28.0 2.05 ddd (10.4, 3.9, 1.6) 2a', 3' Γ, 3' 3' 65.8 2.89 td (10.0, 3.9) 2a', 2b', 4' 4' 4' 70.5 3.16 dd (9.5, 9.0) 3', 5' 3', 5', 6 ^* 5' 73.2 3.26 dq (9.6, 6.0) 4', 6' 6' 17.7 1.3 d (6.0) 5'

Isolation of plasmid pSG 1448/27/9 l/4spnOp5/2 (pSG144angAIangAIIangMIIIspnOpangorfl4) Plasmid pSGLit35/2 (isolated from E. coli ET12567) was digested with Xbal and the insert fragment was isolated and ligated with the Xbal digested vector fragment of pSG 1448/27/9 l/4spnO (pSGl 44angAIangAIIangMIIIspnO). The ligation was used to transform E. coli DH10B and plasmid pSG 1448/27/9 l/4spnOp5/2 (pSG 144angAIangAIIangMIIIspnOpangorf 14) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSG 1448/27/9 l/4spnOp5/24/ 19 (pSG144angAIangAIIangMΪIIspnOpangorfl4 ιngB) Plasmid pSGLit2 /79 (isolated from E. coli ET12567) was digested with _YZ?αI and the insert fragment was isolated and ligated with the Xbal digested vector fragment of pSG 1448/27/9 l/4spnOp 5/2 (pSG\44angAIangAIIangMIIIspnOpangorfl4). The ligation was used to transform E. coli DH10B and plasmid pSGl448/27/91/4spnOp5/24/19 (pSGl 4angAIangAIIangMIIIspnOpangorfHangB) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSG 1448/27/9 l/4spnOp5/24/ 193/6 (pSGl 44angAIangAIIangMIIIspnOpangorfl 4angBangMI) Plasmid pSGLit23/(5 (isolated from E. coli ET12567) was digested with Xbal and the insert fragment was isolated and ligated with the Xbal digested vector fragment of pSG\448/27/91/4spnOp5/24/19 (pSGl44angAIangAIIangMIIIspnOpangorfl4angB). The ligation was used to transform E. coli DH10B and plasmid pSGl 448/27/91/4spnOp5/24/l 93/6 (pSGl 44angAIangAIIangMIIIspnOpangorfl4angBangMl) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. Isolation of plasmid pSG1448/27/91/4spnOp5/24/193/6angMII (pSG144angAIangAIIangMIIIspnOpangorfl4angBangMIangMII) Plasmid pSGLitl angMII (isolated fxo E. co// ET12567) was digested with Xball Bglll and the insert fragment was isolated and ligated with the_¥Z> I and partial Bglll digested vector fragment of pSGl 448/27/9 l/4spnOp5/24/ 193/6 (pSGl44angAIangAIIangMIIIspnOpangorfl4angBangMI). The ligation was used to transform E. coli DHIOB and plasmid pSGH48/27/91/4spnOp5/24/193/6angMII (pSGl 44angAIangAIIangMIIIspnOpangorfl4angBangMIangMII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. The plasmid was used to transform mutant strains of S. erythraea with standard procedures.

Biotransformation using S. erythraea Q42/1 pSGl 448/27/9 !/4spnOp5/24/193/6angMII (pSG144angAIangAIIangMIIIspnOpangorfHangBangMIangMII) Biotransformation experiments feeding tylactone are carried out as described in General Methods and the cultures are analysed. Angolosaminyl tylactone is detected.

Isolation of plasm id pSGl 448/27/96/4 (pSGl 44angAIangAIIangorfl) Plasmid pSG1448/27/9 (pSGl44angAIangAII) was digested with Xbal and treated with alkaline phosphatase using standard protocols. The vector fragment was used for ligations with Xbal treated plasmid pSGLit26/ no9 followed by transformations of ii. coli DHIOB using standard protocols. Plasmid pSG 1448/27/96/4 (pSG 44angAIangAIIangorfl) was isolated using standard procedures and the construct was confirmed by restriction digests and sequence analysis.

Isolation of plasmid pSG1448/27/96/4p5/2 (pSG144angAIangAIIangorflparιgorfH) Plasmid pSGLit35/2 (isolated from E. coli ET12567) was digested with Xbal and the insert fragment was isolated and ligated with the -Yδαl digested vector fragment of pSG\448/27/96/4 (pSG 144angAIangAIIangorf4). The ligation was used to transform E. coli DHIOB and plasmid pSGl 448/27/96/4p5/2 (pSG 144angAIangAIIangorflpangorf 14) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSG1448/27/96/4p5/21/4 (pSG144angAIangAIIangorf4pangorfHangMIIT) Plasmid pSGLit2// (isolated from E. coli ET12567) was digested with Xbal and the 1.4 kb fragment was isolated and ligated with the -Y&αl digested vector fragment of pSGl 448/27/96/4p 5/2 (pSG] 44angAIangAIIangorf4pangorfl4). The ligation was used to transform E. coli DH10B and plasmid pSG\ 448/27/96/4p5/21/4 (pSGl44angAIangAIIangorflpangorfl4angMIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSGH48/27/96/4p5/21/44/ 19 (pSG144angAIangAIIangorflpangorfl4angMIIIangB) Plasmid pSG it24/19 (isolated from E. coli ET12567) was digested with Xbal and the 1.4 kb fragment was isolated and ligated with the Xbal digested vector fragment of pSG 1448/27/96/4p5/21/4 (pSGl44angAIangAIIangorflpangorfl4angMIII). The ligation was used to transform E. coli DHIOB and plasmid pSG\448/27/96/4p5/21/44/19 (pSGl44angAIangAIIangorf4pangorfl4angMIIIangB) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.

Isolation of plasmid pSG 1448/27/96/4p5/21/44/193/6angMII

(pSG144angAIangAIIangorflpangorfHangMIIIangBangMIangMII) Plasmid pSG 1448/27/9 l/4spnOp5/24/193/6angMII was digested with _3g7II and the about 2.2 kb fragment was isolated and used to ligate with the Bglll treated vector fragment of pSG\ 448/27/96/4p5/21/44/19. The ligation was used to transform E. coli DHIOB using standard procedures and plasmid pSGl 448/27 /96/4p5/21/44/193/6angMII

(pSGl 44angAIangAIIangorflpangorfl4angMIIIangBangMIangMII) was isolated. The construct was verified using restriction digests and sequence analysis. The plasmid was used to transform mutant strains of 8. erythraea with standard protocols.

Bioconversion of tylactone with S. erythraea Q42/1 pSG1448/27/96/4p5/21/44/193/6angMII (pSG144angAIangAIIangorflpangorfl 4angMIIIangBangMIangMII) Biotransformation experiments feeding tylactone are carried out as described in General Methods and the cultures are analysed. Angolosaminyl tylactone is detected.

Example 7: Cloning of eryϋT into the gene cassette pSG144

Isolation of plasmid pUC 19eryK To amplify eryK primers eryKl 5'-GGTCTAGACTACGCCGACTGCCTCGGCGAGGAGCCC- 3' (SEQ ID NO: 52) and eryK2: 5 '-GGCATATGTTCGCCGACGTGGAAACGACCTGCTGCG-3 ' (SEQ ID NO: 53) were used and the PCR product was cloned as described for pGC\9eryCVI. Plasmid pUC 19eryK was isolated.

Isolation of plasmid pLSBl 11 (pCJR24eryK) Plasmid pUCl 9eryK was digested with NdellXbal and the insert band was ligated with NdellXbal digested pCJR24. Plasmid pLSBl 11 (pCJR24eryK) was isolated and the construct was verified with restriction digests.

Isolation of plasmid pLSBl 15 Plasmid pLSBl 1 1 (pCJR24eryiζ) was digested with NdellXbal and the insert fragment was isolated and ligated with the NdellXbal digested vector fragment of plasmid pSGLit2 and plasmid pLSBl 15 was isolated using standard protocols. The plasmid was verified using restriction digestion and DNA sequence analysis.

Isolation of plasmid pSG 1448/27/95/2 l/4eryK Plasmid pLSB1 15 from s. coli ET12567 was digested with Xbal and the insert fragment was isolated and ligated with the Xbal treated vector fragment of pSGl 448/27/9 /21/4 (pSG\44angAIangAIIangorfl4angMIIT). The ligation was used to transform E. coli DHIOB with standard procedures and plasmid pSGl448/27/95/21/4eryK(pSGl44angAIangAIIangorfl4angMIIIeryK) is isolated. The construct is confirmed with restriction digests.

Isolation of plasm id pSG 1448/27/95/2 l/4eryK4/l 9 Plasmid pSGLit24/19 from E. coli ET12567 is digested with Xbal and the insert fragment is isolated and ligated with the Xbal treated vector fragment of plasmid pSGl448/27/95/21/4eryK The ligation is used to transform E. coli DH10B with standard procedures and plasmid pSG 1448/27/95/2 l/4eryK4/19 (pSGl 4angAIangAIIangorfl 4 ' angMIIIeryKangB) is isolated. The construct is confirmed with restriction digests.

Isolation of plasmid pSG1448/27/95/21/4eryK4/193/6eryCIII Plasmid pSG 1448/27/95/21/44/193/6eryCIII is digested with Bglll and the about 2.1 kb fragment is isolated and ligated with the Bglll treated vector fragment of pSG 1448/27/95/2 l/4eryK4/19. Plasmid pSG1448/27/95/21/4eryK4/193/6eryCIII is isolated using standard procedures and the construct is confirmed using restriction digests. The plasmid is used to transform mutant strains of S. erythraea with standard methods.

Bioconversion of 3-O-mycarosyl erythronolide B to 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A The S. erythraea strain Q42/lpSG1448/27/95/2// ery^/i93/deryCZ/7 is grown and bioconversions with fed 3-O-mycarosyl erythronolide B are performed as described in the General Methods. The cultures are analysed and a compound with m/z 750 is detected consistent with the presence of 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A.

Example 8: Production of 13-desethyl-13-methyl-5-0-mycaminosyl erythromycins A and B; 13- desethyI-13-isopropyl-5-0-mycaminosyl erythromycin A and B; 13-desethyl-13-secbutyl-5-0- mycaminosyl erythromycin A and B

Production of 13-desethyl-l 3-methyl-3-0-mycarosyl erythronolide B, 13-desethyl-l 3-isopropyl-3-0- mycarosyl erythronolide B and 13-desethyl-l 3-secbutyl-3-0-mycarosyl erythronolide B Plasmid pLS025, (WO 03/033699) a pCJR24-based plasmid containing the DEBS1, DEBS2 and

DEBS3 genes, in which the loading module of DEBS1 has been replaced by the loading module of the avermectin biosynthetic cluster, was used to transform S. erythraea JC2ΔeryCIII (isolated using techniques and plasmids described previously (Rowe et al, 1998; Gaisser et al, 2000)) using standard techniques. The transformant JC2ΔeryCIIIpLS025 was isolated and cultures were grown using standard protocols. Cultures of S. erythraea JC2ΔeryCIIIpLS025 are extracted using methods described in the

General Methods section and the presence of 3-0-mycarosyl erythronolide B, 13-desethyI-13-methyl-3- 0-mycarosyl erythronolide B, 13-desethyl-13-isopropyl-3-0-mycarosyI erythronolide B and 13-desethyl- 13-secbutyl-3-0-mycarosyl erythronolide B in the crude extract is verified by LCMS analysis.

Production of 13-desethyl-l 3-methyl-5-0-dedesosminyl-5-0-mycaminosyl erythromycin A and B, 13- desethyl-13-isopropyl-5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A andB, 13-desethyl-l 3- secbutyl-5-0-dedesosminyl-5-0-mycaminosyl erythromycin A andB Cultures of 8. erythraea JC2ΔeryCIIIpLS025 are extracted using methods described in the General Methods section and the crude extracts are dissolved in 5 ml of methanol and subsequently fed to culture supematants of the S. erythraea strain SGQ2pSG1448/27/95/2i/^/79i?/(5er C/7 using standard techniques. The bioconversion of 13-desethyl-l 3-methyl-3-0-mycarosyl erythronolide B, 13-desethyl-l 3- isopropyl-3-O-mycarosyl erythronolide B and 13-desethyl-l 3 -secbuty 1-3 -O-mycarosyl erythronolide B to 13-desethyl-l 3-methyl-5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A and 13-desethyl-13- methyl-5-O-dedesosaminyl-5-0-mycaminosyl erythromycin B; 13-desethyl-13-isopropyl-5-0- dedesosaminyI-5-O-mycaminosyl erythromycin A and 13-desethyl-l 3-isopropyI-5-0-dedesosaminyl-5- 0-mycaminosyl erythromycin B; l 3-desethyl-l 3-secbutyl-5-0-dedesosaminyl-5-O-mycaminosyl erythromycin A and 13-desethyl-13-secbutyI-5-0-dedesosaminyl-5-0-mycaminosyl erythromycin B is verified by LCMS analysis. Example 9: 13-desethy_-13-methyl-5-0-dedesosaminyI-5-0-mycaminosyl erythromycin A and 13- desethyI-13-methyl-5-0-dedesosaminyI-5-0- mycaminosyl erythromycin B

Production of 13-desethyl-l 3-methyl-3-0-mycarosyl erythronolide B Plasmid pIB023 (Patent application no 0125043.0), a pCJR24-based plasmid containing the

DEBS1 , DEBS2 and DEBS3, was used to transform S. erythraea JC2ΔeryCIII using standard techniques. The transformant JC2ΔeryCIIIpIB023 was isolated and cultures were grown using standard protocols, extracted and the crude extract was assayed using methods described in the General Methods section. The production of 3-O-mycarosyl erythronolide B, and 13-desethyl-13-methyl-3-0-mycarosyl erythronolide B is verified by LCMS analysis.

Production of 13-desethyl-l 3-methyl-5-0-dedesosaminyl-5-0-mycaminosyl erythromycin A, 13-desethyl- 13-methyl-5-0-dedesosaminyl-5-0-mycaminosyl erythromycin B Cultures of S. erythraea JC2ΔeryCIIIpIB023 are extracted using methods described in the General Methods section and the crude extracts are dissolved in 5 ml of methanol and subsequently fed to culture supematants of S. erythraea SGQ2pSG 1448/27/95/21/44/193/6eryCIII using standard techniques. The bioconversion of 13-desethyl-13-methyl-3-0-mycarosyl erythronolide B to 13-desethyl-13-methyl-5- O-dedesosaminyl-5-O-mycaminosyl erythromycin A and 13-desethyl-13-methyl-5-0-dedesosaminyl-5- 0-mycaminosyl erythromycin B are verified by LCMS analysis.

Example 10: Production of 5-0-dedesosaminyl-5-0-mycaminosyI azithromycin

Azithromycin aglycones were prepared using methods described in EP 1024145 A2 (Pfizer Products Inc. Groton, Connecticut). The S. erythraea strain SGT2pSG142 was isolated using techniques and plasmid constructs described earlier (Gaisser et al, 2000). Feeding experiments are carried out using methods described previously (Gaisser et al, 2000) with the S. erythraea mutant SGT2pSG142 thus converting azithromycin aglycone to 3-O-mycarosyl azithronolide. Biotransformation experiments are carried out using S. erythraea SGQ2pSG 1448/27/95/21/44/193/6eryCIII and crude extracts containing 3- 0-mycarosyl azithronolide are added using standard microbiological techniques. The bioconversion of 3- 0-mycarosyl azithronolide to 5-0-dedesosaminyl-5-0-mycaminosyl azithromycin is verified by LCMS analysis.

Example 11: Production of 5-0-dedesosaminyl-5-0-ι_ιycaminosyl erythromycin C

Isolation of the S. erythraea mutant SGP1 (SGQ2ΔeryG) To create a chromosomal deletion in eryG, construct pSGΔG3 was isolated as follows:

Fragment 1 was amplified using primers BIOSG53 5'-

GGAATTCGGCCAGGACGCGTGGCTGGTCACCGGCT -3 ' (SEQ ID NO: 54) and

BIOSG54 5 '-GGTCTAGAAAGAGCGTGAGCAGGCTCTTCTACAGCCAGGTCA -3 ' (SEQ ID NO: 55) and genomic DNA of S. erythraea was used as template. Fragment 2 was amplified using primers

BIOSG55 5'-GGCATGCAGGAAGGAGAGAACCACGATGACCACCGACG-3' (SEQ ID NO: 56) and

BIOSG56 5 '-GGTCTAGACACCAGCCGTATCCTTTCTCGGTTCCTCTTGTG-3 ' (SEQ ID NO: 57) and genomic DNA of S. erythraea was used as template. Both DNA fragments were cloned into Smal cut pUCl 9 using standard techniques, plasmids pUCPCRl and pUCPCR2 were isolated and the sequence of the amplified fragments was verified. Plasmid pUCPCRl was digested using Eco JJXbal and the insert band DNA was isolated and cloned into EcoRUXbal digested pUC19. Plasmid pSGΔGl is isolated using standard methods and digested with SphllXbal followed by a ligation with the Sphl/Xbal digested insert fragment of pUCPCR2. Plasmid pSGΔG2 is isolated using standard procedures, digested with SphllHindlll and ligated with the SphllHindlll fragment of pCJR24 (Rowe et al, 1998) containing the gene encoding for thiostrepton resistance. Plasmid pSGΔG3 is isolated and used to delete eryG in the genome of S. erythraea strain SGQ2 using methods described previously (Gaisser et al, 1997; Gaisser et al, 1998) and the S. erythraea mutant SGP1 (SGQ2ΔeryG) is created.

Production of5-0-dedesosaminyl-5-0-mycaminosyl erythromycin C The S. erythraea strain SGP1 (S. erythraea SGQ2ΔeryG) is isolated using standard techniques and consequently used to transform the cassette construct pSGl448/27/95/21/44/193/6eryCIII as formerly described. The S. erythraea strain SGPlpSG 1448/27/95/21/44/193/6eryCIII is isolated and used for biotransformation as described in Example 2 and assays are carried out as described above to verify the conversion of 3-0-mycarosyl-erythronolide B to 5-0-dedesosaminyl-5-0-mycaminosyi erythromycin C by LCMS analysis.

Example 12: Production of 3-0-angoIosaminyl-erythronoIide B

Bioconversion of erythronolide B with S. erythraea Q42/1 pSGH48/27/91/4spnOp5/24/193/6angMII (pSG144angAIangAIIangMIIIspnOpangorfl4angBangMIangMII) Biotransformation experiments feeding erythronolide B were carried out as described in General Methods and the cultures were analysed. Angolosaminylated erythronolide B was detected. About 30 mg of 3-O-angolosaminyl-erythronolide B were isolated and the structure was confirmed by NMR analysis.

Table IV: Η and ^l3C NMR for the 3-angolosaminyl-erythronolide B in CDCU Position δc δ_H (mult, Hz) H-H COSY H-C HMBC

1 COO 176.3 2 CH 44.5 2.81 dq(10.4, 6.7) 3,16 1, 3 CH 89.7 3.66 dd (10.5, 10.5) 2, 1,2,4,5,16, 17, r 4 CH 36.5 1.99 m 17 5,6,17 5 CH 81.5 3.69 bs 3,6,7,17,18 6 C 75.2 - - 7 CH₂ 38.3 1.92 dd (14.6, 9.0) 7b, 8 6,8,9,18,19 1.44 dd (14.6.5.4) 7a, 8 6,8,9, 18 8 CH 43.4 2.69m 7 7,9,18 9 CO 217.8 - - 10 CH 40.1 2.91 bq (6.6) 20 9, 11,20 11 CH 70.6 3.78 d (10.0) 12 12,13,20 12 CH 40.2 1.69 m 11,21 13,21 13 CH 75.6 5.40 dd (9.5, 9.3) 14 1,11,12,14, 15,21 14 CH₂ 25.8 1.71 qd (7.2, 2.2) 13, 14b, 15 12,13 1.51 m 13, 14a, 15 13 15 CH₃ 9.1 0.90 d (7.7) 14 16 CH₃ 15.2 1.19 d (6.9) 2 2,3 17 CH₃ 8.3 1.06 d (6.7) 4 3,4,5 18 CH₃ 26.6 1.30s 5,6,7 19 CH₃ 16.9 1.16d(6.1) 1 20 CH₃ 8.5 0.98 t (7.7) 10 9, 10,11 21 CH₃ 10.4 0.89 d (7.7) 12 11,12, 13 r CH 103.0 4.61 dd (9.2, 1.6) 2' 2', 3', 3 2' CH₂ 27.0 1.49m l',2b,3' l',3' 2.00m 2a, 3' l',3',4' 3' CH 65.2 2.48 td (10.2, 3.5) 2', 4' 4' 4' CH 70.3 3.03 dd (9.5, 9.5) 3', 5' 3', 5', 6' 5' CH 73.9 3.34 dq (8.7, 6.0) 4', 6' 3' 6' CH₃ 17.5 1.34 d (6.0) 5' 4', 5'

Bioconversion of erythronolide B with S. erythraea 18A1 pSG1448/27/96/4p5/21/44/193/6angMII (pSGH4angAIangAIIangorf4pangorfHangMIIIangBangMIangMII) Biotransformation experiments feeding erythronolide B were carried out as described in General Methods and the cultures are analysed. Peaks characteristic for angolosaminylated erythronolide B were detected. References AH, N., Herron, P.R., Evans, M.C. and Dyson, P.J. (2002) Osmotic regulation of the Streptomyces lividans thiostrepton-inducible promoter, ptipA. Microbiology 148: 381-390. Bertram, G., Innes, S., Minella, O., Richardson, J.P. and Stanfield, I. (2001) Endless possibilities: translation termination and stop codon recognition. Microbiology 147: 255-269. Bussiere, D.E. and Bastia, D. (1999) Termination of DNA replication of bacterial and plasmid chromosomes. Mol Microbiol 31: 161 1-1618. Bierman, M., Logan, R., O'Brien, K., Seno, E.T., Rao, R.N. and Schoner, B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116: 43-49. Caffrey, P., Bevitt, D.J., Staunton, J. and Leadlay, P.F. (1992) Identification of DEBS 1, DEBS 2 and DEBS 3, the multienzyme polypeptides of the erythromycin-producing polyketide synthase from Saccharopolyspora erythraea. FEBS 304: 225-228. Doumith, M., Legrand, R., Lang, C, Salas, J. and Raynal, M.C. (1999) Interspecies complementation in Saccharopolyspora erythraea: Elucidation of the function of olePl, oleGl and oleG2 from the oleandomycin biosynthetic gene cluster of Streptomyces antibioticus and generation of new erythromycin derivatives. Mol Microbiol 34: 1039-1048. Gaisser, S., Bohm, G.A., Cortes, J. and Leadlay, P.F. (1997) Analysis of seven genes from the eryAI-eryK region of the erythromycin biosynthetic gene cluster in Saccharopolyspora erythraea. Mol Gen Genet 256: 239-251. Gaisser, S., Bδhm, G.A., Doumith, M., Raynal, M.C, Dhillon, N., Cortes, J. and Leadlay, P.F. (1998) Analysis of eryBI, eryBIII and eryBVII from the erythromycin biosynthetic gene cluster in Saccharopolyspora erythraea. Mol Gen Genet 258: 78-88. Gaisser, S., Reather, J., Wirtz, G., Kellenberger, L., Staunton, J. and Leadlay, P.F. (2000) A defined system for hybrid macrolide biosynthesis in Saccharopolyspora erythraea. Mol Microbiol 36: 391-401. Gaisser, S., Martin, C.J., Wilkinson, B., Sheridan, R.M., Lill, R.E., Weston, A J., Ready, S.J., Waldron, C, Grouse, G.D., Leadlay, P.F. and Staunton, J. (2002a) Engineered biosynthesis of novel spinosyns bearing altered deoxyhexose substituents. Chem Commun 618-619. Gaisser, S., Lill, R., Staunton, J., Mendez, C, Salas, J. and Leadlay, PF. (2002b) Parallel pathways for oxidation of 14-membered polyketide macrolactones in Saccharopolyspora erythraea. Mol Microbiol 44: 771-81. Gates, P.J., Kearney, G.C., Jones, R., Leadlay, P.F. and Staunton, J. (1999) Structural elucidation studies of erythromycins by electrospray tandem mass spectrometry. Rapid Commun Mass Spectrom 13:

242-246. Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B. and Steitz, T.A. (2002) The structures of four macrolide antibiotics bound to the large ribosomal subunit. Molecular Cell 10: 117-128. Hu Y. and Walker S. (2002) Remarkable structural similarities between diverse glycosyltransferases.

Chemistry and Biology 9: 1287-1296. Ichinose, K., Ozawa M., Itou K., Kunieda K., and Ebizuka Y. (2003) Cloning, sequencing and heterologous expression of the medermycin biosynthetic gene cluster of Streptomyces sp AM-7161 : towards comparative analysis of the benzoisochromanequinone gene cluster. Microbiology 149: 1633-

1645. Jones, P.H., Iyer, K.S. and Grundy, W.E. (1969) Chemical modifications of erythromycin antibiotics. II. Synthesis of 4'-hydroxyerythromycin A. Antimicrobial Agents Chemother 9: 123-130. Kaneko, T., McArthur, H. and Sutcliffe, J. (2000) Recent developments in the area of macrolide antibiotics. Exp Opin Ther Patents 10: 1-23. Kato, Y., Bai, L., Xue, Q., Revill, W. P., Yu, T. W. and Floss, H. G. (2002) Functional expression of genes involved in the biosynthesis of the novel polyketide chain extension unit, methoxymalonyl-acyl carrier protein, and engineered biosynthesis of 2-desmethyl-2-methoxy-6-deoxyerythronolide B. JAm

Chem Soc 124: 5268-5269. Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., and Hopwood, D.A. (2000) Practical

Streptomyces Genetics, John Innes Foundation, Norwich. Kinumaki, A. and Suzuki, M. (1972) Proposed structure of angolamycin (shincomycin A) by mass spectrometry. J. Antibiotics 25: 480-482. Lee, M.H., Pascopella, L., Jacobs, W.R. Jr, and Hatfull, G.F. (1991). Site specific integration of mycobacteriophage L5: integration-proficient vectors for Mycobacterium smegmatis, Mycobacterium tuberculosis and Bacille Calmette-Guerin. Proc. Natl. Acad. Sci. USA, 88: 31 11-3115. Liu, H.-W. and Thorson, J.S. (1994) Pathways and mechanisms in the biogenesis of novel deoxysugars by bacteria. Annu Rev Microbiol 48: 223-56. Madduri, K., Kennedi, J., Rivola, G., Inventi-Solari, A., Filippini, S., Zanoso, G., et al, (1998) Production of the antitumor drug epirubicin (4'-epidoxorubicin) and its precursor by a genetically engineered strain of Streptomyces peucetius. Nat Biotechnol 16: 69-74. Matsuura, M., Noguchi, T., Yamaguchi, D., Aida, T., Asayama, M., Takahashi, H. and Shirai, M.

(1996). The _re gene (ORF469) encodes a site-specific recombinase responsible for integration of the R4 phage genome. JBact. 178: 3374-3376. Mendez, C. and Salas, J.A. (2001) Altering the glycosylation pattern of bioactive compounds.

Trends in Biotechnology 19: 449-456. Pfoestl, A., Hofinger, A., Kosma, P., and Messner P. (2003) Biosynthesis of dTDP-3-acetamido-3,6- dideoxy-alpha-D-galactose in Aneurinibacillus thermoaerophilus L420-91^τ*. J Bio Chem 278:26410- 26417. Poulsen, S.M., Kofoed, C. and Vester, B. (2000) Inhibition of the ribosomal peptidyl transferease reaction by the mycarose moiety of the antibiotics carbomycin, spiramycin and tylosin. J Mol Biol 304: 471-

481. Rowe, C.J., Cortes, J., Gaisser, S., Staunton, J. and Leadlay, P.F. (1998) Construction of new vectors for high-level expression in actinomycetes. Gene 216: 215-223. Salah-Bey, K., Blanc, V. and Thompson, C.J. (1995) Stress-activated expression of a

Streptomyces pristinaespiralis multidrug resistance gene (ptr) in various Streptomyces spp. and

Escherichia coli. Molecular Microbiology 17: 1001-1012. Salah-Bey, K., Doumith, M., Michel, J.M., Haydock, S., Cortes, J., Leadlay, P.F. and Raynal, M.C. (1998) Targeted gene inactivation for the elucidation of the deoxysugar biosynthesis in the erythromycin producer Saccharopolyspora erythraea. Mol Gen Genet 257: 542-553. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, N.Y. Schlϋnzen, F., Zarivach, R., Harms, J., Bashan, A., Tocilj, A., Albrecht, R., Yonath, A. and Franceschi, F. (2001) Structural basis for the interaction of antibiotics with the peptidyl transferase centre in eubacteria. Nature 413: 814-821. Solenberg, P.J., Matsushima, P., Stack, D.R., Wilkie, S.C., Thompson, R.C. and Baltz, R.H. (1997)

Production of hybrid glycopeptide antibiotics in vitro and in Streptomyces toyocaensis. Chem Biol 4: 195-

202. Smovkina, T., Mazodier, P., Boccard, F., Thompson,C.J. and Guerineau, M. (1990) Construction of a series of pSAM2-based integrative vectors for use in actinomycetes. Gene 94: 53-59. Spagnoli, R., Cappelletti, L. and Toscano, L. (1983) Biological conversion of erythronolide B, an intermediate of erythromycin biogenesis, into "hybrid" macrolide antibiotics. J Antibiot 36: 365-375. Staunton, J. and B. Wilkinson (1997). Biosynthesis of erythromycin and rapamycin. Chem Rev 97: 261 1-2629. Summers, R.G., Donadio, S., Staver, M.J., Wendt-Pienkowski, E., Hutchinson, C.R. and Katz, L.

(1997) Sequencing and mutagenesis of genes from the erythromycin biosynthetic gene cluster of

Saccharopolyspora erythraea that are involved in L-mycarose and D-desosamine production. Microbiol

143: 3251-3262. Tang, L. and McDaniel, R. (2001) Construction of desosamine containing polyketide libraries using a glycosyltransferase with broad substrate specificity. Chemistry and Biology 8: 547-555. Trefzer, A., Salas, J.A. and Bechthold, A. (1999) Genes and enzymes involved in deoxysugar biosynthesis in bacteria. Nat Prod Rep 16: 283-299. Van Mellaert, L., Mei, L., Lammertyn, E., Schacht, S., and Anne, J. (1998) Site-specific integration of bacteriophage VWB genome into Streptomyces venezuelae and construction of a VWB-based integrative vector. Microbiology 144: 3351-3358. Wohlert, S. E., Blanco, G., Lombo, F., Fernandez, E., Brana, A.F., Reich, S., Udvarnoki, G., et al, (1998) Novel hybrid tetracenomycins through combinatorial biosynthesis using a glycosyltransferase encoded by the elm genes in cosmid 16F4 and which shows a broad sugar substrate specificity. J Am

Chem Soc 120: 10596-10601. Wohlert, S.E., Lomovskaya, N., Kulowski, K., Fonstein, L., Occi, J.L., Gewain, K.M., MacNeil,

DJ. and Hutchinson, C.R. (2001) Insights about the biosynthesis of the avermectin deoxysugar L- oleandrose through heterologous expression of Streptomyces avermitilis deoxysugar genes in Streptomyces lividans. Chemistry & Biology 8: 681-700. Zhao, L., Ahlert, J., Xue, Y., Thorson J.S., Sherman, D.H. and Liu, H-W. (1999) Engineering a methymycin/pikromycin-calicheamicin hybrid: Construction of two new macrolides carrying a designed sugar moiety. J Am Chem Soc 121: 9881-9882. Zhao, L., Que, N.L.S, Xue, Y., Sherman, D.H. and Liu, H.W. (1998a) Mechanistic studies of desosamine biosynthesis: C-4 deoxygenation precedes C-3 transamination. J Am Chem Soc 120: 12159-

10160. Zhao, L., Sherman, D.H. and Liu, H.W. (1998b) Biosynthesis of desosamine: Construction of a new methymycin/neomethymycin analogue by deletion of a desosamine biosynthetic gene. J Am Chem Soc 120:

10256-10257.

Claims

CLAIMS:

1. A gene cassette comprising a combination of genes which, in an appropriate strain background- are able to direct the synthesis of mycaminose or angolosamine and to direct its subsequent transfer to an aglycone or pseudoaglycone.

2. A gene cassette according to claim 1, comprising a combination of genes able to direct the synthesis and transfer of mycaminose, wherein: a) at least one of the genes is selected from the group consisting of: angorfH, tylMIII, tylMI, tylB, tylAI, tylAII, tylla, angAI, angAII, angMIII, angB, angMI, eryG and eryK;, and, b) at least one of the genes is a glycosyltransferase gene selected from the group consisting of tylMII, angMII, des VI I, eryCIII, eryBV, spnP, and midl.

3. A gene cassette according to claim 2, wherein one of the genes within the gene cassette is tylla

4. A gene cassette according to claim 2, wherein one of the genes within the gene cassette is angorfH

5 A gene cassette according to claim 2 or 4, which comprises angAI, angAII, angorfH, angMIII, angB and angMI, in combination with one or more glycosyltransferase genes selected from the group consisting of eryCIII, tylMII and angMII.

6. A gene cassette according to claim 2 or 3, which comprises tylAI, tylAII, tylMIII, tylB, tylla and tylMI, in combination with one or more glycosyltransferase genes selected from the group consisting of eryCIII, tylMII and angMII.

1. A gene cassette according to claim 1 comprising a combination of genes able to direct the synthesis and transfer of angolosamine, wherein: a) at least one of the genes is selected from the group consisting of: angMIII, angMI, angB, angAI, angAII, angorfH, angorfl, tylMIII, tylMI, tylB, tylAI, tylAII, eryCVI, spnO, eryBVI, and eryK; and, b) at least one of the genes is a glycosyltransferase gene selected from the group consisting of eryCIII, tylMII, angMII, des VII, eryBV, spnP and midl.

8. A gene cassette according to claim 7, which comprises angMIII, angMI, angB, angAI, angAII, angorfH and spnO, in combination with one or more glycosyltransferase genes selected from the group consisting of angMII, tylMII and eryCIII.

9. A gene cassette according to claim 7, which comprises angMIII, angMI, angB, angAI, angAII, angorfl, and angorfH, in combination with one or more glycosyltransferase genes selected from the group consisting of angMII, tylMII and eryCIII.

10. A process for the production of erythromycins and azithromycins which contain either mycaminose or angolosamine at the C-5 position, said process comprising transforming a strain with a gene cassette as described in any one of claims 1 -9 above and culturing the strain under appropriate conditions for the production of said erythromycin or azithromycin.

11. The process of claim 10, wherein the strain is selected from actinomycetes, Pseudomonas, myxobacteria, and E. coli.

12. The process of claim 10, wherein the host strain is additionally transformed with the ermE from S. erythraea.

13. The process of claim 10 or claim 11, wherein the host strain is an actinomycete.

14. The process of claim 13, wherein the host strain is selected from S. erythraea, Streptomyces griseofuscus, Streptomyces cinnamonensis, Streptomyces albus, Streptomyces lividans, Streptomyces hygroscopicus sp., Streptomyces hygroscopicus var. ascomyceticus, Streptomyces longisporoflavus, Saccharopolyspora spinosa, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces fradiae, Streptomyces rimosus, Streptomyces avermitilis, Streptomyces eurythermus, Streptomyces venezuelae, and Amycolatopsis mediterranei.

15. The process of claim 14, wherein the host strain is S. erythraea.

16. The process of claim 15, wherein the host strain is selected from the SGQ2, Q42/1 or 18A1 strains of

S. erythraea.

17. The process of any one of claims 10 to 16, which further comprises feeding of an aglycone and/or a pseudoaglycone substrate to the recombinant strain.

18. The process of claim 17, wherein said aglycone and/or pseudoaglycone is selected from the group consisting of 3-O-mycarosyl erythronolide B, erythronolide B, 6-deoxy erythronolide B, 3-0-mycaros I-6- deoxy erythronolide B, tylactone, spinosyn pseudoaglycone, 3-0-rhamnosyl erythronolide B, 3-0- rhamnosyl-6-deoxy erythronolide B, 3-O-angolosaminyl erythronolide B, 15-hydroxy-3-0-mycarosyl erythronolide B, 15-hydroxy erythronolide B, 15-hydroxy-6-deoxy erythronolide B, 15-hydroxy-3-0- mycarosyl-6-deoxy erythronolide B, 15-hydroxy-3-0-rhamnosyl erythronolide B, 15-hydroxy-3-0- rhamnosyl-6-deoxy erythronolide B, 15-hydroxy-3-0-angolosaminyl erythronolide B, 14-hydroxy-3-0- mycarosyl erythronolide B, 14-hydroxy erythronolide B, 14-hydroxy-6-deoxy erythronolide B, 14-hydroxy- 3-0-mycarosyl-6-deoxy erythronolide B, 14-hydroxy-3-0-rhamnosyl erythronolide B, 14-hydroxy-3-0>- rhamnosyl-6-deoxy erythronolide B, 14-hydroxy-3-0-angolosaminyl erythronolide B.

19. The process of any one of claims 10 to 18, which additionally comprises the step of isolating the compound produced.

20. A compound according to the formula I below:

R is selected from: H, CH₃, C₂H₅ an alpha-branched C₃-C₈ group selected from alkyl, alkenyl, alkynyl, alkoxyalkyl and alkylthioalkyl groups any of which may be optionally substituted by one or more hydroxyl groups; a C₅-C₈ cycloalkylalkyl group wherein the alkyl group is an alpha-branched C₂-C₅ alkyl group a C₃-C₈ cycloalkyl group or C₅-C₈ cycloalkenyl group, either of which may optionally be substituted by one or more hydroxyl, or one or more C₁-C₄ alkyl groups or halo atoms a 3 to 6 membered oxygen or sulphur containing heterocyclic ring which may be saturated, or fully or partially unsaturated and which may optionally be substituted by one or more C₁-C₄ alkyl groups, halo atoms or hydroxyl groups phenyl which may be optionally substituted with at least one substituent selected from C₁-C₄ alkyl, -C₄ alkoxy and C₁-C₄ alkylthio groups, halogen atoms, trifluoromethyl, and cyano or - R¹⁷-CH₂- where R¹⁷ is H, C,-C₈ alkyl, C₂-C₈ alkenyl, C₂-C₈ alkynyl, alkoxyalkyl or alkylthioalkyl containing from 1 to 6 carbon atoms in each alkyl or alkoxy group wherein any of said alkyl, alkoxy, alkenyl or alkynyl groups may be substituted by one or more hydroxyl groups or by one or more halo atoms; or a C₃-C₈ cycloalkyl or C₅-C₈ cycloalkenyl either of which may be optionally substituted by one or more CpG_t alkyl groups or halo atoms; or a 3 to 6 membered oxygen or sulphur containing heterocyclic ring which may be saturated or fully or partially unsaturated and which may optionally be substituted by one or more -C₄ alkyl groups or halo atoms; or a group of the formula SA₁ wherein A₁₆ is Cι-C₈ alkyl, C₂-C₈ alkenyl, C₂-C₈ alkynyl, C₃-C₈ cycloalkyl, C₅-C₈ cycloalkenyl, phenyl or substituted phenyl wherein the substituent is C₁-C₄ alkyl, C]-C₄ alkoxy or halo, or a 3 to 6 membered oxygen or sulphur-containing heterocyclic ring which may be saturated, or fully or partially unsaturated and which may optionally be substituted by one or more C₁-C₄ alkyl groups or halo atoms

R², R⁴, R⁵, R⁶, R⁷ and R⁹ are each independently H, OH, CH₃, C₂H₅ or OCH₃ R³= H or OH

R⁸ = H,

R^l0= H or CH₃ or C(=0)R_A, where R_A = C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl

OR¹⁰

R¹ ' = H, \ , mycarose, C4-0-acyl-mycarose or glucose

R^l2= H or C(=0)R_A, where R_A = C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl R¹³= H or CH₃

R^l6 = H or OH

R¹⁴ = H or -C(0)NR^cR^d wherein each of R^c and R^d is independently H, C C₁₀ alkyl, C₂-C₂₀ alkenyl, C₂- Cio alkynyl, -(CH₂)_m(C₆-Cιo aryl), or -(CH₂)_m(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4, and wherein each of the foregoing R° and R groups, except H, may be substituted by 1 to 3 Q groups; or wherein R^c and R^d may be taken together to form a 4-7 membered saturated ring or a 5-10 membered heteroaryl ring, wherein said saturated and heteroaryl rings may include 1 or 2 heteroatoms selected from O, S and N, in addition to the nitrogen to which R° and R^d are attached, and said saturated ring may include 1 or 2 carbon-carbon double or triple bonds, and said saturated and heteroaryl rings may be substituted by 1 to 3 Q groups; or R² and R¹⁷ taken together form a carbonate ring; each Q is independently selected from halo, cyano, nitro, trifluoromethyl, azido, -C(0)Q^!, -

OC(0)Q', -C(0)OQ', -OC(0)OQ', -NQ²C(0)Q³, -C(0)NQ²Q³, -NQ²Q³, hydroxy, C,-C₆ alkyl, C,-C₆ alkoxy, -(CH₂)_m(C₆-Cιo aryl), and -(CH₂)_ra(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4, and wherein said aryl and heteroaryl substituents may be substituted by 1 or 2 substituents independently selected from halo, cyano, nitro, trifluoromethyl, azido, -C(0)Q', -C(0)OQ', -OC(0)OQ', -NQ²C(0)Q³, -C(0)NQ²Q³, -NQ²Q³, hydroxy, C,-C₆ alkyl, and C,-C₆ alkoxy; each Q¹, Q² and Q³ is independently selected from H, OH, Ci-Cio alkyl, CpCβ alkoxy, C₂-Cιo alkenyl, C₂-Cι₀ alkynyl, -(CH₂)m(C₆-C]o aryl), and -(CH₂)_m(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4; with the proviso that the compound is not 5-O-dedesosaminy 1-5-0- mycaminosyl erythromycin A or D or said compound is a variant of any of the above in which the -CHOR¹⁴- at CI 1 is replaced by a methylene group (-CH₂-), a keto group (C=0), or by a 10,1 1-olefinic bond; or said compound is a variant of any of the above which differs in the oxidation state of one or more of the ketide units (i.e. selection of alternatives from the group: -CO-, -CH(OH)-, alkene -CH-, and CH₂); with the proviso that the compounds are not selected from the group consisting of 5-0-dedesosaminyl-5- 0-mycaminosyl erythromycin A and 5-0-dedesosaminyl-5-0-mycaminosyl erythromycin D.

21 . A compound according to the formula II below:

R is selected from: H, CH₃, C₂H₅ - an alpha-branched C₃-C₈ group selected from alkyl, alkenyl, alkynyl, alkoxyalkyl and alkylthioalkyl groups any of which may be optionally substituted by one or more hydroxyl groups; a C₅-C₈ cycloalkylalkyl group wherein the alkyl group is an alpha-branched C₂-C₅ alkyl group - a C₃-C₈ cycloalkyl group or C₅-C₈ cycloalkenyl group, either of which may optionally be substituted by one or more hydroxyl, or one or more Cj-C alkyl groups or halo atoms a 3 to 6 membered oxygen or sulphur containing heterocyclic ring which may be saturated, or fully or partially unsaturated and which may optionally be substituted by one or more C₁-C₄ alkyl groups, halo atoms or hydroxyl groups - phenyl which may be optionally substituted with at least one substituent selected from C₁-C₄ alkyl, C₁-C₄ alkoxy and C₁-C₄ alkylthio groups, halogen atoms, trifluoromethyl, and cyano or - R¹⁷-CH₂- where R¹⁷ is H, C_rC₈ alkyl, C₂-C₈ alkenyl, C₂-C₈ alkynyl, alkoxyalkyl or alkylthioalkyl containing from 1 to 6 carbon atoms in each alkyl or alkoxy group wherein any of said alkyl, alkoxy, alkenyl or alkynyl groups may be substituted by one or more hydroxyl groups or by one or more halo atoms; or a C₃-C₈ cycloalkyl or C₅-C₈ cycloalkenyl either of which may be optionally substituted by one or more C₁-C₄ alkyl groups or halo atoms; or a 3 to 6 membered oxygen or sulphur containing heterocyclic ring which may be saturated or fully or partially unsaturated and which may optionally be substituted by one or more C₁-C₄ alkyl groups or halo atoms; or a group of the formula SA| wherein Aι₆ is Cι-C₈ alkyl, C₂- alkenyl, C -C₈ alkynyl, C₃-C₈ cycloalkyl, C₅-C₈ cycloalkenyl, phenyl or substituted phenyl wherein the substituent is C₁-C₄ alkyl, C₁-C₄ alkoxy or halo, or a 3 to 6 membered oxygen or sulphur-containing heterocyclic ring which may be saturated, or fully or partially unsaturated and which may optionally be substituted by one or more Cj-Gt alkyl groups or halo atoms

R², R⁴, R⁵, R⁶, R⁷ and R⁹ are each independently H, OH, CH₃, C₂H₅ or OCH₃

R³= H or OH

R⁸ = H,

R¹⁰= H or CH₃ or C(=0)R_A, where R_A = C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl

R = HH,,

, mycarose, C4-0-acy l-mycarose or glucose

R¹²= H or C(=0)R_A, where R_A = C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl R¹ = H or CH₃

R^l6 = H or OH

R¹⁴ = H or -C(0)NR^cR^d wherein each of R^c and R^d is independently H, Ci-Cio alkyl, C₂-C_2Q alkenyl, C₂- Cio alkynyl, -(CH₂)_m(C_δ-Cι₀ aryl), or -(CH₂)_m(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4, and wherein each of the foregoing R° and R^d groups, except H, may be substituted by 1 to 3 Q groups; or wherein R° and R^d may be taken together to form a 4-7 membered saturated ring or a 5-10 membered heteroaryl ring, wherein said saturated and heteroaryl rings may include 1 or 2 heteroatoms selected from O, S and N, in addition to the nitrogen to which R^c and R^d are attached, and said saturated ring may include 1 or 2 carbon-carbon double or triple bonds, and said saturated and heteroaryl rings may be substituted by 1 to 3 Q groups; or R² and R¹⁷ taken together form a carbonate ring; each Q is independently selected from halo, cyano, nitro, trifluoromethyl, azido, -C(0)Q', -

OC(O)Q', -C(0)OQ',

-NQ²C(0)Q³, -C(0)NQ²Q³, -NQ²Q³, hydroxy, C,-C₆ alkyl, C,-C₆ alkoxy, -(CH₂)_m(C₆-Cιo aryl), and -(CH₂)_m(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4, and wherein said aryl and heteroaryl substituents may be substituted by 1 or 2 substituents independently selected from halo, cyano, nitro, trifluoromethyl, azido, -C(0)Q', -C(0)0Q', -OC(0)OQ', -NQ²C(0)Q³, -C(0)NQ²Q³, -NQ Q³, hydroxy, C_rC₆ alkyl, and C,-C₆ alkoxy; each Q¹, Q² and Q³ is independently selected from H, OH, C_rCι₀ alkyl, C C₆ alkoxy, C₂-C₁₀ alkenyl, C₂-

Cio alkyny l, -(CH₂)m(C6-Cι₀ aryl), and -(CH₂)_ra(5-10 membered heteroaryl), wherein m is an integer ranging from 0 to 4; or said compound is a variant of any of the above in which the -CHOR'4- at C12 is replaced by a methylene group (-CH2-), a keto group (C=0), or by a 11,12-oIefinic bond; or said compound is a variant of any of the above which differs in the oxidation state of one or more of the ketide units (i.e. selection of alternatives from the group: -CO-, -CH(OH)-, alkene -CH-, and CH₂).

22. A compound according to claim 20 or 21, wherein: R², R⁴, R⁵, R⁶, R⁷ and R⁹ are all CH₃

23. A compound according to claim 22, wherein

R¹⁴ = H

24. A compound according to claim 23, wherein R¹⁼ C₂H₅ optionally substituted with a hydroxyl group

25. A compound according to claim 24, wherein R¹²= H

26. A compound according to claim 25, wherein R¹⁼ C₂H₅