WO2005051995A2 - Novel advanced glycosylation end product-specific receptor-like protein and nucleic acids encoding same - Google Patents

Novel advanced glycosylation end product-specific receptor-like protein and nucleic acids encoding same Download PDF

Info

Publication number
WO2005051995A2
WO2005051995A2 PCT/US2004/038870 US2004038870W WO2005051995A2 WO 2005051995 A2 WO2005051995 A2 WO 2005051995A2 US 2004038870 W US2004038870 W US 2004038870W WO 2005051995 A2 WO2005051995 A2 WO 2005051995A2
Authority
WO
WIPO (PCT)
Prior art keywords
cgi
polypeptide
protein
rage
seq
Prior art date
Application number
PCT/US2004/038870
Other languages
French (fr)
Other versions
WO2005051995A3 (en
Inventor
David J. Stone
Erik Gunther
Original Assignee
Curagen Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Curagen Corporation filed Critical Curagen Corporation
Publication of WO2005051995A2 publication Critical patent/WO2005051995A2/en
Publication of WO2005051995A3 publication Critical patent/WO2005051995A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily

Definitions

  • the present invention relates generally to nucleic acids, proteins, and antibodies.
  • the invention relates more particularly to nucleic acid molecules, proteins, and antibodies of a novel isoform of the Advanced Glycosylation End product-specific Receptor (RAGE), and its fragments, derivatives, variants, homologs, analogs, or a combination thereof.
  • RAGE Advanced Glycosylation End product-specific Receptor
  • RAGE The receptor for advanced glycosylation end products
  • MHC major histocompatibility complex
  • RAGE is composed of three extracellular immunogloboin-like domains, a single pass transmembrane domain, and a short highly charged cytoplasmic domain that is essential for RAGE-mediated signaling.
  • RAGE advanced glycation end products
  • SlOO/calgranulins SlOO/calgranulins
  • amphoterin/HMGB 1 amyloid fibrils.
  • RAGE has a secreted isoform called soluble RAGE or sRAGE. Since this isoform lacks a transmembrane domain, it is secreted and acts as a decoy receptor (e.g., it binds to the RAGE ligand in place of RAGE).
  • isoforms may be useful in the diagnosis, treatment and prevention of RAGE-mediated diseases, including chronic inflammation, Alzheimer's brain tissue, some tumors, and diabetic vasculature. Citation or discussion of a reference herein shall not be construed as an admission that such is prior art to the present invention.
  • This novel isoform is designated herein as CG162443-07.
  • the present invention provides nucleic acids encoding the CG-
  • the invention provides an isolated CGI 62443-07 protein.
  • the isolated protein comprises the amino acid sequence of SEQ ID NO:2.
  • the invention includes a variant of SEQ ID NO: 2, in which some amino acids residues, e.g., no more than 1%, 2%, 3%, 5%, 10% or 15% of the amino acid sequences of SEQ ID NO: 2 are changed.
  • the invention provides a fragment of a CGI 62443-07 protein, including CGI 62443-07 proteins encoded by allelic variants and single nucleotide polymorphisms of CG162443-07 nucleic acids.
  • the invention includes an isolated CGI 62443-07 nucleic acid molecule.
  • the CG162443-07 nucleic acid molecule can include a sequence encoding any of the CG162443-07 proteins, variants, or fragments disclosed above, or a complement to any such nucleic acid sequence.
  • the CGI 62443-07 nucleic acids include a sequence wherein nucleotides different from those given in SEQ ID NO:l may be incorporated. Preferably, no more than 1%, 2%, 3,%, 5%, 10%, 15%, or 20% of the nucleotides are so changed.
  • the invention includes fragments or complements of these nucleic acid sequences. Another aspect of the present invention describes expression vectors.
  • the expression vector comprises a nucleotide sequence encoding a polypeptide comprising SEQ ID NO 2, wherein the nucleotide sequence is transcriptionally coupled to an exogenous promoter.
  • the nucleotide sequence comprises SEQ ID NO 1, and is transcriptionally coupled to an exogenous promoter.
  • Another aspect of the present invention describes recombinant cells comprising expression vectors comprising the above-described sequences and the promoter is recognized by an RNA polymerase present in the cell.
  • Another aspect of the present invention describes a recombinant cell made by a process comprising the step of introducing into the cell an expression vector comprising a nucleotide sequence of SEQ ID NO 1, wherein the nucleotide sequence is transcriptionally coupled to an exogenous promoter.
  • the expression vector can be used to insert recombinant nucleic acid into the host genome or can exist as an autonomous piece of nucleic acid.
  • Another aspect of the present invention features a purified antibody preparation comprising an antibody that binds selectively to CG162443-07.
  • Another aspect of the present invention provides a method of screening for a compound that binds to CGI 62443-07, or fragments thereof.
  • the method comprises the steps of: (a) expressing a polypeptide comprising the amino acid sequence of SEQ ID NO 2 or a fragment thereof from recombinant nucleic acid; (b) providing to said polypeptide a labeled RAGE ligand that binds to said polypeptide and a test preparation comprising one or more test compounds; (c) and measuring the effect of said test preparation on binding of said test preparation to said polypeptide comprising SEQ ID NO 2.
  • Another aspect of the present invention provides a method for screening a compound that binds selectively to CGI 62443-07 polypeptide as compared to one or more RAGE isoform polypeptides that are not CGI 62443 -07.
  • This method comprises the steps of: providing a CG162443-07 polypeptide comprising SEQ ID NO 2; providing a RAGE isoform polypeptide that is not CGI 62443-07, contacting said CG162443-07 polypeptide and said RAGE isoform polypeptide that is not CG162443-07 with a test preparation comprising one or more test compounds; and determining the binding of said test preparation to said CGI 62443-07 polypeptide and to RAGE isoform polypeptide that is not CG162443-07, wherein a test preparation that binds to said CG162443-07 polypeptide but does not bind to said RAGE isoform polypeptide that is not CGI 62443-07 contains a compound that selectively binds said CG162443-07 polypeptide.
  • Another aspect of the present invention provides a method for determining whether the RAGE/r-ligand interaction is inhibited in a sample comprising (i) adding CG162443-07 or any fragments or derivatives thereof to a sample comprising RAGE and an r-ligand; and (ii) determining whether CGI 62443-07 binds to the r-ligand, thereby inhibiting the RAGE/r-ligand interaction.
  • the CG162443-07 protein is CG162443-15.
  • the CG162443-07 protein is CG162443-15.
  • RAGE-mediated disease comprising administering to a patient in need thereof, a composition comprising CG162443-07 or one of its fragments, derivatives, variants, homologs, or variants in an amount effective to inhibit the interaction between RAGE and its r-ligand.
  • Figure 1A depicts the nucleotide and amino acid sequence of CGI 62443 -07.
  • Figure IB depicts the nucleotide and amino acid sequence of CG162443-06.
  • Figure 2 depicts the amino acid sequence alignment of CGI 62443.
  • CG162443-02 is a known form of RAGE;
  • CG162443-07 is the novel splice variant of the present invention;
  • CG162443-15 is the ECD of CG162443-07;
  • CG162443-04 is a derivative of CG162443-07 with several amino acid substitutions.
  • Figure 3A depicts a BLASTN search using CURAGEN® Ace. No. CG162443-07.
  • Figure 3B shows a high-scoring match as determined by a BLASTP search (versus Non-Redundant Composite dated 09/04/03) using the sequence of the Advanced Glycosylation End product-specific Receptor-like protein of the invention.
  • Figure 3C depicts the BLASTN identity search of CuraGen Corporation's human SeqCallingTM database using the Advanced Glycosylation End product- specific Receptor-like gene according to the invention.
  • Figure 4 depicts the ClustalW alignment of the protein of Ace. No. CGI 62443-06 & CGI 62443-07 with similar Advanced Glycosylation End product- specific Receptors.
  • Figure 5 shows the PSORT, SignalP and hydropathy results for the Advanced
  • FIG. 6 depicts the ClustalW alignment of the protein of CGI 62443-06 with its physical clone 437981130.
  • Figure 7 depicts a Western Blot for CGI 62443-08, a protein with functional similarity to sRAGE.
  • Figure 8 depicts a graph demonstrating that CGI 62443-08 is equal in potency to R&D RAGE
  • Figure 9 depicts a graph demonstrating that CGI 62443-08 can neutralize the binding of RAGE, and thus acts like sRAGE in a cell.
  • Figure 10 depicts a Western Blot for CG162443-15
  • Figure 11 depicts a graph showing the results of a binding study designed to determine whether CG162443-15 binds to S100 and to compare its binding pattern to sRAGE.
  • Figure 12A depicts the amount and type of protein used in the binding study described in Example 4.
  • R&D RAGE refers to the known RAGE (Q15109);
  • CuraRAGE refers to CGI 62443-08, which is the same as sRAGE, and CuraVariant refers to CG162443-15.
  • Figure 12B depicts the results of the binding study underlying the graph in Figure 9. Plates A & B relate to R&D RAGE, Plates C-E relate to Cura-RAGE, and plates F-H relate to CuraVariant.
  • Figure 13 depicts a graph showing the neutralization of RAGE binding to
  • Figure 14A depicts the amount and type of protein used in the neutralization study described in Example 5.
  • Figure 14B depicts the data underlying the graph in Figure 13.
  • Figure 15 depicts the amino acid sequence of CGI 62443 -07 as compared to the known form of RAGE, including the amino acid sequence of the insert.
  • This novel isoform is designated CG162443-07.
  • the present invention provides nucleic acids encoding the CG162443-07 protein, and its fragments, derivatives, variants, homologs, and analogs.
  • the present invention also provides antibodies against a CG162443-07 protein, and methods of use for CG162443-07.
  • CGI 62443-07 CGI 62443-07
  • Methods of Preparing CGI 62443-07 iii) Antibodies to CG162443-07
  • iv Structure Prediction and Functional Analysis of CG162443-07
  • Uses of CGI 62443-07 vi) Administration, Pharmaceutical Compositions and Kits
  • Binding Assays viii) Detection Assays 5.1.
  • CGI 62443-07 refers to a class of proteins or nucleic acids encoding such proteins or their complementary strands, where the proteins comprise an amino acid sequence of SEQ ID NO. 2 (417 amino acids) or its fragments, derivatives, variants, homologs, or analogs.
  • a CGI 62443-07 protein retains at least some biological activity of RAGE.
  • the term "biological activity” means that a CGI 62443-07 protein possesses some but not necessarily all the same properties of (and not necessarily to the same degree as) RAGE.
  • the invention further provides nucleic acids encoding CGI 62443-07, including nucleic acid fragments encoding the proteins just described.
  • the invention includes nucleic acid molecules that can hybridize to a CG-162443-07 nucleic acid under stringent hybridization condition.
  • hybridizes under stringent conditions describes conditions for hybridization
  • hybridizes under stringent conditions describes conditions for hybridization and washing under which nucleotide sequences at least 30% (preferably, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98%) identical to each other typically remain hybridized to each other.
  • stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
  • stringent hybridization conditions comprise a salt concentration from about 0.1 M to about 1.0 M sodium ion, a pH from about 7.0 to about 8.3, a temperature is at least about 60°C, and at least one wash in 0.2 X SSC, 0.01% BSA.
  • stringent hybridization conditions are hybridization at 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.1XSSC, 0.2% SDS at about 68 °C.
  • stringent hybridization conditions are hybridization in 6XSSC at about 45°C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at 50-65°C (i.e., one or more washes at 50°C, 55°C, 60°C or 65°C). It is understood that the nucleic acids of the invention do not include nucleic acid molecules that hybridize under these conditions solely to a nucleotide sequence consisting of only A or T nucleotides.
  • the term "isolated" in the context of a protein agent refers to a protein agent that is substantially free of cellular material or contaminating proteins from the cell or tissue source from which it is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • substantially free of cellular material includes preparations of a protein agent in which the protein agent is separated from cellular components of the cells from which it is isolated or recombinantly produced.
  • a protein agent that is substantially free of cellular material includes preparations of a protein agent having less than about 30%, 20%, 10%, or 5% (by dry weight) of host cell proteins (also referred to as a "contaminating proteins").
  • the protein agent When the protein agent is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein agent preparation.
  • culture medium represents less than about 20%, 10%, or 5% of the volume of the protein agent preparation.
  • the protein agent When the protein agent is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein agent. Accordingly, such preparations of a protein agent have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the protein agent of interest.
  • protein agents disclosed herein are isolated.
  • nucleic acid molecules refers to a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid molecule.
  • an "isolated" nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • nucleic acid molecules are isolated.
  • the term "effective amount” refers to the amount of a therapy (e.g., a composition comprising a CG162443-07 protein) which is sufficient to reduce and/or ameliorate the severity and/or duration of a disease or one or more symptoms thereof, prevent the advancement of a disease, cause regression of a disease, prevent the recurrence, development, or onset of one or more symptoms associated with a disease, or enhance or improve the prophylactic or therapeutic effect(s) of another therapy.
  • a therapy e.g., a composition comprising a CG162443-07 protein
  • the terms “subject” and “subjects” refer to an animal, preferably a mammal, including a non-primate (e.g., a cow, pig, horse, cat, or dog), a primate (e.g., a monkey, chimpanzee, or human), and more preferably a human.
  • the subject is a mammal, preferably a human, who has been exposed to or is going to be exposed to an insult that may induce alimentary mucositis (such as radiation, chemotherapy, or chemical warfare agents).
  • the subject is a farm animal (e.g., a horse, pig, or cow) or a pet (e.g., a dog or cat) that has been exposed to or is going to be exposed to a similar insult.
  • farm animal e.g., a horse, pig, or cow
  • pet e.g., a dog or cat
  • the term "subject” is used interchangeably with "patient” in the present invention.
  • CG162443-07 Derivatives. Variants, Homologs, Analogs and Fragments
  • the present invention also provides fragments, derivatives, variants, homologs, and analogs of CGI 62443-07.
  • Fragments provided herein are defined as sequences of at least 6 (contiguous) nucleic acids or at least 4 (contiguous) amino acids, a length sufficient to allow for specific hybridization in the case of nucleic acids or for specific recognition of an epitope in the case of amino acids, respectively, and are at most some portion less than a full length sequence. Fragments may be derived from any contiguous portion of a nucleic acid or amino acid sequence of choice. Derivatives are nucleic acid sequences or amino acid sequences formed from the native compounds either directly or by modification or partial substitution. Analogs are nucleic acid sequences or amino acid sequences that have a structure similar to, but not identical to, the native compound but differs from it in respect to certain components or side chains.
  • Analogs may be synthetic or from a different evolutionary origin and may have a similar or opposite metabolic activity compared to wild-type.
  • the invention provides a fragment of a CGI 62443 -07 protein, including CGI 62443-07 proteins encoded by allelic variants and single nucleotide polymorphisms of CGI 62443 -07 nucleic acids.
  • the protein fragment of the present invention encodes the ECD of CG162443-07.
  • the amino acid sequence of the ECD of CGI 62443-07, designated herein as CGI 62443- 15, is set forth in Figure 2.
  • the invention provides derivatives and analogs of CG162443-07.
  • CGI 62443-07 The production and use of derivatives and analogs related to CGI 62443-07 are within the scope of the present invention.
  • the derivative or analog is functionally active, i.e., capable of exhibiting one or more functional activities associated with a full-length, wild-type CG162443-07.
  • Derivatives or analogs of CG162443-07 can be tested for the desired activity by procedures known in the art, including but not limited to, using appropriate cell lines, animal models, and clinical trials.
  • CGI 62443-07 derivatives can be made via altering CGI 62443- 07 sequences by substitutions, insertions or deletions that provide for functionally equivalent molecules.
  • such alteration of an CG162443-07 sequence is done in a region that is not conserved in the RAGE protein family. Due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the same amino acid sequence as CGI 62443-07 may be used in the practice of the present invention. These include, but are not limited to, nucleic acid sequences comprising all or portions of CGI 62443-07 that are altered by the substitution of different codons that encode a functionally equivalent amino acid residue within the sequence, thus producing a silent change.
  • the CGI 62443 -07 derivatives of the invention include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of CG162443-07 including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a silent change.
  • one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity that acts as a functional equivalent, resulting in a silent alteration.
  • Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs.
  • the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
  • the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • the positively charged (basic) amino acids include arginine, lysine and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
  • CGI 62443-07 derivatives of the invention also include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of CG162443-07 including altered sequences in which amino acid residues are substituted for residues with similar chemical properties. In a specific embodiment, 1, 2, 3, 4, or 5 amino acids are substituted.
  • Derivatives or analogs of CG162443-07 include, but are not limited to, those proteins which are substantially homologous to CGI 62443-07 or fragments thereof, or whose encoding nucleic acid is capable of hybridizing to the CGI 62443-07 nucleic acid sequence. In a specific embodiment, alterations to the amino acid sequence of
  • CG162443-07 include at least one of the substitutions listed below: (a) Substitute R arginine for W tryptophan in position 97; (b) Substitute I isoleucine for L leucine in position 139; (c) Substitute E glutamic acid for A alanine in position 188; (d) Substitute R arginine for K lysine in position 191 ; (e) Substitute H histadine for N aspargine in position 193; (f) Substitute M methionine for L leucine in position 206; (g) Substitute T threonine for N asparagine in position 208; (h) Substitute A alanine for C cysteine in position 210; and (i) Substitute P praline for T threonine in position 217.
  • a derivative of CGI 62443-07 is CG162443-04.
  • the amino acid sequence of CGI 62443-04 is set forth in Figure 2.
  • the CGI 62443-07 derivatives and analogs of the invention can be produced by various methods known in the art. The manipulations that result in their production can occur at the gene or protein level.
  • the cloned CG162443-07 gene sequence can be modified by any of numerous strategies known in the art (e.g., Maniatis, T., 1989, Molecular Cloning, A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).
  • the sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro.
  • the CGI 62443-07 -encoding nucleic acid sequence can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification.
  • Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site-directed mutagenesis (Hutchinson, C. et al, 1978, J. Biol. Chem 253 :6551), use of TAB.RTM. linkers (Pharmacia), etc.
  • Manipulations of the CG162443-07 sequence may also be made at the protein level.
  • CGI 62443 -07 fragments or other derivatives or analogs which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc.
  • any of numerous chemical modifications may be carried out by known techniques, including but not limited to, reagents useful for protection or modification of free NH2- groups, free COOH- groups, OH- groups, side groups of Tip-, Tyr-, Phe-, His-, Arg-, or Lys-; specific chemical cleavage by cyanogen bromide, hydroxylamine, BNPS-Skatole, acid, or alkali hydrolysis; enzymatic cleavage by trypsin, chymotrypsin, papain, V8 protease, NaBH4; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; etc.
  • CGI 62443 -07 can be chemically synthesized.
  • a protein corresponding to a portion of CGI 62443-07 which comprises the desired domain, or which mediates the desired aggregation activity in vitro, or binding to a receptor can be synthesized by use of a peptide synthesizer.
  • nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the CG162443-07 sequence.
  • Non-classical amino acids include, but are not limited to, the D-isomers of the common amino acids, ⁇ -amino isobutyric acid, 4-aminobutyric acid, hydroxyproline, sarcosine, citrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, ⁇ -alanine, designer amino acids such as ⁇ -methyl amino acids, C ⁇ -methyl amino acids, and N ⁇ -methyl amino acids.
  • the CGI 62443-07 derivative is a chimeric or fusion protein comprising CGI 62443 -07 or a fragment thereof fused via a peptide bond at its amino- and/or carboxy-terminus to a non-CG162443-07 amino acid sequence.
  • the non-CG162443-07 amino acid sequence is fused at the amino- terminus of a CGI 62443-07 or a fragment thereof.
  • such a chimeric protein is produced by recombinant expression of a nucleic acid encoding the protein (comprising a CGI 62443-07 -coding sequence joined in-frame to a non- CG162443-07 coding sequence).
  • Such a chimeric product can be custom made by a variety of companies (e.g., Retrogen, Operon, etc.) or made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other by methods known in the art, in the proper coding frame, and expressing the chimeric product by methods commonly known in the art.
  • a chimeric product may be made by protein synthetic techniques, e.g., by use of a peptide synthesizer.
  • a chimeric nucleic acid encoding CG162443-07 with a heterologous signal sequence is expressed such that the chimeric protein is expressed and processed by the cell to the mature CGI 62443-07 protein.
  • CG162443-07 and non-CG 162443-07 gene may also be used to predict tertiary structure of the molecules using computer simulation (Hopp and Woods, 1981, Proc. Natl. Acad. Sci. U.S.A. 78:3824-3828); the chimeric recombinant genes could be designed in light of correlations between tertiary structure and biological function.
  • chimeric genes comprising an essential portion of CG162443-07 molecule fused to a heterologous (non-CG162443-07) protein-encoding sequence may be constructed.
  • such chimeric construction can be used to enhance one or more desired properties of a CG162443-07, including but not limited to, CG162443-07 stability, solubility, or resistance to proteases.
  • chimeric construction can be used to target CG162443-07 to a specific site.
  • chimeric construction can be used to identify or purify a CGI 62443-07 of the invention, such as a His-tag, a FLAG tag, a green fluorescence protein (GFP), ⁇ -galactosidase, a maltose binding protein (MalE), a cellulose binding protein (CenA) or a mannose protein, etc.
  • GFP green fluorescence protein
  • MalE maltose binding protein
  • CenA cellulose binding protein
  • a CGI 62443-07 protein is carbamylated.
  • a CGI 62443 -07 protein can be modified so that it has an extended half-life in vivo using any methods known in the art.
  • Fc fragment of human IgG or inert polymer molecules such as high molecular weight polyethyleneglycol (PEG) can be attached to a CG162443-07 protein.
  • PEG can be attached to a CG162443-07 protein with or without a multifunctional linker either through site-specific conjugation of the PEG to the N- or C-terminus of the protein or via epsilon-amino groups present on lysine residues.
  • Linear or branched polymer derivatization that results in minimal loss of biological activity will be used.
  • the degree of conjugation can be closely monitored by SDS-PAGE and mass spectrometry to ensure proper conjugation of PEG molecules to the CGI 62443-07 protein.
  • Unreacted PEG can be separated from CGI 62443-07 -PEG conjugates by size-exclusion or by ion-exchange chromatography.
  • PEG-derivatized conjugates can be tested for in vivo efficacy using methods known to those of skill in the art.
  • a CG162443-07 protein can also be conjugated to albumin in order to make the protein more stable in vivo or have a longer half life in vivo.
  • Methods of Preparing CG162443-07 Any techniques known in the art can be used in purifying a CGI 62443-07 protein, including but not limited to, separation by precipitation, separation by adsorption (e.g., column chromatography, membrane adsorbents, radial flow columns, batch adsorption, high-performance liquid chromatography, ion exchange chromatography, inorganic adsorbents, hydrophobic adsorbents, immobilized metal affinity chromatography, affinity chromatography), or separation in solution (e.g., gel filtration, electrophoresis, liquid phase partitioning, detergent partitioning, organic solvent extraction, and ultrafiltration).
  • separation by precipitation e.g., column chromatography, membrane adsorbents, radial flow columns, batch adsorption, high-performance liquid chromatography, ion exchange chromatography, inorganic adsorbents, hydrophobic adsorbents, immobilized metal affinity chromatography, affinity
  • CGI 62443-07 may be monitored by one or more in vitro or in vivo assays.
  • the purity of CG162443-07 can be assayed by any methods known in the art, such as but not limited to, gel electrophoresis. Methods known in the art can be utilized to recombinantly produce CG162443-07 proteins.
  • a nucleic acid sequence encoding a CG162443-07 protein can be inserted into an expression vector for propagation and expression in host cells.
  • An expression construct refers to a nucleic acid sequence encoding a CGI 62443-07 protein operably associated with one or more regulatory regions that enable expression of a CG162443-07 protein in an appropriate host cell.
  • "Operably-associated” refers to an association in which the regulatory regions and the CGI 62443-07 sequence to be expressed are joined and positioned in such a way as to permit transcription, and ultimately, translation.
  • the regulatory regions necessary for transcription of CG162443-07 can be provided by the expression vector.
  • a translation initiation codon (ATG) may also be provided if a CG162443-07 gene sequence lacking its cognate initiation codon is to be expressed.
  • RNA polymerase a promoter which is capable of binding RNA polymerase and promoting the transcription of an operably- associated nucleic acid sequence.
  • regulatory regions may include those 5' non- coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
  • the non-coding region 3' to the coding sequence may contain transcriptional termination regulatory sequences, such as terminators and polyadenylation sites.
  • linkers or adapters providing the appropriate compatible restriction sites may be ligated to the ends of the cDNAs by techniques well known in the art (see e.g., Wu et al., 1987, Methods in Enzymol, 152:343-349). Cleavage with a restriction enzyme can be followed by modification to create blunt ends by digesting back or filling in single-stranded DNA termini before ligation.
  • a desired restriction enzyme site can be introduced into a fragment of DNA by amplification of the DNA using PCR with primers containing the desired restriction enzyme site.
  • An expression construct comprising a CGI 62443-07 sequence operably associated with regulatory regions can be directly introduced into appropriate host cells for expression and production of a CG162443-07 protein without further cloning. See, e.g., U.S. Patent No. 5,580,859.
  • the expression constructs can also contain DNA sequences that facilitate integration of a CG162443-07 sequence into the genome of the host cell, e.g., via homologous recombination.
  • an expression vector comprising a replication origin suitable for appropriate host cells in order to propagate and express CGI 62443-07 in the host cells.
  • expression vectors may be used, including but are not limited to, plasmids, cosmids, phage, phagemids or modified viruses.
  • host-expression systems represent vehicles by which the coding sequences of a CGI 62443-07 gene may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express CGI 62443-07 in situ. These include, but are not limited to, microorganisms such as bacteria (e.g., E. coli and B.
  • subtilis transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing CGI 62443 -07 coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing CGI 62443-07 coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing CGI 62443 -07 coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing CGI 62443 -07 coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, NS0, and 3T3 cells) harboring recombinant expression constructs containing promote
  • bacterial cells such as Escherichia coli and eukaryotic cells are used for the expression of a recombinant CG ⁇ 62443-07 molecule.
  • mammalian cells such as Chinese hamster ovary cells (CHO) can be used with a vector bearing promoter element from major intermediate early gene of cytomegalocirus for effective expression of a CG162443- 07 sequence (Foecking et al, 1986, Gene 45:101; and Cockett et al, 1990, Bio/Technology 8:2).
  • a number of expression vectors may be advantageously selected depending upon the use intended for the CGI 62443-07 molecule being expressed.
  • vectors that direct the expression of high levels of readily purified fusion protein products may be desirable.
  • Such vectors include, but are not limited to, the E. coli expression vector pCR2.1 TOPO (Invitrogen); pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 24:5503-5509) and the like.
  • pFLAG Sigma
  • pMAL N ⁇ B
  • p ⁇ T Novagen
  • pFLAG Long Term Evolution
  • N ⁇ B pMAL
  • p ⁇ T Novagen
  • pG ⁇ X vectors may also be used to express foreign proteins as fusion proteins with glutathione 5-transferase (GST).
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione agarose beads followed by elution in the presence of free glutathione.
  • the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
  • many vectors to express foreign genes can be used, e.g., Autographa californica nuclear polyhedrosis virus (AcNPV) can be used as a vector to express foreign genes. The virus grows in cells like Spodopterafrugiperda cells.
  • a CGI 62443-07 coding sequence may be cloned individually into non-essential regions (e.g., the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (e.g., the polyhedrin promoter).
  • an AcNPV promoter e.g., the polyhedrin promoter
  • a number of viral-based expression systems may be utilized.
  • a CG162443- 07 coding sequence of interest may be ligated to an adenovirus transcription translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination.
  • Insertion in a non-essential region of the viral genome will result in a recombinant virus that is viable and capable of expressing CG162443-07 in infected hosts (see, e.g., Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 8 1:355-359).
  • Specific initiation signals may also be required for efficient translation of inserted CG162443-07 coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert.
  • exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic.
  • the efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see, e.g., Bittner et al., 1987, Methods in Enzymol. 153:51-544).
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
  • Different host cells have characteristic and specific mechanisms for the post- translational processing and modification of proteins and gene products.
  • Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
  • eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript and post-translational modification of the gene product, e.g., glycosylation and phosphorylation of the gene product, may be used.
  • Such mammalian host cells include, but are not limited to, PC12, CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, W138, BT483, Hs578T, HTB2, BT2O and T47D, NSO (a murine myeloma cell line that does not endogenously produce any immunoglobulin chains), CRL7O3O and HsS78Bst cells.
  • Expression in a bacterial or yeast system can be used if post- translational modifications turn to be non-essential for a desired activity of CG162443-07.
  • E. coli is used to express a CG162443-07 sequence.
  • Cell lines that stably express CGI 62443-07 may be engineered by using a vector that contains a selectable marker.
  • engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
  • the selectable marker in the expression construct confers resistance to the selection and optimally allows cells to stably integrate the expression construct into their chromosomes and to grow in culture and to be expanded into cell lines. Such cells can be cultured for a long period of time while CGI 62443 -07 is expressed continuously.
  • a number of selection systems may be used, including but not limited to, antibiotic resistance (markers like Neo, which confers resistance to geneticine, or G- 418 (Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem.
  • mutant cell lines including, but not limited to, tk-, hgprt- or aprt- cells, can be used in combination with vectors bearing the corresponding genes for thymidine kinase, hypoxanthine, guanine- or adenine phosphoribosyltransferase. Methods commonly known in the art of recombinant DNA technology may be routinely applied to select the desired recombinant clone, and such methods are described, for example, in Ausubel et al.
  • the recombinant cells may be cultured under standard conditions of temperature, incubation time, optical density and media composition. However, conditions for growth of recombinant cells may be different from those for expression of CGI 62443-07. Modified culture conditions and media may also be used to enhance production of CG162443-07.
  • CGI 62443 -07 Any techniques known in the art may be applied to establish the optimal conditions for producing CGI 62443 -07.
  • An alternative to producing CGI 62443-07 or a fragment thereof by recombinant techniques is peptide synthesis.
  • an entire CG162443-07, or a protein corresponding to a portion of CG162443-07, can be synthesized by use of a peptide synthesizer.
  • Conventional peptide synthesis or other synthetic protocols well known in the art may be used.
  • Proteins having the amino acid sequence of CGI 62443-07 or a portion thereof may be synthesized by solid-phase peptide synthesis using procedures similar to those described by Merrifield, 1963, J. Am. Chem. Soc, 85:2149.
  • N- ⁇ - protected amino acids having protected side chains are added stepwise to a growing polypeptide chain linked by its C-terminal and to an insoluble polymeric support, i.e., polystyrene beads.
  • the proteins are synthesized by linking an amino group of an N- ⁇ -deprotected amino acid to an ⁇ -carboxyl group of an N- ⁇ -protected amino acid that has been activated by reacting it with a reagent such as dicyclohexylcarbodiimide. The attachment of a free amino group to the activated carboxyl leads to peptide bond formation.
  • the most commonly used N- ⁇ -protecting groups include Boc, which is acid-labile, and Fmoc, which is base-labile.
  • Non-limiting examples of methods for preparing CGI 62443-07 can be found in Section 6, infra. 5.3.
  • Antibodies to CG162443-07 In various embodiments, monoclonal or polyclonal antibodies specific to CG162443-07, or a domain of CG162443-07 (i.e., the ECD (CG162443-15), can be used in immunoassays to measure the amount of CGI 62443-07 or used in immunoaffinity purification of a CG162443-07 protein.
  • a Hopp & Woods hydrophilic analysis see Hopp & Woods, Proc. Natl. Acad. Sci. U.S.A.
  • CG162443- 07, CG162443-015, or CG162443-04 protein is used to generate a CG162443-07- specific antibody.
  • the antibodies that immunospecifically bind to an CGI 62443-07 or an antigenic fragment thereof can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques. Polyclonal antibodies immunospecific for CGI 62443-07 or an antigenic fragment thereof can be produced by various procedures well-known in the art.
  • a CGI 62443-07 protein can be administered to various host animals including, but not limited to, rabbits, mice, and rats, to induce the production of sera containing polyclonal antibodies specific for the CG162443-07.
  • Various adjuvants may be used to increase the immunological response, depending on the host species, including but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette- Guerin) and corynebacterium parvum.
  • BCG Bacille Calmette- Guerin
  • Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof.
  • monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling et al., in: Monoclonal Antibodies and T Cell Hybridomas 563 681 (Elsevier, N.Y., 1981).
  • the term "monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology.
  • mice can be immunized with a non-murine antigen and once an immune response is detected, e.g., antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells, for example cells from cell line SP20 available from the ATCC.
  • Hybridomas are selected and cloned by limited dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention. Ascites fluid, which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones.
  • the present invention provides methods of generating monoclonal antibodies as well as antibodies produced by the method comprising culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse immunized with a non-murine antigen with myeloma cells and then screening the hybridomas resulting from the fusion for hybridoma clones that secrete an antibody able to bind to the antigen.
  • Antibody fragments which recognize specific particular epitopes may be generated by any technique known to those of skill in the art.
  • Fab and F(ab')2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
  • F(ab')2 fragments contain the variable region, the light chain constant region and the CHI domain of the heavy chain.
  • the antibodies of the present invention can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them.
  • DNA sequences encoding VH and VL domains are amplified from animal cDNA libraries (e.g., human or murine cDNA libraries of affected tissues).
  • the DNA encoding the VH and VL domains are recombined together with a scFv linker by PCR and cloned into a phagemid vector.
  • the vector is electroporated in E. coli and the E. coli is infected with helper phage.
  • Phage used in these methods are typically filamentous phage including fd and Ml 3 and the VH and VL domains are usually recombinantly fused to either the phage gene HI or gene VHJ.
  • Phage expressing an antigen binding domain that binds to a particular antigen can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead.
  • Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al, 1995, J. Immunol. Methods 182:41-50; Ames et al., 1995, J. Immunol. Methods 184:177-186; Kettleborough et al., 1994, Eur. J. Immunol.
  • the antibody coding regions from the phage can be isolated and used to generate whole antibodies or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described below.
  • Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in PCT publication No. WO 92/22324; Mullinax et al., 1992, BioTechniques 12(6):864-869; Sawai et al., 1995, AJRI 34:26-34; and Better et al, 1988, Science 240:1041-1043.
  • PCR primers including VH or VL nucleotide sequences, a restriction site, and a flanking sequence to protect the restriction site can be used to amplify the VH or VL sequences in scFv clones.
  • the PCR amplified VH domains can be cloned into vectors expressing a VH constant region, e.g., the human gamma 4 constant region
  • the PCR amplified VL domains can be cloned into vectors expressing a VL constant region, e.g., human kappa or lamba constant regions.
  • the vectors for expressing the VH or VL domains comprise an EF-l ⁇ promoter, a secretion signal, a cloning site for the variable domain, constant domains, and a selection marker such as neomycin.
  • the VH and VL domains may also cloned into one vector expressing the necessary constant regions.
  • the heavy chain conversion vectors and light chain conversion vectors are then co-transfected into cell lines to generate stable or transient cell lines that express full-length antibodies, e.g., IgG, using techniques known to those of skill in the art.
  • humanized antibodies or chimeric antibodies Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also U.S. Patent Nos. 4,444,887 and 4,716,111; and International publication Nos.
  • a chimeric antibody is a molecule in which different portions of the antibody are derived from different immunoglobulin molecules. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, 1985, Science 229:1202; Oi et al, 1986, BioTechniques 4:214; Gillies et al, 1989, J. Immunol. Methods 125:191-202; and U.S. Patent Nos. 5,807,715, 4,816,567, 4,8 16397, and 6,311,415.
  • a humanized antibody is an antibody or its variant or fragment thereof which is capable of binding to a predetermined antigen and which comprises a framework region having substantially the amino acid sequence of a human immunoglobulin and a CDR having substantially the amino acid sequence of a non human immuoglobulin.
  • a humanized antibody comprises substantially all of at least one, and typically two, variable domains (Fab, Fab', F(ab')2, Fabc, Fv) in which all or substantially all of the CDR regions correspond to those of a non human immunoglobulin (i.e., donor antibody) and all or substantially all of the framework regions are those of a human immunoglobulin consensus sequence.
  • a humanized antibody also comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • the antibody will contain both the light chain as well as at least the variable domain of a heavy chain.
  • the antibody also may include the CHI, hinge, CH2, CH3, and CH4 regions of the heavy chain.
  • the humanized antibody can be selected from any class of immunoglobulins, including IgM, IgG, IgD, IgA and IgE, and any isotype, including IgGl, IgG2, IgG3 and lgG4.
  • the constant domain is a complement fixing constant domain where it is desired that the humanized antibody exhibit cytotoxic activity, and the class is typically IgGl.
  • the constant domain may be of the IgG2 class.
  • the humanized antibody may comprise sequences from more than one class or isotype, and selecting particular constant domains to optimize desired effector functions is within the ordinary skill in the art.
  • the framework and CDR regions of a humanized antibody need not correspond precisely to the parental sequences, e.g., the donor CDR or the consensus framework may be mutagenized by substitution, insertion or deletion of at least one residue so that the CDR or framework residue at that site does not correspond to either the consensus or the import antibody. Such mutations, however, will not be extensive.
  • humanized antibody residues will correspond to those of the parental framework region (FR) and CDR sequences, more often 90%, and most preferably greater than 95%.
  • Humanized antibody can be produced using variety of techniques known in the art, including but not limited to, CDR grafting (European Patent No. EP 239,400; International Publication No. WO 91/09967; and U.S. Patent Nos. 5,225,539, 5,530,101, and 5,585,089), veneering or resurfacing (European Patent Nos.
  • framework residues in the framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding.
  • framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Patent No.
  • the antibodies that immunospecifically bind to CG162443-07 or an antigenic fragment thereof can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" CG162443-07 or an antigenic peptide thereof using techniques well- known to those skilled in the art. (See, e.g., Greenspan & Bona, 1989, FASEB J. 7(5)437-444; and Nissinoff, 1991, J. Immunol. 147(8):2429-2438).
  • the invention provides polynucleotides comprising a nucleotide sequence encoding an antibody or fragment thereof that immunospecifically binds to CGI 62443-07 or an antigenic fragment thereof.
  • the invention also encompasses polynucleotides that hybridize under high stringency, intermediate, or lower stringency hybridization conditions to polynucleotides that encode an antibody of the invention.
  • the polynucleotides may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art.
  • the nucleotide sequence of antibodies immunospecific for a desired antigen can be obtained, e.g., from the literature or a database such as GenBank.
  • nucleotide sequences encoding this antibody or a fragment thereof can be determined using * methods well known in the art, i.e., nucleotide codons known to encode particular amino acids are assembled in such a way to generate a nucleic acid that encodes the antibody.
  • Such a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.
  • a polynucleotide encoding an antibody may be generated from nucleic acid from a suitable source.
  • a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody.
  • a suitable source e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention
  • Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art.
  • the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc.
  • one or more of the CDRs is inserted within framework regions using routine recombinant DNA techniques.
  • the framework regions may be naturally occurring or consensus framework regions, and preferably human framework regions (see, e.g., Chothia et al., 1998, J. Mol. Biol. 278: 457-479 for a listing of human framework regions).
  • the polynucleotide generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds to a particular antigen.
  • one or more amino acid substitutions may be made within the framework regions, and, preferably, the amino acid substitutions improve binding of the antibody to its antigen.
  • the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well-known in the art. See, e.g., U.S. Patent No. 6,331,415.
  • methods for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals.
  • the invention provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody or a portion thereof, or a heavy or light chain CDR, operably linked to a promoter.
  • Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., International Publication No. WO 86/05807 and WO 89/01036; and U.S. Patent No.
  • the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy, the entire light chain, or both the entire heavy and light chains.
  • the expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention.
  • the invention includes host cells containing a polynucleotide encoding an antibody of the invention or fragments thereof, or a heavy or light chain thereof, or portion thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter.
  • vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.
  • a variety of host-expression vector systems may be utilized to express the antibody molecules of the invention.
  • the expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)).
  • the host cell may be co-transfected with two expression vectors of the invention, the first " vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide.
  • the two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides.
  • a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides.
  • the coding sequences for the heavy and light chains may comprise cDNA or genomic DNA.
  • an antibody molecule of the invention may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins.
  • the antibodies of the present invention or fragments thereof may be fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification.
  • Structural Prediction and Functional Analysis of CGI 62443-07 Any methods known in the art can be used to determine the identity of a purified CGI 62443-07 protein of the instant invention. Such methods include, but are not limited to, Western Blot, sequencing (e.g., Edman sequencing), liquid chromatography (e.g., HPLC, RP-HPLC with both UV and electrospray mass spectrometric detection), mass spectrometry, total amino acid analysis, peptide mapping, and SDS-PAGE.
  • the secondary, tertiary and/or quaternary structure of a CG162443-07 protein can analyzed by any methods known in the art, e.g., far UV circular dichroism spectrum can be used to analyze the secondary structure, near UV circular dichroism spectroscopy and second derivative UV absorbance spectroscopy can be used to analyze the tertiary structure, and light scattering SEC-HPLC can be used to analyze quaternary structure.
  • a CGI 62443-07 protein of the instant invention can be analyzed by any methods known in the art, such as but not limited to, sodium dodecyl sulphate polyacrylamide gel electrophoresis ("SDS-PAGE"), reversed phase high-performance liquid chromatography (“RP-HPLC”), size exclusion high-performance liquid chromatography (“SEC-HPLC”), and Western Blot (e.g., host cell protein Western Blot).
  • a CGI 62443-07 protein in a composition used in accordance to the instant invention is 80%- 100% pure by densitometry, or at least 97%, at least 98%, or at least 99% pure by densitometry.
  • a CGI 62443-07 protein in a composition used in accordance to the instant invention is more than 97%, more than 98%, or more than 99% pure by densitometry.
  • the biological activities and/or potency of CGI 62443-07 of the present invention can be determined by any methods known in the art.
  • compositions for use in therapy in accordance to the methods of the present invention can be tested in suitable cell lines for one or more activities that CGI 62443-07 possesses (e.g., the ability to bind RAGE ligands).
  • Structure prediction analysis of crystallographic data, sequence alignment, as well as homology modeling, can also be accomplished using computer software programs available in the art, such as BLAST, CHARMm release 21.2 for the Convex, and QUANTA v.3.3, (Molecular Simulations, Inc., York, United Kingdom).
  • Other methods of structural analysis can also be employed. These include, but are not limited to, X-ray crystallography (Engstom, A, 1974, Biochem. Exp. Biol. 11:7-13) and computer modeling (Fletterick, R. and Zoller, M. (eds.), 1986, Computer Graphics and Molecular Modeling, in Current Communications in Molecular Biology, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York).
  • the half life of a protein is a measurement of protein stability and indicates the time necessary for a one half reduction in activity of the protein.
  • the half-life of a CG162443-07 protein can be determined by any method measuring activity of CG162443-07 in samples from a subject over a period of time.
  • the normalization to concentration of CG162443-07 in the sample can be done by, e.g., immunoassays using anti-CGl 62443-07 antibodies to measure the levels of the CG162443-07 molecules in samples taken over a period of time after administration of the
  • CG162443-07 or detection of radiolabelled CG162443-07 molecules in samples taken from a subject after administration of the radiolabeled CGI 62443-07 molecules.
  • techniques known in the art can be used to prolong the half life of an CGI 62443-07 in vivo.
  • albumin or inert polymer molecules such as high molecular weight polyethyleneglycol (PEG) can be used. See, e.g.,
  • compositions comprising one more CGI 62443-07 for use in a therapy can also be tested in suitable animal model systems prior to testing in humans.
  • an index can be developed that combines observational examination of the animals as well as their survival status.
  • the effectiveness of CG162443-07 in preventing and/or treating a disease can be monitored by any methods known to one skilled in the art, including but not limited to, clinical evaluation, and measuring the level of CGI 62443-07 biomarkers in a biosample.
  • CGI 62443-07 Any adverse effects during the use of CGI 62443-07 alone or in combination with another therapy (e.g., another therapeutic or prophylactic agent) are preferably also monitored. Undesired effects typically experienced by patients taking one or more agents other than CGI 62443-07 are numerous and known in the art. Many are described in the Physicians' Desk Reference (58th ed., 2004). 5.5 Uses of CG162443-07 It was discovered that CG162443-07 has a novel ECD, CG162443-15, that inhibits RAGE binding to its known ligands (e.g., S100) (See, e.g., Section 6, supra). As such, the proteins of the present invention are useful in diagnosing, preventing and/or treating RAGE-mediated diseases.
  • another therapy e.g., another therapeutic or prophylactic agent
  • RAGE-mediated diseases refers to conditions associated with the interaction of RAGE and an r-ligand.
  • diseases are well known in the art and include, but are not limited to Alzheimer's Disease, chronic inflammation, arthritis, including rheumatoid arthritis, arthritis induced by lupus, psoriatic arthritis, osteoarthritis, arthritis due to Behchet's syndrome or Sjogren's syndrome, inflammatory disorders, such as multiple sclerosis and autoimmune encephalomyelitis, diabetic vasculature, and tumors.
  • the present invention provides methods for treating a
  • RAGE-mediated disease comprising administering to a subject in need thereof, a composition comprising CGI 62443-07 or one of its fragments, derivatives, variants, homologs, or variants in an amount effective to inhibit the interaction between RAGE and its r-ligand.
  • r-ligand includes any ligand that binds RAGE, examples of r-ligands are well known in the art and include, but are not limited to, AGE, S100, amphoterin/HMGBl, and amyloid fibrils.
  • the composition comprises CG162443-15.
  • a vector capable of expressing CG162443-07 or a fragment or derivative thereof maybe administered to a subject to treat or prevent a RAGE-mediated disorder.
  • the present invention provides methods for determining whether the RAGE/r-ligand interaction is inhibited in a sample comprising (i) adding CG162443-07 or any fragments or derivatives thereof to a sample comprising RAGE and an r-ligand; and (ii) determining whether CG162443- 07 binds to the r-ligand, thereby inhibiting the RAGE/r-ligand interaction.
  • the CG162443-07 protein is CG162443-15.
  • the r-ligand is S100. 5.6.
  • compositions suitable for administration.
  • Such compositions typically comprise the nucleic acid molecule, protein, or antibody and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference.
  • Such carriers or diluents include, but are not limited to, water, saline, finger's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
  • a pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal (e.g., by mouthwash), and rectal administration.
  • parenteral e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal (e.g., by mouthwash), and rectal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • the pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringeability exists.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound (e.g., an CG162443-07 protein or anti-CG 162443 -07 antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • the active compound e.g., an CG162443-07 protein or anti-CG 162443 -07 antibody
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouth wash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed.
  • compositions can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or com starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or com starch
  • a lubricant such as magnesium stearate or Sterotes
  • a glidant such as colloidal silicon dioxide
  • a sweetening agent such as sucrose or saccharin
  • the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
  • compositions for preparation of such formulations will be apparent to those skilled in the art.
  • the materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811. It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.
  • Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
  • the nucleic acid molecules of the invention can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see, e.g., U.S. Pat. No.
  • the pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can include one or more cells that produce the gene delivery system.
  • the pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
  • CGI 62443-07 or its fragments and derivatives thereof, can be used in binding studies to identify compounds binding to or interacting with CGI 62433 -07, or its fragments and derivatives, thereof.
  • the CG162443-07 protein can be used in binding studies with a RAGE isoform protein to identify compounds that: bind to or interact with CGI 62443-07.
  • Such binding studies can be performed using different formats including competitive and non-competitive formats.
  • the particular CGI 62443 -07 sequence involved in ligand binding can be identified using labeled compounds that bind to the protein and different protein fragments. Different strategies can be employed to select fragments to be tested to narrow down the binding region.
  • Examples of such strategies include testing consecutive fragments about 15 amino acids in length starting at the N-terminus, and testing longer length fragments. Jf longer length fragments are tested, a fragment binding to a compound can be subdivided to further locate the binding region. Fragments used for binding studies can be generated using recombinant nucleic acid techniques. In some embodiments, binding studies are performed using CG162443-07 expressed from a recombinant nucleic acid. Alternatively, recombinantly expressed CG162443-07 consists of the SEQ ID NO 2 amino acid sequence. Binding assays can be performed using individual compounds or preparations containing different numbers of compounds.
  • a preparation containing different numbers of compounds having the ability to bind to CGI 62443-07 can be divided into smaller groups of compounds that can be tested to identify the compound(s) binding to CGI 62443-07.
  • Binding assays can be performed using recombinantly produced CGI 62443- 07 present in different environments. Such environments include, for example, cell extracts and purified cell extracts containing a CGI 62443-07 recombinant nucleic acid; and also include, for example, the use of a purified CGI 62443-07 polypeptide produced by recombinant means which is introduced into different environments.
  • a binding method for screening a compound that binds to CG162443-07, or fragments thereof, wherein the method comprises the steps of: (a) expressing a polypeptide comprising the amino acid sequence of SEQ ID NO 2 or a fragment thereof from recombinant nucleic acid; (b) providing to said polypeptide a labeled RAGE ligand that binds to said polypeptide and a test preparation comprising one or more test compounds; (c) and measuring the effect of said test preparation on binding of said test preparation to said polypeptide comprising SEQ ID NO 2.
  • a binding method for identifying a compound that binds selectively to CGI 62443-07 polypeptide as compared to one or more RAGE isoform polypeptides that are not CGI 62443-07.
  • This method comprises the steps of: providing a CGI 62443-07 polypeptide comprising SEQ ID NO 2; providing a RAGE isoform polypeptide that is not CG162443-07, contacting said CG162443-07 polypeptide and said RAGE isoform polypeptide that is not CG162443-07 with a test preparation comprising one or more test compounds; and determining the binding of said test preparation to said
  • the above-described selective binding assays can also be performed with a polypeptide fragment of CG162443-07 wherein the polypeptide fragment comprises at least 5 consecutive amino acids that are coded by a nucleotide sequence that bridges the novel insertion sequence ofCGl 62443-07.
  • cDNA sequences identified herein can be used in numerous ways as polynucleotide reagents.
  • these sequences can be used to: (i) map their respective genes on a chromosome; and, thus, locate gene regions associated with genetic disease; (ii) identify an individual from a minute biological sample (tissue typing); and (iii) aid in forensic identification of a biological sample.
  • Nucleic acids encoding for CGI 62443-07 can be used, for example, to cause a decrease in RAGE-signaling activity or to create a test system (e.g., a transgenic animal) for screening for compounds affecting CGI 62443-07 expression, respectively.
  • Nucleic acids can be introduced and expressed in cells present in different environments. Guidelines for pharmaceutical administration in general are provided in, for example, Remington's Pharmaceutical Sciences, 18.sup.th Edition, supra, and Modem Pharmaceutics, 2.sup.nd Edition, supra.
  • Nucleic acid can be introduced into cells present in different environments using in vitro, in vivo, or ex vivo techniques. Examples of techniques useful in gene therapy are illustrated in Gene Therapy & Molecular Biology: From Basic Mechanisms to Clinical Applications, Ed. Boulikas, Gene Therapy Press, 1998. 6. EXAMPLES The present invention is further illustrated by the following non-limiting examples.
  • Example 1 Identification of CG162443-07
  • the coding sequence of CGI 62443-07 was derived by laboratory cloning of cDNA and by in silico prediction, respectively. In silico prediction was based on sequences available in CuraGen Corporation's proprietary SEQCALLINGTM database or in the public human sequence databases, and provided either the full length DNA sequence, or some portion thereof.
  • SeqcallingTM assembly sequences were initially identified by searching CuraGen Corporation's human SeqcallingTM database for DNA sequences, which translate into proteins with similarity to Advanced Glycosylation End product-specific Receptor and/or members of Immunoglobulin/major histocompatibility complex family.
  • SeqCalling assembly 430201917 was identified as having suitably significant similarity (Figure 3C). The chosen assembly was then extended using one or more sequences taken from additional SEQCALLINGTM fragments. Additional
  • CURAGEN® SEQCALLINGTM fragments were identified by the CURATOOL® program SEQUEXTENDER®. Such fragments were included in the derivation of Ace. No. CGI 62443-07 only when there was significant identity in the overlap region with the initial SeqCalling assemblies selected or their extensions was high. The extent of identity may be, for example, about 90% or higher, preferably about 95% or higher, and even more preferably close to or equal to 100%. Genomic clones having regions with 98% or higher identity to all or part of the initial or extended sequence, obtained as described in the preceding paragraph, were identified by BLASTN searches using the relevant sequence to query human genomic databases.
  • genomic clones that resulted were selected for further analysis because this identity indicates that these clones contain the genomic locus for the query sequence.
  • sequences were analyzed for putative coding regions as well as for similarity to the known DNA and protein sequences. Programs used for these analyses include Grail, Genscan, BLAST, HMMER, FASTA, Hybrid and other relevant programs.
  • the regions defined by the procedures described above were then manually integrated and corrected for apparent inconsistencies that may have arisen, for example, from miscalled bases in the original fragments or from discrepancies between predicted exon junctions and regions of sequence similarity, to derive the final sequence disclosed herein. When necessary, the process to identify and analyze SeqCalling assemblies and genomic clones was reiterated to derive the full-length sequence.
  • the following public components were thus included in the invention: AL845464.5, BG534930.1, and U89336.1 (Fig 1A).
  • SeqCallingTM 1 Assembly ED's were also included in the invention: 319537642 (Fig 1C).
  • the DNA sequence was analyzed to identify any open reading frames encoding novel full-length proteins as well as novel splice forms.
  • the open reading frame for CG162443-07 was identified beginning at nucleotides 1-3 and ending at nucleotides 1252-1254.
  • the start and stop codons of the open reading frame are highlighted in the Table in Figure 1 A in bold type. Putative untranslated regions are underlined and are found upstream from the initiation codon and downstream from the termination codon.
  • the encoded protein, CG162443-07, having 417 amino acid residues is presented using the one-letter code in the Table in Figure 1 A.
  • the DNA sequence and protein sequence for another splice variant of RAGE gene are reported here as CG162443-06, as shown in the Table in Figure IB. It is identical to ABQ99598 [Human coding sequence SEQ ID 331 - Homo sapiens, 1463 bp. WO200259260-A2, 01-AUG-2002, HYSEQ INC].
  • the coding sequences for CG162443-06 are set forth in the Table in Figure IB.
  • HMM file pfamHMMs
  • Scores for sequence family classification (score includes all domains) : Model Description Score E— alue N i£ Immunoglobulin domain 60.6 ' 3.3e-14 2
  • Model Domain seq-f seq-t hmm-f hmm-t score E-value ig 1/2 31 101 . . 1 52 [ ] 20 . 4 0. 042 ig 2 /2 265 316 . . 1 52 [ ] 40 .2 4. 8e-08
  • HMM file pfamHMMs
  • Scores for sequence family classification (score includes all domains) : Model Description Score E—value N ig Immunoglobulin domain 60.6 3 - 3e-14 2 Herpes_gE Alphaherpesvirus glycoprotein E -253.8 4.7 1
  • Model Domain seq-f seq-t hmm-f hmm-t score E-value ig 1/2 31 101 . . 1 52 [ ] 20 .4 0. 042 ig 2 /2 268 319 . . 1 52 [ ] 40 .2 4. 8e-08
  • the Immunoglobulin/major histocompatibility complex motif is found in this gene. 578 other genes in the database also contain this motif.
  • the basic stmcture of immunoglobulin (Ig) molecules is a tetramer of two light chains and two heavy chains linked by disulfide bonds. There are two types of light chains: kappa and lambda, each composed of a constant domain (CL) and a variable domain (VL).
  • alpha, delta, epsilon, gamma and mu consisting of a variable domain (VH) and three (in alpha, delta and gamma) or four (in epsilon and mu) constant domains (CHI to CH4).
  • the major histocompatibility complex (MHC) molecules are made of two chains.
  • the alpha chain is composed of three extracellular domains, a transmembrane region and a cytoplasmic tail.
  • the beta chain (beta-2- microglobulin) is composed of a single extracellular domain.
  • both the alpha and the beta chains are composed of two extracellular domains, a transmembrane region and a cytoplasmic tail.
  • Ig constant chain domains and a single extracellular domain in each type of MHC chains are related. These homologous domains are approximately one hundred amino acids long and include a conserved intradomain disulfide bond.
  • Members of the immunoglobulin superfamily are found in hundreds of proteins of different functions. Examples include antibodies, the giant muscle kinase titin and receptor tyrosine kinases. Immunoglobulin-like domains may be involved in protein-protein and protein-ligand interactions. The Pfam alignments do not include the first and last strand of the immunoglobulin-like domain.
  • Example 2 In Frame Cloning
  • the cDNAs coding for the full-length of CG162443-06 and CG162443-07 were targeted for "in-frame" cloning by PCR.
  • the PCR template was based on human cDNA(s) transcribed from human lung tissue.
  • oligonucleotide primers were used to clone the target cDNA sequence: FI 5'-CACCAGATCTCCCACCATGGCAGCCGGAACAGCAGTTGGAGCCTGG-3' Rl 5 ' -GCCGTCGACAGGCCCTCCAGTACTACTCTCGCCTGCCTC-3 '
  • the forward primer includes an in-frame Bgl II restriction site and the reverse primer contains an in-frame Sal I restriction site.
  • PCR was performed using the above primers and 0.5ng-1.0 ng of one of human lung cDNAs as template.
  • the reaction mixtures contained 2 microliters of each of the primers (original concentration: 5 pmol/ul), 1 microliter of lOmM dNTP (Clontech Laboratories, Palo Alto CA) and 1 microliter of 50xAdvantage-HF 2 polymerase (Clontech Laboratories) in 50 microliter-reaction volume.
  • PCR condition 1 a) 96°C 3 minutes b) 96°C 30 seconds denaturation c) 60°C 30 seconds, primer annealing d) 72°C 6 minutes extension Repeat steps b-d 15 times e) 96°C 15 seconds denaturation f) 60°C 30 seconds, primer annealing g) 72°C 6 minutes extension Repeat steps e-g 29 times e) 72°C 10 minutes final extension PCR condition 2: a) 96°C 3 minutes b) 96°C 15 seconds denaturation c) 76°C 30 seconds, reducing the temperature by 1 °C per cycle d) 72°C 4 minutes extension Repeat steps b-d 34 times e) 72°C 10 minutes final extension.
  • SR3 AGACGCCTCAGAGTAGCAGCG
  • SR4 ACAAGGGTGACATCGTGAGGC
  • SR6 GTGGCACCACCACGTAGGGTTCATA
  • the insert Assembly 437981130 was found to encode an open reading frame between residues 1 to 420aa of the target sequence of CG162443-06.
  • the alignment with CG162443-06 (WO200259260-A2) is displayed in a ClustalW Figure 5.
  • the additional amino acids at the ends of the assembly ORF are encoded by the restriction endonuclease sites incorporated into the amplification primers.
  • RNA integrity of all samples was determined by visual assessment of agarose gel electropherograms using 28S and 18S ribosomal RNA staining intensity ratio as a guide (2:1 to 2.5:1 28s:18s) and the absence of low molecular weight RNAs (degradation products).
  • Control samples to detect genomic DNA contamination included RTQ-PCR reactions run in the absence of reverse transcriptase using probe and primer sets designed to amplify across the span of a single exon.
  • RNA samples were normalized in reference to nucleic acids encoding constitutively expressed genes (i.e., ⁇ -actin and GAPDH).
  • non- normalized RNA samples were converted to single strand cDNA (sscDNA) using Superscript II (Invitrogen Corporation, Carlsbad, CA, Catalog No. 18064-147) and random hexamers according to the manufacturer's instractions. Reactions containing up to 10 ⁇ g of total RNA in a volume of 20 ⁇ l or were scaled up to contain 50 ⁇ g of total RNA in a volume of 100 ⁇ l and were incubated for 60 minutes at 42°C. sscDNA samples were then normalized in reference to nucleic acids as described above.
  • Probes and primers were designed according to Applied Biosystems Primer Express Software package (version I for Apple Computer's Macintosh Power PC) or a similar algorithm using the target sequence as input. Default reaction condition settings and the following parameters were set before selecting primers: 250 nM primer concentration; 58°-60° C primer melting temperature (Tm) range; 59° C primer optimal Tm; 2° C maximum primer difference (if probe does not have 5' G, probe Tm must be 10° C greater than primer Tm; and 75 bp to 100 bp amplicon size. The selected probes and primers were synthesized by Synthegen (Houston, TX).
  • Probes were double purified by HPLC to remove uncoupled dye and evaluated by mass spectroscopy to verify coupling of reporter and quencher dyes to the 5' and 3' ends of the probe, respectively. Their final concentrations were: 900 nM forward and reverse primers, and 200nM probe. Normalized RNA was spotted in individual wells of a 96 or 384- well PCR plate (Applied Biosystems, Foster City, CA). PCR cocktails included a single gene- specific probe and primers set or two multiplexed probe and primers sets. PCR reactions were done using TaqMan® One-Step RT-PCR Master Mix (Applied Biosystems, Catalog No. 4313803) following manufacturer's instructions.
  • Panel vl.7 includeds 2 control wells (genomic DNA control and chemistry control) and 94 wells of cDNA samples from cultured cell lines and primary normal tissues.
  • Cell lines were derived from carcinomas (ca) including: lung, small cell (s cell var), non small cell (non-s or non-sm); breast; melanoma; colon; prostate; glioma (glio), astrocytoma (astro) and neuroblastoma (neuro); squamous cell (squam); ovarian; liver; renal; gastric and pancreatic from the American Type Culture Collection (ATCC, Bethesda, MD).
  • ATCC American Type Culture Collection
  • Normal tissues were obtained from individual adults or fetuses and included: adult and fetal skeletal muscle, adult and fetal heart, adult and fetal kidney, adult and fetal liver, adult and fetal lung, brain, spleen, bone marrow, lymph node, pancreas, salivary gland, pituitary gland, adrenal gland, spinal cord, thymus, stomach, small intestine, colon, bladder, trachea, breast, ovary, uterus, placenta, prostate, testis and adipose.
  • metastasis metal
  • pleural effusion pi. eff or pi effusion
  • * indicates established from metastasis.
  • Example 4 Binding Studies Involving S100: Comparison of sRAGE and CG162443-15
  • the Western Blots for the purified CG162443-15 and CG162443-08 are shown in Figures 7-10.
  • the plates were then washed 3 times with PBS.
  • Anti-IgGl-biotin+Strep-HRP (1:000) was added and allowed to incubate for 1 hour at room temperature.
  • the plates were then washed 3 times with PBS, and substrate was added.
  • Such alterations and changes may include, for example, different pharmaceutical compositions for the administration of the proteins according to the present invention to a mammal; different amounts of protein in the compositions to be administered; different times and means of administering the proteins according to the present invention; and different materials contained in the administration dose including, for example, combinations of different proteins, or combinations of the proteins according to the present invention together with other biologically active compounds for the same, similar or differing purposes than the desired utility of those proteins specifically disclosed herein.
  • Such changes and alterations also are intended to include modifications in the amino acid sequence of the specific desired proteins described herein in which such changes alter the sequence in a manner as not to change the desired potential of the protein, but as to change solubility of the protein in the pharmaceutical composition to be administered or in the body, absorption of the protein by the body, protection of the protein for either shelf life or within the body until such time as the biological action of the protein is able to bring about the desired effect, and such similar modifications. Accordingly, such changes and alterations are properly intended to be within the full range of equivalents, and therefore within the purview of the following claims.
  • the invention and the manner and process of making and using it have been thus described in such full, clear, concise and exact terms so as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates generally to nucleic acids, proteins, and antibodies. The invention relates more particularly to nucleic acid molecules, proteins, and antibodies of a novel isoform of the Advanced Glycosylation End product-specific Receptor (RAGE), and its fragments, derivatives, variants, homologs, analogs, or a combination thereof.

Description

NOVEL ADVANCED GLYCOSYLATION END PRODUCT-SPECIFIC RECEPTOR-LIKE PROTEIN AND NUCLEIC ACIDS ENCODING SAME
This application claims priority to U.S. Provisional Patent Application Serial
No. 60/467,586 filed on November 19, 2003.
1. FIELD OF THE INVENTION
The present invention relates generally to nucleic acids, proteins, and antibodies. The invention relates more particularly to nucleic acid molecules, proteins, and antibodies of a novel isoform of the Advanced Glycosylation End product-specific Receptor (RAGE), and its fragments, derivatives, variants, homologs, analogs, or a combination thereof.
2. BACKGROUND OF THE INVENTION The receptor for advanced glycosylation end products (RAGE) is a member of the immunoglobulin superfamily of cell surface receptors. (J. Biol. Chem. 267, 14998-15004 (1992)). The RAGE gene lies within the major histocompatibility complex (MHC) class HE region on chromosome 6. RAGE is composed of three extracellular immunogloboin-like domains, a single pass transmembrane domain, and a short highly charged cytoplasmic domain that is essential for RAGE-mediated signaling. (/. Biol. Chem. 274, 19919-19924 (1999)). It binds multiple families of ligands, including advanced glycation end products (AGE), SlOO/calgranulins, amphoterin/HMGB 1 and amyloid fibrils. The interaction between RAGE and its ligand is associated with various diseases and disorders, including, but not limited to Alzheimer's Disease, chronic inflammation, arthritis, inflammatory disorders, such as multiple sclerosis and autoimmune encephalomyelitis, diabetic vasculature, and tumors. RAGE has a secreted isoform called soluble RAGE or sRAGE. Since this isoform lacks a transmembrane domain, it is secreted and acts as a decoy receptor (e.g., it binds to the RAGE ligand in place of RAGE). Indeed, sRAGE has been administered in a number of cell culture and animal models of RAGE-mediated disorders where it successfully prevented or reversed RAGE signaling effects that are associated with diabetic atherosclerosis and impaired wound healing (Not. Med. 4, 1025-1031 (1998)), colitis (Cell 97, 889-901 (1999)), amyloid-beta penetration of the blood-brain barrier (Nat. Med. 9, 907-913 (2003)), and tumor cell migration and invasion (Nature 405, 354-360 (2000)). Thus, there is a need in the art for novel isoforms of RAGE. In particular, there is a need for isoforms of RAGE that are capable of inhibiting the RAGE/ligand interaction. These isoforms may be useful in the diagnosis, treatment and prevention of RAGE-mediated diseases, including chronic inflammation, Alzheimer's brain tissue, some tumors, and diabetic vasculature. Citation or discussion of a reference herein shall not be construed as an admission that such is prior art to the present invention.
3. SUMMARY OF THE INVENTION The present invention is based, in part, upon the discovery of a novel splice variant of RAGE, which has an insertion sequence of 13 amino acids as compared to the known reference form of RAGE Q15109 = CG162443-02. This novel isoform is designated herein as CG162443-07. The extracellular domain of CGI 62443-07, referred to herein as CG162443-15, inhibits RAGE-ligand binding and therefore may be useful in the detection, diagnosis, and treatment of RAGE- mediated diseases. Accordingly, the present invention provides nucleic acids encoding the CG-
162443-07 protein, and its fragments, derivatives, variants, homologs, and analogs, including nucleotides that encode portions of CG162443-07 that correspond to its functional domains, and the polypeptide products specified by such nucleotide sequences, including but not limited to the extracellular domains (ECDs), the transmembrane domains (TMs), and the cytoplasmic domains (CDs). In one aspect, the invention provides an isolated CGI 62443-07 protein. In some embodiments, the isolated protein comprises the amino acid sequence of SEQ ID NO:2. In other embodiments, the invention includes a variant of SEQ ID NO: 2, in which some amino acids residues, e.g., no more than 1%, 2%, 3%, 5%, 10% or 15% of the amino acid sequences of SEQ ID NO: 2 are changed. In another aspect, the invention provides a fragment of a CGI 62443-07 protein, including CGI 62443-07 proteins encoded by allelic variants and single nucleotide polymorphisms of CG162443-07 nucleic acids. In another aspect, the invention includes an isolated CGI 62443-07 nucleic acid molecule. The CG162443-07 nucleic acid molecule can include a sequence encoding any of the CG162443-07 proteins, variants, or fragments disclosed above, or a complement to any such nucleic acid sequence. In one embodiment, the CGI 62443-07 nucleic acids include a sequence wherein nucleotides different from those given in SEQ ID NO:l may be incorporated. Preferably, no more than 1%, 2%, 3,%, 5%, 10%, 15%, or 20% of the nucleotides are so changed. In other embodiments, the invention includes fragments or complements of these nucleic acid sequences. Another aspect of the present invention describes expression vectors. In one embodiment of the invention, the expression vector comprises a nucleotide sequence encoding a polypeptide comprising SEQ ID NO 2, wherein the nucleotide sequence is transcriptionally coupled to an exogenous promoter. Alternatively, the nucleotide sequence comprises SEQ ID NO 1, and is transcriptionally coupled to an exogenous promoter. Another aspect of the present invention describes recombinant cells comprising expression vectors comprising the above-described sequences and the promoter is recognized by an RNA polymerase present in the cell. Another aspect of the present invention describes a recombinant cell made by a process comprising the step of introducing into the cell an expression vector comprising a nucleotide sequence of SEQ ID NO 1, wherein the nucleotide sequence is transcriptionally coupled to an exogenous promoter. The expression vector can be used to insert recombinant nucleic acid into the host genome or can exist as an autonomous piece of nucleic acid. Another aspect of the present invention features a purified antibody preparation comprising an antibody that binds selectively to CG162443-07. Another aspect of the present invention provides a method of screening for a compound that binds to CGI 62443-07, or fragments thereof. In one embodiment, the method comprises the steps of: (a) expressing a polypeptide comprising the amino acid sequence of SEQ ID NO 2 or a fragment thereof from recombinant nucleic acid; (b) providing to said polypeptide a labeled RAGE ligand that binds to said polypeptide and a test preparation comprising one or more test compounds; (c) and measuring the effect of said test preparation on binding of said test preparation to said polypeptide comprising SEQ ID NO 2. Another aspect of the present invention provides a method for screening a compound that binds selectively to CGI 62443-07 polypeptide as compared to one or more RAGE isoform polypeptides that are not CGI 62443 -07. This method comprises the steps of: providing a CG162443-07 polypeptide comprising SEQ ID NO 2; providing a RAGE isoform polypeptide that is not CGI 62443-07, contacting said CG162443-07 polypeptide and said RAGE isoform polypeptide that is not CG162443-07 with a test preparation comprising one or more test compounds; and determining the binding of said test preparation to said CGI 62443-07 polypeptide and to RAGE isoform polypeptide that is not CG162443-07, wherein a test preparation that binds to said CG162443-07 polypeptide but does not bind to said RAGE isoform polypeptide that is not CGI 62443-07 contains a compound that selectively binds said CG162443-07 polypeptide. Another aspect of the present invention provides a method for determining whether the RAGE/r-ligand interaction is inhibited in a sample comprising (i) adding CG162443-07 or any fragments or derivatives thereof to a sample comprising RAGE and an r-ligand; and (ii) determining whether CGI 62443-07 binds to the r-ligand, thereby inhibiting the RAGE/r-ligand interaction. In a specific embodiment, the CG162443-07 protein is CG162443-15. In another embodiment, the r-ligand is S100. Another aspect of the present invention provides a method for treating a
RAGE-mediated disease comprising administering to a patient in need thereof, a composition comprising CG162443-07 or one of its fragments, derivatives, variants, homologs, or variants in an amount effective to inhibit the interaction between RAGE and its r-ligand. Other features and advantages of the present invention are apparent from the additional descriptions provided herein including the different examples. The provided examples illustrate different components and methodology useful in practicing the present invention. The examples do not limit the claimed invention. Based on the present disclosure the skilled artisan can identify and employ other components and methodology useful for practicing the present invention. 4. Brief Description of the Drawings
Figure 1A depicts the nucleotide and amino acid sequence of CGI 62443 -07.
Figure IB depicts the nucleotide and amino acid sequence of CG162443-06. Figure 2 depicts the amino acid sequence alignment of CGI 62443. CG162443-02 is a known form of RAGE; CG162443-07 is the novel splice variant of the present invention; CG162443-15 is the ECD of CG162443-07; and CG162443-04 is a derivative of CG162443-07 with several amino acid substitutions.
Figure 3A depicts a BLASTN search using CURAGEN® Ace. No. CG162443-07. Figure 3B shows a high-scoring match as determined by a BLASTP search (versus Non-Redundant Composite dated 09/04/03) using the sequence of the Advanced Glycosylation End product-specific Receptor-like protein of the invention. Figure 3C depicts the BLASTN identity search of CuraGen Corporation's human SeqCalling™ database using the Advanced Glycosylation End product- specific Receptor-like gene according to the invention. Figure 4 depicts the ClustalW alignment of the protein of Ace. No. CGI 62443-06 & CGI 62443-07 with similar Advanced Glycosylation End product- specific Receptors. Figure 5 shows the PSORT, SignalP and hydropathy results for the Advanced
Glycosylation End product-specific Receptor-like protein of CGI 62443-06 & CG162443-07. Figure 6 depicts the ClustalW alignment of the protein of CGI 62443-06 with its physical clone 437981130. Figure 7 depicts a Western Blot for CGI 62443-08, a protein with functional similarity to sRAGE. Figure 8 depicts a graph demonstrating that CGI 62443-08 is equal in potency to R&D RAGE Figure 9 depicts a graph demonstrating that CGI 62443-08 can neutralize the binding of RAGE, and thus acts like sRAGE in a cell. Figure 10 depicts a Western Blot for CG162443-15 Figure 11 depicts a graph showing the results of a binding study designed to determine whether CG162443-15 binds to S100 and to compare its binding pattern to sRAGE. Figure 12A depicts the amount and type of protein used in the binding study described in Example 4. R&D RAGE refers to the known RAGE (Q15109); CuraRAGE refers to CGI 62443-08, which is the same as sRAGE, and CuraVariant refers to CG162443-15. Figure 12B depicts the results of the binding study underlying the graph in Figure 9. Plates A & B relate to R&D RAGE, Plates C-E relate to Cura-RAGE, and plates F-H relate to CuraVariant. Figure 13 depicts a graph showing the neutralization of RAGE binding to
S100 by CG162443-15. Figure 14A depicts the amount and type of protein used in the neutralization study described in Example 5. Figure 14B depicts the data underlying the graph in Figure 13. Figure 15 depicts the amino acid sequence of CGI 62443 -07 as compared to the known form of RAGE, including the amino acid sequence of the insert.
5. DETAILED DESCRIPTION OF THE INVENTION The present invention is based, in part, upon the discovery, identification and characterization of a novel splice variant of RAGE, which has an insertion sequence of 13 amino acids as compared to the known reference form of RAGE Q15109 = CG162443-02. This novel isoform is designated CG162443-07. The present invention provides nucleic acids encoding the CG162443-07 protein, and its fragments, derivatives, variants, homologs, and analogs. The present invention also provides antibodies against a CG162443-07 protein, and methods of use for CG162443-07. For clarity of disclosure, and not by way of limitation, the detailed description of the invention is divided into the following subsections: (i) CGI 62443-07 (ii) Methods of Preparing CGI 62443-07 (iii) Antibodies to CG162443-07 (iv) Structure Prediction and Functional Analysis of CG162443-07 (v) Uses of CGI 62443-07 (vi) Administration, Pharmaceutical Compositions and Kits (vii) Binding Assays (viii) Detection Assays 5.1. CG162443-07 CGI 62443-07 is a splice variant of RAGE, which has an insertion sequence of 13 amino acids as compared to the known reference form of RAGE Q15109 = CG162443-02. (See Figure 2). As used herein, the term "CGI 62443-07" refers to a class of proteins or nucleic acids encoding such proteins or their complementary strands, where the proteins comprise an amino acid sequence of SEQ ID NO. 2 (417 amino acids) or its fragments, derivatives, variants, homologs, or analogs. In a preferred embodiment, a CGI 62443-07 protein retains at least some biological activity of RAGE. As used herein, the term "biological activity" means that a CGI 62443-07 protein possesses some but not necessarily all the same properties of (and not necessarily to the same degree as) RAGE. In another embodiment, the invention further provides nucleic acids encoding CGI 62443-07, including nucleic acid fragments encoding the proteins just described. In another embodiment, the invention includes nucleic acid molecules that can hybridize to a CG-162443-07 nucleic acid under stringent hybridization condition. As used herein, the term "hybridizes under stringent conditions" describes conditions for hybridization As used herein, the term "hybridizes under stringent conditions" describes conditions for hybridization and washing under which nucleotide sequences at least 30% (preferably, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98%) identical to each other typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. In one, non limiting example, stringent hybridization conditions comprise a salt concentration from about 0.1 M to about 1.0 M sodium ion, a pH from about 7.0 to about 8.3, a temperature is at least about 60°C, and at least one wash in 0.2 X SSC, 0.01% BSA. In another non-limiting example, stringent hybridization conditions are hybridization at 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.1XSSC, 0.2% SDS at about 68 °C. In yet another non-limiting example, stringent hybridization conditions are hybridization in 6XSSC at about 45°C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at 50-65°C (i.e., one or more washes at 50°C, 55°C, 60°C or 65°C). It is understood that the nucleic acids of the invention do not include nucleic acid molecules that hybridize under these conditions solely to a nucleotide sequence consisting of only A or T nucleotides. As used herein, the term "isolated" in the context of a protein agent refers to a protein agent that is substantially free of cellular material or contaminating proteins from the cell or tissue source from which it is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of a protein agent in which the protein agent is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, a protein agent that is substantially free of cellular material includes preparations of a protein agent having less than about 30%, 20%, 10%, or 5% (by dry weight) of host cell proteins (also referred to as a "contaminating proteins"). When the protein agent is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein agent preparation. When the protein agent is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein agent. Accordingly, such preparations of a protein agent have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the protein agent of interest. In a specific embodiment, protein agents disclosed herein are isolated. As used herein, the term "isolated" in the context of nucleic acid molecules refers to a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid molecule. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a specific embodiment, nucleic acid molecules are isolated. As used herein, the term "effective amount" refers to the amount of a therapy (e.g., a composition comprising a CG162443-07 protein) which is sufficient to reduce and/or ameliorate the severity and/or duration of a disease or one or more symptoms thereof, prevent the advancement of a disease, cause regression of a disease, prevent the recurrence, development, or onset of one or more symptoms associated with a disease, or enhance or improve the prophylactic or therapeutic effect(s) of another therapy. As used herein, the terms "subject" and "subjects" refer to an animal, preferably a mammal, including a non-primate (e.g., a cow, pig, horse, cat, or dog), a primate (e.g., a monkey, chimpanzee, or human), and more preferably a human. In a certain embodiment, the subject is a mammal, preferably a human, who has been exposed to or is going to be exposed to an insult that may induce alimentary mucositis (such as radiation, chemotherapy, or chemical warfare agents). In another embodiment, the subject is a farm animal (e.g., a horse, pig, or cow) or a pet (e.g., a dog or cat) that has been exposed to or is going to be exposed to a similar insult. The term "subject" is used interchangeably with "patient" in the present invention. 5.1.2. CG162443-07 Derivatives. Variants, Homologs, Analogs and Fragments The present invention also provides fragments, derivatives, variants, homologs, and analogs of CGI 62443-07. Fragments provided herein are defined as sequences of at least 6 (contiguous) nucleic acids or at least 4 (contiguous) amino acids, a length sufficient to allow for specific hybridization in the case of nucleic acids or for specific recognition of an epitope in the case of amino acids, respectively, and are at most some portion less than a full length sequence. Fragments may be derived from any contiguous portion of a nucleic acid or amino acid sequence of choice. Derivatives are nucleic acid sequences or amino acid sequences formed from the native compounds either directly or by modification or partial substitution. Analogs are nucleic acid sequences or amino acid sequences that have a structure similar to, but not identical to, the native compound but differs from it in respect to certain components or side chains. Analogs may be synthetic or from a different evolutionary origin and may have a similar or opposite metabolic activity compared to wild-type. In one embodiment, the invention provides a fragment of a CGI 62443 -07 protein, including CGI 62443-07 proteins encoded by allelic variants and single nucleotide polymorphisms of CGI 62443 -07 nucleic acids. In a specific embodiment, the protein fragment of the present invention encodes the ECD of CG162443-07. The amino acid sequence of the ECD of CGI 62443-07, designated herein as CGI 62443- 15, is set forth in Figure 2. In another embodiment, the invention provides derivatives and analogs of CG162443-07. The production and use of derivatives and analogs related to CGI 62443-07 are within the scope of the present invention. In a specific embodiment, the derivative or analog is functionally active, i.e., capable of exhibiting one or more functional activities associated with a full-length, wild-type CG162443-07. Derivatives or analogs of CG162443-07 can be tested for the desired activity by procedures known in the art, including but not limited to, using appropriate cell lines, animal models, and clinical trials. In particular, CGI 62443-07 derivatives can be made via altering CGI 62443- 07 sequences by substitutions, insertions or deletions that provide for functionally equivalent molecules. In one embodiment, such alteration of an CG162443-07 sequence is done in a region that is not conserved in the RAGE protein family. Due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the same amino acid sequence as CGI 62443-07 may be used in the practice of the present invention. These include, but are not limited to, nucleic acid sequences comprising all or portions of CGI 62443-07 that are altered by the substitution of different codons that encode a functionally equivalent amino acid residue within the sequence, thus producing a silent change. In a preferred embodiment, the CGI 62443 -07 derivatives of the invention include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of CG162443-07 including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a silent change. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity that acts as a functional equivalent, resulting in a silent alteration. Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs. For example, the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. CGI 62443-07 derivatives of the invention also include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of CG162443-07 including altered sequences in which amino acid residues are substituted for residues with similar chemical properties. In a specific embodiment, 1, 2, 3, 4, or 5 amino acids are substituted. Derivatives or analogs of CG162443-07 include, but are not limited to, those proteins which are substantially homologous to CGI 62443-07 or fragments thereof, or whose encoding nucleic acid is capable of hybridizing to the CGI 62443-07 nucleic acid sequence. In a specific embodiment, alterations to the amino acid sequence of
CG162443-07 include at least one of the substitutions listed below: (a) Substitute R arginine for W tryptophan in position 97; (b) Substitute I isoleucine for L leucine in position 139; (c) Substitute E glutamic acid for A alanine in position 188; (d) Substitute R arginine for K lysine in position 191 ; (e) Substitute H histadine for N aspargine in position 193; (f) Substitute M methionine for L leucine in position 206; (g) Substitute T threonine for N asparagine in position 208; (h) Substitute A alanine for C cysteine in position 210; and (i) Substitute P praline for T threonine in position 217. In a specific embodiment, a derivative of CGI 62443-07 is CG162443-04. The amino acid sequence of CGI 62443-04 is set forth in Figure 2. The CGI 62443-07 derivatives and analogs of the invention can be produced by various methods known in the art. The manipulations that result in their production can occur at the gene or protein level. For example, the cloned CG162443-07 gene sequence can be modified by any of numerous strategies known in the art (e.g., Maniatis, T., 1989, Molecular Cloning, A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro. In the production of the gene encoding a derivative or analog of CGI 62443-07, care should be taken to ensure that the modified gene remains within the same translational reading frame as CGI 62443 -07, uninterrupted by translational stop signals, in the gene region where the desired CGI 62443-07 activity is encoded. Additionally, the CGI 62443-07 -encoding nucleic acid sequence can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification. Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site-directed mutagenesis (Hutchinson, C. et al, 1978, J. Biol. Chem 253 :6551), use of TAB.RTM. linkers (Pharmacia), etc. Manipulations of the CG162443-07 sequence may also be made at the protein level. Included within the scope of the invention are CGI 62443 -07 fragments or other derivatives or analogs which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited to, reagents useful for protection or modification of free NH2- groups, free COOH- groups, OH- groups, side groups of Tip-, Tyr-, Phe-, His-, Arg-, or Lys-; specific chemical cleavage by cyanogen bromide, hydroxylamine, BNPS-Skatole, acid, or alkali hydrolysis; enzymatic cleavage by trypsin, chymotrypsin, papain, V8 protease, NaBH4; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; etc. In addition, analogs and derivatives of CGI 62443 -07 can be chemically synthesized. For example, a protein corresponding to a portion of CGI 62443-07 which comprises the desired domain, or which mediates the desired aggregation activity in vitro, or binding to a receptor, can be synthesized by use of a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the CG162443-07 sequence. Non-classical amino acids include, but are not limited to, the D-isomers of the common amino acids, α-amino isobutyric acid, 4-aminobutyric acid, hydroxyproline, sarcosine, citrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, designer amino acids such as β-methyl amino acids, Cα-methyl amino acids, and Nα-methyl amino acids. In a specific embodiment, the CGI 62443-07 derivative is a chimeric or fusion protein comprising CGI 62443 -07 or a fragment thereof fused via a peptide bond at its amino- and/or carboxy-terminus to a non-CG162443-07 amino acid sequence. In one embodiment, the non-CG162443-07 amino acid sequence is fused at the amino- terminus of a CGI 62443-07 or a fragment thereof. In another embodiment, such a chimeric protein is produced by recombinant expression of a nucleic acid encoding the protein (comprising a CGI 62443-07 -coding sequence joined in-frame to a non- CG162443-07 coding sequence). Such a chimeric product can be custom made by a variety of companies (e.g., Retrogen, Operon, etc.) or made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other by methods known in the art, in the proper coding frame, and expressing the chimeric product by methods commonly known in the art. Alternatively, such a chimeric product may be made by protein synthetic techniques, e.g., by use of a peptide synthesizer. In a specific embodiment, a chimeric nucleic acid encoding CG162443-07 with a heterologous signal sequence is expressed such that the chimeric protein is expressed and processed by the cell to the mature CGI 62443-07 protein. The primary sequence of CG162443-07 and non-CG 162443-07 gene may also be used to predict tertiary structure of the molecules using computer simulation (Hopp and Woods, 1981, Proc. Natl. Acad. Sci. U.S.A. 78:3824-3828); the chimeric recombinant genes could be designed in light of correlations between tertiary structure and biological function. Likewise, chimeric genes comprising an essential portion of CG162443-07 molecule fused to a heterologous (non-CG162443-07) protein-encoding sequence may be constructed. In a specific embodiment, such chimeric construction can be used to enhance one or more desired properties of a CG162443-07, including but not limited to, CG162443-07 stability, solubility, or resistance to proteases. In another embodiment, chimeric construction can be used to target CG162443-07 to a specific site. In yet another embodiment, chimeric construction can be used to identify or purify a CGI 62443-07 of the invention, such as a His-tag, a FLAG tag, a green fluorescence protein (GFP), β-galactosidase, a maltose binding protein (MalE), a cellulose binding protein (CenA) or a mannose protein, etc. In one embodiment, a CGI 62443-07 protein is carbamylated. In some embodiment, a CGI 62443 -07 protein can be modified so that it has an extended half-life in vivo using any methods known in the art. For example, Fc fragment of human IgG or inert polymer molecules such as high molecular weight polyethyleneglycol (PEG) can be attached to a CG162443-07 protein. PEG can be attached to a CG162443-07 protein with or without a multifunctional linker either through site-specific conjugation of the PEG to the N- or C-terminus of the protein or via epsilon-amino groups present on lysine residues. Linear or branched polymer derivatization that results in minimal loss of biological activity will be used. The degree of conjugation can be closely monitored by SDS-PAGE and mass spectrometry to ensure proper conjugation of PEG molecules to the CGI 62443-07 protein. Unreacted PEG can be separated from CGI 62443-07 -PEG conjugates by size-exclusion or by ion-exchange chromatography. PEG-derivatized conjugates can be tested for in vivo efficacy using methods known to those of skill in the art. A CG162443-07 protein can also be conjugated to albumin in order to make the protein more stable in vivo or have a longer half life in vivo. The techniques are well known in the art, see e.g., International Publication Nos. WO 93/15199, WO 93/15200, and WO 01/77137; and European Patent No. EP 413, 622, all of which are incorporated herein by reference. 5.2. Methods of Preparing CG162443-07 Any techniques known in the art can be used in purifying a CGI 62443-07 protein, including but not limited to, separation by precipitation, separation by adsorption (e.g., column chromatography, membrane adsorbents, radial flow columns, batch adsorption, high-performance liquid chromatography, ion exchange chromatography, inorganic adsorbents, hydrophobic adsorbents, immobilized metal affinity chromatography, affinity chromatography), or separation in solution (e.g., gel filtration, electrophoresis, liquid phase partitioning, detergent partitioning, organic solvent extraction, and ultrafiltration). See e.g., Scopes, PROTEIN PURIFICATION, PRINCIPLES AND PRACTICE, 3rd ed., Springer (1994). During the purification, the biological activity of CGI 62443-07 may be monitored by one or more in vitro or in vivo assays. The purity of CG162443-07 can be assayed by any methods known in the art, such as but not limited to, gel electrophoresis. Methods known in the art can be utilized to recombinantly produce CG162443-07 proteins. A nucleic acid sequence encoding a CG162443-07 protein can be inserted into an expression vector for propagation and expression in host cells. An expression construct, as used herein, refers to a nucleic acid sequence encoding a CGI 62443-07 protein operably associated with one or more regulatory regions that enable expression of a CG162443-07 protein in an appropriate host cell. "Operably-associated" refers to an association in which the regulatory regions and the CGI 62443-07 sequence to be expressed are joined and positioned in such a way as to permit transcription, and ultimately, translation. The regulatory regions necessary for transcription of CG162443-07 can be provided by the expression vector. A translation initiation codon (ATG) may also be provided if a CG162443-07 gene sequence lacking its cognate initiation codon is to be expressed. In a compatible host-construct system, cellular transcriptional factors, such as RNA polymerase, will bind to the regulatory regions on the expression construct to effect transcription of the modified CGI 62443-07 sequence in the host organism. The precise nature of the regulatory regions needed for gene expression may vary from host cell to host cell. Generally, a promoter is required which is capable of binding RNA polymerase and promoting the transcription of an operably- associated nucleic acid sequence. Such regulatory regions may include those 5' non- coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like. The non-coding region 3' to the coding sequence may contain transcriptional termination regulatory sequences, such as terminators and polyadenylation sites. In order to attach DNA sequences with regulatory functions, such as promoters, to a CG162443-07 gene sequence or to insert a CG162443-07 gene sequence into the cloning site of a vector, linkers or adapters providing the appropriate compatible restriction sites may be ligated to the ends of the cDNAs by techniques well known in the art (see e.g., Wu et al., 1987, Methods in Enzymol, 152:343-349). Cleavage with a restriction enzyme can be followed by modification to create blunt ends by digesting back or filling in single-stranded DNA termini before ligation. Alternatively, a desired restriction enzyme site can be introduced into a fragment of DNA by amplification of the DNA using PCR with primers containing the desired restriction enzyme site. An expression construct comprising a CGI 62443-07 sequence operably associated with regulatory regions can be directly introduced into appropriate host cells for expression and production of a CG162443-07 protein without further cloning. See, e.g., U.S. Patent No. 5,580,859. The expression constructs can also contain DNA sequences that facilitate integration of a CG162443-07 sequence into the genome of the host cell, e.g., via homologous recombination. In this instance, it is not necessary to employ an expression vector comprising a replication origin suitable for appropriate host cells in order to propagate and express CGI 62443-07 in the host cells. A variety of expression vectors may be used, including but are not limited to, plasmids, cosmids, phage, phagemids or modified viruses. Such host-expression systems represent vehicles by which the coding sequences of a CGI 62443-07 gene may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express CGI 62443-07 in situ. These include, but are not limited to, microorganisms such as bacteria (e.g., E. coli and B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing CGI 62443 -07 coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing CGI 62443-07 coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing CGI 62443 -07 coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing CGI 62443 -07 coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, NS0, and 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Preferably, bacterial cells such as Escherichia coli and eukaryotic cells are used for the expression of a recombinant CGι62443-07 molecule. For example, mammalian cells such as Chinese hamster ovary cells (CHO) can be used with a vector bearing promoter element from major intermediate early gene of cytomegalocirus for effective expression of a CG162443- 07 sequence (Foecking et al, 1986, Gene 45:101; and Cockett et al, 1990, Bio/Technology 8:2). In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the CGI 62443-07 molecule being expressed. For example, when a large quantity of a CG162443-07 is to be produced, for the generation of pharmaceutical compositions of a CGI 62443-07 molecule, vectors that direct the expression of high levels of readily purified fusion protein products may be desirable. Such vectors include, but are not limited to, the E. coli expression vector pCR2.1 TOPO (Invitrogen); pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 24:5503-5509) and the like. Series of vectors like pFLAG (Sigma), pMAL (NΕB), and pΕT (Novagen) may also be used to express the foreign proteins as fusion proteins with FLAG peptide, malΕ-, or CBD- protein. These recombinant proteins may be directed into periplasmic space for correct folding and maturation. The fused part can be used for affinity purification of the expressed protein. Presence of cleavage sites for specific proteases like enterokinase allows the CGI 62443-07 protein to be cleaved from the fusion protein. The pGΕX vectors may also be used to express foreign proteins as fusion proteins with glutathione 5-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety. In an insect system, many vectors to express foreign genes can be used, e.g., Autographa californica nuclear polyhedrosis virus (AcNPV) can be used as a vector to express foreign genes. The virus grows in cells like Spodopterafrugiperda cells. A CGI 62443-07 coding sequence may be cloned individually into non-essential regions (e.g., the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (e.g., the polyhedrin promoter). In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, a CG162443- 07 coding sequence of interest may be ligated to an adenovirus transcription translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g. , region El or E3) will result in a recombinant virus that is viable and capable of expressing CG162443-07 in infected hosts (see, e.g., Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 8 1:355-359). Specific initiation signals may also be required for efficient translation of inserted CG162443-07 coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see, e.g., Bittner et al., 1987, Methods in Enzymol. 153:51-544). In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post- translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript and post-translational modification of the gene product, e.g., glycosylation and phosphorylation of the gene product, may be used. Such mammalian host cells include, but are not limited to, PC12, CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, W138, BT483, Hs578T, HTB2, BT2O and T47D, NSO (a murine myeloma cell line that does not endogenously produce any immunoglobulin chains), CRL7O3O and HsS78Bst cells. Expression in a bacterial or yeast system can be used if post- translational modifications turn to be non-essential for a desired activity of CG162443-07. In a preferred embodiment, E. coli is used to express a CG162443-07 sequence. For long-term, high-yield production of properly processed CG162443-07, stable expression in cells is preferred. Cell lines that stably express CGI 62443-07 may be engineered by using a vector that contains a selectable marker. By way of example but not limitation, following the introduction of the expression constructs, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the expression construct confers resistance to the selection and optimally allows cells to stably integrate the expression construct into their chromosomes and to grow in culture and to be expanded into cell lines. Such cells can be cultured for a long period of time while CGI 62443 -07 is expressed continuously. A number of selection systems may be used, including but not limited to, antibiotic resistance (markers like Neo, which confers resistance to geneticine, or G- 418 (Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62: 191-217; May, 1993, TB TECH 11(5):155- 2 15); Zeo, for resistance to Zeocin; Bsd, for resistance to blasticidin, etc.); antimetabolite resistance (markers like Dhfr, which confers resistance to methotrexate, Wigler et al., 1980, Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene 30:147). In addition, mutant cell lines including, but not limited to, tk-, hgprt- or aprt- cells, can be used in combination with vectors bearing the corresponding genes for thymidine kinase, hypoxanthine, guanine- or adenine phosphoribosyltransferase. Methods commonly known in the art of recombinant DNA technology may be routinely applied to select the desired recombinant clone, and such methods are described, for example, in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al, 1981, J. Mol. Biol. 150:1. The recombinant cells may be cultured under standard conditions of temperature, incubation time, optical density and media composition. However, conditions for growth of recombinant cells may be different from those for expression of CGI 62443-07. Modified culture conditions and media may also be used to enhance production of CG162443-07. Any techniques known in the art may be applied to establish the optimal conditions for producing CGI 62443 -07. An alternative to producing CGI 62443-07 or a fragment thereof by recombinant techniques is peptide synthesis. For example, an entire CG162443-07, or a protein corresponding to a portion of CG162443-07, can be synthesized by use of a peptide synthesizer. Conventional peptide synthesis or other synthetic protocols well known in the art may be used. Proteins having the amino acid sequence of CGI 62443-07 or a portion thereof may be synthesized by solid-phase peptide synthesis using procedures similar to those described by Merrifield, 1963, J. Am. Chem. Soc, 85:2149. During synthesis, N-α- protected amino acids having protected side chains are added stepwise to a growing polypeptide chain linked by its C-terminal and to an insoluble polymeric support, i.e., polystyrene beads. The proteins are synthesized by linking an amino group of an N- α-deprotected amino acid to an α-carboxyl group of an N-α-protected amino acid that has been activated by reacting it with a reagent such as dicyclohexylcarbodiimide. The attachment of a free amino group to the activated carboxyl leads to peptide bond formation. The most commonly used N-α-protecting groups include Boc, which is acid-labile, and Fmoc, which is base-labile. Details of appropriate chemistries, resins, protecting groups, protected amino acids and reagents are well known in the art and so are not discussed in detail herein (See, Atherton et al., 1989, Solid Phase Peptide Synthesis: A Practical Approach, IRL Press, and Bodanszky, 1993, Peptide Chemistry, A Practical Textbook, 2nd Ed., Springer- Verlag). Purification of the resulting CGI 62443-07 is accomplished using conventional procedures, such as preparative HPLC using gel permeation, partition and/or ion exchange chromatography. The choice of appropriate matrices and buffers are well known in the art and so are not described in detail herein.
Non-limiting examples of methods for preparing CGI 62443-07 can be found in Section 6, infra. 5.3. Antibodies to CG162443-07 In various embodiments, monoclonal or polyclonal antibodies specific to CG162443-07, or a domain of CG162443-07 (i.e., the ECD (CG162443-15), can be used in immunoassays to measure the amount of CGI 62443-07 or used in immunoaffinity purification of a CG162443-07 protein. A Hopp & Woods hydrophilic analysis (see Hopp & Woods, Proc. Natl. Acad. Sci. U.S.A. 78:3824-3828 (1981) can be used to identify hydrophilic regions of a protein, and to identify potential epitopes of a CG162443-07 protein. In a specific embodiment, CG162443- 07, CG162443-015, or CG162443-04 protein is used to generate a CG162443-07- specific antibody. The antibodies that immunospecifically bind to an CGI 62443-07 or an antigenic fragment thereof can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques. Polyclonal antibodies immunospecific for CGI 62443-07 or an antigenic fragment thereof can be produced by various procedures well-known in the art. For example, a CGI 62443-07 protein can be administered to various host animals including, but not limited to, rabbits, mice, and rats, to induce the production of sera containing polyclonal antibodies specific for the CG162443-07. Various adjuvants may be used to increase the immunological response, depending on the host species, including but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette- Guerin) and corynebacterium parvum. Such adjuvants are also well known in the art. Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling et al., in: Monoclonal Antibodies and T Cell Hybridomas 563 681 (Elsevier, N.Y., 1981). The term "monoclonal antibody" as used herein is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced. Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art. Briefly, mice can be immunized with a non-murine antigen and once an immune response is detected, e.g., antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells, for example cells from cell line SP20 available from the ATCC. Hybridomas are selected and cloned by limited dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention. Ascites fluid, which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones. The present invention provides methods of generating monoclonal antibodies as well as antibodies produced by the method comprising culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse immunized with a non-murine antigen with myeloma cells and then screening the hybridomas resulting from the fusion for hybridoma clones that secrete an antibody able to bind to the antigen. Antibody fragments which recognize specific particular epitopes may be generated by any technique known to those of skill in the art. For example, Fab and F(ab')2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments). F(ab')2 fragments contain the variable region, the light chain constant region and the CHI domain of the heavy chain. Further, the antibodies of the present invention can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In particular, DNA sequences encoding VH and VL domains are amplified from animal cDNA libraries (e.g., human or murine cDNA libraries of affected tissues). The DNA encoding the VH and VL domains are recombined together with a scFv linker by PCR and cloned into a phagemid vector. The vector is electroporated in E. coli and the E. coli is infected with helper phage. Phage used in these methods are typically filamentous phage including fd and Ml 3 and the VH and VL domains are usually recombinantly fused to either the phage gene HI or gene VHJ. Phage expressing an antigen binding domain that binds to a particular antigen can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al, 1995, J. Immunol. Methods 182:41-50; Ames et al., 1995, J. Immunol. Methods 184:177-186; Kettleborough et al., 1994, Eur. J. Immunol. 24:952-958; Persic et al., 1997, Gene 187:9-18; Burton et al., 1994, Advances in Immunology 57:191-280; International application No. PCT/GB91/O1 134; International publication Nos. WO 90/02809, WO 91/10737, WO 92/01047, WO 92/18619, WO 93/11236, WO 95/15982, WO 95/20401, and WO97/13844; and U.S. Patent Nos. 5,698,426, 5,223,409, 5,403,484, 5,580,717, 5,427,908, 5,750,753, 5,821,047, 5,571,698, 5,427,908, 5,516,637, 5,780,225, 5,658,727, 5,733,743 and 5,969,108. As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described below. Techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in PCT publication No. WO 92/22324; Mullinax et al., 1992, BioTechniques 12(6):864-869; Sawai et al., 1995, AJRI 34:26-34; and Better et al, 1988, Science 240:1041-1043. To generate whole antibodies, PCR primers including VH or VL nucleotide sequences, a restriction site, and a flanking sequence to protect the restriction site can be used to amplify the VH or VL sequences in scFv clones. Utilizing cloning techniques known to those of skill in the art, the PCR amplified VH domains can be cloned into vectors expressing a VH constant region, e.g., the human gamma 4 constant region, and the PCR amplified VL domains can be cloned into vectors expressing a VL constant region, e.g., human kappa or lamba constant regions. Preferably, the vectors for expressing the VH or VL domains comprise an EF-lα promoter, a secretion signal, a cloning site for the variable domain, constant domains, and a selection marker such as neomycin. The VH and VL domains may also cloned into one vector expressing the necessary constant regions. The heavy chain conversion vectors and light chain conversion vectors are then co-transfected into cell lines to generate stable or transient cell lines that express full-length antibodies, e.g., IgG, using techniques known to those of skill in the art. For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use humanized antibodies or chimeric antibodies. Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also U.S. Patent Nos. 4,444,887 and 4,716,111; and International publication Nos. WO 98/46645, WO 98/50433, WO 98/24893, WO98/16654, WO 96/34096, WO 96/33735, and WO 91/10741. A chimeric antibody is a molecule in which different portions of the antibody are derived from different immunoglobulin molecules. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, 1985, Science 229:1202; Oi et al, 1986, BioTechniques 4:214; Gillies et al, 1989, J. Immunol. Methods 125:191-202; and U.S. Patent Nos. 5,807,715, 4,816,567, 4,8 16397, and 6,311,415. A humanized antibody is an antibody or its variant or fragment thereof which is capable of binding to a predetermined antigen and which comprises a framework region having substantially the amino acid sequence of a human immunoglobulin and a CDR having substantially the amino acid sequence of a non human immuoglobulin. A humanized antibody comprises substantially all of at least one, and typically two, variable domains (Fab, Fab', F(ab')2, Fabc, Fv) in which all or substantially all of the CDR regions correspond to those of a non human immunoglobulin (i.e., donor antibody) and all or substantially all of the framework regions are those of a human immunoglobulin consensus sequence. Preferably, a humanized antibody also comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Ordinarily, the antibody will contain both the light chain as well as at least the variable domain of a heavy chain. The antibody also may include the CHI, hinge, CH2, CH3, and CH4 regions of the heavy chain. The humanized antibody can be selected from any class of immunoglobulins, including IgM, IgG, IgD, IgA and IgE, and any isotype, including IgGl, IgG2, IgG3 and lgG4. Usually the constant domain is a complement fixing constant domain where it is desired that the humanized antibody exhibit cytotoxic activity, and the class is typically IgGl. Where such cytotoxic activity is not desirable, the constant domain may be of the IgG2 class. The humanized antibody may comprise sequences from more than one class or isotype, and selecting particular constant domains to optimize desired effector functions is within the ordinary skill in the art. The framework and CDR regions of a humanized antibody need not correspond precisely to the parental sequences, e.g., the donor CDR or the consensus framework may be mutagenized by substitution, insertion or deletion of at least one residue so that the CDR or framework residue at that site does not correspond to either the consensus or the import antibody. Such mutations, however, will not be extensive. Usually, at least 75% of the humanized antibody residues will correspond to those of the parental framework region (FR) and CDR sequences, more often 90%, and most preferably greater than 95%. Humanized antibody can be produced using variety of techniques known in the art, including but not limited to, CDR grafting (European Patent No. EP 239,400; International Publication No. WO 91/09967; and U.S. Patent Nos. 5,225,539, 5,530,101, and 5,585,089), veneering or resurfacing (European Patent Nos. EP 592,106 and EP 519,596; Padlan, 1991, Molecular Immunology 28(4/5):489 498; Studnicka et al., 1994, Protein Engineering 7(6):805 814; and Roguska et al., 1994, PNAS 91 :969 973), chain shuffling (U.S. Patent No. 5,565,332), and techniques disclosed in, e.g., U.S. Pat. No. 6,407,213, U.S. Pat. No. 5,766,886, WO 9317105, Tan et al., J. Immunol. 169:1119 25 (2002), Caldas et al., Protein Eng. 13(5):353 60 (2000), Morea et al., Methods 20(3):267 79 (2000), Baca et al., J. Biol. Chem. 272(16): 10678 84 (1997), Roguska et al., Protein Eng. 9(10):895 904 (1996), Couto et al., Cancer Res. 55 (23 Supp):5973s 5977s (1995), Couto et al, Cancer Res.
55(8): 1717 22 (1995), Sandhu JS, Gene 150(2):409 10 (1994), and Pedersen et al., J. Mol. Biol. 235(3):959 73 (1994). Often, framework residues in the framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Patent No. 5,585,089; and Riechnαann et al., 1988, Nature 332:323.) Further, the antibodies that immunospecifically bind to CG162443-07 or an antigenic fragment thereof can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" CG162443-07 or an antigenic peptide thereof using techniques well- known to those skilled in the art. (See, e.g., Greenspan & Bona, 1989, FASEB J. 7(5)437-444; and Nissinoff, 1991, J. Immunol. 147(8):2429-2438). 5.3.1 Polynueleotide Sequences Encoding an Antibody The invention provides polynucleotides comprising a nucleotide sequence encoding an antibody or fragment thereof that immunospecifically binds to CGI 62443-07 or an antigenic fragment thereof. The invention also encompasses polynucleotides that hybridize under high stringency, intermediate, or lower stringency hybridization conditions to polynucleotides that encode an antibody of the invention. The polynucleotides may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art. The nucleotide sequence of antibodies immunospecific for a desired antigen can be obtained, e.g., from the literature or a database such as GenBank. Once the amino acid sequences of a CGI 62443-07 or an antigenic fragment thereof is known, nucleotide sequences encoding this antibody or a fragment thereof (e.g., a CDR) can be determined using * methods well known in the art, i.e., nucleotide codons known to encode particular amino acids are assembled in such a way to generate a nucleic acid that encodes the antibody. Such a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR. Alternatively, a polynucleotide encoding an antibody may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art. Once the nucleotide sequence of the antibody is determined, the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by reference herein in their entireties), to generate antibodies having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions. In a specific embodiment, one or more of the CDRs is inserted within framework regions using routine recombinant DNA techniques. The framework regions may be naturally occurring or consensus framework regions, and preferably human framework regions (see, e.g., Chothia et al., 1998, J. Mol. Biol. 278: 457-479 for a listing of human framework regions). Preferably, the polynucleotide generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds to a particular antigen. Preferably, as discussed supra, one or more amino acid substitutions may be made within the framework regions, and, preferably, the amino acid substitutions improve binding of the antibody to its antigen. Additionally, such methods may be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds. Other alterations to the polynucleotide are encompassed by the present invention and within the skill of the art. 5.3.2 Reeombinant Expression of an Antibody Recombinant expression of an antibody of the invention, derivative, analog or fragment thereof, (e.g., a heavy or light chain of an antibody of the invention or a portion thereof or a single chain antibody of the invention), requires construction of an expression vector containing a polynucleotide that encodes the antibody. Once a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof (preferably, but not necessarily, containing the heavy or light chain variable domain), of the invention has been obtained, the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well-known in the art. See, e.g., U.S. Patent No. 6,331,415. Thus, methods for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The invention, thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody or a portion thereof, or a heavy or light chain CDR, operably linked to a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., International Publication No. WO 86/05807 and WO 89/01036; and U.S. Patent No. 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy, the entire light chain, or both the entire heavy and light chains. The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention. Thus, the invention includes host cells containing a polynucleotide encoding an antibody of the invention or fragments thereof, or a heavy or light chain thereof, or portion thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter. In preferred embodiments for the expression of double-chained antibodies, vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below. A variety of host-expression vector systems may be utilized to express the antibody molecules of the invention. The expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)). When a marker in the vector system expressing antibody is amplifiable, increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse et al., 1983, Mol. Cell. Biol. 3:257). The host cell may be co-transfected with two expression vectors of the invention, the first "vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, 1986, Nature 322:52; and Kohler, 1980, Proc. Natl. Acad. Sci. USA 77:2 197). The coding sequences for the heavy and light chains may comprise cDNA or genomic DNA. Once an antibody molecule of the invention has been produced by recombinant expression, it may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. Further, the antibodies of the present invention or fragments thereof may be fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification. 5.4. Structural Prediction and Functional Analysis of CGI 62443-07 Any methods known in the art can be used to determine the identity of a purified CGI 62443-07 protein of the instant invention. Such methods include, but are not limited to, Western Blot, sequencing (e.g., Edman sequencing), liquid chromatography (e.g., HPLC, RP-HPLC with both UV and electrospray mass spectrometric detection), mass spectrometry, total amino acid analysis, peptide mapping, and SDS-PAGE. The secondary, tertiary and/or quaternary structure of a CG162443-07 protein can analyzed by any methods known in the art, e.g., far UV circular dichroism spectrum can be used to analyze the secondary structure, near UV circular dichroism spectroscopy and second derivative UV absorbance spectroscopy can be used to analyze the tertiary structure, and light scattering SEC-HPLC can be used to analyze quaternary structure. The purity of a CGI 62443-07 protein of the instant invention can be analyzed by any methods known in the art, such as but not limited to, sodium dodecyl sulphate polyacrylamide gel electrophoresis ("SDS-PAGE"), reversed phase high-performance liquid chromatography ("RP-HPLC"), size exclusion high-performance liquid chromatography ("SEC-HPLC"), and Western Blot (e.g., host cell protein Western Blot). In a preferred embodiment, a CGI 62443-07 protein in a composition used in accordance to the instant invention is 80%- 100% pure by densitometry, or at least 97%, at least 98%, or at least 99% pure by densitometry. In another preferred embodiment, a CGI 62443-07 protein in a composition used in accordance to the instant invention is more than 97%, more than 98%, or more than 99% pure by densitometry. The biological activities and/or potency of CGI 62443-07 of the present invention can be determined by any methods known in the art. For example, compositions for use in therapy in accordance to the methods of the present invention can be tested in suitable cell lines for one or more activities that CGI 62443-07 possesses (e.g., the ability to bind RAGE ligands). Structure prediction, analysis of crystallographic data, sequence alignment, as well as homology modeling, can also be accomplished using computer software programs available in the art, such as BLAST, CHARMm release 21.2 for the Convex, and QUANTA v.3.3, (Molecular Simulations, Inc., York, United Kingdom). Other methods of structural analysis can also be employed. These include, but are not limited to, X-ray crystallography (Engstom, A, 1974, Biochem. Exp. Biol. 11:7-13) and computer modeling (Fletterick, R. and Zoller, M. (eds.), 1986, Computer Graphics and Molecular Modeling, in Current Communications in Molecular Biology, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). The half life of a protein is a measurement of protein stability and indicates the time necessary for a one half reduction in activity of the protein. The half-life of a CG162443-07 protein can be determined by any method measuring activity of CG162443-07 in samples from a subject over a period of time. The normalization to concentration of CG162443-07 in the sample can be done by, e.g., immunoassays using anti-CGl 62443-07 antibodies to measure the levels of the CG162443-07 molecules in samples taken over a period of time after administration of the
CG162443-07, or detection of radiolabelled CG162443-07 molecules in samples taken from a subject after administration of the radiolabeled CGI 62443-07 molecules. In specific embodiments, techniques known in the art can be used to prolong the half life of an CGI 62443-07 in vivo. For example, albumin or inert polymer molecules such as high molecular weight polyethyleneglycol (PEG) can be used. See, e.g.,
International Publication Nos. WO 93/15199, WO 93/15200, and WO 01/77137; and U.S. Patent No. 6,528,485. Compositions comprising one more CGI 62443-07 for use in a therapy can also be tested in suitable animal model systems prior to testing in humans. To establish an estimate of drug activity in relevant model experiments, an index can be developed that combines observational examination of the animals as well as their survival status. The effectiveness of CG162443-07 in preventing and/or treating a disease can be monitored by any methods known to one skilled in the art, including but not limited to, clinical evaluation, and measuring the level of CGI 62443-07 biomarkers in a biosample. Any adverse effects during the use of CGI 62443-07 alone or in combination with another therapy (e.g., another therapeutic or prophylactic agent) are preferably also monitored. Undesired effects typically experienced by patients taking one or more agents other than CGI 62443-07 are numerous and known in the art. Many are described in the Physicians' Desk Reference (58th ed., 2004). 5.5 Uses of CG162443-07 It was discovered that CG162443-07 has a novel ECD, CG162443-15, that inhibits RAGE binding to its known ligands (e.g., S100) (See, e.g., Section 6, supra). As such, the proteins of the present invention are useful in diagnosing, preventing and/or treating RAGE-mediated diseases. RAGE-mediated diseases as used herein, refers to conditions associated with the interaction of RAGE and an r-ligand. Examples of such diseases are well known in the art and include, but are not limited to Alzheimer's Disease, chronic inflammation, arthritis, including rheumatoid arthritis, arthritis induced by lupus, psoriatic arthritis, osteoarthritis, arthritis due to Behchet's syndrome or Sjogren's syndrome, inflammatory disorders, such as multiple sclerosis and autoimmune encephalomyelitis, diabetic vasculature, and tumors. In one embodiment, the present invention provides methods for treating a
RAGE-mediated disease comprising administering to a subject in need thereof, a composition comprising CGI 62443-07 or one of its fragments, derivatives, variants, homologs, or variants in an amount effective to inhibit the interaction between RAGE and its r-ligand. As used herein, the term "r-ligand" includes any ligand that binds RAGE, examples of r-ligands are well known in the art and include, but are not limited to, AGE, S100, amphoterin/HMGBl, and amyloid fibrils. In a specific embodiment, the composition comprises CG162443-15. In another embodiment, a vector capable of expressing CG162443-07 or a fragment or derivative thereof maybe administered to a subject to treat or prevent a RAGE-mediated disorder. In another embodiment, the present invention provides methods for determining whether the RAGE/r-ligand interaction is inhibited in a sample comprising (i) adding CG162443-07 or any fragments or derivatives thereof to a sample comprising RAGE and an r-ligand; and (ii) determining whether CG162443- 07 binds to the r-ligand, thereby inhibiting the RAGE/r-ligand interaction. In a specific embodiment, the CG162443-07 protein is CG162443-15. In another embodiment, the r-ligand is S100. 5.6. Pharmaceutical Compositions The CGI 62443-07 nucleic acid molecules, proteins, and antibodies (also referred to herein as "active compounds") of the invention, and derivatives, fragments, analogs and homologs thereof, can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the nucleic acid molecule, protein, or antibody and a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, finger's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions. A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal (e.g., by mouthwash), and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions can be prepared by incorporating the active compound (e.g., an CG162443-07 protein or anti-CG 162443 -07 antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouth wash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed.
Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or com starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery. In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811. It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals. The nucleic acid molecules of the invention can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see, e.g., U.S. Pat. No. 5,328,470) or by stereotactic injection (see, e.g., Chen, et al., 1994. Proc. Natl. Acad. Sci. USA 91: 3054-3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells that produce the gene delivery system. The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
5.7. Binding Assays CGI 62443-07, or its fragments and derivatives thereof, can be used in binding studies to identify compounds binding to or interacting with CGI 62433 -07, or its fragments and derivatives, thereof. In one embodiment, the CG162443-07 protein can be used in binding studies with a RAGE isoform protein to identify compounds that: bind to or interact with CGI 62443-07. Such binding studies can be performed using different formats including competitive and non-competitive formats. The particular CGI 62443 -07 sequence involved in ligand binding can be identified using labeled compounds that bind to the protein and different protein fragments. Different strategies can be employed to select fragments to be tested to narrow down the binding region. Examples of such strategies include testing consecutive fragments about 15 amino acids in length starting at the N-terminus, and testing longer length fragments. Jf longer length fragments are tested, a fragment binding to a compound can be subdivided to further locate the binding region. Fragments used for binding studies can be generated using recombinant nucleic acid techniques. In some embodiments, binding studies are performed using CG162443-07 expressed from a recombinant nucleic acid. Alternatively, recombinantly expressed CG162443-07 consists of the SEQ ID NO 2 amino acid sequence. Binding assays can be performed using individual compounds or preparations containing different numbers of compounds. A preparation containing different numbers of compounds having the ability to bind to CGI 62443-07 can be divided into smaller groups of compounds that can be tested to identify the compound(s) binding to CGI 62443-07. Binding assays can be performed using recombinantly produced CGI 62443- 07 present in different environments. Such environments include, for example, cell extracts and purified cell extracts containing a CGI 62443-07 recombinant nucleic acid; and also include, for example, the use of a purified CGI 62443-07 polypeptide produced by recombinant means which is introduced into different environments. In one embodiment of the invention, a binding method is provided for screening a compound that binds to CG162443-07, or fragments thereof, wherein the method comprises the steps of: (a) expressing a polypeptide comprising the amino acid sequence of SEQ ID NO 2 or a fragment thereof from recombinant nucleic acid; (b) providing to said polypeptide a labeled RAGE ligand that binds to said polypeptide and a test preparation comprising one or more test compounds; (c) and measuring the effect of said test preparation on binding of said test preparation to said polypeptide comprising SEQ ID NO 2. In another embodiment of the present invention, a binding method is provided for identifying a compound that binds selectively to CGI 62443-07 polypeptide as compared to one or more RAGE isoform polypeptides that are not CGI 62443-07. This method comprises the steps of: providing a CGI 62443-07 polypeptide comprising SEQ ID NO 2; providing a RAGE isoform polypeptide that is not CG162443-07, contacting said CG162443-07 polypeptide and said RAGE isoform polypeptide that is not CG162443-07 with a test preparation comprising one or more test compounds; and determining the binding of said test preparation to said
CGI 62443-07 polypeptide and to RAGE isoform polypeptide that is not CGI 62443- 07, wherein a test preparation that binds to said CGI 62443-07 polypeptide but does not bind to said RAGE isoform polypeptide that is not CG162443-07 contains a compound that selectively binds said CGI 62443-07 polypeptide. The above-described selective binding assays can also be performed with a polypeptide fragment of CG162443-07 wherein the polypeptide fragment comprises at least 5 consecutive amino acids that are coded by a nucleotide sequence that bridges the novel insertion sequence ofCGl 62443-07. 5.8 Detection Assays Portions or fragments of the cDNA sequences identified herein (and the corresponding complete gene sequences) can be used in numerous ways as polynucleotide reagents. By way of example, and not of limitation, these sequences can be used to: (i) map their respective genes on a chromosome; and, thus, locate gene regions associated with genetic disease; (ii) identify an individual from a minute biological sample (tissue typing); and (iii) aid in forensic identification of a biological sample. Nucleic acids encoding for CGI 62443-07 can be used, for example, to cause a decrease in RAGE-signaling activity or to create a test system (e.g., a transgenic animal) for screening for compounds affecting CGI 62443-07 expression, respectively. Nucleic acids can be introduced and expressed in cells present in different environments. Guidelines for pharmaceutical administration in general are provided in, for example, Remington's Pharmaceutical Sciences, 18.sup.th Edition, supra, and Modem Pharmaceutics, 2.sup.nd Edition, supra. Nucleic acid can be introduced into cells present in different environments using in vitro, in vivo, or ex vivo techniques. Examples of techniques useful in gene therapy are illustrated in Gene Therapy & Molecular Biology: From Basic Mechanisms to Clinical Applications, Ed. Boulikas, Gene Therapy Press, 1998. 6. EXAMPLES The present invention is further illustrated by the following non-limiting examples.
Example 1: Identification of CG162443-07 The coding sequence of CGI 62443-07 was derived by laboratory cloning of cDNA and by in silico prediction, respectively. In silico prediction was based on sequences available in CuraGen Corporation's proprietary SEQCALLING™ database or in the public human sequence databases, and provided either the full length DNA sequence, or some portion thereof. Seqcalling™ assembly sequences were initially identified by searching CuraGen Corporation's human Seqcalling™ database for DNA sequences, which translate into proteins with similarity to Advanced Glycosylation End product-specific Receptor and/or members of Immunoglobulin/major histocompatibility complex family. SeqCalling assembly 430201917 was identified as having suitably significant similarity (Figure 3C). The chosen assembly was then extended using one or more sequences taken from additional SEQCALLING™ fragments. Additional
CURAGEN® SEQCALLING™ fragments were identified by the CURATOOL® program SEQUEXTENDER®. Such fragments were included in the derivation of Ace. No. CGI 62443-07 only when there was significant identity in the overlap region with the initial SeqCalling assemblies selected or their extensions was high. The extent of identity may be, for example, about 90% or higher, preferably about 95% or higher, and even more preferably close to or equal to 100%. Genomic clones having regions with 98% or higher identity to all or part of the initial or extended sequence, obtained as described in the preceding paragraph, were identified by BLASTN searches using the relevant sequence to query human genomic databases. The genomic clones that resulted were selected for further analysis because this identity indicates that these clones contain the genomic locus for the query sequence. These sequences were analyzed for putative coding regions as well as for similarity to the known DNA and protein sequences. Programs used for these analyses include Grail, Genscan, BLAST, HMMER, FASTA, Hybrid and other relevant programs. The regions defined by the procedures described above were then manually integrated and corrected for apparent inconsistencies that may have arisen, for example, from miscalled bases in the original fragments or from discrepancies between predicted exon junctions and regions of sequence similarity, to derive the final sequence disclosed herein. When necessary, the process to identify and analyze SeqCalling assemblies and genomic clones was reiterated to derive the full-length sequence. The following public components were thus included in the invention: AL845464.5, BG534930.1, and U89336.1 (Fig 1A). In addition, the following SeqCalling™1 Assembly ED's were also included in the invention: 319537642 (Fig 1C). The DNA sequence was analyzed to identify any open reading frames encoding novel full-length proteins as well as novel splice forms. The open reading frame for CG162443-07 was identified beginning at nucleotides 1-3 and ending at nucleotides 1252-1254. The start and stop codons of the open reading frame are highlighted in the Table in Figure 1 A in bold type. Putative untranslated regions are underlined and are found upstream from the initiation codon and downstream from the termination codon. The encoded protein, CG162443-07, having 417 amino acid residues is presented using the one-letter code in the Table in Figure 1 A. The DNA sequence and protein sequence for another splice variant of RAGE gene are reported here as CG162443-06, as shown in the Table in Figure IB. It is identical to ABQ99598 [Human coding sequence SEQ ID 331 - Homo sapiens, 1463 bp. WO200259260-A2, 01-AUG-2002, HYSEQ INC]. The coding sequences for CG162443-06 are set forth in the Table in Figure IB.
Sequence Analysis of CG162443-07 CGI 62443-07 maps to chromosome 6p21.3. This assignment was made using mapping information associated with genomic clones, public genes and ESTs sharing sequence identity with the disclosed sequence and CuraGen Corporation's Electronic Northern bioinformatic tool. In search of sequence databases, it was found that public EST sequences BG534930.1 and BI772019.1 supported the sequence prediction of CG162443-07 and CGI 62443-06, respectively (Fig. 2A). In a search of sequence databases, it was found that the full amino acid sequence of CG16243-07 had 391 of 417 amino acid residues (93%) identical to, and 398 of 417 amino acid residues (95%) similar to, the 404 amino acid residue ptnr:SWISSNEW-ACC:Q15109 protein from Homo sapiens (Human) (Advanced glycosylation end product-specific receptor precursor (Receptor for advanced glycosylation end products))(Fig. 2B). A multiple sequence alignment is given in Fig. 3, with the protein of the invention being shown on the first line in a ClustalW analysis comparing the protein of the invention with related protein sequences.
The presence of identifiable domains in the protein disclosed herein was determined by searches versus domain databases such as Pfam, PROSITE, ProDom, Blocks or Prints and then identified by the h terpro domain accession number. Significant domains are summarized in Table 3.
Table 3A. PFAM HMM Domain Analysis of CG162443-07
HMM file: pfamHMMs
Sequence file: /data4/genetools/saguo07harvardl6508.pfam. seq Query: 162443-07
Scores for sequence family classification (score includes all domains) : Model Description Score E— alue N i£ Immunoglobulin domain 60.6 ' 3.3e-14 2
Herpes_gE Alphaherpesvirus glycoprotein E - 47.7 2.2 1
Parsed for domains:
Model Domain seq-f seq-t hmm-f hmm-t score E-value ig 1/2 31 101 . . 1 52 [ ] 20 . 4 0. 042 ig 2 /2 265 316 . . 1 52 [ ] 40 .2 4. 8e-08
Herpes_gE 1/1 46 413 . . 1 514 [ ] -247 . 7 2 .2
Table 3B. PFAM HMM Domain Analysis of CG162443-06
HMM file: pfamHMMs
Sequence file: /data4/genetools/saguo06harvardl8489.pfam. seq
Query: 162443-06
Scores for sequence family classification (score includes all domains) : Model Description Score E—value N ig Immunoglobulin domain 60.6 3 - 3e-14 2 Herpes_gE Alphaherpesvirus glycoprotein E -253.8 4.7 1
Parsed for domains :
Model Domain seq-f seq-t hmm-f hmm-t score E-value ig 1/2 31 101 . . 1 52 [ ] 20 .4 0. 042 ig 2 /2 268 319 . . 1 52 [ ] 40 .2 4. 8e-08
Herpes_gE 1/1 46 416 . . 1 514 [ ] -253 . 8 4 .7 The Immunoglobulin/major histocompatibility complex motif is found in this gene. 578 other genes in the database also contain this motif. [InterPro annotation] The basic stmcture of immunoglobulin (Ig) molecules is a tetramer of two light chains and two heavy chains linked by disulfide bonds. There are two types of light chains: kappa and lambda, each composed of a constant domain (CL) and a variable domain (VL). There are five types of heavy chains: alpha, delta, epsilon, gamma and mu, all consisting of a variable domain (VH) and three (in alpha, delta and gamma) or four (in epsilon and mu) constant domains (CHI to CH4). The major histocompatibility complex (MHC) molecules are made of two chains. In class I the alpha chain is composed of three extracellular domains, a transmembrane region and a cytoplasmic tail. The beta chain (beta-2- microglobulin) is composed of a single extracellular domain. In class II , both the alpha and the beta chains are composed of two extracellular domains, a transmembrane region and a cytoplasmic tail. It is known that the Ig constant chain domains and a single extracellular domain in each type of MHC chains are related. These homologous domains are approximately one hundred amino acids long and include a conserved intradomain disulfide bond. Members of the immunoglobulin superfamily are found in hundreds of proteins of different functions. Examples include antibodies, the giant muscle kinase titin and receptor tyrosine kinases. Immunoglobulin-like domains may be involved in protein-protein and protein-ligand interactions. The Pfam alignments do not include the first and last strand of the immunoglobulin-like domain. Some of the proteins in this group are responsible for the molecular basis of the blood group antigens, surface markers on the outside of the red blood cell membrane. Most of these markers are proteins, but some are carbohydrates attached to lipids or proteins [Reid M.E., Lomas-Francis C. The Blood Group Antigen FactsBook Academic Press, London / San Diego, (1997)]. Lutheran blood group glycoprotein (B-CAM cell surface glycoprotein) (Auberger B antigen) (F8/G253 antigen) belongs to the Lutheran blood group system and is associated with Lu(a/b), Au(a b), LU6 to LU20 antigens. This indicates that the sequence of the invention has properties similar to those of other proteins known to contain this/these domain(s) and similar to the properties of these domains. Example 2: In Frame Cloning The cDNAs coding for the full-length of CG162443-06 and CG162443-07 were targeted for "in-frame" cloning by PCR. The PCR template was based on human cDNA(s) transcribed from human lung tissue. The following oligonucleotide primers were used to clone the target cDNA sequence: FI 5'-CACCAGATCTCCCACCATGGCAGCCGGAACAGCAGTTGGAGCCTGG-3' Rl 5 ' -GCCGTCGACAGGCCCTCCAGTACTACTCTCGCCTGCCTC-3 ' For downstream cloning purposes, the forward primer includes an in-frame Bgl II restriction site and the reverse primer contains an in-frame Sal I restriction site. PCR was performed using the above primers and 0.5ng-1.0 ng of one of human lung cDNAs as template. The reaction mixtures contained 2 microliters of each of the primers (original concentration: 5 pmol/ul), 1 microliter of lOmM dNTP (Clontech Laboratories, Palo Alto CA) and 1 microliter of 50xAdvantage-HF 2 polymerase (Clontech Laboratories) in 50 microliter-reaction volume. The following reaction conditions were used: PCR condition 1: a) 96°C 3 minutes b) 96°C 30 seconds denaturation c) 60°C 30 seconds, primer annealing d) 72°C 6 minutes extension Repeat steps b-d 15 times e) 96°C 15 seconds denaturation f) 60°C 30 seconds, primer annealing g) 72°C 6 minutes extension Repeat steps e-g 29 times e) 72°C 10 minutes final extension PCR condition 2: a) 96°C 3 minutes b) 96°C 15 seconds denaturation c) 76°C 30 seconds, reducing the temperature by 1 °C per cycle d) 72°C 4 minutes extension Repeat steps b-d 34 times e) 72°C 10 minutes final extension. An amplified product was detected by agarose gel electrophoresis. The fragment was gel-purified and ligated into the pCR2.1 vector (Invitrogen, Carlsbad, CA) following the manufacturer's recommendation. Twelve clones per PCR reaction were picked and sequenced. The inserts were sequenced using vector-specific M13 Forward and M13 Reverse primers and the following gene-specific primers:
SF1: GTGGCCAGAAACATCCTGGAGA
SF2: AGTGACTGGTACCTGGGCAACC
SF3: GCGTCTGACCTCAAGGTGATCCA
SF4: GCCTCACGATGTCACCCTTGT SF5: CTCTCTACGACTACCTCAGGGCCTC
SF6: CCCGCTATGATCCTCGCTTTGT
SRI: TCAGTCACCAAGTGGAGGTGCAG
SR2: TCTGGTTCTCCACAAGACCGAT
SR3: AGACGCCTCAGAGTAGCAGCG SR4: ACAAGGGTGACATCGTGAGGC
SR5: AATAGGCAGGCAGGAAGTCAATG
SR6: GTGGCACCACCACGTAGGGTTCATA The insert Assembly 437981130 was found to encode an open reading frame between residues 1 to 420aa of the target sequence of CG162443-06. The alignment with CG162443-06 (WO200259260-A2) is displayed in a ClustalW Figure 5. The additional amino acids at the ends of the assembly ORF are encoded by the restriction endonuclease sites incorporated into the amplification primers.
Example 3. Quantitative expression analysis of clones in various cells and tissues The quantitative expression of CG164332-07 was assessed using microtiter plates containing RNA samples from a variety of normal and pathology-derived cells, cell lines and tissues using real time quantitative PCR (RTQ-PCR) performed on an Applied Biosystems (Foster City, CA) ABI PRISM® 7700 or an ABI PRISM® 7900 HT Sequence Detection System. RNA integrity of all samples was determined by visual assessment of agarose gel electropherograms using 28S and 18S ribosomal RNA staining intensity ratio as a guide (2:1 to 2.5:1 28s:18s) and the absence of low molecular weight RNAs (degradation products). Control samples to detect genomic DNA contamination included RTQ-PCR reactions run in the absence of reverse transcriptase using probe and primer sets designed to amplify across the span of a single exon.
RNA samples were normalized in reference to nucleic acids encoding constitutively expressed genes (i.e., β-actin and GAPDH). Alternatively, non- normalized RNA samples were converted to single strand cDNA (sscDNA) using Superscript II (Invitrogen Corporation, Carlsbad, CA, Catalog No. 18064-147) and random hexamers according to the manufacturer's instractions. Reactions containing up to 10 μg of total RNA in a volume of 20 μl or were scaled up to contain 50 μg of total RNA in a volume of 100 μl and were incubated for 60 minutes at 42°C. sscDNA samples were then normalized in reference to nucleic acids as described above.
Probes and primers were designed according to Applied Biosystems Primer Express Software package (version I for Apple Computer's Macintosh Power PC) or a similar algorithm using the target sequence as input. Default reaction condition settings and the following parameters were set before selecting primers: 250 nM primer concentration; 58°-60° C primer melting temperature (Tm) range; 59° C primer optimal Tm; 2° C maximum primer difference (if probe does not have 5' G, probe Tm must be 10° C greater than primer Tm; and 75 bp to 100 bp amplicon size. The selected probes and primers were synthesized by Synthegen (Houston, TX). Probes were double purified by HPLC to remove uncoupled dye and evaluated by mass spectroscopy to verify coupling of reporter and quencher dyes to the 5' and 3' ends of the probe, respectively. Their final concentrations were: 900 nM forward and reverse primers, and 200nM probe. Normalized RNA was spotted in individual wells of a 96 or 384- well PCR plate (Applied Biosystems, Foster City, CA). PCR cocktails included a single gene- specific probe and primers set or two multiplexed probe and primers sets. PCR reactions were done using TaqMan® One-Step RT-PCR Master Mix (Applied Biosystems, Catalog No. 4313803) following manufacturer's instructions. Reverse transcription was performed at 48° C for 30 minutes followed by amplification/PCR cycles: 95° C 10 min, then 40 cycles at 95° C for 15 seconds, followed by 60° C for 1 minute. Results were recorded as CT values (cycle at which a given sample crosses a threshold level of fluorescence) and plotted using a log scale, with the difference in RNA concentration between a given sample and the sample with the lowest CT value being represented as 2 to the power of delta CT. The percent relative expression was the reciprocal of the RNA difference multiplied by 100. CT values below 28 indicate high expression, between 28 and 32 indicate moderate expression, between 32 and 35 indicate low expression and above 35 reflect levels of expression that were too low to be measured reliably. Normalized sscDNA was analyzed by RTQ-PCR using IX TaqMan® Universal Master mix (Applied Biosystems; catalog No. 4324020), following the manufacturer's instructions. PCR amplification and analysis were done as described above.
General_screening_panel_ vl.7 Panel vl.7 includeds 2 control wells (genomic DNA control and chemistry control) and 94 wells of cDNA samples from cultured cell lines and primary normal tissues. Cell lines were derived from carcinomas (ca) including: lung, small cell (s cell var), non small cell (non-s or non-sm); breast; melanoma; colon; prostate; glioma (glio), astrocytoma (astro) and neuroblastoma (neuro); squamous cell (squam); ovarian; liver; renal; gastric and pancreatic from the American Type Culture Collection (ATCC, Bethesda, MD). Normal tissues were obtained from individual adults or fetuses and included: adult and fetal skeletal muscle, adult and fetal heart, adult and fetal kidney, adult and fetal liver, adult and fetal lung, brain, spleen, bone marrow, lymph node, pancreas, salivary gland, pituitary gland, adrenal gland, spinal cord, thymus, stomach, small intestine, colon, bladder, trachea, breast, ovary, uterus, placenta, prostate, testis and adipose. The following abbreviations are used in reporting the results: metastasis (met); pleural effusion (pi. eff or pi effusion) and * indicates established from metastasis.
Expression of gene CG162443-07 was assessed using the primer-probe sets Ag6306, Ag6685 and Ag8603, described in Tables 4A, 4B and 4C. Results of the RTQ-PCR runs are shown in Table 4D.
Table 4A. Probe Name Ag6306
Figure imgf000048_0001
Table 4B. Probe Name Ag6685
Figure imgf000049_0001
Table 4C. Probe Name Ag8603 (hits CGI 62443-07 only)
Figure imgf000049_0002
Table 4D. Quantitative expression analysis of CGI 62443-07 (General_screening_panel_v 1.7)
Figure imgf000049_0003
Figure imgf000050_0001
Figure imgf000051_0001
General_screening_panel_vl.7 Summary: Ag6306/Ag6685/Ag8603 showed that CG162443-07 is highly expressed in lung, thyroid, and Lymph Node (CT=22-28). Gene expression was detected at moderate level (CT=28-32) in kidney, brain, Adrenal Gland, spleen, thymus, Trachea, ovary, Prostate, and adipose.
CG162443-07 was expressed in brain, especially in cerebellum (CT=30-31), hippocampus (CT=32-34), and amygdala (CT=33-35). Modulation of this gene, encoded protein and/or use of antibodies or small molecule targeting this gene or gene product is useful in the treatment of Alzheimer's, schizophrenia, forgetfulness, ataxia, autism, seizures, anxiety, and obsessive compulsive disorder. Example 4: Binding Studies Involving S100: Comparison of sRAGE and CG162443-15
Plates were coated overnight with 100 ul of SI 00 (lOug/ml final cone) in carbonate buffer (pH 9.6) at 4° C. The plates were then washed three times with PBS tween, blocked for 1 hour at room temperature with 3% BSA/PBS tween, and washed 3 times again with PBS tween. Purified CG162443-15 or CG162443-08 (sRAGE)(see Figures 7-9) was added to half of the plates at various concentrations (50 ul of 50 ug/ml)in PBS, and incubated for 1-2 hours, (see Figures 12A-B). The proteins can be purified by any method known in the art. The Western Blots for the purified CG162443-15 and CG162443-08 are shown in Figures 7-10. The plates were then washed 3 times with PBS. Anti-IgGl-biotin+Strep-HRP (1:000) was added and allowed to incubate for 1 hour at room temperature. The plates were then washed 3 times with PBS, and substrate was added.
The results of the binding study are shown in Figure 9. CG162443-15 bound to S 100 in with the strongest binding occurring at the higher concentrations (50ug/ml) of CG162443-15CG162443-15 and sRAGE showed similar binding patterns in vitro.
Example 5: Neutralization of RAGE Binding by CG162443-15
Plates were coated overnight with 100 ul of SI 00 (lOug/ml final cone) in carbonate buffer (pH 9.6) at 4° C. The plates were then washed three times with PBS tween, blocked for 1 hour at room temperature with 3% BSA/PBS tween, and washed 3 times again with PBS tween. RAGE was added to half of the plates at various concentrations (50 ul of 50 ug/ml) in PBS, and incubated 2 hours. CG162443-15 was then added in PBS, and allowed to incubate for 2 hours (See Figure 14). The plates were then washed 3 times with PBS tween. Anti-IgGl-biotin+Strep-HRP (1:000) was added and allowed to incubate for 1 hour at room temperature. The plates were then washed 3 times with PBS, and substrate was added.
The results of this study are shown in Figure 10. CGI 62443- 15 blocked binding of RAGE to S100. These results suggest that CG162443-15 acts in the same way as sRAGE, and thus may be used to prevent RAGE/ligand interaction that results in an immune response. 7. EQUIVALENTS Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims. Thus, while the preferred embodiments of the invention have been illustrated and described, it is to be understood that this invention is capable of variation and modification, and should not be limited to the precise terms set forth. The inventors desire to avail themselves of such changes and alterations which may be made for adapting the invention to various usages and conditions. Such alterations and changes may include, for example, different pharmaceutical compositions for the administration of the proteins according to the present invention to a mammal; different amounts of protein in the compositions to be administered; different times and means of administering the proteins according to the present invention; and different materials contained in the administration dose including, for example, combinations of different proteins, or combinations of the proteins according to the present invention together with other biologically active compounds for the same, similar or differing purposes than the desired utility of those proteins specifically disclosed herein. Such changes and alterations also are intended to include modifications in the amino acid sequence of the specific desired proteins described herein in which such changes alter the sequence in a manner as not to change the desired potential of the protein, but as to change solubility of the protein in the pharmaceutical composition to be administered or in the body, absorption of the protein by the body, protection of the protein for either shelf life or within the body until such time as the biological action of the protein is able to bring about the desired effect, and such similar modifications. Accordingly, such changes and alterations are properly intended to be within the full range of equivalents, and therefore within the purview of the following claims. The invention and the manner and process of making and using it have been thus described in such full, clear, concise and exact terms so as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same.

Claims

WHAT IS CLAIMED IS :
1. A purified nucleic acid comprising SEQ ID NO. 1 , or the complement thereof.
2. The purified nucleic acid of claim 1, wherein said nucleic acid comprises a region encoding SEQ ID NO. 2
3. A fragment of the nucleic acid of claim 1, wherein the nucleic acid comprises a region encoding the ECD of the protein encoded by SEQ ID NO. 2.
4. A purified polypeptide comprising SEQ ID NO. 2.
5. A fragment of the polypeptide in claim 4, wherein the polypeptide encodes the ECD of the protein encoded by SEQ ID NO. 2.
6. An expression vector comprising a nucleotide sequence encoding SEQ ID NO 2, wherein said nucleotide sequence is transcriptionally coupled to an exogenous promoter.
7. The expression vector of claim 6, wherein said nucleotide sequence comprises SEQ ID NO 1.
8. A method for screening for a compound able to bind to CG162443-07 comprising the steps of: (a) expressing a polypeptide comprising SEQ ID NO 2 from recombinant nucleic acid; (b) providing to said polypeptide a test preparation comprising one or more test compounds; and (c) measuring the ability of said test preparation to bind to said polypeptide.
9. The method of claim 8, wherein said steps (b) and (c) are perfonned in vitro.
10. The method of claim 8, wherein said steps (a), (b), and (c) are performed using a whole cell.
11. The method of claim 8, wherein said polypeptide is expressed from an expression vector.
12. The method of claim 8, wherein said polypeptide comprises SEQ ID NO 2.
13. A method for screening for a compound able to bind to or interact with a CG162443-07 protein or a fragment thereof comprising the steps of: (a) expressing a CGI 62443-07 polypeptide comprising SEQ ID NO 2 or fragment thereof from a recombinant nucleic acid; (b) providing to said polypeptide a labeled RAGE ligand that binds to said polypeptide and a test preparation comprising one or more compounds; and (c) measuring the effect of said test preparation on binding of said labeled RAGE ligand to said polypeptide, wherein a test preparation that alters the binding of said labeled RAGE ligand to said polypeptide contains a compound that binds to or interacts with said polypeptide.
14. The method of claim 13, wherein said steps (b) and (c) are performed in vitro.
15. The method of claim 13, wherein said steps (a), (b) and (c) are performed using a whole cell
16. The method of claim 13, wherein said polypeptide is expressed from an expression vector.
17. The method of claim 13, wherein said expression vector comprises SEQ ID NO 1 or a fragment of SEQ ID NO 1.
18. The method of claim 13, wherein said polypeptide comprises SEQ ID NO 2 or a fragment of SEQ ID NO 2.
19. A method for treating a RAGE-mediated disease comprising administering to a patient in need thereof, a composition comprising CGI 62443 -07 or a fragment of derivative thereof, in an amount effective to inhibit the interaction between RAGE and its r-ligand.
20. The method according to claim 19, wherein the RAGE-mediated disease is selected from the group consisting of: Alzheimer's Disease, chronic inflammation, arthritis, rheumatoid arthritis, arthritis induced by lupus, psoriatic arthritis, osteoarthritis, arthritis due to Behchet's syndrome or Sjogren's syndrome, inflammatory disorders, multiple sclerosis and autoimmune encephalomyelitis, diabetic vasculature, and tumors.
21. The method according to claim 19, wherein the composition comprises CG162443-15.
22. The method according to claim 21, wherein the r-ligand is selected from the group consisting of: advanced glycation end products, SlOO/calgranulins, amphoterin/HMGB 1 and amyloid fibrils
23. The method according to claim 22, wherein the r-ligand is S100.
24. A method for determining whether the RAGE/r-ligand interaction is inhibited in a sample comprising (i) adding CGI 62443 -07 or any fragments or derivatives thereof to a sample comprising RAGE and an r-ligand; and (ii) determining whether CGI 62443-07 binds to the r-ligand, thereby inhibiting the RAGE/r-ligand interaction.
25. The method according to claim 24, wherein the fragment is CG162443015.
26. The method according to claim 25, wherein the r-ligand is selected from the group consisting of: advanced glycation end products , SlOO/calgranulins, amphoterin HMGB 1 and amyloid fibrils.
27. The method according to claim 26, wherein the r-ligand is SI 00.
PCT/US2004/038870 2003-11-19 2004-11-19 Novel advanced glycosylation end product-specific receptor-like protein and nucleic acids encoding same WO2005051995A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US52426603P 2003-11-19 2003-11-19
US60/524,266 2003-11-19

Publications (2)

Publication Number Publication Date
WO2005051995A2 true WO2005051995A2 (en) 2005-06-09
WO2005051995A3 WO2005051995A3 (en) 2005-08-25

Family

ID=34632883

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/038870 WO2005051995A2 (en) 2003-11-19 2004-11-19 Novel advanced glycosylation end product-specific receptor-like protein and nucleic acids encoding same

Country Status (1)

Country Link
WO (1) WO2005051995A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006119510A2 (en) * 2005-05-04 2006-11-09 Receptor Biologix, Inc. Isoforms of receptor for advanced glycation end products (rage) and methods of identifying and using same
US7470521B2 (en) 2004-07-20 2008-12-30 Critical Therapeutics, Inc. RAGE protein derivatives

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2473587T3 (en) 2004-08-03 2014-07-07 Transtech Pharma, Inc. RAGE fusion proteins and methods of use
RU2011142230A (en) 2009-04-20 2013-05-27 Пфайзер Инк. PROTEIN GLYCOSYLIN CONTROL AND COMPOSITIONS AND METHODS CONCERNING THIS

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997039121A1 (en) * 1996-04-16 1997-10-23 Schering Aktiengesellschaft Advanced glycosylation end-product receptor peptides and uses therefor
WO2000020458A1 (en) * 1998-10-05 2000-04-13 The Trustees Of Columbia University In The City Of New York Methods for determining whether a compound is capable of inhibiting the interaction of a peptide with rage
WO2001092892A2 (en) * 2000-05-30 2001-12-06 Transtech Pharma, Inc. Methods to identify compounds that modulate rage
WO2002030889A2 (en) * 2000-10-13 2002-04-18 The Trustees Of Columbia University In The City Of New York A method for inhibiting new tissue growth in blood vessels in a patient subjected to blood vessel injury
WO2002059260A2 (en) * 2000-11-17 2002-08-01 Hyseq, Inc. Nucleic acids and polypeptides

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997039121A1 (en) * 1996-04-16 1997-10-23 Schering Aktiengesellschaft Advanced glycosylation end-product receptor peptides and uses therefor
WO2000020458A1 (en) * 1998-10-05 2000-04-13 The Trustees Of Columbia University In The City Of New York Methods for determining whether a compound is capable of inhibiting the interaction of a peptide with rage
WO2001092892A2 (en) * 2000-05-30 2001-12-06 Transtech Pharma, Inc. Methods to identify compounds that modulate rage
WO2002030889A2 (en) * 2000-10-13 2002-04-18 The Trustees Of Columbia University In The City Of New York A method for inhibiting new tissue growth in blood vessels in a patient subjected to blood vessel injury
WO2002059260A2 (en) * 2000-11-17 2002-08-01 Hyseq, Inc. Nucleic acids and polypeptides

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KISLINGER T ET AL: "N-epsilon-(carboxymethyl)lysine adducts of proteins are ligands for receptor for advanced glycation end products that activate cell signaling pathways and modulate gene expression" JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, US, vol. 274, no. 44, 29 October 1999 (1999-10-29), pages 31740-31749, XP002217809 ISSN: 0021-9258 *
SCHMIDT A M ET AL: "ACTIVATION OF RECEPTOR FOR ADVANCED GLYCATION END PRODUCTS A MECHANISM FOR CHRONIC VASCULAR DYSFUNCTION IN DIABETIC VASCULOPATHY AND ATHEROSCLEROSIS" CIRCULATION RESEARCH, GRUNE AND STRATTON, BALTIMORE, US, vol. 84, 19 March 1999 (1999-03-19), pages 489-497, XP002909514 ISSN: 0009-7330 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7470521B2 (en) 2004-07-20 2008-12-30 Critical Therapeutics, Inc. RAGE protein derivatives
WO2006119510A2 (en) * 2005-05-04 2006-11-09 Receptor Biologix, Inc. Isoforms of receptor for advanced glycation end products (rage) and methods of identifying and using same
WO2006119510A3 (en) * 2005-05-04 2007-02-22 Receptor Biologix Inc Isoforms of receptor for advanced glycation end products (rage) and methods of identifying and using same

Also Published As

Publication number Publication date
WO2005051995A3 (en) 2005-08-25

Similar Documents

Publication Publication Date Title
JP2002533134A (en) Peptidoglycan recognition protein
MX2007010809A (en) Lipocalin protein.
US10172926B2 (en) KIF20A epitope peptides for TH1 cells and vaccines containing the same
JP3534406B2 (en) Isolation, characterization and use of the human beta subunit of the high affinity receptor for immunoglobulin E
JP2008522162A (en) Mer diagnostic and therapeutic agents
JPH11285392A (en) Mbgp1 polypeptide and polynucleotide
JP2003512856A (en) Uteroglobin-like polynucleotides, polypeptides, and antibodies
US7122345B2 (en) Nucleic acid encoding a NOVX13 polypeptide
EP3004346A1 (en) Imp-3 epitope peptides for th1 cells and vaccines containing the same
JP2001517441A (en) G protein-coupled glycoprotein hormone receptor HG38
WO2001012658A2 (en) Human icos ligand and application thereof
US20080038248A1 (en) Proteins Ligands For Nkg2d And Ul16 Receptors And Uses Thereof
WO2005051995A2 (en) Novel advanced glycosylation end product-specific receptor-like protein and nucleic acids encoding same
WO2001063288A1 (en) Diagnosis of breast cancer using bcmp-81 as marker
US20040248257A1 (en) SPEX compositions and methods of use
EP2831107B1 (en) Toll-like receptor 2 binding epitope and binding members thereto
US20040053364A1 (en) Human CMRF-35-H9 receptor which binds IgM
US7179898B1 (en) Human vanilloid receptor-like receptor
WO2018092754A1 (en) Depdc1 epitope peptides for th1 cells and vaccines containing the same
JP2003506017A (en) Seripanklin
JPH0892285A (en) Human clap protein and dna coding for the same
US20070048791A1 (en) CRYSTAL STRUCTURES AND MODELS FOR Fc RECEPTORS AND USES THEREOF IN THE DESIGN OR IDENTIFICATION OF Fc RECEPTOR MODULATOR COMPOUNDS
JP2002514417A (en) Rotekin is a putative target of Rho
US20060141565A1 (en) Novel fibroblast growth factor and uses thereof
US7153947B2 (en) Ixodes salivary anticomplement protein

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase