WO2005045074A2 - Moyens et methodes de classification des cyanobacteries - Google Patents

Moyens et methodes de classification des cyanobacteries Download PDF

Info

Publication number
WO2005045074A2
WO2005045074A2 PCT/NL2004/000782 NL2004000782W WO2005045074A2 WO 2005045074 A2 WO2005045074 A2 WO 2005045074A2 NL 2004000782 W NL2004000782 W NL 2004000782W WO 2005045074 A2 WO2005045074 A2 WO 2005045074A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
sequences
strains
cyanobacterium
probe
Prior art date
Application number
PCT/NL2004/000782
Other languages
English (en)
Other versions
WO2005045074A3 (fr
Inventor
Willem Edwin Adrianus Kardinaal
Ingmar Janse
Gabriel Jacobus Maria Zwart
Original Assignee
Stichting Voor De Technische Wetenschappen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from EP03078502A external-priority patent/EP1529846A1/fr
Application filed by Stichting Voor De Technische Wetenschappen filed Critical Stichting Voor De Technische Wetenschappen
Publication of WO2005045074A2 publication Critical patent/WO2005045074A2/fr
Publication of WO2005045074A3 publication Critical patent/WO2005045074A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00277—Apparatus
    • B01J2219/00279—Features relating to reactor vessels
    • B01J2219/00306—Reactor vessels in a multiple arrangement
    • B01J2219/00313—Reactor vessels in a multiple arrangement the reactor vessels being formed by arrays of wells in blocks
    • B01J2219/00315—Microtiter plates
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583—Features relative to the processes being carried out
    • B01J2219/00603—Making arrays on substantially continuous surfaces
    • B01J2219/00605—Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583—Features relative to the processes being carried out
    • B01J2219/00603—Making arrays on substantially continuous surfaces
    • B01J2219/00605—Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/0061—The surface being organic
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583—Features relative to the processes being carried out
    • B01J2219/00603—Making arrays on substantially continuous surfaces
    • B01J2219/00605—Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00623—Immobilisation or binding
    • B01J2219/0063—Other, e.g. van der Waals forces, hydrogen bonding
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583—Features relative to the processes being carried out
    • B01J2219/00603—Making arrays on substantially continuous surfaces
    • B01J2219/00639—Making arrays on substantially continuous surfaces the compounds being trapped in or bound to a porous medium
    • B01J2219/00641—Making arrays on substantially continuous surfaces the compounds being trapped in or bound to a porous medium the porous medium being continuous, e.g. porous oxide substrates
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583—Features relative to the processes being carried out
    • B01J2219/00603—Making arrays on substantially continuous surfaces
    • B01J2219/00659—Two-dimensional arrays
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00718—Type of compounds synthesised
    • B01J2219/0072—Organic compounds
    • B01J2219/00722—Nucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to the field of cyanobacteria, in particular it relates to the development of means and methods for classifying cyanobacteria.
  • cyanobacteria eutrophic freshwater lakes endure noxious blooms and surface scums caused by cyanobacteria from, for instance, the genus Microcystis. During such blooms cyanobacteria can occur that produce toxins.
  • An overview of different types of cyanobacterial toxins is shown in table 4 of example 3. During many blooms, Microcystis cells produce the hepatotoxin microcystin which is toxic to humans and many other eukaryotes ⁇ Chorus and Bartram, 1999 ⁇ .
  • Microcystins are cyclic heptapeptides, formed non-ribosomally by peptide- and polyketide-synthetases. More than 70 structural microcystin variants are known to date ⁇ Kurmayer et al. 2003 ⁇ . Examples of microcystin variants are listed in table 5 of example 3. Water management authorities need to determine whether and to what extent blooms of cyanobacteria can influence the water quality of their surface waters. This is important for the conversion into drinking water, but , also to prevent toxic effects of cyanobacteria on recreational users of water bodies and to prevent disturbance of ecosystems.
  • Cyanobacteria have been classified using a number of different methods. Traditionally, cyanobacteria are classified on the basis of morphological characteristics. Recently, hybridisation to 16S rRNA probes has been used for classifying this particular group of bacteria.
  • Strains characteristics alone or combined with local variation in the conditions in the freshwater environment can have an effect on the absolute levels of toxin produced and coupled therewith the risk for the environment. For instance, the maximum growth rate and the tendency to be a high or relatively low producer of toxin, as well as the array of toxin variants that can be produced, has been found to vary from strain to strain. In addition, the tendency to form scums on the water surface and thus the contribution to toxicity of a bloom may vary from strain to strain.
  • the present invention provides an alternative method for the classification of cyanobacteria.
  • the Internal Transcribed Spacer region (ITS) between 16S rRNA and 23S rRNA is used as a discriminating tool. It has been found that this region is sufficiently divergent to allow an adequate separation between the various strains of cyanobacteria, whereas at the same time it is not so divergent as to confound strain identification.
  • the regions flanking the ITS in the 16S rRNA gene and the 23S rRNA gene are sufficiently conserved among cyanobacteria to allow amplification of this region for most cyanobacteria.
  • the ITS regions of cyanobacteria are sufficiently far removed from the ITS regions of other bacteria to prevent detecting bacterial strains in the classification method that do not belong to the phylogenetic radiation of cyanobacteria
  • strain does not refer to a single clone of genetically identical cyanobacteria, although this can be the case, but rather to a group of cyanobacteria that is genetically very similar.
  • cyanobacteria that belong to a strain have the same ITS sequence in the region determined.
  • all cyanobacteria samples that hybridise under stringent conditions are said to be of the same strain. Typically this is the case where the cyanobacteria have no mismatch with the probe.
  • the invention provides a method for classifying a cyanobacterium clone comprising providing nucleic acid from said clone with at least one cyanobacteria specific primer, amplifying at least part of the ITS region therein and separating the resulting amplificate under gradually increasing denaturing conditions.
  • This process that in a specific implementation is referred to as DGGE utilizes both the size of the nucleic acid and the sequence content thereof as a discriminating variable.
  • the conditions that initiate denaturation of the nucleic acid vary with the sequence. Some sequences will denature readily whereas other sequences will denature only under significantly stronger denaturing conditions.
  • the migration speed of a nucleic acid through a mesh under the influence of an electrical field is very sensitive to denaturation state of the nucleic acid. Double stranded nucleic acid migrates relatively quickly through the mesh whereas partly denatured nucleic acid migrates very poorly. Thus the migration endpoint under a gradient of ever increasing denaturing conditions is indicative of both the size and of the sequence of the migrated nucleic acid.
  • this system can favourably be used to discriminate between different cyanobacterium strains. It is particularly suited to discriminate between closely related strains as there are among the genus Microcystis.
  • the cyanobacteria specific primer comprises a sequence as depicted in table 1 of example 3.
  • the primer may comprise a part of a sequence as depicted in table 1 of example 3, however, the primer comprises at least 15 and preferably at least 18 of the nucleotides of the sequences presented in table 1 of example 3.
  • the primer consist of a sequence as depicted in table 1 of example 3.
  • a primer comprises one or more of the (GC-)CSIF sequences in table 1 of example 3.
  • the ITS can be subdivided into regions that are of particular interest in the method for the denaturing electrophoresis analysis.
  • the nucleic acid for the electrophoresis comprises the region amplified by primers (GC-)CSIF and ULR, or by primers (GC-)CSIF and 373R, or by primers (GC-)CSIF and ITS3R.
  • primers (GC-)CSIF and ULR are used.
  • cyanobacterial communities and isolates can be studied at high resolution.
  • the selectivity of the primers makes it possible to focus on cyanobacteria in the presence of other organisms.
  • the rationale for using different rRNA-ITS primer sets has become clear from our results. Each set has its advantages and disadvantages, and the choice which one to use depends on the study that is to be executed.
  • ITSa primers for studying cyanobacteria, ITSa primers (GC-)CSIF and 373R have the broadest applicability and produce the most straightforward DGGE profiles. However, bands from some organisms may end up at identical positions in the gel, while sequence differences do exist (either because sequence differences occur in the non-amplified 3' -part of the rRNA-ITS or because different sequences dictate an identical melting behaviour).
  • ITSb primers GC-CSIF and ITS3R and ITSc primers
  • ULR supplementary resolution
  • ITSb primers provide more selectivity towards some cyanobacterial genera (Table 3 of example 1), and produce complex DGGE profiles for some genera. Most sequence information, and thus strain typing potential, can be retrieved from ITSc primer amplicons. Moreover, for most tested genera they yielded particularly sharp bands on DGGE gels.
  • the ITS region is particularly well suited for the discrimination between different cyanobacterium strains using a probe from that region. It has been found that for many different cyanobacteria it is possible to design probes that discriminate the selected strain from other strains of cyanobacteria.
  • the invention thus provides a method comprising hybridising a probe from an rRNA-internal transcribed spacer (ITS) located between sequences from a 16S and a 23S rRNA gene, of a reference cyanobacterium strain, with a preparation comprising nucleic acid from said region derived from a test cyanobacterium and determining whether hybridisation occurs.
  • ITS rRNA-internal transcribed spacer
  • the method can be used to determine whether the test cyanobacterium belongs to the strain of the reference cyanobacterium or not. This information is useful for instance in monitoring a particular cyanobacterium that is present in a lake. For instance, if in past seasons that particular strain caused problems in the lake, one can monitor samples from the lake for the presence of this cyanobacterium. The method may also be used to determine the relative contribution of the particular strain in the lake. In this embodiment the method further comprises comparing the hybridisation result with a control hybridisation. By using a standard of varying but known amounts of input nucleic acid in the control hybridisation one can compare the hybridisation signal intensity of the sample with the signal intensities in the control hybridisation and determine from that the amount of specific nucleic acid in the test sample.
  • a method of the invention further comprises classifying said test cyanobacterium on the basis of said hybridisation and/or DGGE analysis. For quantification purposes one can correlate the results obtained with reference samples having various known amounts or distributions of the to be quantified cyanobacterium or cyanobacteria, respectively.
  • the invention provides classifying said test cyanobacterium as a toxin producing strain. It is further possible to further classify toxin of the test cyanobacterium and to relate it to a particular toxin group, and within the group to a certain subtype. For instance the mcy gene cluster, encoding the microcystin synthetase genes, exhibits diversity and many different microcystin toxins can be produced by the various strains of Microcystis. With a method of the invention it is possible to correlate the ITS genotype to the toxin genotype.
  • a classification of the invention further comprises classifying said cyanobacterium as a surface layer forming strain and/or as a high toxin producing strain.
  • a method of the present invention can be practised using any reference cyanobacterium.
  • the reference cyanobacterium comprises a Microcystis cyanobacterium.
  • the invention provides a method wherein said hybridisation comprises hybridising said preparation with a panel of nucleic acid probes wherein said panel comprises said probe and at least one probe derived from the intergenic region between the transcribed sequences from 16S and 23S rRNA gene of another reference cyanobacterium strain.
  • the probes do not necessarily have to map to the same region of the ITS. In fact many probes are situated in different regions.
  • said panel comprises at least five probes, wherein each of said five probes is derived from the intergenic region between the transcribed sequences from 16S and 23S rRNA gene of different reference cyanobacterium strains. Using five probes is typically sufficient to monitor the population dynamics of cyanobacteria in a particular body of water.
  • the panel comprises more than ten, and preferably more than 15 of said probes of different cyanobacterium strains. Using these larger number of probes the chance that a test cyanobacterium can assigned to a strain increases.
  • strains that do not belong to one of the strains that a probe is used for (a typed strain) is thereby typed as a new strain and a probe can be designed to identify this new strain, which new probe can subsequently be added to the panel.
  • the ITS region can be used to further delineate genetic differences and thus further subdivision of the strain. This can for instance be done by comparing the ITS regions on a sequence level.
  • the probes are typically selected from ITS sub regions wherein at least one nucleotide mismatch is present compared with the sequence of the strain one wants to distinguish from. Typically a probe is selected to have as much discriminating power as possible. This can be achieved by selecting probes having at least one mismatch with all typed cyanobacterial ITS sequences other than those from the strain for which the probe has been designed. Probes having at least one nucleotide mismatch with the closest related counterpart can be used in the present invention. A one nucleotide mismatch is typically sufficient to obtain a clearly distinguishable hybridisation result. A counterpart probe can be designed for the closest related counterpart.
  • This counterpart probe is situated in the same region as the homologous probe and is completely complementary to the region in the counterpart ITS
  • the counterpart probe can be made one nucleotide longer or shorter than the homologous probe to achieve approximately the same melting temperature as the homologous probe.
  • This counterpart probe can be incorporated into the panel. This allows an even more precise analysis of the hybridisation result.
  • the signal obtained with the probe can be compared with the signal obtained with the counterpart probe.
  • the test cyanobacterium belongs to the same strain as the strain that the probe is derived from, if the hybridisation signal obtained with the probe is above background (i.e. there was specific hybridisation) and simultaneously more intense than the hybridisation signal obtained with counterpart probe.
  • Counterpart probes can be designed for all probes in the panel and likewise be incorporated into the panel.
  • probes can be of different regions in the ITS
  • counterpart probes always overlap the same region as the probe in the closest related counterpart strain.
  • the probe comprises at least two mismatches with the same region in the closest related counterpart.
  • different clones that have no mismatch within the region of the probe are typed in the present invention as belonging to the same strain, irrespective of the fact that other geno- or phenotypic differences may be present.
  • at least one of said probes in the panel comprises no mismatches with the sequence of the reference strain the probe is derived from, and at least two mismatches with the sequence of said region in at least one other reference cyanobacterium strain.
  • said at least one other reference strain is the strain that is the closest related counterpart of the reference cyanobacterium strain that the probe is derived from.
  • the panel is a dedicated panel, for instance, capable of discriminating between all typed Microcystis strains.
  • said at least five of said probes comprise no mismatches with the sequence of said region in the reference strains they are derived from, and each of said at least five probes comprises at least two mismatches with the sequence of said region in the other strains of said at least five reference strains. The latter criterion being met when the probe has at least two mismatches with the same region in the closest related strain.
  • a probe as mentioned above has a sequence as depicted in table 3A of example 3.
  • the probe can have the full sequence as depicted, or it can be a subsequence thereof as identified by alternative position 1 or alternative position 2 in of the table.
  • the alternative positions can encompass 1 to 4 nucleotides that are located adjacent to the sequence depicted.
  • a probe of table 3A can be extended by two and preferably by one nucleotide for matching purposes with other probes in the panel.
  • the probe (identified by the sequence depicted or by the alternative positions) can also be the reverse complement thereof.
  • said strain specific probe is a probe as identified in table 1A of example 4.
  • a method of the invention further comprises hybridising a control probe from said rRNA-internal transcribed spacer region (ITS) located between sequences from a 16S rRNA gene and a 23S rRNA gene, with a preparation comprising nucleic acid from said region derived from a test cyanobacterium and determining whether hybridisation occurs, wherein said control probe comprises sequence divergence with some strains of cyanobacteria, but not with other strains of cyanobacteria.
  • said control probe is selective for a cluster of cyanobacteria strains. This probe provides confirmation of the information obtained for the strain specific probe in that there is also hybridisation with the control probe. It provides further information on the correct strain assignment.
  • control probe is selective for a cluster of cyanobacteria that comprises the strain that said probe is selective for, preferably said control probe comprises a sequence as depicted in table 3B of example 3.
  • the control probe can also be used separately or in combination with strain specific probes that are not specific for strains of the cluster.
  • a positive signal in the control probe provides information on the cluster the test cyanobacterium belongs to and can therefore be used to correlate cluster specific geno- or phenotype characteristics to the test cyanobacterium.
  • a cluster specific probe as mentioned above has a sequence as depicted in table 3B of example 3.
  • the cluster probe can have the full sequence as depicted, or it can be a subsequence thereof as identified by alternative position 1 or alternative position 2 in the last two columns of the table.
  • the cluster probe (identified by the sequence depicted or by the alternative positions) can also be the reverse complement thereof.
  • said cluster probe is a probe as identified by table IB of example 4.
  • a panel of probes comprises at least 4 and preferably at least 8 and more preferably 19 probes of table 1A and table IB of example 4.
  • the probe is preferably an oligonucleotide or a functional equivalent thereof.
  • a functional equivalent of an oligonucleotide comprises the same binding affinity in kind not necessarily in amount as the oligonucleotide itself.
  • Suitable nucleotide mimetics are present in the art such as but not limited to peptide nucleic acid (PNA).
  • Other mimetics include (L)-a-threofuranosyl oligonucleotides (TNA), RNA.
  • at least one of said probes comprises between 12 and 30 nucleotides.
  • at least one of said probes comprises between 16 and 28 nucleotides.
  • the probe may share nucleotide sequence with or be complementary to several distinct regions in the ITS, however, in a preferred embodiment at least between 12 and 30 nucleotides are arranged consecutively in said ITS region. Probes may of course further comprise other sequences, such as for instance for the purpose of incorporating a label that becomes detectable upon hybridisation of the probe to the target nucleic acid. Examples of such probes are the so-called molecular beacon probes.
  • the probes may also comprise nucleotides from one or more other regions of the cyanobacterium genome. Probes may also comprise nucleotide analogues or uracil having similar hybridisation characteristics in kind as the nucleotide they are analogous to, though they do not have to have the same characteristics in amount.
  • Probes may further comprise other nucleotide analogous such as for instance inosine, that do not have a strong preferred counterpart base with which they associated in the opposing strand. Both types of analogues may be used to accommodate binding strength of particular probes thereby allowing fine adjustment of the panel. This fine tuning can be used to arrive at standardized hybridisation conditions. Probes may also further comprise other matter such as but not limited to protein, lipids or other substances to provide further functionality. In a panel the probes are typically selected to have about the same Tm. This being the case where the Tm of the various probes differs no more than one degree from each other, however, this need not always be true. One may further fine tune the probes to have an even closer set of Tm values.
  • a probe can further be scrutinized for other features such as internal repeats, low self-hybridisation characteristics, low internal hybridisation characteristics and low amounts of direct repeats. These properties can all be fine tuned and increase the propensity with which a suitable panel is designed. Probes may also further comprise organic or inorganic compounds, such as can be used to bind the probes to a solid surface or binding matrix and to provide distance from this solid surface or binding matrix.
  • a probe of the invention preferably comprises a nucleic acid sequence as depicted in table 3 of example 3 or a functional equivalent thereof.
  • a functional equivalent in this case also comprises the reverse complement of the presented sequence.
  • a panel of probes preferably comprises at least one of probes comprising a nucleic acid sequence as depicted in table 3 of example 3 or a functional equivalent of such an oligonucleotide, preferably at least two, and more preferably at least five probes of said panel comprise a nucleic acid sequence as depicted in table 3 of example 3 or a functional equivalent of such an oligonucleotide.
  • a method of the invention can be performed using any preparation containing nucleic acid of the ITS region.
  • the preparation comprises nucleic acid that has undergone an amplification step specific for the ITS region.
  • amplifying the nucleic acid from this region two things are accomplished simultaneously.
  • the amount of nucleic acid to be detected is amplified thereby increasing the sensitivity of the method and allowing detection of cyanobacteria that are not easy to grow or obtain in other ways.
  • the potential for background hybridisation of sequences that are not derived from the ITS region is reduced, thereby further increasing the signal to noise ratio for the assay.
  • said preparation of nucleic acid of said test cyanobacterium is at least in part prepared through amplification of a sample comprising nucleic acid of said test cyanobacterium.
  • said amplification is performed using a cyanobacterium specific primer within the 16S, 23S or 16S-23S rRNA internal transcribed spacer gene sequence.
  • specific primers enhance the sensitivity for detection of cyanobacterial ITS sequences, since there is no competition for amplification of non-cyanobacterial sequences during the PCR reaction.
  • Various cyanobacterial specific ITS amplification primers can be designed.
  • amplification methods rely on two opposing primers. It is sufficient that at least one of said primers is specific for cyanobacteria. However, preferably, both primers in strategies relying in two opposing primers are cyanobacteria specific. It is possible to perform so-called nested amplifications to further increase the sensitivity of a method of the invention.
  • Such nested primers can be both cyanobacterial specific primers and primers that recognize a broader range of bacterial ITS regions.
  • at least one nested primer(s) is(are) cyanobacterial specific.
  • a cyanobacterial specific primer comprises a sequence as depicted in table 1 of example 3.
  • the invention further provides at least one of the sequence as identified by the EMBL accession numbers AJ605140 till AJ605221 (see table 2 of example 3).
  • the EMBL sequences refer to ITS regions of particular strains of cyanobacteria that are used to select the probes from.
  • the ITS regions can further be used to characterise the strain from which it was identified.
  • the present invention further provides a method for typing a strain of cyanobacteria comprising determining whether the test cyanobacterium comprises a sequence of one of the isolates identified by accession numbers AJ605140 till AJ605221 as referred to in table 2 of example 3. This method is preferably performed by sequencing amplified product from an ITS region of the test cyanobacterium, however, other sequencing methods are known in art and can also be used.
  • the invention provides a nucleic acid or a functional equivalent thereof as depicted in table 3 of example 3.
  • a panel of nucleic acids, or functional equivalents thereof wherein said panel comprises at least one of said nucleic acids comprise a sequence as depicted in table 3 of example 3.
  • said panel comprises at least two and more preferably at least five of said nucleic acids wherein said at least five nucleic acids comprise a sequence as depicted in table 3 of example 3 or a functional equivalent thereof.
  • the panel preferably comprises an array that is associated with a solid surface. Preferably, a flat solid surface. In a particularly preferred embodiment the panel is present on a chip, which has preferably the dimensions of a microscopic slide.
  • an apparatus for analysing hybridisation signals comprising a nucleic acid having a sequence depicted in table 3 of example 3, a panel of nucleic acids according to invention, an array and/or a chip according to the invention.
  • the apparatus can for instance be an X-ray film, a CCD camera (especially the cooled variant), a reader for microtiterplates capable of detecting chemiluminescence signals.
  • array readers such as the SensiChip DNA Array Reader from Quiagen, the Affymetrix Chip Reader, The Genapta microarray reader and microtiterplate readers such as that from Perkin Elmer, Wallac and Pharmacia.
  • array readers For detection of fluorescence signals, array readers such as the SensiChip DNA Array Reader from Quiagen, the Affymetrix Chip Reader, The Genapta microarray reader and microtiterplate readers such as that from Perkin Elmer, Wallac and Pharmacia.
  • the invention provides the use of a nucleic acid or functional equivalent thereof of table 3 of example 3 or of a sequence identified by EMBL accession numbers AJ605140 till AJ605221, an array, chip or apparatus according to the invention, for classifying a cyanobacterium.
  • said classification comprises classifying said cyanobacterium as a toxic or non-toxic cyanobacterium strain.
  • the invention further provides a method for typing a cyanobacterium in a sample comprising subjecting ITS sequences from said clone to a denaturing gradient gel electrophoresis step and typing the strain from said step.
  • a method of the invention is preferably performed using a clone of the test cyanobacterium as a source to prepare the preparation or as a source of ITS sequences. This source is particularly preferred in the instances wherein the nucleic acid sequence is determined or wherein a denaturing gradient gel is used.
  • a method comprising a denaturing gradient gel electrophoresis step preferably further comprises comparing the result of said step with a reference.
  • the reference is preferably a similar treated sample of a reference cyanobacterium.
  • the reference comprises similar treated samples from at least 5 reference and more preferably at least 15 reference cyanobacteria.
  • the material used to generate the references comprises a sequence as depicted in table 2 of example 3.
  • ITS sequences are provided through amplification of the ITS region of said cyanobacterium clone.
  • the ITS sequences are preferably amplified by using a cyanobacterium specific primer within the 16S, 23S or 16S-23S rRNA internal transcribed spacer gene sequence, preferably by using a cyanobacterium specific primer comprising a sequence as depicted in table 1 of example 3.
  • the reference(s) are preferably similarly treated.
  • cyanobacteria For many ecological studies of cyanobacteria, it is essential that closely related species or strains can be discriminated. Since this is often not possible using morphological features, cyanobacteria are frequently studied using DNA based methods. We realized high-resolution discrimination of a variety of cyanobacteria by means of DGGE analysis of the internal transcribed spacer, or parts thereof between the 16S and 23S rRNA genes (rRNA-ITS). A forward primer specific for cyanobacteria was designed, targeted at the 3'-end of the 16S rRNA gene.
  • Cyanobacteria are a major component of many aquatic and terrestrial ecosystems and can be found in virtually all habitat types, including marine and freshwater environments, deserts, hot springs, hypersaline environments, rocks and ice. In addition, they can be involved in symbiotic associations with a remarkable range of eukaryotic host organisms. In all these environments, cyanobacteria are major contributors to photosynthesis and nitrogen fixation ⁇ Whitton and Potts, 2000 ⁇ . Cyanobacterial populations may reach high densities during blooms in surface waters. Detrimental effects of such blooms are of growing concern for water managers worldwide ⁇ Chorus and Bartram, 1999 ⁇ .
  • Shifts in the ratio of toxic and non-toxic genotypes of Microcystis may (partly) explain the often poor correlations of cell counts with toxin content in many field studies ⁇ Bittencourt-Oliveira et al., 2001 ⁇ .
  • DGGE Denaturant gradient gel electrophoresis
  • Isolated cultures can be assigned to field populations based on the comparison of their DGGE profiles, and sequence information from profile bands can be used to characterize the organisms that are present.
  • a section of DNA is suitable for DGGE analysis if it can be specifically amplified from the target organisms, has sufficient sequence heterogeneity for the desired resolution and, preferably, is part of a gene of which a considerable number of sequences have been deposited in sequence databases.
  • DGGE of hetR a gene assigned to heterocyst differentiation, has been used to study the diversity in isolated strains of the cyanobacterial genera Trichodesmium and Nostoc ⁇ Orcutt et al., 1999; Rasmussen and Svenning, 2001 ⁇ .
  • nifH a gene encoding dinitrogenase reductase in many microorganisms including cyanobacteria ⁇ Zehr et al., 1997 ⁇ , has been used for DGGE analysis of the very diverse functional group of diazotrophic (N2 -fixing) organisms ⁇ Lovell et al., 2001 ⁇ .
  • N2 -fixing diazotrophic
  • rRNA-ITS very suitable for high-resolution analysis of cyanobacteria.
  • Restriction enzyme digestion (RFLP) of rRNA-ITS has been used to resolve closely related cyanobacterial strains ⁇ Laloui et al., 2002; Lu et al., 1997; Neilan et al., 1997; Rasmussen and Svenning, 2001 ⁇
  • direct sequencing has been used to study subgeneric phylogenetic relationships in genera such as Microcystis ⁇ Otsuka et al., 1998 ⁇ , Trichodesmium ⁇ Orcutt et al., 2002 ⁇ and picocyanobacteria ⁇ Rocap et al., 2002 ⁇ .
  • rRNA-ITS sequences have been used for analysis of Synechococcus ⁇ Becker et al., 2002 ⁇ and Aphanizomenon ⁇ Laamanen et al.
  • Lakes Kinselmeer and Sneekermeer are shallow lakes (maximum depth approximately 3 m), and Volkerak and Zeegerplas are deeper lakes (maximum depth 15m and 25 m respectively). All lakes have extensive blooms of various cyanobacteria, mostly in spring and summer. Water samples from the lakes were collected 0.5 m below the surface in sterile bottles from a boat in the middle of the lake and stored in the dark at 4°C. Within four hours after sampling, a volume of 250 ml water (or less if the filter clogged) was filtered over a 25 mm diameter, 0.2 mm pore size mixed esters filter (ME 24, Schleicher & Schuell, Dassel, Germany).
  • the filter was cut in two with a sterile scalpel and each half was stored in a microcentrifuge tube at -80°C until further processing.
  • DNA from filters containing field samples was isolated as described by Zwart et al. ⁇ 1998 ⁇ .
  • DNA from the pellet of 2 ml cyanobacterial cultures in which growth was visible by eye was isolated by means of the DNA isolation procedure described by Tillett et al. ⁇ 2000 ⁇ . Strain isolation and culture conditions. Strains of cyanobacteria used in this study are given in Table 1. Cultures isolated in this study (Microcystis sp.
  • the bacteria used as negative controls to test the specificity of the primers were Serratia marcescens (DSM 1636), Acinetobacter calcoaceticus strain BD4 (DSM 586), Erwinia carotovora carotovora (DSM 30168), Escherichia coli (DSM 423), Rhodococcus erythropolis (DSM 43188), Lactobacillus reuteri (DSM 20016), Lactococcus lactis lactis (NIZO-81), Bacillus polymixa (DSM 36), Bacillus subtilis (DSM 10), and Pseudomonas stutzeri (DSM 5190).
  • sequences with a given number of mismatches was determined using probe match, followed by a correction for degenerate base positions in the primer sequence.
  • Sequences from the rRNA-ITS region were obtained from Genbank/EMBL/DDBJ and were aligned using the programs ClustalW and the BioEdit Sequence Alignment Editor ⁇ Hall, 1999 ⁇ .
  • PCR amplification Primer sequences and references are given in Table 2.
  • the forward primer for amplification of part of the 16S rRNA gene was slightly modified from N ⁇ bel et al ⁇ 1997 ⁇ to further improve their theoretical specificity. This because the efficiency of amplification, and thereby the selectivity of the primer, is typically determined by the nature of the 3' end nucleotides.
  • PCR amplification was performed in a MBS 0.5 S thermocycler (ThermoHybaid, Ashford, UK) in a 25 ml reaction mixture containing approximately 50 ng of DNA, [10 mM Tris/HCl pH 8.3, 50 mM KC1, 0.01% w/v gelatin, 200 mM of each deoxynucleotide, 1.5 mM MgC12, 2.5 units of Taq DNA polymerase (Boehringer Mannheim,
  • the temperature cycling conditions for the amplification of part of the 16S rRNA were modified slightly from ⁇ N ⁇ bel et al., 1997 ⁇ . After a pre-incubation at 94°C for 5 min, a total of 30 cycles were performed of 94°C for 1 min, 60°C for 1 min and 72°C for 1 min. The temperature cycling was concluded with a final step of 5 min at 72°C.
  • the optimized temperature cycling conditions for the amplification of rRNA-ITS (ITSa, ITSb, and ITSc, for explanation see results section and Table 2) were as follows.
  • DGGE was performed essentially as described by Muyzer et al. ⁇ 1993 ⁇ . Briefly, PCR products were separated on a 1.5 mm thick, vertical gel containing 8% (w/v) poly acrylamide (37.5:1 acrylamide: bisacrylamide) and a linear gradient of the denaturants urea and formamide, increasing from 25 or 30% at the top of the gel to 40% at the bottom. The concentrations depended on the gene products that were analyzed and are given in the figure legends. Here, 100% denaturant is defined as 7 M urea and 40% v/v formamide.
  • Electrophoresis was performed in a buffer containing 40 mM Tris, 40 mM acetic acid, 1 mM EDTA, pH 7.6 (0.5 x TAE) for 16 hours at 75 V.
  • the gel was stained for 1 h in water containing 0.5 ⁇ g ml-1 ethidium bromide.
  • An image of the gel was recorded with a CCD camera system (Imago, B&L Systems, The Netherlands). Sequencing of DNA from DGGE bands. A small piece of gel from the middle of the target band was excised from the DGGE gel and incubated in 50 ml sterile milli- for 24 hours at 4°C.
  • the eluent was reamplified using the original primerset and run on DGGE to confirm its identity.
  • the eluent was reamplified with reverse primers that had M13 priming sites added 5' of the original primers.
  • PCR products were purified using the Concert Rapid PCR Purification System (GibcoBRL Life Technologies, UK), and these products were used as templates for sequencing reactions with the Thermo Sequenase Primer cycle sequencing kit (Amersham Pharmacia Biotech, USA). Sequencing reaction products were analyzed on an ALF Express II sequencer (Amersham Pharmacia Biotech, USA) with CY5 fluorescence labeled M13 sequence primers or a labeled GC-clamp.
  • sequences were deposited at EMBL and were assigned accession numbers AJ579895-AJ579906. Sequences were processed using the program sequencher version 4.0.5 (Gene Codes Corp., MI, USA) and similarity with sequences deposited in Genbank/EMBL/DDBJ was checked using the program Blast (2)(via http ://www .ncbi.nlm.nih. gov/BLAST ) .
  • ITSa was amplified from the selected cultures, and for each strain the amount of PCR product was estimated from an agarose gel.
  • the PCR products were mixed and diluted in order to obtain template DNA from selected cultures, or from mixtures thereof, all in identical final concentrations. This template DNA was used for ITSa amplification and the PCR products were analyzed on a DGGE gel.
  • a combined probe search was performed in the RDPII database (using the check_probe program) and in an ARB database containing more than 8000 full length 16S rRNA prokaryotic sequences (using the probe match option in ARB). No sequences of prokaryotes other than cyanobacteria were found with less than three mismatches, 2 sequences (from Ammonifex degensii and
  • Thermodesulfobacterium hverag had 3 mismatches, 116 sequences had 4 mismatches, and the remainder had 5 or more mismatches.
  • a BLAST search ⁇ Altschul et al., 1997 ⁇ of the primer sequence yielded only cyanobacteria in the hits with highest similarity scores.
  • Reverse primer sites for the amplification of cyanobacterial rRNA-ITS sequences were gathered from previous research (Table 2). Three reverse primers were used, two of these (373R and ITS3R) targeted at highly conserved sequence motifs in the ITS, and one (ULR) at the 5'-end of the 23S gene.
  • ITSa primersets
  • ITSb primersets
  • ITSc CSIF + ULR
  • the phylogenetic coverage within the cyanobacterial phylum of the primers was investigated by using DNA from strains of a range of different cyanobacterial genera as template for PCR amplification (Table 3). For each primer combination, the highest temperature at which PCR products were generated for all genera was selected as optimal PCR amplification temperature. As a consequence, for several genera amplification is possible at higher annealing temperatures then those used in our optimized protocol. The number of PCR products and their sizes and relative intensities varied between the different genera (Table 3). For all strains that were tested, ITSa amplification yielded one band of 275 to 350 bp.
  • ITSb amplification resulted in PCR products between 350 and 800 bp for most tested strains, with the exception of Synechocystis, Leptolyngbya and Lyngbya.
  • One PCR product was formed from the genera Microcystis, Pseudanabaena, Planktothrix,
  • ITSc primers successfully amplified DNA from all strains that were tested, yielding for most genera PCR products ranging between 450 and 900 bp.
  • Prochlorothrix hollandica yielded one very long product of 1050 basepairs.
  • Amplification with ITSb or ITSc primers yielded the same number of bands for most strains, only ITSc amplification of Planktothrix strains produced two bands instead of one.
  • ITSa amplicons from strains CYA228 (lane 10), PCC7820 (lane 11) and PCC7806 (lane 12) were undistinguishable and differed only faintly from those of strain V91 (lane 13) (Fig. IB), whereas ITSb or ITSc amplicons enabled a clear separation and left only CYA228 and PCC7820 undifferentiated (Fig.
  • strains PCC7806 (lane 12) and V28 (lane 17), could hardly be distinguished when analyzing ITSb or ITSc amplicons, but occupied clearly different positions in the DGGE gel when ITSa amplicons were used (Fig. 1B-D).
  • Microcoleus sp. isolate was analyzed and yielded sharp, single bands both on ITSa and ITSc DGGE gels (data not shown).
  • ITSa profiles from Fig. 4. unique as well as (probably) similar genotypes could be identified.
  • the dominant bands were excised from the gel and the PCR products were re-amplified and sequenced.
  • a BLAST search performed on these sequences revealed that the retrieved bands were all derived from cyanobacteria of various genera, including Microcystis, Anabaena, Synechococcus, Oscillatoria and Nostoc.
  • DISCUSSION There are two main considerations for the use of primers specific for cyanobacteria in DGGE analyses. Firstly, specific primers prevent amplification of the abundant DNA of non-cyanobacterial microbes in field samples. The resulting DGGE profiles are less complex compared to those generated with general bacterial primers, hence detection of cyanobacteria that are less abundant or have lower amplification efficiency is feasible. Secondly, characterization of cultures by DGGE, but also by RFLP or sequencing, is not possible when DNA from contaminants is co-amplified. Rendering cyanobacteria axenic can be a difficult and time-consuming procedure, and often they are cultivated more easily when accompanied by heterotrophic bacteria ⁇ N ⁇ bel et al., 1997 ⁇ .
  • Primers 322 described by Wilmotte et al. ⁇ 1993 ⁇ , and 16CITS, described by Neilan et al ⁇ 1997 ⁇ , are targeted at sequences just upstream from the target sequence of forward primer CSIF, and thus could produce virtually identical amplification products.
  • Primer 322 is targeted at highly conserved bacterial sequences and is therefore only suitable for studies of axenic cultures of cyanobacteria ⁇ Iteman et al., 2002; Laloui et al., 2002 ⁇ .
  • Primer 16CITS is specific for cyanobacteria. However, from our alignment of 16S sequences it appeared that primer CSIF has more sequence differences with non- cyanobacterial sequences, especially at the 3' side.
  • Primer 16CITS we found 71 non-cyanobacterial sequences with 2 mismatches (as opposed to 0 for primer CSIF), and 266 sequences with 3 mismatches (as opposed to 2 for CSIF). Primer CSIF can therefore be considered more specific for cyanobacteria. Nevertheless, we emphasize that this was based on sequences in the current database and no experimental comparisons between the primers were made.
  • PCR products can be formed from all strains from the genera Nostoc and Spirulina (2 or 3 mismatches in deposited sequences), from Gloeobacter and Calothrix (3 mismatches), by including specific primers for these genera, i.e. reducing the mismatches to two or less.
  • primerset ITSc is preferable in most cases. Compared to ITSb analysis the resolution was similar (compare Figs 1C and ID), yet more genera could be amplified and there is more sequence information contained in the amplicons (60-100 bp extra, see Table 3). Nevertheless, for some genera primerset ITSb was more suitable for DGGE profiling. For instance, ITSb amplification products of Nodularia yielded sharp DGGE bands (data not shown), whereas ITSc DGGE resulted in diffuse bands, unsuitable for analysis (Fig. 3B).
  • DGGE profiles resulting from ITSb amplication of Planktothrix aghardii were relatively simple (1 band) compared to the profile resulting from ITSc amplification (3 bands). Due to the occurrence of multiple rRNA-ITS operons in one organism, identification of all dominant bands produced with ITSb and ITSc primers is necessary to come to a reliable estimate of the diversity of cyanobacteria in complex DGGE profiles.
  • DGGE diversity profiles do not necessarily reflect the true diversity in the field.
  • DNA extraction efficiency and the number of rRNA operons may vary between genera, and the PCR step has several inherent pitfalls, which complicate the interpretation of DGGE profiles of communities.
  • FIG. 1 Discrimination of closely related cyanobacteria. DNA from 20 Microcystis strains was amplified with 4 different primer combinations (A-D) and separated on DGGE gels. Primer sequences and combinations are given in Table 2. The different primer combinations amplified a segment of the 16S gene (A) or different portions of the rRNA-ITS, ITSa (B), ITSb (C), or ITSc (D).
  • the Microcystis strains are SAG17.85 (1), V80 (2), V72 (3), V73 (4), CYA43 (5), V67 (6), K29 (7), K50 (8), CYA140 (9), CYA228 (10), PCC7820 (11), PCC7806 (12), V91 (13), Z6 (14), Zll (15), V89 (16), V28 (17), S2 (18), V88 (19), V40 (20).
  • Information about the Microcystis strains is given in Table 1.
  • the DGGE gels had a 30-40% denaturant concentration gradient and only the part of the gel containing bands is shown.
  • FIG. 2 DGGE profiles of ITSa amplified from DNA template mixtures.
  • Lane 1- 4 show ITSa PCR products which were amplified from equal concentrations of template mixtures of Microcystis strains PCC7820 + K29 (1), PCC7820 + K29 + SAG17.85 (2), Z6 + PCC7820 + CYA140 + K29 + SAG17.85 (3), and S2 +Z6 + PCC7820 + CYA140 + K29 + CYA43 + SAG17.85 (4).
  • FIG. 3 DGGE profiles of various cyanobacterial genera amplified with ITSa and ITSc primers. The following strains were analyzed: Synechococcus sp. (1), Synechocystis sp. (2), Leptolyngbya sp. (3), Lyngbya sp. (4), Pseudanabaena catenata (5), Trichodesmium erythraeum (6), Anabaena variablis (7),
  • the gels had a denaturant Figure legends of example 1
  • FIG. 1 Discrimination of closely related cyanobacteria. DNA from 20 Microcystis strains was amplified with 4 different primer combinations (A-D) and separated on DGGE gels. Primer sequences and combinations are given in Table 2. The different primer combinations amplified a segment of the 16S gene (A) or different portions of the rRNA-ITS, ITSa (B), ITSb (C), or ITSc (D).
  • the Microcystis strains are SAG17.85 (1), V80 (2), V72 (3), V73 (4), CYA43 (5), V67 (6), K29 (7), K50 (8), CYA140 (9), CYA228 (10), PCC7820 (11), PCC7806 (12), V91 (13), Z6 (14), Zll (15), V89 (16), V28 (17), S2 (18), V88 (19), V40 (20).
  • Information about the Microcystis strains is given in Table 1.
  • the DGGE gels had a 30-40% denaturant concentration gradient and only the part of the gel containing bands is shown.
  • FIG. 2 DGGE profiles of ITSa amplified from DNA template mixtures.
  • Lane 1- 4 show ITSa PCR products which were amplified from equal concentrations of template mixtures of Microcystis strains PCC7820 + K29 (1), PCC7820 + K29 + SAG17.85 (2), Z6 + PCC7820 + CYA140 + K29 + SAG17.85 (3), and S2 +Z6 + PCC7820 + CYA140 + K29 + CYA43 + SAG17.85 (4).
  • FIG. 3 DGGE profiles of various cyanobacterial genera amplified with ITSa and ITSc primers. The following strains were analyzed: Synechococcus sp. (1), Synechocystis sp. (2), Leptolyngbya sp. (3), Lyngbya sp. (4), Pseudanabaena catenata (5), Trichodesmium erythraeum (6), Anabaena variablis (7),
  • the gels had a denaturant concentration gradient of 25-40% and only the part of the gel containing bands is shown. The lower gel was assembled from two gels.
  • FIG. 4 DGGE profiles generated from ITSa amplification products from freshwater lake samples. The samples were taken from Lake Zeegerplas on July 20 (lane 1) and August 21 (lane 2), both when cyanobacteria were blooming, and from Lake Kinselmeer on May 5 (lane 3) during a cyanobacterial bloom (lane 3), and on January 16 in the absence of a visible presence of cyanobacteria (lane 4). Several dominant bands were excised, re- amplified and sequenced.
  • Microcystis colonies were isolated from 14 European and 1 Pavcan lakes, the presence of microcystins in each colony was examined by MALDI-TOF, and they were grouped using rRNA-ITS DGGE. Based on DGGE analysis of amplified ITSa and ITSc fragments, yielding supplementary resolution ⁇ Janse et al., 2003 ⁇ , 59 classes could be distinguished.
  • Microcystin- producing and non-producing colonies were separated into different classes. Sequences obtained from at least one representative strain from most classes were congruent with the classification based on rRNA-ITS DGGE. Alignment of these colony sequences and published rRNA-ITS sequences from cultured Microcystis strains of known toxicity confirmed that microcystin production correlated with rRNA-ITS sequences. About 30% of the analyzed colonies gave rise to more than one band in DGGE profiles, indicating either aggregation of different colonies or the occurrence of sequence differences between multiple operons in some strains.
  • Microcystis cells produce the hepatotoxin microcystin which is toxic to humans and many other eukaryotes ⁇ Chorus and Bartram, 1999 ⁇ .
  • Microcystins are cyclic heptapeptides, formed non-ribosomally by peptide- and polyketide-synthetases. More than 70 structural microcystin variants are known to date ⁇ Kurmayer et al., 2003 ⁇ .
  • Strains isolated from the same bloom sample are constitutively toxic or non-toxic ⁇ Long et al., 2001; Orr and Jones, 1998; Vezie et al., 1998 ⁇ and the cellular microcystin content may differ considerably between strains ⁇ Bolch et al., 1997 ⁇ .
  • the decisive factor determining the average cellular microcystin content in a given natural population, and thereby the toxicity of a bloom, is the abundance of microcystin producing strains ⁇ Chorus et al., 2001 ⁇ . Understanding of the community composition and dynamics of microcystin producing and non-producing Microcystis strains in the field is very limited, due to a lack of suitable identification methods.
  • microcystin synthetase mcy
  • mcy microcystin synthetase
  • the high sequence similarity between the mcyB region and other peptide synthetase loci ⁇ Dittmann et al., 1997; Tillet et al., 2001 ⁇ and the occurrence of multiple adenylation domains in toxic and non-toxic Microcystis spp. ⁇ Nishizawa et al., 1999 ⁇ may explain these discrepancies.
  • Nishizawa et al. ⁇ 1999 ⁇ suggested that some non-toxic Microcystis strains do contain the mcyABC gene.
  • genetic analyses have also been done on colonies that had been isolated directly from the field. Kurmayer et al. ⁇ Kurmayer et al., 2003 ⁇ separated Microcystis colonies from a field population in size classes and showed through qtiantification of genotypes with and without the mcyB gene that larger colonies were mainly responsible for microcystin production.
  • Microcystis colonies that had been characterized for microcystin production using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI TOF MS) ⁇ Fastner et al., 2001 ⁇
  • Microcystis specific primers targeted at mcyB ⁇ Kurmayer et al., 2002 ⁇ did not yield PCR products from 39% of microcystin containing colonies (false negatives).
  • combination with a diagnostic PCR targeted at mcyA resulted in only a few (4.9%) false negatives, as well as a few (2.5%) false positives ⁇ Via-Ordorika et al., 2004 ⁇ .
  • strain differentiation was based on sequence differences in universal genes, the pitfalls of diagnostic PCR when using mcy gene detection (occurrence of false positives and negatives) were avoided. Moreover, this approach provides ecologically relevant insights into the dynamics of all cyanobacterial strains that are present in a natural community. Instead of focusing on the limited subgroup of mcy gene -containing Microcystis strains, different toxic and non-toxic strains can be distinguished. Finally, since colony properties other than microcystin production (such as the production of other — potentially toxic- peptides) may also correlate with rRNA-ITS classification, this gene offers possibilities for characterization of a broader range of strain properties. It is preferred that all strains that can be encountered are characterized with regard to the strain properties of interest (such as toxin production) and rRNA-ITS sequence information.
  • Morphological classification was clone using the morphological criteria proposed by Komarek and Anagnostidis ⁇ 1999 ⁇ . Colonies were transferred into a reaction tube (0.5ml) containing culture medium (final sample volume 4-30 ⁇ l) and the presence of each colony in the ttibe was verified microscopically. The tubes were frozen (liquid nitrogen) and thawed several times to disintegrate the colonies, and stored at -20° C. Aliquots from each tube were used for gene amplification and for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TO MS). MALDI-TOF MS
  • Measurements were performed in the delayed extraction mode, allowing the determination of monoisotopic mass values.
  • a low mass gate of 500 improved the measurement by filtering out the most intensive matrix ions.
  • Chlorophyll-a degradation products phaeophytine-a and phaeophorbide-a with mass values of m/z 871.57 and 593.27 Da were used for internal calibration.
  • microcystins were identified by Post Source Decay (PSD) measurements of fragment ions.
  • the precursor ions were selected with a Time Ion Selector having a mass window of 10 mass units.
  • the operating voltages of the reflectron were reduced stepwise to record 12 spectral segments sequentially.
  • PSD analysis were performed directly from the same colony on the template.
  • Lakes 't Joppe and Zeegerplas are eutrophic lakes (maximum depth approximately 25 m) which are stratified during the summer. Water samples were collected 0.5 m below the surface, or from surface scum, in sterile bottles from a boat in the middle of the lake and stored in the dark at 4°C. Within four hours after sampling, a volume of 250 ml water or less if the filter clogged, was filtered over a 25 mm diameter, 0.2 mm pore size mixed esters filter (ME 24, Schleicher & Schuell, Dassel, Germany). The filter was cut in two with a sterile scalpel and each half was stored in a microcentrifuge tube at -80°C until further processing. DNA from filters containing field samples was isolated as described by Zwart et al. ⁇ 1998 ⁇ .
  • Primer CYA 37 IF forward primer for nested PCR
  • Primer GC- CSIF forward primer for ITSa and ITSc amplification
  • Primer 373R reverse primer for ITSa amplification
  • primer ULR reverse primer for nested PCR and for ITSc amplification
  • PCR amplification was performed in an MBS 0.5 S thermocycler (ThermoHybaid, Ashford, UK) in a 25 ml reaction mixture containing approximately 50 ng of DNA, (10 mM Tris/HCl pH 8.3, 50 mM KC1, 0.01% w/v gelatin, 200 mM of each deoxynucleotide, 1.5 mM MgC12, 2.5 units of Taq DNA polymerase and 0.5 mM of each primer).
  • the temperature cycling conditions for the amplification of rRNA-ITS, ITSa and ITSc ⁇ Janse et al., 2003 ⁇ were as follows.
  • DGGE was performed essentially as described by Muyzer et al. ⁇ 1993 ⁇ . Briefly, PCR products were separated on a 1.5 mm thick, vertical gel containing 8% (w/v) poly acrylamide (37.5:1 acrylamide: bisacrylamide) and a linear gradient of the denaturants urea and formamide, increasing from 25 or 30% at the top of the gel to 40% at the bottom. The concentrations depended on the gene products that were analyzed and are given in the figure legends. Here, 100% denaturant is defined as 7 M urea plus 40% v/v formamide.
  • Electrophoresis was performed in a buffer containing 40 mM Tris, 40 mM acetic acid, 1 mM EDTA (pH 7.6) (0.5' Tris-acetate-EDTA buffer) for 16 hours at 75 V.
  • the gel was stained for 1 h in water containing 0.5 ⁇ g ml-1 ethidium bromide. An image of the gel was recorded with a CCD camera system (Imago, B&L Systems, The Netherlands).
  • DGGE gel and incubated in 50 ml sterile milli-Q purified water for 24 hours at 4°C.
  • the eluent was reamplified using the original primerset and run on DGGE to confirm its identity.
  • PCR products were purified and sequenced using Applied Biosystems 3730 and 3100 genetic analysers by Baseclear Labservices (Baseclear, Leiden, the Netherlands). Sequences were deposited at EMBL and were assigned accession numbers AJ605140-AJ605221 for sequences from isolated colonies. Similarity with sequences deposited in Genbank/EMBL/DDBJ was checked using the program Blast ⁇ Altschul et al., 1997 ⁇ (via http://www.ncbi.nlm.nih.gov/BLAST/).
  • Genbank/EMBL/DDBJ were aligned using the programs ClustalW, the BioEdit Sequence Alignment Editor ⁇ Hall, 1999 ⁇ , and the program package ARB (www.ARB-home.de). Trees were constructed from aligned sequences using ARB and Treecon ⁇ Van de Peer and De Wachter, 1994 ⁇ . RESULTS
  • Microcystis colonies we used for our investigations originated from 15 lakes from 9 European countries and Pavco. Most of the water samples had been collected early July 2001 and were isolated and characterized by experts during a European workshop. Additional colonies from two Dutch lakes ('t Joppe and Zeegerplas) were isolated and characterized in August and September.
  • Microcystis colonies exhibited intermediate morphological characteristics. For details on relative abundances and distribution over the sampled lakes of these morphotypes, we refer to their paper. In 123 out of 151 colony samples we obtained, the presence of toxins had been determined by MALDI TOF MS and in 111 of these colonies toxin production capacity had been confirmed by PCR detection of the mcy gene. Eight colonies that had not yielded a MALDI TOF signal, had been characterized by mcy PCR only.
  • the resulting PCR product was diluted and used as template for amplification of the 3'-end of the 16S plus part of the rRNA ITS (ITSa) by using cyanobacteria specific 16S primer CSIF in combination with ITS primer 373R, or for amplification of a longer fragment spanning the entire rRNA ITS (ITSc) by using primers CSIF and ULR ⁇ Janse et al., 2003 ⁇ .
  • Colonies were differentiated by analysis of ITSa amplicons on DGGE. Based on the position of ITSa bands in the gel (Fig. 1), colonies were assigned to 27 different groups (Table 1). To enable between gels comparison of bands, each new batch of colonies was analyzed together with a mixture of colonies assigned to different groups and thus representing different gel positions. Differentiation of colonies based on ITSc DGGE was more difficult due to the smaller differences in migration of the longer sequences. Nevertheless, colonies could be assigned to 19 different groups based on ITSc DGGE (Table 1). Several of the colonies gave rise to profiles with two or more bands (e.g. Fig 1, colonies #63 or #147).
  • ITSa bands on DGGE was not a sufficient determinant for differentiation of all toxic and non-toxic colonies.
  • ITSa group 11 for instance, several non-toxic colonies were grouped together with a majority of toxic ones (Table 1).
  • colonies could be sufficiently set apart to allow classification of toxic and non-toxic colonies into distinct groups. Only one colony (#100, see ITSa group 18 and ITSc group 18, denoted as 18a/18c) in which a toxin was identified could not be differentiated from non-toxic colonies on the basis of ITS DGGE.
  • ITSc was sequenced from colonies and bands representative for most of the DGGE classes of Table 1.
  • colony #60 and #105 in classes 19a/12c plus 26a/12c and 18a/17c plus 24a/17c respectively
  • sequencing of two ITSa bands resolved ambiguous base calls resulting from a mixture of sequences that were not separated on ITSc DGGE.
  • Out of 59 ITS DGGE classes we obtained from 15 classes multiple sequences, from 29 classes one sequence and from 14 classes no sequences. Attempts to obtain sequences from some bands (e.g.
  • Microcystis rRNA ITS sequences were aligned and phylogenetic trees were constructed based on the alignment of ITSa or ITSc fragments.
  • the ITSa tree revealed that sequence differences in the ITSa region were sufficient for discrimination of toxic and non-toxic colonies (data not shown). The only exception was toxic colony #100 which had an ITS sequence identical to that of non-toxic colonies #87 and #89, which had been classified in the same ITS DGGE class 18a/18c (see above and Table 1).
  • ITSa and ITSc DGGE profiles from the water samples from which most colonies had been harvested. These samples had been taken from the water column of Lakes 't Joppe and Zeegerplas in June, August and September 2001, and from the surface scum oft Joppe at the latter two sampling dates. Ambient abiotic parameters, microcystin concentrations, and cell and colony numbers are given in Table 2. Microbial communities from these lakes were collected on filters and ITSa and ITSc DGGE profiles were generated (Fig. 2).
  • ITSa community profile from 't Joppe we detected 12 bands (4 of which less distinct) in the lower part of the gel where Microcystis sequences were expected, and 6 bands in the upper part of the gel, while isolated Microcystis colonies from this lake had been differentiated into 18 groups based on ITSa DGGE (Table 1).
  • ITSa community profiles from the Zeegerplas 8 different Microcystis bands (2 less distinct) were discernable, while colony analysis had resulted in the identification of 9 groups.
  • ITSc DGGE yielded for both lakes profiles with 8 bands (1 less distinct) in the lower part of the gels, while colonies isolated from 't Joppe and Zeegerplas had been differentiated in 15 and 7 groups, respectively (Table 1).
  • bands at different positions in the ITS profiles from water samples were excised, reamplified, and their position and purity were verified on DGGE. Sequences were retrieved from the bands indicated in Fig. 2 and Table 3. Compared to ITSa profiles, retrieval of pure bands for sequencing proved more difficult from ITSc profiles. Greater differences in melting behavior of the smaller ITSa fragments made distinction and isolation of bands easier (and also explains the higher number of discernable bands). ITSa sequences were also sufficiently discriminating for identification of colony toxicity (see above). Nevertheless, we also put an effort in the retrieval of bands from ITSc profiles, mainly to obtain full sequences from strains that become dominant in scums.
  • Genotype analysis using DGGE enables processing of many samples, assessment of the purity of isolated cultures or colonies, and detection of various genotypes in complex natural communities. Differentiation of colonies was achieved by means of ITSa and ITSc DGGE. Although a somewhat better separation of bands could be achieved by ITSa DGGE (Fig. 2), ITSc DGGE yielded supplementary resolution and contaminant detection in several cases, and provided more sequence information ⁇ Janse et al., 2003 ⁇ (Table 1). DGGE based on ITSa or ITSc alone yielded insufficient resolution for discrimination of toxic and non-toxic Microcystis strains. In combination, however, these methods provided a suitable basis for identification of toxic strains (Table 1).
  • ITSa The partial rRNA-ITS sequences covered by ITSa amplicons discriminated toxic and non-toxic colonies in our dataset. Therefore, sequences from ITSa DGGE profiles were suitable for identification of toxic colonies.
  • ITSc sequences covering the entire ITS (ITSc) confirmed the colony classification and identification of toxic groups based on ITSa and ITSc DGGE (sequences differed between classes and were mostly identical within a class).
  • the occurrence of a few colonies within a class with slight (one basepair) sequence differences could be explained by the position of this basepair in the 3' region, which forms the high melting domain. In this region, base substitutions do not result in altered migration on DGGE.
  • one basepair differences could be detected clearly as evidenced by the upper and lower bands from e.g. colony #41.
  • the multiple sequences in a portion of the colonies may be explained by contamination from aggregated colonies which were not separated despite thorough washings during isolation, or by the occurrence of multiple different rRNA operons in a portion of Microcystis strains. This can be resolved by further replating and cloning of the respective strains. The occurrence of different operons in a portion of the Microcystis strains would imply considerable intragenus variability. The most parsimonious explanation would be the presence in the genus Microcystis of at least two rRNA operons, identical in sequence in most strains and with mutations in one operon in a portion of the strains.
  • Two sequences derived from a non-toxic colony will correspond to one or two non-toxic Microcystis strains, however, one of the sequences in a toxic colony could be derived from a non- toxic contaminant.
  • a second solution would be based on expanding the available database of sequences assigned to toxic and non toxic strains to infer properties of the colonies of interest. The variation in Microcystis ITS between strains was restricted to approximately 11% of the sequence positions.
  • the conserved regions contained elements necessary for coordinated transcription and processing of rRNA genes ⁇ Iteman et al., 2000 ⁇ . Regions DI, DI', D2, D4, and D5 are required for correct folding of the rRNA transcript, indispensable for the pre-maturation of the 16S and 23S rRNA molecules by RNase III. Premature termination of transription of the rRNA operon is prevented by antiterminator sites. Antiterminator Box A sequences are reasonably well conserved within bacteria and are immediately preceded by a Box B stem of more variable sequence. Microcystis rRNA-ITS also contains one highly conserved tRNAile gene.
  • Microcystin concentration in water samples were well below the 10 ⁇ g/L guideline for safe recreational waters ⁇ Chorus and Bartram, 1999 ⁇ but exceeded this concentration considerably in scums. Although care is needed in quantitative interpretations of band intensities.
  • the methods of the present invention are suitable for identification of the most abundant organisms in field populations. Initial cell numbers of Microcystis strains are likely to correlate well with DGGE band intensities since the efficiencies of DNA isolation and amplification are comparable (see also above).
  • the apparent abundance in many samples of (identical) bands e2, e7, el3 and el6 should have resulted in the isolation of the corresponding colonies. Possibly, this Microcystis strain forms small colonies as the isolation procedure was selective against small colonies ⁇ Via-Ordorika et al., 2004 ⁇ .
  • the dominant bands in community profiles could correspond to non-colony forming Microcystis strains that are missed by the colony isolation procedure yet are detected in community profiles generated from filtered water samples.
  • a more intensive sampling and colony isolation study can be used to elucidate the sequence identity of all bands in the community profiles and thereby substantiate insights in the dynamics of Microcystis colonies.
  • Fig. 2 Cyanobacterial community composition of lakewater samples analyzed by ITSa (left gel) and ITSc (right gel) DGGE. Samples were taken from lakes 't Joppe and Zeegerplas in June, August and September 2001. An S following the sampling date signifies scum samples. Bands that yielded useable sequences after excision, reamplification and sequencing are numbered. Information on these sequences is presented in Table 3.
  • Probe P1514 was designed as general probe to hybridize with all Microcystis strains and thus serve as positive hybridization control.
  • Probe Pla354 (52) was designed to hybridize with strain 1A only (which includes only toxic isolates). Only group 1A sequences hybridized with this probe, no cross-reactivity was observed. Probe Plall was designed to hybridize with all strains from cluster 1 (which includes toxic strains 1A and IB and non- toxic strains IC and ID). 1A, IB and IC sequences hybridized with this probe, however, one sequence from strain7 (BKlO-o) also did, which call for further optimization of reaction conditions. Probe P2all was designed to hybridize with all strains from cluster 2 (which includes toxic strains 2A and 2B). Only strain 2A and 2B sequences hybridized with this probe and no cross-reactivity was observed.
  • Probes were designed on the basis of rRNA ITS sequences from 129 different cyanobacterial isolates (EMBL database accession numbers AB015357 to AB015403 ⁇ Otsuka et al., 1999 ⁇ and AJ605140 to AJ605221. The sequences were aligned using the software ARB to the alignment/database, release June 2002, provided by W. Ludwig of the ARB bioinformatics group (httn://www2. mikro.biologie.tu-muenchen.de/arb/). Using the program Treecon (van de Peer et al) a distance tree was calculated using a neighbor joining algorithm. Among the 129 ITS sequences we identified 13 clusters of sequences.
  • cluster members were relatively similar in comparison to sequences outside of the cluster.
  • Cluster 1 was subdivided into 4 strains (strain la,lb,lc and Id)
  • cluster2 was subdivided into 2 strains (strain 2a and 2b)
  • cluster 5 was subdivided into 6 strains (strain 5a, 5b, 5c, 5d, 5e and 5f). All other clusters (3,4,6 to 13) were designated strains for the purpose of the present invention.
  • sequences belonging to this strain had very high similarity or were identical.
  • probes that had perfect match (full complementarity) to all sequences of the strain or cluster and 2 or more nucleotide mismatches to any sequence outside of the strain or cluster. If such a probe could not be designed for a particular strain or cluster, we selected a probe that had a single mismatch to all sequences outside of the strain or cluster. In addition probes were found that were specific for a combination of strains such for strains 8 and 9, for strains 2b, 5a and 6, for strains 2b 5d 5e and 6, for strains 10, 11, 12, 13 (Table 3B of Example 3)
  • probe match which is a list of matching sequences to the investigated probe, also contains flanking sequences. If possible, we extended each probe with 1 to 8 flanking nucleotides (adjacent to the probe sequence at 3' and 5' side) that were shared by all sequences that had perfect match to the 20 nucleotide investigated probe. These extended probe sequences were subjected to a second round of probe design using the software Array Designer (Premier Biosoft International, Palo Alto, CA, USA) in order to generate probes of similar theoretical melting temperatures (Tm).
  • Array Designer Premier Biosoft International, Palo Alto, CA, USA
  • the package selects a contiguous stretch of nucleotides from each input sequence (the extended probe sequences) to best approach a chosen target Tm as calculated using nearest neighbor thermodynamic theory with SantaLucia thermodynamics values and to best agree to a number of additional probe settings.
  • additional probe design settings were as follows: The maximum acceptable free energy of hairpin formation was set at 6.0 — kcal/mol; the maximum acceptable free energy for self dimer formation was set at 12.0 —kcal/mol and the maximum acceptable run repeat length of nucleotides and dinucleotides was set at 8.
  • this 1-mismatch counterpart probe was identical to the perfectly matching probe, but, if necessary one or two, perfectly matching, extra nucleotides were added at the 3' side and/or 5'side. This addition was deemed necessary if the mismatch was an A or T to replace a G or C. In this manner the counterpart mismatch probe could be designed such that the theoretical melting temperature was identical to or slightly higher than that of the theoretical melting temperature of the perfectly matching probe.
  • probes are covalently bound to a membrane and the target DNA is applied in solution ⁇ Dattagupta et al., 1989; Saiki et al., 1989 ⁇ .
  • Reverse line blot hybridization is a modification introduced by Kaufhold et al. ⁇ 1994 ⁇ in which the probes are applied as lines instead of dots.
  • Hybridization with labeled target DNA in lines perpendicular to the probe lines enables simultaneous testing of several samples to several probes.
  • a detailed protocol is available at http://www.nioo.knaw.nl/cl/me/.
  • a Biodyne C membrane (Pall Europe Ltd, Portsmouth, UK) is activated by incubation for 10 min in a rolling bottle at room temperature in 16% l-ethyl-3-(3-dimethyl- aminopropyi)carbodiimide (Sigma-Aldrich, St. Louis, MO), rinsed with tapwater, and placed on a PC200 support cushion (Immunetics, Cambridge, MA) in a Miniblotter 45 manifold (Immunetics), with screws handtight. Slots are filled with 150 ⁇ l of 0.66, 2, 6.6, 20 ⁇ M probe solution (probes in Table 3 Example 3) in 500 mM NaHCO3 (pH 8.4).
  • Probes are allowed to bind at room temperature for 5 minutes, after which the probe solution is aspirated from the slots.
  • the blot is then removed from the manifold using forceps and incubated for 8 minutes at room temperature in 100 mM NaOH in a rolling bottle to inactivate the membrane.
  • SDS sodium dodecyl sulphate
  • the prepared membrane is washed in 200 ml 20 mM NaEDTA pH 8 at room temperature for 15 min, sealed in seal foil (Audion Electro, Weesp, Netherlands) to avoid dehydration and kept at 4°C until use.
  • Hybridization After incubation in 2 x SSPE/0.1% SDS at room temperature for 5 min, the probe-carrying membrane is placed on the support cushion in the manifold, rotated 90° from the orientation of probe application. Each PCR products is denatured in 150 ⁇ l 2 x SSPE/0.1% SDS in a 0.5 ml microcentrifuge tube at 99°C for 10 min and immediately thereafter chilled on ice. Then, all PCR products are applied to the slots and slots without PCR product are filled with 2 x SSPE/0.1% SDS. Hybridization is performed in the manifold at 42°C for 60 min on a horizontal surface without agitation.
  • the membrane is washed by two subsequent incubations in a rolling bottle (with mesh) in 200 ml 2 x SSPE/0.5% SDS at 52°C for 10 min (stringent wash). Detection.
  • the washed membrane is incubated in 10 ml of a 1:4000 dilution of peroxidase labeled streptavidin conjugate (Roche,
  • Each of these variant probes has different melting characteristics when tested in actual hybridization, thus allowing selection of the optimal probe for particular assays.
  • the optimal probe pairs high sensitivity with high selectivity. 13 probes were selected that were highly specific, meaning that they have perfect match for sequences of the target strain or cluster and two or more mismatches to strains that are not part of the target strain or cluster. For probe P2all252-48 longer versions of the probe, with higher theoretical melting temperatures could not be designed because of the variation of the flanking nucleotides within cluster 2. 33 probes were selected that had perfect match to most sequences from the target strain or cluster and one or more mismatches to sequences that are not part of the target strain or cluster.
  • Fig. 2 of example 3 shows an example of a hybridization result.
  • the isolated colonies used for this example were K63-b, Kl ⁇ -o, K60, K12, K65. K13, K21, K75-b, K69, K75-o, KlO-o, K51, K72, K123, KlO-b, K104, K139-0, K47-o, K74, K57, K34, K58, K16, K49. These colonies were obtained from lake water samples through microscope assisted micromanipulation as described in example 2. After DNA isolation from these colonies and specific amplification of the ITSc region as described in Example 2, the amplified DNA was subjected to DGGE and bands were excised from the gel, as described in Example 2. The test DNA was obtained through amplification using the ITSc primers of the DNA extracted from these excised bands as described in Example 2. This amplified known test DNA was then subjected to hybridization in Reverse Line Blot.
  • Probe P1514 -52 was designed as general probe to hybridize with all Microcystis strains and thus serves as positive hybridization control. All sequences tested hybridized with this probe. Probe Pla251 -52 was designed to hybridize with group 1A only (which includes only toxic strains). Only group 1A sequences hybridized with this probe, no cross-reactivity was observed ( Figure 2 of Example3). Probe Plall36 -52 was designed to hybridize with all strains from cluster 1 (which includes toxic strains 1A and IB and non-toxic strains IC and ID). 1A, IB and IC sequences hybridized with this probe, however, one sequence from strain 6 (KlO-o) also did ( Figure 2 of Example3). Probe P2all252 -52 was designed to hybridize with all strains from cluster 2 (which includes toxic strains 2A and 2B). Only strain 2A and 2B sequences hybridized with this probe and no cross-reactivity was observed (Figure 2 of Example 3).
  • Example 3 we report on the effectiveness and specificity of a larger set of ITS probes selected from Table 3 of Example 3. As a result of our tests, a preferred set of probes is selected. This preferred set is marked in table 3 of example 3.
  • control PCR products have been obtained from earlier research as described in detail in example 2.
  • DNA was extracted from Microcystis colonies that were isolated through micromanipulation from lake water samples. The isolation of these colonies was a first step towards obtaining homogeneous DNA.
  • the second step in this purification process was the amplification of the DNA from the colony and subsequent separation into distinct bands through denaturing gradient gel electrophoresis (DGGE).
  • DGGE denaturing gradient gel electrophoresis
  • individual bands were excised from the gel and in another round of PCR, for each excised band a control PCR product was obtained. In some cases PCR produced no amplification products (see example 2).
  • control PCR products have been determined as described in example 2 and deposited at the EMBL/Genbank DDBJ nucleotide databases.
  • accession numbers and strain identifiers are listed in Table 2 of Example 3.
  • the identifiers of the control PCR products are preceded by BK.
  • BK21 in example 4 is the control PCR product obtained from colony 21 in Table 1 of example 2 and deposited sequence K21 of Table 2 of Example 3.
  • BK75-b is the PCR product from band 75-u in Table 1 of Example 2
  • BK75- o is the PCR product from band 75-1 and both bands are derived from colony 75.
  • the probe with the lowest cross-reactivity was chosen in the preferred set. If variants reacted similarly to the positive control PCR product and showed no cross-reactivity, the shortest variant probe was preferred.
  • Figs 1 to 6 serve to illustrate the performance of probes from the preferred set and some related probes.
  • Fig 1 shows the reactivity of control PCR products in reverse lineblot to probes from cluster 1. All control DNAs showed reactivity to the general probe pl514.
  • Cluster 1 is an important cluster because subclusters la and lb sofar encompass only toxic Microcystis colonies while subcluster lc and Id encompass only non-toxic Microcystis colonies. We had no test DNA for subcluster ID. Note that Pla251-52 has been designed with a theoretical melting temperature of 52 degrees while the broader probes Plab32-48 and Plall38-48 are designed to have a theoretical melting temperature of 48 degrees. Variants with other theoretical melting temperatures have been tested but the probes shown here showed optimal reactivity (high reactivity with low or no cross-reactivity). All three cluster 1 probes are selected for the preferred set.
  • Fig 2 shows an example of probes that differentiate on 1 nucleotide.
  • Probes Pll-11-50 and Pll-11-52 react only with the two test DNAs from cluster 11.
  • Probe P2all-50 differs by only one nucleotide from Pll-11-50 and can therefore also be considered to be the counterpart 1 mismatch probe for Pll- 11-50.
  • the probe reacts only to test DNAs from subcluster 2a.
  • P2all-52 differs by one nucleotide from Pll-11-52 and reacts only to the subcluster 2a test DNAs. Therefore at these conditions and with these probes single nucleotide mismatches can be differentiated.
  • Probe pll-11-50 is showing an artefact that we have sometimes encountered. The probe 'smears' across all lanes.
  • a reactive site can be recognized through the square shape of the signal, or if the reactivity is high by an intense round signal. This is not the case for this probe at the control DNAs that do not belong to cluster 11. The smear even extends beyond the region where test DNAs have been applied. We cannot yet explain this artefact. It is however specific for this batch of probe since it occurred to this probe in multiple blots irrespective of the application position chosen in the manifold. Possibly, the probe is partly degraded or contaminated. Probes Pll-11-52 and P2all-52 are selected for the preferred set of probes. Fig. 3 shows reactivity of probes for cluster 2.
  • Probes P2all-50, P2all71-48, P2all259-48 and P2b5de6-37-48 react with intended specificity to the test DNAs.
  • Probe P2b5a6-225-48 is reacting strongly to test DNAs from subclusters 2b and 5a and cluster 6. However, a weaker reactivity is apparent to test DNAs from subcluster 2a. Also when a higher stringent washing temperature was used (54 degrees) this reactivity remained.
  • Probe P5c-213-48 has rather weak reactivity to all test DNAs from subcluster 5c. Elongation of the probe to reach theoretical melting temperatures of 50 or 52 degrees did not improve the reactivity of the probe. Possibly, the binding site for this probe is not optimal due to inhibitory propely folding structure. Still, the probe adds information and was therefore included in the preferred set.
  • Fig. 5 is another illustration of one nucleotide differentiation of probes.
  • Probes P5f74-48, P5f9-50 and P5fl0-52 all react only to the control DNA of subcluster 5f.
  • the 1 nucleotide mismatch counterprobe P5f74-48mm reacts to test DNAs from subcluster 5b, and clusters 6 and 7. With the exception of the control for cluster 6 all the reactive test DNAs are homologous to this counterpart probe.
  • the test DNA for cluster 6 differs by 1 nucleotide from the counterpart probe and by 2 nucleotides from probe P5f74-48. Since the reactivity of P5f9-50 is similar to that of P5f9-52 the former is selected for the preferred set.
  • the mismatch probe P5f9-50mm reacts to the test DNAs of subcluster 5a to which it is completely homologous. No reactivity is seen to the 5f test DNAs.
  • the longer variant P5fmml0-52 reacts more strongly to the 5a test DNAs but also reacts to the imperfectly matching 5f DNA. This demonstrates the balance that must be sought between reactivity and specificity.
  • the P5f9-50mm counterpart probe is selected in the preferred set but the P5fmml0-52 probe is not.
  • Both P5f74-48 and P5f9-50 are selected in the preferred set. They have the same specificity but target a different binding site in ITS.
  • Fig 6 shows that probe P10111213-246-50 was specifically reacting to test DNAs from clusters 10,11 and 13 and is selected into the preferred set of probes. No test DNA was available for cluster 12.
  • the current preferred set of probes will differentiate most of the Microcystis strains that have been characterized to date. Frequently, the combination of reactivities is providing additional information. For instance a pure culture that would react to probe Plall38-48 and not to probes Pla251-52 and Plab32- 48 is likely to be a member of subclusters lc or Id. Both contain no toxic strains among those characterized. An alternative possibility with this reactivity is that the investigated culture is from an as yet unknown variant of cluster 1.
  • the set can be expanded and we will pursue expansion on the basis of both the characterized strains and strains to be characterized in the future. For instance expansion to clusters 3, 4, 5d, 5e, 10, 12 and 13. Cluster 11 can be differentiated.
  • PCC 7806 Microcystis aeruginosa Braakman Reservoir, The Netherlands PCC
  • PCC 6803 Synechocystis sp. Freshwater, California, USA PCC
  • PCC 7942 Synechococcus sp. Freshwater, California, USA PCC
  • PCC a NTVA Culture CoUection of Algae, Norwegian Institute for Water Research; PCC: Pasteur Culture Collection of Cyanobacteria, Institut Pasteur, Paris, France; KAC: Kal ar Algae Collections, Kalmar University, Sweden; SAG: Culture Collection of Algae at the University of Gottingen, Germany; CCAP: Culture Collection of Algae and Protozoa, CEH, Windermere, UK; ATCC: American Type Culture Collection, Manassas, Virginia, USA.
  • F (forward) and R (reverse) refer to primer orientation in relation to rRNA or phycocyanin genes.
  • a 40-nucleotide GC-clamp 5'-CGC CCG CCG CGC CCC GCG CCC GGC CCG CCG CCC CCG CCC C-3' was added to the 5' end of the forward primers indicated with (GC-).
  • Anabaenopsis arnoldii. 300 350, 650 450, 725
  • Cylindrospermopsis raciborskii 300 350, 525 425, 600
  • MALDI-TOF MS profile had only 1 peak at mass-to-charge ratio (m/z) 995 which was not analyzed by post-source decay (PSD) measurements and could therefore be derived from either microcystin LR or cyanopeptolin.
  • Table 1 Grouping of isolated Microcystis colonies based on rRNA- ITS DGGE. Colonies were analyzed using ITSa and ITSc DGGE and assigned group numbers based on the positions of their bands. Morphospecies assignment and lake of origin are given for each colony.
  • Colonies in bold are toxic as was determined by MALDI-TOF or in a few cases by amplification of the mcy gene. Toxicity data are lacking for colonies printed in italics. Underlined bands were sequenced.
  • the suffix — u refers to the upper band in the ITSc DGGE profile from a colony
  • the suffix -m refers to the middle band
  • suffix -1 refers to the lower band. If the upper and lower band from a colony have the same group assignment for e.g. ITSa, this means that there is one band in the ITSa profile, and two in the ITSc profile.
  • ULR CCT CTG TGT GCC TAG GTA TC a F (forward) and R (reverse) refer to primer orientation in relation to rRNA genes.
  • a 40-nucleotide GC-clamp 5'-CGC CCG CCG CGC CCC GCG CCC GGC CCG CCG CCC CCG CCC C-3' was added to the 5' end of the forward primers indicated with (GC-).
  • Alignment position corresponds to nucleotide position in the aHgnment of all 129 sequences, numbered from the 5' end of the ITS region. This alignment has a total length of 372 positions.
  • This column shows the nucleotides to be added to the depicted probe sequence in the 2 nd colum.
  • the bindingsite for P5bl7-52 has absolute positions 17 to 39 in ITS of the reference sequence and the probe sequence is CTACTTTTTTTCGTCTCCTACCT (see 2 nd column).
  • Alternative 1 of P5bl7-52 corresponds to positions 19 to 40 of the reference sequence and the extra nucleotide corresponding to position 40 is an A at the 5' side of the probe (corresponding to a T in the reference sequence, because the reference sequence is sense and the probe is anti-sense).
  • P2b5de6-34-52 is specific for strains 2b, 5d and 5e as well as for strain 6.
  • P10111213-252-52 is specific for strains 10, 11, 12 and 13.
  • Probes with the abbreviation mm in the name have a single mismatch to members of the indicated strains or clusters.
  • Alignment position corresponds to nucleotide position in the alignment of all 129 sequences, numbered from the 5' end of the ITS region. This alignment has a total length of 372 positions.
  • Absolute position of the corresponding probe in the reference sequence numbered from the 5'end of the ITS region 5.
  • Absolute position of alternative 1 which was designed to have a theoretical melting temperature of 50°C ⁇ 1°C. 6.
  • Absolute position of alternative 2 which was designed to have a theoretical melting temperature of 48°C + 1°C.
  • Universal bacterial probes complementary to sequences in the 16S rRNA gene. Positions in the 16S rRNA gene, numbering according to Escherichia coli numbering.
  • Cyanobacterial toxins 43 Table 3.1 General features of the cyanotoxins Primary target Toxin group 1 organ in mammals Cyanobacterial genera 2 Cyclic peptides Microcystins Liver Microcystis, Anabaena, Planktothrix (Oscillatoria), Nostoc, Hapalosiphon, Anabaenopsis Nodularin Liver Nodularia Alkaloids Anatoxin-a Nerve synapse Anabaena, Planktothrix (Oscillatoria), Aphanizomenon Anatoxin-a(S) Nerve synapse Anabaena Aplysiatoxins Skin Lyngbya, Schizothrix, Planktothrix (Oscillatoria) Cylindrospermopsins Liver 3 Cylindtospermopsis, Aphanizomenon, Umezakia Lyngbyatoxin-a Skin, gastroLyngbya intestinal tract Saxitoxins Nerve axons Anabaena
  • M. aeruginosa 5 Azevedo et al., 1994 MCYST-LR 994 50 M. aeruginosa 5 , A. flos-aquae 5 Botes et al., 1985; Rlnehart et al., 19B8; M. viridis 5 Krishnamyrthy et al., 1989; Watanabe ef al., 1988 [D-Asp 3 ,D-GIU(OCH 3 ) ⁇ ]MCYST-LR 994 NR A. Ilos-aquae 5 Sivonen et al., 1992d 7 t(6Z)-Adda 5 ]MCYST-LR 994 _ 1,200 M.
  • ADMAdda OAcetyl-O-demethylAdda (0) Methionlne-S-oxlde LDso value is the dose of toxin that kills 50% of
  • Example 4 table 1A preferred set of strain specific probes
  • P2all-50 (alternative 1 of P2all-52 according to table 3A of example 3)
  • P5c213-48 (alternative 2 of P5c213-52 according to table 3A of example 3)
  • P5f9-50 (alternative 1 of P5f 10-52 according to table 3A of example 3)
  • P5f9-50mm (alternative 1 of P5fmml0-52 according to table 3A of example 3)
  • Example 4 table IB preferred set of cluster specific probes
  • Plab32-48 (alternative 2 of Plab30-52 according to table 3B of example 3) Plall38-48 (alternative 2 of Plall36-52 according to table 3B of example 3) P2aU71-48 (alternative 2 of P2all70-52 according to table 3B of example 3) P2all259-48 (alternative 2 of P2all258-52 according to table 3B of example 3) P2b5a6-225-48 (alternative 2 of P2b5a6-52 according to table 3B of example 3) P2b5de6-37-48 (alternative 2 of P2b5de6-34-52 according to table 3B of example 3) P10111213-246-50 (alternative 1 of P10111213-246-52 according to table 3B of example 3)
  • DCSE v2.54 an interactive tool for sequence alignment and secondary structure research. Comput. Applic. Biosci 9:735-740. Dittmann, E., B. A. Neilan, M. Erhard, H. von D ⁇ hren, and T. B ⁇ rner. 1997. Insertional mutagenesis of a peptide synthetase gene that is responsible for hepatotoxin production in the cyanobacterium Microcystis aeruginosa PCC 7806. Mol. Microbiol. 26:779-787. Fastner, J., M. Erhard, and H. von D ⁇ hren. 2001. Determination of oligopeptide diversity within a natural population of Microcystis spp.
  • Phenotype variability of identical genotypes The need for a combined approach in cyanobacterial taxonomy demonstrated on Merismopedia-like isolates.
  • Microcystis aeruginosa PCC7806 an integrated peptide- polyketide synthetase system. Chem. Biol. 7:753-764. Van de Peer, Y., and R. De Wachter. 1994. TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Co put. Applic. Biosci 10:569-570. Vezie, C, L. Brient, K. Sivonen, G. Bertru, J. C. Lefeminister, and M. Salkinoja-Salonen. 1998. Variation of microcystin content of cyanobacterial blooms and isolated strains in Lake Grand-Lieu (France). Microb. Ecol. 35:126- 135. • Via-Ordorika, L., J. Fastner, M. Hisbergues, E. Dittmann, M. Erhard, J.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne la typologie des cyanobactéries. Sont décrits des méthodes et des acides nucléiques s'utilisant pour tester des préparations contenant une cyanobactérie et pour classer ladite cyanobactérie. La classification peut servir à corréler la cyanobactérie présente dans la préparation et des caractéristiques phéno- ou génotypiques connues pour la souche déterminée. Cette information est utile pour des applications diverses et variées, par exemple pour prévoir et/ou caractériser une prolifération toxique de cyanobactéries dans des organismes d'eau de surface.
PCT/NL2004/000782 2003-11-05 2004-11-05 Moyens et methodes de classification des cyanobacteries WO2005045074A2 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US51745803P 2003-11-05 2003-11-05
EP03078502A EP1529846A1 (fr) 2003-11-05 2003-11-05 Procédés et moyens pour classifier des Cyanobactéries
EP03078502.6 2003-11-05
US60/517,458 2003-11-05

Publications (2)

Publication Number Publication Date
WO2005045074A2 true WO2005045074A2 (fr) 2005-05-19
WO2005045074A3 WO2005045074A3 (fr) 2005-10-27

Family

ID=34575675

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2004/000782 WO2005045074A2 (fr) 2003-11-05 2004-11-05 Moyens et methodes de classification des cyanobacteries

Country Status (1)

Country Link
WO (1) WO2005045074A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107292436A (zh) * 2017-06-16 2017-10-24 北京工商大学 基于非线性动力学时序模型的蓝藻水华预测方法
US10570464B2 (en) 2016-05-09 2020-02-25 The Board Of Trustees Of The Leland Stanford Junior University Bacterial pathogen identification by high resolution melting analysis

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104899653B (zh) * 2015-06-02 2018-01-12 北京工商大学 基于专家系统及蓝藻生长机理时序模型的湖库蓝藻水华预测方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000298A1 (fr) * 1994-06-24 1996-01-04 Innogenetics N.V. Detection, identification et differentiation simultanees de taxa d'eubacteriales a l'aide d'une technique d'hybridation
US20020024026A1 (en) * 2000-08-22 2002-02-28 Kaushikkar Shantanu V. System, method, and computer software product for specifying a scanning area of a substrate

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2001269180A (ja) * 2000-03-28 2001-10-02 Marine Biotechnol Inst Co Ltd 原核藻類の１６ＳｒＤＮＡを特異的に増幅するプライマー

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000298A1 (fr) * 1994-06-24 1996-01-04 Innogenetics N.V. Detection, identification et differentiation simultanees de taxa d'eubacteriales a l'aide d'une technique d'hybridation
US20020024026A1 (en) * 2000-08-22 2002-02-28 Kaushikkar Shantanu V. System, method, and computer software product for specifying a scanning area of a substrate

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BARRY T ET AL: "The 16s/23s ribosomal spacer region as a target for DNA probes to identify eubacteria." PCR METHODS AND APPLICATIONS. AUG 1991, vol. 1, no. 1, August 1991 (1991-08), pages 51-56, XP00609831 ISSN: 1054-9803 *
DATABASE EMBL [Online] 4 September 2002 (2002-09-04), "Primer amplifying specifically 16SrDNA of prokaryotic algae." XP002318293 retrieved from EBI accession no. EM_PRO:BD061327 Database accession no. BD061327 & JP 2001 269180 A (MARINE BIOTECHNOL INST CO LTD) 2 October 2001 (2001-10-02) *
DATABASE EMBL [Online] 4 September 2002 (2002-09-04), "Primer amplifying specifically 16SrDNA of prokaryotic algae." XP002318295 retrieved from EBI accession no. EM_PRO:BD061305 Database accession no. BD061305 & JP 2001 269180 A (MARINE BIOTECHNOL INST CO LTD) 2 October 2001 (2001-10-02) *
DATABASE EMBL [Online] 4 September 2002 (2002-09-04), "Primer amplifying specifically 16SrDNA of prokaryotic algae." XP002318296 retrieved from EBI accession no. EM_PRO:BD061333 Database accession no. BD061333 & JP 2001 269180 A (MARINE BIOTECHNOL INST CO LTD) 2 October 2001 (2001-10-02) *
DATABASE Geneseq [Online] 21 May 2002 (2002-05-21), "PCR primer associated with identification of prokaryotic algae #15." XP002318294 retrieved from EBI accession no. GSN:ABK40496 Database accession no. ABK40496 & JP 2001 269180 A (MARINE BIOTECHNOL INST CO LTD) 2 October 2001 (2001-10-02) *
ITEMAN I ET AL: "Comparison of conserved structural and regulatory domains within divergent 16S rRNA-23S rRNA spacer sequences of cyanobacteria." MICROBIOLOGY (READING, ENGLAND) JUN 2000, vol. 146 ( Pt 6), June 2000 (2000-06), pages 1275-1286, XP002279654 ISSN: 1350-0872 *
LU W ET AL: "IDENTIFICATION OF CYANOBACTERIA BY POLYMORPHISMS OF PCR-AMPLIFIED RIBOSOMAL DNA SPACER REGION" FEMS MICROBIOLOGY LETTERS, AMSTERDAM, NL, vol. 153, no. 1, 1997, pages 141-149, XP001190804 ISSN: 0378-1097 *
OTSUKA S ET AL: "Phylogenetic relationships between toxic and non-toxic strains of the genus Microcystis based on 16S to 23S internal transcribed spacer sequence." FEMS MICROBIOLOGY LETTERS. 1 MAR 1999, vol. 172, no. 1, 1 March 1999 (1999-03-01), pages 15-21, XP002279653 ISSN: 0378-1097 *
WILMOTTE A ET AL: "Structure of the 16 S ribosomal RNA of the thermophilic cyanobacterium Chlorogloeopsis HTF ('Mastigocladus laminosus HTF') strain PCC7518, and phylogenetic analysis." FEBS LETTERS. 8 FEB 1993, vol. 317, no. 1-2, 8 February 1993 (1993-02-08), pages 96-100, XP002279657 ISSN: 0014-5793 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10570464B2 (en) 2016-05-09 2020-02-25 The Board Of Trustees Of The Leland Stanford Junior University Bacterial pathogen identification by high resolution melting analysis
CN107292436A (zh) * 2017-06-16 2017-10-24 北京工商大学 基于非线性动力学时序模型的蓝藻水华预测方法
CN107292436B (zh) * 2017-06-16 2020-07-17 北京工商大学 基于非线性动力学时序模型的蓝藻水华预测方法

Also Published As

Publication number Publication date
WO2005045074A3 (fr) 2005-10-27

Similar Documents

Publication Publication Date Title
Janse et al. High-resolution differentiation of cyanobacteria by using rRNA-internal transcribed spacer denaturing gradient gel electrophoresis
Amann Fluorescently labelled, rRNA‐targeted oligonucleotide probes in the study of microbial ecology
Capote et al. Molecular tools for detection of plant pathogenic fungi and fungicide resistance
Overmann et al. Phylogeny and molecular fingerprinting of green sulfur bacteria
Pearson et al. The molecular genetics of cyanobacterial toxicity as a basis for monitoring water quality and public health risk
Castiglioni et al. Development of a universal microarray based on the ligation detection reaction and 16S rRNA gene polymorphism to target diversity of cyanobacteria
Widmer Genetic heterogeneity and PCR detection of Cryptosporidium parvum
Al-Tebrineh et al. A multiplex qPCR targeting hepato-and neurotoxigenic cyanobacteria of global significance
Groppe et al. A microsatellite marker for studying the ecology and diversity of fungal endophytes (Epichloë spp.) in grasses
Øvreås et al. Characterization of microbial diversity in hypersaline environments by melting profiles and reassociation kinetics in combination with terminal restriction fragment length polymorphism (T-RFLP)
Thies et al. Application of molecular techniques to studies in Rhizobium ecology: a review
KR20070011354A (ko) 취약 ｘ염색체 증후군과 같은 ｓｔｒｐ의 검출 방법
Galluzzi et al. Development of an oligonucleotide microarray for the detection and monitoring of marine dinoflagellates
JP2006512928A5 (fr)
NO326359B1 (no) Fremgangsmate ved pavisning av forskjellige nukleotidsekvenser i en enkelt prove samt sett for utforelse av fremgangsmaten
JPH10503382A (ja) ライム病関連ボレリアに対する核酸増幅オリゴヌクレオチドおよびプローブ
Dhalluin et al. Genotypic differentiation of twelve Clostridium species by polymorphism analysis of the triosephosphate isomerase (tpi) gene
WO2005045074A2 (fr) Moyens et methodes de classification des cyanobacteries
Elboutahiri et al. Genotypic characterization of indigenous Sinorhizobium meliloti and Rhizobium sullae by rep-PCR, RAPD and ARDRA analyses
SG174036A1 (en) Multiplex analysis of nucleic acids
JI et al. Novel polymorphic microsatellite markers developed in the cotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae)
AU2013205090B2 (en) Compositions and Methods for Detecting Gastrointestinal Pathogen Nucleic Acid
EP1546177A2 (fr) Empreinte genetique pour le cannabis sativa (marijuana) au moyen de marqueurs microsatellites (str)
EP1098003A2 (fr) Procédé pour l' identification et la détection spécifique des mycobactéries qui grandissent lentement en utilisant le gène de l'ADN gyrase
Felske Reviewing the DA001-files: a 16S rRNA chase on suspect# X99967, a Bacillus and Dutch underground activist

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase