WO2005040390A1

WO2005040390A1 - A recombinant vaccine using yellow fever virus as vector

Info

Publication number: WO2005040390A1
Application number: PCT/CN2004/000845
Authority: WO
Inventors: Xiaowu Pang; Xinbin Gu
Original assignee: Shanghai Tengen Biomedical Co., Ltd.; Tengen Biomedical Co.; Beijing Oriental Tengen Technology Development Co., Ltd.
Priority date: 2003-07-21
Filing date: 2004-07-21
Publication date: 2005-05-06

Abstract

The present invention provides a yellow fever virus vector, into which exogenous polypeptide expression element was inserted, said expression element comprises in the order of 5' to 3': (a) a 5' releasing element; (b) a gene element encoding exogenous polypeptide; and (c) a 3' releasing element, said releasing elements are selected from: a nucleotide sequence encoding hydrolase from foot-and-mouth disease virus, a nucleotide sequence encoding hydrolase from signal peptide, and their combination. The vector can provide antigenic polypeptides of virus and tumor in the host to elicit immunological reaction to the virus and tumor.

Description

Recombinant yellow fever virus-based vaccine TECHNICAL FIELD

The present invention relates to the fields of virology and immunology, and more particularly to a yellow fever virus vector expressing a foreign polypeptide (such as an antigen) and a recombinant vaccine containing the vector. Background technique

Yellow fever virus (YFV) is spherical, 40-50 nm in diameter, and consists of an envelope and a nucleocapsid. The nucleocapsid consists of a capsid protein (C) and a nucleic acid. The surface of the envelope has a capsule. Glycoprotein (E) spikes, and there is still inner membrane protein (M) in the capsule, which is involved in the assembly of the virus. The viral genome is a single positive strand with a total length of 1 kb, and the structural proteins C, M, E, and non-structural proteins NS1-NS5 are sequentially encoded from the 5 'to 3' ends. The viral RNA directly functions as mRNA in the cytoplasm and is translated. Structural and non-structural proteins.

Yellow fever (YF) caused by yellow fever virus infection is a zoonotic disease, which cannot be completely eradicated at present, but by inoculating 17D yellow before the yellow fever outbreak or entering the yellow fever endemic area Fever virus vaccines and regular ¾a immunization of children with yellow fever virus vaccine in areas where yellow fever is endemic can effectively reduce the prevalence of the population.

The 17D yellow fever vaccine is a live attenuated vaccine. It was invented by Max Theiler and Sinrth in 1937. It is a standard safe vaccine recognized by the World Health Organization (WHO). It is also the only safe vaccine currently in production and use. A vaccine that effectively prevents yellow fever. (Monath TP. Stabi lity of yellow fever vaccine. Dev Biol Stand 1996; 87: 219-25)

The virus seed bank of the 17D yellow fever virus vaccine established in 1945 effectively solved the instability of vaccine inactivation conditions and made the 17D yellow fever virus vaccine universally safe. Since 1945, the vaccine has been used worldwide Used more than 400 million. After immunization, immunization can be triggered within 10 days, with an effective rate of more than 95%, and the period for detecting virus-neutralizing antibodies can reach 35 years.

The 17D yellow fever virus vaccine has a seroconversion rate of 93.8% for adult immunization, and a seroconversion rate for 6-month-old and 9-month-old babies can reach 98.6 ° /. And 98%. (Osei-Kwasi M, Dunyo SK, Koram KA, et al. Antibody response to 17D yellow fever vaccine in Ghanaian infants. Bull World Health Organ 2001; 79 (11): 1056-9)

The serious side effects caused by the 17D yellow fever virus vaccine and the virus mutation rate of the vaccine are very rare, and there is almost no possibility of returning to the wild type. Therefore, its effectiveness and safety have been fully verified.

Severe Acute Respiratory Syndromes (SARS), also known as infectious atypical pneumonia (referred to as SARS) in mainland China, is a highly infectious disease that is transmitted mainly through close air flying and close contact. Respiratory infectious diseases were first discovered in Guangdong Province, China in November 2002, and they quickly spread to 33 countries and regions including Asia, North America, and Europe. The clinical manifestations of SARS are mainly pneumonia, with significant aggregation in homes and hospitals. Urgent onset, with fever as the first symptom, body temperature generally higher than 38 ° C, occasional chills; may be accompanied by headache, joint pain, muscle aches, fatigue, diarrhea; cough, mostly dry cough, sputum, occasionally Bloody sputum; chest tightness; severe cases of rapid breathing, shortness of breath, or obvious respiratory distress. The fatality rate is about 3.5%. SARS is different from the common cold. Common cold symptoms include fever, cough, headache, which can be improved after a few days, and generally

Confirm this No signs of pneumonia.

On April 16, 2003, the World Health Organization officially announced that the pathogen of SARS is a new coronavirus and officially named SARS coronarivus »

The SARS coronavirus is an ssRNA (+) virus that replicates without passing through DNA intermediates and uses standard codons. Under the electron microscope, the virus particles are irregular in shape, with a diameter of about 60-220 mn, and the surface has plum-shaped membrane particles, which look like a crown. The center of the particles was indefinite under negative electron microscope, and the nuclear shell was loose. Structural proteins of SARS coronavirus include spike protein (S), small membrane protein (E), transmembrane protein (M), and nucleocapsid protein (N). The S protein is closely related to the infectivity of the virus, and mediates the receptor binding of the virus to the host cell and the fusion of the viral envelope and the host cell membrane. This protein is the main antigen for protective immunity of coronavirus. M protein is involved in envelope formation and plays an important role in virus budding and release. The N protein is involved in the packaging of viral RNA and the formation of nucleocapsids, and assists in the production of S protein antibodies. In some subclasses, there is a third glycoprotein, HE hemagglutinin esterase. Genomic RNA and basic phosphoproteins N P

The outbreak of the SARS epidemic caused a great shock worldwide. In order to effectively control and prevent SARS, people are developing various SARS vaccines, of which there are mainly five types: inactivated vaccines, live attenuated vaccines, recombinant subunit vaccines, DNA vaccines and attenuated virus vector vaccines. Among them, attenuated viral vector vaccines are the most popular, and they are considered to be the most technical and most promising SARS vaccines. Many institutes and companies have chosen to develop SARS vaccines with attenuated adenovirus vectors.

However, the existing technology for developing vaccines with attenuated adenovirus vectors has the following disadvantages-

(1) Most people (55%) have adenovirus antibodies in their bodies. When vaccinated, the antibodies bind to the adenovirus vector, which seriously affects the vaccine effect;

(2) Cytotoxicity is high at high titers;

(3) The vector has the possibility of returning to the wild type, and there is a potential safety hazard.

W00153467 discloses a recombinant flavivirus comprising an exogenous nucleotide sequence encoding an exogenous amino acid sequence. Infecting a host cell with a recombinant flavivirus can provide exogenous nucleic acid in the host cell and generate an antigenic polypeptide encoded by the exogenous nucleic acid, thereby triggering an immune response to the exogenous polypeptide. However, its disadvantages are (a) the use of yellow fever virus that can autonomously replicate and proliferate, retains the entire yellow fever virus genome sequence, and has no deletion of structural protein genes. (B) The inserted foreign sequence is only a small fragment gene sequence of about 30 nucleotides, which is not suitable for inserting a fragment longer than 300bp, especially a fragment longer than 1000bp. (C) The cleavage effect of the proteolytic cleavage site used is not very satisfactory.

Therefore, there is an urgent need in the art to develop safer and more effective vaccines for the prevention of viral diseases such as SARS. Summary of the invention

The object of the present invention is to provide a yellow fever virus vector expressing a SARS coronavirus antigen and a recombinant SARS vaccine containing the vector. In a first aspect of the present invention, a yellow fever virus vector is provided. An exogenous polypeptide expression module is inserted into the genome of the yellow fever virus, and the expression module has the following sequence from 5 'to 3' in order. element: (a) a 5 'end release element, the 5' end release element is selected from the group consisting of a nucleotide sequence encoding a foot-and-mouth disease virus autohydrolase shown in SEQ ID NO: 1 and a signal peptide shown in SEQ ID NO: 2: Nucleotide sequences of hydrolase substrates, and combinations thereof:

(b) a genetic element encoding a foreign polypeptide;

(c) a 3'-end release element, the 3'-end release element is selected from the group consisting of a nucleotide sequence encoding a foot-and-mouth disease virus autohydrolase shown in SEQ ID NO: 1, and a signal peptide shown in SEQ ID NO: 2: The nucleotide sequence of a hydrolase substrate, and combinations thereof,

The expression component is inserted into the coding region of the yellow fever virus genome, and does not cause frame shifting of the yellow fever virus genome sequence.

In another preferred example, the exogenous polypeptide is a viral protein or a cancer-related protein.

In another preferred example, the genetic element of the exogenous polypeptide is the S1 gene, the N gene, the S gene, the S2 gene, the M gene, or a fragment of the aforementioned genes, or a combination thereof of the full-length SARS-coronal virus.

In another preferred example, the site where the expression component is inserted into the yellow fever virus genome is selected from the following group:

(i) between the NS2B coding region and the NS3 coding region;

(ii) between the E-coding area and the NS1 coding area;

(ii i) between the C coding region and the prM coding region.

In another preferred example, the 5'-end release element and the 3'-end release element are both the nucleotide sequence of the encoded foot-and-mouth disease virus autohydrolase shown in SEQ ID NO: 1.

In another preferred example, the 5′-end release element is a nucleotide sequence encoding a signal peptide hydrolase substrate shown in SEQ ID NO: 2.

In another preferred example, the yellow fever virus genome is partially deleted from the yellow fever virus structural protein gene sequence, and the deleted structural protein gene sequence is selected from the following group: protein C, prM protein, E protein, or combination.

In a second aspect of the present invention, there is provided a pharmaceutical composition comprising the yellow fever virus carrier of the present invention and a pharmaceutically acceptable carrier.

In a third aspect of the present invention, there is provided the use of the yellow fever virus vector of the present invention, which are used to prepare a preventive or therapeutic vaccine.

In a fourth aspect of the present invention, a method for preparing yellow fever virus is provided, including the steps:

(1) Introducing the yellow fever virus genome into packaging cells, wherein the yellow fever virus genome is inserted with an exogenous polypeptide expression module, and the expression module has the following elements in order from 5 'to 3':

(a) a 5 'end release element, the 5' end release element is selected from the group consisting of a nucleotide sequence encoding a foot-and-mouth disease virus autohydrolase shown in SEQ ID NO: 1 and a signal peptide shown in SEQ ID NO: 2 Nucleotide sequences of hydrolase substrates, and combinations thereof-

(b) a genetic element encoding a foreign polypeptide;

(c) a 3 'end release element, the 3' end release element is selected from the group consisting of a nucleotide sequence encoding a foot-and-mouth disease virus autohydrolase shown in SEQ ID NO: 1 and a signal peptide shown in SEQ ID NO: 2: The nucleotide sequence of a hydrolase substrate, and combinations thereof,

And the genome is deleted from a structural protein gene sequence selected from the group consisting of protein C, prM protein, E protein, or The combination, and the recombined genome retains the function of self-replication;

And the packaging cells are selected from the group:

(1) a cell transfected with a plasmid containing a structural protein gene deleted by the virus,

(ii) a cell transfected with a helper virus vector containing a structural protein gene deleted by said virus, and

(iii) a cell having a genome integrated with the structural protein gene deleted by the virus;

(2) the packaging cell of the culture step (1);

(3) Isolate the recombinant yellow fever virus from the culture. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a schematic diagram of the RNA gene structure of yellow fever virus.

Fig. 2 is a flow chart for converting yellow fever virus RNA into three segments of yellow fever virus cDNA fragment.

Figure 3 is a flow chart for the preparation of a full-length yellow fever virus cDNA clone.

Figure 4 is a flow chart for the preparation of a coronavirus vaccine modified with a gene fragment (2A) of foot-and-mouth disease virus between the NS2B and NS3 of the yellow fever virus cDNA.

Figure 5 shows the gene fragment of foot and mouth disease virus with insertion point between E and NS 1 of yellow fever virus cDNA.

(2A) Flow chart of a modified coronavirus vaccine.

Figure 6 is a flow chart for preparing a coronavirus vaccine modified with a gene fragment (2A) of foot-and-mouth disease virus and a gene fragment of a signal peptide hydrolase substrate inserted between the E and NS 1 of yellow fever virus cDNA.

FIG. 7 is a flow chart for preparing a coronavirus vaccine modified with a gene fragment (2A) of foot-and-mouth disease virus inserted between C and prM of yellow fever virus cDNA.

Figure 8 is a flow chart for the preparation of a SARS vaccine and a HBV vaccine containing a YFV subgenome. detailed description

After intensive and extensive research, the present inventors have developed a vaccine for preventing viral diseases (such as SARS). The vaccine is a genetic element that is inserted into the genome of the yellow fever virus with viral antigen polypeptides with release elements on both sides. Wherein the release element is a gene fragment (2A) of foot-and-mouth disease virus and / or a gene fragment of a signal peptide hydrolase substrate. When the expression module with the above structure is used, not only can the genetic elements of antigen polypeptides such as SARS virus and HBV be stably present in the genome of the yellow fever virus, but also the antigenicity can be effectively released when the yellow fever virus infects host cells Peptide, thereby effectively stimulating the immune response. The present invention has been completed on this basis. the term

As used herein, "genetic element of a foreign polypeptide" refers to a nucleic acid sequence encoding a foreign polypeptide.

As used herein, "exogenous polypeptide" refers to a polypeptide that is not encoded by the natural flavivirus genome, such as various antigens, epitopes, cytokines, growth factors, polypeptide hormones, enzymes, receptors, antibodies, and / or cancer-related protein. Particularly preferred exogenous polypeptides are SARS virus, HBV virus, HCV virus, antigen peptides of HIV virus, and cancer antigen polypeptides, especially those having a molecular weight of 1-200 Kda, preferably 10-150 Kda, more preferably 20-100 Kda or more. Antigen polypeptide. For example, "SARS antigenic polypeptide" means any polypeptide capable of eliciting an immune response against the SARS virus, Representative examples include S protein, N protein, and the like. The antigenic polypeptide may be a full-length protein or a fragment thereof. Antigenic polypeptides can be natural or mutated.

As used herein, "release element" refers to a nucleic acid sequence located on both sides of a genetic element of a foreign polypeptide, and is used to release a complete, foreign sequence without an unrelated sequence after translation into a protein together with the genetic element of the foreign polypeptide . The release element includes a 5 'end release element and a 3' end release element. The preferred 5 'and 3' end release elements are selected from the group consisting of: a nucleotide sequence encoding a foot-and-mouth disease virus autohydrolase represented by SEQ ID NO: 1, a nucleoside encoding a signal peptide hydrolase substrate represented by SEQ ID NO: 2: Acid sequences, and combinations thereof. There is usually one release element on either side of the antigenic gene element, but it may be plural.

As used herein, the term "exogenous polypeptide expression component" refers to a nucleic acid sequence having the following structure:

5'-end release element-a genetic element of a foreign polypeptide -3'-end release element The exogenous polypeptide expression component may not include a promoter, a start codon, and a stop codon. When the foreign polypeptide expression module is inserted into the yellow fever virus genome, it will express a large precursor protein together with the yellow fever virus nucleotide sequence. Then, during the post-processing of the precursor protein, the hydrolase enzyme digests the amino acid sequences encoded by the 5 'and 3' end release elements, thereby releasing exogenous polypeptides (such as SARS antigenic polypeptides).

The term "immune activity" or "immunogenicity" refers to the ability of natural, recombinant or synthetic peptides to induce specific humoral and / or cellular immune responses in mammals. The term "antigenic polypeptide" or "antigenic peptide" as used herein refers to an amino acid sequence that can elicit an immune response in a mammal, whether alone or in combination with a helper molecule (such as a major class I or II histocompatibility antigen molecule).

The term "immune response" as used herein includes cellular and / or humoral immune responses, which are sufficient to inhibit or prevent infection; or to prevent or suppress the onset of diseases caused by microorganisms, especially pathogenic microorganisms.

As used herein, the term "subject" or "individual" or "patient" refers to any target that requires diagnosis or treatment, especially mammalian subjects, especially humans. Other subjects include cattle, dogs, cats, guinea pigs, rabbits, large animals Rat, mouse, horse, etc. Of particular interest are those who are susceptible to flaviviruses (such as yellow fever virus), such as those that can support yellow fever virus replication.

A "biological sample" includes a variety of sample types obtained from an organism and used for diagnostic or monitoring analysis. The term includes blood and other biological liquid samples, solid tissue samples (such as biopsy samples or tissue cultures or cells derived from them and their progeny). The term includes samples that are manipulated by any method after purchase, such as treatment with reagents, solubilization, or enrichment of certain components. The term includes clinical samples and also includes cell cultures, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples. Recombinant yellow fever virus vector

Nucleotide sequences of several YFV strains are available from public databases, including, for example, GenBank. The model strain is "YFV 17D". The nucleotide sequence of the YFV genome and the amino acid sequence that can encode the viral polyprotein can be obtained at GenBank accession number X03700. The production of yellow fever virus particles is well known in the art.

The YFV genome according to the present invention may be a whole genome or a sub-genome in which a part of a nucleic acid sequence is deleted. In one embodiment of the present invention, the YFV genome is a whole genome. In another embodiment of the present invention, the YFV genome is a subgenome in which a part of a structural protein gene sequence is deleted, wherein the deletion is The structural protein gene sequence is selected from the following genes: protein C, prM protein, protein E, or a combination thereof.

In the present invention, the exogenous polypeptide expression components may be located at different sites in the yellow fever virus genome. As a non-limiting example, a foreign nucleic acid sequence can be inserted into one or more of the following positions: (1) the N-terminus of a viral polypeptide; (2) between the viral proteins C and prM; (3) the viral proteins NS2A and NS2B (4) between the viral proteins NS2B and NS3; (5) between the viral proteins NS3 and NS4A; (5) between NS4A and NS4B; (6) between the E coding region and the NS1 coding region. Exogenous nucleic acid can be inserted into other sites of the yellow fever virus genome. Preferably, the insertion of the exogenous nucleic acid does not disrupt the function of the yellow fever virus protein, and / or the proteolytic processing of the viral polypeptide, and / or the replication of the virus.

Taking the SARS antigenic polypeptide as an example, when the yellow fever virus vector of the present invention is used to infect a host cell, the recombinant yellow fever virus encodes a recombinant polyprotein precursor containing the antigen polypeptide of the SARS coronavirus. The recombinant polyprotein precursor is processed by 2A autohydrolase and / or signal peptide hydrolase to release the antigenic peptide of SARS coronavirus. Infecting host cells with the recombinant yellow fever virus, the coding sequence of the SARS coronavirus antigenic polypeptide can be provided in the host cell, and the corresponding antigenic polypeptide can be generated, thereby triggering an immune response against the SARS coronavirus antigen polypeptide. Therefore, the recombinant yellow fever virus vector of the present invention can be used as a vaccine for preventing SARS.

Unlike other vectors that can produce only one round of antigenic virus expression and / or other vectors that stop expression, the active recombinant virus of the present invention will continue to multiply until the immune system is sufficiently activated to stop the infection. This results in a stronger immune response (against the SARS antigenic peptide) than an immune response elicited with a conventional expression vector such as a viral replicon. Pharmaceutical composition

The present invention also provides various compositions including the recombinant yellow fever virus of the present invention, including pharmaceutical compositions, especially vaccine compositions.

Various compositions containing the recombinant yellow fever virus of the present invention may contain a buffer selected according to the actual use of the recombinant yellow fever virus; it may also contain other substances suitable for the intended use. Those skilled in the art are good at selecting buffers, and a variety of buffers are known in the art to be suitable for the intended use. In some examples, the composition may contain pharmaceutically acceptable excipients, many of which are known in the art and need not be discussed in detail herein. Various pharmaceutically acceptable excipients have been detailed in various publications, including, for example, "Remington: Pharmacy and Pharmaceutical Practice", 19th Edition (1995) Mack Publishing Co.

The pharmaceutical composition can be prepared into various dosage forms, such as injections, granules, tablets, pills, suppositories, capsules, suspensions, sprays, suppositories, transdermal drugs (such as patches, etc.), ointments, lotions, etc. . Pharmaceutical grade organic or inorganic carriers and / or diluents suitable for oral or topical use can be used to formulate various compositions containing therapeutically active compounds. Diluents known in the art include aqueous media, vegetable and animal oils and fats. Stabilizers, wetting agents and emulsifiers, salts that change the osmotic pressure or various buffers to maintain a suitable pH value, and skin penetration enhancers can also be used as auxiliary materials.

When used as a vaccine, the recombinant yellow fever virus of the present invention can be formulated by various methods. Generally, the vaccines of the present invention are formulated in a variety of methods well known in the art using suitable pharmaceutical carriers and / or vehicles. A suitable carrier is sterile saline. Other aqueous and non-aqueous isotonic sterile injections can be used for this purpose as well as aqueous and non-aqueous Sterile suspension (known as pharmaceutically acceptable carriers well known to those skilled in the art).

In addition, the formulation of the vaccine composition of the present invention may also contain other ingredients, including, for example, adjuvants, stabilizers, pH regulators, preservatives, and the like. These ingredients are well known to those skilled in the vaccine art. Adjuvants include (but are not limited to) aluminum salt adjuvants; saponin adjuvants; Ribi adjuvants (Ribi Chem Research In., Hamilton, MT); Montanide ISA adjuvants (Seppic, Paris, France); Hunter 's TiterMax (CytRx Corp., Norcross, GA); Gerbu adjuvant (Gerbu Biotechnik GmbH, Gaiberg, Germany) and the like. In addition, other ingredients that modulate the immune response may be included in the formulation. Route and dosage

When used as a vaccine, the recombinant yellow fever virus of the present invention can be administered to an individual by a known method. These vaccines are usually administered using the same route of administration as conventional vaccines and / or mimicking pathogen infection routes. When a vaccine composition can be used, a pharmaceutically acceptable carrier can be included in addition to the recombinant YFV virus. In addition, such a composition may include an adjuvant, a flavoring agent, or a stabilizer.

Conventional and pharmaceutically acceptable routes of administration include: intranasal, intramuscular, intratracheal, subcutaneous, intradermal, pulmonary, intravenous, nasal, oral, or other parenteral routes of administration. If desired, the route of administration can be combined or adjusted according to the antigenic peptide or disease condition. The vaccine composition may be administered in a single dose or multiple doses, and may include administering booster doses to elicit and / or maintain immunity.

The recombinant yellow fever virus vaccine should be administered in an "effective amount", that is, the amount of recombinant yellow fever virus in the chosen route of administration is sufficient to elicit an immune response, which can effectively promote protection of the host against SARS virus infection or SARS symptoms.

The amount of recombinant yellow fever virus used in each vaccine dose is determined based on the amount that can elicit an immune protective response without significant side effects. Generally, after infecting a host cell, each dose of the vaccine is sufficient to produce about 1-1000 μ _§ , preferably 1- 200 μ, more preferably 10-100 μ _§ protein. Recombinant nucleic acid of yellow fever virus vaccine based on the calculated effective dose generally comprise administration of about 1- 100 (g Further nucleic acid, typically an effective dosage range of yellow fever virus recombinant Phytophthora acres of about ¹⁰² - ^107, 10 ^{^3--106} or ^{^104--105} plaque forming units (PFU) is available comprises the antibody titer observed object and other reaction criteria method to determine the optimum amount for a particular vaccine can be provided by monitoring vaccines. Strength level to determine if a booster dose is needed. After assessing antibody titers in the serum, booster dose immunization may be required. Adjuvants and / or immunostimulants can be used to increase the immune response to the protein of the invention. Technically speaking, the main advantages of the present invention are:

(1) Good safety. As a vector virus, yellow fever virus is a standard safe vaccine recognized by the WHO. It has been used for nearly 70 years, and the incidence of side effects is close to 1 in 10 million.

(2) Good immune effect. A few days of vaccination can be effective and maintain immunity for a long time (usually more than 10 years).

(3) There is no yellow fever virus antibody in the Chinese body, which basically does not affect the effectiveness of the vaccine.

(4) Suitable for production. The production process and quality standards are easy to establish, and the existing facilities are used for production. The production cost is low.

(5) The release element of the present invention has a higher release efficiency for long exogenous polypeptides, and can bind to 500 amino acids or longer of exogenous polypeptides in combination with YFV in which some structural genes are deleted. The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are indicated, 'generally according to conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturing conditions Conditions recommended by the manufacturer. Example 1

Preparation of full-length cDNA clone of yellow fever virus vaccine

The construction process is shown in Figures 1, 2, and 3-1. The full-length yellow fever virus vaccine cDNA was integrated into the pRS424 plasmid (Plasmid), and the yellow fever virus vaccine Yel low Fever virus Strain 17D ( YF 17D) and pRS42 plasmid (ATCC #: 77105) were purchased from the American Type Culture Collection (ATCC).

a) The RT-PCR method was used to convert the RNA of yellow fever virus YF 17D into three sections of yellow fever virus cDNA fragments (5 'end cDNA, 3' end cDNA and middle cDNA). Add the Not I digestion site and Sp6 enhancer sequence at the 5 'end; the EcoR I digestion site of the YF cDNA at the 3' end of the 5 'end cDNA fragment; add Xho at the 3' end of the 3 'end fragment I Restriction site; both ends of the middle fragment include the same gene sequence as the 3 'end of the 5' end cDNA fragment and the 5 'end of the 3' end cDNA fragment.

b) Obtain three yellow fever virus fragments with lengths of 2280bp, 6130bp, and 2580bp.

c) The 5 'end fragment was cloned into the pRS424 plasmid by ligation.

d) using the same sequence of DNA recombination in yeast, inserting the intermediate fragment cDNA into the above clones to generate a full-length yellow fever virus cDNA clone. Example 2

Preparation of a SARS vaccine modified with a foot and mouth disease gene fragment (2A) inserted between the NS2B and NS3 of the yellow fever virus cDNA (the insertion site is 4572-4573 nt of the yellow fever virus genome)

The construction process is shown in Figure 4.

1. The full-length yellow fever virus cDNA clone obtained in Example 1 was cut with a Kpn I endonuclease and Nhe I endonuclease to a about 2.2 kb long fragment, which includes the yellow fever virus cDNA sequence. 3445-5576 bases.

2. Using yellow fever virus cDNA clones as templates and GGATACAAGGTTCAGACGAAC (SEQ ID NO: 10) And AACCATCGATTCGGGGCCAGGGTTGGACTCGTCTCCCGCAAGCTTAAGAAGGTCA AAATTCAACAGCTGCA TATGCCACAAGACATCCCCACTTCTC (SEQ ID NO: 11) as a pair of primers; and AACCCTGGCCCCG

AATCGATGGTTCGAGGCGCGCGCGACGCAGCGGTGACGTACTCTGGGATAT TCCCACTCCTAAGATCATC (SEQ ID NO: 12; ^ n CGCTGCCCAACCTCTAGCGCGGC (SEQ ID NO: 13)) is another pair of primers, and then two DNA fragments are generated by the PCR method, and a 2A gene sequence is introduced therein. The gene sequence is a gene fragment of foot-and-mouth disease virus, which consists of sixty bases, and its nucleotide sequence is shown in SEQ ID NO: 1. Then, the two DNA fragments are ligated into NS2B and NS3 by fusion PCR. The gene contains a 2A DNA fragment of foot-and-mouth disease virus, and the 5 'and 3' ends include a DNA sequence of approximately 50 bp, which is identical to the adjacent sequences of the cleavage site of Kpη I and the site of Nhe I restriction.

3. The about 2 kb long yellow fever virus cDNA fragment and the DNA fragment generated in step 2 were cut out in step 1 to transform yeast, and during the DNA replication process of yeast, the above fragments Ability to automatically integrate to produce recombinant yellow fever virus cDNA.

4. DNA plasmids B21 and H21 containing the S1 gene of SARS coronarivus are available from Briti sh Columbia Cancer Agency, Canada. The full sequence of the SI gene is shown in SEQ ID NO: 3.

ATTTTCTTATTATTTCTT (SEQ ID NO: 14) and GGTGGGGTGCAAGGTTTGCCATCA (SEQ ID NO: 15) were used as primers, and a DNA plasmid B21 was used as a template to generate a partial DNA fragment at the 5 'end of the SARS coronavirus S1 antigen by PCR. Using CCTTTGAGAGAGACATATCTAATG (SEQ ID NO: 16) and GGGGCCAGGGTTGGAC N0: 17) as primers and DNA plasmid H21 as a template, a PCR method was used to generate a partial DNA fragment at the 3 'end of the SARS coronavirus S 1 antigen. The above two DNA fragments were ligated into a complete SI DNA fragment (SARS coronavirus-SI-2A) by a fusion PCR method, and the 5 'end and 3' end included a 2A sequence.

5. Linearize the recombinant yellow fever virus cDNA generated in step 3 with AIIII endonuclease.

6. The linearized recombinant yellow fever virus cDNA and the SARS coronavirus-SI-2A fragment generated in step 4 were used to transform yeast. During the DNA replication process of yeast, SARS coronavirus-S1-2A The fragments can be automatically integrated to produce recombinant yellow fever virus (referred to as recombinant yellow fever virus, rYFV) cDNA.

7. Linearize the recombinant yellow fever virus cDNA generated in step 6 with Xhol endonuclease.

8. Transcribe the linearized recombinant yellow fever virus cDNA into RNA using DNA dependent Sp6 RNA polymerase.

9. Transfection of recombinant yellow fever virus RNA into host cells using el ectroporation BHK-

21 (Baby hamster kidney) (purchased from American Type Culture Collection (ATCC), ATCC #: CCL_10). Supernatants were collected after 7-10 days to obtain recombinant yellow fever virus particles (rYFV). Example 3

Preparation of a SARS vaccine modified with a foot-and-mouth disease gene fragment (2A) inserted between the E and NS1 of the yellow fever virus cDNA (the insertion site is 2453-2454 nt of the yellow fever virus genome)

The construction process is shown in Figure 5. 1. Cut out a full-length yellow fever virus cDNA clone with Pst I to remove a fragment about lkb long. This fragment includes positions 1959-2782 of the yellow fever virus cDNA sequence.

2. Using the yellow fever virus cDNA clone as a template, use GTCAAGAACCCAACTGACACT (SEQ ID NO: 18) and AAGGTCAAAATTCAACAGCTGAAAGAAGATGGCGCATCCTTG (SEQ ID NO: 19) as a pair of primers; and

GTCCATGAGC (SEQ ID NO: 20) and CCAGACCCGGTTTGAAAACGG (SEQ ID NO: 21) are another pair of primers, and then two DNA fragments are generated by PCR, and a 2A gene sequence is introduced thereinto, and the 2A gene sequence is Is a gene fragment of foot-and-mouth disease virus (SEQ ID NO: 1). Then the two DNA fragments were ligated by fusion PCR to generate a 2A DNA fragment containing foot-and-mouth disease virus between the E and NS1 genes. The 5 'and 3' ends of the DNA fragment contained approximately 50 bp of the sequence and Pst I, respectively. Adjacent sequences are the same.

3. Use the yellow fever virus cDNA fragment from step 1 in which the approximately 1 kb long fragment was cut out and the DNA fragment generated in step 2 to transform the yeast. During the DNA replication process of the yeast, the above fragments can be automatically Integration produces recombinant yellow fever virus cDNA.

4. Obtain the complete SI DNA fragment (SARS coronavirus-SI-2A) in the same manner as in step 4 of Example 2. The 5 'and 3' ends of the SI DNA fragment include the 2A sequence.

5. Linearize the recombinant yellow fever virus cDNA generated in step 3 with Af 1 II endonuclease.

6. The linearized recombinant yellow fever virus cDNA and the SARS coronavirus-S1-2A fragment generated in step 4 were used to transform yeast. During the DNA replication process of the yeast, SARS coronavirus-S 1-2A The fragments can be automatically integrated to produce recombinant yellow fever virus cDNA.

8. Transcribe linearized recombinant yellow fever virus cDNA into RNA using DNA-dependent Sp6 RNA polymerase.

9. Transfect the recombinant yellow fever virus RNA into host cell BHK-21 (ATCC #: CCL-10) by electroporation.

The supernatant was collected after 7-10 days to obtain recombinant yellow fever virus particles. Example 4

Preparation of a SARS vaccine modified with a gene fragment of foot-and-mouth disease virus (2A) inserted between E and NS1 of yellow fever virus cDNA and a signal peptide hydrolase substrate (insertion site of the yellow fever virus genome 2453- 2454nt)

The construction process is shown in Figure 6.

1. Cut out a full-length yellow fever virus cDNA clone with Pst I and cut a fragment of about 1 kb in length. This fragment includes the yellow fever virus cDNA sequence 1959-2782.

2. According to the same method as in step 2 of Example 3, a 2A DNA fragment containing foot-and-mouth disease virus between the E and NS1 genes was obtained. The 5 'and 3' ends of the DNA fragment contained approximately 50 bp of sequences adjacent to Pst I, respectively. the same.

4. Take AGCATGATCTTGGTAGGAGTGATCATGATGTTTTTGTCCACAAGCCCAAGCCAGTG ACCTTGACCGGTGCACCACT (SEQ ID NO: 22) and GGTGGGGTGCAAGGTTTGCCATCA (SEQ ID NO: 14) were used as primers and DNA plasmid B21 was used as a template to generate a partial DNA fragment at the 5 'end of the SARS coronavirus S1 antigen by PCR, and at the 5' end The gene fragment sequence of the modified signal peptide hydrolase substrate is inserted (ie, positions 40-54 in SEQ ID NO: 22, and the coding sequence is the signal peptide hydrolase substrate shown in SEQ ID NO: 2);

CCTTTGAGAGAGACATATCTAATG (SEQ ID NO: 16) and GGGGCCAGGGTTGGACTCGACGTCTCCC

GCAAGCTTAAGCAGATCGAAGTTCAGGAGTTGCTCAGCTCCTATAAGACAGCC (SEQ ID NO: 17) was used as a primer. Using the DNA plasmid H21 as a template, a PCR method was used to generate a partial DNA fragment at the 3 'end of the SARS coronavirus S1 antigen. The above two DNA fragments were ligated into a complete SI DNA fragment (SARS coronavirus-S1-2A) by the method of PR fusion, and the 5 'end of the protein included the 3' end of the protein E of the yellow fever virus and the modified A signal peptide hydrolase substrate gene fragment whose 3 'end includes a 2A sequence.

5. Linearize the recombinant yellow fever virus cDNA generated in step 3 with Afl II endonuclease.

6. The linearized recombinant yellow fever virus cDNA and the SARS coronavirus-SI-2A fragment generated in step 4 were used to transform yeast. During the DNA replication process of the yeast, the SARS coronavirus-SI-2A fragment Ability to automatically integrate to produce recombinant yellow fever virus cDNA.

9. Transfect the recombinant yellow fever virus RNA into host cells BHK-21 (ATC (¾: CCL-10) by electroporation. Collect the supernatant after 7-10 days to obtain the recombinant yellow fever virus Granules Example 5:

Preparation of SARS vaccine modified by foot and mouth disease gene fragment (2A) with insertion site between C and prM of yellow fever virus cDNA (insertion site is 482-483nt of yellow fever virus genome)

The construction process is shown in Figure 7.

1. Cut out a full-length yellow fever virus cDNA clone with Bsm I to a fragment of about 1 kb. This fragment includes the yellow fever virus cDNA sequence 458-1514.

2. Using the yellow fever virus cDNA clone as a template, use GCCAGTTTGATGAGAGGATTG (SEQ ID NO: 23)

ACAG (SEQ ID NO: 24) is a pair of primers; and GGAGACGTCGAGTCCAACCCTGGCCCCTCCCATGATGTTC TGACTGTG (SEQ ID NO: 25) and CTCTCTCCACACCCCGCCACT (SEQ ID NO: 26) are another pair of primers, and then two DNA fragments are generated by PCR method, A 2A gene sequence was introduced therein (SEQ ID NO: 1). Then, the two DNA fragments were ligated by fusion PCR to generate a 2A DNA fragment containing foot-and-mouth disease virus between the C and prM genes. The 5 'and 3' ends of the DNA fragment contained approximately 50 bp of sequences and Bsm I, respectively. Adjacent sequences are the same.

3. The about 1 kb yellow fever virus cDNA fragment and the DNA fragment generated in step 2 were used to transform the yeast described in step 1. During the DNA replication process of the yeast, the above fragments can Automatic integration produces recombinant yellow fever virus cDNA.

4. TTCCTAATTTTGGGAATGCTGTTGATGACGGGTGGAGTGAGTGACCTTGACC

GGTGCACCACT (SEQ ID NO: 27) and GGTGGGGTGCAAGGTTTGCCATCA (SEQ ID NO: 28) were used as primers. DNA plasmid B21 was used as a template, and a partial DNA fragment at the 5 ′ end of the SARS coronavirus S1 antigen was generated by PCR. Using the CCTTTGAGAGAGACATATCTAATG (SEQ ID NO: 16) and GGGGCCAGGGTTGGACTCGACG primers and the DNA plasmid H21 as a template, a PCR method was used to generate a partial DNA fragment at the 3 ′ end of the SARS coronavirus S 1 antigen. The above two DNA fragments were ligated into a complete SI DNA fragment (SARS coronavirus-SI-2A) by a fusion PCR method, and the 5 'end thereof includes the 3' end sequence of protein C of the yellow fever virus. The 3 'end includes a 2k sequence.

5. Linearize the recombinant yellow fever virus cDNA generated in step 3 with Afl I I endonuclease.

6. The linearized recombinant yellow fever virus cDNA and the SARS coronavirus-S1-2A fragment generated in step 4 were used to transform yeast. During the DNA replication process of the yeast, the SARS coronavirus-S1-2A fragment Ability to automatically integrate to produce recombinant yellow fever virus cDNA.

9. Transfect the recombinant yellow fever virus RNA into host cell BHK-21 (ATCC #: CCL-10) by electroporation. After 7-10 days, the supernatant was collected to obtain recombinant yellow fever virus particles. Example 6:

Preparation of recombinant YFV subgenome

In this example, a cDNA clone from which the YFV structural protein C sequence is removed is prepared.

1. The recombinant yellow fever virus cDNA clone containing the SARS coronavirus-S1 sequence obtained in Example 5 was cut into linearity with Not I.

2. Using a conventional fusion PCR method, a 384 bp base DNA fragment was prepared, which corresponds to the yellow fever virus structural protein C gene but the nucleotide sequence at positions 179-409 was deleted.

3. The linear recombinant flavivirus cDNA and 384bp cDNA fragment were transformed into yeast (ATCC 76628) to obtain a recombinant flavivirus cDNA clone (A C rYFV cDNA) from which the C sequence of the YFV structural protein was removed.

4. Linearize the A C-rYFV cDNA produced in step 3 with a Kpn I endonuclease.

5. Using DNA dependent Sp6 RNA polymerase (DNA dependent Sp6 RNA polymerase) to transcribe the linearized Δ C rYFV cDNA into RNA, namely Δ C- rYFV RNA. Example 7:

Preparation of SARS vaccine containing YFV subgenome

See Figure 8.

1. Using pCI (purchased from PROMEGA, USA) as a template and using and as primers to prepare a CMV (cytomegalovirus, cytomegalovirus) DNA fragment (referred to as CMV) by PCR. CMV acts as an early enhancer and promoter and has a length of 631 bp. Using the full-length flavivirus cDNA clone obtained in Example 1 as a template, and f 17 = Τ5 / ^ and-? 'R / ^^ OTi as primers, the 5' end fragment of YFV cDNA (referred to as YFV5 for short) was prepared by PCR. 'end). A DNA fragment of CMV-YFV 5 'end (referred to as CMV-YFV 5' end) was prepared by using the two DM fragments as a template and 5 'CMV ^ · T W ^ eW as primers by the method of fusing PC. 2004/000845

2. The CMV-YFV 5 'end produced in step 1 and pRS424 plasmid (ATCC # _: 77105) were digested with Not I and Apa I. The digestion product was purified using a Qiagen spin column (available from QIAGEN Inc.). The above two DNA fragments were ligated with T4 ligase (purchased from New England Bio lab) and transformed into E. coli. CMV-YFV 5 'end clone (pRS / CMV-YFV 5' end) was obtained by screening.

3. Using the full-length flavivirus cDNA obtained in Example 1 as a template, and ^ We ^ and 3 'YFV3' c as primers, a 3 'end fragment of the YFV cDNA (referred to as YFV 3' end) was prepared by PCR. Using 5 '© Kr and 3, HDVr as primers, a DNA fragment (HDVr) of hepatitis delta virus antigenomic ribozyme (HDVr) was prepared by fusion PCR method. Using pcDNA3 (purchased from Invitrogen) as a template and> 1 and 3 ′ ^ as primers, a PCR method was used to prepare a bovine growth hormone poly A (bovine growth hormone poly A (BGH pA)) DNA fragment (referred to as pA). Using the above three fragments as a template, ^ Ke and primers as primers, a MA fragment of YFV 3 'end- HDVr- pA was prepared by fusion PCR method.

4. Digest the DNA fragments of pRS / CMV-YFV5 'end generated in step 2 and YFV3' end- HDVr- pA generated in step 3 with Pral I and Sac II, and purify the digestion product with Qiagen spin column. The two DNA fragments were ligated with T4 ligase and transformed into E. coli. The clones of pRS / CMV- YFV5 'end- YFV3' end- HDVr- pA were obtained by screening.

5. Digest the pRS / CMV-YFV5 'end- YFV3' end-HDVr-pA clone generated in step 4 with Pml I, and use the Notl and Kpn I clones for the full-length yellow fever virus cDNA clone obtained in Example 1. Digestion. The above-mentioned digested product was purified, and the purified product was transformed into Saccharomyces cerevisiae, and DNA with the same sequence in yeast was used to recombine to obtain a modified full-length YFVcDNA clone (referred to as pRS / CMV / YFV).

6. Digest the pRS / CMV / YFV generated in step 5 with Stu 1 to obtain a linear pRS / CMV / YFV clone. And TGTTTCACCGCTGTCATTCAAGATCTCATGTTCCTCAGG (SEQ ID NO: 38) as primers, and a fusion PCR method was used to generate a 78 bp DNA fragment with the sequence:

ACA (SEQ ID NO: 39). Transform the linear pRS / CMV / YFV clone described above with a 78bp DNA fragment To yeast (ATCC 76628), the DNA sequence of the same sequence in yeast was used to recombine part of the YFV NS3 coding region gene sequence (nt 5126-6280) in the linear pRS / CMV / YFV clone to obtain NS3 deleted YFV cDNA clone.

The NS3 deleted YFV cDNA clone and pcDNA3 (purchased from INVITROGEN) generated in step 6 above were simultaneously transfected with BHK- 21 cel l (ATCC #: CCL-10). O After the cells were cultured for one day, they were converted to cells containing G418 (purchased from SIGMA). ) Cell culture fluid. The AC rYFV RNA obtained in Example 6 was used to transform an anti-G418 cell line, and a packaging cell line was selected. The production cell line may reach ¹⁰⁶ per ml recombinant yellow fever virus particles (A C- rYFV), i.e. SARS vaccine. Example 8

Preparation of a foot-and-mouth disease gene fragment (2A) modified HBV vaccine with insertion point between NS2B and NS3 of yellow fever virus cDNA (insertion site is 4572-4573nt of yellow fever virus genome)

Steps 1-9 of Example 2 were repeated, except that the SARS antigen polypeptide was replaced with the HBV antigen polypeptide. Specifically, in step 4, CAGCTGTTGAATTTTGACCTTCTTAAGCTGGCCGGCGATGTGGAAT

CAAATCCCGGGCCTATGGAGAACATCACATCAGGATTC (SEQ ID NO: 40) and GGGGCCAGGGTTGGA

No. 41) is a primer, using a DNA plasmid (ATCC 45020D) of the HBV surface antigen (HBVsAg) gene as a template, and a HBVsAg DNA fragment (HBVsAg-2A) is generated by a conventional PCR method, and the 5 'end and the 3' end include 2A the sequence of.

As a result, a recombinant yellow fever virus particle (rYFV) was obtained, in which a HBVsAg gene was inserted between NS2B and NS3 of the yellow fever virus cDNA. Example 9

Preparation of a HBV vaccine modified with a foot-and-mouth disease gene fragment (2A) inserted between the E and NS1 of the yellow fever virus cDNA (2453-2454 nt of the yellow fever virus genome)

Steps 1-9 of Example 3 were repeated, except that the SARS antigen polypeptide was replaced with the HBV antigen polypeptide. Specifically, in step 4, the HBVsAg DNA fragment (HBVsAg-2A) was obtained in the same manner as in step 7 of Example 7, and the 5 'end and the 3' end included a 2A sequence.

As a result, a recombinant yellow fever virus particle (rYFV) was obtained in which a HBVsAg gene was inserted between E and NS1 of the yellow fever virus cDNA. Example 10

Preparation of a HBV vaccine modified with a gene fragment of foot-and-mouth disease virus (2A) and a signal peptide hydrolase substrate inserted between the E and NS1 of the yellow fever virus cDNA (insertion site of the yellow fever virus genome 2453-2454nt)

The steps 1-9 of Example 4 were repeated, except that the SARS antigen polypeptide was replaced with the HBV antigen polypeptide. Specifically, in step 4, use AGCATGATCTTGGTAGGAGTGATCATGATGTTTTTGTCTCCACAAGCCCAAGCCAT GGAGAACATCACATCAGGATTC (SEQ ID NO: 42) and GGGGCCAGGGTTGGACTCGACGTCTCCCGCAAG CTTAAGCAGATCGAAGTTCAGGAGTTGAATGTATACCCAAAGACAIDGAAAAGAAAACATACAGAGACATCA The HBV surface antigen (HBVsAg) gene DNA plasmid (ATCC # 45020D) is used as a template, and the HBVsAg DNA fragment (HBVsAg-2A) generated by PCR method includes the 3 'end sequence of protein E of yellow fever virus And the modified signal peptide hydrolase substrate gene fragment (encoding the signal peptide hydrolase substrate as shown in SEQ ID NO: 2), the HBVsAg DNA fragment generated by PCR includes a 2k sequence at the 3 'end.

As a result, a recombinant yellow fever virus particle (rYFV) was obtained in which a HBVsAg gene was inserted between E and NS1 of the yellow fever virus cDNA. Example 11:

Preparation of a HBV vaccine modified with a gene fragment of foot-and-mouth disease virus (2A) and a signal peptide hydrolase substrate with insertion sites between C and prM of yellow fever virus cDNA (insertion site of the yellow fever virus genome (482-483nt) The steps 1-9 of Example 5 were repeated, except that the SARS antigen polypeptide was replaced with the HBV antigen polypeptide, and the 3-terminal release element was a gene fragment of a signal peptide hydrolase substrate. Specifically, in step 4, the and GGGGCCAGGGTTGGACTCGACGTCTCCCGCAAGCTTAAGCAGATCGAAGTTCAGGAGTT

GAATGTATACCCAAAGACAAAAGAA (SEQ ID NO: 41) was used as a primer. The HBV surface antigen (HBVsAg) gene

A DNA plasmid (ATCC # 45020D) was used as a template, and the HBVsAg DNA fragment (HBVsAg-2A) generated by PCR was used. Its 5 'end included the 3' end of protein C of the yellow fever virus and a modified signal peptide hydrolase. A substrate gene fragment whose 3 'end includes a 2A sequence.

As a result, a recombinant yellow fever virus particle (rYFV) was obtained in which a HBVsAg gene was inserted between C and prM of the yellow fever virus cDNA. Example 12:

Preparation of recombinant YFV subgenome

The steps 1-5 of Example 6 were repeated, except that the recombinant yellow fever virus cDNA clone containing the SARS coronavirus-S1 sequence was replaced with the recombinant yellow fever virus cDNA clone containing the HBsAg gene sequence. Specifically, in step 1, the cDNA clone of the recombinant yellow fever virus containing the HBsAg gene sequence obtained in Example 11 was cut into linearity with Acl I.

As a result, a cDNA clone (Δ C-rYFV cDNA) from which the Y sequence of the structural protein of YFV was removed was obtained, which contained the gene sequence of HBsAg, and Δ Ο rYFV RM was obtained. Example 13:

Preparation of HBV vaccine containing YFV subgenome

Steps 1-6 of Example 7 were repeated. Then, the ΔC rYFV RNA obtained in Example 12 was used to transform the anti-G418 cell line obtained in Example 7 to obtain a packaging cell line. The yield of this cell line can reach 10 ⁵ recombinant flavivirus particles (ΔC-rYFV) per ml, which is the HBV vaccine. Example 14:

Mouse anti-SARS coronavirus IgG detection

In this example, the immunogenicity of the recombinant yellow fever virus particles (SARS coronavirus vaccine) prepared in Examples 2-5 and 7 was tested, and mouse anti-SARS coronavirus IgG detection was performed. The method is as follows-1. A total of 16 BALB / c mice were randomly divided into two groups of 8 mice each. A subcutaneous injection set 10 ⁵ PFU recombinant flavivirus particle (0. 5ml), the group two injections 10 ⁵ PFU 17D yellow fever virus vaccine (0. 5rnl, as a control) immunized mice. Blood was collected from the orbits of the mice on day 0, day 7, day 14, day 21, and day 28 after injection, and the serum was stored at -70 ° C.

2. Enzyme-linked plate coated with S300 antigen (S300 is amino acid 14-313 of SARS coronavirus S protein, which is transformed by transforming the S300 expression plasmid into E. coli, expressing the S300 protein fragment, and purified by Ni-NTA affinity resin Go>.

3. The serum to be tested is diluted 1:50. Add 100 μl of the diluted serum sample to each well, incubate for 1 h at 37 ° C, wash the plate 6 times, and add enzyme-labeled antibody (HRP-goat anti-mouse IgG, 1: 1000) to each well. (Dilution) 100 microliters, incubate at 37 ° C for 45min, add TMB / H202 to develop color, and then stop the reaction with sulfuric acid to measure A450 / A630 with a microplate reader.

4. Judgment criteria: The average value of serum A450 / A630 of mice from the recombinant yellow fever virus particle immunization group and the control 17D yellow fever virus vaccine group is greater than or equal to 2.1, and the antibody test is positive.

The test results are as follows:

Time (days) 0 7 14 21 28

17D-YFV (control) 0.07 0. 11 0. 12 0. 14 0. 15 rYFV (SARS vaccine of Example 7) 0. 06 0. 18 0. 32 0. 43 0. 51 Mean ratio T 0. 9 1. 6 2. 7 3. 1 3. 4 The results showed that anti-SARS antibodies were produced on the 14th day. The SARS vaccine of Examples 2-5 also produced anti-SARS antibodies on the 14th day (the ratio T on the 14th day ranged from 2. 2 to 2. 6). Example 15:

Mouse anti-HBs IgG test

In this example †, the immunogenicity of the recombinant yellow fever virus particles (HBV vaccine) prepared in Examples 8-11 and 13 was tested, and a mouse anti-HBs IgG test was performed. Enzyme immunoassay of Shanghai Kehua Biological Engineering Co., Ltd. was used to detect the HBsAg kit to determine the titer of anti-HBs IgG in serum samples. The test method is as follows:

1. Eight BALB / c mice were randomly divided into two groups of four. A group intramuscularly in the left anterior tibialis 10 ⁵ PFU recombinant flavivirus particle (0. 5π), two groups injected 10 ⁵ PFU 17D yellow fever virus vaccine (0. 5ml) immunized mice. After 2 weeks, boost the immunity once, the same dose as the first time. The mice were observed every day after immunization, and the eyeballs were removed and blood was taken 3 weeks after the booster injection, and the serum was separated and placed at -20'C for inspection.

2. The serum to be tested is diluted 1:50, and 50 μl of the serum sample is added to each well, and the positive and blank controls are set.

3. Add 1 drop of enzyme conjugate to each well (except the blank control well), mix well, seal the plate, and incubate at 37C for 30 minutes.

4. Wash the plate 6 times, and add 1 drop of each of the developer A and B solutions to each well, mix thoroughly, and incubate at 37C for 15 minutes. 5

5. Determine the A450 / A630 with a microplate reader after the sulfuric acid termination reaction.

6. Judgment criteria: The average value of serum A450 / A630 in mice from the recombinant yellow fever virus particle immunization group and the control 17D yellow fever virus vaccine group is greater than or equal to 2.1, and the antibody test is positive.

The test results are as follows:

Time (days) 0 14 35

17D-YFV (control) 0. 01 0. 06 0. 12

rYFV (HBV vaccine of Example 13) 0. 01 0. 07 0. 35

The average ratio T 1. 0 1. 2 2. 9 The results showed that anti-HBs was produced on the 35th day. The HBV vaccines of Examples 8-11 also produced anti-HBs on day 35 (the ratio T on day 35 ranged from 2.1-2. 8).

After 4 weeks of immunization with recombinant yellow fever virus particles (HBV vaccine), blood was collected, serum was separated, and the average geometric titer of anti-HBs was determined to be 650 mIU / ml. Example 16: Determination of yellow fever virus neutralizing antibodies

Yellow fever virus neutralizing antibodies were measured using a plaque reduction test. The sera of mice immunized with recombinant yellow fever virus particles (SARS vaccine), recombinant yellow fever virus particles (HBV vaccine), and 17D yellow fever virus vaccine (control) in Examples 14, 15 were collected for 7 days. The three groups of serum were mixed with the diluted yellow fever virus strain (about 200PFU / 0.4ral) in equal amounts. At the same time, the diluted virus was diluted 1: 2 as a virus control and placed in a 37 ° C water bath for 90 minutes. BHK21 cells were inoculated in a 6-well plate, 0.4 ml per well, and incubated at 37 ° C for 90 minutes. A methyl cellulose-containing medium cover was added, and incubated in a CO ₂ incubator for 5 days. Staining, plaque count, and calculation of serum etch Neutralizing titer of plaque reduction, of which the average number of plaques in the virus control group is 80, the neutralizing titer of the antibody against recombinant yellow fever virus particles (SARS vaccine) is 1: 20, and the recombinant yellow fever virus particles (HBV vaccine The neutralizing titer of the antibody is 1:20, and the neutralizing titer of the 17D yellow fever virus vaccine (positive control) is 1:20.

This shows that, like the 17D yellow fever virus vaccine, recombinant yellow fever virus particles (SARS vaccine and HBV vaccine), the antibodies produced after immunizing animals can effectively neutralize the yellow fever virus antigen and are therefore safe. All documents mentioned in the present invention are incorporated by reference in this application, as if each document was individually incorporated by reference. In addition, it should be understood that after reading the above-mentioned teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

Rights request

A yellow fever virus vector, characterized in that an exogenous polypeptide expression component is inserted into the genome of the yellow fever virus, and the expression component has the following elements in order from 5 'to 3':

(a) a 5 'end release element, the 5' end release element is selected from the group consisting of a nucleotide sequence encoding a foot-and-mouth disease virus autohydrolase shown in SEQ ID NO: 1, and a signal peptide shown in SEQ ID NO: 2 Nucleotide sequences of hydrolase substrates, and combinations thereof:

(b) a genetic element encoding a foreign polypeptide;

2. The yellow fever virus vector according to claim 1, wherein the exogenous polypeptide is a viral protein or a cancer-related protein.

The yellow fever virus vector according to claim 1, wherein the genetic elements of the exogenous polypeptide are S1 gene, N gene, S gene, S2 gene, M of the full-length SARS-coronavirus. A gene or a fragment of a gene or a combination thereof.

The yellow fever virus vector according to claim 1, wherein the site where the expression component is inserted into the genome of the yellow fever virus is selected from the group consisting of-

(i) between the NS2B coding region and the NS3 coding region;

(i i) between the E and NS1 coding regions;

(i i i) between the C coding region and the prM coding region.

The yellow fever virus vector according to claim 1, wherein the 5′-end release element and the 3′-end release element both encode a foot-and-mouth disease virus autohydrolase as shown in SEQ ID NO: 1 Nucleotide sequence.

The yellow fever virus vector according to claim 1, wherein the 5 ′ terminal release element is a nucleotide sequence encoding a signal peptide hydrolase substrate represented by SEQ ID NO: 2.

The yellow fever virus vector according to claim 1, wherein the yellow fever virus genome is partially deleted from the yellow fever virus structural protein gene sequence, and the deleted structural protein gene sequence is selected From the lower group: protein C, prM protein, protein E or a combination thereof.

A pharmaceutical composition comprising the yellow fever virus vector of claim 1 and a pharmaceutically acceptable carrier.

The use of the yellow fever virus vector according to claim 1, characterized in that it is used for preparing a preventive or therapeutic vaccine.

10. A method for preparing yellow fever virus, comprising the steps of:

(1) Introducing the yellow fever virus genome into packaging cells, wherein the yellow fever virus genome is inserted with an exogenous polypeptide expression module, and the expression module has the following elements in order from 5 'to 3': (a) a 5 'end release element, the 5' end release element is selected from the group consisting of a nucleotide sequence encoding a foot-and-mouth disease virus autohydrolase shown in SEQ ID NO: 1 and a signal peptide shown in SEQ ID NO: 2: Nucleotide sequences of hydrolase substrates, and combinations thereof:

(b) a genetic element encoding a foreign polypeptide;

In addition, the genome has a structural protein gene sequence selected from the group consisting of protein C, prM, protein E, or a combination thereof, and the recombined genome retains a self-replicating function;

And the packaging cells are selected from the group-

(2) the packaging cell of the culture step (1);

(3) Isolate the recombinant yellow fever virus from the culture.