WO2005019250A1 - Staphylococcus antibiotic peptides with a broad spectrum of action - Google Patents

Staphylococcus antibiotic peptides with a broad spectrum of action Download PDF

Info

Publication number
WO2005019250A1
WO2005019250A1 PCT/DK2004/000553 DK2004000553W WO2005019250A1 WO 2005019250 A1 WO2005019250 A1 WO 2005019250A1 DK 2004000553 W DK2004000553 W DK 2004000553W WO 2005019250 A1 WO2005019250 A1 WO 2005019250A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
seq
precursor
fragment
variant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/DK2004/000553
Other languages
French (fr)
Inventor
Angus King
Martin Hansen
Vladimir P. Korobov
Thomas Kofoed
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zymenex Holding AS
Original Assignee
ACE Biosciences AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by ACE Biosciences AS filed Critical ACE Biosciences AS
Publication of WO2005019250A1 publication Critical patent/WO2005019250A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/305Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
    • C07K14/31Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to antibiotic (poly)peptides, in particular low-molecular- mass polypeptides with a broad spectrum of antimicrobial activity that are synthesised by bacteria of the genus Staphylococcus, in particular S. warneri.
  • Bacteria are known to secrete specific peptide substances into the environment, inhibiting the micro-flora of the adjacent surroundings as a means of controlling the sources of nutrition and territory.
  • a first type of such substances are the bacteriocins, which represent common simple or complex peptide molecules with a molecular weight above 10 kDa. As a rule, their effect is manifested within a genus. The release of typical bacteriocins into the environment resembles suicide in that both producing cells. and the remaining cells of bacterial populations are killed.
  • a second type of antibacterial peptide substances comprises specific peptide compounds of small size with a molecular mass below 10 kDa that are similar to bacteriocins in their bactericidal effects.
  • Low-molecular-weight bacteriocin-like peptides are detected in cells and supernatants from cultivation media of bacteria from different genera - Bacillaxeae, Enterobacteriaceae, Micrococcaceae, Streptococcaceae, Peptococcaceae, Lactobacillaceae, Actinoplanaceae, Streptomyceae, and also from the bacteria of genera Lactococcus lactis and Enterococcus faecalis.
  • Such peptides do not have any effect on cells from the parent or producer strain but result in the inhibition of growth or death of sensitive cells from other species.
  • Low-molecular-weight antibacterial peptides also exhibit inhibiting effects on the growth of viruses and fungi.
  • antimicrobial peptides Due to peculiarities of their chemical molecular structure, low-molecular-weight peptides usually exhibit marked thermal stability, resistance to pH alterations, and some tolerance to the effect of proteases. A specific feature of some antimicrobial peptides appears to be their hypoallergenic properties. There have only been very rare occurrences of bacterial resistance to these peptides observed over a 30-year period during which the most familiar peptide of this kind, nisin, has been used as a food preservative. These characteristics of antimicrobial peptides make these compounds also promising for practical use in control of infectious agents in animals and humans.
  • Staphylococci are active producers of both staphylocins (typical bacteriocins), and bacteriocin-like peptide compounds with low molecular mass.
  • staphylocins typically bacteriocins
  • bacteriocin-like peptide compounds with low molecular mass typically lysostaphin (S. simulans), epidermin, Pep 5 (S. epid ⁇ rmidis) and gallidermin (S. gallinarum) are best studied.
  • US patent 5,703,040 describes a method for the production of a partially purified protein-like compound with a molecular weight of about 6.4 kDa from the cultivation media of Staphylococcus aureus KSI 1829.
  • the compound exhibits antibacterial action to Streptococci, Corynebacteria, Bordetella, Moraxella, and the bacterium Haemophilus parasuis.
  • RU patent 2,200,195 describes detection of an antibacterial activity in the culture medium of Staphylococcus warneri strain IEGM KL1.
  • the antibacterial activity was resistant to boiling, to DNase and to RNase, but sensitive to trypsin. Ultrafiltration indicated that the activity was due to substances smaller than 3,000 Da. However, no further purification, identification or characterisation of the antibacterial substance(s) was described in RU 2,200,195.
  • the present invention relates to isolated antimicrobial polypeptides, in particular an isolated polypeptide synthesised by S. warneri (also termed “warnerin” herein) and variants, fragments and precursors of said polypeptide. More specifically the invention relates to an isolated antimicrobial polypeptide, wherein said polypeptide - comprises the sequence Dha-Val-Val-Xaa1-Dhb-Dhb-Xaa2-Xaa3-Ala (SEQ ID NO:1), wherein Xaa1 is Lys or Gin, Xaa2 is Leu or lie, Xaa3 is Lys or Gin, and comprises the sequence Lys-Gly-Ala-Xaa4-Xaa5-Xaa6-Xaa7-Xaa8- Xaa9-Asn-Xaa10-Dhb-Gly-Lys-Xaa11 (SEQ ID NO:2), wherein Xaa4 is Thr or an Abu-part of a
  • the invention furthermore relates to pharmaceutical and other compositions comprising a polypeptide, fragment, variant or precursor of the invention and a pharmaceutically-acceptable or other carrier.
  • the invention furthermore relates to methods of producing a polypeptide, fragment, variant or precursor of the invention, and to polynucleotides, expression vectors, and heterologous host cells for use in such methods.
  • the present invention relates to uses of polypeptides, fragments, variants and precursors of the invention to combat microorganisms.
  • Figure 2. Dynamics of the antimicrobial factor's release into the producer's medium: Quantitative estimation of the content of antibacterial factor in a cultivation medium. Black spots evidence for the growth of S. epidermidis.
  • Figure 3. Detection of antibacterial activity in a cultivation medium. Antibacterial test on a solid LB agarose medium. Numerals - hours of cultivation.
  • Figure 4 Purification using a heparin-agarose column: Isolation of fractions possessing antibacterial activity from the supernatants of the S. warneri cultivation medium with different carriers. Gradient elution of fractions exhibiting antibacterial activity from the affinity sorbents (Heparin-agarose). Column dimensions: 16 x 200 mm.
  • Figure 5 Desalination of purified fractions exhibiting antibacterial activity on the columns PD-10. The volume of the column - 3 ml, the volume of the sample - 2 ml. Detection of the release of active fraction along the area of lysis of the indicator culture lawn from S. epidermidis in 12 hours after the application of 5 ⁇ fraction eluate and cultivation at 37 e C.
  • Lane 1 Molecular weight markers.
  • Lane 3 Duplicate gel seen in lanes 1 & 2, overlayed with S. epidermidis culture and grown at 37 e C overnight.
  • the clear area in lane 3 shows bacterial killing.
  • Figure 7 Chromatographic confirmation of purity of isolated antibacterial peptide fraction. Chromatographic isolation of antibacterial peptide homogenous fraction under the use of an acetonitrile gradient with "gentle slope”.
  • Figure 8. Activity of warnerin upon treatment with nucleases and proteases Rows 1 ,4,7 and 10; Warnerin + enzyme + buffer + LB + S. epidermidis.
  • RNAase 1 mg/ml was prepared by boiling for 5 minutes, centrifugation and removal of precipitate material in 100mM Tris.HCI pH7.2. 1 mg/ml Proteinase K and 1 mg/ml trypsin were prepared separately in 50mM Tris.HCI pH7.5. DNAase: Deoxyribonu- clease, RNAase: Ribonuclease, LB: Lauria Bertani broth.
  • Figure 9 MALDI spectrum of intact peptide, with internal calibration
  • Figure 16 Possible sequence of mercaptoethanol treated fragment 1312 Figure 17. Fragmentation spectrum of 1544. The sequences indicates are in reverse order, i.e. from C-terminus to N-terminus.
  • Figure 20 Genomic fragment encoding warnerin Figure 21. Warnerin without leader before and after post-translational modification
  • Peptide and polypeptide - are used interchangeably herein.
  • Isolated - is used to characterise polypeptides and polynucleotides disclosed herein that have been identified and separated and/or recovered from a component of their natural environment. Contaminant components of their natural environment are materials that would typically interfere with the various uses for the polypeptide, and may include proteinaceous and/or non-proteinaceous solutes.
  • about - When used in connection with the value for a molecular mass of a protein, "about” is meant to indicate a molecular mass close to ( ⁇ 10%) the indicated value.
  • E.g. "about 3000 Da” is meant to indicate between 2700 and 3300 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, or exactly 3000 Da.
  • Fragment - refers to a non-full-length part of a polypeptide.
  • the length of fragments may vary from 2 amino acids to the full-length polypeptide minus one amino-acid residue.
  • fragments are less than 28 amino acids, e.g. less than 25 amino acids, such as less than 20 amino acids, e.g. less than 10 amino acids in length.
  • fragments are more than 5, such as more than 10, e.g. more than 15, such as more than 20, e.g. more than 25, such as more than 27 amino acids in length.
  • a fragment consists of a part of an amino-acid sequence which is less than 100% in length as compared to the full-length polypeptide.
  • the length of the fragment is between 10% and 99%, such as between 50% and 99%, for example between 75% and 99% of the length of the full-length polypeptide.
  • Further preferred fragments are fragments containing at least 5, such as at least 7, e.g. at least 9, such as at least 11 , e.g. at least 13, such as at least 15, e.g. at least 17, such as at least 19, e.g. at least 21 , such as at least 23, e.g. at least 25, such as at leas 27 consecutive amino acids of the full-length warnerin polypeptide.
  • Variant- Variants can be naturally-occurring variants, but also variants that have not been found in nature. Furthermore, the invention also encompasses variants of fragments of the invention and variants of precursors of the invention. Variants are determined on the basis of their degree of identity or their homology with a predetermined amino-acid sequence, said predetermined amino-acid sequence preferably being selected from the group of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:25, SEQ ID NO:26 and SEQ ID NO:27; or, when the variant is a fragment, a fragment of one of these specific sequences.
  • variants preferably have at least 50%, such as at least 75% sequence identity, for example at least 80% sequence identity, such as at least 85% sequence identity, for example at least 90% sequence identity, such as at least 92% sequence identity, for example at least 93% sequence identity, such as at least 94% sequence identity, for example at least 96% sequence identity, such as at least 98 % sequence identity with SEQ ID NO:27.
  • Identities between amino-acid sequences may be calculated using well known algorithms, such as BLOSUM 30, BLOSUM 40, BLOSUM 45, BLOSUM 50, BLOSUM 55, BLOSUM 60, BLOSUM 62, BLOSUM 65, BLOSUM 70, BLOSUM 75, BLOSUM 80, BLOSUM 85, or BLOSUM 90.
  • Variants are also determined based on a predetermined number of conservative amino-acid substitutions as defined herein below.
  • a conservative amino-acid substitution as used herein relates to the substitution of one amino acid within a predetermined group of amino acids for another amino acid within the same group, wherein the amino acids exhibit similar or substantially similar characteristics.
  • one amino acid may be substituted for another within the groups of amino acids indicated herein below: i) Amino acids having aliphatic side chains (Gly, Ala, Val, Leu, lie) ii) Amino acids having cyclic side chains (Phe, Tyr, Trp, His, Pro) iii) Amino acids having acidic side chains (Asp, Glu) iv) Amino acids having basic side chains (Lys, Arg, His) v) Amino acids having amide side chains (Asn, Gin) vi) Amino acids having hydroxy side chains, and their dehydrated derivatives (Ser, Thr, Dha, Dhb) vii) Amino acids having sulphor-containing side chains (Cys, Met) viii) Lanthionine and methyllanthionine
  • the same variant or fragment thereof may comprise at least one conservative amino-acid substitution from one or more than one group of conservative amino- acids as defined herein above.
  • Conservative substitutions may be introduced in any position of SEQ ID NO:26 or SEQ ID NO:27, and it may also be desirable to intro-wit non-conservative substitutions in any one or more positions.
  • a non- conservative substitution leading to the formation of a functionally equivalent variant of warnerin would for example i) differ substantially in its effect on polypeptide backbone orientation such as substitution of or for Pro or Gly by another residue; and/or ii) differ substantially in electric charge, for example substitution of a negatively charged residue such as Glu or Asp for a positively charged residue such as Lys, His or Arg (and vice versa); and/or iii) differ substantially in steric bulk, for example substitution of a bulky residue such as His, Trp, Phe or Tyr for one having a minor side chain, e.g. Ala, Gly or Ser (and vice versa).
  • Variants obtained by substitution of amino acids may in one preferred embodiment be made based upon the hydropho- bicity and hydrophilicity values and the relative similarity of the amino acid side- chain substituents, including charge, size, and the like.
  • Exemplary amino-acid substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.
  • Variants may also differ from the pre-determined sequence in that one or more amino acids have been added or deleted.
  • the addition or deletion of an amino acid is preferably an addition or deletion of from 1 to 20 amino acids, for example from 1 to 10 amino acids, such as from 1 to 5 amino acids, e.g. 1 ,2,3,4 or 5 amino acids.
  • sterically similar variants may be formulated to mimic the key portions of the polypeptide structure. This may be achieved by techniques of modelling and chemical designing known to those of skill in the art. It will be understood that all such sterically similar constructs fall within the scope of the present invention.
  • the present invention relates to functionally equivalent variants comprising substituted amino acids having hydrophilic or hydropathic indices that are within +/-2.5, for example within +/- 2.3, such as within +/- 2.1 , for example within +/- 2.0, such as within +/- 1.8, for example within +/- 1.6, such as within +/- 1.5, for example within +/- 1.4, such as within +/- 1.3 for example within +/- 1.2, such as within +/- 1.1 , for example within +/- 1.0, such as within +/- 0.9, for example within +/- 0.8, such as within +/- 0.7, for example within +/- 0.6, such as within +/- 0.5, for example within +/- 0.4, such as within +/- 0.3, for example within +/- 0.25, such as within +/- 0.2 of the value of the amino acid it has substituted.
  • hydrophilic and hydropathic amino acid indices in conferring interactive biologic function on a protein is well understood in the art (Kyte & Doolittle, 1982 and Hopp, U.S. Pat. No. 4,554,101 , each incorporated herein by reference).
  • amino acid hydropathic index values as used herein are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); ala- nine (+1.8); glycine (-0.4 ); threonine (-0.7 ); serine (-0.8 ); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (- 3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5) (Kyte & Doolittle, 1982).
  • amino acid hydrophilicity values are: arginine (+3.0); lysine (+3.0); aspartate (+3.0.+- .1 ); glutamate (+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine
  • Antimicrobial activity indicates the ability to kill microorganisms (a cidal activity) and/or prevent propagation or growth of microorganisms (a static activity). Antimicrobial activities include antibacterial, antifungal, antiparasitic as well as antiviral activity.
  • unusual amino acids refers to amino acids in antimicrobial peptides, such as lantibiotics, that are formed by post-translational modification, such as didehydroalanine (Dha), didehydroamino-2- butyric acid (Dhb), lanthionine, (beta)-methyllanthionine, and 2-aminobutyric acid (Abu).
  • didehydroalanine (Dha) can be formed by post-translational modification of serine residues
  • didehydroamino-2-butyric acid (Dhb) can be formed by post-translational modification of threonine residues.
  • Lanthionines can be formed from a dehydrated serine and a cysteine. The two parts of the resulting lanthionine are termed “Ala-part of lanthionine” herein. Methyllanthionines can be formed from a dehydrated threonine and a cysteine. The two parts of the resulting methyllan- thionine are termed "Abu-part of methyllanthionine” and "Ala-part of methyllanthionine” for the derivative of the dehydrated threonine and the derivative of the cysteine, respectively. See the figures for illustration.
  • Precursor - refers to a polypeptide from which an antimicrobial peptide of the invention can be formed, preferably by post-translational modification.
  • a precursor may or may not possess antimicrobial activity.
  • post-translational modifications can include dehydration of specific hydroxyl amino acids and/or formation of thioether amino acids via addition of neighbouring cysteines to didehydro amino acids.
  • a precursor can be a naturally-occurring precursor, or a precursor that has not been found in nature.
  • Purified - indicates that the polypeptide of the invention has been separated from other components such as cellular components, or other cell-derived or other components found in the culture medium.
  • purified indicates that the polypeptide makes up at least 50%, such as 60%, for example 70%, such as 80%, for example 90%, such as 95%, for example 98%, such as 99%, for example essentially 100% of the total macromolecular content of the composition on a weight or molecule basis.
  • Segment- refers to a part of a polypeptide, i.e. a part of the polypeptide chain.
  • polypeptides of the invention in a main aspect, relates to an isolated antimicrobial polypeptide, wherein said polypeptide comprises the sequence Dha-Val-Val-Xaa1 -Dhb-Dhb- Xaa2-Xaa3-Ala (SEQ ID NO:1), wherein Xaa1 is Lys or Gin, Xaa2 is Leu or lie, Xaa3 is Lys or Gin, and comprises the sequence Lys-Gly-Ala-Xaa4-Xaa5-Xaa6-Xaa7-Xaa8-Xaa9-Asn-
  • Xaa10-Dhb-Gly-Lys-Xaa11 (SEQ ID NO:2), wherein Xaa4 is Thr or an Abu-part of a methyllanthionine, Xaa5 is Leu or lie, Xaa6 is Thr or an Abu-part of a methyllanthionine, Xaa7 is Gly or Cys or an Ala-part of a methyllanthionine, Xaa8 is Gly or Cys or an Ala-part of a methyllanthionine, Xaa9 is Cys or an Ala-part of a methyllanthionine, Xaa10 is Leu or lie, Xaa11 is Lys or Gin, and wherein SEQ ID NO:1 is located N-terminally of SEQ ID NO: 2, or a fragment, a variant, or a precursor of said polypeptide;
  • the invention relates to an isolated antimicrobial polypeptide which has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids each individually selected from the group of Dha and Dhb;
  • the invention relates to an isolated antimicrobial polypeptide which is derivable, by post-translational modification, from the precursor sequence of SEQ ID NO:25 and/or the sequence of SEQ ID NO:26.
  • polypeptide of the invention possess all three of the above defined characteristics, i.e. the polypeptide
  • - comprises the sequence Dha-Val-Val-Xaa1-Dhb-Dhb-Xaa2-Xaa3-Ala (SEQ ID NO:1), wherein Xaa1 is Lys or Gin, Xaa2 is Leu or He, and Xaa3 is Lys or Gin; and comprises the sequence Lys-Gly-Ala-Xaa4-Xaa5-Xaa6-Xaa7-Xaa8-Xaa9-Asn- Xaa10-Dhb-Gly-Lys-Xaa11 (SEQ ID NO:2), wherein Xaa4 is Thr or an Abu-part of a methyllanthionine, Xaa5 is Leu or lie, Xaa6 is Thr or an Abu-part of a methyllanthionine, Xaa7 is Gly or Cys or an Ala-part of a methyllanthionine, Xaa8 is Gly or Cys or
  • NO:1 is located N-terminally of SEQ ID NO: 2, and
  • polypeptide has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids, each individually selected from the group of Dha and Dhb; and
  • - is derivable, by post-translational modification, from the precursor sequence of SEQ ID NO:25 and/or the sequence of SEQ ID NO:26.
  • the isolated antimicrobial polypeptide - has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids each individually selected from the group of Dha and Dhb; and - comprises the sequence of SEQ ID NO:1. More preferably, the above polypeptide also comprises the sequence of SEQ ID NO:2.
  • Xaa1 is a lysine. In other embodiments, Xaa1 is a glutamine.
  • Xaa2 is in some embodiments an isoleucine and in other embodiments a leucine.
  • Xaa3 is in some embodiments a lysine and in other embodiments a glutamine.
  • Xaa4 is in some embodiments a threonine and in other embodiments an Abu-part of a methyllanthionine.
  • Xaa5 is in some embodiments an isoleucine and in other embodiments a leucine.
  • Xaa6 is in some embodiments a threonine and in other embodiments an Abu-part of a methyllanthionine.
  • Xaa7 is in some embodiments a glycine, in other embodiments a cysteine and in yet other embodiments an Ala-part of a methyllanthionine.
  • Xaa8 is in some embodiments a glycine, in other embodiments a cysteine and in yet other embodiments an Ala-part of a methyllanthionine.
  • Xaa9 is in some embodiments a cysteine and in other embodiments an Ala-part of a methyllanthionine.
  • Xaa10 is in some embodiments a leucine and in other embodiments an isoleucine.
  • Xaa11 is in some embodiments a lysine and in other embodiments a glutamine.
  • Xaa4 and Xaa6 are both an Abu-part of a methyllanthionine and Xaa7 and Xaa9 are both an Ala-part of methyllanthionine and these four residues form two methyllanthionines.
  • Xaa4 forms a methyllanthionine with Xaa7 and Xaa6 forms a methyllanthionine with Xaa9.
  • Xaa4 forms a methyllanthionine with Xaa9 and Xaa6 forms a methyllanthionine with Xaa7.
  • a polypeptide segment of about 541 Da separates the segments defined in SEQ ID NO:1 and SEQ ID NO:2.
  • the segment defined in SEQ ID NO:1 is preceded by a polypeptide segment of about 143 Da.
  • the sequence of SEQ ID NO:2 comprises the C-terminus of the polypeptide.
  • the polypeptide of the invention preferably contains no aspartic acid and no glutamic acid residues.
  • polypeptide of the invention comprises the sequence of SEQ ID NO:27, even more preferably comprising thioether linkages located as shown in figure 21.
  • the invention relates in one aspect to an isolated antimicrobial polypeptide which is derivable, by post-translational modification, from the precursor sequence set forth in SEQ ID NO:25 and/or the sequence of SEQ ID NO:26.
  • Said post-translational modification is preferably a type of modification which can be performed by Staphylococcus warneri.
  • the post- translational modification comprises removal of the leader peptide and/or dehydration of at least one serine and/or threonine. In a more preferred embodiment, it comprises dehydration of all serines and threonines.
  • the post-translational modification further comprises formation of at least one thioether linkage. More preferably, 3 thioether linkages are formed.
  • the polypeptide of the invention has antibacterial activity against Staphylococcus epidermis.
  • the polypeptide preferably preserves its antibacterial action after boiling for 5 min of an aqueous solution of the polypeptide at a concentration of 1 micrograms/ml and/or after freezing and storage at -18 Q C for 36 months.
  • the polypeptide of the invention contains two preferred cleavage sites for trypsin.
  • polypeptide of the invention is isolated and/or purified. Fragments, variants and precursors
  • the invention also relates to fragments, variants and precursors of the above defined polypeptide of the invention. Preferred are fragment variants and precursors of SEQ ID NO:27. Fragments, variants and precursors have been defined above.
  • the invention also relates to variants of fragments of the polypeptide of the invention, to variants of precursors of the polypeptide of the invention, and to fragments of precursors of polypeptides of the invention.
  • Preferred fragments are fragments with a length of at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90% of the length of the polypeptide of the invention.
  • a variant or precursor of a polypeptide of the invention has at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90% sequence identity to said polypeptide.
  • variants and variants have retained at least some or all of the antimicrobial activity of the polypeptide of the invention. Without being bound by a specific theory, it is expected that the methyllanthionine and lanthionine residues are important for the activity of the peptide.
  • variants or fragments of the polypeptide of the invention that comprise at least one, such as two, more preferably three, meth- ylanthionines or lanthionines are preferred.
  • variants or fragments of SEQ ID NO:27 that comprise at least one, such as two, more preferably three, methylanthionines or lanthionines.
  • fragments and variants of the invention have a pi of more than 9, such as more than 10.
  • fragments and variants of the polypeptide of the invention preferably have more than 5 positively charged residues, such as more than 6, more than 7, more than 8 or more than 9 positively charged residues, preferably lysines or arginines, most preferably lysines.
  • the invention relates to a precursor comprising the sequence set forth in SEQ ID NO:3.
  • the invention relates to a precursor comprising the sequence set forth in SEQ ID NO:26, such as the precursor set forth in SEQ ID NO:25.
  • Precursors of the polypeptides of the invention can e.g. be used to synthesise polypeptide of the invention in vitro.
  • the antimicrobial activity of the polypeptide, fragment, variant or precursor of the invention is an antibacterial activity.
  • the minimal inhibitory concentration against S. epidermis 33 under the test-conditions described herein in the examples is 5 micrograms/ml or less.
  • the minimal inhibitory concentration against S. epidermis 33 under the test-conditions described herein in the examples is preferably a molar concentration which is equivalent to 5 micrograms/ml of the peptide of SEQ ID NO:27 or less.
  • the minimal inhibitory concentration is, or is equivalent to, 2 micrograms SEQ ID NO:27-peptide/ml or less, for example 1 microgram/ml or less, such as 0.5 micrograms/ml or less, for example 0.25 micrograms/ml or less, such as 0.1 micrograms/ml or less, for example 0.05 micrograms/ml or less such as 0.02 micrograms/ml or less, for example 0.01 micrograms/ml or less against S. epidermis 33 under the test-conditions described herein in the examples.
  • the invention also relates to isolated polynucleotides comprising a sequence encoding a polypeptide of the invention or a variant, fragment or precursor of the invention.
  • the polynucleotide of the invention is the sequence of SEQ ID NO:24 or a variant of fragment thereof.
  • Such polynucleotides can be obtained or constructed using standard techniques known in the art and be used in production of the polypeptide. For example, such polynucleotides can be introduced into the original production strain by transformation in order to obtain a strain with multiple copies of a polynucleotide encoding the polypeptide of the invention. This would normally result in the production of larger amounts of the polypeptide.
  • polynucleotides can be introduced into a heterologous production organism.
  • the term 'heterologous' refers to any other strain or species than the one from which the polypeptide originates (i.e. any other strain than S. warneri IEGM KL1), preferably another Staphylococcus species.
  • Such warnerin-overproducing homologous strains and wamerin-producing heterologous strains are a further aspect of this invention.
  • Methods for protein engineering and heterologous production of lantibiotics have been described in e.g. Kuipers et al.(1996) Ant. v. Leeuwenhoek 69:161-169 and Heidrich et al. (1998) Appl. Environ. Microbiol.
  • the invention furthermore relates to an expression vector comprising a polynucleotide of the invention and to a heterologous host cell comprising such an expression vector and/or a polynucleotide of the invention. Furthermore, the invention relates to Staphylococcus warneri ACE Neo-mut-DSM 16081 strain which has been deposited at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) under the registration nr.: Staphylococcus warneri ACE Neo-mut-DSM 16081.
  • the polypeptide of the invention is preferably purified.
  • the invention relates to a method for producing a polypeptide, fragment, variant or precursor as defined herein, comprising the steps of a. culturing a strain capable of producing said polypeptide, fragment, variant or precursor under conditions wherein the polypeptide is produced, b. harvesting the polypeptide from the culture, and c. purifying the polypeptide.
  • the purification in step c. is continued until the polypeptide of the invention comprises at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90%, such as at least 95%, for example at least 98%, such as at least 99%, for example essentially 100% of the total protein content, e.g. using the procedures described herein in the Examples. Methods for quantifying the degree of purification are well-known to those skilled in the art.
  • the invention relates to compositions comprising a carrier and a polypeptide, fragment, variant or precursor as defined herein.
  • Such warnerin- containing compositions are preferably stabilised using methods known in the art, such as the methods described in US 5,763,395.
  • Suitable carriers are defined below.
  • the polypeptide, fragment, variant or precursor makes up at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90%, such as at least 95%, for example at least 98%, such as at least 99%, for example essentially 100% of the total protein content of the composition.
  • the invention relates to a composition
  • a composition comprising an antimicrobial polypeptide, a carrier and optionally other substances, wherein the polypeptide has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids each individually selected from the group of Dha and Dhb. and wherein said polypeptide makes up at least 1 %, such as at least 5%, for exam- pie at least 10%, such as at least 20%, for example at least 30%, such as at least
  • the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide, fragment, variant or precursor of the invention and a pharma- ceutically-acceptable carrier.
  • pharmaceutically-acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption-delaying agents and the like.
  • the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conven- tional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
  • the pharmaceutical composition is suitable for topical admini- stration.
  • the polypeptide may be incorporated with excipients and used in the form of non-ingestible mouthwashes and dentifrices.
  • a mouthwash may be prepared incorporating the active ingredient in the required amount in an appropriate solvent, such as a sodium borate solution (Dobell's Solution).
  • the active ingredient may be incorporated into an antiseptic wash containing sodium borate, glycerin and potassium bicarbonate.
  • the active ingredient may also be dispersed in dentifrices, including gels, pastes, powders and slurries.
  • the active ingredient may be added in a therapeutically effective amount to a paste dentifrice that may include water, binders, abrasives, flavouring agents, foaming agents, and humectants.
  • the active compounds may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or they may be enclosed in hard or soft shell gelatin capsule, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet.
  • the active compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • Such compositions and preparations should contain at least 0.1% of active compound.
  • the percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of the unit.
  • the amount of active compounds in such therapeutically useful compositions is such that a suitable dosage will be obtained.
  • the tablets, troches, pills, capsules and the like may also contain the following: a binder, as gum tragacanth, acacia, cornstarch, or gelatin; excipients, such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin may be added or a flavouring agent, such as peppermint, oil of wintergreen, or cherry flavouring.
  • a binder as gum tragacanth, acacia, cornstarch, or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate
  • the dosage unit form When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. In addition, the active compounds may be incorporated into sustained-release preparation and formulations.
  • the active compounds may also be administered parenterally, e.g., formulated for intravenous, intramuscular, or subcutaneous injection.
  • Solutions of the active com- pounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and ster- ile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dis- persion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilisation.
  • dispersions are prepared by incorporating the various steril- ised active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previ- ously sterile-filtered solution thereof.
  • Polypeptides, fragments, variants, precursors, compositions and pharmaceutical compositions of the invention can be used to combat microorganisms in any envi- ronment capable of sustaining microbial growth.
  • This refers to any fluid, substance or organism where microbial growth can occur or where microbes can exist.
  • Such environments can be, for example, animal tissue or bodily fluids, water and other liquids, food, food products or food extracts, crops and certain inanimate objects. It is not necessary that the environment promotes the growth of the microbe, only that it permits its subsistence. Any use for which nisin, subtilin or other known lantibiotics are used are also envisioned for the polypeptides of this invention and fragments, variants or precursors thereof.
  • a preferred use is use as a food additive.
  • the inven ⁇ tion thus also relates to an edible product comprising a polypeptide, fragment, variant or precursor as defined herein in an amount sufficient to prevent undesirable microbial growth and/or kill undesirable microorganisms.
  • said edible product is a meat or diary product.
  • the invention also relates to use of a polypeptide, fragment, variant or precursor as defined herein for the preparation of such an edible product.
  • the present invention relates to methods for treating and preventing infections by administering to an individual in need thereof a therapeutically-effective amount of a polypeptide, fragment, variant or precursor of the invention as defined herein.
  • the polypeptide, fragment, variant, precursor or pharmaceutical composition of the invention as defined herein is used for the prevention (i.e. prophylaxis) or treatment of microbial infection in a mammal, preferably a human being.
  • the invention also relates to the polypeptide, fragment, variant, precursor or phar- maceutical composition of the invention for use as a medicament and to use of the polypeptide, fragment, variant, precursor or pharmaceutical composition of the invention for the manufacture of a medicament for the prevention or treatment of microbial infection in a mammal.
  • said mammal is a human being.
  • said infection is a bacterial infection, more preferably caused by Gram-positive bacteria.
  • the invention furthermore relates to a kit of parts comprising a polypeptide, fragment, variant, precursor, composition or pharmaceutical composition of the invention as defined herein, and a scheme instructing a user of the dosage to be used in function of the weight and/or age and/or clinical diagnosis of an individual that is to be treated for an antimicrobial infection.
  • the polypeptide of the invention may be used alone or in combination with other active compounds.
  • Non-limiting examples of such other active compounds are compounds that have antimicrobial activity or compounds that stimulate the immune system of the host.
  • the polypeptide of the invention may be useful as an enhancer of the activity of another compound. Effects of combinations of the polypeptide of the invention with other compounds may be additive or synergistic.
  • Infections that may be treated with polypeptides of the invention include those caused by or due to microorganisms.
  • microorganisms include bacteria (e.g. Gram-positive, Gram-negative), fungi, (e.g. yeast and moulds), parasites (e.g. protozoans, nema- todes, cestodes and trematodes), and viruses. Specific organisms in these classes are well known (see for example, Davis et al., Microbiology, 3rd edition, Harper & Row, 1980).
  • clinical indications include, but are not limited to: 1/infections following insertion of intravascular devices or peritoneal dialysis catheters; 2/infection associated with medical devices or prostheses; 3/infection during hemodialysis; 4/S. aureus nasal and extra-nasal carriage; 5/burn wound infections; 6/surgical wounds, 7/acne, including severe acne vulgaris; 8/nosocomial pneumonia; 9/meningitis; 10/cystic fibrosis; 11 /infective endocarditis; 12/osteomyelitis; and 13/sepsis in an immunocompromised host.
  • contaminated intravascular devices such as central venous catheters, or peritoneal dialysis catheters. These catheters are cuffed or non-cuffed, although the infection rate is higher for non-cuffed catheters. Both local and systemic infection may result from contaminated intravascular devices. More than 25,000 patients develop device-related bacteremia in the United States each year. The main organisms responsible are coagulase-negative staphylococci (CoNS), Staphylococcus aureus, Enterococcus spp, E. coli and Candida spp.
  • CoNS coagulase-negative staphylococci
  • Staphylococcus aureus Staphylococcus aureus
  • Enterococcus spp E. coli
  • Candida spp Candida spp.
  • the polypeptide of the invention and/or antibiotic preferably as an ointment or cream, can be applied to the catheter site prior to insertion of the catheter and then again at each dressing change.
  • the polypeptide may be incorporated into the ointment or cream at a concentration preferably of about 0.5 to about 2% (w/v)
  • the polypeptide of the invention and/or other antibiotic can be coated, either covalently bonded or by any other means, onto the medical device either at manufacture of the device or after manufacture but prior to insertion of the device.
  • the polypeptide is preferably applied as a 0.5 to 2% solution.
  • topical antimicrobial substances such as Bacitracin, Tetracycline, or Chlorhexidine
  • the polypeptide of the in- vention alone or in combination with an antibiotic are preferably applied intra- nasally, formulated for nasal application, as a 0.5 to 2% ointment, cream or solution. Application may occur once or multiple times until the colonisation of staphylococci is reduced or eliminated. 5/Burn wound infections. Although the occurrence of invasive burn wound infections has been significantly reduced, infection remains the most common cause of morbidity and mortality in extensively burned patients. Infection is the predominant determinant of wound healing, incidence of complications, and outcome of burn pa- tients.
  • the main organisms responsible are Pseudomonas aeruginosa, S. aureus, Streptococcus pyogenes, and various Gram-negative organisms. Frequent de- bridements and establishment of an epidermis, or a surrogate such as a graft or a skin substitute, is essential for prevention of infection.
  • the polypeptide alone or in combination with antibiotics can be applied to burn wounds as an ointment or cream and/or administered systemically. Topical application may prevent systemic infection following superficial colonisation or eradicate a superficial infection.
  • the polypeptide is preferably administered as a 0.5 to 2% cream or ointment. Application to the skin could be done once a day or as often as dressings are changed.
  • the systemic administration could be by intravenous, intramuscular or subcutaneous injections or infusions. Other routes of administration can also be used.
  • the antimicrobial polypeptide alone or with an antibiotic can be incorporated into soap or applied topically as a cream, lotion or gel to the affected areas either once a day or multiple times during the day.
  • the length of treatment may be for as long as the lesions are present or used to prevent recurrent lesions.
  • the peptide antibiotic could also be administered orally or systemically to treat or prevent acne lesions.
  • Nosocomial pneumonias account for nearly 20% of all nosocomial infections. Patients most at risk for developing nosocomial pneumonia are those in intensive care units, patients with altered levels of consciousness, elderly patients, patients with chronic lung disease, ventilated patients, smokers and post-operative patients. In a severely-compromised patient, multiantibiotic-resistant nosocomial pathogens are likely to be the cause of the pneumonia.
  • the main organisms responsible are P. aeruginosa, S. aureus, Klebsiella pneumoniae and En- terobacter spp.
  • the polypeptide alone or in combination with other antibiotics can be administered systemically to treat pneumonia. Administration could be once a day or multiple administrations per day.
  • the antimicrobial polypeptide can also be admin- istered directly into the lung via inhalation or via installation of an endotracheal tube.
  • Cystic fibrosis is the most common genetic disorder of the Caucasian population. Pulmonary disease is the most common cause of premature death in cystic fibrosis patients. Optimum antimicrobial therapy for CF is not known, and it is generally believed that the introduction of better anti-pseudomonal antibiotics has been the major factor contributing to the increase in life expectancy for CF patients.
  • the most common organisms associated with lung disease in CF are S. aureus , P. aeruginosa and H. influenzae.
  • the polypeptide alone or in combination with other antibiotics could be administrated orally or systemically or via aerosol to treat cystic fibrosis.
  • treatment is effected for up to 3 weeks during acute pulmonary disease and/or for up to 2 weeks every 2-6 months to prevent acute exacerbations.
  • Infective endocarditis results from infection of the heart valve cusps, although any part of the endocardium or any prosthetic material inserted into the heart may be involved. It is usually fatal if untreated. Most infections are nosocomial in origin, caused by pathogens increasingly resistant to available drugs. The main organisms responsible are Viridans streptococci, Enterococcus spp, S. aureus and CoNS. The antimicrobial polypeptide alone or in combination with other antibiotics could be administered orally or systemically to treat endocarditis, although systemic administration would be preferred. Treatment is preferably for 2-6 weeks in duration and may be given as a continuous infusion or multiple admini- stration during the day.
  • 12/Osteomyelitis In early acute disease the vascular supply to the bone is compromised by infection extending into surrounding tissue. Within this necrotic and ische- mic tissue, the bacteria may be difficult to eradicate even after an intense host re- sponse, surgery, and/or antibiotic therapy.
  • the main organisms responsible are S. aureus, E. coli, and P. aeruginosa.
  • the antimicrobial polypeptide could be administered systemically alone or in combination with other antibiotics. Treatment would be 2-6 weeks in duration.
  • the peptide antibiotic could be given as a continuous infusion or multiple administration during the day.
  • the polypeptide of the invention could be used as an antibiotic-impregnated cement or as antibiotic coated beads for joint replacement procedures.
  • Effective treatment of infection may be examined in several different ways.
  • the patient may exhibit reduced fever, a reduced number of microorganisms, a lower level of inflammatory molecules (e.g., IFN-.gamma., IL-12, IL-1 , TNF), and the like.
  • the in vivo therapeutic efficacy from administering an antimicrobial polypeptide and antibiotic agent in combination is based on a successful clinical outcome and does not require 100% elimination of the organisms involved in the infection. Achieving a level of antimicrobial activity at the site of infection that allows the host to survive or eradicate the microorganism is sufficient. When host defences are maximally effective, such as in an otherwise healthy individual, only a minimal antimicrobial effect may suffice.
  • Another preferred use according to the invention is use of the polypeptide, fragment, variant or precursor of the invention for coating of a medical device.
  • the invention also relates to a medical device, such as a catheter, coated with a polypeptide, fragment, variant or precursor of the invention.
  • the strain producing the low-molecular-weight antibacterial peptide was isolated from air in laboratory compartments in 1996 at the Laboratory of the Biochemistry of Microorganisms at the Institute of Ecology and Genetics of Microorganisms, Ural Branch of the Russian Academy of Sciences, Perm, Russia.
  • the bacterial strain was identified as being a strain of Staphylococcus warneri and deposited at the Ta- rasevitch Institute as Staphylococcus warneri IEGM KL1 , No. 260.
  • Strains of Micro- coccus luteus, Staphylococcus epidermidis 33, Staphylococcus aureus 209P; Streptococcus pyogenes were received from the Tarasevitch Institute.
  • the strain E E.
  • coli M17 was received from the Scientific-Production Association "Biomed", Perm, Russia. Strains Corynebacterium ammoniagenes, , Rhodococcus ruber, Bacillus subtilis were obtained from the Regional Collection of Alkanotrophic Microorganisms IEGM UB RAS, Perm, Russia.
  • Cultivation of the bacterial strain IEGM KL1 was carried out on a rich nutrient Lauria Broth (LB) medium containing 1 % Tryptone (Difco), 0.5% yeast extract, and 0.64% KCI under aeration at 37 S C.
  • Cultivation of other bacterial strains was carried out in the specified standard media of the suppliers. Typical curves for the warnerin producer's growth and for the level of antibacterial factors in the medium are represented in Fig.1.
  • Example 2 Secretion of an antibacterial factor from a producer strain into the growth medium
  • Determination of the level of antibacterial activity in preparations was carried out in immunological plates based on the principle of two-fold dilution of aliquots from cultivation media in LB medium (Fig. 2).
  • One hundred microliters of LB medium were introduced into each well of the plate.
  • the first well was supplemented with 100 mi- croliters of cultivation media that had been cleared by centrifugation (10000 g, 10 min) under sterile conditions followed by boiling for 5 min.
  • a serial dilution series was made ranging from 1:2 to 1 :256..
  • Ten microliters of S. epidermidis test-culture was subsequently added a to each well.
  • This test culture was prepared as follows: Cells from the loga- rithmic growth phase were washed twice with fresh cultivation medium and centrifugation at 10000 g for 10 minutes. Cells were then resuspended in fresh culture medium at a density of 1.8-2.0 x 10 5 CFU/ml and used as test culture. The efficacy of the inhibiting action of the preparations was evaluated after 12-16 hours of cultivation at 37 S C. The quantity of antibacterial factor in the preparations under investiga- tion was expressed in arbitrary units (AU) that represented reciprocal of the amounts from maximum dilutions at which a complete lack of growth of the S. epidermidis indicator strain was observed. To test the antibacterial peptide activity on a solid medium, the indicator culture S.
  • AU arbitrary units
  • epidermidis was added to a 0.7% LB-agar medium at a concentration of 1.8-2.0 x 10 4 CFU/ml.
  • Five microliters of culture supernatants was added to aga- rose in Petri dishes.
  • the antibacterial action was detected by the formation of areas of bacterial cell lysis at the sites of application after 12-16 hours of incubation at 37 e C.
  • triphenyltetrazolium chloride was introduced to a final con- centration of 0.1% at the end of the incubation period.
  • the same solution was layered onto the LB-agar surface during the tests on dishes.
  • a typical example of such tests for the level of the antibacterial factor production in the cultivation medium is represented in Fig.3.
  • aqueous solutions of warnerin at a concentration of 1 ⁇ g/ml were prepared and held in a boiling water bath for up to 60 minutes. Samples were then frozen at -18 Q C and stored for 60 min, 24 hours, or several months. Results of the heat treatment are shown in Table 2. Freezing and storing for long periods at -18 e C did not affect the antibacterial activity. Similar solutions of peptides isolated were examined for the resistance to enzymatic action. The addition of DNAse (1 mg/ml) and RNAse (1 mg/ml) to warnerin solutions did not result in any alteration in antibacterial activity after incubation at 37 9 C for 2 hours. However, treatment with proteinase K (1 mg/ml) under similar conditions lead to loss of antibacterial activity. Similar observations occurred after treatment with trypsin (1 mg/ml) after a 12 hour-incubation (shown in Fig.8).
  • Mass spectrometric analysis was done using MALDI-TOF (internal calibration) and ESI-MS.
  • the exact mass of the intact peptide as determined by ESI-MS was (monoisotopic): 2997.88 Da.
  • the exact mass of the intact peptide by MALDI-MS was: 2998.75 Da (M+H) monoisotopic: 2997.74 Da. (Shown in Fig. 9 and 10)
  • the observation of loss of 128 Da during treatment with trypsin from both the intact protein 2998 Da (peak at 2870 Da) and from the 1312 Da fragment (1184 Da) indicates that either the N-terminal is a Lys or the 2nd amino acid from the C-terminal is an Arg or Lys and the C-terminal end a Lys or a Gin (See Fig.11 ).
  • the exact masses of the two fragments found by MS were:
  • the intact peptide showed up to 7 additions of mercaptoetanol/ethanthiol (Fig. 14). Since each lanthionine, Dha and Dhb will give one addition, we expect the intact peptide to have 7 of these unusual amino acids.
  • the different products were used in MS/MS fragmentation studies. Especially the data from a 1544 Da fragment were very good and these were used in the sequence identification.
  • the peptide with a mass of 1544 Da corresponds to the 1312 Da peptide plus addition of three mercaptoethanol-groups and loss of 2 Da during disulfide- bridge formation. Investigation of the fragmentation spectrum gave the possible se- quence shown in figure 16. This structure will lead to the possible original structures shown in figures 17 and 18.
  • the placement of the thio-ether bonds is not verified and the C-terminal Lys may be a Gin. Furthermore, the method does not discriminate between the lie and Leu amino acids.
  • the sequence can be prepared from an unmodified precursor peptide comprising the following sequence: Gly-Ala-Thr-lle/Leu-Thr-Gly/Cys-Cys/Gly-Cys-Asn-Leu/lle- Thr-Gly-Lys-Lys/Gln (SEQ ID NO:3) (figure 22 shows SEQ ID NO:1-3).
  • N-terminal part of the polypeptide was analysed.
  • the N-terminal part was isolated by RP-HPLC (molecular weight of 1705 Da) and allowed to react with beta-mercaptoethanol to give between 2 and 4 substitutions. Subsequently, fragmentation studies were carried out wherein MALDI-TOF/TOF and ESI-MS/MS were used.
  • Figure 19 shows a possible sequence in accordance with the information obtained.
  • Test plates for immunological reactions with round bottom wells were used. 100 microliters of LB medium were pipetted into each well. 100 microliters of warnerin were introduced into the first well of a row, mixed, and 100 microliters of the peptide solution obtained were transferred to the next well of a row, etc., thus creating a sequential serial dilution series. A bacterial test-culture inoculum (10 microliters, prepared as above) was added to each well creating an initial cell concentration of 2 x 10 4 CFU/ml. Results are shown in Table 3.
  • the warnerin gene was obtained via sequencing from genomic DNA of Staphylococcus warneri ACE Neo-mut-DSM 16081 strain (a mutation which was introduced via UV incubation and led to higher production of the peptide). The mutation was not genetically analysed or specified.
  • the Staphylococcus warneri ACE Neo-mut-DSM 16081 strain has been deposited at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) under the registration nr.: Staphylococcus warneri ACE Neo-mut-DSM 16081.
  • Genomic DNA was prepared using a modified protocol originally provided by Qiagen.
  • the modification included mainly the addition of high amounts of lysostaphin (1 OOU per 2 x 10 8 bacteria), which was required to break the Staphylococcus warneri mutated strain.
  • Sequencing was done according to standard protocols at the ABI 3100 Sequencer. Cloning was performed into the cloning vectors pBad and pET101 , both obtained from Invitrogen via standard PCR-cloning proto- cols.
  • Neo-forward 5'- CAG TTG TTA AAA CAA C - 3' (SEQ ID NO:6)
  • Neo-Seq-1 5'- GTT CGG ATT GTA GTC TGC -3' SEQ ID NO:7
  • neointernallfw 5'- GGA GCA ACA TTA ACT TGT GG SEQ ID NO:8
  • neointerna rw 5'- CCA CAA GTT AAT GTT GCT CC SEQ ID NO:9
  • Neo(rwint)RW2 5'- CTT TAT TCA TAT CGA CTC ACC SEQ ID NO:17
  • SEQ ID NO: 24 shows the warnerin ORF and 5' and 3' flanking regions (figure 20)
  • SEQ ID NO: 25 shows the warnerin precursor sequence (figure 20)
  • SEQ ID NO: 26 shows the warnerin peptide sequence without leader(figure 21)
  • SEQ ID NO: 27 shows the warnerin peptide including post-translational modifications (figure 21 ).
  • the 73 Da group at the N-terminus is a blocking group. Without being bound by one theory, this may well be a 2-hydroxypropionyl, having the following structure: CH3-CH(OH)-CO-.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention provides low-molecular-mass Staphylococcus warneri peptides with a broad spectrum of antimicrobial activity. Furthermore, variants, fragments and precursors of said peptides are provided. The invention also relates to pharmaceutical and other compositions comprising said peptides, fragments, variants or precursors. The invention furthermore relates to methods of producing a polypeptide, fragment, variant or precursor of the invention, and to polynucleotides, expression vectors, and heterologous host cells for use in such methods. Moreover the present invention relates to uses of polypeptides, fragments, variants and precursors of the invention to combat microorganisms.

Description

Staphylococcus antibiotic peptides with a broad spectrum of action
This application is a non-provisional of U.S. provisional application Serial No. 60/496,914, filed August 22, 2003, which is hereby incorporated by reference in its entirety. All patent and non-patent references cited in the present application are hereby incorporated by reference in their entirety.
Field of the invention The present invention relates to antibiotic (poly)peptides, in particular low-molecular- mass polypeptides with a broad spectrum of antimicrobial activity that are synthesised by bacteria of the genus Staphylococcus, in particular S. warneri.
Background of the invention Bacteria are known to secrete specific peptide substances into the environment, inhibiting the micro-flora of the adjacent surroundings as a means of controlling the sources of nutrition and territory. A first type of such substances are the bacteriocins, which represent common simple or complex peptide molecules with a molecular weight above 10 kDa. As a rule, their effect is manifested within a genus. The release of typical bacteriocins into the environment resembles suicide in that both producing cells. and the remaining cells of bacterial populations are killed. A second type of antibacterial peptide substances comprises specific peptide compounds of small size with a molecular mass below 10 kDa that are similar to bacteriocins in their bactericidal effects. Low-molecular-weight bacteriocin-like peptides are detected in cells and supernatants from cultivation media of bacteria from different genera - Bacillaxeae, Enterobacteriaceae, Micrococcaceae, Streptococcaceae, Peptococcaceae, Lactobacillaceae, Actinoplanaceae, Streptomyceae, and also from the bacteria of genera Lactococcus lactis and Enterococcus faecalis. Such peptides do not have any effect on cells from the parent or producer strain but result in the inhibition of growth or death of sensitive cells from other species. Low-molecular-weight antibacterial peptides also exhibit inhibiting effects on the growth of viruses and fungi.
Due to peculiarities of their chemical molecular structure, low-molecular-weight peptides usually exhibit marked thermal stability, resistance to pH alterations, and some tolerance to the effect of proteases. A specific feature of some antimicrobial peptides appears to be their hypoallergenic properties. There have only been very rare occurrences of bacterial resistance to these peptides observed over a 30-year period during which the most familiar peptide of this kind, nisin, has been used as a food preservative. These characteristics of antimicrobial peptides make these compounds also promising for practical use in control of infectious agents in animals and humans.
The number of biological sources from which low-molecular-weight antimicrobial peptides have been isolated within recent years approaches several hundred. It is known that the production of antimicrobial compounds is wide-spread in bacteria of the Staphylococcus genus. Staphylococci are active producers of both staphylocins (typical bacteriocins), and bacteriocin-like peptide compounds with low molecular mass. Of these, lysostaphin (S. simulans), epidermin, Pep 5 (S. epidβrmidis) and gallidermin (S. gallinarum) are best studied.
US patent 5,703,040 describes a method for the production of a partially purified protein-like compound with a molecular weight of about 6.4 kDa from the cultivation media of Staphylococcus aureus KSI 1829. The compound exhibits antibacterial action to Streptococci, Corynebacteria, Bordetella, Moraxella, and the bacterium Haemophilus parasuis.
RU patent 2,200,195 describes detection of an antibacterial activity in the culture medium of Staphylococcus warneri strain IEGM KL1. The antibacterial activity was resistant to boiling, to DNase and to RNase, but sensitive to trypsin. Ultrafiltration indicated that the activity was due to substances smaller than 3,000 Da. However, no further purification, identification or characterisation of the antibacterial substance(s) was described in RU 2,200,195.
Summary of the invention
The present invention relates to isolated antimicrobial polypeptides, in particular an isolated polypeptide synthesised by S. warneri (also termed "warnerin" herein) and variants, fragments and precursors of said polypeptide. More specifically the invention relates to an isolated antimicrobial polypeptide, wherein said polypeptide - comprises the sequence Dha-Val-Val-Xaa1-Dhb-Dhb-Xaa2-Xaa3-Ala (SEQ ID NO:1), wherein Xaa1 is Lys or Gin, Xaa2 is Leu or lie, Xaa3 is Lys or Gin, and comprises the sequence Lys-Gly-Ala-Xaa4-Xaa5-Xaa6-Xaa7-Xaa8- Xaa9-Asn-Xaa10-Dhb-Gly-Lys-Xaa11 (SEQ ID NO:2), wherein Xaa4 is Thr or an Abu-part of a methyllanthionine, Xaa5 is Leu or lie, Xaa6 is Thr or an Abu-part of a methyllanthionine, Xaa7 is Gly or Cys or an Ala-part of a methyllanthionine, Xaaδ is Gly or Cys or an Ala-part of a methyllanthionine, Xaa9 is Cys or an Ala-part of a methyllanthionine, Xaa10 is Leu or lie, Xaa11 is Lys or Gin, and wherein SEQ ID NO:1 is located N-terminally of SEQ ID NO: 2, or a fragment, a variant, or a precursor of said polypeptide; and/or - has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids, each individually selected from the group of Dha and Dhb; and/or - is derivable, by post-translational modification, from the precursor sequence set forth in SEQ ID NO:25 and/or from the sequence of SEQ ID NO:26.
The invention furthermore relates to pharmaceutical and other compositions comprising a polypeptide, fragment, variant or precursor of the invention and a pharmaceutically-acceptable or other carrier. The invention furthermore relates to methods of producing a polypeptide, fragment, variant or precursor of the invention, and to polynucleotides, expression vectors, and heterologous host cells for use in such methods.
Moreover, the present invention relates to uses of polypeptides, fragments, variants and precursors of the invention to combat microorganisms.
Description of Drawings
Figure 1. Production of the antimicrobial factor during growth of a producer strain on an LB medium
Figure 2. Dynamics of the antimicrobial factor's release into the producer's medium: Quantitative estimation of the content of antibacterial factor in a cultivation medium. Black spots evidence for the growth of S. epidermidis. Figure 3. Detection of antibacterial activity in a cultivation medium. Antibacterial test on a solid LB agarose medium. Numerals - hours of cultivation.
Figure 4. Purification using a heparin-agarose column: Isolation of fractions possessing antibacterial activity from the supernatants of the S. warneri cultivation medium with different carriers. Gradient elution of fractions exhibiting antibacterial activity from the affinity sorbents (Heparin-agarose). Column dimensions: 16 x 200 mm.
Figure 5. Desalination of purified fractions exhibiting antibacterial activity on the columns PD-10. The volume of the column - 3 ml, the volume of the sample - 2 ml. Detection of the release of active fraction along the area of lysis of the indicator culture lawn from S. epidermidis in 12 hours after the application of 5 μ\ fraction eluate and cultivation at 37eC.
Figure 6. Gel overlay showing antibacterial activity of warnerin:
Lane 1 ; Molecular weight markers.
Lane 2, Warnerin crude extract
Lane 3. Duplicate gel seen in lanes 1 & 2, overlayed with S. epidermidis culture and grown at 37eC overnight.
The clear area in lane 3 shows bacterial killing.
Figure 7. Chromatographic confirmation of purity of isolated antibacterial peptide fraction. Chromatographic isolation of antibacterial peptide homogenous fraction under the use of an acetonitrile gradient with "gentle slope". Figure 8. Activity of warnerin upon treatment with nucleases and proteases Rows 1 ,4,7 and 10; Warnerin + enzyme + buffer + LB + S. epidermidis.
Rows 2,5,8 and 11 ; Warnerin + buffer + LB + S. epidermidis (Buffer control).
Rows 3,6,9 and 12; Enzyme + buffer + LB + S. epidermidis (Enzyme control).
Columns A-H, serial dilutions of Warnerin; Undiluted, 1 :2, 1 :4, 1 :8, 1 :16, 1 :32, 1 :64, 1 :128. 1 mg/ml DNAase was prepared in 10OmM acetate buffer pH5.0, 5mM MgCI2.
1 mg/ml RNAase was prepared by boiling for 5 minutes, centrifugation and removal of precipitate material in 100mM Tris.HCI pH7.2. 1 mg/ml Proteinase K and 1 mg/ml trypsin were prepared separately in 50mM Tris.HCI pH7.5. DNAase: Deoxyribonu- clease, RNAase: Ribonuclease, LB: Lauria Bertani broth. Figure 9. MALDI spectrum of intact peptide, with internal calibration
Figure 10. ESI-MS spectrum of intact peptide
Figure 11. Tryptic digest of intact peptide
Figure 12. Mass determination on two main fractions from trypsin digestion. Found by internal calibration Figure 13. Unusual amino acids in lantibiotics: In lantibiotics there are several unusual amino acids, among them didehydroalanine (Dha), didehydroamino-2- butyric acid (Dhb) and lanthionine. During reaction with mercaptoethanol (and ethanethiol) the addition product will form.
Figure 14. Intact peptide reacted with mercaptoethanol and ethanethiol Intact pep- tide reacted with mercaptoethanol and ethanethiol. Each mercaptoethanol will add
78 Da and each ethanthiol will add 62 Da.
Figure 15. Addition of mercaptoethanol and ethanethiol to fragment 1312. It is possible to see up to three additions.
Figure 16. Possible sequence of mercaptoethanol treated fragment 1312 Figure 17. Fragmentation spectrum of 1544. The sequences indicates are in reverse order, i.e. from C-terminus to N-terminus.
Figure 18. Possible structure of fragment 1312
Figure 19. Possible structure of the antimicrobial polypeptide
Figure 20. Genomic fragment encoding warnerin Figure 21. Warnerin without leader before and after post-translational modification
Figure 22. Sequences of SEQ ID NO:1 , SEQ ID NO:2 and SEQ ID NO:3
Table 1. Antibacterial peptide purification from the cultivation medium of S. warneri
IEGM KL-1
Table 2. Decline in antibacterial activity of fractions isolated after thermal treatment. Water bath 1002C Table 3. Minimal inhibitory concentration of low-molecular cationic peptide produced by S. warneri
Detailed description of the invention
Definitions
Peptide and polypeptide - are used interchangeably herein.
Isolated - is used to characterise polypeptides and polynucleotides disclosed herein that have been identified and separated and/or recovered from a component of their natural environment. Contaminant components of their natural environment are materials that would typically interfere with the various uses for the polypeptide, and may include proteinaceous and/or non-proteinaceous solutes.
About - When used in connection with the value for a molecular mass of a protein, "about" is meant to indicate a molecular mass close to (± 10%) the indicated value. E.g. "about 3000 Da" is meant to indicate between 2700 and 3300 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, or exactly 3000 Da.
Fragment - refers to a non-full-length part of a polypeptide. The length of fragments may vary from 2 amino acids to the full-length polypeptide minus one amino-acid residue. Preferably, fragments are less than 28 amino acids, e.g. less than 25 amino acids, such as less than 20 amino acids, e.g. less than 10 amino acids in length. However, in other preferred embodiments, fragments are more than 5, such as more than 10, e.g. more than 15, such as more than 20, e.g. more than 25, such as more than 27 amino acids in length. Expressed in another way, a fragment consists of a part of an amino-acid sequence which is less than 100% in length as compared to the full-length polypeptide. Preferably, the length of the fragment is between 10% and 99%, such as between 50% and 99%, for example between 75% and 99% of the length of the full-length polypeptide. Further preferred fragments are fragments containing at least 5, such as at least 7, e.g. at least 9, such as at least 11 , e.g. at least 13, such as at least 15, e.g. at least 17, such as at least 19, e.g. at least 21 , such as at least 23, e.g. at least 25, such as at leas 27 consecutive amino acids of the full-length warnerin polypeptide.
Variant- Variants can be naturally-occurring variants, but also variants that have not been found in nature. Furthermore, the invention also encompasses variants of fragments of the invention and variants of precursors of the invention. Variants are determined on the basis of their degree of identity or their homology with a predetermined amino-acid sequence, said predetermined amino-acid sequence preferably being selected from the group of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:25, SEQ ID NO:26 and SEQ ID NO:27; or, when the variant is a fragment, a fragment of one of these specific sequences. Accordingly, variants preferably have at least 50%, such as at least 75% sequence identity, for example at least 80% sequence identity, such as at least 85% sequence identity, for example at least 90% sequence identity, such as at least 92% sequence identity, for example at least 93% sequence identity, such as at least 94% sequence identity, for example at least 96% sequence identity, such as at least 98 % sequence identity with SEQ ID NO:27. Identities between amino-acid sequences may be calculated using well known algorithms, such as BLOSUM 30, BLOSUM 40, BLOSUM 45, BLOSUM 50, BLOSUM 55, BLOSUM 60, BLOSUM 62, BLOSUM 65, BLOSUM 70, BLOSUM 75, BLOSUM 80, BLOSUM 85, or BLOSUM 90.
Variants are also determined based on a predetermined number of conservative amino-acid substitutions as defined herein below. A conservative amino-acid substitution as used herein relates to the substitution of one amino acid within a predetermined group of amino acids for another amino acid within the same group, wherein the amino acids exhibit similar or substantially similar characteristics. Within the meaning of the term "conservative amino-acid substitution" as applied herein, one amino acid may be substituted for another within the groups of amino acids indicated herein below: i) Amino acids having aliphatic side chains (Gly, Ala, Val, Leu, lie) ii) Amino acids having cyclic side chains (Phe, Tyr, Trp, His, Pro) iii) Amino acids having acidic side chains (Asp, Glu) iv) Amino acids having basic side chains (Lys, Arg, His) v) Amino acids having amide side chains (Asn, Gin) vi) Amino acids having hydroxy side chains, and their dehydrated derivatives (Ser, Thr, Dha, Dhb) vii) Amino acids having sulphor-containing side chains (Cys, Met) viii) Lanthionine and methyllanthionine
The same variant or fragment thereof may comprise at least one conservative amino-acid substitution from one or more than one group of conservative amino- acids as defined herein above. Conservative substitutions may be introduced in any position of SEQ ID NO:26 or SEQ ID NO:27, and it may also be desirable to intro- duce non-conservative substitutions in any one or more positions. A non- conservative substitution leading to the formation of a functionally equivalent variant of warnerin would for example i) differ substantially in its effect on polypeptide backbone orientation such as substitution of or for Pro or Gly by another residue; and/or ii) differ substantially in electric charge, for example substitution of a negatively charged residue such as Glu or Asp for a positively charged residue such as Lys, His or Arg (and vice versa); and/or iii) differ substantially in steric bulk, for example substitution of a bulky residue such as His, Trp, Phe or Tyr for one having a minor side chain, e.g. Ala, Gly or Ser (and vice versa). Variants obtained by substitution of amino acids may in one preferred embodiment be made based upon the hydropho- bicity and hydrophilicity values and the relative similarity of the amino acid side- chain substituents, including charge, size, and the like. Exemplary amino-acid substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.
Variants may also differ from the pre-determined sequence in that one or more amino acids have been added or deleted. The addition or deletion of an amino acid is preferably an addition or deletion of from 1 to 20 amino acids, for example from 1 to 10 amino acids, such as from 1 to 5 amino acids, e.g. 1 ,2,3,4 or 5 amino acids.
In addition to the variants described above, sterically similar variants may be formulated to mimic the key portions of the polypeptide structure. This may be achieved by techniques of modelling and chemical designing known to those of skill in the art. It will be understood that all such sterically similar constructs fall within the scope of the present invention. In a further embodiment the present invention relates to functionally equivalent variants comprising substituted amino acids having hydrophilic or hydropathic indices that are within +/-2.5, for example within +/- 2.3, such as within +/- 2.1 , for example within +/- 2.0, such as within +/- 1.8, for example within +/- 1.6, such as within +/- 1.5, for example within +/- 1.4, such as within +/- 1.3 for example within +/- 1.2, such as within +/- 1.1 , for example within +/- 1.0, such as within +/- 0.9, for example within +/- 0.8, such as within +/- 0.7, for example within +/- 0.6, such as within +/- 0.5, for example within +/- 0.4, such as within +/- 0.3, for example within +/- 0.25, such as within +/- 0.2 of the value of the amino acid it has substituted. The importance of the hydrophilic and hydropathic amino acid indices in conferring interactive biologic function on a protein is well understood in the art (Kyte & Doolittle, 1982 and Hopp, U.S. Pat. No. 4,554,101 , each incorporated herein by reference). The amino acid hydropathic index values as used herein are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); ala- nine (+1.8); glycine (-0.4 ); threonine (-0.7 ); serine (-0.8 ); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (- 3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5) (Kyte & Doolittle, 1982). The amino acid hydrophilicity values are: arginine (+3.0); lysine (+3.0); aspartate (+3.0.+- .1 ); glutamate (+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine
(0); threonine (-0.4); proline (-0.5.+-.1); alanine (-0.5); histidine (-0.5); cysteine (- 1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4) (U.S. 4,554,101).
Antimicrobial activity - indicates the ability to kill microorganisms (a cidal activity) and/or prevent propagation or growth of microorganisms (a static activity). Antimicrobial activities include antibacterial, antifungal, antiparasitic as well as antiviral activity.
Unusual amino acids - in the present context, the term "unusual amino acids" refers to amino acids in antimicrobial peptides, such as lantibiotics, that are formed by post-translational modification, such as didehydroalanine (Dha), didehydroamino-2- butyric acid (Dhb), lanthionine, (beta)-methyllanthionine, and 2-aminobutyric acid (Abu). Didehydroalanine (Dha) can be formed by post-translational modification of serine residues, whereas didehydroamino-2-butyric acid (Dhb) can be formed by post-translational modification of threonine residues. Lanthionines can be formed from a dehydrated serine and a cysteine. The two parts of the resulting lanthionine are termed "Ala-part of lanthionine" herein. Methyllanthionines can be formed from a dehydrated threonine and a cysteine. The two parts of the resulting methyllan- thionine are termed "Abu-part of methyllanthionine" and "Ala-part of methyllanthionine" for the derivative of the dehydrated threonine and the derivative of the cysteine, respectively. See the figures for illustration.
Precursor - The term precursor refers to a polypeptide from which an antimicrobial peptide of the invention can be formed, preferably by post-translational modification. A precursor may or may not possess antimicrobial activity. Such post-translational modifications can include dehydration of specific hydroxyl amino acids and/or formation of thioether amino acids via addition of neighbouring cysteines to didehydro amino acids. A precursor can be a naturally-occurring precursor, or a precursor that has not been found in nature.
Purified - indicates that the polypeptide of the invention has been separated from other components such as cellular components, or other cell-derived or other components found in the culture medium. Preferably, purified indicates that the polypeptide makes up at least 50%, such as 60%, for example 70%, such as 80%, for example 90%, such as 95%, for example 98%, such as 99%, for example essentially 100% of the total macromolecular content of the composition on a weight or molecule basis.
Segment- refers to a part of a polypeptide, i.e. a part of the polypeptide chain.
Aspects of the invention
Polypeptides of the invention In a main aspect, the invention relates to an isolated antimicrobial polypeptide, wherein said polypeptide comprises the sequence Dha-Val-Val-Xaa1 -Dhb-Dhb- Xaa2-Xaa3-Ala (SEQ ID NO:1), wherein Xaa1 is Lys or Gin, Xaa2 is Leu or lie, Xaa3 is Lys or Gin, and comprises the sequence Lys-Gly-Ala-Xaa4-Xaa5-Xaa6-Xaa7-Xaa8-Xaa9-Asn-
Xaa10-Dhb-Gly-Lys-Xaa11 (SEQ ID NO:2), wherein Xaa4 is Thr or an Abu-part of a methyllanthionine, Xaa5 is Leu or lie, Xaa6 is Thr or an Abu-part of a methyllanthionine, Xaa7 is Gly or Cys or an Ala-part of a methyllanthionine, Xaa8 is Gly or Cys or an Ala-part of a methyllanthionine, Xaa9 is Cys or an Ala-part of a methyllanthionine, Xaa10 is Leu or lie, Xaa11 is Lys or Gin, and wherein SEQ ID NO:1 is located N-terminally of SEQ ID NO: 2, or a fragment, a variant, or a precursor of said polypeptide;
In another main aspect, the invention relates to an isolated antimicrobial polypeptide which has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids each individually selected from the group of Dha and Dhb;
In a further main aspect, the invention relates to an isolated antimicrobial polypeptide which is derivable, by post-translational modification, from the precursor sequence of SEQ ID NO:25 and/or the sequence of SEQ ID NO:26.
In a highly preferred embodiment, the polypeptide of the invention possess all three of the above defined characteristics, i.e. the polypeptide
- comprises the sequence Dha-Val-Val-Xaa1-Dhb-Dhb-Xaa2-Xaa3-Ala (SEQ ID NO:1), wherein Xaa1 is Lys or Gin, Xaa2 is Leu or He, and Xaa3 is Lys or Gin; and comprises the sequence Lys-Gly-Ala-Xaa4-Xaa5-Xaa6-Xaa7-Xaa8-Xaa9-Asn- Xaa10-Dhb-Gly-Lys-Xaa11 (SEQ ID NO:2), wherein Xaa4 is Thr or an Abu-part of a methyllanthionine, Xaa5 is Leu or lie, Xaa6 is Thr or an Abu-part of a methyllanthionine, Xaa7 is Gly or Cys or an Ala-part of a methyllanthionine, Xaa8 is Gly or Cys or an Ala-part of a methyllanthionine, Xaa9 is Cys or an Ala-part of a methyllanthionine, Xaa10 is Leu or lie, and Xaa11 is Lys or Gin; wherein SEQ ID
NO:1 is located N-terminally of SEQ ID NO: 2, and
- has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids, each individually selected from the group of Dha and Dhb; and
- is derivable, by post-translational modification, from the precursor sequence of SEQ ID NO:25 and/or the sequence of SEQ ID NO:26.
In another preferred embodiment, the isolated antimicrobial polypeptide - has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids each individually selected from the group of Dha and Dhb; and - comprises the sequence of SEQ ID NO:1. More preferably, the above polypeptide also comprises the sequence of SEQ ID NO:2.
Embodiments - SEQ ID NO:1 and SEQ ID NO:2
In some embodiments, Xaa1 is a lysine. In other embodiments, Xaa1 is a glutamine.
Independently thereof, Xaa2 is in some embodiments an isoleucine and in other embodiments a leucine.
Independently thereof, Xaa3 is in some embodiments a lysine and in other embodiments a glutamine. Independently thereof, Xaa4 is in some embodiments a threonine and in other embodiments an Abu-part of a methyllanthionine.
Independently thereof, Xaa5 is in some embodiments an isoleucine and in other embodiments a leucine.
Independently thereof, Xaa6 is in some embodiments a threonine and in other embodiments an Abu-part of a methyllanthionine.
Independently thereof, Xaa7 is in some embodiments a glycine, in other embodiments a cysteine and in yet other embodiments an Ala-part of a methyllanthionine.
Independently thereof, Xaa8 is in some embodiments a glycine, in other embodiments a cysteine and in yet other embodiments an Ala-part of a methyllanthionine.
Independently thereof, Xaa9 is in some embodiments a cysteine and in other embodiments an Ala-part of a methyllanthionine.
Independently thereof, Xaa10 is in some embodiments a leucine and in other embodiments an isoleucine.
Independently thereof, Xaa11 is in some embodiments a lysine and in other embodiments a glutamine.
In preferred embodiment, Xaa4 and Xaa6 are both an Abu-part of a methyllanthionine and Xaa7 and Xaa9 are both an Ala-part of methyllanthionine and these four residues form two methyllanthionines.
In a more preferred embodiment, Xaa4 forms a methyllanthionine with Xaa7 and Xaa6 forms a methyllanthionine with Xaa9. In another more preferred embodiment, Xaa4 forms a methyllanthionine with Xaa9 and Xaa6 forms a methyllanthionine with Xaa7. In a preferred embodiment of the polypeptide of the invention, a polypeptide segment of about 541 Da separates the segments defined in SEQ ID NO:1 and SEQ ID NO:2. In another preferred embodiment of the polypeptide of the invention, the segment defined in SEQ ID NO:1 is preceded by a polypeptide segment of about 143 Da. In a yet further preferred embodiment of the polypeptide of the invention, the sequence of SEQ ID NO:2 comprises the C-terminus of the polypeptide. Furthermore, the polypeptide of the invention preferably contains no aspartic acid and no glutamic acid residues.
In a highly preferred embodiment, the polypeptide of the invention comprises the sequence of SEQ ID NO:27, even more preferably comprising thioether linkages located as shown in figure 21.
As described above, the invention relates in one aspect to an isolated antimicrobial polypeptide which is derivable, by post-translational modification, from the precursor sequence set forth in SEQ ID NO:25 and/or the sequence of SEQ ID NO:26. Said post-translational modification is preferably a type of modification which can be performed by Staphylococcus warneri. In preferred embodiments, the post- translational modification comprises removal of the leader peptide and/or dehydration of at least one serine and/or threonine. In a more preferred embodiment, it comprises dehydration of all serines and threonines. Furthermore, in preferred embodiments, the post-translational modification further comprises formation of at least one thioether linkage. More preferably, 3 thioether linkages are formed.
Preferably, the polypeptide of the invention has antibacterial activity against Staphylococcus epidermis. The polypeptide preferably preserves its antibacterial action after boiling for 5 min of an aqueous solution of the polypeptide at a concentration of 1 micrograms/ml and/or after freezing and storage at -18QC for 36 months. In some embodiments, the polypeptide of the invention contains two preferred cleavage sites for trypsin.
In preferred embodiments, the polypeptide of the invention is isolated and/or purified. Fragments, variants and precursors
The invention also relates to fragments, variants and precursors of the above defined polypeptide of the invention. Preferred are fragment variants and precursors of SEQ ID NO:27. Fragments, variants and precursors have been defined above. The invention also relates to variants of fragments of the polypeptide of the invention, to variants of precursors of the polypeptide of the invention, and to fragments of precursors of polypeptides of the invention.
Preferred fragments are fragments with a length of at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90% of the length of the polypeptide of the invention. In preferred embodiments, a variant or precursor of a polypeptide of the invention has at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90% sequence identity to said polypeptide.
Preferred fragments and variants have retained at least some or all of the antimicrobial activity of the polypeptide of the invention. Without being bound by a specific theory, it is expected that the methyllanthionine and lanthionine residues are important for the activity of the peptide. Thus, variants or fragments of the polypeptide of the invention that comprise at least one, such as two, more preferably three, meth- ylanthionines or lanthionines are preferred. Highly preferred are variants or fragments of SEQ ID NO:27 that comprise at least one, such as two, more preferably three, methylanthionines or lanthionines. Furthermore, without being bound by a specific theory, it is anticipated that the high pi and the lysine residues are important for the activity of the polypeptide. Thus, preferred fragments and variants of the invention, have a pi of more than 9, such as more than 10. Furthermore, fragments and variants of the polypeptide of the invention preferably have more than 5 positively charged residues, such as more than 6, more than 7, more than 8 or more than 9 positively charged residues, preferably lysines or arginines, most preferably lysines.
In one embodiment, the invention relates to a precursor comprising the sequence set forth in SEQ ID NO:3. In a preferred embodiment, the invention relates to a precursor comprising the sequence set forth in SEQ ID NO:26, such as the precursor set forth in SEQ ID NO:25. Precursors of the polypeptides of the invention can e.g. be used to synthesise polypeptide of the invention in vitro.
Antimicrobial activity Preferably, the antimicrobial activity of the polypeptide, fragment, variant or precursor of the invention is an antibacterial activity. Furthermore, preferably, the minimal inhibitory concentration against S. epidermis 33 under the test-conditions described herein in the examples is 5 micrograms/ml or less. For fragments or variants with a different molecular mass, the minimal inhibitory concentration against S. epidermis 33 under the test-conditions described herein in the examples is preferably a molar concentration which is equivalent to 5 micrograms/ml of the peptide of SEQ ID NO:27 or less. More preferably, the minimal inhibitory concentration is, or is equivalent to, 2 micrograms SEQ ID NO:27-peptide/ml or less, for example 1 microgram/ml or less, such as 0.5 micrograms/ml or less, for example 0.25 micrograms/ml or less, such as 0.1 micrograms/ml or less, for example 0.05 micrograms/ml or less such as 0.02 micrograms/ml or less, for example 0.01 micrograms/ml or less against S. epidermis 33 under the test-conditions described herein in the examples.
Methods for production of warnerin The invention also relates to isolated polynucleotides comprising a sequence encoding a polypeptide of the invention or a variant, fragment or precursor of the invention. In a preferred embodiment, the polynucleotide of the invention is the sequence of SEQ ID NO:24 or a variant of fragment thereof. Such polynucleotides can be obtained or constructed using standard techniques known in the art and be used in production of the polypeptide. For example, such polynucleotides can be introduced into the original production strain by transformation in order to obtain a strain with multiple copies of a polynucleotide encoding the polypeptide of the invention. This would normally result in the production of larger amounts of the polypeptide. Furthermore, such polynucleotides can be introduced into a heterologous production organism. The term 'heterologous' refers to any other strain or species than the one from which the polypeptide originates (i.e. any other strain than S. warneri IEGM KL1), preferably another Staphylococcus species. Such warnerin-overproducing homologous strains and wamerin-producing heterologous strains are a further aspect of this invention. Methods for protein engineering and heterologous production of lantibiotics have been described in e.g. Kuipers et al.(1996) Ant. v. Leeuwenhoek 69:161-169 and Heidrich et al. (1998) Appl. Environ. Microbiol. 64: 3140-3146. The invention furthermore relates to an expression vector comprising a polynucleotide of the invention and to a heterologous host cell comprising such an expression vector and/or a polynucleotide of the invention. Furthermore, the invention relates to Staphylococcus warneri ACE Neo-mut-DSM 16081 strain which has been deposited at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) under the registration nr.: Staphylococcus warneri ACE Neo-mut-DSM 16081.
Purification and purity
The polypeptide of the invention is preferably purified. In a further aspect, the invention relates to a method for producing a polypeptide, fragment, variant or precursor as defined herein, comprising the steps of a. culturing a strain capable of producing said polypeptide, fragment, variant or precursor under conditions wherein the polypeptide is produced, b. harvesting the polypeptide from the culture, and c. purifying the polypeptide.
In preferred embodiments, the purification in step c. is continued until the polypeptide of the invention comprises at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90%, such as at least 95%, for example at least 98%, such as at least 99%, for example essentially 100% of the total protein content, e.g. using the procedures described herein in the Examples. Methods for quantifying the degree of purification are well-known to those skilled in the art.
Compositions
In another main aspect, the invention relates to compositions comprising a carrier and a polypeptide, fragment, variant or precursor as defined herein. Such warnerin- containing compositions are preferably stabilised using methods known in the art, such as the methods described in US 5,763,395. Suitable carriers are defined below. In preferred embodiments, the polypeptide, fragment, variant or precursor makes up at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90%, such as at least 95%, for example at least 98%, such as at least 99%, for example essentially 100% of the total protein content of the composition. In a further aspect, the invention relates to a composition comprising an antimicrobial polypeptide, a carrier and optionally other substances, wherein the polypeptide has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids each individually selected from the group of Dha and Dhb. and wherein said polypeptide makes up at least 1 %, such as at least 5%, for exam- pie at least 10%, such as at least 20%, for example at least 30%, such as at least
40%, for example at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90%, such as at least 95%, for example at least 98%, such as at least 99%, for example essentially 100% of the total protein content (w/w) of the composition.
Pharmaceutical compositions and formulations
In an important aspect, the invention relates to a pharmaceutical composition comprising a polypeptide, fragment, variant or precursor of the invention and a pharma- ceutically-acceptable carrier.
As used herein, "pharmaceutically-acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption-delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conven- tional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
In one embodiment, the pharmaceutical composition is suitable for topical admini- stration. For oral prophylaxis, the polypeptide may be incorporated with excipients and used in the form of non-ingestible mouthwashes and dentifrices. A mouthwash may be prepared incorporating the active ingredient in the required amount in an appropriate solvent, such as a sodium borate solution (Dobell's Solution). Alternatively, the active ingredient may be incorporated into an antiseptic wash containing sodium borate, glycerin and potassium bicarbonate. The active ingredient may also be dispersed in dentifrices, including gels, pastes, powders and slurries. The active ingredient may be added in a therapeutically effective amount to a paste dentifrice that may include water, binders, abrasives, flavouring agents, foaming agents, and humectants.
The active compounds may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or they may be enclosed in hard or soft shell gelatin capsule, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet. For oral therapeutic administration, the active compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of the unit. The amount of active compounds in such therapeutically useful compositions is such that a suitable dosage will be obtained. The tablets, troches, pills, capsules and the like may also contain the following: a binder, as gum tragacanth, acacia, cornstarch, or gelatin; excipients, such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin may be added or a flavouring agent, such as peppermint, oil of wintergreen, or cherry flavouring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. In addition, the active compounds may be incorporated into sustained-release preparation and formulations.
The active compounds may also be administered parenterally, e.g., formulated for intravenous, intramuscular, or subcutaneous injection. Solutions of the active com- pounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and ster- ile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dis- persion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilisation. Generally, dispersions are prepared by incorporating the various steril- ised active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previ- ously sterile-filtered solution thereof.
Uses
Polypeptides, fragments, variants, precursors, compositions and pharmaceutical compositions of the invention can be used to combat microorganisms in any envi- ronment capable of sustaining microbial growth. This refers to any fluid, substance or organism where microbial growth can occur or where microbes can exist. Such environments can be, for example, animal tissue or bodily fluids, water and other liquids, food, food products or food extracts, crops and certain inanimate objects. It is not necessary that the environment promotes the growth of the microbe, only that it permits its subsistence. Any use for which nisin, subtilin or other known lantibiotics are used are also envisioned for the polypeptides of this invention and fragments, variants or precursors thereof. A preferred use is use as a food additive. The inven¬ tion thus also relates to an edible product comprising a polypeptide, fragment, variant or precursor as defined herein in an amount sufficient to prevent undesirable microbial growth and/or kill undesirable microorganisms. Preferably, said edible product is a meat or diary product. The invention also relates to use of a polypeptide, fragment, variant or precursor as defined herein for the preparation of such an edible product.
Clinical uses, indications and medical treatment
The present invention relates to methods for treating and preventing infections by administering to an individual in need thereof a therapeutically-effective amount of a polypeptide, fragment, variant or precursor of the invention as defined herein.
In one embodiment, the polypeptide, fragment, variant, precursor or pharmaceutical composition of the invention as defined herein is used for the prevention (i.e. prophylaxis) or treatment of microbial infection in a mammal, preferably a human being.
The invention also relates to the polypeptide, fragment, variant, precursor or phar- maceutical composition of the invention for use as a medicament and to use of the polypeptide, fragment, variant, precursor or pharmaceutical composition of the invention for the manufacture of a medicament for the prevention or treatment of microbial infection in a mammal. In preferred embodiments, said mammal is a human being. Preferably, said infection is a bacterial infection, more preferably caused by Gram-positive bacteria.
The invention furthermore relates to a kit of parts comprising a polypeptide, fragment, variant, precursor, composition or pharmaceutical composition of the invention as defined herein, and a scheme instructing a user of the dosage to be used in function of the weight and/or age and/or clinical diagnosis of an individual that is to be treated for an antimicrobial infection. The polypeptide of the invention may be used alone or in combination with other active compounds. Non-limiting examples of such other active compounds are compounds that have antimicrobial activity or compounds that stimulate the immune system of the host. In treatment of infectious agents towards which the polypeptide of the invention has only poor activity, the polypeptide of the invention may be useful as an enhancer of the activity of another compound. Effects of combinations of the polypeptide of the invention with other compounds may be additive or synergistic.
Patients suitable for treatment may be identified by well-established hallmarks of an infection, such as fever, pus, culture of organisms, and the like. Infections that may be treated with polypeptides of the invention include those caused by or due to microorganisms. Examples of microorganisms include bacteria (e.g. Gram-positive, Gram-negative), fungi, (e.g. yeast and moulds), parasites (e.g. protozoans, nema- todes, cestodes and trematodes), and viruses. Specific organisms in these classes are well known (see for example, Davis et al., Microbiology, 3rd edition, Harper & Row, 1980).
More specifically, clinical indications include, but are not limited to: 1/infections following insertion of intravascular devices or peritoneal dialysis catheters; 2/infection associated with medical devices or prostheses; 3/infection during hemodialysis; 4/S. aureus nasal and extra-nasal carriage; 5/burn wound infections; 6/surgical wounds, 7/acne, including severe acne vulgaris; 8/nosocomial pneumonia; 9/meningitis; 10/cystic fibrosis; 11 /infective endocarditis; 12/osteomyelitis; and 13/sepsis in an immunocompromised host.
1/lnfections following insertion of contaminated intravascular devices, such as central venous catheters, or peritoneal dialysis catheters. These catheters are cuffed or non-cuffed, although the infection rate is higher for non-cuffed catheters. Both local and systemic infection may result from contaminated intravascular devices. More than 25,000 patients develop device-related bacteremia in the United States each year. The main organisms responsible are coagulase-negative staphylococci (CoNS), Staphylococcus aureus, Enterococcus spp, E. coli and Candida spp.
The polypeptide of the invention and/or antibiotic, preferably as an ointment or cream, can be applied to the catheter site prior to insertion of the catheter and then again at each dressing change. The polypeptide may be incorporated into the ointment or cream at a concentration preferably of about 0.5 to about 2% (w/v)
2/lnfection associated with medical devices or prostheses, e.g. catheter, grafts, prosthetic heart valves, artificial joints, etc. One to five percent of indwelling prostheses become infected which usually requires removal or replacement of the prostheses. The main organisms responsible for these infections are CoNS and S. aureus. Preferably, the polypeptide of the invention and/or other antibiotic can be coated, either covalently bonded or by any other means, onto the medical device either at manufacture of the device or after manufacture but prior to insertion of the device. In such an application, the polypeptide is preferably applied as a 0.5 to 2% solution.
3/lnfection during hemodialysis. Infection is the second leading cause of death in patients on chronic hemodialysis. Approximately 23% of bacteremias are due to access-site infections. The majority of graft infections are caused by coagulate- positive (S. aureus) and coagulate-negative staphylococci. To combat infection, the polypeptide alone or in combination with an antibiotic can be applied as an ointment or cream to the dialysis site prior to each hemodialysis procedure.
4/S. aureus nasal and extra-nasal carriage. Infection by this organism may result in impetigenous lesions or infected wounds. It is also associated with increased infection rates following cardiac surgery, hemodialysis, orthopedic surgery and neutrope- nia, both disease-induced and iatrogenic. Nasal and extra-nasal carriage of staphylococci can result in hospital outbreaks of the same staphylococci strain that is colo- nising a patient's or hospital worker's nasal passage or extra-nasal site. Much attention has been paid to the eradication of nasal colonisation, but the results of treatment have been generally unsatisfactory. The use of topical antimicrobial substances, such as Bacitracin, Tetracycline, or Chlorhexidine, results in the suppression of nasal colonisation, as opposed to its eradication. The polypeptide of the in- vention alone or in combination with an antibiotic are preferably applied intra- nasally, formulated for nasal application, as a 0.5 to 2% ointment, cream or solution. Application may occur once or multiple times until the colonisation of staphylococci is reduced or eliminated. 5/Burn wound infections. Although the occurrence of invasive burn wound infections has been significantly reduced, infection remains the most common cause of morbidity and mortality in extensively burned patients. Infection is the predominant determinant of wound healing, incidence of complications, and outcome of burn pa- tients. The main organisms responsible are Pseudomonas aeruginosa, S. aureus, Streptococcus pyogenes, and various Gram-negative organisms. Frequent de- bridements and establishment of an epidermis, or a surrogate such as a graft or a skin substitute, is essential for prevention of infection. The polypeptide alone or in combination with antibiotics can be applied to burn wounds as an ointment or cream and/or administered systemically. Topical application may prevent systemic infection following superficial colonisation or eradicate a superficial infection. The polypeptide is preferably administered as a 0.5 to 2% cream or ointment. Application to the skin could be done once a day or as often as dressings are changed. The systemic administration could be by intravenous, intramuscular or subcutaneous injections or infusions. Other routes of administration can also be used.
6/Surgical wounds, especially those associated with foreign material, e.g. sutures. As many as 71% of all nosocomial infections occur in surgical patients, 40% of which are infections at the operative site. Despite efforts to prevent infection, it is estimated that between 500,000 and 920,000 surgical wound infections complicate the approximately 23 million surgical procedures performed annually in the United States. The infecting organisms are varied but staphylococci are important organisms in these infections. The polypeptide alone or with an antibiotic may be applied as an ointment, cream or liquid to the wound site or as a liquid in the wound prior to and during closure of the wound. Following closure, the antimicrobial polypeptide can be applied at dressing changes. For wounds that are infected, the peptide antibiotic could be applied topically and/or systemically.
7/Acne, including severe acne vulgaris. This condition is due to colonisation and infection of hair follicles and sebaceous cysts by Propionibacterium acne. Most cases remain mild and do not lead to scarring although a subset of patients develop large inflammatory cysts and nodules, which may drain and result in significant scarring. The antimicrobial polypeptide alone or with an antibiotic can be incorporated into soap or applied topically as a cream, lotion or gel to the affected areas either once a day or multiple times during the day. The length of treatment may be for as long as the lesions are present or used to prevent recurrent lesions. The peptide antibiotic could also be administered orally or systemically to treat or prevent acne lesions.
8/Nosocomial pneumonia. Nosocomial pneumonias account for nearly 20% of all nosocomial infections. Patients most at risk for developing nosocomial pneumonia are those in intensive care units, patients with altered levels of consciousness, elderly patients, patients with chronic lung disease, ventilated patients, smokers and post-operative patients. In a severely-compromised patient, multiantibiotic-resistant nosocomial pathogens are likely to be the cause of the pneumonia. The main organisms responsible are P. aeruginosa, S. aureus, Klebsiella pneumoniae and En- terobacter spp. The polypeptide alone or in combination with other antibiotics can be administered systemically to treat pneumonia. Administration could be once a day or multiple administrations per day. The antimicrobial polypeptide can also be admin- istered directly into the lung via inhalation or via installation of an endotracheal tube.
9/Meningitis. Bacterial meningitis remains a common disease world-wide. Approximately 25,000 cases occur annually, of which 70% occur in children under 5 years of age. Despite an apparent recent decline in the incidence of severe neurologic sequelae among children surviving bacterial meningitis, the public health problems as a result of this disease are significant world-wide. The main responsible organisms are H. influenzae, Streptococcus pneumoniae and Neisseria meningitidis. Community-acquired drug-resistant S. pneumoniae axe emerging as a widespread problem in the United States. The polypeptide of the invention alone or in combina- tion with known antibiotics can be administered systemically to treat meningitis. The preferred route would be intravenously either once a day or multiple administration per day. Treatment would preferably last for up to 14 days.
10/Cystic f ibrosis. Cystic fibrosis (CF) is the most common genetic disorder of the Caucasian population. Pulmonary disease is the most common cause of premature death in cystic fibrosis patients. Optimum antimicrobial therapy for CF is not known, and it is generally believed that the introduction of better anti-pseudomonal antibiotics has been the major factor contributing to the increase in life expectancy for CF patients. The most common organisms associated with lung disease in CF are S. aureus , P. aeruginosa and H. influenzae. The polypeptide alone or in combination with other antibiotics could be administrated orally or systemically or via aerosol to treat cystic fibrosis. Preferably, treatment is effected for up to 3 weeks during acute pulmonary disease and/or for up to 2 weeks every 2-6 months to prevent acute exacerbations.
11/lnfective endocarditis. Infective endocarditis results from infection of the heart valve cusps, although any part of the endocardium or any prosthetic material inserted into the heart may be involved. It is usually fatal if untreated. Most infections are nosocomial in origin, caused by pathogens increasingly resistant to available drugs. The main organisms responsible are Viridans streptococci, Enterococcus spp, S. aureus and CoNS. The antimicrobial polypeptide alone or in combination with other antibiotics could be administered orally or systemically to treat endocarditis, although systemic administration would be preferred. Treatment is preferably for 2-6 weeks in duration and may be given as a continuous infusion or multiple admini- stration during the day.
12/Osteomyelitis. In early acute disease the vascular supply to the bone is compromised by infection extending into surrounding tissue. Within this necrotic and ische- mic tissue, the bacteria may be difficult to eradicate even after an intense host re- sponse, surgery, and/or antibiotic therapy. The main organisms responsible are S. aureus, E. coli, and P. aeruginosa. The antimicrobial polypeptide could be administered systemically alone or in combination with other antibiotics. Treatment would be 2-6 weeks in duration. The peptide antibiotic could be given as a continuous infusion or multiple administration during the day. The polypeptide of the invention could be used as an antibiotic-impregnated cement or as antibiotic coated beads for joint replacement procedures.
13/Sepsis in immunocompromised host. Treatment of infections in patients who are immunocompromised by virtue of chemotherapy-induced granulocytopenia and im- munosuppression related to organ or bone marrow transplantation remains a considerable challenge. The neutropenic patient is especially susceptible to infection, so antimicrobial therapy should be initiated promptly to cover likely pathogens, if infection is suspected. Organisms likely to cause infections in granulocytopenic patients are: S. epidermidis, S. aureus, S. viridans, Enterococcus spp, E. coli, Klebsiella spp, P. aeruginosa and Candida spp. The antimicrobial peptide of the invention alone or with another antibiotic is preferably administered orally or systemically for 2-6 weeks in duration. The peptide could be given as a continuous infusion or multiple administration during the day.
Effective treatment of infection may be examined in several different ways. The patient may exhibit reduced fever, a reduced number of microorganisms, a lower level of inflammatory molecules (e.g., IFN-.gamma., IL-12, IL-1 , TNF), and the like. The in vivo therapeutic efficacy from administering an antimicrobial polypeptide and antibiotic agent in combination is based on a successful clinical outcome and does not require 100% elimination of the organisms involved in the infection. Achieving a level of antimicrobial activity at the site of infection that allows the host to survive or eradicate the microorganism is sufficient. When host defences are maximally effective, such as in an otherwise healthy individual, only a minimal antimicrobial effect may suffice. Thus, reducing the organism load by even one log (a factor of 10) may permit the defences of the host to control the infection. In addition, clinical therapeutic success may depend more on augmenting an early bactericidal effect than on the long-term effect. These early events are a significant and critical part of therapeutic success, because they allow time for the host defence mechanisms to activate. This is especially true for life-threatening infections (e.g. meningitis) and other serious chronic infections (e.g. infective endocarditis).
Another preferred use according to the invention is use of the polypeptide, fragment, variant or precursor of the invention for coating of a medical device. The invention also relates to a medical device, such as a catheter, coated with a polypeptide, fragment, variant or precursor of the invention.
Examples
Example 1. Bacterial strains and cultivation conditions
The strain producing the low-molecular-weight antibacterial peptide was isolated from air in laboratory compartments in 1996 at the Laboratory of the Biochemistry of Microorganisms at the Institute of Ecology and Genetics of Microorganisms, Ural Branch of the Russian Academy of Sciences, Perm, Russia. The bacterial strain was identified as being a strain of Staphylococcus warneri and deposited at the Ta- rasevitch Institute as Staphylococcus warneri IEGM KL1 , No. 260. Strains of Micro- coccus luteus, Staphylococcus epidermidis 33, Staphylococcus aureus 209P; Streptococcus pyogenes were received from the Tarasevitch Institute. The strain E. coli M17 was received from the Scientific-Production Association "Biomed", Perm, Russia. Strains Corynebacterium ammoniagenes, , Rhodococcus ruber, Bacillus subtilis were obtained from the Regional Collection of Alkanotrophic Microorganisms IEGM UB RAS, Perm, Russia.
Cultivation of the bacterial strain IEGM KL1 was carried out on a rich nutrient Lauria Broth (LB) medium containing 1 % Tryptone (Difco), 0.5% yeast extract, and 0.64% KCI under aeration at 37SC. Cultivation of other bacterial strains was carried out in the specified standard media of the suppliers. Typical curves for the warnerin producer's growth and for the level of antibacterial factors in the medium are represented in Fig.1.
Example 2. Secretion of an antibacterial factor from a producer strain into the growth medium
Determination of the level of antibacterial activity in preparations was carried out in immunological plates based on the principle of two-fold dilution of aliquots from cultivation media in LB medium (Fig. 2). One hundred microliters of LB medium were introduced into each well of the plate. The first well was supplemented with 100 mi- croliters of cultivation media that had been cleared by centrifugation (10000 g, 10 min) under sterile conditions followed by boiling for 5 min. By sequential transfer of 100 microliters content from the first well, a serial dilution series was made ranging from 1:2 to 1 :256.. Ten microliters of S. epidermidis test-culture was subsequently added a to each well. This test culture was prepared as follows: Cells from the loga- rithmic growth phase were washed twice with fresh cultivation medium and centrifugation at 10000 g for 10 minutes. Cells were then resuspended in fresh culture medium at a density of 1.8-2.0 x 105 CFU/ml and used as test culture. The efficacy of the inhibiting action of the preparations was evaluated after 12-16 hours of cultivation at 37SC. The quantity of antibacterial factor in the preparations under investiga- tion was expressed in arbitrary units (AU) that represented reciprocal of the amounts from maximum dilutions at which a complete lack of growth of the S. epidermidis indicator strain was observed. To test the antibacterial peptide activity on a solid medium, the indicator culture S. epidermidis was added to a 0.7% LB-agar medium at a concentration of 1.8-2.0 x 104 CFU/ml. Five microliters of culture supernatants was added to aga- rose in Petri dishes. The antibacterial action was detected by the formation of areas of bacterial cell lysis at the sites of application after 12-16 hours of incubation at 37eC. To increase the sensitivity of the visual evaluation of the antibacterial action of the aqueous solution, triphenyltetrazolium chloride was introduced to a final con- centration of 0.1% at the end of the incubation period. The same solution was layered onto the LB-agar surface during the tests on dishes. A typical example of such tests for the level of the antibacterial factor production in the cultivation medium is represented in Fig.3.
Example 3. Isolation and purification of the antibacterial peptide
250 ml flasks containing 50 ml medium were inoculated with a 18-hour S. warneri IEGM KL1 culture to OD540 = 0.02-0.03 absorbance units, and cultivated at 37SC on a rotary shaker at 160 rpm for 8-10 hours to an OD540 of 2.0-2.5. Cells were precipitated by centrifugation at 4000 g for 15 min. Supernatants were incubated at 95SC for 20 minutes and re-centrifuged under the same conditions to precipitate insoluble components. The cleared supernatant was then added to a Heparin-agarose column (Sigma) that was equilibrated with 0.05 M phosphate buffer, pH 7.2. The column was washed with two-fold buffer volume compared to supernatant, and a linear 0- 0.5 M NaCI gradient in 0.05 M phosphate buffer, pH 7.2 was applied. Fractions were collected and examined for the level of antibacterial activity. A typical example of a chromatographic isolation of the antibacterial peptide from supernatant fractions is presented in Fig.4. Fractions that exhibited antibacterial activity were combined and desalted using PD-10 columns (Pharmacia, Sweden). A typical result of a desalination is presented in Fig.5. After desalination, fractions that exhibited antibacterial activity were selected pooled and lyophilised. The heterogeneity of lyophilised fractions was examined by PAGE. The peptide compound was visualised by silver staining and detection of antibacterial activity after the electrophoresis was carried out using a "gel overlay" method. Typical results of both tests are given in Fig.6.
Reverse Phase High Performance Liquid Chromatography (Applied Biosystems) on a C-18 carrier using different acetonitrile gradients was used for the isolation of the purified antibacterial peptide fraction. Vessel A contained 0.1 % trifluoroacetate, vessel B - 80% acetonitrile in 0.1% trifluoroacetate. A steep gradient of acetonitrile was used for initial isolation of the purified antibacterial peptide fraction. Fractions pos- sessing antibacterial activity were collected, lyophilised, and re-subjected to chro- matography with a more gentle acetonitrile gradient up to the release of a homogenous fraction exhibiting antibacterial activity (Fig.7). Homogenous peptide fractions obtained were combined, lyophilised, and used to characterise the physical- chemical properties and antibacterial activity of warnerin. An overview of the purifi- cation is shown in Table 1.
Example 4. Study of Physical-Chemical Characteristics of Warnerin
Thermal stability
To study thermal stability, aqueous solutions of warnerin at a concentration of 1 μg/ml were prepared and held in a boiling water bath for up to 60 minutes. Samples were then frozen at -18QC and stored for 60 min, 24 hours, or several months. Results of the heat treatment are shown in Table 2. Freezing and storing for long periods at -18eC did not affect the antibacterial activity. Similar solutions of peptides isolated were examined for the resistance to enzymatic action. The addition of DNAse (1 mg/ml) and RNAse (1 mg/ml) to warnerin solutions did not result in any alteration in antibacterial activity after incubation at 379C for 2 hours. However, treatment with proteinase K (1 mg/ml) under similar conditions lead to loss of antibacterial activity. Similar observations occurred after treatment with trypsin (1 mg/ml) after a 12 hour-incubation (shown in Fig.8).
Mass spectrometric analysis
Mass spectrometric analysis was done using MALDI-TOF (internal calibration) and ESI-MS. The exact mass of the intact peptide as determined by ESI-MS was (monoisotopic): 2997.88 Da. The exact mass of the intact peptide by MALDI-MS was: 2998.75 Da (M+H) monoisotopic: 2997.74 Da. (Shown in Fig. 9 and 10)
Digest analysis
The protease trypsin cleaves proteins at the C-terminal side of Arg and Lys amino acids. Digestion of the intact peptide with trypsin gave mainly two fragments of mass 1312 Da and 1705 Da. This fits with the splitting of the intact protein into two parts with addition of one molecule of water (1704 Da + 1311.65 Da - 18 Da = 2997 Da). The observation of loss of 128 Da during treatment with trypsin from both the intact protein 2998 Da (peak at 2870 Da) and from the 1312 Da fragment (1184 Da) indicates that either the N-terminal is a Lys or the 2nd amino acid from the C-terminal is an Arg or Lys and the C-terminal end a Lys or a Gin (See Fig.11 ). The exact masses of the two fragments found by MS were:
Exact masses of the 1312 Da peptide by MALDI-MS: 1312.65 Da (M+H) monoiso- tope 1311.64 Da Exact masses of the 1705 Da peptide by MALDI-MS: 1705.03 Da (M+H) monoiso- tope 1704.02 Da. (See Fig. 12).
Reaction of the intact peptide with ethanethiol or mercaptoethanol The thio-ether bond found in lantibiotics (the lanthionine structure) is very stable and will not break during reduction. To break this bond, a reaction was done with either ethanethiol or mercaptoethanol. This reaction will transform Dha and Dhb into new products. See figure 13 for a description of these reactions.
The intact peptide showed up to 7 additions of mercaptoetanol/ethanthiol (Fig. 14). Since each lanthionine, Dha and Dhb will give one addition, we expect the intact peptide to have 7 of these unusual amino acids.
Reaction of fragment 1312 with ethanethiol or mercaptoethanol The 1312 Da fragment was isolated by HPLC after digestion and used in addition reactions to collect more sequence information and to be used in MS/MS fragmentation studies. The fragment was shown to be the C-terminal fragment and therefore will have an Arg-Lys, Arg-Gln, Lys-Lys or Lys-Gln as the C-terminus. During addition-reaction up to three additions were observed. (See Fig. 15)
The different products were used in MS/MS fragmentation studies. Especially the data from a 1544 Da fragment were very good and these were used in the sequence identification. The peptide with a mass of 1544 Da corresponds to the 1312 Da peptide plus addition of three mercaptoethanol-groups and loss of 2 Da during disulfide- bridge formation. Investigation of the fragmentation spectrum gave the possible se- quence shown in figure 16. This structure will lead to the possible original structures shown in figures 17 and 18. The placement of the thio-ether bonds is not verified and the C-terminal Lys may be a Gin. Furthermore, the method does not discriminate between the lie and Leu amino acids. The sequence can be prepared from an unmodified precursor peptide comprising the following sequence: Gly-Ala-Thr-lle/Leu-Thr-Gly/Cys-Cys/Gly-Cys-Asn-Leu/lle- Thr-Gly-Lys-Lys/Gln (SEQ ID NO:3) (figure 22 shows SEQ ID NO:1-3).
Similarly, the N-terminal part of the polypeptide was analysed. The N-terminal part was isolated by RP-HPLC (molecular weight of 1705 Da) and allowed to react with beta-mercaptoethanol to give between 2 and 4 substitutions. Subsequently, fragmentation studies were carried out wherein MALDI-TOF/TOF and ESI-MS/MS were used.
Figure 19 shows a possible sequence in accordance with the information obtained.
Example 5. Detection of the antibacterial action of warnerin
The antibacterial activity of warnerin towards a test-culture of S. epidermidis and the other above-mentioned bacteria was tested by two-fold dilution of peptide samples.
Test plates for immunological reactions with round bottom wells were used. 100 microliters of LB medium were pipetted into each well. 100 microliters of warnerin were introduced into the first well of a row, mixed, and 100 microliters of the peptide solution obtained were transferred to the next well of a row, etc., thus creating a sequential serial dilution series. A bacterial test-culture inoculum (10 microliters, prepared as above) was added to each well creating an initial cell concentration of 2 x 104 CFU/ml. Results are shown in Table 3.
Example 6. Cloning and seguencing of the warnerin gene Cloning of the warnerin gene
The warnerin gene was obtained via sequencing from genomic DNA of Staphylococcus warneri ACE Neo-mut-DSM 16081 strain (a mutation which was introduced via UV incubation and led to higher production of the peptide). The mutation was not genetically analysed or specified. The Staphylococcus warneri ACE Neo-mut-DSM 16081 strain has been deposited at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) under the registration nr.: Staphylococcus warneri ACE Neo-mut-DSM 16081.
Genomic DNA was prepared using a modified protocol originally provided by Qiagen. The modification included mainly the addition of high amounts of lysostaphin (1 OOU per 2 x 108 bacteria), which was required to break the Staphylococcus warneri mutated strain. Sequencing was done according to standard protocols at the ABI 3100 Sequencer. Cloning was performed into the cloning vectors pBad and pET101 , both obtained from Invitrogen via standard PCR-cloning proto- cols.
Primers which were used for sequencing Staphylococcus warneri ACE Neo-mut- DSM 16081 genomic DNA, which finally led to the DNA sequence of the gene encoding the peptide:
Neo fw stump verl .95'-GAG TTG TTA AAA CTA CTA TTA A-3' (SEQ ID NO:4) Neo rw ver3.9 5'-TTT TCA GTA ATG TTA CAA CC-3' (SEQ ID NO:5)
Neo-forward 5'- CAG TTG TTA AAA CAA C - 3' (SEQ ID NO:6)
Neo-Seq-1 5'- GTT CGG ATT GTA GTC TGC -3' (SEQ ID NO:7) neointernallfw 5'- GGA GCA ACA TTA ACT TGT GG (SEQ ID NO:8) neointerna rw 5'- CCA CAA GTT AAT GTT GCT CC (SEQ ID NO:9)
Primers used to cover the gene sequencing:
Neo(fwint)FW1 5'- GGT CAT GGA ACG CAA GTA AT (SEQ ID NO:10)
Neo(fwint)RW1 5'- ATT ACT TGC GTT CCA TGA CC (SEQ ID NO:11 )
Neo(fwint)FW2 5'- GTA GAT GAT GAT AAC AGT TTG C (SEQ ID NO:12)
Neo(fwint)RW2 5'- GCA AAC TGT TAT CAT CAT CTA C (SEQ ID NO:13)
Neo(rwint)FW1 5'- ACC GGT AAG TAA GGG AAC AG (SEQ ID NO:14)
Neo(rwint)RW1 5'- AGC TGT TCC CTT ACT TAG CG (SEQ ID NO:15)
Neo(rwint)FW2 5'- GGT GAG TCG ATA TGA ATA AAG (SEQ ID NO:16)
Neo(rwint)RW2 5'- CTT TAT TCA TAT CGA CTC ACC (SEQ ID NO:17)
Primers used for subcloning of the warnerin gene were: Forward: pBADNeona-leaFW
5'- GAG GAA TAA TAA ATG AAT AAA GAA TTA TTT GAT TTA-3' (SEQ ID NO: 18)
Cloning in pBAD. Amplifying leader and warnerin. Primer containing RBS and 2 stop codons. Reverse
NeopBAD
5'- TCA TTA TTTTTT TCC AGT GAT G (SEQ ID NO:19) Cloning in pET101 and pBAD. Containing 2 stop codons.
Forward: pET101 neona-leaFW
5'- CAC CAT GAA TAA AGA ATT ATT TGA TTT A -3' (SEQ ID NO:20)
Reverse: pET101 RW
5'- TCA TTA TTT TTT TCC AGT GAT G (SEQ ID NO:21 )
Cloning in pET101 and pBAD. Containing 2 stop codons.
We obtained clones with the warnerin gene inserted into pBAD and pET. Two versions for pBAD (+/- leader peptide, both without the C-term polyHis and V5) and one version for pET101 (incl. leader peptide).
Obtained total sequences were: Warnerin + leader sequence
ATGAATAAAGAATTATTTGATTTAAACCTTAACAAGGGCGTTGAAACTCAAAA- GAGCGACCTGAATCCACAATCTGCTAGTGTTGTCAAAACTACTATCAAGGCT- TCTAAAAAGCTTTGTAAAGGAGCAACATTAACTTGTGGATGTAACATCACTG-
GAAAAAAATAATGA (SEQ ID NO:22)
Warnerin sequence
GCTAGTGTTGTCAAAACTACTATCAAGGCTTCTAAAAAGCTTTGTAAAGGAG- CAACATTAACTTGTGGATGTAACATCACTGGAAAAAAATAATGA (SEQ ID NO:23)
SEQ ID NO: 24 shows the warnerin ORF and 5' and 3' flanking regions (figure 20) SEQ ID NO: 25 shows the warnerin precursor sequence (figure 20) SEQ ID NO: 26 shows the warnerin peptide sequence without leader(figure 21) SEQ ID NO: 27 shows the warnerin peptide including post-translational modifications (figure 21 ). The 73 Da group at the N-terminus is a blocking group. Without being bound by one theory, this may well be a 2-hydroxypropionyl, having the following structure: CH3-CH(OH)-CO-.

Claims

Claims
1. An isolated antimicrobial polypeptide, wherein said polypeptide - comprises the sequence Dha-Val-Val-Xaa1 -Dhb-Dhb-Xaa2-Xaa3-Ala (SEQ ID NO:1), wherein Xaa1 is Lys or Gin, Xaa2 is Leu or He, Xaa3 is Lys or Gin, and comprises the sequence Lys-Gly-Ala-Xaa4-Xaa5-Xaa6-Xaa7-Xaa8- Xaa9-Asn-Xaa10-Dhb-Gly-Lys-Xaa11 (SEQ ID NO:2), wherein Xaa4 is Thr or an Abu-part of a methyllanthionine, Xaa5 is Leu or lie, Xaa6 is Thr or an Abu-part of a methyllanthionine, Xaa7 is Gly or Cys or an Ala-part of a methyllanthionine, Xaa8 is Gly or Cys or an Ala-part of a methyllanthionine, Xaa9 is Cys or an Ala-part of a methyllanthionine, Xaa10 is Leu or He, Xaa11 is Lys or Gin, and wherein SEQ ID NO:1 is located N-terminally of SEQ ID NO: 2, or a fragment, a variant, or a precursor of said polypeptide; and/or - has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids each individually selected from the group of Dha and Dhb; and/or - is derivable, by post-translational modification, from the precursor sequence of SEQ ID NO:25 and/or the sequence of SEQ ID NO:26.
2. The polypeptide of claim 1 , wherein said isolated antimicrobial polypeptide has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids each individually selected from the group of Dha and Dhb; and comprises the sequence of SEQ ID NO:1.
3. The polypeptide of claim 2, wherein said polypeptide comprises the sequence of SEQ ID NO:2.
4. The polypeptide of any of the preceding claims, wherein Xaa1 is a lysine.
5. The polypeptide of any of the preceding claims, wherein Xaa2 is an isoleucine.
6. The polypeptide of any of the preceding claims, wherein Xaa3 is a lysine.
7. The polypeptide of any of claims 1 or 3-6, wherein Xaa4 and Xaa6 are Abu-parts of a methyllanthionine and Xaa7 and Xaa9 are Ala-parts of a methyllanthionine and wherein these four residues form two methyllanthionines.
8. The polypeptide of any of claim 1 or 3-7, wherein Xaa4 forms a methyllanthionine with Xaa7 and Xaa6 forms a methyllanthionine with Xaa9.
9. The polypeptide of any of claim 1 or 3-7, wherein Xaa4 forms a methyllanthionine with Xaa9 and Xaa6 forms a methyllanthionine with Xaa7.
10. The polypeptide of any of claims 1 or 3-9, wherein Xaa5 is a leucine.
11. The polypeptide of any of claims 1 or 3-10, wherein Xaa8 is a glycine.
12. The polypeptide of any of claims 1 or 3-11 , wherein Xaa10 is an isoleucine.
13. The polypeptide of any of claims 1 or 3-12, wherein Xaa11 is a lysine.
14. The polypeptide of any of claims 1 or 3-13, wherein a polypeptide segment of about 541 Da separates the segments of SEQ ID NO:1 and SEQ ID NO:2.
15. The polypeptide of any of the preceding claims, wherein the segment defined in SEQ ID NO:1 is preceded by a polypeptide segment of about 143 Da.
16. The polypeptide of any of claims 1 or 3-15, wherein the sequence of SEQ ID NO:2 comprises the C-terminus of the polypeptide.
17. The polypeptide of any of the preceding claims, wherein the polypeptide contains no aspartic acid and no glutamic acid residues.
18. The polypeptide of any of the preceding claims, wherein said polypeptide comprises the sequence of SEQ ID NO:27.
19. The polypeptide of any of the preceding claims, wherein said polypeptide has an N-terminally blocked group, such as a 2- hydroxypropionyl group.
20. The polypeptide of claim 1 , wherein the post-translational modification comprises removal of the leader peptide and/or dehydration of at least one serine and/or threonine.
21. The polypeptide of claim 20, wherein the post-translational modification comprises dehydration of all serines and threonines.
22. The polypeptide of claim 20 or 21 , wherein the post-translational modification further comprises formation of at least one thioether linkage.
23. The polypeptide of any of claims 20-22, wherein the post-translational modification comprises formation of 3 thioether linkages.
24. The polypeptide of any of the preceding claims, wherein the polypeptide has antibacterial activity against Staphylococcus epidermis.
25. The polypeptide of any of the preceding claims, wherein the polypeptide preserves its antibacterial action after boiling for 5 min of an aqueous solution of the polypeptide at a concentration of 1 micrograms/ml and/or after freezing and storage at -189C for 36 months.
26. The polypeptide of any of the preceding claims, wherein the polypeptide is purified.
27. A fragment of a polypeptide of any of the preceding claims, wherein the length of said fragment is at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90% of the length of the polypeptide of SEQ ID NO:27 and/or wherein said fragment contains at least 5, such as at least 7, e.g. at least 9, such as at least 11 , e.g. at least 13, such as at least 15, e.g. at least 17, such as at least 19, e.g. at least 21 , such as at least 23, e.g. at least 25, such as at least 27, e.g. at least 29 consecutive amino acids of the full-length polypeptide of SEQ ID NO:27.
28. A variant or precursor of a polypeptide of any of claims 1 -26, wherein said vari- ant or precursor has at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90% sequence identity to said polypeptide.
29. A precursor of a polypeptide of any of claims 1 -26, wherein the precursor com- prises the sequence set forth in SEQ ID NO:26.
30. A composition comprising an antimicrobial polypeptide, a carrier and optionally other substances, wherein the polypeptide has a molecular mass of about 3000 Da, such as between 2900 and 3100 Da, for example between 2950 and 3050 Da, such as between 2990 and 3010 Da, for example between 2995 and 3005 Da, wherein said polypeptide comprises at least one amino acid, such as at least 2 amino acids, for example at least 3 amino acids, such as at least 4 amino acids each individually selected from the group of Dha and Dhb, and wherein said polypeptide makes up at least 1 %, such as at least 5%, for example at least 10%, such as at least 20%, for example at least 30%, such as at least 40%, for example at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90%, such as at least 95%, for example at least 98%, such as at least 99%, for example essentially 100% of the total protein content (w/w) of the composition.
31. A composition comprising a carrier and a polypeptide of any of the claims 1 -26, a fragment of claim 27 or a variant or precursor of claim 28 or 29.
32. The composition of claim 31 , wherein the polypeptide makes up at least 1%, such as at least 5%, for example at least 10%, such as at least 20%, for example at least 30%, such as at least 40%, for example at least 50%, such as at least 60%, for example at least 70%, such as at least 80%, for example at least 90%, such as at least 95%, for example at least 98%, such as at least 99%, for example essentially 100% of the total protein content (w/w) of the composition.
33. A pharmaceutical composition comprising a polypeptide of any of the claims 1 - 26, a fragment of claim 27 or a variant or precursor of claim 28 or 29, and a pharmaceutically-acceptable carrier.
34. The pharmaceutical composition of claim 33, wherein the composition is suitable for topical administration.
35. The pharmaceutical composition of claim 33, wherein the composition is suitable for intravenous administration.
36. An isolated polynucleotide encoding a polypeptide of any of the claims 1 -26, a fragment of claim 27 or a variant or precursor of claim 28 or 29.
37. The isolated polynucleotide of claim 36, wherein the polynucleotide comprises a sequence encoding the polypeptide of SEQ ID NO:26, such as the polynucleotide of SEQ ID NO:24.
38. An expression vector comprising a polynucleotide of claim 36 or 37.
39. A heterologous host cell comprising a polynucleotide of claim 36 or 37, or an expression vector of claim 38.
40. A method for producing a polypeptide of any of the claims 1-26, a fragment of claim 27 or a variant or precursor of claim 28 or 29, comprising the steps of a. culturing a strain capable of producing a polypeptide of any of claims 1 -26, a fragment of claim 27 or a variant or precursor of claim 28 or 29 under conditions wherein the polypeptide is produced, b. harvesting the polypeptide from the culture, and c. purifying the polypeptide.
41. An edible product comprising a polypeptide of any of claims 1 -26, a fragment of claim 27 or a variant or precursor of claim 28 or 29 in an amount sufficient to prevent undesirable microbial growth and/or kill undesirable microorganisms.
42. The edible product of claim 41 , wherein the product is a meat or diary product.
43. A kit of parts comprising one or more of i) the polypeptide of any of claims 1 -26, ii) the fragment of claim 27 or iii) the variant or precursor of claim 28 or 29, iv) the composition of any of claims 30-32 or v) a pharmaceutical composition of any of claims 33-35, and a scheme instructing a user of the dosage to be used in function of the weight and/or age and/or clinical diagnosis of a patient that is to be treated for an anti- microbial infection.
44. The polypeptide any of claims 1 -26, the fragment of claim 27, or the variant or precursor of claim 28 or 29 for use in medicine.
45. Use of a polypeptide of any of claims 1 -26, a fragment of claim 27 or a variant or precursor of claim 28 or 29, or a composition of any of claims 30-32 as a food additive.
46. Use of the polypeptide any of claims 1 -26, a fragment of claim 27 or a variant or precursor of claim 28 or 29, or the pharmaceutical composition of any of claims 33-35 for the manufacture of a medicament for the treatment or prevention or treatment of microbial infection in a mammal.
47. Use of claim 46, wherein said mammal is a human being.
48. Use of claim 46 or 47, wherein said mammal or human being is simultaneously treated with other antimicrobial substances.
49. Use of any of claims 46-48, wherein said infection is a bacterial infection.
50. Use of claim 49, wherein said bacterial infection is caused by Gram-positive bacteria.
51. Use of a polypeptide any of claims 1-26, a fragment of claim 27 or a variant or precursor of claim 28 or 29, or a pharmaceutical composition of any of claims 33-35 for the manufacture of a medicament for the treatment or prevention of one or more or the following clinical indications in an individual in need thereof: 1 /infections following insertion of intravascular devices or peritoneal dialysis catheters; 2/infection associated with medical devices or prostheses; 3/infection during hemodialysis; A/S. aureus nasal and extra-nasal carriage; 5/burn wound infections; 6/surgical wounds, 7/acne, including severe acne vulgaris; 8/nosocomial pneumonia; 9/meningitis; 10/cystic fibrosis; 11/infective endocarditis; 12/osteomyelitis; or 13/sepsis.
52. Use of any of claims 46-51 , wherein the polypeptide, fragment, variant, precursor or pharmaceutical composition is dosed in a pharmaceutically-effective amount.
53. Use of the polypeptide any of claims 1 -26, a fragment of claim 27 or a variant or precursor of claim 28 or 29 for coating of a medical device.
PCT/DK2004/000553 2003-08-21 2004-08-19 Staphylococcus antibiotic peptides with a broad spectrum of action Ceased WO2005019250A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DKPA200301192 2003-08-21
DKPA200301192 2003-08-21
US49691403P 2003-08-22 2003-08-22
US60/496,914 2003-08-22

Publications (1)

Publication Number Publication Date
WO2005019250A1 true WO2005019250A1 (en) 2005-03-03

Family

ID=34219528

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2004/000553 Ceased WO2005019250A1 (en) 2003-08-21 2004-08-19 Staphylococcus antibiotic peptides with a broad spectrum of action

Country Status (1)

Country Link
WO (1) WO2005019250A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008091416A2 (en) 2006-09-28 2008-07-31 The Ohio State University Research Foundation Antibiotic antimicrobial agents and methods of their use
US9017692B2 (en) 2011-12-05 2015-04-28 Ohio State Innovation Foundation Antimicrobial agent, bacterial strain, biosynthesis, and methods of use

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2200195C2 (en) * 2001-01-12 2003-03-10 Коробов Владимир Павлович Strain staphylococcus warneri iegm kl-1 as producer of low-molecular peptide compound inhibiting cells growth of gram-positive microorganisms

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2200195C2 (en) * 2001-01-12 2003-03-10 Коробов Владимир Павлович Strain staphylococcus warneri iegm kl-1 as producer of low-molecular peptide compound inhibiting cells growth of gram-positive microorganisms

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
D. KURNIASIH: "Isolation and characterization of warnerin 20, a bacteriocin produced by Staphylococcus warneri FM20", ABSTRACTS OF THE 99TH GENERAL MEETING OF THE AMERICAN SOCIETY FOR MICROBIOLOGY, vol. 99, 1999, pages 659, XP002307440 *
KAMP VAN DE M ET AL: "ELUCIDATION OF THE PRIMARY STRUCTURE OF THE LANTIBIOTIC EPILANCIN K7 FROM STAPHYLOCOCCUS EPIDERMIDIS K7 CLONING AND CHARACTERISATION OF THE EPILANCIN-K7-ENCODING GENE AND NMR ANALYSIS OF MATURE EPILANCIN K7", EUROPEAN JOURNAL OF BIOCHEMISTRY, BERLIN, DE, vol. 230, no. 2, 1995, pages 587 - 600, XP000990390, ISSN: 0014-2956 *
KOROBOV V P ET AL.: "Change of staphylococcal susceptibility to antibiotics under the effect of peptide antibacterial factor", ANTIBIOTIKI I KHIMIOTERAPIYA, vol. 47, 2002, pages 11 - 15, XP008039329 *
TOSHIHIRO SASHIHARA ET AL.: "A novel lantibiotic, Nukacin ISK-1, of Staphylococcus warneri ISK-1: Cloning of the structural gene and identification of the structure", BIOSCIENCE, BIOTECHNOLOGY AND BIOCHEMISTRY, vol. 64, no. 11, November 2000 (2000-11-01), pages 2420 - 2428, XP002307441 *
V.P. KOROBOV ET AL.: "Production of a wide-spectrum antibacterial factor by Staphylococcus warneri cells", DOKLADY BIOLOGICAL SCIENCES, vol. 390, no. 5, May 2003 (2003-05-01), pages 703 - 705, XP008039331 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008091416A2 (en) 2006-09-28 2008-07-31 The Ohio State University Research Foundation Antibiotic antimicrobial agents and methods of their use
EP2069473A4 (en) * 2006-09-28 2009-11-11 Univ Ohio State Res Found ANTIMICROBIAL ANTIBIOTIC AGENTS AND METHODS OF USE
US20110245152A1 (en) * 2006-09-28 2011-10-06 The Ohio State University Research Foundation a not-for-profit corporation Antibiotic antimicrobial agents and methods of their use
US8299020B2 (en) * 2006-09-28 2012-10-30 The Ohio State University Research Foundation Antimicrobial peptides and methods of their use
US9017692B2 (en) 2011-12-05 2015-04-28 Ohio State Innovation Foundation Antimicrobial agent, bacterial strain, biosynthesis, and methods of use

Similar Documents

Publication Publication Date Title
EP2078529A1 (en) Antimicrobial peptides
EP0689550A1 (en) Novel antimicrobial peptides from bovine neutrophils
KR102544364B1 (en) Romo1-derived antimicrobial peptides and variants thereof
KR101896927B1 (en) An anti-microbial peptide, Protaetiamycine 1 isolated from Protaetia brevitarsis seulensis and its synthetic composition
CA2764490A1 (en) Antimicrobial peptides
EP1169340B1 (en) Lantibiotic
AU5564299A (en) Antimicrobial peptides isolated from the skin of american frogs
KR101629386B1 (en) An anti-microbial peptide Scolopendrasin-7 isolated from the Scolopendra subspinipes mutilans and its synthetic peptide
Ghoreishi et al. Novel chronic wound healing by anti-biofilm peptides and protease
KR101444257B1 (en) A new scolopendrasin ii peptide isolated from the scolopendra subsinipes and its synthetic composition
IE61615B1 (en) Antibiotic
US20030219854A1 (en) Methods for producing modified anti-infective peptides
KR20180052181A (en) An anti-microbial peptide, Protaetiamycine 2 isolated from Protaetia brevitarsis seulensis and its synthetic composition
KR101743113B1 (en) An anti-microbial peptide, Oxyasin-1 isolated from Oxya chinensis sinuosa and its synthetic composition
JP2001517422A (en) Isolated and recombinant antimicrobial peptides thrombosidine-1 (TC-1) and thrombosidine-2 (TC-2) or variants thereof
KR101740551B1 (en) An anti-microbial peptide, Oxyasin-2 isolated from Oxya chinensis sinuosa and its synthetic composition
US20060258596A1 (en) Antimicrobial agents
KR101444256B1 (en) Novel scolopendrazine Ⅲ peptide and its composition isolated from Wang Ji
ES2382466T3 (en) Bacteriocin inducing peptides
KR101865782B1 (en) Antimicrobial peptide isolated from Bacillus amyloliquefaciens K14 and its use in combinatorial drug therapy
US6727223B2 (en) Treatment of microbial infections with bacterial proteins and peptides
KR101820086B1 (en) An anti-microbial peptide, Oxyasin-4 isolated from Oxya chinensis sinuosa and its synthetic composition
KR101624632B1 (en) A New Scolopendrasin-5 peptide isolated from the Scolopendra subspinipes and its synthetic composition
HK1250639A1 (en) Antimicrobial therapy

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase