WO2005019205A1 - Mitotic kinesin inhibitors - Google Patents

Mitotic kinesin inhibitors Download PDF

Info

Publication number
WO2005019205A1
WO2005019205A1 PCT/US2004/025980 US2004025980W WO2005019205A1 WO 2005019205 A1 WO2005019205 A1 WO 2005019205A1 US 2004025980 W US2004025980 W US 2004025980W WO 2005019205 A1 WO2005019205 A1 WO 2005019205A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
methyl
difluorophenyl
phenyl
pyrrole
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/025980
Other languages
French (fr)
Inventor
Paul J. Coleman
Christopher D. Cox
Robert M. Garbaccio
George D. Hartman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Merck and Co Inc
Original Assignee
Merck and Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck and Co Inc filed Critical Merck and Co Inc
Priority to BRPI0413580-6A priority Critical patent/BRPI0413580A/en
Publication of WO2005019205A1 publication Critical patent/WO2005019205A1/en
Priority to IS8276A priority patent/IS8276A/en
Priority to IL173513A priority patent/IL173513A0/en
Anticipated expiration legal-status Critical
Priority to NO20061194A priority patent/NO20061194L/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D413/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C04CEMENTS; CONCRETE; ARTIFICIAL STONE; CERAMICS; REFRACTORIES
    • C04BLIME, MAGNESIA; SLAG; CEMENTS; COMPOSITIONS THEREOF, e.g. MORTARS, CONCRETE OR LIKE BUILDING MATERIALS; ARTIFICIAL STONE; CERAMICS; REFRACTORIES; TREATMENT OF NATURAL STONE
    • C04B35/00Shaped ceramic products characterised by their composition; Ceramics compositions; Processing powders of inorganic compounds preparatory to the manufacturing of ceramic products
    • C04B35/622Forming processes; Processing powders of inorganic compounds preparatory to the manufacturing of ceramic products
    • C04B35/626Preparing or treating the powders individually or as batches ; preparing or treating macroscopic reinforcing agents for ceramic products, e.g. fibres; mechanical aspects section B
    • C04B35/63Preparing or treating the powders individually or as batches ; preparing or treating macroscopic reinforcing agents for ceramic products, e.g. fibres; mechanical aspects section B using additives specially adapted for forming the products, e.g.. binder binders
    • C04B35/632Organic additives
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings

Definitions

  • This invention relates to 2,2-disubstituted 2,5-dihydropyrrole derivatives that are inhibitors of mitotic kinesins, in particular the mitotic kinesin KSP, and are useful in the tteatment of cellular proliferative diseases, for example cancer, hyperplasias, restenosis, cardiac hypertrophy, immune disorders and inflammation.
  • mitotic kinesins in particular the mitotic kinesin KSP
  • cellular proliferative diseases for example cancer, hyperplasias, restenosis, cardiac hypertrophy, immune disorders and inflammation.
  • the therapeutic agents used to treat cancer are the taxanes and vinca alkaloids. Taxanes and vinca alkaloids act on microtubules, which are present in a variety of cellular structures.
  • Microtubules are the primary structural element of the mitotic spindle.
  • the mitotic spindle is responsible for distribution of replicate copies of the genome to each of the two daughter cells that result from cell division. It is presumed that; disruption of the mitotic spindle by these drugs results in inhibition of cancer cell division, and induction of cancer cell death.
  • microtubules form other types of cellular structures, including ttacks for inttacellular ttansport in nerve processes. Because these agents do not- specifically target mitotic spindles, they have side effects that limit their usefulness. Improvements in the specificity of agents used to treat cancer is of considerable interest because of the therapeutic benefits which would be realized if the side effects associated with the administration of these agents could be reduced.
  • Mitotic kinesins are enzymes essential for assembly and function of the mitotic spindle, but are not generally part of other microtubule structures, such as in nerve processes. Mitotic kinesins play essential roles during all phases of mitosis. These enzymes are "molecular motors" that transform energy released by hydrolysis of ATP into mechanical force which drives the directional movement of cellular cargoes along microtubules.
  • the catalytic domain sufficient for this task is a compact structure of approximately 340 amino acids.
  • kinesins organize microtubules into the bipolar structure that is the mitotic spindle. Kinesins mediate movement of chromosomes along spindle microtubules, as well as structural changes in the mitotic spindle associated with specific phases of mitosis. Experimental perturbation of mitotic kinesin function causes malformation or dysfunction of the mitotic spindle, frequently resulting in cell cycle arrest and cell death.
  • KSP mitotic kinesins which have been identified is KSP.
  • KSP belongs to an evolutionarily conserved kinesin subfamily of plus end-directed microtubule motors that assemble into bipolar homotetramers consisting of antiparallel homodimers.
  • KSP associates with microtubules of the mitotic spindle.
  • Microinjection of antibodies directed against KSP into human cells prevents spindle pole separation during prometaphase, giving rise to monopolar spindles and causing mitotic arrest and induction of programmed cell death.
  • KSP and related kinesins in other, non-human, organisms bundle antiparallel microtubules and slide them relative to one another, thus forcing the two spindle poles apart.
  • KSP may also mediate in anaphase B spindle elongation and focussing of microtubules at the spindle pole.
  • Human KSP also termed HsEg5 has been described [Blangy, et al., Cell, 83:1159-69 (1995); Whitehead, et al., Arthritis Rheum., 39:1635-42 (1996); Galgio et al., J. Cell Biol., 135:339-414 (1996); Blangy, et al., J Biol. Chem., 272:19418-24 (1997); Blangy, et al., Cell Motil Cytoskeleton, 40:174-82 (1998); Whitehead and Rattner, J.
  • the present invention relates to dihydropyrrole derivatives, that are useful for treating cellular proliferative diseases, for treating disorders associated with KSP kinesin activity, and for inhibiting KSP kinesin.
  • the compounds of the invention may be illustrated by the Formula I:
  • FIGURE 1 An ORTEP drawing of Compound 2-5
  • FIGURE 2 An ORTEP drawing of Compound 3-1
  • most of the hydrogen atoms are not shown.
  • R3 is selected from: 1) hydrogen; 2) Ci-ClO alkyl; 3) Ci-Cio alkyl-O-Rd, 4) C2-C10 alkenyl-O-Rd, 5) C2-C10 alkynyl-O-Rd, 6) (C ⁇ -C6-alkylene) n C3-C8 cycloalkyl-O-Rd,
  • R8 and R can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 3-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle - optionally substituted with one, two or three substituents selected from R7;
  • RlO is selected from: F and -CH2F;
  • Rl3 is selected from: H and -CH2F, provided that if t is 1, Rl is H;
  • R ox is absent or is oxo
  • R a is independently selected from: (C ⁇ -C6)alkyl, (C3-C6)cycloalkyl, aryl, or heterocyclyl, optionally substituted with one, two or three substituents selected from R7;
  • R and R c ' can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 3-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle optionally substituted with one, two or three substituents selected from R7;
  • Rd is selected from: H, (C ⁇ -C6)alkyl, -(C2-C6)alkyl-OH, -(C ⁇ -C6)alkyl-0-(C ⁇ -C6)alkyl and -(C ⁇ -
  • R e and R e ' are independently selected from: H, (Ci-C6)alkyl, aryl, heterocyclyl and (C3-C6)cycloalkyl, optionally substituted with one, two or three substituents selected from R7; or
  • R e and R e ' can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 3-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle optionally substituted with one, two or three substituents selected from R7.
  • n 0, 1 or 2;
  • Rl and R are independently selected from: H, (C ⁇ -C6)alkyl, aryl and (C3-C6)cycloalkyl, optionally substituted with one, two or three substituents selected fromR7;
  • R4 is independently selected from: 1) halo, 2) OH, and 3) ObC ⁇ -C6 perfluoroalkyl,
  • R5 is selected from: 1) hydrogen, 2) halo, 3) OH, and 4) ObCi-C ⁇ perfluoroalkyl;
  • Rl and R2 are independently selected from: H and (Ci-C ⁇ )alkyl.
  • Rl and R are independently selected from: H and (C ⁇ -C6)alkyl.
  • the compounds of the present invention may have asymmetric centers, chiral axes, and chiral planes (as described in: E.L. Eliel and S.H. Wilen, Stereochemistry of Carbon Compounds, John Wiley & Sons, New York, 1994, pages 1119-1190), and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers and mixtures thereof, including optical isomers, all such stereoisomers being included in the present invention.
  • the compounds disclosed herein may exist as tautomers and both tautomeric forms are intended to be encompassed by the scope of the invention, even though only one tautomeric structure is depicted.
  • any variable e.g. R4, R7, etc .
  • its definition on each occurrence is independent at every other occurrence.
  • combinations of substituents and variables are permissible only if such combinations result in stable compounds.
  • Lines drawn into the ring systems from substituents represent that the indicated bond may be attached to any of the substitutable ring atoms. If the ring system is polycyclic, it is intended that the bond be attached to any of the suitable carbon atoms on the proximal ring only.
  • substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure results.
  • the phrase "optionally substituted with one or more substituents” should be taken to be equivalent to the phrase “optionally substituted with at least one substituent” and in such cases the preferred embodiment will have from zero to three substituents.
  • alkyl is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms.
  • C ⁇ -C ⁇ o as in “Ci-Cio alkyl” is defined to include groups having 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbons in a linear or branched arrangement.
  • C1-C1 o alkyl specifically includes methyl, ethyl, n-propyl, i- propyl, n-butyl, r-butyl, /-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, and so on.
  • cycloalkyl means a monocyclic saturated aliphatic hydrocarbon group having the specified number of carbon atoms.
  • cycloalkyl includes cyclopropyl, methyl-cyclopropyl, 2,2-dimethyl- cyclobutyl, 2-ethyl-cyclopentyl, cyclohexyl, and so on.
  • cycloalkyl includes the groups described immediately above and further includes monocyclic unsaturated aliphatic hydrocarbon groups.
  • cycloalkyl as defined in this embodiment includes cyclopropyl, methyl-cyclopropyl, 2,2-dimethyl-cyclobutyl, 2-ethyl-cyclopentyl, cyclohexyl, cyclopentenyl, cyclobutenyl and so on.
  • alkylene means a hydrocarbon diradical group having the specified number of carbon atoms.
  • alkylene includes - CH2-, -CH2CH2- and the like.
  • C ⁇ -C6 refers to the alkyl portion of the moiety and does not describe the number of atoms in the aryl and heteroaryl portion of the moiety.
  • Alkoxy represents either a cyclic or non-cyclic alkyl group of indicated number of carbon atoms attached through an oxygen bridge. “Alkoxy” therefore encompasses the definitions of alkyl and cycloalkyl above.
  • alkenyl refers to a non-aromatic hydrocarbon radical, straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon double bond. Preferably one carbon to carbon double bond is present, and up to four non-aromatic carbon-carbon double bonds may be present.
  • C2-C6 alkenyl means an alkenyl radical having from 2 to 6 carbon atoms.
  • Alkenyl groups include ethenyl, propenyl, butenyl, 2- methylbutenyl and cyclohexenyl.
  • alkenyl refers to a hydrocarbon radical straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon triple bond. Up to three carbon- carbon triple bonds may be present.
  • C2-C6 alkynyl means an alkynyl radical having from 2 to 6 carbon atoms.
  • Alkynyl groups include ethynyl, propynyl, butynyl, 3-methylbutynyl and so on.
  • the straight, branched or cyclic portion of the alkynyl group may contain triple bonds and may be substituted if a substituted alkynyl group is indicated.
  • substituents may be defined with a range of carbons that includes zero, such as (Co-C6)alkylene-aryl. If aryl is taken to be phenyl, this definition would include phenyl itself as well as -CH2PI1, -C ⁇ OJ ⁇ Ph, CH(CH3)CH2CH(CH3)Ph, and so on.
  • aryl is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 atoms in each ring, wherein at least one ring is aromatic.
  • aryl elements include phenyl, naphthyl, tetrahydronaphthyl, indanyl and biphenyl.
  • aryl substituent is bicyclic and one ring is non-aromatic, it is understood that attachment is via the aromatic ring.
  • heteroaryl represents a stable monocyclic or bicyclic ring of up to 7 atoms in each ring, wherein at least one ring is aromatic and contains from 1 to 4 heteroatoms selected from the group consisting of O, N and S.
  • Heteroaryl groups within the scope of this definition include but are not limited to: acridinyl, carbazolyl, cinnolinyl, quinoxalinyl, pyrrazolyl, indolyl, benzotriazolyl, furanyl, thienyl, benzothienyl, benzofuranyl, quinolinyl, isoquinolinyl, oxazolyl, isoxazolyl, indolyl, pyrazinyl, pyridazinyl, pyridinyl, pyrimidinyl, pyrrolyl, tetrahydroquinoline.
  • heteroaryl is also understood to include the N-oxide derivative of any nitrogen-containing heteroaryl.
  • heteroaryl substituent is bicyclic and one ring is non-aromatic or contains no heteroatoms, it is understood that attachment is via the aromatic ring or via the heteroatom containing ring, respectively.
  • heterocycle or “heterocyclyl” as used herein is intended to mean a 5- to 10- membered aromatic or nonaromatic heterocycle containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S, and includes bicyclic groups.
  • Heterocyclyl therefore includes the above mentioned heteroaryls, as well as dihydro and tetrathydro analogs thereof. Further examples of “heterocyclyl” include, but are not limited to the following: benzoimidazolyl, benzofuranyl, benzofurazanyl, benzopyrazolyl, benzotriazolyl, benzothiophenyl, benzoxazolyl, carbazolyl, carbolinyl, cinnolinyl, furanyl, imidazolyl, indolinyl, indolyl, indolazinyl, indazolyl, isobenzofuranyl, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthpyridinyl, oxadiazolyl, oxazolyl, oxazoline, isoxazoline, oxetanyl, pyranyl, pyrazinyl,
  • heterocycle is selected from 2-azepinone, benzimidazolyl, 2-diazapinone, imidazolyl, 2-imidazolidinone, indolyl, isoquinolinyl, morpholinyl, piperidyl, piperazinyl, pyridyl, pyrrolidinyl, 2-piperidinone, 2-pyrimidinone, 2-pyrollidinone, quinolinyl, tetrahydrofuryl, tettahydroisoquinolinyl, and thienyl.
  • halo or “halogen” as used herein is intended to include chloro, fluoro, bromo and iodo.
  • the alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl and heterocyclyl substituents may be substituted or unsubstituted, unless specifically defined otherwise.
  • a (C -C6)alkyl may be substituted with one, two or three substituents selected from OH, oxo, halogen, alkoxy, dialkylamino, or heterocyclyl, such as morpholinyl, piperidinyl, and so on.
  • R and R9, RC and R c ' and Rf and Rf are defined such that they can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 5-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said heterocycle optionally substituted with one or more substituents selected from R7.
  • the heterocycles that can thus be formed include, but are not limited to the following, keeping in mind that the heterocycle is optionally substituted with one or more (and in an embodiment, one, two or three) substituents chosen from R7:
  • Rd and Rd' are defined such that they can be taken together with the phosphorous to which they are attached to form a monocyclic heterocycle with 5-7 members in the ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from NR e , O and S, said heterocycle optionally substituted with one or more substituents selected from R7.
  • the heterocycles that can thus be formed include, but are not limited to the following, keeping in mind that the heterocycle is optionally substituted with one or more (and in an embodiment, one or two) substituents chosen from R7:
  • Rl is selected from H and C ⁇ -C6 alkyl.
  • R2 is selected from H and C ⁇ -C6 alkyl.
  • R 3 is selected from -C ⁇ -C ⁇ o alkyl-O-Rg and -C ⁇ -C ⁇ o alkyl- NRfRf ', optionally substituted with one to two substituents selected fromRlO.
  • R4 is independently selected from halogen and OH.
  • n is 2 and R4 is independently selected from halogen.
  • R5 is independently selected from H, halogen and OH.
  • t is 1, RlO is fluoro and Rl is H.
  • t is 0 and Rl3 is fluoromethyl.
  • R ox is absent.
  • Included in the instant invention is the free form of compounds of Formula I, as well as the pharmaceutically acceptable salts and stereoisomers thereof.
  • Some of the specific compounds exemplified herein are the protonated salts of amine compounds.
  • the term "free form” refers to the amine compounds in non-salt form.
  • the encompassed pharmaceutically acceptable salts not only include the salts exemplified for the specific compounds described herein, but also all the typical pharmaceutically acceptable salts of the free form of compounds of Formula I.
  • the free form of the specific salt compounds described may be isolated using techniques known in the art.
  • the free form may be regenerated by treating the salt with a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate.
  • a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate.
  • the free forms may differ from their respective salt forms somewhat in certain physical properties, such as solubility in polar solvents, but the acid and base salts are otherwise pharmaceutically equivalent to their respective free forms for purposes of the invention.
  • the pharmaceutically acceptable salts of the instant compounds can be synthesized from the compounds of this invention which contain a basic or acidic moiety by conventional chemical methods.
  • the salts of the basic compounds are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
  • the salts of the acidic compounds are formed by reactions with the appropriate inorganic or organic base.
  • pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed by reacting a basic instant compound with an inorganic or organic acid.
  • non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like, as well as salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
  • inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like
  • organic acids such as acetic, propionic, succinic, glycolic, ste
  • suitable “pharmaceutically acceptable salts” refers to salts prepared form pharmaceutically acceptable non-toxic bases including inorganic bases and organic bases.
  • Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc and the like. Particularly preferred are the ammonium, calcium, magnesium, potassium and sodium salts.
  • Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as arginine, betaine caffeine, choline, N,N - dibenzylethylenediamine, diethylamin, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine tripropylamine, ttomethamine and the like.
  • basic ion exchange resins such as arginine, be
  • the compounds of this invention may be prepared by employing reactions as shown in the following schemes, in addition to other standard manipulations that are known in the literature or exemplified in the experimental procedures.
  • Substituent numbering as shown in the schemes does not necessarily correlate to that used in the claims and often, for clarity, a single substituent is shown attached to the compound where multiple substituents are allowed under the definitions of Formula I hereinabove.
  • SCHEMES As shown in Scheme A, key 2,2-disubstituted dihydropyrrole intermediate A-8 may be obtained from readily available suitably substituted -phenylglycines.
  • the enantiomers of A-8 may often be separated utilizing chiral chromatographic techniques.
  • the ring nitrogen may then be reacted with triphosgene to prepare the activated carbonyl chloride A-9.
  • Scheme B illustrates the preparation of the fluorinated aminopiperidine B-5, starting with the N-protected piperidone.
  • the cis and trans diastereomeric pairs may often be separated by silica gel chromatography and the enantiomers may often be separated utilizing chiral chromatographic techniques.
  • such a fluorinated aminopiperidine may then be reacted with the dihydropyrrole intermediate A-9 to provide the instant compound C-l.
  • Scheme D illustrates preparation of 2-fluoromethyl-4-aminopiperidine compounds and incorporation of those groups into the compounds of the instant invention. It should be noted that fluoride displacement of the sidechain hydroxyl in intermediate D-3 often leads to both the desired intermediate D-4 and the ring homologous compound D-5. These intermediate compounds may be separated by silica gel chromatography.
  • Scheme E illustrates an alternative preparation of the 2-fluoromethyl-3-aminopiperidine compounds in which the seven-membered ring isomer is not produced. As shown in Schemes F and G, the hydroyl moiety of A-9 may undergo alkylation with a variety of reagents.
  • the aldehyde H-l is treated with a Grignard reagent, such as an alkyl Grignard, to provide the hydroxy compound K-l.
  • Scheme L illustrates homologation of the C-2 side chain.
  • the aldehyde H-l is treated with a phosphonoacetate and the conjugated double bond is then reduced to provide the ester L-1.
  • Subsequent reduction of the ester and oxidation of the alcohol provides the aldehyde L-3, which can reductively alkylate a suitably substituted amine to provide the instant compound L-4. Further alkylation of L-4 is also illustrated.
  • Scheme M illustrates fluorination of the C-2 sidechain and subsequent conversion of the hydroxyl moiety to an amine via displacement of the corresponding triflate with sodium azide.
  • Scheme N illustrates incorporation of a difluoromethyl moiety into the C-2 sidechain.
  • mitosis may be altered in a variety of ways; that is, one can affect mitosis either by increasing or decreasing the activity of a component in the mitotic pathway. Stated differently, mitosis may be affected (e.g., disrupted) by disturbing equilibrium, either by inhibiting or activating certain components. Similar approaches may be used to alter meiosis.
  • the compounds of the invention are used to modulate mitotic spindle formation, thus causing prolonged cell cycle arrest in mitosis.
  • modulate herein is meant altering mitotic spindle formation, including increasing and decreasing spindle formation.
  • mitotic spindle formation herein is meant organization of microtubules into bipolar structures by mitotic kinesins.
  • mitotic spindle dysfunction herein is meant mitotic arrest and monopolar spindle formation.
  • the compounds of the invention are useful to bind to and/or modulate the activity of a mitotic kinesin.
  • the mitotic kinesin is a member of the bimC subfamily of mitotic kinesins (as described in U.S. Pat. No. 6,284,480, column 5).
  • the mitotic kinesin is human KSP, although the activity of mitotic kinesins from other organisms may also be modulated by the compounds of the present invention, i this context, modulate means either increasing or decreasing spindle pole separation, causing malformation, i.e., splaying, of mitotic spindle poles, or otherwise causing morphological perturbation of the mitotic spindle. Also included within the definition of KSP for these purposes are variants and/or fragments of KSP. In addition, other mitotic kinesins may be inhibited by the compounds of the present invention. The compounds of the invention are used to treat cellular proliferation diseases.
  • Disease states which can be treated by the methods and compositions provided herein include, but are not limited to, cancer (further discussed below), autoimmune disease, arthritis, graft rejection, inflammatory bowel disease, proliferation induced after medical procedures, including, but not limited to, surgery, angioplasty, and the like. It is appreciated that in some cases the cells may not be in a hyper- or hypoproliferation state (abnormal state) and still require treatment. For example, during wound healing, the cells may be proliferating "normally", but proliferation enhancement may be desired.
  • cells may be in a "normal" state, but proliferation modulation may be desired to enhance a crop by directly enhancing growth of a crop, or by inhibiting the growth of a •plant or organism which adversely affects the crop.
  • the invention herein includes application to cells or individuals which are afflicted or may eventually become afflicted with any one of these disorders or states.
  • the compounds, compositions and methods provided herein are useful for the treatment of cancer including solid tumors such as skin, breast, brain, cervical carcinomas, testicular carcinomas, etc.
  • cancers that may be treated by the compounds, compositions and methods of the invention include, but are not limited to: Cardiac: sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma; Lung: bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma; Gastrointestinal: esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancre
  • nephroblastoma lymphoma, leukemia
  • bladder and urethra squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate (adenocarcinoma, sarcoma), testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma); Liver: hepatoma (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, hemangioma; Bone: osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, mal
  • the term "cancerous cell” as provided herein includes a cell afflicted by any one of the above-identified conditions.
  • the compounds of the instant invention may also be useful as antifungal agents, by modulating the activity of the fungal members of the bimC kinesin subgroup, as is described in U.S. Pat. No. 6,284,480.
  • the compounds of this invention may be administered to mammals, such as humans, either alone or in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice.
  • the compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration.
  • compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
  • Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
  • excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc.
  • the tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a water soluble taste masking material such as hydroxypropyl-methylcellulose or hydroxypropylcellulose, or a time delay material such as ethyl cellulose, cellulose acetate butyrate may be employed.
  • Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyleneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
  • Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinyl- pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate.
  • dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin,
  • the aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame.
  • Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation.
  • compositions may be preserved by the addition of an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol.
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present.
  • compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
  • the pharmaceutical compositions of the invention may also be in the form of an oil-in- water emulsions.
  • the oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these.
  • Suitable emulsifying agents may be naturally occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
  • the emulsions may also contain sweetening, flavoring agents, preservatives and antioxidants.
  • Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous solutions. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • the sterile injectable preparation may also be a sterile injectable oil-in-water microemulsion where the active ingredient is dissolved in the oily phase. For example, the active ingredient may be first dissolved in a mixture of soybean oil and lecithin.
  • the oil solution then introduced into a water and glycerol mixture and processed to form a microemulation.
  • the injectable solutions or microemulsions may be introduced into a patient's blood stream by local bolus injection. Alternatively, it may be advantageous to administer the solution or microemulsion in such a way as to maintain a constant circulating concentration of the instant compound.
  • a continuous intravenous delivery device may be utilized. An example of such a device is the Deltec CADD-PLUSTM model 5400 intravenous pump.
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example as a solution in 1,3-butane diol.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • Compounds of Formula I may also be administered in the form of suppositories for rectal administration of the drug.
  • compositions can be prepared by mixing the drug with a suitable non- irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non- irritating excipient include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula I are employed.
  • topical application shall include mouth washes and gargles.
  • the compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art.
  • the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
  • the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, sex and response of the individual patient, as well as the severity of the patient's symptoms.
  • a suitable amount of compound is administered to a mammal undergoing treatment for cancer.
  • Administration occurs in an amount between about 0.1 mg kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg kg of body weight to about 40 mg/kg of body weight per day.
  • the instant compounds are also useful in combination with known therapeutic agents and anti-cancer agents.
  • instant compounds are useful in combination with known anti- cancer agents. Examples of such agents can be found in Cancer Principles and Practice of Oncology by V.T. Devita and S. Hellman (editors), 6 th edition (February 15, 2001), Lippincott Williams & Wilkins Publishers.
  • anti- cancer agents include, but are not limited to, the following: estrogen receptor modulators, androgen receptor modulators, retinoid receptor modulators, cytotoxic/cytostatic agents, antiproliferative agents, prenyl-protein transferase inhibitors, HMG-CoA reductase inhibitors and other angiogenesis inhibitors, inhibitors of cell proliferation and survival signaling, apoptosis inducing agents and agents that interfere with cell cycle checkpoints.
  • the instant compounds are particularly useful when co-administered with radiation therapy.
  • Cytotoxic/cytostatic agents refer to compounds which cause cell death or inhibit cell proliferation primarily by interfering directly with the cell's functioning or inhibit or interfere with cell mytosis, including alkylating agents, tumor necrosis factors, intercalators, hypoxia activatable compounds, microtubule inhibitors/microtubule-stabilizing agents, inhibitors of mitotic kinesins, inhibitors of kinases involved in mitotic progression, antimetabolites; biological response modifiers; hormonal/anti-hormonal therapeutic agents, haematopoietic growth factors, monoclonal antibody targeted therapeutic agents, topoisomerase inhibitors, proteasome inhibitors and ubiquitin ligase inhibitors.
  • cytotoxic agents include, but are not limited to, sertenef, cachectin, ifosfamide, tasonermin, lonidamine, carboplatin, altretamine, prednimustine, dibromodulcitol, ranimustine, fotemustine, nedaplatin, oxaliplatin, temozolomide, heptaplatin, estramustine, improsulfan tosilate, trofosfamide, nimustine, dibrospidium chloride, pumitepa, lobaplatin, satraplatin, profiromycin, cisplatin, irofulven, dexifosfamide, cis-aminedichloro(2-methyl-pyridine)platinum, benzylguanine, glufosfamide, GPX100, (trans, trans, trans)-bis-mu-(hexane-l,6-diamine)-
  • administration means introducing the compound or a prodrug of the compound into the system of the animal in need of treatment.
  • a compound of the invention or prodrug thereof is provided in combination with one or more other active agents (e.g., a cytotoxic agent, etc.)
  • administration and its variants are each understood to include concurrent and sequential introduction of the compound or prodrug thereof and other agents.
  • composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts.
  • terapéuticaally effective amount means that amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician.
  • treating cancer or “treatment of cancer” refers to administration to a mammal afflicted with a cancerous condition and refers to an effect that alleviates the cancerous condition by killing the cancerous cells, but also to an effect that results in the inhibition of growth and/or metastasis of the cancer.
  • the angiogenesis inhibitor to be used as the second compound is selected from a tyrosine kinase inhibitor, an inhibitor of epidermal-derived growth factor, an inhibitor of fibroblast-derived growth factor, an inhibitor of platelet derived growth factor, an MMP (matrix metalloprotease) inhibitor, an integrin blocker, interferon- ⁇ , interleukin-12, pentosan polysulfate, a cyclooxygenase inhibitor, carboxyamidotriazole, combretastatin A-4, squalamine, 6-O-chloroacetyl- carbonyl)-fumagillol, thalidomide, angiostatin, troponin-1, or an antibody to VEGF.
  • a tyrosine kinase inhibitor an inhibitor of epidermal-derived growth factor, an inhibitor of fibroblast-derived growth factor, an inhibitor of platelet derived growth factor, an MMP (matrix metalloprotease) inhibitor, an integrin blocker
  • the estrogen receptor modulator is tamoxifen or raloxifene.
  • a method of treating cancer comprises administering a therapeutically effective amount of a compound of Formula I in combination with radiation therapy and/or in combination with a compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxic/cytostatic agent, an antiproliferative agent, a prenyl-protein ttansferase inhibitor, an HMG-CoA reductase inhibitor, an HTV protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, PPAR- ⁇ agonists, PPAR- ⁇ agonists, an inhibitor of inherent multidrug resistance, an anti-emetic agent, an agent useful in the treatment of anemia, an agent useful in the treatment of neutropenia, an immunologic-enhancing drug, an inhibitor of cell proliferation and survival signaling, an agent that interfers with a cell cycle
  • Yet another embodiment of the invention is a method of treating cancer that comprises administering a therapeutically effective amount of a compound of Formula I in combination with paclitaxel or trastuzumab.
  • the instant invention also includes a pharmaceutical composition useful for treating or preventing cancer that comprises a therapeutically effective amount of a compound of Formula I and a compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxic/cytostatic agent, an antiproliferative agent, a prenyl-protein ttansferase inhibitor, an HMG-CoA reductase inhibitor, an HTV protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, a PPAR- ⁇ agonist, a PPAR- ⁇ agonists; an inhibitor of cell proliferation and survival signaling, an agent that interfers with a cell cycle checkpoint, and an apoptosis inducing agent.
  • ASSAYS The compounds of the instant invention described in the Examples were tested by the assays described below and were found to have kinase inhibitory activity. Other assays are known in the literature and could be readily performed by those of skill in the art.
  • Supernatants were diluted and loaded onto an SP Sepharose column (Pharmacia, 5ml cartridge) in buffer A (50mM K- HEPES, pH 6.8, lmM MgCl 2 , lmM EGTA, lO ⁇ M Mg-ATP, lmM DTT) and eluted with a 0 to 750mM KC1 gradient in buffer A.
  • buffer A 50mM K- HEPES, pH 6.8, lmM MgCl 2 , lmM EGTA, lO ⁇ M Mg-ATP, lmM DTT
  • Fractions containing KSP were pooled and incubated with Ni-NTA resin (Qiagen) for one hour. The resin was washed three times with buffer B (Lysis buffer minus PMSF and protease inhibitor cocktail), followed by three 15-minute incubations and washes with buffer B.
  • Purified tubulin (> 97% MAP-free) at 1 mg/ml is polymerized at 37°C in the presence of 10 ⁇ M paclitaxel, 1 mM DTT, 1 mM GTP in BRB80 buffer (80 mM K-PIPES, 1 mM EGTA, 1 mM MgCl 2 at pH 6.8).
  • the resulting microtubules are separated from non-polymerized tubulin by ulttacentrifugation and removal of the supernatant.
  • the pellet, containing the microtubules, is gently resuspended in 10 ⁇ M paclitaxel, 1 mM DTT, 50 ⁇ g/ml ampicillin, and 5 ⁇ g/ml chloramphenicol in BRB80.
  • the kinesin motor domain is incubated with microtubules, 1 mM ATP (1:1 MgCl 2 : Na- ATP), and compound at 23°C in buffer containing 80 mM K-HEPES (pH 7.0), 1 mM EGTA, 1 mM DTT, 1 mM MgCl 2 , and 50 mM KC1.
  • the reaction is terminated by a 2-10 fold dilution with a final buffer composition of 80 mM HEPES and 50 mM EDTA.
  • Free phosphate from the ATP hydrolysis reaction is measured via a quinaldine red/ammonium molybdate assay by adding 150 ⁇ l of quench C buffer containing a 2:1 ratio of quench A:quench B.
  • Quench A contains 0.1 mg/ml quinaldine red and 0.14% polyvinyl alcohol; quench B contains 12.3 mM ammonium molybdate tetrahydrate in 1.15 M sulfuric acid.
  • the reaction is incubated for 10 minutes at 23°C, and the absorbance of the phospho- molybdate complex is measured at 540 nm.
  • Cell Proliferation Assay Cells are plated in 96-well tissue culture dishes at densities that allow for logarithmic growth over the course of 24, 48, and 72 hours and allowed to adhere overnight. The following day, compounds are added in a 10-point, one-half log tittation to all plates. Each titration series is performed in triplicate, and a constant DMSO concenttation of 0.1 % is maintained throughout the assay. Conttols of 0.1% DMSO alone are also included. Each compound dilution series is made in media without serum. The final concentration of serum in the assay is 5% in a 200 ⁇ L volume of media.
  • cytotoxic EC 50 is derived by plotting compound concentration on the x-axis and average percent inhibition of cell growth for each tittation point on the y-axis. Growth of cells in control wells that have been tteated with vehicle alone is defined as 100% growth for the assay, and the growth of cells treated with compounds is compared to this value. Proprietary in-house software is used to calculate percent cytotoxicity values and inflection points using logistic 4-parameter curve fitting. Percent cytotoxicity is defined as:
  • the inflection point is reported as the cytotoxic EC 50 .
  • FACS analysis is used to evaluate the ability of a compound to arrest cells in mitosis and to induce apoptosis by measuring DNA content in a treated population of cells.
  • Cells are seeded at a density of 1.4xl0 6 cells per 6cm 2 tissue culture dish and allowed to adhere overnight. Cells are then tteated with vehicle (0.1% DMSO) or a tittation series of compound for 8-16 hours. Following tteatment, cells are harvested by trypsinization at the indicated times and pelleted by centrifugation. Cell pellets are rinsed in PBS and fixed in 70% ethanol and stored at 4°C overnight or longer.
  • Paraffin-embedded tumor sections are deparaffinized with xylene and rehydrated through an ethanol series prior to blocking.
  • Slides are incubated in primary antibodies (mouse monoclonal anti- ⁇ -tubulin antibody, clone DM1 A from Sigma diluted 1:500; rabbit polyclonal anti-pericentrin antibody from Covance, diluted 1:2000) overnight at 4°C.
  • primary antibodies mouse monoclonal anti- ⁇ -tubulin antibody, clone DM1 A from Sigma diluted 1:500; rabbit polyclonal anti-pericentrin antibody from Covance, diluted 1:2000
  • conjugated secondary antibodies FITC-conjugated donkey anti-mouse IgG for tubulin; Texas red-conjugated donkey anti-rabbit IgG for pericenttin
  • FITC-conjugated donkey anti-mouse IgG for tubulin Texas red-conjugated donkey anti-rabbit IgG for pericent
  • Step 1 4-Allyl-4-phenyl-l,3-oxazolidin-2-one (l-4) To a suspension of 15.8g (416mmol) of LAH powder in 600 mL of diethyl ether was added 18.3g (90 mmol) of -allyl- ⁇ -phenylglycine ethyl ester (1-3) (prepared according to: Van Betsbrugge et. al. Tetrahedron, 1997, 53, 9233-9240) in 75 mL of diethyl ether at such a rate as to maintain gentle reflux. After stirring overnight at room temperature, the reaction was carefully quenched with 27 mL of water, followed by 27 mL of 15% NaOH and finally 82 mL of water.
  • 1-3 prepared according to: Van Betsbrugge et. al. Tetrahedron, 1997, 53, 9233-9240
  • Step 2 Diester (1-5) A solution of 68g (334.6 mmol) of I in 500 mL of CH 2 C1 2 was cooled to -78°C and ozone was bubbled through the solution until a pale blue color persisted. 0 2 was then bubbled through the solution for 15 minutes, followed by 30 minutes with N 2 . At that time, 491 mL (6.7 moles) of dimethyl sulfide was added, and the solution was stirred overnight while slowly coming to room temperature. The volatiles were removed by rotary evaporation to provide a brown oil. This material was suspended in IL of tBuOH, and 200 mL (1.9 moles) of 2-methyl-2-butene was added.
  • Step 3 7a-Phenyldihydro-m-pyrrolori,2-ciri,31oxazole-3,6(5H)-dione (1-6)
  • a solution of 18.6g (53 mmol) of in 150 mL of THF at -78°C was added dropwise 58.6 mL (58.6 mmol) of a IM solution of LiHMDS in THF.
  • the cooling bath was removed and the reaction was allowed to warm to room temperature and stir overnight.
  • the mixture was quenched with a saturated NHL t Cl solution, extracted twice with EtOAc, washed twice with brine, dried over Na 2 S0 4 and concentrated.
  • Step 4 6-(2.5-Difluorophenyl)-7a-phenyl-5.7a-dihydro-lH-pyrrolo[ 1 ,2-c] fl ,31oxazol-3-one (1-7)
  • a suspension of 2.2g (10 mmol) of 1 7 in 150 mL of THF at -78°C was added dropwise 12.2 mL (12.2 mmol) of a IM solution of NaHMDS in THF. After stirring for 30 min, the solution was allowed to warm to 0°C and held there for lh.
  • Step 5 2-( ⁇ [tert-Butyl(dimethyl)silyl]oxy ⁇ methyl)-4-(2,5-difluorophenyl)-2-phenyl-2,5-dihydro- lH-pyrrole (1-8)
  • a suspension of 1.75g (5.6 mmol) 1 7 in 15 mL of EtOH and 10 mL of 3 M NaOH was heated at 60°C for 3h, cooled to room temperature and dumped into a separatory funnel with EtOAc and brine. The layers were separated, the aqueous phase was extracted twice with EtOAc, the combined organic phases were washed twice with brine, dried over Na 2 S0 , and concentrated to provide a white solid.
  • Step 6 Enantiomeric resolution of Intermediate 1-8 Resolution of the enantiomers was carried out chromatographically using a Chiralpak
  • Step 7 (2S)-2-( ⁇ [tert-Butyl(dimethyl)silyl]oxy ⁇ methyl)-4-(2,5-difluorophenyl)-2-phenyl-2,5- dihydro-lH-pyrrole-1 -carbonyl chloride 1-9
  • Step 1 Methyl 4-methylene-2-phenylprolinate (1B-2) An aqueous solution (300 mL) of phenyl glycine methyl ester-HCl (100 g) was neutralized to pH 8 with ION NaOH. The aqueous solution was extracted with EtOAc (3 X 200 mL). The combined organic extracts were dried over MgS0 , filtered, and concentrated. The residue (56.7 g, 344 mmol) was dissolved in ttimethylorthoformate (100 mL) and tteated with benzaldehyde (34.9 mL, 36.4 g, 344 mmol).
  • Step 2 7a-Phenyldihvdro-lH-Dyrrolon.2-ciri.31oxazole-3.6(5H)-dione (1-6)
  • a suspension of LiAlBU (7.14 g, 188 mmol) in THF (500 mL) was cooled to 0°C and treated with a solution of ester IB -2 (10.2 g, 47 mmol) in THF (50 mL) over 20 min. After stirring for 30 min at 0°C, the reaction was cautiously quenched by the addition of water (7.1 mL), 15% aq NaOH (7.1 mL), and H 2 0 (21.3 mL). Solid Na 2 S0 4 was added and the mixture stirred for 40 min.
  • Step 1 (2R)-r(ethoxycarbonyl)amino1(phenyl)acetic acid (1C-2)
  • ethyl chloroformate ethyl chloroformate over 1 h with the internal temperature maintained below 10 °C.
  • the reaction was aged for 15 min at 0-10 °C and assayed for completion.
  • Step 2 ethyl (2S.4R)-5-oxo-2.4-diphenyl-1.3-oxa7.olidine-3-carboxylate (1C-3)
  • 1C-2 and PhS0 H 42.7gm
  • toluene 5 mL/g
  • Toluene/MeOH was distilled off through the course of reaction.
  • the solution was cooled to rt and diluted with THF (36L), until homogeneous.
  • Step 3 ethyl (2S.4S)-4-allyl-5-oxo-2.4-diphenyl-1.3-oxazolidine-3-carboxylate (1C-4)
  • THF a 2M solution of sodium bis(trimethylsilyl)amide in THF (7L) over 1 h, with the temperature maintained ⁇ 5 °C.
  • the reaction was assayed for completion.
  • the reaction was quenched with IN HC1 (22.5L) and diluted with heptane (20L). The Aq. layer was cut and the organic layer was washed with sat'd. brine (12L).
  • Step 4 methyl (2S)-2-r(ethoxycarbonyl)aminol -2-phenylpent-4-enoate ( 1 C-5)
  • 30% NaOMe in MeOH 535mL
  • the reaction was assayed for completion.
  • the reaction was quenched into 5% NaHS0 3 (40L) and diluted with fPAc (20L).
  • the aqueous layer was cut and the organic layer was washed with 10% KH 2 P0 (12L).
  • Step 5 methyl 4-[(ethoxycarbonyl)oxyl-2-phenyl-D-prolinate (1C-6) To an 23 °C solution of 1C-5 in MeCN (42L) was added water (12L), followed by I 2 (8kg). After 6 h, the reaction was assayed for completion. The reaction was quenched with 10% Na 2 S0 3 (35L), basif ⁇ ed with 50wt% NaOH (4L)and extracted with IPAc (35L). The aqueous layer was cut and discarded and the organic layer was extracted with 6N HC1 (35L). The organic layer was discarded. The aq.
  • Step 6 (5S)-5-(hydroxymethyl)-5-phenylpyrrolidin-3-ol (1C-7)
  • the reaction mixture was warmed up to rt and aged for 2h.
  • the reaction was quenched by 2.0M Rochelle salt solution (45mL, ca. 1.5moleq to Red-Al) at 0° and aged vigorously over 5h at rt.
  • Step 7 (7aS)-6-hvdroxy-7a-phenyltetrahvdro-lH-pyrrolor 1.2-cl 1 ,31oxazol-3-one ( 1C-8)
  • CDI 3.46g, 21.3mmol, 1.25moleq.
  • 30mL of 2N HC1 solution was added to the reaction mixture and aging for lh.
  • the aqueous phase was separated and extracted with 30mL of n-BuOAc after addition of 6.0g of NaCl.
  • To the combined organic layer was added 150mg of activated carbon (Darco KB) and the mixture aged overnight.
  • Step 8 (7aS)-7a-phenyldihvdro-lH-pyrrolor 1.2-cl ⁇ 1 ,31oxazole-3.6(5H)-dione ( 1 C-9)
  • Step 1 6-(2.5-Difluorophenyl)-7a-phenyl-5.7a-dihydro- 1 H-pyrrolo r 1 ,2-c] ⁇ 1,31 oxazol-3-one ( 1 -7)
  • a suspension of 231 g (1.06 moles) of l__5 in 11 L of THF in a 20L jacketed reactor was stirred vigorously with overhead stirring for 1 h, then cooled to -70°C.
  • To this suspension was added dropwise 1.28 L (1.28 moles) of a IM solution of NaHMDS in THF.
  • Step 2 2-( ⁇ [tert-Butyl(dimethyl)silyl]oxy ⁇ methyl)-4-(2,5-difluorophenyl)-2-phenyl-2,5-dihydro- lH-pyrrole (1-8)
  • a suspension of 109.4g (349 mmol) L7 in 2.2 L of EtOH and 105 mL (1.05 moles) of 10 M NaOH in a 10L round bottom was heated at 60°C for 4h, cooled to room temperature and aged overnight. To this mixture was added 90.2 mL (1.08 moles) of concentrated HCl and the solvents were removed by rotary evaporation.
  • Step 2 Benzyl 3-fluoro-4-(methylamino)piperidine-l-carboxylate (2-2a) To a solution of 9.4g (37.5 mmol) of 7 1 in 150 mL of 1,2-dichloroethane was added 37.5 mL (74.9 mmol) of a 2M solution of methylamine in THF and 11.9g (56.2 mmol) of Na(OAc) 3 BH. After stirring for 2h, the reaction was quenched with saturated aqueous K 2 C0 3 , partitioned with EtOAc, separated, and the aqueous phase extracted 3 x EtOAc.
  • Step 3 Benzyl (3R,4S)-4-[(ter ⁇ -butoxycarbonyl)(methyl)amino]-3-fluoropiperidine-l- carboxylate (2-3)
  • a solution of 7.67g (28.8 mmol) of cis-2-2a in 150 mL of CH 2 C1 2 was added 12.1 mL (86.5 mmol) of triethylamine and 9.44g (43.3 mmol) of di-tert-butyl dicarbonate.
  • the reaction was partitioned between CH 2 C1 2 and H 2 0, the organic phase was washed with brine, dried over MgS0 , filtered and concenttated by rotary evaporation.
  • Step 4 fe -Butyl r(3R.45)-3-fluoro-l-methylpiperidin-4-yllmethylcarbamate (2-4) To a solution of 4.6g (12.6 mmol) of the second eluting enantiomer 2 in 150 mL of
  • EtOH was added 29.7 mL (314 mmol) of 1,4-cyclohexadiene and a catalytic amount of 10% Pd on carbon. After stirring overnight, the reaction was filtered through Celite, and concenttated by rotary evaporation. The residue was dissolved in 75 mL of MeOH, 2mL of AcOH and 3.1mL (38 mmol) of 37% aqueous formaldehyde were added, and the mixture was stirred for lh. At that time, 1.58g (25.1 mmol) of NaCNBH 3 in lOmL of MeOH was added and the reaction was aged for 2h more before being dumped into saturated aqueous NaHC0 3 .
  • Step 5 (3R.4S)-3-Fluoro-N. l-dimethylpiperidin-4-amine (2-5)
  • a solution of 3.0g (12.2 mmol) of 24 in lOOmL of EtOAc was bubbled HCl gas until the solution was warm to the touch.
  • the flask was then capped and stirred for 4h.
  • the volatiles were removed by rotary evaporation, and the residue was triturated with Et 2 0 and placed under high vacuum to provide a white solid.
  • This material was mixed with 25 mL of 15% aqueous ⁇ a C0 3 and extracted with 5 x 50 mL 2: 1 CHCl 3 /EtOH.
  • Step 1 Benzyl 3-fluoro-4-oxopiperidine-l-carboxylate (2-2) A 22-L round bottom flask with mechanical stirrer was charged with Cbz-ketone 2-1 (2.5 kg, 10.7 mol), 5.0 L of dimethylacetamide, ttiethylamine (3.0L, 21.5 mol). Trimethylsilylchloride (2.0 L, 15.7 mol) was added. The mixture heated to 60 °C and aged for 4 hours. After cooling to 10 °C, the mixture was quenched into 10 L of 5% sodium bicarbonate and 10 L n-heptane maintaining the internal temperature at less than 20 °C. The organic layer was washed twice with 10 L of 2.5% sodium bicarbonate.
  • the final organic layer was dried over sodium sulfate, filtered, and concentrated under reduced pressure and solvent switched to 10 L MeCN.
  • a 50-L jacketed vessel was charged with 7.5 L of MeCN and Selectfluor (4.1 kg, 11.5 mol).
  • the slurry was cooled to 10 °C and potassium carbonate (0.37 kg, 2.68 mol) added.
  • the silyl ether solution in MeCN was ttansferred in portions maintaining the internal temperature at 10-15 °C.
  • the final slurry was aged for 2 hours at 10-15 °C.
  • the reaction was quenched into a 100 L extractor containing 20L of 2 N hydrochloric acid and 30 L of ethyl acetate.
  • Step 2 Benzyl 3-fluoro-4-(methylammo)piperidine-l-carboxylate (2-2a) In a round-bottom flask, Cbz fluoroketone (10.3mol) was dissolved in tetrahydrofuran
  • the solid was suspended in 36L EtOH and 4L water mixture and the mixture was heated to 70 °C-80 °C until all solid dissolved. The heat source was removed and the clear solution was seeded with the cis isomer mixture 2-2a. After stirring at room temperature overnight, a crystalline solid precipitated and was collected by filtration. The solid product was dried in vacuum oven to give white solid.
  • Step 3 Benzyl (3/?,4S)-4-[(f ⁇ rt-butoxycarbonyl)(methyl)amino]-3-fluoropiperidine-l- carboxylate 2-3
  • IPAC 20 L
  • CBZ amine 2-2aphosphate (1.85 kg, 5.3 mol) were added.
  • the layers were cut after mixing.
  • the aqueous layer was extracted with another 5L IPAC.
  • the combined organic layers were dried with sodium sulfate. After the drying agent was filtered off, the batch was charged into a 72 L round bottom flask, and Boc 0 solution (1.0 M, 4.8 L) was added.
  • Step 4 fe -Butyl r(3R.4S)-3-fluoro-l -methylpiperidin-4-yllmethylcarbamate (2-4)
  • the concenttated solution (4 L) from the chiral separation step was shown to contain
  • Step 5 (3R.4S)-3-Fluoro-N. l-dimethylpiperidin-4-amine (2-5)
  • the ethyl acetate solution containing the Boc protected diamine 2-4 (327 g by HPLC assay) was charged to a 12 L flask while concentrating at 28 °C.
  • the batch had a total volume of 1.5L
  • the batch was then solvent switched to ethanol by charging 8L of ethanol while distilling at a constant volume.
  • To a different 12 L round bottom flask was added 1.5 L of ethanol (200 proof, punctilious). 436 mL of acetyl chloride was then added to the ethanol maintaining the temperature below 35 °C with the aid of a water bath. The solution was stirred for lh.
  • Anisottopic displacement parameters (A 2 x 10 ) for 2 5.
  • the anisottopic displacement factor exponent takes the form: -2 pi 2 [ h 2 a* 2 UI 1 + ... + 2 h k a* b* U12 ]
  • the solution was warmed to 60°C for 15 hrs and assayed for conversion of carbamyl chloride to product.
  • the reaction is considered complete when the conversion of carbamyl chloride to product is >98A% at 200 nm by HPLC.
  • the reaction was cooled to 5°C and 450 ml 6 ⁇ HC1 was added.
  • the solution was aged until desilylation was complete (>99A% at 200 nm), about 2 hrs.
  • Isopropylacetate (3L) and then 8wt % aqueous sodium bicarbonate was added (2L) to the reaction mixture, which was allowed to warm to 15-20°C.
  • the layers were separated and the aqueous layer exttacted once with 3L IPAC.
  • the combined organic layers were washed twice with IL water.
  • a single crystal from the above preparation was selected for single crystal x-ray data collection on a Bruker Smart Apex system.
  • the crystal was colorless polyhedron with dimensions of 0.14 mm x 0.13 mm x 0.13 mm.
  • the unit cell was collected on 30 second scan rate and auto indexing gave the cell setting to be orfhorhombic.
  • the structure was solved in the orthorhombic P 2 ⁇ 2j 2 ⁇ space group after a quadrant data collection using 30 second scan rate. See Tables 6-10 for tabulated information pertaining to the final specifications of the solved structure.
  • Absolute structure parameter 0(10) Largest diff. peak and hole 0.165 and -0.120 e.A "3
  • Anisottopic displacement parameters (A 2 x 10 3 ) for 3-1.
  • the anisottopic displacement factor exponent takes the form: -2 pi 2 [ h 2 a* 2 UI 1 + ... + 2 h k a* b* U12 ]
  • Step 1 (2S.4S)-tert-Butyl 4-hvdroxy-2-phenylpyrrolidine-l -carboxylate (6-2)
  • Step 2 (2S)-tert-Butyl 4-oxo-2-phenylpyrrolidine-l -carboxylate (6-3) To a flame dried flask equipped with stir bar was added 150 mL anhydrous dichloromethane which was cooled to -78°C. Oxalyl chloride (3.8 mL, 44 mmol) and DMSO (4.8 mL, 61 mmol) were added sequentially and the reaction stirred for 10 minutes.
  • Step 3 (2S)-tert-Butyl 2-phenyl-4- ⁇ [(ttifluoromethyl)sulfonyl]oxy ⁇ -2,5-dihydro-lH-pyrrole-l- carboxylate (6-4 )
  • ketone (2S)-tert-butyl 4-oxo-2- phenylpyrrolidine-1 -carboxylate (6-3, 0.16 g, 0.62 mmol)
  • anhydrous THF (2 resulting solution was cooled to -78°C, and treated dropwise with lithium hexamethyldisilylamide (LHMDS, 0.68 mL, IM in THF, 0.68 mmoL).
  • Step 4 (2S)-4-(2,5-Difluorophenyl)-2-phenyl-N,N-dimethyl-2,5-dihydro-lH-pyrrole-l- carboxamide (6-5)
  • (2S)-tert-butyl 2-phenyl-4- ⁇ [(ttifluoromethyl)sulfonyl]oxy ⁇ -2,5-dihydro-lH-pyrrole-l-carboxylate (6- ⁇ , 0.250 g, 0.636 mmol), 2,5- difluorophenyl boronic acid (0.251 g, 1.59 mmol), Na 2 C0 3 (0.202 g, 1.91 mmol), and LiCl (0.081 g, 1.91 mmol).
  • Step 5 l- ⁇ [(2S)-4-(2,5-Difluorophenyl)-2-phenyl-2,5-dihydro-lH-pyrrol-l-yl]carbonyl ⁇ -3- methyl-lH-imidazol-3-ium (6-6)
  • 6-5 (0.63 g, 1.75 mmol) and anhydrous CH 2 CL 2 (10 mL).
  • the resulting solution was treated with trifluoroacetic acid (5 mL) and stirred 1.5 hours at 25°C.
  • the reaction was concentrated, taken up in CH 2 C1 2 (50 mL) and washed with 5% NaHC0 3 (50 mL).
  • reaction was quenched with saturated aqueous NH 4 CI, exttacted with CH 2 C1 2 , washed with NaHC0 3 , H 2 0, brine, dried over MgS0 , and concentrated to provide 2.0g (7.2 mmol) of the amine.
  • This material was dissolved in 25mL of CH 2 C1 2 , 1.78g (8.2 mmol) of di-tert-butyl dicarbonate and 1.8 mL (12.9 mmol) of triethylamine were added, and the resultant mixture was stirred for 72h.
  • the reaction was then partitioned between CH 2 C1 2 and saturated aqueous NaHC0 3 , separated, washed with H 2 0, brine, dried over MgS0 4 , and concenttated.
  • the residue was purified by silica gel chromatography with EtOAc/hexanes to provide 1.85g (4.6 mmol) of a mixture of diastereomers. This was dissolved in 20 mL of THF and ImL of MeOH, cooled to 0°C, and 496mg (22.8 mmol) of LiBEL, was added.
  • Step 1 Benzyl (3R,4S)-4-[ ⁇ [(25)-4-(2,5-difluoro ⁇ henyl)-2-(hydroxymethyl)-2-phenyl-2,5- dihydro- lH-pyrrol- 1 -y 1] carbonyl ⁇ (methyl)amino] -3 -fluoropiperidine-1 -carboxylate (10- 11; To a solution of 885mg (2.4 mmol) of 2_3 in 12 mL of EtOAc at 0°C was added 12 mL (48 mmol) of a 4M solution of HCl in dioxane.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Ceramic Engineering (AREA)
  • Manufacturing & Machinery (AREA)
  • Structural Engineering (AREA)
  • Materials Engineering (AREA)
  • Health & Medical Sciences (AREA)
  • Inorganic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to dihydropyrrole compounds of the formula (I) that are useful for treating cellular proliferative diseases, for treating disorders associated with KSP kinesin activity, and for inhibiting KSP kinesin. The invention is also related to compositions which comprise these compounds, and methods of using them to treat cancer in mammals.

Description

TITLE OF THE INVENTION MΓΓOTIC KΓNESΓN INHIB TORS
BACKGROUND OF THE INVENTION This invention relates to 2,2-disubstituted 2,5-dihydropyrrole derivatives that are inhibitors of mitotic kinesins, in particular the mitotic kinesin KSP, and are useful in the tteatment of cellular proliferative diseases, for example cancer, hyperplasias, restenosis, cardiac hypertrophy, immune disorders and inflammation. Among the therapeutic agents used to treat cancer are the taxanes and vinca alkaloids. Taxanes and vinca alkaloids act on microtubules, which are present in a variety of cellular structures.
Microtubules are the primary structural element of the mitotic spindle. The mitotic spindle is responsible for distribution of replicate copies of the genome to each of the two daughter cells that result from cell division. It is presumed that; disruption of the mitotic spindle by these drugs results in inhibition of cancer cell division, and induction of cancer cell death. However, microtubules form other types of cellular structures, including ttacks for inttacellular ttansport in nerve processes. Because these agents do not- specifically target mitotic spindles, they have side effects that limit their usefulness. Improvements in the specificity of agents used to treat cancer is of considerable interest because of the therapeutic benefits which would be realized if the side effects associated with the administration of these agents could be reduced. Traditionally, dramatic improvements in the tteatment of cancer are associated with identification of therapeutic agents acting through novel mechanisms. Examples of this include not only the taxanes, but also the camptothecin class of topoisomerase I inhibitors. From both of these perspectives, mitotic kinesins are attractive targets for new anti-cancer agents. Mitotic kinesins are enzymes essential for assembly and function of the mitotic spindle, but are not generally part of other microtubule structures, such as in nerve processes. Mitotic kinesins play essential roles during all phases of mitosis. These enzymes are "molecular motors" that transform energy released by hydrolysis of ATP into mechanical force which drives the directional movement of cellular cargoes along microtubules. The catalytic domain sufficient for this task is a compact structure of approximately 340 amino acids. During mitosis, kinesins organize microtubules into the bipolar structure that is the mitotic spindle. Kinesins mediate movement of chromosomes along spindle microtubules, as well as structural changes in the mitotic spindle associated with specific phases of mitosis. Experimental perturbation of mitotic kinesin function causes malformation or dysfunction of the mitotic spindle, frequently resulting in cell cycle arrest and cell death. Among the mitotic kinesins which have been identified is KSP. KSP belongs to an evolutionarily conserved kinesin subfamily of plus end-directed microtubule motors that assemble into bipolar homotetramers consisting of antiparallel homodimers. During mitosis KSP associates with microtubules of the mitotic spindle. Microinjection of antibodies directed against KSP into human cells prevents spindle pole separation during prometaphase, giving rise to monopolar spindles and causing mitotic arrest and induction of programmed cell death. KSP and related kinesins in other, non-human, organisms, bundle antiparallel microtubules and slide them relative to one another, thus forcing the two spindle poles apart. KSP may also mediate in anaphase B spindle elongation and focussing of microtubules at the spindle pole. Human KSP (also termed HsEg5) has been described [Blangy, et al., Cell, 83:1159-69 (1995); Whitehead, et al., Arthritis Rheum., 39:1635-42 (1996); Galgio et al., J. Cell Biol., 135:339-414 (1996); Blangy, et al., J Biol. Chem., 272:19418-24 (1997); Blangy, et al., Cell Motil Cytoskeleton, 40:174-82 (1998); Whitehead and Rattner, J. Cell Sci., 111:2551-61 (1998); Kaiser, et al, JBC 274:18925-31 (1999); GenBank accession numbers: X85137, NM004523 and U37426] , and a fragment of the KSP gene (TRIP5) has been described [Lee, et al., Mol Endocrinol., 9:243-54 (1995); GenBank accession number L40372]. Xenopus KSP homologs (Eg5), as well as Drosophila K-LP61 F/KRP 130 have been reported. Certain quinazolinones have recently been described as being inhibitors of KSP (PCT Publ. WO 01/30768, May 3, 2001). Mitotic kinesins are attractive targets for the discovery and development of novel mitotic chemotherapeutics. Accordingly, it is an object of the present invention to provide compounds, methods and compositions useful in the inhibition of KSP, a mitotic kinesin.
SUMMARY OF THE INVENTION The present invention relates to dihydropyrrole derivatives, that are useful for treating cellular proliferative diseases, for treating disorders associated with KSP kinesin activity, and for inhibiting KSP kinesin. The compounds of the invention may be illustrated by the Formula I:
Figure imgf000003_0001
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 An ORTEP drawing of Compound 2-5 FIGURE 2 An ORTEP drawing of Compound 3-1 In order to simplify the drawing most of the hydrogen atoms are not shown.
DETAILED DESCRIPTION OF THE INVENTION The compounds of this invention are useful in the inhibition of mitotic kinesins and are illustrated by a compound of Formula I:
Figure imgf000004_0001
or a pharmaceutically acceptable salt or stereoisomer thereof,
wherein:
a is 0 or 1; b is 0 or 1; m is 0, 1, or 2; n is 0, 1, 2 or 3; r is O or l; s is O or l; t is 0, 1 or 2; Rl and R2 are independently selected from: H, (Cl-C6)alkyl, aryl, heterocyclyl and (C3~C6)cycloalkyl, optionally substituted with one, two or three substituents selected from R7;
R3 is selected from: 1) hydrogen; 2) Ci-ClO alkyl; 3) Ci-Cio alkyl-O-Rd, 4) C2-C10 alkenyl-O-Rd, 5) C2-C10 alkynyl-O-Rd, 6) (Cι-C6-alkylene)nC3-C8 cycloalkyl-O-Rd,
Figure imgf000005_0001
10) (Cι-C6-alkylene)nC3-C8
Figure imgf000005_0002
11) C1-C10 alkyl-S(0)ra-Rd, 12) C2-C10 alkenyl- S(0)m-Rd, 13) C2-C10 alkynyl- S(0)m-Rd, 14) (Cι-C6-alkylene)nC3-C8 cycloalkyl- S(0)m-Rd, said alkyl, alkenyl, alkynyl and cycloalkyl are optionally substituted with one or more substituents selected from R6;
R4 is independently selected from: 1) (C=0)aObCι-Cιo alkyl, 2) (C=0)aObaryl, 3) CO2H, 4) halo, 5) CN, 6) OH, 7) ObCl-Cβ perfluoroalkyl,
Figure imgf000005_0003
9) S(0)mRa, 10) S(0)2NR8R9, said alkyl, aryl, alkenyl, alkynyl, heterocyclyl, and cycloalkyl optionally substituted with one, two or three substituents selected from R7; R5 is selected from: 1) hydrogen; 2) (C=0)aObCi-Cιo alkyl, 3) (C=0)aObaιyl, 4) C02H, 5) halo, 6) CN, 7) OH, 8) O Ci -C6 perfluoroalkyl, 9) Oa(C=0) NR8R9, 10) S(0)mRa
Figure imgf000006_0001
12) -OPO(OH)2; said alkyl, aryl, alkenyl, alkynyl, heterocyclyl, and cycloalkyl optionally substituted with one, two or three substituents selected from R ;
R6 is independently selected from: 1) (C=0)aObCι-Cιo alkyl, 2) (C=0)aObaryl, 3) C2-C1 o alkenyl, 4) C2-C10 alkynyl, 5) (C=0)aOb heterocyclyl, 6) C02H, 7) halo, 8) CN, 9) OH, 10) O Ci -Cβ perfluoroalkyl,
Figure imgf000006_0002
12) S(0)mRa,
Figure imgf000006_0003
14) oxo, 15) CHO, 16) (N=0)R8R9, 17) (C=0)aObC3-C8 cycloalkyl, and 18) -OPO(OH)2; said alkyl, aryl, alkenyl, alkynyl, heterocyclyl, and cycloalkyl optionally substituted with one, two or three substituents selected from R7;
R7 is selected from: 1) (C=0)rOs(Ci-Cio)alkyl, 2) Or(C 1 -C3)perfluoroalkyl, 3) oxo, 4) OH, 5) halo, 6) CN, 7) (C2-Cιo)alkenyl, 8) (C2-Cιo)alkynyl, 9) (C=0)rOs(C3-C6)cycloalkyl, 10) (C=0)rOs(Co-C6)alkylene-aryl, 11) (C=0)rOs(Co-C6)alkylene-heterocyclyl, 12) (C=O)rOs(C0-C6)alkylene-N(Rb)2, 13) C(0)Ra, 14) (Co-C6)alkylene-C02Ra, 15) C(0)H, 16) (Co-C6)alkylene-Cθ2H, and 17) (C=0)rN(Rb)2, 18) S(0)mRa 19) S(0)2N(Rb)2; and 20) -OPO(OH)2; said alkyl, alkenyl, alkynyl, cycloalkyl, aryl, alkylene and heterocyclyl is optionally substituted with up to three substituents selected fromRb, OH, (Cι-C6)alkoxy, halogen, CO2H, CN,
Figure imgf000007_0001
alkyl, oxo, NO2 and N(Rb)2; and R9 1 ire independently selected from: 1) H, 2) (C=0)O Cι-Cιo alkyl, 3) (C=0)ObC3-C8 cycloalkyl, 4) (C=0)Obaryl, 5) (C=0)Obheterocyclyl, 6) C1-C10 alkyl, 7) aryl, 8) C2-C10 alkenyl, 9) C2-C10 alkynyl, 10) heterocyclyl, 11) C3-C8 cycloalkyl, 12) Sθ2Ra, and 13) (C=0)NRb2, said alkyl, cycloalkyl, aryl, heterocylyl, alkenyl, and alkynyl is optionally substituted with one, two or three substituents selected from R7, or
R8 and R can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 3-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle - optionally substituted with one, two or three substituents selected from R7;
RlO is selected from: F and -CH2F;
Rl3 is selected from: H and -CH2F, provided that if t is 1, Rl is H;
Rox is absent or is oxo;
Ra is independently selected from: (Cι-C6)alkyl, (C3-C6)cycloalkyl, aryl, or heterocyclyl, optionally substituted with one, two or three substituents selected from R7;
Rb is independently selected from: H, (Cι-C6)alkyl, aryl, heterocyclyl, (C3-C6)cycloalkyl, (C=0)OCι - Cβ alkyl, (C=0)Cι-C6 alkyl, (C=0)aryl, (C=0)heterocyclyl, (C=0)NReRe Or S(0)2Ra, optionally substituted with one, two or three substituents selected from R7;
RCand Rc' are independently selected from: H, (Cι-C6)alkyl, aryl, NH2, OH, OR , -(Cι -C6)alkyl-OH, - (Cι-C6)alkyl-0-(Cι-C6)alkyl, (C=0)OCi-C6 alkyl, (C=0)Cι -C6 alkyl, (C=0)aryl, (C=0)heterocyclyl, (C=0)NReRe ', S(0)2Ra and -(Cι-C6)alkyl-N(Rb)2, wherein the alkyl is optionally substituted with one, two or three substituents selected from R7; or
R and Rc' can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 3-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle optionally substituted with one, two or three substituents selected from R7; Rd is selected from: H, (Cι-C6)alkyl, -(C2-C6)alkyl-OH, -(Cι-C6)alkyl-0-(Cι-C6)alkyl and -(Cι-
C6)alkyl-N(Rb)2, wherein the alkyl is optionally substituted with one, two or three substituents selected from R7;;
Re and Re' are independently selected from: H, (Ci-C6)alkyl, aryl, heterocyclyl and (C3-C6)cycloalkyl, optionally substituted with one, two or three substituents selected from R7; or
Re and Re' can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 3-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle optionally substituted with one, two or three substituents selected from R7.
In an embodiment of the invention the compounds are illustrated by a compound of Formula II:
Figure imgf000009_0001
or a pharmaceutically acceptable salt or stereoisomer thereof,
wherein a, b, m, r, s, R8, R9, Ra5 Rb5 RC; RC', Rd; Re and e'5 ^Q as described above in the compound of Formula I; and
n is 0, 1 or 2; Rl and R are independently selected from: H, (Cι-C6)alkyl, aryl and (C3-C6)cycloalkyl, optionally substituted with one, two or three substituents selected fromR7;
R4 is independently selected from: 1) halo, 2) OH, and 3) ObCι-C6 perfluoroalkyl,
R5 is selected from: 1) hydrogen, 2) halo, 3) OH, and 4) ObCi-Cβ perfluoroalkyl; and
R7 is selected from: 1) (C=0)rOs(Cι-Cιo)alkyl, 2) Or (C i -C3 )perfluoroalky 1, 3) oxo, 4) OH, 5) halo, 6) CN, 7) (C2-Cιo)alkenyl, 8) (C2-Cιo)alkynyl, 9) (C=0)rOs(C3-C6)cycloalkyl, 10) (C=0)rOs(Co-C6)alkylene-aryl, 11) (C=0)rOs(Co-C6)alkylene-heterocyclyl, 12) (C=0)rOs(Co-C6)alkylene-N(Rb)2, 13) C(0)Ra, 14) (Co-C6)alkylene-Cθ2Ra, 15) C(0)H, 16) (Co-C6)alkylene-Cθ2H, and 17) C(0)N(Rb)2, 18) S(0)mRa, and 19) S(0)2N(Rb)2; said alkyl, alkenyl, alkynyl, cycloalkyl, aryl, alkylene and heterocyclyl is optionally substituted with up to three substituents selected fromRb, OH, (Cι-C6)alkoxy, halogen, CO2H, CN, 0(C=0)Cj_-C6 alkyl,
Figure imgf000011_0001
A further embodiment of the present invention is illustrated by a compound of Formula m:
Figure imgf000011_0002
or a pharmaceutically acceptable salt or stereoisomer thereof,
wherein:
Rl and R2 are independently selected from: H and (Ci-Cβ)alkyl.
A further embodiment of the present invention is illusttated by a compound of Formula TV:
Figure imgf000011_0003
or a pharmaceutically acceptable salt or stereoisomer thereof,
wherein:
Rl and R are independently selected from: H and (Cι-C6)alkyl.
Specific examples of the compounds of the instant invention include:
(25)-4-(2,5-Difluorophenyl)-N-[(35,4R)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro- lH-pyrrole- 1 -carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(3R,4S)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,4R)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl- 2-phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(3S,45)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro- lH-pyrrole- 1 -carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(35,4R)-3-fluoro-l-methylpiperidin-4-yl]-N-methyl-2-phenyl-2,5- dihydro-lH-pyrrole-1-carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(3R,4S)-3-fluoro-l-methylpiperidin-4-yl]-N-methyl-2-phenyl-2,5- dihydro-lH-pyrrole-1 -carboxamide
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,4R)-3-fluoro-l-methylpiperidin-4-yl]-N-methyl-2-phenyl-2,5- dihydro- lH-pyrrole- 1 -carboxamide
(2S)-4-(2,5-Difluorophenyl)-N-[(2R,4R)-2-(fluoromethyl)-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(25,4S)-2-(fluoromethyl)-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide (25)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoro-l-methyl-l-oxidopiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro-lH-pyrrole-l-carboxarnide
(2S)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoropiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2-phenyl- 2,5-dihydro- lH-pyrrole- 1 -carboxamide
(2S)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoro-l-isopropylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro- lH-pyrrole- 1 -carboxamide
(2S)-4-(2,5-Difluorophenyl)-N-[(3S,45)-3-fluoropiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2-phenyl- 2,5-dihydro- lH-pyrrole- 1 -carboxamide
or a pharmaceutically acceptable salt or stereoisomer thereof. Particular examples of the compounds of the instant invention are:
Figure imgf000013_0001
(2S)-4-(2,5-DifIuorophenyl)-N-[(3S,45)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide
Figure imgf000014_0001
(2S)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro- lH-pyrrole- 1 -carboxamide
Figure imgf000014_0002
(25)-4-(2,5-Difluorophenyl)-N-[(3R,4S)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide
Figure imgf000015_0001
(2S)-4-(2,5-Difluorophenyl)-N-[(2R,4R)-2-(fluoromethyl)-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro- lH-pyrrole- 1 -carboxamide
Figure imgf000015_0002
(21S)-4-(2,5-Difluorophenyl)-N-[(3R,4S)-3-fluoro-l-methylpiperidin-4-yl]-N-methyl-2-phenyl-2,5- dihydro- lH-pyrrole- 1 -carboxamide
or a pharmaceutically acceptable salt or stereoisomer thereof. The compounds of the present invention may have asymmetric centers, chiral axes, and chiral planes (as described in: E.L. Eliel and S.H. Wilen, Stereochemistry of Carbon Compounds, John Wiley & Sons, New York, 1994, pages 1119-1190), and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers and mixtures thereof, including optical isomers, all such stereoisomers being included in the present invention. In addition, the compounds disclosed herein may exist as tautomers and both tautomeric forms are intended to be encompassed by the scope of the invention, even though only one tautomeric structure is depicted. When any variable (e.g. R4, R7, etc.) occurs more than one time in any constituent, its definition on each occurrence is independent at every other occurrence. Also, combinations of substituents and variables are permissible only if such combinations result in stable compounds. Lines drawn into the ring systems from substituents represent that the indicated bond may be attached to any of the substitutable ring atoms. If the ring system is polycyclic, it is intended that the bond be attached to any of the suitable carbon atoms on the proximal ring only. It is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure results. The phrase "optionally substituted with one or more substituents" should be taken to be equivalent to the phrase "optionally substituted with at least one substituent" and in such cases the preferred embodiment will have from zero to three substituents. As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms. For example, Cχ-Cιo, as in "Ci-Cio alkyl" is defined to include groups having 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbons in a linear or branched arrangement. For example, "C1-C1 o alkyl" specifically includes methyl, ethyl, n-propyl, i- propyl, n-butyl, r-butyl, /-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, and so on. The term "cycloalkyl" means a monocyclic saturated aliphatic hydrocarbon group having the specified number of carbon atoms. For example, "cycloalkyl" includes cyclopropyl, methyl-cyclopropyl, 2,2-dimethyl- cyclobutyl, 2-ethyl-cyclopentyl, cyclohexyl, and so on. In an embodiment of the invention the term "cycloalkyl" includes the groups described immediately above and further includes monocyclic unsaturated aliphatic hydrocarbon groups. For example, "cycloalkyl" as defined in this embodiment includes cyclopropyl, methyl-cyclopropyl, 2,2-dimethyl-cyclobutyl, 2-ethyl-cyclopentyl, cyclohexyl, cyclopentenyl, cyclobutenyl and so on. The term "alkylene" means a hydrocarbon diradical group having the specified number of carbon atoms. For example, "alkylene" includes - CH2-, -CH2CH2- and the like. When used in the phrases "C1-C6 aralkyl" and "C1-C6 heteroaralkyl" the term "Cχ-C6" refers to the alkyl portion of the moiety and does not describe the number of atoms in the aryl and heteroaryl portion of the moiety. "Alkoxy" represents either a cyclic or non-cyclic alkyl group of indicated number of carbon atoms attached through an oxygen bridge. "Alkoxy" therefore encompasses the definitions of alkyl and cycloalkyl above. If no number of carbon atoms is specified, the term "alkenyl" refers to a non-aromatic hydrocarbon radical, straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon double bond. Preferably one carbon to carbon double bond is present, and up to four non-aromatic carbon-carbon double bonds may be present. Thus, "C2-C6 alkenyl" means an alkenyl radical having from 2 to 6 carbon atoms. Alkenyl groups include ethenyl, propenyl, butenyl, 2- methylbutenyl and cyclohexenyl. The straight, branched or cyclic portion of the alkenyl group may contain double bonds and may be substituted if a substituted alkenyl group is indicated. The term "alkynyl" refers to a hydrocarbon radical straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon triple bond. Up to three carbon- carbon triple bonds may be present. Thus, "C2-C6 alkynyl" means an alkynyl radical having from 2 to 6 carbon atoms. Alkynyl groups include ethynyl, propynyl, butynyl, 3-methylbutynyl and so on. The straight, branched or cyclic portion of the alkynyl group may contain triple bonds and may be substituted if a substituted alkynyl group is indicated. In certain instances, substituents may be defined with a range of carbons that includes zero, such as (Co-C6)alkylene-aryl. If aryl is taken to be phenyl, this definition would include phenyl itself as well as -CH2PI1, -C^OJ^Ph, CH(CH3)CH2CH(CH3)Ph, and so on. , As used herein, "aryl" is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 atoms in each ring, wherein at least one ring is aromatic. Examples of such aryl elements include phenyl, naphthyl, tetrahydronaphthyl, indanyl and biphenyl. In cases where the aryl substituent is bicyclic and one ring is non-aromatic, it is understood that attachment is via the aromatic ring. The term heteroaryl, as used herein, represents a stable monocyclic or bicyclic ring of up to 7 atoms in each ring, wherein at least one ring is aromatic and contains from 1 to 4 heteroatoms selected from the group consisting of O, N and S. Heteroaryl groups within the scope of this definition include but are not limited to: acridinyl, carbazolyl, cinnolinyl, quinoxalinyl, pyrrazolyl, indolyl, benzotriazolyl, furanyl, thienyl, benzothienyl, benzofuranyl, quinolinyl, isoquinolinyl, oxazolyl, isoxazolyl, indolyl, pyrazinyl, pyridazinyl, pyridinyl, pyrimidinyl, pyrrolyl, tetrahydroquinoline. As with the definition of heterocycle below, "heteroaryl" is also understood to include the N-oxide derivative of any nitrogen-containing heteroaryl. In cases where the heteroaryl substituent is bicyclic and one ring is non-aromatic or contains no heteroatoms, it is understood that attachment is via the aromatic ring or via the heteroatom containing ring, respectively. The term "heterocycle" or "heterocyclyl" as used herein is intended to mean a 5- to 10- membered aromatic or nonaromatic heterocycle containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S, and includes bicyclic groups. "Heterocyclyl" therefore includes the above mentioned heteroaryls, as well as dihydro and tetrathydro analogs thereof. Further examples of "heterocyclyl" include, but are not limited to the following: benzoimidazolyl, benzofuranyl, benzofurazanyl, benzopyrazolyl, benzotriazolyl, benzothiophenyl, benzoxazolyl, carbazolyl, carbolinyl, cinnolinyl, furanyl, imidazolyl, indolinyl, indolyl, indolazinyl, indazolyl, isobenzofuranyl, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthpyridinyl, oxadiazolyl, oxazolyl, oxazoline, isoxazoline, oxetanyl, pyranyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridopyridinyl, pyridazinyl, pyridyl, pyrimidyl, pyrrolyl, quinazolinyl, quinolyl, quinoxalinyl, tetrahydropyranyl, tetrahydrothiopyranyl, tettahydroisoquinolinyl, tetrazolyl, tettazolopyridyl, thiadiazolyl, thiazolyl, thienyl, triazolyl, azetidinyl, 1,4-dioxanyl, hexahydroazepinyl, piperazinyl, piperidinyl, pyridin-2-onyl, pyrrolidinyl, morpholinyl, thiomorpholinyl, dihydrobenzoimidazolyl, dihydrobenzofuranyl, dihydrobenzothiophenyl, dihydrobenzoxazolyl, dihydrofuranyl, dihydroimidazolyl, dihydroindolyl, dihydroisooxazolyl, dihydroisothiazolyl, dihydrooxadiazolyl, dihydrooxazolyl, dihydropyrazinyl, dihydropyrazolyl, dihydropyridinyl, dihydropyrimidinyl, dihydropyrrolyl, dihydroquinolinyl, dihydrotetrazolyl, dihydrothiadiazolyl, dihydrothiazolyl, dihydrothienyl, dihydrotriazolyl, dihydroazetidinyl, methylenedioxybenzoyl, tetrahydrofuranyl, and tetrahydrothienyl, and N-oxides thereof. Attachment of a heterocyclyl substituent can occur via a carbon atom or via a heteroatom. Preferably, heterocycle is selected from 2-azepinone, benzimidazolyl, 2-diazapinone, imidazolyl, 2-imidazolidinone, indolyl, isoquinolinyl, morpholinyl, piperidyl, piperazinyl, pyridyl, pyrrolidinyl, 2-piperidinone, 2-pyrimidinone, 2-pyrollidinone, quinolinyl, tetrahydrofuryl, tettahydroisoquinolinyl, and thienyl. As appreciated by those of skill in the art, "halo" or "halogen" as used herein is intended to include chloro, fluoro, bromo and iodo. The alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl and heterocyclyl substituents may be substituted or unsubstituted, unless specifically defined otherwise. For example, a (C -C6)alkyl may be substituted with one, two or three substituents selected from OH, oxo, halogen, alkoxy, dialkylamino, or heterocyclyl, such as morpholinyl, piperidinyl, and so on. In this case, if one substituent is oxo and the other is OH, the following are included in the definition: - C=0)CH2CH(OH)CH3, -(C=0)OH, -CH2(OH)CH2CH(0), and so on. In certain instances, R and R9, RC and Rc' and Rf and Rf are defined such that they can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 5-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said heterocycle optionally substituted with one or more substituents selected from R7. Examples of the heterocycles that can thus be formed include, but are not limited to the following, keeping in mind that the heterocycle is optionally substituted with one or more (and in an embodiment, one, two or three) substituents chosen from R7:
Figure imgf000019_0001
In certain instances, Rd and Rd' are defined such that they can be taken together with the phosphorous to which they are attached to form a monocyclic heterocycle with 5-7 members in the ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from NRe, O and S, said heterocycle optionally substituted with one or more substituents selected from R7. Examples of the heterocycles that can thus be formed include, but are not limited to the following, keeping in mind that the heterocycle is optionally substituted with one or more (and in an embodiment, one or two) substituents chosen from R7:
Figure imgf000019_0002
In an embodiment, Rl is selected from H and Cχ-C6 alkyl. In an embodiment, R2 is selected from H and Cχ-C6 alkyl. In an embodiment, R3 is selected from -Cχ-Cιo alkyl-O-Rg and -Cχ-Cιo alkyl- NRfRf ', optionally substituted with one to two substituents selected fromRlO. In an embodiment, R4 is independently selected from halogen and OH. In a further embodiment, n is 2 and R4 is independently selected from halogen. In an embodiment, R5 is independently selected from H, halogen and OH. In an embodiment, t is 1, RlO is fluoro and Rl is H. In another embodiment, t is 0 and Rl3 is fluoromethyl. In an embodiment, Rox is absent. Included in the instant invention is the free form of compounds of Formula I, as well as the pharmaceutically acceptable salts and stereoisomers thereof. Some of the specific compounds exemplified herein are the protonated salts of amine compounds. The term "free form" refers to the amine compounds in non-salt form. The encompassed pharmaceutically acceptable salts not only include the salts exemplified for the specific compounds described herein, but also all the typical pharmaceutically acceptable salts of the free form of compounds of Formula I. The free form of the specific salt compounds described may be isolated using techniques known in the art. For example, the free form may be regenerated by treating the salt with a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate. The free forms may differ from their respective salt forms somewhat in certain physical properties, such as solubility in polar solvents, but the acid and base salts are otherwise pharmaceutically equivalent to their respective free forms for purposes of the invention. The pharmaceutically acceptable salts of the instant compounds can be synthesized from the compounds of this invention which contain a basic or acidic moiety by conventional chemical methods. Generally, the salts of the basic compounds are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents. Similarly, the salts of the acidic compounds are formed by reactions with the appropriate inorganic or organic base. Thus, pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed by reacting a basic instant compound with an inorganic or organic acid. For example, conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like, as well as salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like. When the compound of the present invention is acidic, suitable "pharmaceutically acceptable salts" refers to salts prepared form pharmaceutically acceptable non-toxic bases including inorganic bases and organic bases. Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc and the like. Particularly preferred are the ammonium, calcium, magnesium, potassium and sodium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as arginine, betaine caffeine, choline, N,N - dibenzylethylenediamine, diethylamin, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine tripropylamine, ttomethamine and the like. The preparation of the pharmaceutically acceptable salts described above and other typical pharmaceutically acceptable salts is more fully described by Berg et al., "Pharmaceutical Salts," J. Pharm. Sci., 1977:66:1-19. It will also be noted that the compounds of the present invention are potentially internal salts or zwitterions, since under physiological conditions a deprotonated acidic moiety in the compound, such as a carboxyl group, may be anionic, and this electronic charge might then be balanced off internally against the cationic charge of a protonated or alkylated basic moiety, such as a quaternary nitrogen atom. The following abbreviations, used in the Schemes and Examples, are defined below:
Figure imgf000021_0001
Figure imgf000022_0001
The compounds of this invention may be prepared by employing reactions as shown in the following schemes, in addition to other standard manipulations that are known in the literature or exemplified in the experimental procedures. The illustrative schemes below, therefore, are not limited by the compounds listed or by any particular substituents employed for illusttative purposes. Substituent numbering as shown in the schemes does not necessarily correlate to that used in the claims and often, for clarity, a single substituent is shown attached to the compound where multiple substituents are allowed under the definitions of Formula I hereinabove. SCHEMES As shown in Scheme A, key 2,2-disubstituted dihydropyrrole intermediate A-8 may be obtained from readily available suitably substituted -phenylglycines. Following the procedure described by Van Betsbrugge et. al. (Tetrahedron, 1997, 53, 9233-9240) the -allyl- -phenylglycine A- 3 is prepared. Reduction of the ester and cyclization with carbonyldiimidazole provides intermediate A- 4. Ruthenium oxidation of the allylic olefin, followed by ester formation and alkylation of the nitrogen provides intermediate A-5. Cyclization and decarboxylation results in intermediate A-6. The ring carbonyl can then be utilized to incorporate a suitably substituted phenyl moiety. Subsequent saponification and oxygen protection leads to the protected intermediate A-8. The enantiomers of A-8 may often be separated utilizing chiral chromatographic techniques. The ring nitrogen may then be reacted with triphosgene to prepare the activated carbonyl chloride A-9. Scheme B illustrates the preparation of the fluorinated aminopiperidine B-5, starting with the N-protected piperidone. The cis and trans diastereomeric pairs may often be separated by silica gel chromatography and the enantiomers may often be separated utilizing chiral chromatographic techniques. As shown in Scheme C, such a fluorinated aminopiperidine may then be reacted with the dihydropyrrole intermediate A-9 to provide the instant compound C-l. Scheme D illustrates preparation of 2-fluoromethyl-4-aminopiperidine compounds and incorporation of those groups into the compounds of the instant invention. It should be noted that fluoride displacement of the sidechain hydroxyl in intermediate D-3 often leads to both the desired intermediate D-4 and the ring homologous compound D-5. These intermediate compounds may be separated by silica gel chromatography. Scheme E illustrates an alternative preparation of the 2-fluoromethyl-3-aminopiperidine compounds in which the seven-membered ring isomer is not produced. As shown in Schemes F and G, the hydroyl moiety of A-9 may undergo alkylation with a variety of reagents. As illustrated in Scheme H, replacement of the hydroxyl moiety of compound C-l with a suitably substituted amine proceeds through the corresponding aldehyde H-l, followed by reductive alkylation, resulting in the instant compound H-2. Scheme I illustrates the synthesis of 2-monosubstituted dihyropyrrole compounds of the instant invention. Preparation and displacement of the methylimidazolyl moiety in intermediate 1-7 with the aminopiperidine provides the instant compound 1-8. Scheme J illustrates homologation of the 2-alkyl sidechain to provide the instant compounds J-3 and J-4. Schemes K to M illustrate further modifications of the C-2 alkyl sidechain starting with the intermediate aldehyde H-l. Thus in Scheme K, the aldehyde H-l is treated with a Grignard reagent, such as an alkyl Grignard, to provide the hydroxy compound K-l. Scheme L illustrates homologation of the C-2 side chain. The aldehyde H-l is treated with a phosphonoacetate and the conjugated double bond is then reduced to provide the ester L-1. Subsequent reduction of the ester and oxidation of the alcohol provides the aldehyde L-3, which can reductively alkylate a suitably substituted amine to provide the instant compound L-4. Further alkylation of L-4 is also illustrated. Scheme M illustrates fluorination of the C-2 sidechain and subsequent conversion of the hydroxyl moiety to an amine via displacement of the corresponding triflate with sodium azide. Scheme N illustrates incorporation of a difluoromethyl moiety into the C-2 sidechain.
SCHEME A
Figure imgf000024_0001
SCHEME A (continued
Figure imgf000025_0001
SCHEME B
Figure imgf000025_0002
SCHEME C
Figure imgf000026_0001
SCHEMED
Figure imgf000026_0002
Figure imgf000026_0003
SCHEME D (continued
Figure imgf000027_0001
SCHEME E
Figure imgf000028_0001
fluoroacetone, OH Bu2BOTf, iPr2NEt, CH2CI2 O 1. Pd/C, H2, H+ Ph' σ I cr 2. Swern Oxidation Me
Figure imgf000028_0002
SCHEME F
Figure imgf000028_0003
SCHEME G
Figure imgf000029_0001
SCHEME H
Figure imgf000030_0001
SCHEME I
Figure imgf000031_0001
LiHMDS, THF
Figure imgf000031_0003
Figure imgf000031_0002
Figure imgf000031_0004
Figure imgf000031_0005
Figure imgf000031_0006
SCHEME I (continued)
Figure imgf000032_0001
Figure imgf000032_0002
SCHEME J
Figure imgf000033_0001
Figure imgf000033_0002
SCHEME J (continued)
Figure imgf000034_0001
Figure imgf000034_0002
SCHEME K
Figure imgf000035_0001
SCHEME L
Figure imgf000035_0002
SCHEME L (continued)
Figure imgf000036_0001
SCHEME M
Figure imgf000037_0001
SCHEME N
Figure imgf000038_0001
Utilities
The compounds of the invention find use in a variety of applications. As will be appreciated by those skilled in the art, mitosis may be altered in a variety of ways; that is, one can affect mitosis either by increasing or decreasing the activity of a component in the mitotic pathway. Stated differently, mitosis may be affected (e.g., disrupted) by disturbing equilibrium, either by inhibiting or activating certain components. Similar approaches may be used to alter meiosis. In an embodiment, the compounds of the invention are used to modulate mitotic spindle formation, thus causing prolonged cell cycle arrest in mitosis. By "modulate" herein is meant altering mitotic spindle formation, including increasing and decreasing spindle formation. By "mitotic spindle formation" herein is meant organization of microtubules into bipolar structures by mitotic kinesins. By "mitotic spindle dysfunction" herein is meant mitotic arrest and monopolar spindle formation. The compounds of the invention are useful to bind to and/or modulate the activity of a mitotic kinesin. In a preferred embodiment, the mitotic kinesin is a member of the bimC subfamily of mitotic kinesins (as described in U.S. Pat. No. 6,284,480, column 5). In a further embodiment, the mitotic kinesin is human KSP, although the activity of mitotic kinesins from other organisms may also be modulated by the compounds of the present invention, i this context, modulate means either increasing or decreasing spindle pole separation, causing malformation, i.e., splaying, of mitotic spindle poles, or otherwise causing morphological perturbation of the mitotic spindle. Also included within the definition of KSP for these purposes are variants and/or fragments of KSP. In addition, other mitotic kinesins may be inhibited by the compounds of the present invention. The compounds of the invention are used to treat cellular proliferation diseases. Disease states which can be treated by the methods and compositions provided herein include, but are not limited to, cancer (further discussed below), autoimmune disease, arthritis, graft rejection, inflammatory bowel disease, proliferation induced after medical procedures, including, but not limited to, surgery, angioplasty, and the like. It is appreciated that in some cases the cells may not be in a hyper- or hypoproliferation state (abnormal state) and still require treatment. For example, during wound healing, the cells may be proliferating "normally", but proliferation enhancement may be desired. Similarly, as discussed above, in the agriculture arena, cells may be in a "normal" state, but proliferation modulation may be desired to enhance a crop by directly enhancing growth of a crop, or by inhibiting the growth of a •plant or organism which adversely affects the crop. Thus, in one embodiment, the invention herein includes application to cells or individuals which are afflicted or may eventually become afflicted with any one of these disorders or states. The compounds, compositions and methods provided herein are useful for the treatment of cancer including solid tumors such as skin, breast, brain, cervical carcinomas, testicular carcinomas, etc. More particularly, cancers that may be treated by the compounds, compositions and methods of the invention include, but are not limited to: Cardiac: sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma; Lung: bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma; Gastrointestinal: esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, vipoma), small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large bowel (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma); Genitourinary tract: kidney (adenocarcinoma, Wilm's tumor
[nephroblastoma], lymphoma, leukemia), bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate (adenocarcinoma, sarcoma), testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma); Liver: hepatoma (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, hemangioma; Bone: osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant cell tumor chordoma, osteochronfroma (osteocartilaginous exostoses), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors; Nervous system: skull (osteoma, hemangioma, granuloma, xanthoma, osteitis deformans), meninges (meningioma, meningiosarcoma, gliomatosis), brain (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma [pinealoma], glioblastoma multiform, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors), spinal cord neurofibroma, meningioma, glioma, sarcoma); Gynecological: uterus (endometrial carcinoma), cervix (cervical carcinoma, pre-tumor cervical dysplasia), ovaries (ovarian carcinoma [serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma], granulosa-thecal cell tumors, Sertoli-Leydig cell tumors, dysgerminoma, malignant teratoma), vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma (embryonal rhabdomyosarcoma), fallopian tubes (carcinoma); Hematologic: blood (myeloid leukemia [acute and chronic], acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, non-Hodgkin's lymphoma [malignant lymphoma]; Skin: malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi's sarcoma, moles dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, psoriasis; and Adrenal glands: neuroblastoma. Thus, the term "cancerous cell" as provided herein, includes a cell afflicted by any one of the above-identified conditions. The compounds of the instant invention may also be useful as antifungal agents, by modulating the activity of the fungal members of the bimC kinesin subgroup, as is described in U.S. Pat. No. 6,284,480. The compounds of this invention may be administered to mammals, such as humans, either alone or in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice. The compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. The pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a water soluble taste masking material such as hydroxypropyl-methylcellulose or hydroxypropylcellulose, or a time delay material such as ethyl cellulose, cellulose acetate butyrate may be employed. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyleneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil. Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinyl- pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame. Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol. Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid. The pharmaceutical compositions of the invention may also be in the form of an oil-in- water emulsions. The oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifying agents may be naturally occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening, flavoring agents, preservatives and antioxidants. Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant. The pharmaceutical compositions may be in the form of a sterile injectable aqueous solutions. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. The sterile injectable preparation may also be a sterile injectable oil-in-water microemulsion where the active ingredient is dissolved in the oily phase. For example, the active ingredient may be first dissolved in a mixture of soybean oil and lecithin. The oil solution then introduced into a water and glycerol mixture and processed to form a microemulation. The injectable solutions or microemulsions may be introduced into a patient's blood stream by local bolus injection. Alternatively, it may be advantageous to administer the solution or microemulsion in such a way as to maintain a constant circulating concentration of the instant compound. In order to maintain such a constant concentration, a continuous intravenous delivery device may be utilized. An example of such a device is the Deltec CADD-PLUS™ model 5400 intravenous pump. The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration. This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example as a solution in 1,3-butane diol. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. Compounds of Formula I may also be administered in the form of suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non- irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol. For topical use, creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula I are employed. (For purposes of this application, topical application shall include mouth washes and gargles.) The compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. When a compound according to this invention is administered into a human subject, the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, sex and response of the individual patient, as well as the severity of the patient's symptoms. In one exemplary application, a suitable amount of compound is administered to a mammal undergoing treatment for cancer. Administration occurs in an amount between about 0.1 mg kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg kg of body weight to about 40 mg/kg of body weight per day. The instant compounds are also useful in combination with known therapeutic agents and anti-cancer agents. For example, instant compounds are useful in combination with known anti- cancer agents. Examples of such agents can be found in Cancer Principles and Practice of Oncology by V.T. Devita and S. Hellman (editors), 6th edition (February 15, 2001), Lippincott Williams & Wilkins Publishers. A person of ordinary skill in the art would be able to discern which combinations of agents would be useful based on the particular characteristics of the drugs and the cancer involved. Such anti- cancer agents include, but are not limited to, the following: estrogen receptor modulators, androgen receptor modulators, retinoid receptor modulators, cytotoxic/cytostatic agents, antiproliferative agents, prenyl-protein transferase inhibitors, HMG-CoA reductase inhibitors and other angiogenesis inhibitors, inhibitors of cell proliferation and survival signaling, apoptosis inducing agents and agents that interfere with cell cycle checkpoints. The instant compounds are particularly useful when co-administered with radiation therapy. "Cytotoxic/cytostatic agents" refer to compounds which cause cell death or inhibit cell proliferation primarily by interfering directly with the cell's functioning or inhibit or interfere with cell mytosis, including alkylating agents, tumor necrosis factors, intercalators, hypoxia activatable compounds, microtubule inhibitors/microtubule-stabilizing agents, inhibitors of mitotic kinesins, inhibitors of kinases involved in mitotic progression, antimetabolites; biological response modifiers; hormonal/anti-hormonal therapeutic agents, haematopoietic growth factors, monoclonal antibody targeted therapeutic agents, topoisomerase inhibitors, proteasome inhibitors and ubiquitin ligase inhibitors. Examples of cytotoxic agents include, but are not limited to, sertenef, cachectin, ifosfamide, tasonermin, lonidamine, carboplatin, altretamine, prednimustine, dibromodulcitol, ranimustine, fotemustine, nedaplatin, oxaliplatin, temozolomide, heptaplatin, estramustine, improsulfan tosilate, trofosfamide, nimustine, dibrospidium chloride, pumitepa, lobaplatin, satraplatin, profiromycin, cisplatin, irofulven, dexifosfamide, cis-aminedichloro(2-methyl-pyridine)platinum, benzylguanine, glufosfamide, GPX100, (trans, trans, trans)-bis-mu-(hexane-l,6-diamine)-mu-[diamine- platinum(π)]bis[diamine(chloro)platinum (π)]tetrachloride, diarizidinylspermine, arsenic trioxide, 1-(11- dodecylamino-10-hydroxyundecyl)-3,7-dimethylxanthine, zorubicin, idarubicin, daunorubicin, bisantrene, mitoxantrone, pirarubicin, pinafide, valrubicin, amrubicin, antineoplaston, 3'-deamino-3'- morpholino-13-deoxo-lO-hydroxycaπninomycin, annamycin, galarubicin, elinafide, MEN10755, and 4- demethoxy-3-deamino-3-aziridinyl-4-methylsulphonyl-daunorubicin (see WO 00/50032). The term "administration" and variants thereof (e.g., "administering" a compound) in reference to a compound of the invention means introducing the compound or a prodrug of the compound into the system of the animal in need of treatment. When a compound of the invention or prodrug thereof is provided in combination with one or more other active agents (e.g., a cytotoxic agent, etc.), "administration" and its variants are each understood to include concurrent and sequential introduction of the compound or prodrug thereof and other agents. As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts. The term "therapeutically effective amount" as used herein means that amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician. The term "treating cancer" or "treatment of cancer" refers to administration to a mammal afflicted with a cancerous condition and refers to an effect that alleviates the cancerous condition by killing the cancerous cells, but also to an effect that results in the inhibition of growth and/or metastasis of the cancer. In an embodiment, the angiogenesis inhibitor to be used as the second compound is selected from a tyrosine kinase inhibitor, an inhibitor of epidermal-derived growth factor, an inhibitor of fibroblast-derived growth factor, an inhibitor of platelet derived growth factor, an MMP (matrix metalloprotease) inhibitor, an integrin blocker, interferon-α, interleukin-12, pentosan polysulfate, a cyclooxygenase inhibitor, carboxyamidotriazole, combretastatin A-4, squalamine, 6-O-chloroacetyl- carbonyl)-fumagillol, thalidomide, angiostatin, troponin-1, or an antibody to VEGF. In an embodiment, the estrogen receptor modulator is tamoxifen or raloxifene. Also included in the scope of the claims is a method of treating cancer that comprises administering a therapeutically effective amount of a compound of Formula I in combination with radiation therapy and/or in combination with a compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxic/cytostatic agent, an antiproliferative agent, a prenyl-protein ttansferase inhibitor, an HMG-CoA reductase inhibitor, an HTV protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, PPAR-γ agonists, PPAR-δ agonists, an inhibitor of inherent multidrug resistance, an anti-emetic agent, an agent useful in the treatment of anemia, an agent useful in the treatment of neutropenia, an immunologic-enhancing drug, an inhibitor of cell proliferation and survival signaling, an agent that interfers with a cell cycle checkpoint, and an apoptosis inducing agent. And yet another embodiment of the invention is a method of treating cancer that comprises administering a therapeutically effective amount of a compound of Formula I in combination with paclitaxel or trastuzumab. The instant invention also includes a pharmaceutical composition useful for treating or preventing cancer that comprises a therapeutically effective amount of a compound of Formula I and a compound selected from: an estrogen receptor modulator, an androgen receptor modulator, a retinoid receptor modulator, a cytotoxic/cytostatic agent, an antiproliferative agent, a prenyl-protein ttansferase inhibitor, an HMG-CoA reductase inhibitor, an HTV protease inhibitor, a reverse transcriptase inhibitor, an angiogenesis inhibitor, a PPAR-γ agonist, a PPAR-δ agonists; an inhibitor of cell proliferation and survival signaling, an agent that interfers with a cell cycle checkpoint, and an apoptosis inducing agent. These and other aspects of the invention will be apparent from the teachings contained herein.
ASSAYS The compounds of the instant invention described in the Examples were tested by the assays described below and were found to have kinase inhibitory activity. Other assays are known in the literature and could be readily performed by those of skill in the art.
I. Kinesin ATPase In Vitro Assay
Cloning and expression of human poly-histidine tagged KSP motor domain (KSP(367H)) Plasmids for the expression of the human KSP motor domain construct were cloned by
PCR using a pBluescript full length human KSP construct (Blangy et al., Cell, vol.83, ppl 159-1169,
1995) as a template. The N-terminal primer 5'-
GCAACGATTAATATGGCGTCGCAGCCAAATTCGTCTGCGAAG (SEQ.ID.NO.: 1) and the C- terminal primer 5'-GCAACGCTCGAGTCAGTGAT GATGGTGGTGATGCTGATTCACTTCAGGCTTATTCAATAT (SEQ.ID.NO.: 2) were used to amplify the motor domain and the neck linker region. The PCR products were digested with
Asel and Xhol, ligated into the Ndel/Xhol digestion product of pRSETa (Invittogen) and transformed into E. coli BL21 (DE3). Cells were grown at 37°C to an OD60o of 0.5. After cooling the culture to room temperature expression of KSP was induced with lOOμM IPTG and incubation was continued overnight.
Cells were pelleted by centrifugation and washed once with ice-cold PBS. Pellets were flash-frozen and stored -80°C.
Protein Purification Cell pellets were thawed on ice and resuspended in lysis buffer (50mM K-HEPES, pH
8.0, 250mM KC1, 0.1% Tween, lOmM imidazole, 0.5mM Mg-ATP, lmM PMSF, 2mM benzimidine, lx complete protease inhibitor cocktail (Roche)). Cell suspensions were incubated with lmg/ml lysozyme and 5mM β-mercaptoethanol on ice for 10 minutes, followed by sonication (3x 30sec). All subsequent procedures were performed at 4°C. Lysates were centtifuged at 40,000x g for 40 minutes. Supernatants were diluted and loaded onto an SP Sepharose column (Pharmacia, 5ml cartridge) in buffer A (50mM K- HEPES, pH 6.8, lmM MgCl2, lmM EGTA, lOμM Mg-ATP, lmM DTT) and eluted with a 0 to 750mM KC1 gradient in buffer A. Fractions containing KSP were pooled and incubated with Ni-NTA resin (Qiagen) for one hour. The resin was washed three times with buffer B (Lysis buffer minus PMSF and protease inhibitor cocktail), followed by three 15-minute incubations and washes with buffer B. Finally, the resin was incubated and washed for 15 minutes three times with buffer C (same as buffer B except for pH 6.0) and poured into a column. KSP was eluted with elution buffer (identical to buffer B except for 150mM KC1 and 250mM imidazole). KSP-containing fractions were pooled, made 10% in sucrose, and stored at -80°C. Microtubules are prepared from tubulin isolated from bovine brain. Purified tubulin (> 97% MAP-free) at 1 mg/ml is polymerized at 37°C in the presence of 10 μM paclitaxel, 1 mM DTT, 1 mM GTP in BRB80 buffer (80 mM K-PIPES, 1 mM EGTA, 1 mM MgCl2 at pH 6.8). The resulting microtubules are separated from non-polymerized tubulin by ulttacentrifugation and removal of the supernatant. The pellet, containing the microtubules, is gently resuspended in 10 μM paclitaxel, 1 mM DTT, 50 μg/ml ampicillin, and 5 μg/ml chloramphenicol in BRB80. The kinesin motor domain is incubated with microtubules, 1 mM ATP (1:1 MgCl2: Na- ATP), and compound at 23°C in buffer containing 80 mM K-HEPES (pH 7.0), 1 mM EGTA, 1 mM DTT, 1 mM MgCl2, and 50 mM KC1. The reaction is terminated by a 2-10 fold dilution with a final buffer composition of 80 mM HEPES and 50 mM EDTA. Free phosphate from the ATP hydrolysis reaction is measured via a quinaldine red/ammonium molybdate assay by adding 150 μl of quench C buffer containing a 2:1 ratio of quench A:quench B. Quench A contains 0.1 mg/ml quinaldine red and 0.14% polyvinyl alcohol; quench B contains 12.3 mM ammonium molybdate tetrahydrate in 1.15 M sulfuric acid. The reaction is incubated for 10 minutes at 23°C, and the absorbance of the phospho- molybdate complex is measured at 540 nm. The compounds 3-1, 4-2, 5-3, 5-4, 7-1, 7-2, 7-3, 8-6a/8-6b, 9-1, 10-2, 11-1, 12-1, 12-2 and 12-3 in the Examples were tested in the above assay and found to have an IC50 < 50μM.
π. Cell Proliferation Assay Cells are plated in 96-well tissue culture dishes at densities that allow for logarithmic growth over the course of 24, 48, and 72 hours and allowed to adhere overnight. The following day, compounds are added in a 10-point, one-half log tittation to all plates. Each titration series is performed in triplicate, and a constant DMSO concenttation of 0.1 % is maintained throughout the assay. Conttols of 0.1% DMSO alone are also included. Each compound dilution series is made in media without serum. The final concentration of serum in the assay is 5% in a 200 μL volume of media. Twenty microliters of Alamar blue staining reagent is added to each sample and control well on the tittation plate at 24, 48, or 72 hours following the addition of drug and returned to incubation at 37°C. Alamar blue fluorescence is analyzed 6-12 hours later on a CytoFluor II plate reader using 530-560 nanometer wavelength excitation, 590 nanometer emission. A cytotoxic EC50 is derived by plotting compound concentration on the x-axis and average percent inhibition of cell growth for each tittation point on the y-axis. Growth of cells in control wells that have been tteated with vehicle alone is defined as 100% growth for the assay, and the growth of cells treated with compounds is compared to this value. Proprietary in-house software is used to calculate percent cytotoxicity values and inflection points using logistic 4-parameter curve fitting. Percent cytotoxicity is defined as:
% cytotoxicity:(Fluorescencecontroι) - (Flourescencesampιe) xlOOx (Fluorescencecontroi)"1
The inflection point is reported as the cytotoxic EC50.
m. Evaluation of mitotic arrest and apoptosis by FACS FACS analysis is used to evaluate the ability of a compound to arrest cells in mitosis and to induce apoptosis by measuring DNA content in a treated population of cells. Cells are seeded at a density of 1.4xl06 cells per 6cm2 tissue culture dish and allowed to adhere overnight. Cells are then tteated with vehicle (0.1% DMSO) or a tittation series of compound for 8-16 hours. Following tteatment, cells are harvested by trypsinization at the indicated times and pelleted by centrifugation. Cell pellets are rinsed in PBS and fixed in 70% ethanol and stored at 4°C overnight or longer. For FACS analysis, at least 500,000 fixed cells are pelleted and the 70% ethanol is removed by aspiration. Cells are then incubated for 30 min at 4°C with RNase A (50 Kunitz units/ml) and propidium iodide (50 μg/ml), and analyzed using a Becton Dickinson FACSCaliber. Data (from 10,000 cells) is analyzed using the Modfit cell cycle analysis modeling software (Verity Inc.). An ECso for mitotic arrest is derived by plotting compound concenttation on the x-axis and percentage of cells in the G2/M phase of the cell cycle for each tittation point (as measured by propidium iodide fluorescence) on the y-axis. Data analysis is performed using the SigmaPlot program to calculate an inflection point using logistic 4-parameter curve fitting. The inflection point is reported as the EC50 for mitotic arrest. A similar method is used to determine the compound EC50 for apoptosis. Here, the percentage of apoptotic cells at each tittation point (as determined by propidium iodide fluorescence) is plotted on the y-axis, and a similar analysis is carried out as described above.
VI. Immunofluorescence Microscopy to Detect Monopolar Spindles Methods for immunofluorescence staining of DNA, tubulin, and pericenttin are essentially as described in Kapoor et al. (2000) J. Cell Biol. 150: 975-988. For cell culture studies, cells are plated on tissue culture treated glass chamber slides and allowed to adhere overnight. Cells are then incubated with the compound of interest for 4 to 16 hours. After incubation is complete, media and drug are aspirated and the chamber and gasket are removed from the glass slide. Cells are then permeabilized, fixed, washed, and blocked for nonspecific antibody binding according to the referenced protocol. Paraffin-embedded tumor sections are deparaffinized with xylene and rehydrated through an ethanol series prior to blocking. Slides are incubated in primary antibodies (mouse monoclonal anti-α-tubulin antibody, clone DM1 A from Sigma diluted 1:500; rabbit polyclonal anti-pericentrin antibody from Covance, diluted 1:2000) overnight at 4°C. After washing, slides are incubated with conjugated secondary antibodies (FITC-conjugated donkey anti-mouse IgG for tubulin; Texas red-conjugated donkey anti-rabbit IgG for pericenttin) diluted to 15μg/ml for one hour at room temperature. Slides are then washed and counterstained with Hoechst 33342 to visualize DNA. fmmunostained samples are imaged with a lOOx oil immersion objective on a Nikon epifluorescence microscope using Metamorph deconvolution and imaging software.
EXAMPLES
Examples provided are intended to assist in a further understanding of the invention. Particular materials employed, species and conditions are intended to be illusttative of the invention and not limiting of the reasonable scope thereof.
SCHEME 1
Figure imgf000050_0001
Step 1: 4-Allyl-4-phenyl-l,3-oxazolidin-2-one (l-4) To a suspension of 15.8g (416mmol) of LAH powder in 600 mL of diethyl ether was added 18.3g (90 mmol) of -allyl-α-phenylglycine ethyl ester (1-3) (prepared according to: Van Betsbrugge et. al. Tetrahedron, 1997, 53, 9233-9240) in 75 mL of diethyl ether at such a rate as to maintain gentle reflux. After stirring overnight at room temperature, the reaction was carefully quenched with 27 mL of water, followed by 27 mL of 15% NaOH and finally 82 mL of water. A quantity of Na S04 was added, and the mixture was stirred for lh. The solids were then filtered off and the solution concentrated. The residue was dissolved in 300 mL of CH2C12, dried over Na2S04, and concentrated to provide the amino alcohol as a colorless oil. The amino alcohol (4.5g, 25 mmol) was dissolved in 50 mL of CH2C12 and cooled to 0°C. Following the addition of 5.4 mL (53 mmol) of ttiethylamine and 4.5g (28 mmol) of l, -carbonyldiimidazole, the mixture was warmed to room temperature and allowed to stir for 4h. The reaction was then dumped into a separatory funnel, washed twice with IM HC1, water, dried over Na2S04, and concentrated to obtain oxazolidinone L4 as a colorless oil. Data for L4: 'HNMR (500 MHz, CDC13) δ 7.4 - 7.2 (m, 5H), 6.6 (s, 1H), 5.6 - 5.5 (m, 1H), 5.2 (m, 2H), 4.5 (d, 1H), 4.35 (d, 1H), 2.8 (m, 1H), 2.6 (m, 1H) ppm.
Step 2: Diester (1-5) A solution of 68g (334.6 mmol) of I in 500 mL of CH2C12 was cooled to -78°C and ozone was bubbled through the solution until a pale blue color persisted. 02 was then bubbled through the solution for 15 minutes, followed by 30 minutes with N2. At that time, 491 mL (6.7 moles) of dimethyl sulfide was added, and the solution was stirred overnight while slowly coming to room temperature. The volatiles were removed by rotary evaporation to provide a brown oil. This material was suspended in IL of tBuOH, and 200 mL (1.9 moles) of 2-methyl-2-butene was added. To this solution was then added dropwise a mixture of 160g (1.33 moles) of NaH2P0 and 70g (774 mmol) of NaC102 in 800 mL of H 0. After the addition was complete, the mixture was stirred for an additional 4h. After separating the layers, the organic was concentrated by rotary evaporation, the residue was dissolved in EtOAc and placed in a separatory funnel with the aqueous phase from the reaction. After separation, the aqueous phase was extracted 3 x with EtOAc, dried over Na2S04, and concentrated to provide ~ 90g of a yellow gum. This residue was suspended in 500 mL of MeOH, and HC1 gas was bubbled through the solution until it was nearly refluxing. The flask was then capped and allowed to stir overnight while cooling to room temperature. The volatiles were removed by rotary evaporation, the residue was loaded onto a silica gel column in CH2C12, and eluted with EtOAc/hexanes to provide the methyl ester as a pale orange gum. This residue was dissolved in 500 mL of THF, cooled to 0°C, and 32.6 mL (220.5 mmol) of tert-butyl bromoacetate was added, followed by 10.6g of NaH (264.6 mmol of a 60% suspension). After the mixture was allowed to warm to room temperature and stir overnight, it was quenched with a saturated NHtCl solution, and extracted twice with EtOAc. The combined organic layers were then washed with brine, dried over Na S04, concentrated, and the residue purified by silica gel chromatography with EtOAc/hexanes to provide 1^5 as a thick pale yellow gum. Data for 1^5: 1HNMR (500 MHz, CDC13) δ 7.4 - 7.3 (m, 5H), 4.65 (d, IH), 4.55 (d, IH), 3.9 (d, IH), 3.65 (s, 3H), 3.5 (d, IH), 3.35 (d, IH), 3.2 (d, IH), 1.4 (s, 9H) ppm. HRMS (ES) calc'd M + Na for C18H23N06: 372.1423. Found: 372.1412.
Step 3: 7a-Phenyldihydro-m-pyrrolori,2-ciri,31oxazole-3,6(5H)-dione (1-6) To a solution of 18.6g (53 mmol) of in 150 mL of THF at -78°C was added dropwise 58.6 mL (58.6 mmol) of a IM solution of LiHMDS in THF. After stirring for lh at that temperature, the cooling bath was removed and the reaction was allowed to warm to room temperature and stir overnight. The mixture was quenched with a saturated NHLtCl solution, extracted twice with EtOAc, washed twice with brine, dried over Na2S04 and concentrated. The residue was dissolved in 60 mL of formic acid and heated at 100°C for 24h. The volatiles were removed under vacuum and the residue was triturated with CH2Cl2/hexanes Et20 to provide as a beige solid. Data for 6: 'HNMR (500 MHz, CDC13) δ 7.5 - 7.3 (m, 5H), 4.7 (d, IH), 4.3 (d, IH), 4.2 (d, IH), 3.5 (d, IH), 3.1 (d, IH), 2.95 (d, IH), 2.9 (d, IH) ppm.
Step 4: 6-(2.5-Difluorophenyl)-7a-phenyl-5.7a-dihydro-lH-pyrrolo[ 1 ,2-c] fl ,31oxazol-3-one (1-7) To a suspension of 2.2g (10 mmol) of 1 7 in 150 mL of THF at -78°C was added dropwise 12.2 mL (12.2 mmol) of a IM solution of NaHMDS in THF. After stirring for 30 min, the solution was allowed to warm to 0°C and held there for lh. The solution was then cooled back down to - 78°C and a solution of 4.35g (12.2 mmol) of N-phenylbis(trifluoro-methanesulphonimide) in 10 mL of THF was added. The cooling bath was removed and the mixture was allowed to warm to room temperature and stir overnight. The mixture was quenched with a saturated NHUCl solution, extracted twice with EtOAc, washed twice with brine, dried over Na2S0 and concentrated. The residue was dissolved in 75 mL of DME and 18 mL of water. To this mixture was added 1.29g (30 mmol) of LiCl, 3.2g (30 mmol) of Na2C03, and 4.8g (30 mmol) of 2,5-difluorophenylboronic acid. The solution was then degassed with N2 for 1 minute, followed by the addition of 630 mg (0.5 mmol) of tetrakis(triphenylphosphine) palladium (0). The reaction was heated at 90°C for 3h, cooled to room temperature, diluted with saturated NaHC03, and extracted twice with EtOAc. The combined organic layers were washed with brine, dried over Na2S0 , concentrated, and the residue purified by silica gel chromatography with CH2Cl2/hexanes to provide 1 7 as a white solid. Data for 1 7: 'HNMR (500 MHz, CDCI3) δ 7.5 - 7.3 (m, 5H), 7.1 - 6.9 (m, 3H), 6.8 (s, IH), 4.9 (d, IH), 4.75 (d, IH), 4.5 (d, IH), 4.25 (d, IH) ppm. HRMS (ES) calc'd M + H for C18H13F2N02: 314.0987. Found: 314.0993. Step 5: 2-({ [tert-Butyl(dimethyl)silyl]oxy }methyl)-4-(2,5-difluorophenyl)-2-phenyl-2,5-dihydro- lH-pyrrole (1-8) A suspension of 1.75g (5.6 mmol) 1 7 in 15 mL of EtOH and 10 mL of 3 M NaOH was heated at 60°C for 3h, cooled to room temperature and dumped into a separatory funnel with EtOAc and brine. The layers were separated, the aqueous phase was extracted twice with EtOAc, the combined organic phases were washed twice with brine, dried over Na2S0 , and concentrated to provide a white solid. To this flask was added 30 mL of CH2C12, 1.5g (22.3 mmol) of imidazole and 1.76g (11.7 mmol) of TBSCl, and the resultant suspension was stirred overnight. The reaction was diluted with CH2C12, washed twice with water, dried over Na2S0 , concentrated, and the residue purified by silica gel chromatography with EtOAc/hexanes to provide 1^8 as a white solid. Data for 1^8: !HNMR (500 MHz, CDC13) δ 7.6 - 7.3 (m, 5H), 7.1 - 6.9 (m, 3H), 6.75 (s, IH), 4.25 (d, IH), 4.1 (d, IH), 3.95 (d, IH), 3.75 (d, IH), 0.9 (s, 9H), 0.1 (s, 3H), 0.05 (s, 3H) ppm.
Step 6: Enantiomeric resolution of Intermediate 1-8 Resolution of the enantiomers was carried out chromatographically using a Chiralpak
AD® 10 x 50cm column with 1% isopropanol in hexanes (with 0.1% diethylamine) at 150 mL/min.
Analytical HPLC analysis of the eluent on a 4 x 250mm Chiralpak AD® column with 1% isopropanol in hexanes (with 0.1% diethylamine) at 1 mL/min indicated that first eluting, active enantiomer has Rt= 5.5 min and the second enantiomer has Rt = 6.9 min.
Step 7: (2S)-2-({ [tert-Butyl(dimethyl)silyl]oxy}methyl)-4-(2,5-difluorophenyl)-2-phenyl-2,5- dihydro-lH-pyrrole-1 -carbonyl chloride 1-9 To a solution of 1.95g (6.6 mmol) of triphosgene in 25mL of THF at 0°C was added a solution of
1.31g (3.3 mmol) of the first eluting enantiomer of J 8 and 915 μL (6.6 mmol) of ttiethylamine in 10 mL of THF. The ice bath was removed and the reaction was allowed to warm to room temperature and stir for 3h. The reaction was then partitioned between water and EtOAc, the organic solution was dried over
Na2S04, and concentrated to provide 1^9 as a brown oil. Data for 1-9: HRMS (ES) calc'd M + H for
C24H28ClF2N02Si: 464.1619. Found: 464.1625. SCHEME 1A
Figure imgf000054_0001
Alternate synthesis of Diester 1-5 To a biphasic mixture of 14.8g (73 mmol) of 1-4 and 110 mL of CH2C12, 110 mL of CH3CN, and 320 mL of water was added approximately 200mg of rathenium(flT) chloride hydrate.
Sodium periodate (85.6g, 400 mmol) was then added portion-wise over lh with rapid stirring. After the addition was complete, the reaction was allowed to stir for 4h more at room temperature. The mixture was diluted with 500mL of water and 1.5 L of EtOAc, and the solids were removed by filtration. The filtrate was placed in a separatory funnel, the phases separated, the aqueous phase extracted twice with EtOAc, the combined organic phases washed twice with brine, and dried over Na2S04. Following concentration, the dark brown solid was dissolved in 250 mL of MeOH and HCl(g) was slowly passed through the solution at a rate so as not to increase the temperature of the solution above 35°C. After 5 min, the reaction was capped and allowed to stir at room temperature overnight. The volatiles were then removed on a rotary evaporator, and the residue was purified by silica gel chromatography with EtOAc hexanes to provide 13.6g (58 mmol) of the methyl ester as a viscous oil. This residue was then dissolved in 200 mL of THF, cooled to 0°C, and 10.3 mL (70 mmol) of tert-butyl bromoacetate was added, followed by 2.8g of NaH (70 mmol of a 60% suspension). After the mixture was allowed to warm to room temperature and stir overnight, it was quenched with a saturated NHtCl solution, and extracted twice with EtOAc. The combined organic layers were then washed with brine, dried over Na2S04, concentrated, and the residue purified by silica gel chromatography with EtOAc/hexanes to provide -5 as a colorless oil.
SCHEME IB
Figure imgf000055_0001
then 1N HCI/NaOH
Figure imgf000055_0002
Step 1: Methyl 4-methylene-2-phenylprolinate (1B-2) An aqueous solution (300 mL) of phenyl glycine methyl ester-HCl (100 g) was neutralized to pH 8 with ION NaOH. The aqueous solution was extracted with EtOAc (3 X 200 mL). The combined organic extracts were dried over MgS0 , filtered, and concentrated. The residue (56.7 g, 344 mmol) was dissolved in ttimethylorthoformate (100 mL) and tteated with benzaldehyde (34.9 mL, 36.4 g, 344 mmol). After stirring for 2 h, the reaction was diluted with Et20 (200 mL) and washed with water (3 X 50 mL). The organic solution was dried over MgS04, filtered, and concentrated. A portion of the imine residue (26.8 g, 100 mmol) was dissolved in dichloromethane (240 mL) and tteated with 160 mL of ION NaOH, methallyl dichloride (50.0 g, 400 mmol), and Bu4NHS04 (3.59 g). After stirring for 10 h at rt, the reaction was diluted with dichloromethane and the organic solution separated, dried over MgS04, filtered, and concentrated. The residue was redissolved in Et20/1N HC1 (200 mL/200 mL) and stirred for 2h. The aqueous phase was separated and neutralized with ION NaOH (to pH 8). The aqueous mixture was extracted with EtOAc (3 x 200 mL). The combined organic solutions were dried over MgS04, filtered and concentrated. The residue was dissolved in water and neutralized (to pH 8). Extraction of this mixture with EtOAc (X 3) followed by drying over MgS0 , filtratration, and concenttation provided crude 1B-2. Purification of this residue by flash chromatography (Si02; 30% EtOAc/hexanes) provided pure 1B-2. Data for 1B-2: JHNMR (500 MHz, CDC13) δ 7.51 (m, 2H), 7.42 (m, 3H), 5.03 (s, IH), 4.95 (s, IH), 3.71 (m, 5H), 3.41 (m, IH), 2.80 (m, IH) ppm. Step 2: 7a-Phenyldihvdro-lH-Dyrrolon.2-ciri.31oxazole-3.6(5H)-dione (1-6) A suspension of LiAlBU (7.14 g, 188 mmol) in THF (500 mL) was cooled to 0°C and treated with a solution of ester IB -2 (10.2 g, 47 mmol) in THF (50 mL) over 20 min. After stirring for 30 min at 0°C, the reaction was cautiously quenched by the addition of water (7.1 mL), 15% aq NaOH (7.1 mL), and H20 (21.3 mL). Solid Na2S04 was added and the mixture stirred for 40 min. The mixture was filtered and concenttated. The residue (8.2 g, 43.3 mmol) was dissolved in dichloromethane (300 mL) and treated with triethylamine (9.0 mL, 6.5 g, 65.0 mmol) and carbonyldiimidazole (9.14 g, 56.4 mmol). After stirring for 48 h at rt, the reaction was diluted with dichloromethane and washed with IN HC1 and brine. The organic solution was concentrated and not further purified. A solution of the residue 1B-3 (9.2 g, 42.8 mmol) in dichloromethane (200 mL) was cooled to -78°C and ozone was passed through the solution until a blue color persisted. The solution was purged and treated with dimethylsulfide (35 mL). After gradual warming to rt overnight, the solution was concenttated to a yellow solid. Trituration of this solid with Et20 provided pure - Data for 6- 1HNMR (500 MHz, CDC13) δ 7.5 - 7.3 (m, 5H), 4.7 (d, IH), 4.3 (d, IH), 4.2 (d, IH), 3.5 (d, IH), 3.1 (d, IH), 2.95 (d, IH), 2.9 (d, IH) ppm.
SCHEME IC
Figure imgf000057_0001
1C-1 1C-2
Figure imgf000057_0002
Step 1: (2R)-r(ethoxycarbonyl)amino1(phenyl)acetic acid (1C-2) To a 0 °C mixture of (R)-(-)-2-phenylglycine (lC-1, 4kg) in THF and 5N NaOH (10.6L) was added ethyl chloroformate over 1 h with the internal temperature maintained below 10 °C. Upon completion of the addition, the reaction was aged for 15 min at 0-10 °C and assayed for completion. The reaction was quenched with 37% HC1 (until pH = 1, 2.3 L) with the internal temperature maintained <25 °C. Toluene (20L) was added and after agitation/settling, the aqueous layer was cut. The organic layer was assayed for yield and solvent switched to toluene. The slurry of 1C-2 was used directly in the next reaction. (2R)-[(ethoxycarbonyl)amino]-(phenyl)acetic acid: mp 154-156 °C; :H NMR (CDC13, 400 MHz) indicated a -1.1:1 mixture of rotamers: 5=12.12 (bs, 2H), 7.99 (d, J = 5.3 Hz, IH), 7.45-7.32 (m, 10 H), 5.78 (d, J = 6.2 Hz, IH), 5.41 (d, J = 1.1 Hz, IH), 5.25 (d, / = 5.7 Hz, IH), 4.12 (m, 2H), 4.05 (m, 2H), 1.24 (t, J = 6.9 Hz, 3H), 1.06 (t, J = 7.0 Hz, 3H); 13C NMR (CDC13, 100 MHz): 5=175.1, 173.6, 157.3, 155.8, 137.4, 136.1, 129.0, 128.7, 128.6, 128.2, 127.2, 127.1, 62.1, 61.5, 58.3, 57.7, 14.4, 14.1; MS m/z 224 ([M + H]+,
Figure imgf000058_0001
calc'd 224.09).
Step 2: ethyl (2S.4R)-5-oxo-2.4-diphenyl-1.3-oxa7.olidine-3-carboxylate (1C-3) To an 85 °C solution of 1C-2 and PhS0 H (42.7gm) in toluene under reduced pressure (350 torr), was added a solution of benzaldehyde dimethyl acetal(3L) in toluene (5 mL/g) over 1-2 h. Toluene/MeOH was distilled off through the course of reaction. Upon completion of the reaction, the solution was cooled to rt and diluted with THF (36L), until homogeneous. The organic solution was washed with 10% NaHS03 (7.5L), followed by sat'd. NaHC03 (9L). The solvent was then switched to . toluene and diluted to 7.5 mL/g total volume (vs. assay yield) with toluene upon completion. The slurry was heated to 75 °C and aged until homogeneous. Upon slow cooling, 1C-3 crystallized. When the slurry reached 40 °C, heptane (2.5 mL/g) was added. The slurry was cooled to rt and filtered to collect the solid. The solid was washed with 1:1 toluene/heptane (5 mL/g) and dried to a constant weight under a nitrogen stream, ethyl (2S,4R)-5-oxo-2,4-diphenyl-l,3-oxazolidine-3-carboxylate: mp 197-199 °C; !H NMR (CDC13> 400 Hz) δ=7.46-7.37 (m, 10H), 6.77 (bs, IH), 5.45 (bs, IH), 3.96 (m, 2H), 3.86 (m, 2H), 0.84 (t, 7 = 7.1 Hz, 3H); 13C NMR (CDC13, 100 MHz): δ=130.2, 129.1, 129.0, 218.8, 126.7, 90.3, 61.9, 60.3, 13.8; MS m/z 312 ([M + H]+, C188N04, calc'd 312.12).
Step 3: ethyl (2S.4S)-4-allyl-5-oxo-2.4-diphenyl-1.3-oxazolidine-3-carboxylate (1C-4) To an -10 °C solution of 1C-3 and allyl-Br(1.67L) in THF (40L) was added a 2M solution of sodium bis(trimethylsilyl)amide in THF (7L) over 1 h, with the temperature maintained <5 °C. After 5 min, the reaction was assayed for completion. The reaction was quenched with IN HC1 (22.5L) and diluted with heptane (20L). The Aq. layer was cut and the organic layer was washed with sat'd. brine (12L). The solvent was switched to MeOH and water was removed azeotropically until a KF < 900ppm was achieved. The solution of 1C-4 was used directly in the next reaction, ethyl (2S,4S)- - allyl-5-oxo-2,4-diphenyl-l,3-oxazolidine-3-carboxylate: !H NMR (CDC13, 400 Hz) δ=7.60-7.52 (m, 2H), 7.39-7.33 (m, 8H), 6.55 (m, IH), 5.84 (m, IH), 5.38 (m, 2H), 4.16 (m, 2H), 3.72-3.12 (m, 2H), 1.17 (t, J = 7.0 Hz, 3H); 13C NMR (CDC13, 100 MHz): δ=172.5, 164.0, 137.5, 131.0, 130.5, 129.7, 128.3, 128.1, 127.4, 126.2, 122.0, 89.5, 62.0, 42.2, 40.4, 14.2; MS m/z 352 ([M + H]+, C2ιH22N04, calc'd 352.15).
Step 4: methyl (2S)-2-r(ethoxycarbonyl)aminol -2-phenylpent-4-enoate ( 1 C-5) To an 23 °C solution of 1C-4 in MeOH (20L) was added 30% NaOMe in MeOH (535mL) over 0.25 h, with the temperature maintained <30 °C. After 4 h, the reaction was assayed for completion. The reaction was quenched into 5% NaHS03 (40L) and diluted with fPAc (20L). The aqueous layer was cut and the organic layer was washed with 10% KH2P0 (12L). The solvent was switched to MeCN and used directly in the next reaction, methyl (25)-2-[(ethoxycarbonyl)amino]-2- phenylpent-4-enoate: *H NMR (CDC13, 400 Hz) δ=7.46-7.43 (m, 2H), 7.39-7.27 (m, 3H), 6.23 (bs, IH), 5.76-5.66 (m, IH), 5.20-5.14 (m, 2H), 4.10-4.00 (m, 2H), 3.68 (s, 3H), 3.53 (bs, IH), 3.20 (dd, J = 13.7, 7.6 Hz, IH) 1.27-1.15 (m, 3H); 13C NMR (CDC13, 100 MHz): δ=172.6, 154.3, 139.8, 132.3, 128.4,
127.8, 125.9, 119.4, 65.0, 60.6, 53.1, 37.8, 14.4; MS m/z 300 ([M + Na]+, C15H19NNa04, calc'd 300.12).
Step 5: methyl 4-[(ethoxycarbonyl)oxyl-2-phenyl-D-prolinate (1C-6) To an 23 °C solution of 1C-5 in MeCN (42L) was added water (12L), followed by I2 (8kg). After 6 h, the reaction was assayed for completion. The reaction was quenched with 10% Na2S03 (35L), basifϊed with 50wt% NaOH (4L)and extracted with IPAc (35L). The aqueous layer was cut and discarded and the organic layer was extracted with 6N HC1 (35L). The organic layer was discarded. The aq. layer was cooled to -10 °C, IPAc (35L) was added, and slowly neutralized with 22L of ION NaOH. The aqueous layer was cut and discarded and the solution of 1C-6 was stored, methyl 4- [(ethoxycarbonyl)oxy]-2-phenyl-D-prolinate: !H NMR (CDC13, 400 Hz) indicated a 2: 1 mixture of diastereomers: δ=7.55-7.47 (m, 5H), 7.34-7.22 (m, 5H), 5.18-5.11 (m, 2H), 4.22-4.11 (m, 4H), 3.68 (s, 6H), 3.33-3.24 (m, 4H), 3.10 (d, J= 14.1 Hz, 2H), 3.05 (b, 2H), 2.34 (dd7= 14.3, 5.5 Hz, IH), 2.22 (dd/ = 14.3, 4.1 Hz, IH), 1.31-1.23 (m, 6H); 13C NMR (CDC13, 100 MHz): δ=175.2, 175.1, 154.7, 154.4, 142.0, 141.5, 128.3, 128.2, 127.5, 127.4, 126.0, 125.7, 78.5, 77.6, 71.7, 71.0, 63.8, 52.9, 52.8, 52.7, 52.0, 51.8, 43.2, 42.9, 14.1, 14.0; MS m/z 294 ([M + H]+, C15H20NO5, calc'd 294.13).
Step 6: (5S)-5-(hydroxymethyl)-5-phenylpyrrolidin-3-ol (1C-7) To a solution of carbonate 1C-6 (5.0g, 17.0mmol) in THF (50mL) was added Red-Al 3.5M solution in toluene (17.0mL, 59.7mmol, 3.5moleq.) at -50°C. The reaction mixture was warmed up to rt and aged for 2h. The reaction was quenched by 2.0M Rochelle salt solution (45mL, ca. 1.5moleq to Red-Al) at 0° and aged vigorously over 5h at rt. After the aqueous phase was separated, the mixed organic solution was switched to n-BuOAc by azeottopic distillation under reduced pressure (ca. 20 torr, 60°C). After 200mL of n-BuOAc was added, THF, toluene and methoxy ethanol were detected less than 0.1% in GC and KF showed 0.11%. MS m/z 194 ([M + H]+, C11H15N02, calc'd 193.11).
Step 7: (7aS)-6-hvdroxy-7a-phenyltetrahvdro-lH-pyrrolor 1.2-cl 1 ,31oxazol-3-one ( 1C-8) To the n-BuOAc solution described in Step 6 was added CDI (3.46g, 21.3mmol, 1.25moleq.) portionwise and aging for lh at rt. 30mL of 2N HC1 solution was added to the reaction mixture and aging for lh. The aqueous phase was separated and extracted with 30mL of n-BuOAc after addition of 6.0g of NaCl. To the combined organic layer was added 150mg of activated carbon (Darco KB) and the mixture aged overnight. The carbon was filtered through a pad of Solka-Floc. Data : !H- NMR (400MHz, CDC13) δ 7.47-7.28 (m, 7H), 4.65 (d, 7=8.3 Hz, IH), 4.64-4.59 (m, 0.4H), 4.57-4.51 (m, IH), 4.51 (d, 7=8.8 Hz, 0.4H), 4.33 (d, 7=8.3 Hz, IH), 4.28 (dd, 7=13.1, 6.7 Hz, 0.4H), 4.15 (d, 7=8.8 Hz, 0.4H), 3.92 (d, 7=12.7 Hz, IH), 3.28 (dd, 7=12.7, 3.9 Hz, IH), 3.18 (dd, 7=13.1, 2.7 Hz, 0.4H), 2.63 (d, 7=13.6 Hz, 0.4H), 2.50 (dd, 7=13.7, 5.1 Hz, IH), 2.40 (brd, 7=13.7 Hz, IH), 2.25 (dd, 7=13.6, 6.8 Hz, 0.4H).
Step 8: (7aS)-7a-phenyldihvdro-lH-pyrrolor 1.2-cl \ 1 ,31oxazole-3.6(5H)-dione ( 1 C-9) IC-8 (crude, a portion of above solution 1.40g assay, 6.38mmol) in n-BuOAc was concentrated under reduced pressure and 14 mL of MeCN was added to the crude crystals. The solvent ratio was n-BuOAc : MeCN = 8 : 92 in GC. To this solution was added AcOH (l.lOmL, 19.2mmol, 3.0moleq.), TPAP (33.6mg, 0.095mmol, 1.5mol%) and 2.0M solution of NaOCl (9.5mL, 19.2mmol, 3.0moleq.) dropwise over 30min at rt. (ca. 5% of chlorinated product was seen in HPLC.) After 30min, the reaction mixture was diluted with 12mL of AcOEt and the aqueous phase was separated. The organic phase was washed with sat. Na2S203 aq. and brine. The organic solvent was switched to MTBE and the resulted precipitate was filtered and washed with MTBE. Obtained ketone 1C-9; 78% (1.08g, 4.97mmol, 99.4area%, 97.0 w/w%, 0.5area% of chlorinated product).
SCHEME ID
(25)-2-({[terf-Butyl(dimethyl)silyl]oxy}methyl)-4-(2,5-difluorophenyl)-2-phenyl-2,5-dihydro-lH- pyrrole- 1 -carbonyl chloride 1-9 In a flask equipped with overhead stirrer, thermocouple, and nitrogen vacuum inlet was charged the S-TBS pyrroline solid T . (180 gms) and IPAC added (1.26L). Stirring was continued until the solution became homogeneous, about 30 minutes. In a separate flask equipped with overhead stirrer, thermocouple, and nitrogen/vacuum inlet IPAC added (1.26L) and the solution cooled to -5°C. Triphosgene was added (67gms) and then lutidine (173 ml) slowly added. The solution of the S-TBS pyrroline was then added to this solution slowly. The reaction was monitored by HPLC and was considered complete when the conversion of the amine to the product is >99A% at 200 nmby HPLC. The reaction was quenched by adding 1.8 L of 10wt% aq. citric acid to the reaction mixture. The layers were separated and the organic layer washed twice with water (240 mL). The organic layer was then concenttated to 900 ml (water content was 105 ug/ml) and used directly in the coupling reactions. HPLC assay showed 99.96% conversion to the carbamyl chloride. SCHEMEjE
2-((rtert-Butyl(dimethyl)silylloxylmethyl)-4-(2,5-difluorophenyl)-2-phenyl-2.5-dihvdro-lH-ρyrrole(l-8)
Step 1: 6-(2.5-Difluorophenyl)-7a-phenyl-5.7a-dihydro- 1 H-pyrrolo r 1 ,2-c] \ 1,31 oxazol-3-one ( 1 -7) A suspension of 231 g (1.06 moles) of l__5 in 11 L of THF in a 20L jacketed reactor was stirred vigorously with overhead stirring for 1 h, then cooled to -70°C. To this suspension was added dropwise 1.28 L (1.28 moles) of a IM solution of NaHMDS in THF. After stirring for 3 h, 478.9g (1.28 moles) of solid N-phenylbis(ttifluoro-methanesulphonimide) was added, followed by an additional 1.5 h of stirring, before being quenched by the addition of 2 L of a saturated aqueous NHiCl solution. After the solution reached room temperature, 2 L of water and 2 L of EtOAc were added, the layers were separated, and the aqueous layer was extracted with 2 L of EtOAc. The combined organic layers were washed with brine, dried over Na2S04, and concentrated by rotary evaporation. The residue was dissolved in 6 L of DME and 1.2 L of water in a 20L jacketed reactor with overhead stirring, and the solution was degassed with a strong flow of N2 for 1 h. To the reactor was then added 201.6g (1.28 moles) of 2,5-difluorophenylboronic acid, 134g (3.19 moles) of LiCl, 338g (3.19 moles) of Na2C03, and 24.6g (21 mmol) of tetrakis(triphenylphospine)palladium(0), and the reaction was heated at 90°C for 2h. Following this period of time, approximately 4.5 L of DME was distilled off, the remaining solution was cooled to room temperature, and dumped into 6 L of water and 8 L of CH2C12. The layers were separated, the aqueous layer was extracted with 2 L of CH2C12, the organic layers were combined, washed with 4 L of water, dried over Na2S04 and concenttated by rotary evaporation to provide a dark red solid mass. This residue was swished with 500 mL of CHC13, and filtered to provide a tan solid. The filtrate was concentrated to ~ 300 mL and a second crop of solid was collected, combined with the first crop, and the combined material was swished with 500 mL of EtOAc overnight. This suspension was filtered to provide an off-white solid, the filtrate was concentrated to ~ 250 mL and a second crop was collected, combined with the first crop, and the combined material (~ 205 g) was recrystallized from 1.6 L of EtOAc to provide L7 as a white solid. Data for L7: !HNMR (500 MHz, CDC13) δ 7.5 - 7.3 (m, 5H), 7.1 - 6.9 (m, 3H), 6.8 (s, IH), 4.9 (d, IH), 4.75 (d, IH), 4.5 (d, IH), 4.25 (d, IH) ppm. HRMS (ES) calc'd M + H for C18H13F2N02: 314.0987. Found: 314.0993.
Step 2: 2-({[tert-Butyl(dimethyl)silyl]oxy}methyl)-4-(2,5-difluorophenyl)-2-phenyl-2,5-dihydro- lH-pyrrole (1-8) A suspension of 109.4g (349 mmol) L7 in 2.2 L of EtOH and 105 mL (1.05 moles) of 10 M NaOH in a 10L round bottom was heated at 60°C for 4h, cooled to room temperature and aged overnight. To this mixture was added 90.2 mL (1.08 moles) of concentrated HCl and the solvents were removed by rotary evaporation. The residue was suspended in 2 L of acetonitrile and again taken to dryness by rotary evaporation. The solids were suspended in 3.8 L of CH2C12 and 200 mL of DMF, 118.7g (1.75 moles) of imidazole was added, followed by 110.5 (733 mmol) of TBSCl. After stirring for 15 h under a gentle stream of N2, the reaction was dumped into 4 L of water and 2 L of CH2C12, the layers were separated, and the aqueous layer was extracted with 2 L of CH2C12. The combined organic extracts were then washed with 4 x 4 L of water, dried over Na2S04, and concenttated by rotary evaporation. The residue was dissolved in 500 mL of MeOH and 500 mL of 2M MeNH2 in MeOH, stirred for 4h, and then concentrated by rotary evaporation. The residue was placed under high vacuum until a constant weight was obtained, and the material was crushed with a mortar and pestle to provide lz 8 as a beige solid. Data for 8- !HNMR (500 MHz, CDC13) δ 7.6 - 7.3 (m, 5H), 7.1 - 6.9 (m, 3H), 6.75 (s, IH), 4.25 (d, IH), 4.1 (d, IH), 3.95 (d, IH), 3.75 (d, IH), 0.9 (s, 9H), 0.1 (s, 3H), 0.05 (s, 3H) ppm.
SCHEME 2
Figure imgf000062_0001
Step 1: Benzyl 3-fluoro-4-oxopiperidine-l-carboxyIate (2-2)
To a solution of lO.Og (43 mmol) of benzyl-4-oxo-l-piρeridinecarboxylate in 25 mL of DMF was added 14.3 mL (103 mmol) of triethylamine and then 6.53 mL (52 mmol) of TMSC1. The reaction was heated at 80°C overnight, cooled to room temperature, and then dumped into hexanes in a separatory funnel. The mixture was partitioned with saturated aqueous NaHC03, separated, washed with brine, dried over MgS04 and concentrated by rotary evaporation. The residue was dissolved in 500mL of CH3CN and tteated with 16.7g (47 mmol) of Selectfluor. After 90 min the reaction was concenttated to about half the original volume, partitioned between EtOAc and brine, separated, dried over MgS04, filtered, and concentrated by rotary evaporation. The residue was loaded onto a silica gel column and eluted with EtOAc/hexanes to provide 2/2 as a colorless oil.
Step 2: Benzyl 3-fluoro-4-(methylamino)piperidine-l-carboxylate (2-2a) To a solution of 9.4g (37.5 mmol) of 7 1 in 150 mL of 1,2-dichloroethane was added 37.5 mL (74.9 mmol) of a 2M solution of methylamine in THF and 11.9g (56.2 mmol) of Na(OAc)3BH. After stirring for 2h, the reaction was quenched with saturated aqueous K2C03, partitioned with EtOAc, separated, and the aqueous phase extracted 3 x EtOAc. The combined organic extracts were washed with brine, dried over MgS04, filtered, and concentrated by rotary evaporation. The residue was loaded onto a silica gel column and eluted with 80:10:10 CHCl3/EtOAc/MeOH to provide both the cis and trans isomers of 2-2a as colorless oils. Data for the trans isomer of 2-2a, first to elute (confirmed by NOE analysis): 1HNMR (600 MHz, CD2C12) δ 7.4 - 7.3 (m, 5H), 5.1 (m, 2H), 4.4 - 4.1 (m, 2H), 3.9 (m, IH), 3.15 - 3.05 (m, 2H), 2.75 (m, IH), 2.4 (s, 3H), 2.0 (m, IH), 1.25 (m, IH) ppm. Data for the cis isomer of 2-2a. second to elute (confirmed by NOE analysis): 1HNMR (600 MHz, CD2C12) δ 7.4 - 7.2 (m, 5H), 5.1 (m, 2H), 4.9 - 4.7 (m IH), 4.4 (m, IH), 4.15 (m, IH), 3.1 - 2.9 (m, 2H), 2.6 (m, IH), 2.4 (s, 3H), 1.8 (m, IH), 1.6 (m, IH) ppm. HRMS (ES) calc'd M + H for
Figure imgf000063_0001
267.1504. Found: 267.1500.
Step 3: Benzyl (3R,4S)-4-[(terϊ-butoxycarbonyl)(methyl)amino]-3-fluoropiperidine-l- carboxylate (2-3) To a solution of 7.67g (28.8 mmol) of cis-2-2a in 150 mL of CH2C12 was added 12.1 mL (86.5 mmol) of triethylamine and 9.44g (43.3 mmol) of di-tert-butyl dicarbonate. After stirring for lh, the reaction was partitioned between CH2C12 and H20, the organic phase was washed with brine, dried over MgS0 , filtered and concenttated by rotary evaporation. The residue was loaded onto a silica gel column and eluted with EtOAc/hexanes to provide racemic cis-2-3 as a white solid. Resolution of the enantiomers was carried out chromatographically using a Chiralpak AD® 10 x 50cm column with 20% isopropanol in hexanes (with 0.1% diethylamine) at 150 mL/min. Analytical HPLC analysis of the eluent on a 4 x 250mm Chiralpak AD® column with 20% isopropanol in hexanes (with 0.1% diethylamine) at 1 mL/min indicated that first eluting enantiomer (enantiomer of 2-3) has Rt= 5.90 min and the second enantiomer (2-3) has Rt = 6.74 min. Data for 2θ: HRMS (ES) calc'd M + Na for Cι9H27F1N204: 389.1847. Found: 389.1852.
Step 4: fe -Butyl r(3R.45)-3-fluoro-l-methylpiperidin-4-yllmethylcarbamate (2-4) To a solution of 4.6g (12.6 mmol) of the second eluting enantiomer 2 in 150 mL of
EtOH was added 29.7 mL (314 mmol) of 1,4-cyclohexadiene and a catalytic amount of 10% Pd on carbon. After stirring overnight, the reaction was filtered through Celite, and concenttated by rotary evaporation. The residue was dissolved in 75 mL of MeOH, 2mL of AcOH and 3.1mL (38 mmol) of 37% aqueous formaldehyde were added, and the mixture was stirred for lh. At that time, 1.58g (25.1 mmol) of NaCNBH3 in lOmL of MeOH was added and the reaction was aged for 2h more before being dumped into saturated aqueous NaHC03. After extracting with 3 x CH2C12, the organic phase was washed with water, dried over MgS0 , filtered, and concenttated by rotary evaporation to provide 2_4 as a colorless oil. Data for Z4: HRMS (ES) calc'd M + H for C12H23FN202: 247.1817. Found: 247.1810.
Step 5: (3R.4S)-3-Fluoro-N. l-dimethylpiperidin-4-amine (2-5) To a solution of 3.0g (12.2 mmol) of 24 in lOOmL of EtOAc was bubbled HCl gas until the solution was warm to the touch. The flask was then capped and stirred for 4h. The volatiles were removed by rotary evaporation, and the residue was triturated with Et20 and placed under high vacuum to provide a white solid. This material was mixed with 25 mL of 15% aqueous Νa C03 and extracted with 5 x 50 mL 2: 1 CHCl3/EtOH. The organic was concentrated by rotary evaporation with very mild heating, the residue was dissolved in 200 mL of CHCI3, dried over Na2S04, and concentrated to provide 2-5 as a colorless oil. Data for 2-5: !HNMR (500 MHz, CDC13) δ 4.8 (m, IH), 3.15 (m, IH), 2.85 (m, IH), 2.5 (s, 3H), 2.45 (m, IH), 2.3 (s, 3H), 2.2 - 2.0 (m, 2H), 1.9 - 1.7 (m, 2H) ppm. HRMS (ES) calc'd M + H for C7H15FN2: 147.1292. Found: 147.1300.
SCHEME 2A
Step 1: Benzyl 3-fluoro-4-oxopiperidine-l-carboxylate (2-2) A 22-L round bottom flask with mechanical stirrer was charged with Cbz-ketone 2-1 (2.5 kg, 10.7 mol), 5.0 L of dimethylacetamide, ttiethylamine (3.0L, 21.5 mol). Trimethylsilylchloride (2.0 L, 15.7 mol) was added. The mixture heated to 60 °C and aged for 4 hours. After cooling to 10 °C, the mixture was quenched into 10 L of 5% sodium bicarbonate and 10 L n-heptane maintaining the internal temperature at less than 20 °C. The organic layer was washed twice with 10 L of 2.5% sodium bicarbonate. The final organic layer was dried over sodium sulfate, filtered, and concentrated under reduced pressure and solvent switched to 10 L MeCN. A 50-L jacketed vessel was charged with 7.5 L of MeCN and Selectfluor (4.1 kg, 11.5 mol). The slurry was cooled to 10 °C and potassium carbonate (0.37 kg, 2.68 mol) added. The silyl ether solution in MeCN was ttansferred in portions maintaining the internal temperature at 10-15 °C. The final slurry was aged for 2 hours at 10-15 °C. The reaction was quenched into a 100 L extractor containing 20L of 2 N hydrochloric acid and 30 L of ethyl acetate. The organic layer was washed with 20 L of 2 N hydrochloric acid, 10 L of 20 wt% sodium chloride, dried over sodium sulfate, and filtered. The filtrate was concentrated and flushed with dry EtOAc under reduced pressure to KF = 16000 μg/mL and then solvent switch under reduced pressure to ~10L THF.
Step 2: Benzyl 3-fluoro-4-(methylammo)piperidine-l-carboxylate (2-2a) In a round-bottom flask, Cbz fluoroketone (10.3mol) was dissolved in tetrahydrofuran
(30L). Methylamine, 2 M in tetrahydrofuran (2.00 equiv; 20.6 moles; 10.3L) was added and the mixture stirred for 30 min at room temp. The mixture was cooled to 0 °C and acetic acid (20.6 moles; 1.17 L;
1.236 kg) added followed by stirring at 0 °C for another 30 minutes. Sodium triacetoxyborohydride (12.36 moles; 2.62 kg) was added in portions to the solution in 15 minutes and the reaction mixture was aged at 0 °C until completion as judged by HPLC analysis. The reaction mixture was ttansferred slowly into a 100 L cylindrical extractor containing hydrochloric acid, 12 M in water (30.9 moles, 2.575 L), water (30 L), and toluene (140mol, 15 L). After vigorous stirring for 15 minutes, the layers were separated and toluene layer further washed with water (10L). The combined aqueous layer was transferred back into the exttactor. Sodium hydroxide, 10 M in water (82.4 mole, 8.24 L), was added and the mixture extracted once with IPAC (30 L). The organic layer was dried with sodium sulfate (3 kg) and concenttated. The residue was dissolved in 8:2 (vo vol) ethanohwater (23 kg ethanol mixed with 7.2 kg water), 85% phosphoric acid (9.83 mol, 952g, 667mL) was added to the solution and crystal seeds were added. The mixture was stirred at room temperature overnight. Crystalline solid precipitated and was collected by filtration. The solid was washed with 8:2 ethanohwater and dried in vacuum oven to give 2.1 kg solid. The solid was suspended in 36L EtOH and 4L water mixture and the mixture was heated to 70 °C-80 °C until all solid dissolved. The heat source was removed and the clear solution was seeded with the cis isomer mixture 2-2a. After stirring at room temperature overnight, a crystalline solid precipitated and was collected by filtration. The solid product was dried in vacuum oven to give white solid.
Step 3: Benzyl (3/?,4S)-4-[(ført-butoxycarbonyl)(methyl)amino]-3-fluoropiperidine-l- carboxylate 2-3 In a 50 L extractor was charged 20 L water and 1.06 kg Na2C03, the mixture was stirred until all solid was dissolved. IPAC (20 L) and CBZ amine 2-2aphosphate (1.85 kg, 5.3 mol) were added. The layers were cut after mixing. The aqueous layer was extracted with another 5L IPAC. The combined organic layers were dried with sodium sulfate. After the drying agent was filtered off, the batch was charged into a 72 L round bottom flask, and Boc 0 solution (1.0 M, 4.8 L) was added. HPLC assay after 45 min indicated 98% conversion. Additional Boc20 solution (50 mL) was added. After the batch was aged for additional 15 hours, it was concentrated under vacuum to the minimum volume, flushed with MeOH (10L-15 L). The batch was diluted with methanol to a total weight of ca. 14.3 kg . HPLC assay indicated ca. 1.9 kg desired product. The fluoropiperidine was resolved by chromatographic separation on 20 micron Chiralpak AD (Diacel Chemical Industries, Ltd.) chiral stationary phase column (30 ID x 25 cm). An amount of 54 g of racemate per injection was eluted with methanol. The lowest retention time enantiomer was collected giving 45 g (85% recovery) of the desired (3R, 4S) enantiomer in 98 % ee. This separation process was repeated and the desired fractions from different injections were combined and concentrated.
Step 4: fe -Butyl r(3R.4S)-3-fluoro-l -methylpiperidin-4-yllmethylcarbamate (2-4) The concenttated solution (4 L) from the chiral separation step was shown to contain
489.5 g (1.3 mol) of Cbz-Boc-diamine 2-3. To this solution, formaldehyde (37% in water, 430 mL, 5.3 mol) was added and the mixture pressurized under hydrogenated over 5% Pd/C (183 g) for 4 hours. The reaction mixture was filtered to remove the catalyst and partitioned between 8 L of EtOAc and 8 L of 0.5 M sodium bicarbonate. The organic layer was washed with 8 L of 0.5 M sodium bicarbonate. The combined aqueous layers were back extracted with 8 L of EtOAc. The combined organic layers were dried over sodium sulfate and filtered. The filtrate was used in the next step directly.
Step 5: (3R.4S)-3-Fluoro-N. l-dimethylpiperidin-4-amine (2-5) The ethyl acetate solution containing the Boc protected diamine 2-4 (327 g by HPLC assay) was charged to a 12 L flask while concentrating at 28 °C. When the batch had a total volume of 1.5L, the batch was then solvent switched to ethanol by charging 8L of ethanol while distilling at a constant volume. To a different 12 L round bottom flask was added 1.5 L of ethanol (200 proof, punctilious). 436 mL of acetyl chloride was then added to the ethanol maintaining the temperature below 35 °C with the aid of a water bath. The solution was stirred for lh. The ethanol solution containing 302g of the Boc protected diamine 2-4 was then slowly added to the HCl, maintaining temp <30 °C. At the point where 3A of the addition was complete, solids began to crystallize from the solution. The reaction was monitored by GC and the slurry stirred overnight. The solids were isolated by filtration and cake washed with 2L of 85 % ethanol, 15% ethyl acetate. The filter cake was then dried under vacuum with a stream of Ν2 overnight to yield 243g of the desired product 2-5 as the bis HCl salt. GC analysis indicated the batch to be 99.3% ee. Approximately 200mg of 2-5 (fluoropiperidine 2 HCl) was added to a vial and suspended in methanol (<500μL). The sample was heated to dissolution with a heat gun. After 2 hours large 3 dimensional crystals were noted. Crystals were isolated by removal of the remaining solvent. A single crystal was selected for single crystal x-ray data collection on a Bruker Smart Apex system. The crystal was a colorless plate with dimensions of 0.24 mm x 0.22 mm x 0.14 mm. The unit cell was collected on 5 second scan rate and auto indexing gave the cell setting to be monoclinic. The structure was solved in the monoclinic P 2X space group after a quadrant data collection using 5 second scan rate. See Tables 1-5 for tabulated information pertaining to the final specifications of the solved structure. A computer drawing of the structure of 2^5 is shown in Figure 1.
Table 1. Crystal data and structure refinement for 2-5. Empirical formula C8 H2J 2 F N2 O Formula weight 251.17 Temperature 298(2) K Wavelength 0.71073 A Crystal system, space group Monoclinic, P2(l) Unit cell dimensions: a = 7.286(2) A alpha = 90 deg. b = 7.637(2) A beta = 105.295(5) deg. c = 12.378(4) A gamma = 90 deg. Volume 664.3(4) A3 Z, Calculated density 2, 1.256 Mg/m3 Absorption coefficient 0.477 mm"1 F(000) 268 Crystal size 0.24 x 0.22 x 0.14 mm Theta range for data collection 1.71 to 26.35 deg. Limiting indices -9<=h<=9, -9<=k<=9, -15<=1<=15 Reflections collected / unique 5309 / 2674 [R(int) = 0.0227] Completeness to theta = 26.35 99.7 % Absorption correction None Refinement method Full-matrix least-squares on F2 Data / restraints / parameters 2674 / 1 / 135 Goodness-of-fit on F2 1.055 Final R indices [I>2sigma(I)] Rl = 0.0383, wR2 = 0.0939 R indices (all data) Rl = 0.0409, wR2 = 0.0959 Absolute structure parameter 0.02(6) Largest diff. peak and hole 0.310 and -0.135 e.A"3 Table 2. Atomic coordinates ( x 10 ) and equivalent isottopic displacement parameters (A2 x 103) for 2 5. U(eq) is defined as one third of the trace of the orthogonalized Uij tensor. x y z U(eq)
C(l) 10896(3) 4999(4) 3165(2) 45(1)
C(2) 10015(3) 6778(3) 2967(2) 40(1)
C(3) 7954(3) 6708(3) 2311(2) 36(1)
C(4) 7708(3) 5658(3) 1234(2) 43(1)
C(5) 8554(3) 3861(3) 1506(2) 44(1)
C(6) 11521(4) 2227(3) 2315(2) 53(1)
C(7) 5074(3) 8626(4) 1808(3) 62(1)
C(ll) 6300(5) 5224(6) 4909(3) 85(1)
Cl(l) 2362(1) 4966(1) 194(1) 53(1)
Cl(2) 8214(1) 1057(1) 4028(1) 55(1)
F(l) 10991(2) 7785(2) 2346(1) 55(1)
N(l) 10618(3) 3989(2) 2104(2) 39(1)
N(2) 7187(3) 8513(2) 2056(2) 39(1)
0(11) 5695(3) 4422(3) 3856(2) 68(1)
Table 3. Bond lengths [A] and angles [deg] for 2=5.
C(l)-N(l) 1.491(3) C(2)-C(1)-H(1A) 109.2
C(l)-C(2) 1.495(3) N(1)-C(1)-H(1B) 109.2
C(1)-H(1A) 0.9700 C(2)-C(1)-H(1B) 109.2
Cd)-H(IB) 0.9700 H(1A)-C(1)-H(1B) 107.9
C(2)-F(l) 1.406(3) F(l)-C(2)-C(l) 109.28(19)
C(2)-C(3) 1.508(3) F(l)-C(2)-C(3) 107.49(17)
C(2)-H(2) 0.9800 C(l)-C(2)-C(3) 112.33(18)
C(3)-N(2) 1.489(3) F(l)-C(2)-H(2) 109.2
C(3)-C(4) 1.525(3) C(l)-C(2)-H(2) 109.2
C(3)-H(3) 0.9800 C(3)-C(2)-H(2) 109.2
C(4)-C(5) 1.505(3) N(2)-C(3)-C(2) 110.26(17) C(4)-H(4A) 0.9700 N(2)-C(3)-C(4) 110.51(17)
C(4)-H(4B) 0.9700 C(2)-C(3)-C(4) 111.07(18)
C(5)-N(l) 1.494(3) N(2)-C(3)-H(3) 108.3
C(5)-H(5A) 0.9700 C(2)-C(3)-H(3) 108.3
C(5)-H(5B) 0.9700 C(4)-C(3)-H(3) 108.3
C(6)-N(l) 1.490(3) C(5)-C(4)-C(3) 109.71(19)
C(6)-H(6A) 0.9600 C(5)-C(4)-H(4A) 109.7
C(6)-H(6B) 0.9600 C(3)-C(4)-H(4A) 109.7
C(6)-H(6C) 0.9600 C(5)-C(4)-H(4B) 109.7
C(7)-N(2) 1.491(3) C(3)-C(4)-H(4B) 109.7
C(7)-H(7A) 0.9600 H(4A)-C(4)-H(4B) 108.2
C(7)-H(7B) 0.9600 N(l)-C(5)-C(4) 110.49(18)
C(7)-H(7C) 0.9600 N(1)-C(5)-H(5A) 109.6
C(ll)-0(11) 1.402(4) C(4)-C(5)-H(5A) 109.6
C(11)-H(11A) 0.9600 N(1)-C(5)-H(5B) 109.6
C(11)-H(11B) 0.9600 C(4)-C(5)-H(5B) 109.6
C(11)-H(11C) 0.9600 H(5A)-C(5)-H(5B) 108.1
N(l)-H(l) 0.77(2) N(1)-C(6)-H(6A) 109.5
N(2)-H(2A) 0.9000 N(1)-C(6)-H(6B) 109.5
N(2)-H(2B) 0.9000 H(6A)-C(6)-H(6B) 109.5
0(11)-H(11) 0.8200 N(1)-C(6)-H(6C) 109.5
N(l)-C(l)-C(2) 111.88(18) H(6A)-C(6)-H(6C) 109.5
N(1)-C(1)-H(1A) 109.2 H(6B)-C(6)-H(6C) 109.5 N(2)-C(7)-H(7A) 109.5 C(l)-N(l)-C(5) 110.83(17) N(2)-C(7)-H(7B) 109.5 C(6)-N(l)-C(5) 111.57(19) H(7A)-C(7)-H(7B) 109.5 C(l)-N(l)-H(l) 107.9(17) N(2)-C(7)-H(7C) 109.5 C(6)-N(l)-H(l) 110.0(17) H(7A)-C(7)-H(7C) 109.5 C(5)-N(l)-H(l) 105.1(18) H(7B)-C(7)-H(7C) 109.5 C(3)-N(2)-C(7) 113.99(19) 0(11)-C(11)-H(11A) 109.5 C(3)-N(2)-H(2A) 108.8 0(11)-C(11)-H(11B) 109.5 C(7)-N(2)-H(2A) 108.8 H(11A)-C(11)-H(11B) 109.5 C(3)-N(2)-H(2B) 108.8 0(11)-C(11)-H(11C) 109.5 C(7)-N(2)-H(2B) 108.8 H(11A)-C(11)-H(11C) 109.5 H(2A)-N(2)-H(2B) 107.6 H(11B)-C(11)-H(11C) 109.5 C(ll)-0(11)-H(ll) 109.5 C(l)-N(l)-C(6) 111.2(2)
Table 4. Anisottopic displacement parameters (A2 x 10 ) for 2=5. The anisottopic displacement factor exponent takes the form: -2 pi2 [ h2 a*2 UI 1 + ... + 2 h k a* b* U12 ]
Ull U22 U33 U23 U13 U12
C(l) 45(1) 49(1) 38(1) 0(1) 6(1) 3(1)
C(2) 41(1) 41(1) 37(1) -6(1) 8(1) -5(1)
C(3) 38(1) 39(1) 35(1) -KD 13(1) -3(1)
C(4) 43(1) 43(1) 40(1) -9(1) 4(1) 0(1)
C(5) 44(1) 39(1) 46(1) -9(1) 8(1) -5(1)
C(6) 59(2) 40(1) 62(2) 7(1) 21(1) 12(1)
C(7) 37(1) 68(2) 78(2) -12(2) 12(1) 8(1)
C(ll) 69(2) 112(3) 77(2) -25(2) 21(2) 7(2)
Cl(l) 70(1) 52(1) 43(1) -3(1) 25(1) -10(1)
Cl(2) 68(1) 58(1) 43(1) -10(1) 21(1) -3(1)
F(l) 41(1) 49(1) 75(1) 2(1) 18(1) -9(1)
N(l) 47(1) 36(1) 40(1) 4(1) 18(1) 2(1)
N(2) 37(1) 43(1) 39(1) -6(1) 15(1) 0(1)
O(ll) 59(1) 80(2) 63(1) 0(1) 14(1) 5(1) Table 5. Hydrogen coordinates ( x 104) and isottopic displacement parameters (A2 x 103) for 2=5. x y z U(eq)
H(1A) 12248 5118 3517 54
H(1B) 10335 4358 3675 54
H(2) 10113 7348 3689 48
H(3) 7231 6126 2773 44
H(4A) 6367 5558 853 52
H(4B) 8336 6256 740 52
H(5A) 7885 3246 1973 52
H(5B) 8403 3198 820 52
H(6A) 12857 2358 2661 79
H(6B) 11341 1615 1617 79
H(6C) 10945 1575 2802 79
H(7A) 4507 7821 1218 92
H(7B) 4671 9795 1577 92
H(7C) 4683 8333 2468 92
H(11A) 7656 5114 5184 128
H(11B) 5699 4665 5421 128
H(11C) 5960 6441 4843 128
H(2A) 7550 8924 1463 46
H(2B) 7704 9209 2644 46
H(ll) 6251 3486 3866 102
H(l) 11060(30) 4510(30) 1710(20)
Figure imgf000072_0001
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,45)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2.5-dihydro-lH-pyrrole-l-carboxamide (3-l) To a solution of 1.6g (3.45 mmol) of carbamoyl chloride 1=9 in 25mL of THF was added 630mg (4.31 mmol) of amine 2-5, 1.44 mL (10.3 mmol) of triethylamine, and a catalytic amount of DMAP. After stirring for 24h at room temperature, the reaction was partitioned between EtOAc and satorated aqueous ΝaHC03, the organic was washed with brine, dried over Na2S04, and concentrated by rotary evaporation. The residue was purified by silica gel chromatography with EtOAc/hexanes to provide ~ 1.7g of a pale yellow taffy. This was dissolved in 75 mL of CH3CN, 3mL of triethylamine trihydrofluoride was added, and the mixture was stirred for 24h at room temperature. An additional 3 mL of triethylamine trihydrofluoride was added and the reaction was heated at 37°C for an additional 24h. The reaction was then dumped into saturated aqueous NaHC03, extracted 3 x with EtOAc, washed with brine, dried over Na2S04, and concenttated by rotary evaporation. The residue was purified by silica gel chromatography with EtOAc - 20: 1 : 1 EtOH/NH4θH/H20 to provide 3=1 as a white solid. Data for 3=1: 1HNMR (500 MHz, CDC13) δ 7.4 - 7.2 (m, 5H), 7.1 - 6.9 (m, 3H), 6.3 (s, IH), 5.25 (m, IH), 4.9 (d, IH), 4.8 (d, IH), 4.6 (d, IH), 4.45 (m, IH), 4.1 - 4.0 (m, 2H), 3.2 - 3.1 (m, IH), 3.1 (s, 3H), 3.0 (m, IH), 2.4 - 2.3 (m, IH), 2.3 (s, 3H), 2.3 - 2.2 (m, 2H), 1.7 (m, IH) ppm. HRMS (ES) calc'd M + H for
Figure imgf000072_0002
460.2207. Found: 460.2213. SCHEME 3A
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,4S)-3-fluoro-l-memylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihvdro-lH-pyrrole-l-carboxamide (3-l) In a flask equipped with overhead stirrer, thermocouple, and nitrogen/vacuum inlet was charged the carbamyl chloride 1=9 in IPAC (0.9L). To this solution was added 0.9L DMF, 111 gms fluorodiamine 2=5 and 540 ml diisopropylethylamine. The solution was warmed to 60°C for 15 hrs and assayed for conversion of carbamyl chloride to product. The reaction is considered complete when the conversion of carbamyl chloride to product is >98A% at 200 nm by HPLC. The reaction was cooled to 5°C and 450 ml 6ΝHC1 was added. The solution was aged until desilylation was complete (>99A% at 200 nm), about 2 hrs. Isopropylacetate (3L) and then 8wt % aqueous sodium bicarbonate was added (2L) to the reaction mixture, which was allowed to warm to 15-20°C. The layers were separated and the aqueous layer exttacted once with 3L IPAC. The combined organic layers were washed twice with IL water. The washed organic solution was concentrated to 5 liters and, while at 35- 40°C ttansferred to another flask through a lμm polypropylene filter. Distillation was continued until a volume of IL was obtained and then the reaction was cooled to room temperature over two hours. Heptane (IL) was then slowly added over 2 hrs. The resultant slurry was filtered onto a sintered glass funnel and the crystalline product was washed 3 times with 500mls of 2: 1 heptane : isopropylacetate as displacement washes. The solid 3=1 was dried with a sweep of nitrogen overnight. 'HNMR and HRMS data for this solid corresponded to the data of the product from Scheme 3. A single crystal from the above preparation was selected for single crystal x-ray data collection on a Bruker Smart Apex system. The crystal was colorless polyhedron with dimensions of 0.14 mm x 0.13 mm x 0.13 mm. The unit cell was collected on 30 second scan rate and auto indexing gave the cell setting to be orfhorhombic. The structure was solved in the orthorhombic P 2ι 2j 2\ space group after a quadrant data collection using 30 second scan rate. See Tables 6-10 for tabulated information pertaining to the final specifications of the solved structure. A computer drawing of the structure of 3=1 is shown in Figure 2.
Table 6. Crystal data and structure refinement for 3-1. Empirical formula C25 H28 F3 N3 02 Formula weight 459.50 Temperature 298(2) K Wavelength 0.71073 A Crystal system, space group Orthorhombic, P2(l)2(l)2(l) Unit cell dimensions a = 11.3916(14) A alpha = 90 deg b = 11.4808(14) A beta = 90 deg. c = 17.718(2) A gamma = 90 deg.
Volume 2317.3(5) A3 '
Z, Calculated density 4, 1.317 Mg/m3
Absorption coefficient 0.101 mm"1
F(000) 968
Crystal size 0.14 mm x 0.13 mm x 0.13 mm Theta range for data collection 2.11 to 26.43 deg. Limiting indices -14<=h<=14, -14<=k<=14, -22<=1<=22
Reflections collected / unique 22539 / 2698 [R(int) = 0.0405] Completeness to theta = 26.43 99.8 % Absorption correction None
Refinement method Full-matrix least-squares on F2
Data / restraints / parameters 2698 / 0 / 301 Goodness-of-fit on FΛ2 1.157
Final R indices [I>2sigma(I)] Rl = 0.0429, wR2 = 0.0993 R indices (all data) Rl = 0.0550, wR2 = 0.1047
Absolute structure parameter 0(10) Largest diff. peak and hole 0.165 and -0.120 e.A"3
Table 7. Atomic coordinates ( x 104) and equivalent isottopic displacement parameters (A2 x 103) for Compound 3=1. U(eq) is defined as one third of the ttace of the orthogonalized Uij tensor.
U(eq)
C(5) -2267(3) 6218(3) 2092(2) 53(1) C(25) 5273(3) 3363(4) 2054(3) 93(1) 0(2) 24(2) 5125(1) 1748(1) 50(1) F(3) 4039(2) 6650(2) 1452(1) 74(1) F(l) -3491(2) 9889(2) 691(1) 73(1) O(l) -2142(2) 5028(2) 2243(1) 63(1) C(18) 313(2) 6092(2) 1508(1) 39(1) C(l) -1779(2) 6659(2) 1327(2) 41(1)
N(l) -501(2) 6935(2) 1354(1) 41(1)
C(12) -1597(2) 9968(2) 1225(1) 44(1)
C(20) 2315(2) 5486(2) 1637(1) 40(1)
N(2) 1463(2) 6357(2) 1377(1) 42(1)
F(2) 177(2) 12521(2) 1590(1) 105(1)
C(4) -303(2) 8186(2) 1463(2) 50(1)
C(17) -680(3) 10679(2) 1453(2) 53(1)
C(2) -2267(2) 7865(2) 1205(1) 44(1)
C(ll) -3201(3) 5372(2) 626(2) 53(1)
C(24) 2651(3) 4586(2) 1056(2) 52(1)
C(3) -1487(2) 8695(2) 1296(1) 42(1)
N(3) 4491(2) 4230(2) 1726(2) 60(1)
C(19) 1830(3) 7139(3) 769(2) 58(1)
C(15) -1705(4) 12401(3) 1043(2) 78(1)
C(21) 3404(2) 6016(2) 1983(2) 52(1)
C(16) -754(3) 11868(3) 1362(2) 68(1)
C(6) -2088(2) 5851(2) 671(1) 40(1)
C(13) -2555(3) 10532(3) 918(2) 55(1)
C(14) -2613(4) 11716(3) 818(2) 71(1)
C(7) -1323(3) 5615(3) 89(2) 57(1)
C(10) -3518(3) 4678(3) 26(2) 64(1)
C(9) -2748(3) 4452(3) -544(2) 70(1)
C(22) 4183(3) 5085(3) 2291(2) 64(1)
C(8) -1644(3) 4917(3) -508(2) 73(1)
C(23) 3449(3) 3691(2) 1414(2) 63(1)
Table 8. Bond lengths [A] and angles [deg] for 3-1.
C(5)-0(l) 1.399(3) C(25)-H(25A) 0.9600 C(5)-C(l) 1.550(4) C(25)-H(25B) 0.9600 C(5)-H(5A) 0.9700 C(25)-H(25C) 0.9600 C(5)-H(5B) 0.9700 0(2)-C(18) 1.233(3) C(25)-N(3) 1.457(4) F(3)-C(21) 1.393(3) F(l)-C(13) 1.358(4) C(15)-C(16) 1.367(5)
0(1)-H(1) 0.8200 C(15)-H(15) 0.9300
C(18)-N(l) 1.368(3) C(21)-C(22) 1.492(4)
C(18)-N(2) 1.364(3) C(21)-H(21) 0.9800
C(l)-N(l) 1.490(3) C(6)-C(7) 1.377(4)
C(l)-C(2) 1.508(3) C(13)-C(14) 1.372(4)
C(l)-C(6) 1.528(4) C(14)-H(14) 0.9300
N(l)-C(4) 1.466(3) C(7)-C(8) 1.377(4)
C(12)-C(13) 1.381(4) C(7)-H(7) 0.9300
C(12)-C(17) 1.386(4) C(10)-C(9) 1.362(4)
C(12)-C(3) 1.473(3) C(10)-H(10) 0.9300
C(20)-N(2) 1.468(3) C(9)-C(8) 1.368(5)
C(20)-C(24) 1.508(4) C(9)-H(9) 0.9300
C(20)-C(21) 1.512(4) C(22)-H(22A) 0.9700
C(20)-H(20) 0.9800 C(22)-H(22B) 0.9700
N(2)-C(19) 1.464(3) C(8)-H(8) 0.9300
F(2)-C(16) 1.360(4) C(23)-H(23A) 0.9700
C(4)-C(3) 1.500(3) C(23)-H(23B) 0.9700
C(4)-H(4A) 0.9700 0(1)-C(5)-C(1) 116.7(2)
C(4)-H(4B) 0.9700 0(1)-C(5)-H(5A) 108.1
C(17)-C(16) 1.376(4) C(1)-C(5)-H(5A) 108.1
C(17)-H(17) 0.9300 0(1)-C(5)-H(5B) 108.1
C(2)-C(3) 1.313(4) C(1)-C(5)-H(5B) 108.1
C(2)-H(2) 0.9300 H(5A)-C(5)-H(5B) 107.3
C(ll)-C(10) 1.376(4) N(3)-C(25)-H(25A) 109.5
C(ll)-C(6) 1.385(4) N(3)-C(25)-H(25B) 109.5
C(ll)-H(ll) 0.9300 H(25A)-C(25)-H(25B)ι 109.5
C(24)-C(23) 1.511(4) N(3)-C(25)-H(25C) 109.5
C(24)-H(24A) 0.9700 H(25A)-C(25)-H(25C)ι 109.5
C(24)-H(24B) 0.9700 ■ H(25B)-C(25)-H(25C) 109.5
N(3)-C(22) 1.446(4) C(5)-0(1)-H(l) 109.5
N(3)-C(23) 1.448(4) 0(2)-C(18)-N(l) 121.6(2)
C(19)-H(19A) 0.9600 0(2)-C(18)-N(2) 121.0(2)
C(19)-H(19B) 0.9600 N(l)-C(18)-N(2) 117.3(2)
C(19)-H(19C) 0.9600 N(l)-C(l)-C(2) 99.73(19)
C(15)-C(14) 1.360(5) N(l)-C(l)-C(6) 112.2(2) C(2)-C(l)-C(6) 111.3(2) C(23)-C(24)-H(24A) 109.8
N(l)-C(l)-C(5) 113.1(2) C(20)-C(24)-H(24B) 109.8
C(2)-C(l)-C(5) 107.1(2) C(23)-C(24)-H(24B) 109.8
C(6)-C(l)-C(5) 112.6(2) H(24A)-C(24)-H(24B) 108.2
C(18)-N(l)-C(4) 124.2(2) C(2)-C(3)-C(12) 130.7(2)
C(18)-N(l)-C(l) 121.18(19) C(2)-C(3)-C(4) 110.5(2)
C(4)-N(l)-C(l) 111.32(19) C(12)-C(3)-C(4) 118.7(2)
C(13)-C(12)-C(17) 115.7(2) C(22)-N(3)-C(23) 110.8(2)
C(13)-C(12)-C(3) 124.5(3) C(22)-N(3)-C(25) 109.7(3)
C(17)-C(12)-C(3) 119.7(2) C(23)-N(3)-C(25) 111.2(3)
N(2)-C(20)-C(24) 114.8(2) N(2)-C(19)-H(19A) 109.5
N(2)-C(20)-C(21) 113.3(2) N(2)-C(19)-H(19B) 109.5
C(24)-C(20)-C(21) 110.1(2) H(19A)-C(19)-H(19B) 109.5
N(2)-C(20)-H(20) 105.9 N(2)-C(19)-H(19C) 109.5
C(24)-C(20)-H(20) 105.9 H(19A)-C(19)-H(19C) 109.5
C(21)-C(20)-H(20) 105.9 H(19B)-C(19)-H(19C) 109.5
C(18)-N(2)-C(19) 122.5(2) C(14)-C(15)-C(16) 117.7(3)
C(18)-N(2)-C(20) 115.44(19) C(14)-C(15)-H(15) 121.1
C(19)-N(2)-C(20) 117.40(19) C(16)-C(15)-H(15) 121.1
N(l)-C(4)-C(3) 102.5(2) F(3)-C(21)-C(22) 108.3(2)
N(1)-C(4)-H(4A) 111.3 F(3)-C(21)-C(20) 111.3(2)
C(3)-C(4)-H(4A) 111.3 C(22)-C(21)-C(20) 110.4(2)
N(1)-C(4)-H(4B) 111.3 F(3)-C(21)-H(21) 109.0
C(3)-C(4)-H(4B) 111.3 C(22)-C(21)-H(21) 109.0
H(4A)-C(4)-H(4B) 109.2 C(20)-C(21)-H(21) 109.0
C(16)-C(17)-C(12) 120.3(3) F(2)-C(16)-C(15) 119.6(3)
C(16)-C(17)-H(17) 119.9 F(2)-C(16)-C(17) 117.7(3)
C(12)-C(17)-H(17) 119.9 C(15)-C(16)-C(17) 122.8(3)
C(3)-C(2)-C(l) 113.6(2) C(7)-C(6)-C(ll) 117.3(3)
C(3)-C(2)-H(2) 123.2 C(7)-C(6)-C(l) 122.9(2)
C(l)-C(2)-H(2) 123.2 C(ll)-C(6)-C(l) 119.7(2)
C(10)-C(ll)-C(6) 121.0(3) F(l)-C(13)-C(14) 117.6(3)
C(10)-C(ll)-H(ll) 119.5 F(l)-C(13)-C(12) 118.8(3)
C(6)-C(ll)-H(ll) 119.5 C(14)-C(13)-C(12) 123.6(3)
C(20)-C(24)-C(23) 109.4(2) C(15)-C(14)-C(13) 119.9(3)
C(20)-C(24)-H(24A) 109.8 C(15)-C(14)-H(14) 120.0 C(13)-C(14)-H(14) 120.0
C(6)-C(7)-C(8) 121.5(3)
C(6)-C(7)-H(7) 119.3
C(8)-C(7)-H(7) 119.3
C(9)-C(10)-C(ll) 120.9(3)
C(9)-C(10)-H(10) 119.5
C(ll)-C(10)-H(10) 119.5
C(10)-C(9)-C(8) 118.9(3)
C(10)-C(9)-H(9) 120.5
C(8)-C(9)-H(9) 120.5
N(3)-C(22)-C(21) 112.1(2)
N(3)-C(22)-H(22A) 109.2
C(21)-C(22)-H(22A) 109.2
N(3)-C(22)-H(22B) 109.2
C(21)-C(22)-H(22B) 109.2
H(22A)-C(22)-H(22B) 107.9
C(9)-C(8)-C(7) 120.4(3)
C(9)-C(8)-H(8) 119.8
C(7)-C(8)-H(8) 119.8
N(3)-C(23)-C(24) 111.3(2)
N(3)-C(23)-H(23A) 109.4
C(24)-C(23)-H(23A) 109.4
N(3)-C(23)-H(23B) 109.4
C(24)-C(23)-H(23B) 109.4
H(23A)-C(23)-H(23B) 108.0
Table 9. Anisottopic displacement parameters (A2 x 103) for 3-1. The anisottopic displacement factor exponent takes the form: -2 pi2 [ h2 a*2 UI 1 + ... + 2 h k a* b* U12 ]
Ull U22 U33 U23 U13 U12
C(5) 52(2) 57(2) 50(2) 2(1) 4(1) -5(1)
C(25) 53(2) 89(3) 136(3) 38(3) 3(2) 21(2)
0(2) 43(1) 33(1) 75(1) 13(1) -4(1) 0(1)
F(3) 58(1) 57(1) 109(1) 18(1) -2(1) -15(1)
F(l) 65(1) 68(1) 86(1) 5(1) -14(1) 19(1)
O(l) 63(1) 58(1) 69(1) 21(1) 9(1) -6(1)
C(18) 42(1) 32(1) 42(1) KD -2(1) 2(1)
C(l) 35(1) 38(1) 50(1) 4(1) 2(1) KD
N(l) 39(1) 28(1) 55(1) 4(1) -2(1) 3(1)
C(12) 60(2) 35(1) 36(1) 2(1) 6(1) 12(1)
C(20) 41(1) 36(1) 43(1) 8(1) 2(1) 4(1)
N(2) 41(1) 35(1) 50(1) 9(1) 4(1) 4(1)
F(2) 144(2) 40(1) 131(2) -4(1) -27(2) -12(1)
C(4) 45(1) 30(1) 74(2) 6(1) -6(1) 3(1)
C(17) 69(2) 37(1) 53(2) 2(1) 3(2) 9(1)
C(2) 41(1) 41(1) 50(1) -2(1) -KD 9(1)
C(ll) 49(2) 51(2) 58(2) 5(1) -6(1) 0(1)
C(24) 55(2) 44(1) 58(2) -3(1) -2(1) 5(1)
C(3) 49(1) 39(1) 38(1) 2(1) 5(1) 9(1)
N(3) 40(1) 58(1) 82(2) 20(1) 9(1) 13(1)
C(19) 53(2) 49(2) 73(2) 24(1) 10(2) 7(1)
C(15) 127(3) 38(2) 68(2) 1(2) -3(2) 25(2)
C(21) 46(1) 51(2) 58(2) -6(1) -KD -KD
C(16) 105(3) 35(1) 65(2) -2(1) -5(2) 3(2)
C(6) 40(1) 33(1) 48(1) 7(1) -2(1) 6(1)
C(13) 67(2) 53(2) 47(2) 0(1) 4(1) 19(2) C(14) 99(3) 53(2) 62(2) 4(2) -6(2) 35(2)
C(7) 51(2) 66(2) 56(2) -8(2) 1(1) 5(2)
C(10) 61(2) 55(2) 75(2) 0(2) -21(2) -6(2)
C(9) 82(2) 61(2) 67(2) -18(2) -23(2) 14(2)
C(22) 43(2) 81(2) 67(2) . 12(2) -6(1) -3(2)
C(8) 75(2) 83(2) 63(2) -19(2) 0(2) 21(2)
C(23) 65(2) 42(1) 83(2) 3(2) 8(2) 12(2)
Table 10. Hydrogen coordinates ( x 104) and isottopic displacement parameters (A2 x 103) for 3-1.
U(eq)
H(5A) -1881 6648 2493 64 H(5B) -3096 6408 2114 64 H(25A) 4878 2968 2458 139 H(25B) 5963 3742 2246 139 H(25C) 5495 2810 1674 139 H(l) -1483 4815 2120 95 H(20) 1926 5057 2045 48 H(4A) 287 8479 1116 60 H(4B) -61 8355 1977 60 H(17) -13 10353 1669 64 H(2) -3046 8007 1077 53 H(ll) -3743 5520 1006 63 H(24A) 3051 4959 637 62 H(24B) 1951 4208 863 62 H(19A) 1181 7275 435 88 H(19B) 2463 6789 492 88 H(19C) 2087 7865 980 88 H(15) -1730 13206 983 93 H(21) 3171 6536 2395 62
H(14) -3273 12049 597 85
H(7) -572 5933 100 69
H(10) -4268 4360 9 76
H(9) -2970 3989 . -950 84
H(22A) 4894 5438 2487 77
H(22B) 3787 4700 2707 77
H(8) -1106 4760 -890 88
H(23A) 3028 3288 1812 76
H(23B) 3677 3120 1038 76
SCHEME 4
Figure imgf000082_0001
(25)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2.5-dihvdro-lH-pyrrole-l-carboxamide (4-2)
This compound was made in a manner identical to that for 3-1. with the exception of incorporation of the first eluting enantiomer of 2=3 from the chiral column described in Scheme 2, Step 3. Data for 4-2: 1HΝMR (500 MHz, CDC13) δ 7.4 - 7.2 (m, 5H), 7.1 - 6.9 (m, 3H), 6.3 (s, IH), 5.4 (bs, IH), 5.2 (d, IH), 4.9 (m, IH), 4.6 (m, IH), 4.4 (m, IH), 4.0 (m, IH), 3.8 (m, IH), 3.2 (s, 3H), 3.0 (m, IH), 2.5 - 2.2 (m, 3H), 2.4 (s, 3H), 1.8 - 1.6 (m, 2H) ppm. HRMS (ES) calc'd M + H for C25H28F3N302: 460.2207. Found: 460.2229. SCHEME 5
Figure imgf000083_0001
(25)-4-(2,5-Difluorophenyl)-N-[(3R,4R)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-
2-phenyl-2.5-dihvdro-lH-pyrrole-l-carboxamide (5-3) ______ This compound was made in a manner identical to that for 3=1, with the exception that the trans isomer of 2-2a was incorporated into the synthesis. Resolution of the enantiomers of "trans-2 3" was carried out chromatographically using a Chiralpak AD® 10 x 50cm column with 15% EtOH in hexanes (with 0.1 % diethylamine) at 150 mL/min. Analytical HPLC analysis of the eluent on a 4 x 250mm Chiralpak AD® column with 15% EtOH in hexanes (with 0.1% diethylamine) at 1 mL/min indicated that first eluting enantiomer has Rt= 7.30 min and the second enantiomer has Rt = 11.59 min. The first eluting enantiomer (having unknown absolute stereochemistry) was further processed to provide frøns-amine 5-1, which was incorporated into the synthesis of 5=3 following a route identical to that explained in Scheme 2. Data for 5=3: XHΝMR (500 MHz, CDC13) δ 7.4 - 7.2 (m, 5H), 7.1 - 6.9 (m, 3H), 6.3 (s, IH), 5.0 - 4.7 (m, 4H), 4.5 (m, IH), 4.0 (m, IH), 3.8 (m, IH), 3.3 (m, IH), 2.9 (s, 3H), 2.85 (m, IH), 2.35 (s, 3H), 2.2 - 1.9 (m, 3H), 1.7 (m, IH) ppm. HRMS (ES) calc'd M + H for C25H28F3N302: 460.2207. Found: 460.2231. The absolute stereochemistry on the piperidine of compounds 5-3 and 5-4 has not been determined and stereochemistry indicated has been tentatively assigned.
(2S)-4-(2,5-Difluorophenyl)-N-[(3S,45)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2.5-dihydro- lH-pyrrole- 1 -carboxamide (5-4) This compound was made in a manner identical to that for 5-3. with the exception of incorporation of the second eluting isomer of trans-2-3 from the chiral column. Data for 5=4: 1HΝMR (500 MHz, CDC13) δ 7.4 - 7.2 (m, 5H), 7.1 - 6.9 (m, 3H), 6.3 (s, IH), 5.4 (m, IH), 4.9 - 4.6 (m, 3H), 4.4 (m, IH), 4.0 (m, IH), 3.85 (m, IH), 3.25 (m, IH), 3.0 (s, 3H), 2.85 (m, IH), 2.35 (s, 3H), 2.2 - 1.9 (m, 4H) ppm. HRMS (ES) calc'd M + H for C2SH28F3N3θ2: 460.2207. Found: 460.2229. SCHEME 6
Figure imgf000084_0001
SCHEME 6 (continued)
Figure imgf000085_0001
Step 1: (2S.4S)-tert-Butyl 4-hvdroxy-2-phenylpyrrolidine-l -carboxylate (6-2) To a flame dried flask equipped with stir bar was added tert-butyl (2S,4S)-4-{ [tert- butyl(dimethyl)silyl]oxy}-2-phenylpyrrolidine-l-carboxylate (6-1, prepared from (S)-(-)-4-chloro-3- hydroxybutyronottile by the method of Maeda, et al Synlett 2001, 1808-1810, 7.8 g, 20.7 mmol) and anhydrous acetonittile (20.0 mL). The resulting solution was treated with triethylamine trihydrofluoride (10.1 mL, 62.0 mmol) while stirring under N2. The reaction stirred 12 hours at 40°C. The reaction was then diluted with EtOAc (100 mL) and poured into 5% aq. NaHC03. Following cessation of gas evolution, the organic layer was washed three additional times with 5% aq. NaHC03. The organic layer was dried over magnesium sulfate, filtered and concentrated to provide crude product. Recrystallization was effected from EtOAc/hexanes to provide (2S,4S)-tert-butyl 4-hydroxy-2-phenylpyrrolidine-l- carboxylate (6-2) as a white crystalline solid. !H NMR (300 MHz, CDC13) rotamers δ 7.38-7.18 (m, 5H), 4.90 (m, IH), 4.42 (m, IH), 3.88 (m, IH), 3.56 (dd, 7= 11.5, 4.0 Hz, IH), 2.60 (m, IH), 2.03 (m, IH), 1.50 and 1.20 (br s, 9H); MS 208.0 found, 208.1 (M - C(CH3)3) required.
Step 2: (2S)-tert-Butyl 4-oxo-2-phenylpyrrolidine-l -carboxylate (6-3) To a flame dried flask equipped with stir bar was added 150 mL anhydrous dichloromethane which was cooled to -78°C. Oxalyl chloride (3.8 mL, 44 mmol) and DMSO (4.8 mL, 61 mmol) were added sequentially and the reaction stirred for 10 minutes. (2S,4S)-tert-Butyl 4-hydroxy- 2-phenylpyrrolidine-l -carboxylate (6-2, 2.28 g, 8.73 mmol) in 10 mL anhydrous dichloromethane was added dropwise and stirred 1 hour at -78°C. Triethylamine (12 mL, 87mmol) was added and the reaction was warmed to 0°C over 1 hour. Upon completion, the reaction was washed with 5% NaHC03, brine and dried over MgS0 . The organic layer was concenttated to provide crude (2S)-tert-butyl 4-oxo-2- phenylpyrrolidine-1-carboxylate (6-3). Recrystallization was effected with EtOAc/hexanes. H NMR (300 MHz, CDC13) δ 7.35 (m, 3H), 7.17 (m, 2H), 5.38 (m, IH), 4.08 (d, 7 = 19.5 Hz, IH), 3.90 (d, 7 = 19.3 Hz, IH), 3.13 (dd, 7= 18.8, 9.8 Hz, IH), 2.58 (dd, 7 = 18.6, 2.4 Hz, IH), 1.40 (br s, 9H); MS 206.0 found, 206.1 (M - C(CH3)3) required.
Step 3: (2S)-tert-Butyl 2-phenyl-4-{[(ttifluoromethyl)sulfonyl]oxy}-2,5-dihydro-lH-pyrrole-l- carboxylate (6-4 ) To a flame dried flask equipped with stir bar was added ketone (2S)-tert-butyl 4-oxo-2- phenylpyrrolidine-1 -carboxylate (6-3, 0.16 g, 0.62 mmol) and anhydrous THF (2 mL). The resulting solution was cooled to -78°C, and treated dropwise with lithium hexamethyldisilylamide (LHMDS, 0.68 mL, IM in THF, 0.68 mmoL). The reaction stirred 1 hour at -78°C, and N-(5-chloropyridin-2-yl)-l,l,l- trifluoro-N-[(ttifluoromethyl)sulfonyl]methanesulfonamide (0.27 g, 068 mmol) was added neat in one portion. The reaction was allowed to warm to 0°C and stirred 4 hours total. The reaction was diluted with' Et 0 (lOmL) and washed successively with H20 (lOmL) and brine (10 mL). The organic layer was dried over MgS04, filtered and concentrated. The crude residue was purified by flash column choromatography (0-20% EtOAc/hexanes gradient, 15 min) to provide (2S)-tert-butyl 2-phenyl-4- {[(trifluoromethyl)sulfonyl]oxy}-2,5-dihydro-lH-pyrrole-l-carboxylate (6-4). !H NMR (300 MHz, CDCI3) major rotamer: δ 7.30 (m, 5H), 5.72 (m, IH), 5.48 (m, IH), 4.42 (m, 2H), 1.18 (s, 9H); MS 379.0 found 379.1 (M - CH3) required.
Step 4: (2S)-4-(2,5-Difluorophenyl)-2-phenyl-N,N-dimethyl-2,5-dihydro-lH-pyrrole-l- carboxamide (6-5) To a flame dried flask equipped with stir bar was added (2S)-tert-butyl 2-phenyl-4- { [(ttifluoromethyl)sulfonyl]oxy}-2,5-dihydro-lH-pyrrole-l-carboxylate (6-Λ, 0.250 g, 0.636 mmol), 2,5- difluorophenyl boronic acid (0.251 g, 1.59 mmol), Na2C03 (0.202 g, 1.91 mmol), and LiCl (0.081 g, 1.91 mmol). The solids were dissolved in 20 mL 4: 1 DME/H20 and degassed with nittogen. Pd(PPh3) (0.037 g, 0.032 mmol) was added and the reaction was sealed under nitrogen and heated to 90°C for 2 hours. Upon completion, the reaction was partitioned between 5% aq. NaHC03 and EtOAc (3 x 50 mL), and the combined organic layers were dried over MgS0 . Following filtration, the organic layer was concentrated and purified via flash column chromatography (Si02, 0-20% EtOAc/hexanes gradient) to provide (2S)-tert-butyl 4-(2,5-difluorophenyl)-2-phenyl-2,5-dihydro-lH-pyrrole-l-carboxylate (6-5). Step 5: l-{ [(2S)-4-(2,5-Difluorophenyl)-2-phenyl-2,5-dihydro-lH-pyrrol-l-yl]carbonyl}-3- methyl-lH-imidazol-3-ium (6-6) To a flame-dried flask equipped with stir bar under nitrogen was charged 6-5 (0.63 g, 1.75 mmol) and anhydrous CH2CL2 (10 mL). The resulting solution was treated with trifluoroacetic acid (5 mL) and stirred 1.5 hours at 25°C. Upon completion, the reaction was concentrated, taken up in CH2C12 (50 mL) and washed with 5% NaHC03 (50 mL). The organic layer was dried (MgS04), filtered and concentrated under reduced pressure. The resulting free-amine was dissolved in anhydrous THF (10 mL) and tteated with carbonyl diimidazole (0.31 g, 1.93 mmol). The resulting solution was refluxed for 4 hours until completion. The reaction was concenttated, taken up in EtOAc (50 mL) and washed with H20 and brine. The combined organic layers were dried (MgS0 ) and concenttated. The crude acyl imidazole was dissolved in anhydrous CH3CN and tteated with Mel (2.2 mL, 36 mmol). The resulting solution was stirred at 25 °C overnight. Upon completion, the reaction was concenttated to give 6-6 as an orange colored solid: LRMS m/z (M+H) 365.9 found, 366.1 required.
SCHEME 7
Figure imgf000087_0001
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,4S)-3-fluoro-l-methylpiperi dihvdro- lH-pyrrole- 1 -carboxamide (7- 1 ) To a solution of 75mg (0.15 mmol) of 6=6 in lmL of THF was added 40mg (0.18 mmol) of the bis-HCl salt of amine 2=5 and 106 μL (0.76 mmol) of triethylamine. After stirring for 72h at room temperature, the reaction was partitioned between CH C12 and saturated aqueous ΝaHC03, the organic was washed with brine, dried over MgS0 , and concenttated by rotary evaporation. The residue was purified by silica gel chromatography with 80:10:10 CHCl3/EtOAc/MeOH to provide 7=1 as a white solid. Data for 7=1: HRMS (ES) calc'd M + H for C24H26F3N3O: 430.2101. Found: 430.2116.
Figure imgf000088_0001
(25)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoro-l-methylpiperidin-4-yl]-N-methyl-2-phenyl-2,5- dihydro- lH-pyrrole- 1 -carboxamide (7-2) This compound was made in an analogous way as was 7=1, substituting 4=1 as starting material. Data for 7=2: HRMS (ES) calc'd M + H for C^H^^O: 430.2101. Found: 430.2119.
Figure imgf000088_0002
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,4R)-3-fluoro-l-methylpiperidin-4-yl]-N-methyl-2-phenyl-2,5- dihydro-lH-pyrrole-1 -carboxamide (7-3) This compound was made in an analogous way as was 7-1. substituting 5=1 as starting material. Data for 7=3: HRMS (ES) calc'd M + H for C24H26F3Ν30: 430.2101. Found: 430.2115. The absolute stereochemistry on the piperidine of compound 7-3 has not been determined and stereochemistry indicated has been tentatively assigned. EXAMPLE 8
Figure imgf000089_0001
benzyl 4-r(fer^-Butoxycarbonyl)(methyl)aminol-2-(hydroxymethyl)piperidine-l-carboxylate (8-2) To a solution of 2.0 g (6.8 mmol) of 8=1 (reported in: S. J. Hayes, T. C. Malone, G. Johnson 7. Org. Chem. 1991, 56, 4084-4086) in 100 mL of CH2C12 was added 3.33 mL (23.9 mmol) of triethylamine, followed by dropwise addition of 2.44g (15.4 mmol) of S03-pyridine in 50 mL of DMSO. After stirring for 5h at room temperature, the mixture was partitioned between CH2C12 and H20, the phases were separated, washed with 2 x IM HCl, saturated aqueous NaHC03, brine, dried over MgS04, and concentrated to provide the ketone. To 2.1g (7.2 mmol) of this ketone dissolved in 35 mL of MeOH was added ImL of AcOH and 14.4 mL (28.9 mmol) of a 2M solution of MeNH2 in MeOH. After stirring for lh, 910mg (14.4 mmol) of NaCNBH3 in 5 mL of MeOH was added and the reaction was stirred overnight. The reaction was quenched with saturated aqueous NH4CI, exttacted with CH2C12, washed with NaHC03, H20, brine, dried over MgS0 , and concentrated to provide 2.0g (7.2 mmol) of the amine. This material was dissolved in 25mL of CH2C12, 1.78g (8.2 mmol) of di-tert-butyl dicarbonate and 1.8 mL (12.9 mmol) of triethylamine were added, and the resultant mixture was stirred for 72h. The reaction was then partitioned between CH2C12 and saturated aqueous NaHC03, separated, washed with H20, brine, dried over MgS04, and concenttated. The residue was purified by silica gel chromatography with EtOAc/hexanes to provide 1.85g (4.6 mmol) of a mixture of diastereomers. This was dissolved in 20 mL of THF and ImL of MeOH, cooled to 0°C, and 496mg (22.8 mmol) of LiBEL, was added. After warming to room temperature and stirring overnight, the reaction was quenched with saturated aqueous NHtCl, exttacted with EtOAc, washed with H20, brine, dried over MgS0 , and concentrated to provide 8=2 as a colorless gum. Data for 8=2: LRMS (ES) calc'd M + H for C20H3oN205: 379. Found: 379.
tert-Butyl r2-(hvdroxymethyl)-l-methylpiperidin-4-ynmethylcarbamate (8-3) To 1.08g (2.9 mmol) of 8=2 in 30 mL of EtOH was added 7mL (74 mmol) of 1 ,4- cyclohexadiene and a catalytic amount of 10% Pd on carbon. After stirring overnight, the reaction was filtered through Celite, concentrated by rotary evaporation, and dissolved in 25mL of MeOH. To this was added 2mL of AcOH, and 700 μL (8.6 mmol) of 37% aqueous formaldehyde. After stirring overnight, 540mg (8.6 mmol) of NaCNBH3 in 5 mL of MeOH was added and the reaction was stirred for lh more. The solvents were removed by rotary evaporation, the residue was partitioned between EtOAc and aqueous NaHC03, the organic phase was washed with brine, dried over Na2S04, and concentrated. The residue was taken up in CH2C12, filtered and concentrated to provide 8=3 as a colorless oil. Data for 8-3: LRMS (ES) calc'd M + H for C13H26N203: 259. Found: 259.
tert-Butyl [2-(fluoromethyl)-l-methylpiperidin-4-yl]methylcarbamate (8-4) and tert-butyl (6-fluoro-l- methylazepan-4-yl)methylcarbamate (8-5) To a solution of 350 μL (2.6 mmol) of (diethylamino)sulfur trifluoride (DAST) in 15mL of CH2C12 at -78°C was added 520mg (2.0 mmol) of 8=3 in 5 mL of CH2C12. The reaction was allowed to slowly warm to room temperature with stirring overnight, and was then quenched with ice water. The mixture was partitioned with additional CH2C12 and a small amount of 3M KOH, the organic phase was washed with water, dried over Na2S0 , and concenttated. The residue was loaded onto a silica gel column and eluted with EtOAc - 20: 1 : 1 EtOH/NH4θH/H20. The first product to elute was the ring enlarged product 8=5 as a colorless oil, and the second to elute was 8=4 as a colorless oil. Both 8-5 and 8- 4 were isolated as enantiomeric mixtures of the trans diastereomer. The structures were confirmed by extensive ID and 2D NMR specttoscopy. Data for 8=5: 1HNMR (600 MHz, CD2C12) δ 4.75 (m, IH), 4.1 - 3.9 (m, IH), 2.9 - 2.7 (m, 3H), 2.75 (s, 3H), 2.4 (s, 3H), 2.35 (m, IH), 2.1 - 1.7 (m, 4H), 1.4 (s, 9H) ppm. Data for 8=4: !HNMR (500 MHz, CD2C12) δ 4.8 -4.5 (m, 2H), 4.1 - 4.0 (m, IH), 3.2 (m, IH), 2.75 (m, 2H), 2.7 (s, 3H), 2.45 (s, 3H), 1.9 - 1.5 (m, 4H), 1.45 (s, 9H) ppm.
(25)-4-(2,5-Difluorophenyl)-N-[(2JR,4R)-2-(fluoromethyl)-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide (8-6a) and (2S)-4-(2,5-Difluorophenyl)-N- [(25,45)-2-(fluoromethyl)-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2-phenyl-2,5-dihydro- lff-pyrrole-l -carboxamide (8-6b) A solution of 80mg (0.31 mmol) of 8=4 in 30 mL of EtOAc was saturated with HCl gas and allowed to stir lh at room temperature. The reaction was then concentrated by rotary evaporation and the resulting white solid was suspended in ImL of THF. To this was added 156mg (0.34 mmol) of 1=9, 268 μL ( 1.54 mmol) of diisopropylethylamme and a catalytic amount of DMAP. After heating at 50 °C overnight, 500 μL of trifluoroacetic acid was added and stirring was continued an additional lh at room temperature before being quenched with saturated aqueous ΝaHC03. The mixture was partitioned with CH2C12, the organic phase was washed with brine, dried over MgS04, and concenttated. The residue was loaded onto a silica gel column and eluted with CHC13 - 80: 10: 10 CHCl /EtOAc/MeOH to provide 8-6a and 8-6b as an inseparable mixture - a colorless gum. Data for 8-6a/8-6b: HRMS (ES) calc'd M + H for C26H3oF3N3θ2: 474.2363. Found: 474.2374.
EXAMPLE 9
Figure imgf000091_0001
9-1
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,45)-3-fluoro-l-methyl-l-oxidopiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2.5-dihydro- lH-pyrrole- 1 -carboxamide (9-1 ) To a solution of 20mg (0.044 mmol) of 34 in 1 mL of CH2C12 at 0°C was added 1 lmg (~ 0.048 mmol) of mCPBA. The ice-bath was removed and the reaction was stirred for 30 min. The mixture was partitioned with EtOAc and saturated aqueous ΝaHC0 , separated, washed with H 0, brine, dried over Na2S0 and concentrated by rotary evaporation. The residue was loaded onto a silica gel column and eluted with EtOAc- 20: 1: 1
Figure imgf000091_0002
to provide 9=1 as a white foam. Data for 9-1: 1HNMR (500 MHz, CDC13) δ 7.4 - 7.2 (m, 5H), 7.1 - 6.9 (m, 3H), 6.25 (s, IH), 5.0 - 4.9 (m, 2H), 4.7 (m, IH), 4.5 (m, IH), 4.3 - 4.2 (m, IH), 4.0 (m, 2H), 3.7 (m, IH), 3.4 - 3.3 (m, 2H), 3.3 (s, 3H), 3.2 (s, 3H), 2.5 - 1.9 (bs, 2H), 1.8 (m, IH) ppm. HRMS (ES) calc'd M + H for C25H28F3N3θ3: 476.2156. Found: 476.2165.
EXAMPLE 10
Figure imgf000091_0003
Step 1: Benzyl (3R,4S)-4-[ { [(25)-4-(2,5-difluoroρhenyl)-2-(hydroxymethyl)-2-phenyl-2,5- dihydro- lH-pyrrol- 1 -y 1] carbonyl } (methyl)amino] -3 -fluoropiperidine-1 -carboxylate (10- 11; To a solution of 885mg (2.4 mmol) of 2_3 in 12 mL of EtOAc at 0°C was added 12 mL (48 mmol) of a 4M solution of HCl in dioxane. The ice-bath was removed, stirring was continued for 2h, and then the volatiles were removed by rotary evaporation. The residue was partitioned between EtOAc and saturated aqueous NaHC03 with 5mL of IM NaOH, separated, and the aqueous phase exttacted 2 x EtOAc. The combined organic extracts were washed again with NaHC03, brine, dried over Na2S04, and concentrated to provide 590mg (2.2 mmol) of the amine. To 215mg (0.81 mmol) of this material in 5 mL of THF was added 340mg (0.73 mmol) of 1=9, 306 μL (2.2 mmol) of triethylamine, and a catalytic amount of DMAP. After stirring overnight, the reaction was judged only ~ 40% complete by LC/MS, so an additional portion of DMAP was added and stirring was continued overnight. The reaction was then partitioned between EtOAc and saturated aqueous NaHC03, the organic phase was washed with NaHC03, H20, brine, dried over Na2S0 , and concenttated. The residue was purified by silica gel chromatography with EtOAc/hexanes to provide 10-1 as a colorless oil. Data for 10-1: LRMS (ES) calc'd M + H for C38H46F3N304Si: 694.4. Found: 694.3.
Step 2: (25)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoropiperidin-4-yl]-2-(hydroxymethyl)-N- methy 1-2-pheny 1-2, 5 -dihvdro- lH-pyrrole- 1 -carboxamide (10-2): To a solution of 405mg (0.58 mmol) of 10=1 in 4 mL of EtOH was added 1.38 mL (14.6 mmol) of 1,4-cyclohexadiene, lOOmg of 10% palladium on carbon, and then stirred overnight. The reaction was filtered through Celite, concentrated, and the residue was dissolved in 3 mL of CH2C12. To this was added 3mL of trifluoroacetic acid, stirring was maintained for lh, and then the mixture was partitioned between EtOAc and saturated aqueous ΝaHC03 plus 25mL of 5% aqueous Na2C03, the organic phase was washed with NaHC03 again, H20, brine, dried over Na2S04, and concentrated by rotary evaporation. The residue was loaded onto a silica gel column and eluted with EtOAc - 20: 1: 1 EtOH/NH4OH/H20 to provide 10-2 as a white solid. There was an impurity of ~ 5% subsequently removed by reverse phase chromatography with 95:5 to 5:95 H20/CH3CN (both with 0.1% TFA). The fractions were basifϊed with NaHC03 to provide pure 10-2 as a white solid. Data for 10-2: 'HNMR (500 MHz, CDC13) δ 7.4 - 7.2 (m, 5H), 7.1 - 6.9 (m, 3H), 6.3 (s, IH), 5.2 (bs, IH), 4.9 (m, IH), 4.8 - 4.6 (m, 2H), 4.45 (m, IH), 4.2 - 4.1 (m, IH), 4.0 (m, IH), 3.3 - 3.2 (m, 2H), 3.1 (s, 3H), 2.85 - 2.7 (m, 2H), 2.1 (m, IH), 1.7 (m, 2H) ppm. HRMS (ES) calc'd M + H for C2 H26F3N3θ2: 446.2050. Found: 446.2059. EXAMPLE 11
Figure imgf000093_0001
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,45)-3-fluoro-l-isopropylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2.5-dihvdro-lH-pyrrole-l-carboxamide (11-1) To a solution of 38mg (0.085 mmol) of 10=2 in 1 mL of 1,2-dichloroethane was added 20 μL (0.34 mmol) of acetic acid, 25 μL (0.34 mmol) of acetone, and 27 mg (0.13 mmol) of Νa(OAc)3BH. After stirring overnight, the reaction was partitioned between EtOAc and saturated aqueous NaHC03, the organic phase was washed again with NaHC03, H20, brine, dried over Na2S04, and concentrated by rotary evaporation. The residue was purified by reverse phase chromatography with 95:5 to 5:95 H20/CH3CN (both with 0.1% TFA). The fractions were basified with NaHC03 to provide 11=1 as a colorless film. Data for 11=1: !HNMR (500 MHz, CDC13) δ 7.4 - 7.2 (m, 5H), 7.1 - 6.9 (m, 3H), 6.3 (s, . IH), 5.3 (m, IH), 4.95 -4.8 (m, 2H), 4.6 (m, IH), 4.45 (m, IH), 4.1 - 4.0 (m, 2H), 3.2 (m, IH), 3.15 (s, 3H), 3.0 (m, IH), 2.8 (m, IH), 2.45 - 2.25 (m, 3H), 1.75 (m, IH), 1.1 - 1.0 (m, 6H) ppm. HRMS (ES) calc'd M + H for C27H32F3N3θ2: 488.2519. Found: 488.2517.
EXAMPLE 12
Figure imgf000093_0002
(2S)-4-(2,5-Difluorophenyl)-N-[(35,4i?)-3-fluoropiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2-phenyl-
2,5-dihydro-lH-pyrrole-l-carboxamide (12-1) This compound was made in a manner identical to that for 10-2, with the exception of incorporation of the enantiomer of 2=3. Data for 12=1: HRMS (ES) calc'd M + H for C24H26F3Ν3θ2: 446.2050. Found: 446.2069.
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,4R)-3-fluoropiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2-phenyl-
2,5-dihydro-lH-pyrrole-l-carboxamide (12-2) This compound was made in a manner identical to that for 10-2, with the exception that the trans isomer of 2-2a was incorporated into the synthesis. Resolution of the enantiomers of "fran>s-2= 3" was carried out chromatographically using a Chiralpak AD® 10 x 50cm column with 15% EtOH in hexanes (with 0.1 % diethylamine) at 150 mL/min. Analytical HPLC analysis of the eluent on a 4 x 250mm Chiralpak AD® column with 15% EtOH in hexanes (with 0.1% diethylamine) at 1 mL/min indicated that first eluting enantiomer has Rt = 7.30 min and the second enantiomer has Rt = 11.59 min. The first eluting enantiomer (having unknown absolute stereochemistry) was further processed to provide the trans amine, which was incorporated into the synthesis of 12-2 following a route identical to that explained in Example 10. Data for 12-2: HRMS (ES) calc'd M + H for C24H26F3Ν3θ2: 446.2050. Found: 446.2069. The absolute stereochemistry on the piperidine of compounds 12-2 and 12-3 has not been determined and stereochemistry indicated has been tentatively assigned.
(2S)-4-(2,5-Difluorophenyl)-N-[(35,45)-3-fluoropiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2-phenyl-
2,5-dihydro- lH-pyrrole- 1 -carboxamide (12-3) This compound was made in a manner identical to that for 10-2, with the exception of incorporation of the second eluting isomer of "trans-2-3" from the chiral column. Data for 12-3: HRMS (ES) calc' d M + H for C24H26F3Ν302: 446.2050. Found: 446.2068.

Claims

WHAT IS CLAIMED IS:
A compound of Formula I:
Figure imgf000095_0001
or a pharmaceutically acceptable salt or stereoisomer thereof,
wherein:
a is Oorl; bis Oorl; mis 0, 1, or 2; nis 0, 1, 2 or 3; ris Oorl; s is Oorl; tis 0, 1 or 2;
Rl and R are independently selected from: H, (Cι-C6)alkyl, aryl, heterocyclyl and (C3-C6)cycloalkyl, optionally substituted with one, two or three substituents selected from R7;
R3 is selected from: 1) hydrogen; 2) Ci-Cio alkyl; 3) C1-C10 alkyl-O-Rd, 4) C2-C10 alkenyl-0-Rd, 5) C2-C1 o alkynyl-O-Rd 6) (Cι-C6-alkylene)nC3-C8 cycloalkyl-0-Rd,
Figure imgf000096_0001
10) (Cι-C6-alkylene)nC3-C8
Figure imgf000096_0002
11) Ci-Cio alkyl-S(0)m-Rd 12) C2-C10 alkenyl- S(0)m-Rd 13) C2-C10 alkynyl- S(0)m-Rd 14) (Cl -C6-alkylene)nC3-C8 cycloalkyl- S(0)m-Rd, said alkyl, alkenyl, alkynyl and cycloalkyl are optionally substituted with one or more substituents selected from R6;
R4 is independently selected from: 1) (C=O)aObCι-Ci0 alkyl, 2) (C=0)aObaryl, 3) C02H, 4) halo, 5) CN, 6) OH, 7) ObCι-C6 perfluoroalkyl,
Figure imgf000096_0003
9) S(0)mRa,
Figure imgf000096_0004
said alkyl, aryl, alkenyl, alkynyl, heterocyclyl, and cycloalkyl optionally substituted with one, two or three substituents selected from R7; is selected from: D hydrogen; 2) (C=0)aObCi-Cio alkyl, 3) (C=0)aObaryl, 4) C02H, 5) halo, 6) CN, 7) OH, 8) O Ci-Cβ perfluoroalkyl,
Figure imgf000097_0001
10) S(0)mRa,
Figure imgf000097_0002
12) -OPO(OH)2; said alkyl, aryl, alkenyl, alkynyl, heterocyclyl, and cycloalkyl optionally substituted with one, two or three substituents selected from R7; is independently selected from: 1) (C=O)aObCι-Cl0 alkyl, 2) (C=0)aObaryl, 3) C2-C10 alkenyl, 4) C2-C10 alkynyl, 5) (C=0)aOb heterocyclyl, 6) C02H, 7) halo, 8) CN, 9) OH, 10) O Ci -Cβ perfluoroalkyl, 11) Oa(C=0) NR8R9, 12) S(0)mRa,
Figure imgf000097_0003
14) oxo, 15) CHO, 16) (N=0)R8R9, 17) (C=0)aObC3-C8 cycloalkyl, and 18) -OPO(OH)2; said alkyl, aryl, alkenyl, alkynyl, heterocyclyl, and cycloalkyl optionally substituted with one, two or three substituents selected from Rl;
R7 is selected from: 1) (C=0)rOs(Cι-Cιo)alkyl, 2) Or(Cι-C3)perfluoroalkyl, 3) oxo, 4) OH, 5) halo, 6) CN, 7) (C2-Cιo)alkenyl, 8) (C2-Cιo)alkynyl, 9) (C=0)rOs(C3-C6)cycloalkyl, 10) (C=0)rOs(Co-C6)alkylene-aryl, 11) (C=0)rOs(Co-C6)alkylene-heterocyclyl, 12) (C=0)rOs(Co-C6)alkylene-N(Rb)2, 13) C(0)Ra, 14) (Co-C6)alkylene-C02Ra, 15) C(0)H, 16) (Co-C6)alkylene-C02H, and 17) (C=0)rN(Rb)2, 18) S(0)mRa, 19) S(0)2N(Rb)2; and 20) -OPO(OH)2; said alkyl, alkenyl, alkynyl, cycloalkyl, aryl, alkylene and heterocyclyl is optionally substituted with up to three substituents selected fromRb, OH, (Cι-C6)alkoxy, halogen, CO2H, CN, 0(C=0)Cχ-C6 alkyl,
Figure imgf000098_0001
R8 and R are independently selected from: 1) H, 2) (C=0)ObCι-Cιo alkyl, 3) (C=0)ObC3-C8 cycloalkyl 4) (C=0)Obaryl, 5) (C=0)Obheterocyclyl, 6) C1-C10 alkyl, 7) aryl, 8) C2-C10 alkenyl, 9) C2-C10 alkynyl, 10) heterocyclyl, ID C3-C8 cycloalkyl, 12) Sθ2Ra, and 13) (C=0)NRb2, said alkyl, cycloalkyl, aryl, heterocylyl, alkenyl, and alkynyl is optionally substituted with one, two or three substituents selected from R7, or
R8 and R can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 3-7 members in each ring and optionally containing, in addition to the nittogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle optionally substituted with one, two or three substituents selected from R7;
RlO is selected from: F and -CH2F;
Rl is selected from: H and -CH2F, provided that if t is 1, Rl3 is H;
Rox is absent or is oxo;
Ra is independently selected from: (Cχ-C6)alkyl, (C3-Cg)cycloalkyl, aryl, or heterocyclyl, optionally substituted with one, two or three substituents selected from R7;
Rb is independently selected from: H, (Cχ-C6)alkyl, aryl, heterocyclyl, (C3-C6)cycloalkyl, (C=0)OCχ- C alkyl, (C=0)Cι -C6 alkyl, (C=0)aryl, (C=0)heterocyclyl, (C=0)NReRe Or S(0)2Ra, optionally substituted with one, two or three substituents selected from R7;
RCand Rc' are independently selected from: H, (Cι-C6)alkyl, aryl, NH2, OH, ORa, -(C -C6)alkyl-OH, - (Cι-C6)alkyl-0-(Cι-C6)alkyl, (C=0)OCχ-C6 alkyl, (C=0)Cι-C6 alkyl, (C=0)aryl, (C=0)heterocyclyl, (C=0)NReRe ', S(0)2Ra and -(Cχ-C6)alkyl-N(Rb)2, wherein the alkyl is optionally substituted with one, two or three substituents selected from R ; or
Rc and Rc' can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 3-7 members in each ring and optionally containing, in addition to the nittogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle optionally substituted with one, two or three substituents selected fromR7;
Rd is selected from: H, (Cχ-C6)alkyl, -(C2-C6)alkyl-OH, -(Cχ-C6)alkyl-0-(Cχ-C6)alkyl and ~(Cχ- C6)alkyl-N(Rb)2, wherein the alkyl is optionally substituted with one, two or three substituents selected from R7'>; Re and Re' are independently selected from: H, (Cχ-C6)alkyl, aryl, heterocyclyl and (C3-C6)cycloalkyl, optionally substituted with one, two or three substituents selected from R7; or
Re and Re' can be taken together with the nittogen to which they are attached to form a monocyclic or bicyclic heterocycle with 3-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle optionally substituted with one, two or three substituents selected from R7.
2. The compound according to Claim 1 of the Formula JJ:
Figure imgf000100_0001
or a pharmaceutically acceptable salt or stereoisomer thereof,
wherein a, b, m, r, s, R8, R9, Ra, Rb RC, RC', Rd, Re and Re', ^e as described in Claim 1 in the compound of Formula I; and
n is 0, 1 or 2;
Rl and R2 are independently selected from: H, (Cχ-C6)alkyl, aryl and (C3-C6)cycloalkyl, optionally substituted with one, two or three substituents selected from R7;
R4 is independently selected from: 1) halo, 2) OH, and 3) ObCχ-C6 perfluoroalkyl,
R5 is selected from: 1) hydrogen, 2) halo, 3) OH, and 4) ObCχ-C6 perfluoroalkyl; and
R7 is selected from: 1) (C=0)rOs(Cχ-Cχo)alkyl, 2) Or(C x -C3)perfluoroalkyl,
3) oxo, 4) OH, 5) halo, 6) CN, 7) (C2-Cχo)alkenyl, 8) (C2-Cχo)alkynyl, 9) (C=0)rOs(C3-C6)cycloalkyl, 10) (C=0)rOs(Co-C6)alkylene-aryl, 11) (C=0)rOs(Co-C6)alkylene-heterocyclyl, 12) (C=0)rOs(Co-C6)alkylene-N(Rb)2, 13) C(0)Ra, 14) (Co-C6)alkylene-Cθ2Ra, 15) C(0)H, 16) (Co-C6)alkylene-C02H, and 17) C(0)N(Rb)2, 18) S(0)mRa, and 19) S(0)2N(Rb)2; said alkyl, alkenyl, alkynyl, cycloalkyl, aryl, alkylene and heterocyclyl is optionally substituted with up to three substituents selected fromRb, OH, (Cχ-C6)alkoxy, halogen, CO2H, CN, 0(C=0)Cχ-C6 alkyl, oxo, NO2 and N(Rt>)_.
The compound according to Claim 2 of the Formula HI:
Figure imgf000102_0001
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
Rl and R are independently selected from: H and (Cχ-C6)alkyl.
4. The compound according to Claim 1 of the formula IV:
Figure imgf000102_0002
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein: Rl and R are independently selected from: H and (Cχ-C6)alkyl.
5. A compound selected from:
(2S)-4-(2,5-Difluorophenyl)-N-[(3S,47?)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide (25)-4-(2,5-Difluorophenyl)-N-[(3R,4S)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro- lH-pyrrole- 1 -carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(3R,4R)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl- 2-ρhenyl-2,5-dihy dro- lH-pyrrole- 1 -carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(3S,45)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoro-l-methylpiperidin-4-yl]-N-methyl-2-phenyl-2,5- dihydro- lH-pyrrole-1 -carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(3R,4S)-3-fluoro-l-methylpiperidin-4-yl]-N-methyl-2-phenyl-2,5- dihydro-lH-pyrrole-1-carboxamide
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,4R)-3-fluoro-l-methylpiperidin-4-yl]-N-methyl-2-phenyl-2,5- dihydro- lH-pyrrole- 1 -carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(2R,4R)-2-(fluoromethyl)-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro- lH-pyrrole- 1 -carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(2S,4S)-2-(fluoromethyl)-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro- lH-pyrrole- 1 -carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoro-l-methyl-l-oxidopiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide
(25)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoropiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2-phenyl- 2,5-dihydro-lH-pyrrole-l-carboxamide
(2S)-4-(2,5-Difluorophenyl)-N-[(3S,4R)-3-fluoro-l-isopropylpiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide (2S)-4-(2,5-Difluorophenyl)-N-[(3S,45)-3-fluoropiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2-phenyl- 2,5-dihydro- lH-pyrrole- 1 -carboxamide
or a pharmaceutically acceptable salt thereof.
6. A compound which is:
Figure imgf000104_0001
(2S)-4-(2,5-Difluorophenyl)-N-[(3S,4S)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide
or a pharmaceutically acceptable salt thereof.
7. A compound which is:
Figure imgf000104_0002
(2S)-4-(2,5-Difluorophenyl)-N-[(35,4R)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide; or a pharmaceutically acceptable salt thereof.
8. A compound which is :
Figure imgf000105_0001
(25)-4-(2,5-Difluorophenyl)-N-[(3R,4S)-3-fluoro-l-methylpiperidin-4-yl]-2-(hydroxymethyl)-N-methyl-2- phenyl-2,5-dihydro- lH-pyrrole- 1 -carboxamide
or a pharmaceutically acceptable salt thereof.
9. A compound which is:
Figure imgf000105_0002
(2S)-4-(2,5-Difluorophenyl)-N-[(2R,4i?)-2-(fluoromethyl)-l-methylρiperidin-4-yl]-2-(hydroxymethyl)-N- methyl-2-phenyl-2,5-dihydro-lH-pyrrole-l-carboxamide; or a pharmaceutically acceptable salt thereof.
10. A compound which is:
Figure imgf000106_0001
(2S)-4-(2,5-Difluorophenyl)-N-[(3R,4S)-3-fluoro-l-methylpiperidin-4-yl]-N-methyl-2-phenyl-2,5- dihydro-lH-pyrrole-1-carboxamide; or a pharmaceutically acceptable salt thereof.
11. A pharmaceutical composition that is comprised of a compound in accordance with Claim 1 and a pharmaceutically acceptable carrier.
12. A method of treating or preventing cancer in a mammal in need of such treatment that is comprised of administering to said mammal a therapeutically effective amount of a compound of Claim 1.
13. A method of treating cancer or preventing cancer in accordance with Claim 12 wherein the cancer is selected from cancers of the brain, genitourinary ttact, lymphatic system, stomach, larynx and lung.
14. A method of treating or preventing cancer in accordance with Claim 12 wherein the cancer is selected from histiocytic lymphoma, lung adenocarcinoma, small cell lung cancers, pancreatic cancer, gioblastomas and breast carcinoma.
15. A method of treating cancer which comprises administering a therapeutically effective amount of a compound of Claim 1 in combination with radiation therapy.
16. A method of modulating mitotic spindle formation which comprises administering a therapeutically effective amount of a compound of Claim 1.
17. A method of inhibiting the mitotic kinesin KSP which comprises administering a therapeutically effective amount of a compound of Claim 1.
PCT/US2004/025980 2003-08-15 2004-08-11 Mitotic kinesin inhibitors Ceased WO2005019205A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
BRPI0413580-6A BRPI0413580A (en) 2003-08-15 2004-08-11 compound, pharmaceutical composition, and methods for treating or preventing cancer in a mammal in need of such treatment, for modulating mitotic spindle formation and for inhibiting mitotic kinesin ksp
IS8276A IS8276A (en) 2003-08-15 2006-01-31 Mitosis quinine inhibits
IL173513A IL173513A0 (en) 2003-08-15 2006-02-02 Mitotic kinesin inhibitors
NO20061194A NO20061194L (en) 2003-08-15 2006-03-14 Mitotic kinesin inhibitors

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US49563703P 2003-08-15 2003-08-15
US60/495,637 2003-08-15
US51268003P 2003-10-20 2003-10-20
US60/512,680 2003-10-20
US56358604P 2004-04-19 2004-04-19
US60/563,586 2004-04-19

Publications (1)

Publication Number Publication Date
WO2005019205A1 true WO2005019205A1 (en) 2005-03-03

Family

ID=34222358

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/025980 Ceased WO2005019205A1 (en) 2003-08-15 2004-08-11 Mitotic kinesin inhibitors

Country Status (13)

Country Link
US (1) US20050038074A1 (en)
KR (1) KR20060058716A (en)
AR (1) AR045342A1 (en)
BR (1) BRPI0413580A (en)
CO (1) CO5650252A2 (en)
EC (1) ECSP066362A (en)
IL (1) IL173513A0 (en)
IS (1) IS8276A (en)
MA (1) MA27986A1 (en)
NO (1) NO20061194L (en)
PE (1) PE20050730A1 (en)
TW (1) TW200510380A (en)
WO (1) WO2005019205A1 (en)

Cited By (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006123182A2 (en) 2005-05-17 2006-11-23 Merck Sharp & Dohme Limited Cyclohexyl sulphones for treatment of cancer
US7301028B2 (en) 2002-06-14 2007-11-27 Merck & Co., Inc. Mitotic kinesin inhibitors
US7348440B2 (en) 2002-06-14 2008-03-25 Merck & Co., Inc. Mitotic kinesin inhibitors
US7638549B2 (en) 2003-08-15 2009-12-29 Merck & Co. Inc. Mitotic kinesin inhibitors
US7666862B2 (en) 2003-08-15 2010-02-23 Merck & Co., Inc. Mitotic Kinesin Inhibitors
WO2010114780A1 (en) 2009-04-01 2010-10-07 Merck Sharp & Dohme Corp. Inhibitors of akt activity
WO2011046771A1 (en) 2009-10-14 2011-04-21 Schering Corporation SUBSTITUTED PIPERIDINES THAT INCREASE p53 ACTIVITY AND THE USES THEREOF
WO2011163330A1 (en) 2010-06-24 2011-12-29 Merck Sharp & Dohme Corp. Novel heterocyclic compounds as erk inhibitors
WO2012018754A2 (en) 2010-08-02 2012-02-09 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF CATENIN (CADHERIN-ASSOCIATED PROTEIN), BETA 1 (CTNNB1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012024170A2 (en) 2010-08-17 2012-02-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012030685A2 (en) 2010-09-01 2012-03-08 Schering Corporation Indazole derivatives useful as erk inhibitors
WO2012058210A1 (en) 2010-10-29 2012-05-03 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACIDS (siNA)
WO2012087772A1 (en) 2010-12-21 2012-06-28 Schering Corporation Indazole derivatives useful as erk inhibitors
WO2013063214A1 (en) 2011-10-27 2013-05-02 Merck Sharp & Dohme Corp. Novel compounds that are erk inhibitors
WO2013165816A2 (en) 2012-05-02 2013-11-07 Merck Sharp & Dohme Corp. SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS
WO2014052563A2 (en) 2012-09-28 2014-04-03 Merck Sharp & Dohme Corp. Novel compounds that are erk inhibitors
WO2014085216A1 (en) 2012-11-28 2014-06-05 Merck Sharp & Dohme Corp. Compositions and methods for treating cancer
WO2014100065A1 (en) 2012-12-20 2014-06-26 Merck Sharp & Dohme Corp. Substituted imidazopyridines as hdm2 inhibitors
US8796460B2 (en) 2007-10-19 2014-08-05 Mercky Sharp & Dohme Corp. Compounds for inhibiting KSP kinesin activity
WO2014120748A1 (en) 2013-01-30 2014-08-07 Merck Sharp & Dohme Corp. 2,6,7,8 substituted purines as hdm2 inhibitors
WO2015034925A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Circular polynucleotides
WO2018058022A1 (en) 2016-09-26 2018-03-29 Merck Sharp & Dohme Corp. Anti-cd27 antibodies
WO2018071283A1 (en) 2016-10-12 2018-04-19 Merck Sharp & Dohme Corp. Kdm5 inhibitors
WO2018190719A2 (en) 2017-04-13 2018-10-18 Aduro Biotech Holdings, Europe B.V. Anti-sirp alpha antibodies
WO2019094312A1 (en) 2017-11-08 2019-05-16 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2019094311A1 (en) 2017-11-08 2019-05-16 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2019152642A1 (en) 2018-02-01 2019-08-08 Merck Sharp & Dohme Corp. Anti-pd-1/lag3 bispecific antibodies
WO2020033288A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2020033282A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2020033284A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2021126731A1 (en) 2019-12-17 2021-06-24 Merck Sharp & Dohme Corp. Prmt5 inhibitors
EP4076459A1 (en) 2019-12-17 2022-10-26 Merck Sharp & Dohme LLC Prmt5 inhibitors
US12441730B2 (en) 2019-12-17 2025-10-14 Merck Sharp & Dohme Llc PRMT5 inhibitors
WO2026027944A1 (en) 2024-07-30 2026-02-05 Sairopa B.V. Anti-sirp alpha antibody formulations and uses thereof
US12552826B2 (en) 2018-08-07 2026-02-17 Merck Sharp & Dohme Llc PRMT5 inhibitors
US12583871B2 (en) 2019-12-17 2026-03-24 Merck Sharp & Dohme Llc PRMT5 inhibitors

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1664026B1 (en) * 2003-08-15 2009-01-21 Merck & Co., Inc. Mitotic kinesin inhibitors
US20070225499A1 (en) * 2004-04-19 2007-09-27 Gary Javadi Process for the Preparation of 2,2-Disubstituted Pyrroles
WO2007103308A2 (en) * 2006-03-07 2007-09-13 Array Biopharma Inc. Heterobicyclic pyrazole compounds and methods of use
US12172108B2 (en) 2018-08-16 2024-12-24 Emd Millipore Corporation Closed bioprocessing device

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6440686B1 (en) * 2000-06-15 2002-08-27 Cytokinetics, Inc. Methods for screening and therapeutic applications of kinesin modulators
WO2003049527A2 (en) * 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003105855A1 (en) * 2002-01-11 2003-12-24 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003106417A1 (en) * 2002-06-14 2003-12-24 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004037171A2 (en) * 2002-10-18 2004-05-06 Merck & Co., Inc. Mitotic kinesin inhibitors

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6057342A (en) * 1996-08-16 2000-05-02 Dupont Pharmaceutical Co. Amidinophenyl-pyrrolidines, -pyrrolines, and -isoxazolidines and derivatives thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6440686B1 (en) * 2000-06-15 2002-08-27 Cytokinetics, Inc. Methods for screening and therapeutic applications of kinesin modulators
WO2003049527A2 (en) * 2001-12-06 2003-06-19 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003105855A1 (en) * 2002-01-11 2003-12-24 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2003106417A1 (en) * 2002-06-14 2003-12-24 Merck & Co., Inc. Mitotic kinesin inhibitors
WO2004037171A2 (en) * 2002-10-18 2004-05-06 Merck & Co., Inc. Mitotic kinesin inhibitors

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Retrieved from the Internet <URL:http://www.cytokinetics.com/pdf/AACR_2002_Poster_1337.pdf> *
Retrieved from the Internet <URL:http://www.cytokinetics.com/pdf/AACR_2002_Poster_325.pdf> *

Cited By (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7301028B2 (en) 2002-06-14 2007-11-27 Merck & Co., Inc. Mitotic kinesin inhibitors
US7348440B2 (en) 2002-06-14 2008-03-25 Merck & Co., Inc. Mitotic kinesin inhibitors
US7638549B2 (en) 2003-08-15 2009-12-29 Merck & Co. Inc. Mitotic kinesin inhibitors
US7666862B2 (en) 2003-08-15 2010-02-23 Merck & Co., Inc. Mitotic Kinesin Inhibitors
WO2006123182A2 (en) 2005-05-17 2006-11-23 Merck Sharp & Dohme Limited Cyclohexyl sulphones for treatment of cancer
US8796460B2 (en) 2007-10-19 2014-08-05 Mercky Sharp & Dohme Corp. Compounds for inhibiting KSP kinesin activity
WO2010114780A1 (en) 2009-04-01 2010-10-07 Merck Sharp & Dohme Corp. Inhibitors of akt activity
WO2011046771A1 (en) 2009-10-14 2011-04-21 Schering Corporation SUBSTITUTED PIPERIDINES THAT INCREASE p53 ACTIVITY AND THE USES THEREOF
WO2011163330A1 (en) 2010-06-24 2011-12-29 Merck Sharp & Dohme Corp. Novel heterocyclic compounds as erk inhibitors
WO2012018754A2 (en) 2010-08-02 2012-02-09 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF CATENIN (CADHERIN-ASSOCIATED PROTEIN), BETA 1 (CTNNB1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP3330377A1 (en) 2010-08-02 2018-06-06 Sirna Therapeutics, Inc. Rna interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (ctnnb1) gene expression using short interfering nucleic acid (sina)
EP4079856A1 (en) 2010-08-17 2022-10-26 Sirna Therapeutics, Inc. Rna interference mediated inhibition of hepatitis b virus (hbv) gene expression using short interfering nucleic acid (sina)
WO2012024170A2 (en) 2010-08-17 2012-02-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012030685A2 (en) 2010-09-01 2012-03-08 Schering Corporation Indazole derivatives useful as erk inhibitors
WO2012058210A1 (en) 2010-10-29 2012-05-03 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACIDS (siNA)
EP3766975A1 (en) 2010-10-29 2021-01-20 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
EP3327125A1 (en) 2010-10-29 2018-05-30 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using short interfering nucleic acids (sina)
WO2012087772A1 (en) 2010-12-21 2012-06-28 Schering Corporation Indazole derivatives useful as erk inhibitors
WO2013063214A1 (en) 2011-10-27 2013-05-02 Merck Sharp & Dohme Corp. Novel compounds that are erk inhibitors
WO2013165816A2 (en) 2012-05-02 2013-11-07 Merck Sharp & Dohme Corp. SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS
EP3919620A1 (en) 2012-05-02 2021-12-08 Sirna Therapeutics, Inc. Short interfering nucleic acid (sina) compositions
WO2014052563A2 (en) 2012-09-28 2014-04-03 Merck Sharp & Dohme Corp. Novel compounds that are erk inhibitors
WO2014085216A1 (en) 2012-11-28 2014-06-05 Merck Sharp & Dohme Corp. Compositions and methods for treating cancer
WO2014100065A1 (en) 2012-12-20 2014-06-26 Merck Sharp & Dohme Corp. Substituted imidazopyridines as hdm2 inhibitors
WO2014120748A1 (en) 2013-01-30 2014-08-07 Merck Sharp & Dohme Corp. 2,6,7,8 substituted purines as hdm2 inhibitors
WO2015034925A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Circular polynucleotides
WO2018058022A1 (en) 2016-09-26 2018-03-29 Merck Sharp & Dohme Corp. Anti-cd27 antibodies
WO2018071283A1 (en) 2016-10-12 2018-04-19 Merck Sharp & Dohme Corp. Kdm5 inhibitors
WO2018190719A2 (en) 2017-04-13 2018-10-18 Aduro Biotech Holdings, Europe B.V. Anti-sirp alpha antibodies
WO2019094311A1 (en) 2017-11-08 2019-05-16 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2019094312A1 (en) 2017-11-08 2019-05-16 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2019152642A1 (en) 2018-02-01 2019-08-08 Merck Sharp & Dohme Corp. Anti-pd-1/lag3 bispecific antibodies
US12173026B2 (en) 2018-08-07 2024-12-24 Merck Sharp & Dohme Llc PRMT5 inhibitors
WO2020033288A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2020033282A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
WO2020033284A1 (en) 2018-08-07 2020-02-13 Merck Sharp & Dohme Corp. Prmt5 inhibitors
US12552826B2 (en) 2018-08-07 2026-02-17 Merck Sharp & Dohme Llc PRMT5 inhibitors
US11981701B2 (en) 2018-08-07 2024-05-14 Merck Sharp & Dohme Llc PRMT5 inhibitors
US11993602B2 (en) 2018-08-07 2024-05-28 Merck Sharp & Dohme Llc PRMT5 inhibitors
EP4076459A1 (en) 2019-12-17 2022-10-26 Merck Sharp & Dohme LLC Prmt5 inhibitors
US12441730B2 (en) 2019-12-17 2025-10-14 Merck Sharp & Dohme Llc PRMT5 inhibitors
WO2021126731A1 (en) 2019-12-17 2021-06-24 Merck Sharp & Dohme Corp. Prmt5 inhibitors
US12583871B2 (en) 2019-12-17 2026-03-24 Merck Sharp & Dohme Llc PRMT5 inhibitors
US12595262B2 (en) 2019-12-17 2026-04-07 Merck Sharp & Dohme Llc PRMT5 inhibitors
US12595248B2 (en) 2019-12-17 2026-04-07 Merck Sharp & Dohme Llc PRMT5 inhibitors
WO2026027944A1 (en) 2024-07-30 2026-02-05 Sairopa B.V. Anti-sirp alpha antibody formulations and uses thereof

Also Published As

Publication number Publication date
PE20050730A1 (en) 2005-09-20
TW200510380A (en) 2005-03-16
BRPI0413580A (en) 2006-10-17
IS8276A (en) 2006-01-31
ECSP066362A (en) 2006-10-31
AR045342A1 (en) 2005-10-26
NO20061194L (en) 2006-05-05
CO5650252A2 (en) 2006-06-30
KR20060058716A (en) 2006-05-30
IL173513A0 (en) 2006-07-05
US20050038074A1 (en) 2005-02-17
MA27986A1 (en) 2006-07-03

Similar Documents

Publication Publication Date Title
WO2005019205A1 (en) Mitotic kinesin inhibitors
AU2004266232B2 (en) Mitotic kinesin inhibitors
AU2003287057B2 (en) Mitotic kinesin inhibitors
AU2004264533B2 (en) Mitotic kinesin inhibitors
AU2004266629B2 (en) Mitotic kinesin inhibitors
AU2003276005B2 (en) Mitotic kinesin inhibitors
AU2004266612B2 (en) Mitotic kinesin inhibitors
AU2003297230B2 (en) Mitotic kinesin inhibitors
EP1515724A1 (en) Mitotic kinesin inhibitors
AU2003299672A1 (en) Mitotic kinesin inhibitors
AU2004305069C1 (en) Mitotic kinesin inhibitors
EP1696927A2 (en) Mitotic kinesin inhibitors
AU2004248160A1 (en) Prodrugs of mitotic kinesin inhibitors
AU2004249138B2 (en) Mitotic kinesin inhibitors
WO2006101780A1 (en) Mitotic kinesin inhibitors
MXPA06001799A (en) Mitotic kinesin inhibitors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 200600680

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 545054

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 173513

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 06013574

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: 12006500322

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: PA/a/2006/001799

Country of ref document: MX

Ref document number: 1020067003087

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 1200600382

Country of ref document: VN

WWE Wipo information: entry into national phase

Ref document number: 2006108002

Country of ref document: RU

WWP Wipo information: published in national office

Ref document number: 1020067003087

Country of ref document: KR

122 Ep: pct application non-entry in european phase
ENP Entry into the national phase

Ref document number: PI0413580

Country of ref document: BR