WO2005018536A2 - Agonist antibodies that specifically bind the glucagon like peptide-1 receptor - Google Patents

Agonist antibodies that specifically bind the glucagon like peptide-1 receptor Download PDF

Info

Publication number
WO2005018536A2
WO2005018536A2 PCT/US2004/015866 US2004015866W WO2005018536A2 WO 2005018536 A2 WO2005018536 A2 WO 2005018536A2 US 2004015866 W US2004015866 W US 2004015866W WO 2005018536 A2 WO2005018536 A2 WO 2005018536A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
glp
antibodies
receptor
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/015866
Other languages
French (fr)
Other versions
WO2005018536A3 (en
Inventor
Craig A. Rosen
Adam Bell
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Publication of WO2005018536A2 publication Critical patent/WO2005018536A2/en
Publication of WO2005018536A3 publication Critical patent/WO2005018536A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2869Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against hormone receptors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)

Definitions

  • the present invention relates to antibodies and related molecules that specifically bind to the glucagon like peptide-1 (GLP-1) receptor.
  • GLP-1 glucagon like peptide-1
  • Such antibodies have uses, for example, in the treatment of diabetes, obesity, hyperglycemia, neurodegenerative disorders, and heart disease.
  • the invention also relates to nucleic acid molecules encoding anti-GLP-1 receptor antibodies, vectors and host cells containing these nucleic acids, and methods for producing the same.
  • the present invention relates to methods and compositions for preventing, detecting, diagnosing, treating or ameliorating a disease or disorder including diabetes, obesity, hyperglycemia, neurodegenerative disorders, and heart disease, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that specifically bind to the GLP-1 receptor.
  • Glucagon-like peptide-1 (GLP-1) is a 30 amino acid peptide secreted by intestinal L cells in response to the ingestion of food (Mojsov et al., J Biol Chem. 1986; 261 (25): 11880- 11889).
  • GLP-1 plays an important role in controlling post-prandial blood glucose levels. Increases in GLP-1 have two significant effects on pancreatic regulation of glucose metabolism: GLP-1 stimulates glucose- dependent insulin secretion resulting in increased glucose absorption in the periphery and it suppresses glucagon secretion leading to reduced hepatic glucose output. GLP-1 also delays gastric emptying and slows small bowel motility.
  • GLP-1 receptor GLP-1 receptor
  • GLP-1 infusion recombinant GLP-1 effectively stimulates glucose-dependent insulin secretion (mimicking the natural incretin effect), and that GLP-1 infusion lowers blood glucose in the overnight fasting state, not just after meal ingestion.
  • GLP-1 promotes continued beta cell competence by inhibiting beta cell apoptosis and degeneration, stimulating transcription of genes important for glucose dependent insulin secretion, and by promoting beta-cell neogenesis.
  • numerous groups have reported increased satiety, reduced caloric intake and or weight loss in GLP-1 treated humans.
  • GLP-1 receptor agonists have wide therapeutic applications.
  • the use of GLP-1 as a therapeutic is limited by its very short serum half-life, about 5 minutes in man (Orskov et al, 1993).
  • compositions such as antibodies
  • exhibit extended serum half-lives relative to native GLP-1 and mimic some or all of the biological activities of GLP-1, in both normal and in disease states.
  • the present invention encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a glucagon like peptide-1 receptor (GLP-1 receptor; described in International Publication Nos. WO 93/19175, WO 95/04821, and U.S Patents 5,670,360, 5,846,747, and 6,051,689, each of which are hereby incorporated by reference in their entireties) or a polypeptide fragment or variant of the GLP-1 receptor.
  • GLP-1 receptor glucagon like peptide-1 receptor
  • the invention encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a GLP-1 receptor polypeptide or polypeptide fragment or variant of human GLP-1 receptor such as SEQ ID NO:2.
  • the present invention relates to methods and compositions for preventing, treating or ameliorating a disease or disorder comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that specifically bind to the GLP-1 receptor or a fragment or variant thereof.
  • the present invention relates to methods and compositions for preventing, treating or ameliorating a disease or disorder associated with the GLP-1 receptor function or aberrant the GLP-1 receptor expression, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that specifically bind to the GLP-1 receptor or a fragment or variant thereof.
  • the present invention encompasses methods for using the antibodies of the present invention to treat, prevent, diagnose and/or prognose a metabolic disease or disorder.
  • the present invention encompasses methods for using antibodies of the invention to treat, prevent, diagnose and/or prognose type 1 diabetes, type 2 diabetes, obesity, and hyperglycemia.
  • the present invention encompasses methods for using the antibodies of the present invention to promote satiety and weight loss in a patient.
  • the present invention relates to antibody- based methods and compositions for preventing, treating or ameliorating cardiovascular diseases and disorders.
  • the present invention relates to antibody-based methods and compositions for preventing, treating or ameliorating neurological diseases and conditions such as neurodegenerative disorders (e.g., Alzheimer's disease, Parkinson's disease, Huntington's disease, ALS) and stroke.
  • neurological diseases and conditions such as neurodegenerative disorders (e.g., Alzheimer's disease, Parkinson's disease, Huntington's disease, ALS) and stroke.
  • the invention encompasses methods for using the antibodies of the invention to stimulate cAMP production in cells expressing the GLP-1 receptor, and to stimulate transcription of insulin mRNA and glucose-dependent insulin secretion in pancreatic beta cells and other cell lines expressing the GLP-1 receptor.
  • the invention encompasses methods for using the antibodies of the present invention to promote pancreatic beta cell proliferation and pancreatic islet neogenesis; and/or to inhibit beta cell degeneration and apoptosis.
  • the invention encompasses methods for using the antibodies of the invention to delay gastric emptying and slow small bowel motility.
  • the invention encompasses methods for using the antibodies of the invention to promote neurite outgrowth, inhibit neuronal apoptosis, and reduce amyloid beta-peptide levels in the brain.
  • the invention encompasses methods for using the antibodies of the invention to stimulate proliferation of cells expressing a GLP-1 receptor (e.g., cells of the pancreas, nervous system, heart, kidney, and GI tract).
  • a GLP-1 receptor e.g., cells of the pancreas, nervous system, heart, kidney, and GI tract.
  • Another embodiment of the present invention includes the use of the antibodies of the invention as a diagnostic tool to monitor the expression of GLP-1 receptors.
  • the present invention also encompasses cell lines engineered to express the antibodies of the invention.
  • the present invention encompasses polynucleotides encoding the antibodies of the invention, as well as the corresponding amino acid sequences of the antibodies of the invention. Molecules comprising, or alternatively consisting of, fragments or variants of these antibodies that specifically bind to the GLP-1 receptor polypeptide or fragments or variants thereof are also encompassed by the invention, as are nucleic acid molecules that encode these antibodies and/or molecules.
  • the present invention also provides anti-GLP-1 receptor antibodies which are coupled to a detectable label, such as an enzyme, a fluorescent label, a luminescent label, or a bioluminescent label.
  • the present invention also provides anti-GLP-1 receptor antibodies which are coupled to a therapeutic or cytotoxic agent.
  • the present invention also provides anti-GLP-1 receptor antibodies which are coupled to a radioactive material.
  • the present invention provides antibodies that specifically bind one or more GLP-1 receptor polypeptide and that act as GLP-1 receptor agonists.
  • the antibodies of the invention stimulate cAMP production in cells that express the GLP-1 receptor.
  • the antibodies of the invention stimulate transcription of insulin in pancreatic beta cells.
  • the antibodies of the invention stimulate glucose-dependent insulin secretion in pancreatic beta cells.
  • the antibodies of the invention reduce fasting glucose in diabetic rat and mouse models (e.g., Zucker fatty diabetic rats, db/db mice, and high fat diet-induced diabetic mice). In specific embodiments, the antibodies of the invention improve glucose tolerance in diabetic rat and mouse models.
  • diabetic rat and mouse models e.g., Zucker fatty diabetic rats, db/db mice, and high fat diet-induced diabetic mice.
  • the antibodies of the invention have a longer serum half-life in vivo than GLP-1. In preferred embodiments, the antibodies of the invention have an in vivo serum half-life of greater than 1 day. In preferred embodiments, the antibodies of the invention have an in vivo serum half-life of greater than 10 days. [0023] In further embodiments, the antibodies of the invention have a dissociation constant (K D ) of 10 "7 M or less. In preferred embodiments, the antibodies of the invention have a dissociation constant (KD) of 10 "9 M or less.
  • antibodies of the invention have an off rate (k o ff) of 10 "3 /sec or less. In preferred embodiments, antibodies of the invention have an off rate (k off ) of lO ⁇ /sec or less. In other preferred embodiments, antibodies of the invention have an off rate (k 0ff ) of 10 "5 /sec or less.
  • the present invention also provides panels of antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants) wherein the panel members correspond to one, two, three, four, five, ten, fifteen, twenty, or more different antibodies of the invention (e.g., whole antibodies, Fabs, F(ab') 2 fragments, Fd fragments, disulfide-linked Fvs (sdFvs), anti-idiotypic (anti-Id) antibodies, and scFvs).
  • antibodies including molecules comprising, or alternatively consisting of, antibody fragments or variants
  • the panel members correspond to one, two, three, four, five, ten, fifteen, twenty, or more different antibodies of the invention (e.g., whole antibodies, Fabs, F(ab') 2 fragments, Fd fragments, disulfide-linked Fvs (sdFvs), anti-idiotypic (anti-Id) antibodies, and scFvs).
  • the present invention further provides mixtures of antibodies, wherein the mixture corresponds to one, two, three, four, five, ten, fifteen, twenty, or more different antibodies of the invention (e.g., whole antibodies, Fabs, F(ab') 2 fragments, Fd fragments, disulfide- linked Fvs (sdFvs), anti-idiotypic (anti-Id) antibodies, and scFvs)).
  • the present invention also provides for compositions comprising, or alternatively consisting of, one, two, three, four, five, ten, fifteen, twenty, or more antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof).
  • a composition of the invention may comprise, or alternatively consist of, one, two, three, four, five, ten, fifteen, twenty, or more amino acid sequences of one or more antibodies or fragments or variants thereof.
  • a composition of the invention may comprise, or alternatively consist of, nucleic acid molecules encoding one or more antibodies of the invention.
  • the present invention also provides for fusion proteins comprising an antibody (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) of the invention, and a heterologous polypeptide (i.e., a polypeptide unrelated to an antibody or antibody domain). Nucleic acid molecules encoding these fusion proteins are also encompassed by the invention.
  • a composition of the present invention may comprise, or alternatively consist of, one, two, three, four, five, ten, fifteen, twenty or more fusion proteins of the invention.
  • a composition of the invention may comprise, or alternatively consist of, nucleic acid molecules encoding one, two, three, four, five, ten, fifteen, twenty or more fusion proteins of the invention.
  • the present invention also provides for a nucleic acid molecule(s), generally isolated, encoding an antibody (including molecules, such as scFvs, VH domains, or VL domains, that comprise, or alternatively consist of, an antibody fragment or variant tliereof) of the invention.
  • the present invention also provides a host cell transformed with a nucleic acid molecule of the invention and progeny thereof.
  • the present invention also provides a method for the production of an antibody (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof) of the invention.
  • the present invention further provides a method of expressing an antibody (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof) of the invention from a nucleic acid molecule.
  • GLP-1 receptor refers to the polypeptide, or portions thereof, corresponding to the amino acid sequence of SEQ ID NO:2, as well as polynucleotides encoding the GLP-1 receptor polypeptides, such as the nucleic acid sequence of SEQ ID NO:l, and portions thereof.
  • GLP-1 receptor encompasses numerous variant polypeptide sequences known in the art.
  • variant GLP-1 receptor polypeptides include those disclosed in GenBank Accession Nos: AAA17021, AAA03614, AAC50050, AAA62471, AAA63787, P43220, as well polynucleotides encoding these variant GLP-1 receptor polypeptides.
  • variant GLP-1 receptor polypeptides contain an amino acid substitution at one or more of the following residues of SEQ ID NO:2 : Leu-12, Arg-44, Arg-131, Ser-136, Pro-137, Gly-151, Gln-221, Phe-260, Tyr-289, and Gly-316.
  • antibody refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that specifically binds an antigen. As such, the term antibody encompasses not only whole antibody molecules, but also antibody multimers and antibody fragments as well as variants (including derivatives) of antibodies, antibody multimers and antibody fragments.
  • antibody examples include, but are not limited to: single chain Fvs (scFvs), Fab fragments, Fab' fragments, F(ab') 2 , disulfide linked Fvs (sdFvs), Fvs, and fragments comprising or alternatively consisting of, either a VL or a VH domain.
  • scFvs single chain Fvs
  • Fab fragments fragments
  • Fab' fragments fragments
  • F(ab') 2 disulfide linked Fvs
  • Fvs fragments comprising or alternatively consisting of, either a VL or a VH domain.
  • sdFvs disulfide linked Fvs
  • Fvs fragments comprising or alternatively consisting of, either a VL or a VH domain.
  • antibodies that specifically bind to the GLP-1 receptor do not cross-react with other antigens (e.g., other members of the PACAP/glucagon receptor superfamily. See, e.g., Sherwood et al., Endocrine Reviews 21(6):619-670.
  • Antibodies that specifically bind to the GLP-1 receptor can be identified, for example, by immunoassays or other techniques known to those of skill in the art.
  • Antibodies of the invention include, but are not limited to, monoclonal, multispecific, human or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), intracellularly-made antibodies (i.e., intrabodies), and epitope-binding fragments of any of the above.
  • the immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG ls IgG 2 , IgG 3 , IgG 4 , IgAi and IgA ) or subclass of immunoglobulin molecule.
  • the immunoglobulin is an IgGi isotype.
  • the immunoglobulin is an IgG4 isotype.
  • Immunoglobulins may have both a heavy and light chain.
  • Antibodies of the invention may also include multimeric forms of antibodies.
  • antibodies of the invention may take the fonn of antibody dimers, trimers, or higher-order multimers of monomeric immunoglobulin molecules. Dimers of whole immunoglobulin molecules or of F(ab')2 fragments are tetravalent, whereas dimers of Fab fragments or scFv molecules are bivalent.
  • Individual monomers withon an antibody multimer may be identical or different, i.e., they may be heteromeric or homomeric antibody multimers. For example, individual antibodies within a multimer may have the same or different binding specificities.
  • Multimerization of antibodies may be accomplished through natural aggregation of antibodies or through chemical or recombinant linking techniques known in the art. For example, some percentage of purified antibody preparations (e.g., purified IgGi molecules) spontaneously form protein aggregates containing antibody horiiodimers, and other higher-order antibody multimers. Alternatively, antibody homodimers may be formed through chemical linkage techniques known in the art.
  • heterobifunctional crosslinking agents including, but not limited to, SMCC [succinimidyl 4-(maleimidomethyl)cyclohexane-l-carboxylate] and SATA [N-succinimidyl S- acethylthio-acetate] (available, for example, from Pierce Biotechnology, Inc. (Rockford, IL)) can be used to form antibody multimers.
  • SMCC succinimidyl 4-(maleimidomethyl)cyclohexane-l-carboxylate
  • SATA N-succinimidyl S- acethylthio-acetate
  • An exemplary protocol for the formation of antibody homodimers is given in Ghetie et al., Proceedings of the National Academy of Sciences USA (1997) 94:7509-7514, which is hereby incorporated by reference in its entirety.
  • Antibody homodimers can be converted to Fab'2 homodimers through digestion with pepsin.
  • antibody homodimers Another way to form antibody homodimers is through the use of the autophilic T15 peptide described in Zhao and Kohler, The Journal of Immunology (2002) 25:396-404, which is hereby incorporated by reference in its entirety.
  • antibodies can be made to multimerize through recombinant DNA techniques. IgM and IgA naturally form antibody multimers through the interaction with the J chain polypeptide.
  • Non-IgA or non-IgM molecules such as IgG molecules
  • IgG molecules can be engineered to contain the J chain interaction domain of IgA or IgM, thereby conferring the ability to form higher order multimers on the non-IgA or non-IgM molecules, (see, for example, Chintalacharuvu et al., (2001) Clinical Immunology 101:21-31.
  • ScFv dimers can also be formed through recombinant techniques known in the art; an example of the construction of scFv dimers is given in Goel et al, (2000) Cancer Research 60:6964-6971 which is hereby incorporated by reference in its entirety.
  • Antibody multimers may be purified using any suitable method known in the art, including, but not limited to, size exclusion chromatography.
  • isolated antibody is intended an antibody removed from its native environment. Thus, an antibody produced by, purified from and/or contained within a hybridoma and/or a recombinant host cell is considered isolated for purposes of the present invention.
  • specific binding or immunospecifc binding by an anti-GLP-1 receptor antibody means that the anti-GLP-1 receptor antibody binds the GLP-1 receptor but does not significantly bind to (i.e., cross- react with) proteins other than the GLP-1 receptor, such as other proteins in the same family of proteins.
  • an antibody that binds the GLP-1 receptor protein and does not cross- react with other proteins is not necessarily an antibody that does not bind said other proteins in all conditions; rather, the GLP-1 receptor-specific antibody of the invention preferentially binds the GLP-1 receptor compared to its ability to bind said other proteins such that it will be suitable for use in at least one type of assay or treatment, i.e., give low background levels or result in no unreasonable adverse effects in treatment. It is well known that the portion of a protein bound by an antibody is known as the epitope.
  • An epitope may either be linear (i.e., comprised of sequential amino acids residues in a protein sequences) or conformational (i.e., comprised of one or more amino acid residues that are not contiguous in the primary structure of the protein but that are brought together by the secondary, tertiary or quaternary structure of a protein).
  • GLP-1 receptor-specific antibodies bind to epitopes of the GLP-1 receptor
  • an antibody that specifically binds the GLP-1 receptor may or may not bind fragments of the GLP-1 receptor and/or variants of the GLP-1 receptor (e.g., proteins that are at least 90% identical to the GLP-1 receptor) depending on the presence or absence of the epitope bound by a given GLP-1 receptor-specific antibody in the GLP-1 receptor fragment or variant.
  • GLP-1 receptor-specific antibodies of the invention may bind species orthologues of the GLP-1 receptor (including fragments thereof) depending on the presence or absence of the epitope recognized by the antibody in the orthologue.
  • GLP-1 receptor-specific antibodies of the invention may bind modified forms of the GLP-1 receptor.
  • Antibodies that specifically bind to the GLP-1 receptor can be identified, for example, by immunoassays or other techniques known to those of skill in the art, e.g., the immunoassays described in the Examples below.
  • variant refers to a polypeptide that possesses a similar or identical amino acid sequence as a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, an anti-GLP-1 receptor antibody or antibody fragment thereof.
  • a variant having a similar amino acid sequence refers to a polypeptide that satisfies at least one of the following: (a) a polypeptide comprising, or alternatively consisting of, an amino acid sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the amino acid sequence of a GLP-1 receptor polypeptide, a fragment thereof, an anti-GLP-1 receptor antibody or antibody fragment thereof (including a VH domain, VHCDR, VL domain, or VLCDR) described herein; (b) a polypeptide encoded by a nucleotide sequence, the complementary sequence of which hybridizes under stringent conditions to a nucleotide sequence encoding a GLP-1 receptor polypeptide (e.g., SEQ ID NO:l), a fragment of a G
  • a polypeptide with similar structure to a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, an anti- GLP-1 receptor antibody or antibody fragment thereof, described herein refers to a polypeptide that has a similar secondary, tertiary or quaternary structure of a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, an anti-GLP-1 receptor antibody, or antibody fragment thereof, described herein.
  • the structure of a polypeptide can be determined by methods known to those skilled in the art, including but not limited to, X-ray crystallography, nuclear magnetic resonance, and crystallographic electron microscopy.
  • a variant GLP-1 receptor polypeptide, a variant fragment of a GLP-1 receptor polypeptide, or a variant anti-GLP-1 receptor antibody and/or antibody fragment possesses similar or identical function and/or structure as the reference GLP-1 receptor polypeptide, the reference fragment of a GLP-1 receptor polypeptide, or the reference anti-GLP-1 receptor antibody and/or antibody fragment, respectively.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence).
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, then the molecules are identical at that position.
  • the determination of percent identity between two sequences can be accomplished using a mathematical algorithm known to those of skill in the art.
  • An example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-2268(1990), modified as in Karlin and Altschul Proc. Natl Acad. Sci. USA 90:5873-5877(1993).
  • the BLASTn and BLASTx programs of Altschul, et al. J. Mol. Biol. 215:403-410(1990) have incorporated such an alogrithm.
  • Gapped BLAST can be utilized as described in Altschul et al. Nucleic Acids Res. 25:3589-3402(1997).
  • PSI-BLAST can be used to perform an iterated search which detects distant relationships between molecules (Id.).
  • derivative refers to a variant polypeptide of the invention that comprises, or alternatively consists of, an amino acid sequence of a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an antibody of the invention that specifically binds to a GLP-1 receptor polypeptide, which has been altered by the introduction of amino acid residue substitutions, deletions or additions.
  • derivative as used herein also refers to a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an antibody that specifically binds to a GLP-1 receptor polypeptide which has been modified, e.g., by the covalent attachment of any type of molecule to the polypeptide.
  • a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an anti-GLP-1 receptor antibody may be modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc.
  • a derivative of a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an anti-GLP- 1 receptor antibody may be modified by chemical modifications using techniques known to those of skill in the art, including, but not limited to, specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Further, a derivative of a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an anti- GLP-1 receptor antibody, may contain one or more non-classical amino acids.
  • a polypeptide derivative possesses a similar or identical function as a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an anti-GLP-1 receptor antibody, described herein.
  • fragment refers to a polypeptide comprising an amino acid sequence of at least 5 amino acid residues, at least 10 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 30 amino acid residues, at least 35 amino acid residues, at least 40 amino acid residues, at least 45 amino acid residues, at least 50 amino acid residues, at least 60 amino residues, at least 70 amino acid residues, at least 80 amino acid residues, or at least 90 amino acid residues, of the amino acid sequence of GLP-1 receptor, or an anti-GLP-1 receptor antibody (including molecules such as scFv's, that comprise, or alternatively consist of, antibody fragments or variants thereof) that specifically binds to GLP-1 receptor.
  • host cell refers to the particular subject cell transfected with a nucleic acid molecule and the progeny or potential progeny of such a cell. Progeny may not be identical to the parent cell transfected with the nucleic acid molecule due to mutations or environmental influences that may occur in succeeding generations or integration of the nucleic acid molecule into the host cell genome.
  • the basic antibody structural unit is known to comprise a tetramer.
  • Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light” (about 25 kDa) and one "heavy" chain (about 50-70 kDa).
  • the amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
  • the carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.
  • Human light chains are classified as kappa and lambda light chains.
  • Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. See generally, Fundamental Immunology Ch. 7 (Paul, W., ed., 2nd ed. Raven Press, N.Y. (1989)) (incorporated by reference in its entirety for all purposes).
  • the variable regions of each light/heavy chain pair form the antibody binding site.
  • an intact IgG antibody has two binding sites. Except in bifunctional or bispecific antibodies, the two binding sites are the same.
  • the chains all exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions, also called complementarity determimng regions or CDRs.
  • the CDRs from the heavy and the ligt chains of each pair are aligned by the framework regions, enabling binding to a specific epitope.
  • both light and heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.
  • the assignment of amino acids to each domain is in accordance with the definitions of Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia & Lesk J Mol. Biol. 196:901-917 (1987); Chothia et al. Nature 342:878-883 (1989).
  • a bispecific or bifunctional antibody is an artificial hybrid antibody having two different heavy/light chain pairs and two different binding sites.
  • Bispecific antibodies can be produced by a variety of methods including fusion of hybridomas or linking of Fab' fragments. See, e.g., Songsivilai & Lachmann Clin. Exp. Immunol. 79: 315-321 (1990), Kostelny et al. J Immunol. 148:1547 1553 (1992).
  • bispecific antibodies may be formed as "diabodies” (Holliger et al. "'Diabodies': small bivalent and bispecific antibody fragments” PNAS USA 90:6444-6448 (1993)) or "Janusins" (Traunecker et al.
  • bispecific single chain molecules target cytotoxic lymphocytes on HIV infected cells
  • EMBO J 10:3655-3659 (1991) and Traunecker et al. “Janusin: new molecular design for bispecific reagents” Int. J. Cancer Suppl. 7:51-52 (1992)).
  • Production of bispecific antibodies can be a relatively labor intensive process compared with production of conventional antibodies and yields and degree of purity are generally lower for bispecific antibodies.
  • Bispecific antibodies do not exist in the form of fragments having a single binding site (e.g., Fab, Fab', and Fv).
  • scFvs single chain antibody molecules
  • GLP-1 receptor or fragments or variants thereof.
  • Molecules comprising, or alternatively consisting of, fragments or variants of these scFvs (e.g., including VH domains, VH CDRs, VL domains, or VL CDRs), that specifically bind to GLP-1 receptor polypeptides (or fragments or variants thereof) are also encompassed by the invention, as are nucleic acid molecules that encode these scFvs, and/or molecules.
  • the present invention provides antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a polypeptide or a polypeptide fragment of the GLP-1 receptor.
  • SCFvs may routinely be "converted" to immunoglobulin molecules by inserting, for example, the nucleotide sequences encoding the VH and/or VL domains of the scFv into an expression vector containing the constant domain sequences and engineered to direct the expression of the immunoglobulin molecule, as described in more detail in Example 2 below.
  • the invention provides antibodies that comprise the VH and VL domains of scFvs of the invention.
  • the present invention encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a GLP-1 receptor polypeptide or a fragment or variant thereof.
  • a GLP-1 receptor polypeptide includes, but is not limited to, the GLP-1 receptor (SEQ ID NO:2).
  • the GLP-1 receptor may be produced through recombinant expression of nucleic acids encoding the polypeptides of SEQ ID NO:2.
  • Antibodies of the invention may specifically bind the GLP-1 receptor as well as fragments and variants thereof, and are described in more detail below.
  • Antibodies of the present invention bind the GLP-1 receptor polypeptide, or fragments or variants thereof.
  • the following section describes in more detail the GLP-1 receptor polypeptides, fragments and variants that antibodies of the invention may bind.
  • the antibodies of the present invention specifically bind the GLP-1 receptor polypeptide.
  • An antibody that specifically binds the GLP-1 receptor may, in some embodiments, bind fragments, variants (including species orthologs and allelic variants of the GLP-1 receptor), multimers or modified forms of the GLP-1 receptor.
  • an antibody specific for the GLP-1 receptor may bind the GLP-1 receptor moiety of a fusion protein comprising all or a portion of the GLP-1 receptor.
  • Antibodies that bind GLP-1 receptor polypeptides may bind them as isolated polypeptides, in their naturally occurring state, and/or their native conformation.
  • antibodies of the present invention may bind recombinantly produced GLP-1 receptor.
  • Antibodies of the present invention may also bind GLP-1 receptor polypeptides purified from a cell culture, wherein said GLP-1 receptor polypeptides are encoded by a polynucleotide encoding amino acids 1 to 463 of SEQ ID NO:2 operably associated with a regulatory sequence that controls expression of said polynucleotide.
  • Antibodies of the present invention may bind GLP-1 receptor polypeptide fragments comprising or alternatively, consisting of, an amino acid sequence contained in SEQ ID NO:2, or encoded by nucleic acids which hybridize (e.g., under stringent hybridization conditions) to the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:2.
  • Protein fragments may be "free-standing," or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region.
  • Antibodies of the present invention may bind polypeptide fragments, including, for example, fragments that comprise or alternatively, consist of from about amino acid residues: 1 to 23, 24 to 145, 146 to 168, 169 to 176, 177 to 196, 197 to 227, 228 to 252, 253 to 264, 265 to 288, 289 to 303, 304 to 329, 330 to 351, 352 to 372, 373 to 387, 388 to 408, 409 to 463 of SEQ ID NO:2.
  • polypeptide fragments that antibodies of the invention may bind can be at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, or 460 amino acids in length.
  • about includes the particularly recited value, larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes.
  • antibodies of the present invention bind a polypeptide comprising, or alternatively consisting of, an extracellular domain of the GLP-1 receptor (from about amino acid residues 24 to 145, 197 to 227, 289 to 303, and 373 to 387 of SEQ ID NO:2), [0058]
  • the antibodies of the invention prevent the GLP-1 receptor from binding to GLP-1.
  • the antibodies of the invention that bind the GLP-1 receptor mimic some or all of the activities of GLP-1.
  • the antibodies of the invention that bind the GLP-1 receptor stimulate cAMP production in cells expressing the GLP-1 receptor.
  • the antibodies of the invention that bind the GLP-1 receptor stimulate transcription of insulin in pancreatic beta cells. In other highly preferred embodiments, the antibodies of the invention that bind the GLP-1 receptor stimulate glucose-dependent insulin secretion in pancreatic beta cells. In other highly preferred embodiments, the antibodies of the invention that bind the GLP-1 receptor reduces fasting glucose and improves glucose tolerance in diabetic rat and mouse models.
  • Antibodies of the invention may also bind fragments comprising, or alternatively, consisting of structural or functional attributes of the GLP-1 receptor.
  • Such fragments include amino acid residues that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet-forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions"), coil and coil-forming regions ("coil-regions”), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, surface forming regions, and high antigenic index regions (i.e., containing four or more contiguous amino acids having an antigenic index of greater than or equal to 1.5, as identified using the default parameters of the Jameson- Wolf program) of complete (i.e., full-length) GLP-1 receptor.
  • Certain preferred regions are those set out in Table 2 and include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence depicted in SEQ ID NO:2, such preferred regions include; Garnier-Robson predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted alpha-regions, beta-regions, and turn-regions; Kyte-Doolittle predicted hydrophilic regions; Eisenberg alpha and beta amphipathic regions; Emini surface-forming regions; and Jameson- Wolf high antigenic index regions, as predicted using the default parameters of these computer programs.
  • the data presented in columns VIII, XIII, and XIV of Table 2 can be used to determine regions of the GLP-1 receptor which exhibit a high degree of potential for antigenicity. Regions of high antigenicity are determined from the data presented in columns VIII, XIII, and/or XIV by choosing values which represent regions of the polypeptide which are likely to be exposed on the surface of the polypeptide in an environment in which antigen recognition may occur in the process of initiation of an immune response.
  • the above-mentioned preferred regions set out in Table 2 include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set out in SEQ ID NO:2.
  • such preferred regions include Garnier-Robson alpha-regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and turn-regions, Kyte-Doolittle hydrophilic regions, Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Jameson- Wolf regions of high antigenic index and Emini surface-forming regions.
  • polypeptide fragments bound by one or more antibodies of the invention are those that comprise regions of the GLP-1 receptor that combine several structural features, such as several (e.g., 1, 2, 3 , or 4) of the same or different region features set out above and in Table 2.
  • O fc p0 fc t, S" 3 3 -- £5 p0 > J WI ⁇ - t. o 3 3 C 3 2 i w &O J fc H ⁇ ⁇ ⁇ w O O O O oQ j - ⁇ l O - ⁇ ai Ki fc O O O H-l H -l fc j > ⁇ O ro O OI CN O CN CTN Tf C ⁇ O Tf CN CN rO rn fc CN m en - ⁇ ⁇ f N ⁇ en cN en ⁇ f eo cN CN ⁇ H ⁇ H -- ⁇ ,_ ⁇ ,_ ⁇ ⁇ — ⁇ *— ⁇ co co »n co *n »n x ⁇ o o o o o o o o o o o o o o o o o o o o o o o o
  • the invention provides an antibody that binds a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide described herein.
  • the epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide of the invention.
  • An "immunogenic epitope" is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen.
  • a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen et al, Proc. Natl. Acad. Sci. USA 81:399%- 4002 (1983).
  • Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins nor to the amino or carboxyl terminals.
  • Antigenic epitope-bearing peptides and polypeptides are therefore useful to raise antibodies, including monoclonal antibodies, that bind to a GLP-1 receptor polypeptide. See, for instance, Wilson et al, Cell 57:767-778 (1984) at 777.
  • Antigenic epitope-bearing peptides and polypeptides preferably contain a sequence of at least seven, more preferably at least nine and most preferably between at least about 15 to about 30 amino acids contained within the amino acid sequence of SEQ ID NO:2.
  • Antibodies of the invention may bind one or more antigenic GLP-1 receptor polypeptides or peptides.
  • Epitope-bearing GLP-1 receptor peptides and polypeptides may be produced by any conventional means. Houghten, R.A., "General method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids," Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985). This "Simultaneous Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,211 to Houghten et al. (1986).
  • SMPS Simultaneous Multiple Peptide Synthesis
  • GLP-1 receptor polypeptides and the epitope-bearing fragments thereof described herein can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulins
  • These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al, Nature 331:84- 86 (1988)).
  • Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric GLP-1 receptor protein or protein fragment alone (Fountoulakis et al, J Biochem 270:3958-3964 (1995)).
  • antibodies of the invention may bind fusion proteins that comprise all or a portion of a GLP-1 receptor polypeptide.
  • Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or "muteins" including single or multiple amino acid substitutions, deletions, additions or fusion proteins.
  • modified polypeptides can show, e.g., enhanced activity or increased stability.
  • they may be purified in higher yields and show better solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions.
  • Antibodies of the present invention may also bind such modified GLP-1 receptor polypeptides or GLP-1 receptor polypeptide fragments or variants.
  • the present invention further provides antibodies that bind polypeptides having one or more residues deleted from the amino terminus of the GLP-1 receptor amino acid sequence of SEQ ID NO:2 and polynucleotides encoding such polypeptides.
  • the present invention provides antibodies that bind polypeptides comprising the amino acid sequence of residues n 1 -463 of SEQ ID NO:2, where n 1 is an integer from 2 to 458 corresponding to the position of the amino acid residue in SEQ ID NO:2.
  • the invention provides antibodies that bind polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of: A-2 to S-463; G-3 to S-463; A-4 to S-463; P-5 to S-463; G-6 to S-463; P-7 to S-463; L-8 to S- 463; R-9 to S-463; L-10 to S-463; A-ll to S-463; L-12 to S-463; L-13 to S-463; L-14 to S-463; L-15 to S-463; G-16 to S-463; M-17 to S-463; V-18 to S-463; G-19 to S-463; R-20 to S-463; A-21 to S-463; G-22 to S-463; P-23 to S-463; R-24 to S-463; P-25 to S-463; Q- 26 to S-463; G-27 to S-463; A-28 to S-463; T-29 to S-463; V-30 to S-463; S-31 to S-463
  • antibodies of the invention bind C-terminal deletions of the GLP-1 receptor polypeptide that can be described by the general formula 1-m 1 where m 1 is a number from 7 to 462 corresponding to the amino acid sequence identified of SEQ ID NO:2.
  • the invention provides antibodies that bind GLP-1 receptor polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues: M-l to C-462; M-l to S-461; M-l to A-460; M-l to Q-459; M-l to C-458; M- 1 to T-457; M-l to A-456; M-l to T-455; M-l to Y-454; M-l to M-453; M-l to S-452; M- 1 to S-451; M-l to G-450; M-l to A-449; M-l to T-448; M-l to A-447; M-l to G-446; M- 1 to S-445; M-l to S-444; M-l to L-443; M-l to S-442; M-l to S-441; M-l to T-440; M-l to P-439; M-l to C-438; M-l to K-437; M-l to L-436;
  • the invention also provides antibodies that bind polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini of a GLP-1 receptor polypeptide, which may be described generally as having residues n 1 - m 1 of SEQ ID NO:2, where n 1 and m 1 are integers as described above.
  • the invention further includes antibodies that bind variations of the GLP- 1 receptor protein which show substantial GLP-1 receptor protein activity or which include regions of GLP-1 receptor such as the protein fragments discussed below.
  • Such mutants include deletions, insertions, inversions, repeats, and type substitution.
  • Guidance concerning which amino acid changes are likely to be phenotypically silent can be found in Bowie, J.U. et al, Science 247:1306-1310 (1990).
  • antibodies of the present invention may bind a fragment, derivative, or analog of the polypeptide of SEQ ID NO:2.
  • Such fragments, variants or derivatives may be (i) one in which at least one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue(s), and more preferably at least one but less than ten conserved amino acid residues) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as an IgG Fc fusion region peptide or leader or secretory sequence or a sequence which is employed for purification of
  • the replacement of amino acids can also change the selectivity of binding to cell surface receptors. Ostade et al, Nature 361:266-268 (1993) describes certain mutations resulting in selective binding of TNF-alpha to only one of the two known types of TNF receptors.
  • the antibodies of the present invention may bind a GLP-1 receptor that contains one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation.
  • changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (see Table 3).
  • the number of substitutions, additions or deletions in the amino acid sequence of SEQ ID NO: 2 and or any of the polypeptide fragments described herein is 75, 70, 60, 50, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 30- 20, 20-15, 20-10, 15-10, 10-1, 5-10, 1-5, 1-3 or 1-2.
  • Amino acids in the GLP-1 receptor protein of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alar ⁇ ne-scanning mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro, or in vivo proliferative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol. Biol.
  • antibodies of the present invention bind regions of the GLP-1 receptor that are essential for GLP-1 receptor function. In other preferred embodiments, antibodies of the present invention bind regions of GLP-1 receptor that are essential for GLP-1 receptor function and enhance GLP-1 receptor function.
  • Non-naturally occurring variants of the GLP-1 receptor may be produced using art-known mutagenesis techniques, which include, but are not limited to oligonucleotide mediated mutagenesis, alanine scanning, PCR mutagenesis, site directed mutagenesis (see e.g., Carter et al, Nucl Acids Res. 75:4331 (1986); and Zoller et al, Nucl Acids Res. 10:6487 (1982)), cassette mutagenesis (see e.g., Wells et al, Gene 34:315 (1985)), restriction selection mutagenesis (see e.g., Wells et al, Philos. Trans. R. Soc. London Ser A 317:4 5 (1986)).
  • art-known mutagenesis techniques include, but are not limited to oligonucleotide mediated mutagenesis, alanine scanning, PCR mutagenesis, site directed mutagenesis (see e.g., Carter
  • the invention also encompasses antibodies that bind GLP-1 receptor derivatives and analogs that have one or more amino acid residues deleted, added, and/or substituted to generate GLP-1 receptor polypeptides that have better binding activity, better therapeutic activity, are expressed better, or are better suited to scale up, etc., in the host cells chosen.
  • cysteine residues can be deleted or substituted with another amino acid residue in order to eliminate disulfide bridges; N-linked glycosylation sites can be altered or eliminated to achieve, for example, expression of a homogeneous product that is more easily recovered and purified from yeast hosts which are known to hyperglycosylate N-linked sites.
  • amino acid residues of GLP-1 receptor polypeptides may be deleted or substituted with another residue to eliminate undesired processing by proteases such as, for example, furins or kexins.
  • a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of a GLP-1 receptor polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to one amino acid alterations per each 20 amino acids of the reference amino acid of the GLP-1 receptor polypeptide.
  • up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those te ⁇ riinal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence shown in SEQ ID NO:2 can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711.
  • Bestfit program Wiconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711.
  • Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
  • the identity between a reference (query) sequence (a sequence of the present invention) and a subject sequence is determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
  • the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence.
  • a determination of whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of this embodiment.
  • the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%.
  • a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-te ⁇ nini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected.
  • the present application is also directed to antibodies that bind proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to the GLP- 1 receptor polypeptide sequence set forth herein as n ⁇ m 1 .
  • the application encompasses antibodies that bind proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the specific GLP-1 receptor N- and C-terminal deletions recited herein.
  • antibodies of the invention bind GLP-1 receptor fusion proteins as described above wherein the GLP-1 receptor portion of the fusion protein are those described as n ⁇ m 1 herein.
  • Antibodies of the Invention May Bind Modified GLP-1 Receptor Polypeptides [0091] It is specifically contemplated that antibodies of the present invention may bind modified forms of the GLP-1 receptor protein.
  • antibodies of the present invention bind GLP-1 receptor polypeptides (such as those described above) including, but not limited to naturally purified GLP-1 receptor polypeptides, GLP-1 receptor polypeptides produced by chemical synthetic procedures, and GLP-1 receptor polypeptides produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells using, for example, the recombinant compositions and methods described above. Depending upon the host employed in a recombinant production procedure, the polypeptides may be glycosylated or non- glycosylated.
  • GLP-1 receptor polypeptides may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • GLP-1 receptor proteins that antibodies of the present invention may bind can be chemically synthesized using techniques known in the art (e.g., see Creighton, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y. (1983), and Hunkapiller, et al, Nature 370:105-111 (1984)).
  • a peptide corresponding to a fragment of a GLP-1 receptor polypeptide can be synthesized by use of a peptide synthesizer.
  • nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the GLP-1 receptor polypeptide sequence.
  • Non-classical amino acids include, but are not limited to, to the D- isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4- aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3 -amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitralline, cysteic acid, t-butylglycine, t- butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer
  • the invention additionally, encompasses antibodies that bind GLP-1 receptor polypeptides which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited to, specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBE ⁇ acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin; etc.
  • GLP-1 receptor polypeptides include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of procaryotic host cell expression.
  • the polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • antibodies that bind chemically modified derivatives of GLP-1 receptor polypeptide which may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U. S. Patent No. 4,179,337).
  • the chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
  • the polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.
  • the polymer may be of any molecular weight, and may be branched or unbranched.
  • the preferred molecular weight is between about 1 kDa and about 100 kDa (the term "about” indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing.
  • Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
  • the polyethylene glycol may have an average molecular weight of about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa.
  • the polyethylene glycol may have a branched structure.
  • Branched polyethylene glycols are described, for example, in U.S. Patent No. 5,643,575; Morpurgo et al, Appl. Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al, Nucleosides Nucleotides 75:2745-2750 (1999); and Caliceti et al, Bioconjug. Chem. 10:638-646 (1999), the disclosures of each of which are inco ⁇ orated herein by reference.
  • the polyethylene glycol molecules should be attached to the protein with consideration of effects on functional or antigenic domains of the protein.
  • polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group.
  • Reactive groups are those to which an activated polyethylene glycol molecule may be bound.
  • the amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues, glutamic acid residues and the C-terminal amino acid residue.
  • Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules. Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group.
  • polyethylene glycol may be attached to proteins via linkage to any of a number of amino acid residues.
  • polyethylene glycol can be linked to a proteins via covalent bonds to lysine, histidine, aspartic acid, glutamic acid, or cysteine residues.
  • One or more reaction chemistries may be employed to attach polyethylene glycol to specific amino acid residues (e.g., lysine, histidine, aspartic acid, glutamic acid, or cysteine) of the protein or to more than one type of amino acid residue (e.g., lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations thereof) of the protein.
  • polyethylene glycol as an illustration of the present composition, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein.
  • the method of obtaining the N-terminally pegylated preparation i.e., separating this moiety from other monopegylated moieties if necessary
  • Selective proteins chemically modified at the N-terminus modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N- terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.
  • pegylation of the proteins of the invention may be accomplished by any number of means.
  • polyethylene glycol may be attached to the protein either directly or by an intervening linker.
  • Linkerless systems for attaching polyethylene glycol to proteins are described in Delgado et al, Crit. Rev. Ther a. Drug Carrier Sys. 9:249-304 (1992); Francis et al, Intern. J. of Hematol. 68:1-18 (1998); U.S. Patent No. 4,002,531; U.S. Patent No. 5,349,052; WO 95/06058; and WO 98/32466, the disclosures of each of which are incorporated herein by reference.
  • One system for attaching polyethylene glycol directly to amino acid residues of proteins without an intervening linker employs tresylated MPEG, which is produced by the modification of monmethoxy polyethylene glycol (MPEG) using tresylchloride (ClSO CH 2 CF 3 ).
  • MPEG monmethoxy polyethylene glycol
  • ClSO CH 2 CF 3 tresylchloride
  • polyethylene glycol is directly attached to amine groups of the protein.
  • the invention includes protein- polyethylene glycol conjugates produced by reacting proteins of the invention with a polyethylene glycol molecule having a 2,2,2 -trifluoreothane sulphonyl group.
  • Polyethylene glycol can also be attached to proteins using a number of different intervening linkers. For example, U.S.
  • Patent No. 5,612,460 discloses urethane linkers for connecting polyethylene glycol to proteins.
  • Protein-polyethylene glycol conjugates wherein the polyethylene glycol is attached to the protein by a linker can also be produced by reaction of proteins with compounds such as MPEG-succinimidylsuccinate, MPEG activated with l,r-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate, MPEG-p- nitrophenolcarbonate, and various MPEG-succinate derivatives.
  • the number of polyethylene glycol moieties attached to each GLP-1 receptor polypeptide may also vary.
  • the pegylated proteins of the invention may be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules.
  • the average degree of substitution within ranges such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11- 13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per protein molecule.
  • the antibodies of the present invention may bind GLP-1 receptor polypeptides that are modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given GLP-1 receptor polypeptide.
  • GLP-1 receptor polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic GLP-1 receptor polypeptides may result from posttranslation natural processes or may be made by synthetic methods.
  • Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.
  • the present invention also provides for nucleic acid molecules, generally isolated, encoding an antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof).
  • the present invention also provides antibodies that comprise, or alternatively consist of, variants (including derivatives) of the antibody molecules described herein, which antibodies specifically bind to GLP-1 receptor or fragment or variant thereof. Standard techniques known to those of skill in the art can be used to introduce mutations in the nucleotide sequence encoding a molecule of the invention, including, for example, site-directed mutagenesis and PCR-mediated mutagenesis which result in amino acid substitutions.
  • the variants encode less than 50 amino acid substitutions, less than 40 amino acid subsitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions relative to the reference VH domain.
  • a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a side chain with a similar charge. Families of amino acid residues having side chains with similar charges have been defined in the art.
  • amino acids with basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid, glutamic acid
  • uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine
  • nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • beta-branched side chains e.g., threonine, valine, isoleucine
  • aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine
  • mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity (e.g., the ability to bind a GLP-1 receptor).
  • mutations can be introduced only in framework regions or only in CDR regions of an antibody molecule. Introduced mutations may be silent or neutral missense mutations, i.e., have no, or little, effect on an antibody's ability to bind antigen. These types of mutations may be useful to optimize codon usage, or improve a hybridoma' s antibody production. Alternatively, non-neutral missense mutations may alter an antibody's ability to bind antigen.
  • the location of most silent and neutral missense mutations is likely to be in the framework regions, while the location of most non-neutral missense mutations is likely to be in CDR, though this is not an absolute requirement.
  • One of skill in the art would be able to design and test mutant molecules with desired properties such as no alteration in antigen binding activity or alteration in binding activity (e.g, improvements in antigen binding activity or change in antibody specificity).
  • the encoded protein may routinely be expressed and the functional and/or biological activity of the encoded protein, (e.g., ability to specifically bind the GLP-1 receptor) can be determined using techniques described herein or by routinely modifying techniques known in the art.
  • Antibodies in accordance with the invention are preferably prepared utilizing a phage scFv display library. Technologies utilized for achieving the same are disclosed in the patents, applications, and references disclosed herein.
  • phage display methods functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them.
  • DNA sequences encoding VH and VL domains are amplified from animal cDNA libraries (e.g., human or murine cDNA libraries of lymphoid tissues) or synthetic cDNA libraries.
  • the DNA encoding the VH and VL domains are joined together by an scFv linker by PCR and cloned into a phagemid vector (e.g., p CANTAB 6 or pComb 3 HSS).
  • the vector is electroporated in E. coli and the E. coli is infected with helper phage.
  • Phage used in these methods are typically filamentous phage including fd and Ml 3 and the VH and VL domains are usually recombinantly fused to either the phage gene III or gene VIII.
  • Phage expressing an antigen binding domain that binds to an antigen of interest i.e., a GLP-1 receptor polypeptide or a fragment thereof
  • an antigen of interest i.e., a GLP-1 receptor polypeptide or a fragment thereof
  • Examples of phage display methods that can be used to make the antibodies of the present invention include, but are not limited to, those disclosed in Brinkman et al, J. Immunol. Methods 182:41-50 (1995); Ames et al, J.
  • Antibodies of the invention can be produced by any method known in the art.
  • antibodies in accordance with the present invention can be expressed in cell lines including, but not limited to, myeloma cell lines and hybridoma cell lines.
  • Sequences encoding the cDNAs or genomic clones for the particular antibodies can be used for transformation of a suitable mammalian or nonmammalian host cells or to generate phage display libraries, for example.
  • polypeptide antibodies of the invention may be chemically synthesized or produced through the use of recombinant expression systems.
  • the cloned VH and VL genes may be placed into one or more suitable expression vectors.
  • PCR primers including VH or VL nucleotide sequences, a restriction site, and a flanking sequence to protect the restriction site may be used to amplify the VH or VL sequences.
  • the PCR amplified VH or VL domains may be cloned into vectors expressing the appropriate immunoglobulin constant region, e.g., the human IgGi or IgG4 constant region for VH domains, and the human kappa or lambda constant regions for kappa and lambda VL domains, respectively.
  • the vectors for expressing the VH or VL domains comprise a promoter suitable to direct expression of the heavy and light chains in the chosen expression system, a secretion signal, a cloning site for the immunoglobulin variable domain, immunoglobulin constant domains, and a selection marker such as neomycin.
  • the VH and VL domains may also be cloned into a single vector expressing the necessary constant regions.
  • the heavy chain conversion vectors and light chain conversion vectors are then co-transfected into cell lines to generate stable or transient cell lines that express full-length antibodies, e.g., IgG, using techniques known to those of skill in the art (See, for example, Guo et al., J. Clin. Endocrinol. Metab. 82:925- 31 (1997), and Ames et al., J. Immunol. Methods 184:177-86 (1995) which are herein incorporated in their entireties by reference).
  • the invention provides polynucleotides comprising, or alternatively consisting of, a nucleotide sequence encoding an antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof).
  • the invention also encompasses polynucleotides that hybridize under high stringency, or alternatively, under intermediate or lower stringency hybridization conditions, e.g., as defined supra, to polynucleotides complementary to nucleic acids having a polynucleotide sequence that encodes an antibody of the invention or a fragment or variant thereof.
  • the polynucleotides may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art.
  • nucleotide sequences encoding these antibodies can be determined using methods well known in the art, i.e., the nucleotide codons known to encode the particular amino acids are assembled in such a way to generate a nucleic acid that encodes the antibody, of the invention.
  • Such a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al, BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.
  • a polynucleotide encoding an antibody may be generated from nucleic acid from a suitable source.
  • a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells or Epstein Barr virus transformed B cell lines that express an antibody of the invention) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art.
  • a suitable source e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid,
  • nucleotide sequence of the antibody including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof
  • the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc.
  • chimeric antibodies While chimeric antibodies have a human constant region and a murine variable region, it is expected that certain human anti-chimeric antibody (HACA) responses will be observed, particularly in chronic or multi-dose utilizations of the antibody. Thus, it would be desirable to provide fully human antibodies against GLP-1 receptor polypeptides in order to vitiate concerns and/or effects of HAMA or HACA responses.
  • HACA human anti-chimeric antibody
  • Monoclonal antibodies specific for GLP-1 receptor polypeptides may be prepared using hybridoma technology.
  • Kohler et al. Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 571-681 (1981)).
  • XenoMouseTM mice may be immunized with GLP-1 receptor polypeptides.
  • the splenocytes of such mice may be extracted and fused with a suitable myeloma cell line.
  • a suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP2O), available from the ATCC.
  • SP2O parent myeloma cell line
  • the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981)).
  • the hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the GLP-1 receptor polypetides.
  • human or chimeric antibodies For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use human or chimeric antibodies. Completely human antibodies are particularly desirable for therapeutic treatment of human patients. See also, U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50435, WO 98/24893, WO98/16654, WO 96/34096, WO 96/35735, and WO 91/10741; each of which is incorporated herein by reference in its entirety.
  • antibodies of the present invention comprise one or more VH and VL domains of the invention and constant regions from another immunoglobulin molecule, preferably a human immunoglobulin molecule.
  • antibodies of the present invention comprise one or more CDRs corresponding to the VH and VL domains of the invention and framework regions from another immunoglobulin molecule, preferably a human immunoglobulin molecule.
  • a chimeric antibody is a molecule in which different portions of the antibody are derived from different immunoglobulin molecules such as antibodies having a human variable region and a non-human (e.g., murine) immunoglobulin constant region or vice versa.
  • Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science 229:1202 (1985); Oi et al, BioTechniques 4:214 (1986); Gillies et al, J. Immunol. Methods 125:191-202 (1989); U.S. Patent Nos. 5,807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their entirety.
  • Chimeric antibodies comprising one or more CDRs from human species and framework regions from a non-human immunoglobulin molecule (e.g., framework regions from a murine, canine or feline immunoglobulin molecule) (or vice versa) can be produced using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Patent Nos.
  • framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al, U.S. Patent No. 5,585,089; Riechmann et al, Nature 352:323 (1988), which are incorporated herein by reference in their entireties.)
  • Intrabodies are antibodies, often scFvs, that are expressed from a recombinant nucleic acid molecule and engineered to be retained intracellularly (e.g., retained in the cytoplasm, endoplasmic reticulum, or periplasm). Intrabodies may be used, for example, to ablate the function of a protein to which the intrabody binds. The expression of intrabodies may also be regulated through the use of inducible promoters in the nucleic acid expression vector comprising the intrabody. Intrabodies of the invention can be produced using methods known in the art, such as those disclosed and reviewed in Chen et al, Hum. Gene Ther. 5:595-601 (1994); Marasco, W.A., Gene Ther.
  • an antibody of the invention requires construction of an expression vector(s) containing a polynucleotide that encodes the antibody.
  • an antibody molecule e.g., a whole antibody, a heavy or light chain of an antibody, or portion thereof (preferably, but not necessarily, containing the heavy or light chain variable domain)
  • the vector(s) for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art.
  • the invention thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention (e.g., a whole antibody, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody, or a portion thereof, or a heavy or light chain CDR, a single chain Fv, or fragments or variants thereof), operably linked to a promoter.
  • Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., PCT Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Patent No. 5,122,464, the contents of each of which are hereby incorporated by reference in its entirety) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy chain, the entire light chain, or both the entire heavy and light chains.
  • the expression vector(s) is(are) transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention.
  • the invention includes host cells containing polynucleotide(s) encoding an antibody of the invention (e.g., whole antibody, a heavy or light chain thereof, or portion thereof, or a single chain antibody, or a fragment or variant thereof), operably linked to a heterologous promoter.
  • vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.
  • host-expression vector systems may be utilized to express the antibody molecules of the invention.
  • Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ.
  • These include, but are not limited to, bacteriophage particles engineered to express antibody fragments or variants teherof (single chain antibodies), microorganisms such as bacteria (e.g., E. coli, B.
  • subtilis transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pi chid) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3, NSO cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or
  • bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule.
  • mammalian cells such as Chinese hamster ovary cells (CHO)
  • CHO Chinese hamster ovary cells
  • a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et al, Gene 45:101 (1986); Cockett et al, Bio/Technology 8:2 (1990); Bebbington et al, Bio/Techniques 10:169 (1992); Keen and Hale, Cytotechnology 18:207 (1996)).
  • a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of pharmaceutical compositions of an antibody molecule, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable.
  • vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruther et al, EMBO 1.
  • pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione 5- transferase (GST).
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione agarose beads followed by elution in the presence of free glutathione.
  • the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
  • Autographa californica nuclear polyhedrosis virus may be used as a vector to express foreign genes.
  • the virus grows in Spodoptera frugiperda cells.
  • Antibody coding sequences may be cloned individually into non-essential regions (for example, the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example, the polyhedrin promoter).
  • an AcNPV promoter for example, the polyhedrin promoter
  • the antibody coding sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
  • This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts (e.g., see Logan & Shenk, Proc. Natl. Acad. Sci. USA 8 1:355-359 (1984)).
  • Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see, e.g., Bittner et al, Methods in Enzymol. 153:51-544 (1987)).
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
  • Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
  • eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
  • Such mammalian host cells include, but are not limited to, CHO, VERY, BHK, Hela, COS, NSO, MDCK, 293, 3T3, W138, and in particular, breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT2O and T47D, and normal mammary gland cell line such as, for example, CRL7O3O and HsS78Bst.
  • breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT2O and T47D
  • normal mammary gland cell line such as, for example, CRL7O3O and HsS78Bst.
  • stable expression is preferred.
  • cell lines which stably express the antibody may be engineered.
  • host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
  • appropriate expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
  • engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express the antibody molecule.
  • Such engineered cell lines may be particularly useful in screening and evaluation of compositions that interact directly or indirectly with the antibody molecule.
  • a number of selection systems may be used, including but not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11:223 (1977)), hypoxanthine- guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci.
  • adenine phosphoribosyltransferase genes can be employed in tk-, hgprt- or aprt- cells, respectively.
  • antimetabolite resistance can be used as the basis of selection for the following genes: dhf. i", which confers resistance to methotrexate (Wigler et al, Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al, Proc. Natl. Acad. Sci.
  • Vectors which use glutamine synthase (GS) or DHFR as the selectable markers can be amplified in the presence of the drugs methionine sulphoximine or methotrexate, respectively.
  • An advantage of glutamine synthase based vectors are the availabilty of cell lines (e.g., the murine myeloma cell line, NSO) which are glutamine synthase negative.
  • Glutamine synthase expression systems can also function in glutamine synthase expressing cells (e.g., Chinese Hamster Ovary (CHO) cells) by providing additional inhibitor to prevent the functioning of the endogenous gene.
  • glutamine synthase expression system and components thereof are detailed in PCT publications: WO87/04462; WO86/05807; WO89/01036; WO89/10404; and WO91/06657 which are inco ⁇ orated in their entireties by reference herein.
  • glutamine synthase expression vectors that may be used according to the present invention are commercially available from suplliers, including, for example Lo za Biologies, Inc. (Portsmouth, NH). Expression and production of monoclonal antibodies using a GS expression system in murine myeloma cells is described in Bebbington et al, Bio/technology 10:169(1992) and in Biblia and Robinson Biotechnol. Prog. 11:1 (1995) which are inco ⁇ orated in their entirities by reference herein.
  • the host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide.
  • the two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides.
  • a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides.
  • the light chain is preferably placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl. Acad. Sci. USA 77:2 197 (1980)).
  • the coding sequences for the heavy and light chains may comprise cDNA or genomic DNA.
  • an antibody molecule of the invention including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof
  • it may be purified by any method known in the art for purification of an immunoglobulin molecule, or more generally, a protein molecule, such as, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins.
  • the antibodies of the present invention may be fused to heterologous polypeptide sequences described herein or otherwise known in the art, to facilitate purification.
  • Antibodies of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the antibodies of the present invention may be glycosylated or may be non-giycosylated. In addition, antibodies of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • Antibodies of the invention can be chemically synthesized using techniques known in the art (e.g., see Creighton, 1983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiller, M., et al., 1984, Nature 310:105-111).
  • a peptide corresponding to a fragment of an antibody of the invention can be synthesized by use of a peptide synthesizer.
  • nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the antibody polypeptide sequence.
  • Non-classical amino acids include, but are not limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3 -amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitralline, cysteic acid, t- butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na- methyl amino acids, and amino acid analogs in general. Furthermore,
  • the invention encompasses antibodies which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
  • Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of procaryotic host cell expression.
  • the antibodies may also be modified with a detectable label, such as an enzymatic, fluorescent, radioisotopic or affinity label to allow for detection and isolation of the antibody.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, glucose oxidase or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include biotin, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive material include a radioactive metal ion, e.g., alpha-emitters such as, for example, 213Bi, or other radioisotopes such as, for example, iodine (1311, 1251
  • antibodies of the invention may be labeled with Europium.
  • antibodies of the invention may be labelled with Europium using the DELFIA Eu-labeling kit (catalog# 1244-302, Perkin Elmer Life Sciences, Boston, MA) following manufacturer's instructions.
  • antibodies of the invention are attached to macrocyclic chelators useful for conjugating radiometal ions, including but not limited to, l l lln, 177Lu, 90Y, 166Ho, 153Sm, 215Bi and 225 Ac to polypeptides.
  • the radiometal ion associated with the macrocyclic chelators attached to antibodies of the invention is 11 Hn.
  • the radiometal ion associated with the macrocyclic chelator attached to antibodies polypeptides of the invention is 90 Y.
  • the macrocyclic chelator is 1,4,7,10- tetraazacyclododecane-N,N , ,N",N'"-tetraacetic acid (DOTA).
  • the macrocyclic chelator is D-(5-isothiocyanato-2-methoxyphenyl)- 1,4,7, 10-tetraaza- cyclododecane-l,4,7,10-tetraacetic acid.
  • the DOTA is attached to the antibody of the invention via a linker molecule.
  • linker molecules useful for conjugating a macrocyclic chelator such as DOTA to a polypeptide are commonly known in the art - see, for example, DeNardo et al., Clin Cancer Res. 4(10):2483-90, 1998; Peterson et al., Bioconjug. Chem. 10(4):553-7, 1999; and Zimmerman et al, Nucl. Med. Biol. 26(8):943-50, 1999 which are hereby inco ⁇ orated by reference in their entirety.
  • U.S. Patents 5,652,361 and 5,756,065, which disclose chelating agents that may be conjugated to antibodies, and methods for making and using them, are hereby inco ⁇ orated by reference in their entireties.
  • antibodies of the invention are labeled with biotin.
  • biotinylated antibodies of the invention may be used, for example, as an imaging agent or as a means of identifying one or more TRAIL receptor coreceptor or ligand molecules.
  • chemically modified derivatives of antibodies of the invention which may provide additional advantages such as increased solubility, stability and in vivo or in vitro circulating time of the polypeptide, or decreased immunogenicity (see U. S. Patent No. 4,179,337).
  • the chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
  • the antibodies may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.
  • the polymer may be of any molecular weight, and may be branched or unbranched.
  • the preferred molecular weight is between about 1 kDa and about 100 kDa (the term "about” indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing.
  • Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
  • the polyethylene glycol may have an average molecular weight of about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa.
  • the polyethylene glycol may have a branched structure.
  • Branched polyethylene glycols are described, for example, in U.S. Patent No. 5,643,575; Mo ⁇ urgo et al., Appl. Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al., Nucleosides Nucleotides 18:2745-2750 (1999); and Caliceti et al., Bioconjug. Chem. 10:638-646 (1999), the disclosures of each of which are inco ⁇ orated herein by reference.
  • polyethylene glycol molecules should be attached to the antibody with consideration of effects on functional or antigenic domains of the antibody.
  • attachment methods available to those skilled in the art, e.g., EP 0 401 384, herein inco ⁇ orated by reference (coupling PEG to G-CSF), see also Malik et al., Exp. Hematol. 20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl chloride).
  • polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group.
  • Reactive groups are those to which an activated polyethylene glycol molecule may be bound.
  • the amino acid residues having a free amino group may include, for example, lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues, glutamic acid residues, and the C-terminal amino acid residue.
  • Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules.
  • Preferred for therapeutic pu ⁇ oses is attachment at an amino group, such as attachment at the N-terminus or lysine group.
  • polyethylene glycol may be attached to proteins, e.g., antibodies, via linkage to any of a number of amino acid residues.
  • polyethylene glycol can be linked to a proteins via covalent bonds to lysine, histidine, aspartic acid, glutamic acid, or cysteine residues.
  • One or more reaction chemistries may be employed to attach polyethylene glycol to specific amino acid residues (e.g., lysine, histidine, aspartic acid, glutamic acid, or cysteine) of the protein or to more than one type of amino acid residue (e.g., lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations thereof) of the protein.
  • polyethylene glycol as an illustration, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein.
  • the method of obtaining the N-terminally pegylated preparation i.e., separating this moiety from other monopegylated moieties if necessary
  • Selective chemical modification at the N-terminus may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.
  • pegylation of the antibodies of the invention may be accomplished by any number of means.
  • polyethylene glycol may be attached to the antibody either directly or by an intervening linker. Linkerless systems for attaching polyethylene glycol to proteins are described in Delgado et al., Crit. Rev. Thera. Drug Carrier Sys.
  • One system for attaching polyethylene glycol directly to amino acid residues of antibodies without an intervening linker employs tresylated MPEG, which is produced by the modification of monmethoxy polyethylene glycol (MPEG) using tresylchloride (C1SO2CH2CF3).
  • polyethylene glycol Upon reaction of protein with tresylated MPEG, polyethylene glycol is directly attached to amine groups of the protein.
  • the invention includes antibody- polyethylene glycol conjugates produced by reacting antibodies of the invention with a polyethylene glycol molecule having a 2,2,2 -trifluoreothane sulphonyl group.
  • Polyethylene glycol can also be attached to antibodies using a number of different intervening linkers.
  • U.S. Patent No. 5,612,460 the entire disclosure of which is inco ⁇ orated herein by reference, discloses urethane linkers for connecting polyethylene glycol to proteins.
  • Antibody-polyethylene glycol conjugates wherein the polyethylene glycol is attached to the antibody by a linker can also be produced by reaction of antibodies with compounds such as MPEG- succinimidylsuccinate, MPEG activated with l,r-carbonyldiimidazole, MPEG- 2,4,5-trichloropenylcarbonate, MPEG-p-nitrophenolcarbonate, and various MPEG- succinate derivatives.
  • compounds such as MPEG- succinimidylsuccinate, MPEG activated with l,r-carbonyldiimidazole, MPEG- 2,4,5-trichloropenylcarbonate, MPEG-p-nitrophenolcarbonate, and various MPEG- succinate derivatives.
  • a number additional polyethylene glycol derivatives and reaction chemistries for attaching polyethylene glycol to proteins are described in WO 98/32466, the entire disclosure of which is inco ⁇ orated herein by reference. Pegylated antibody products produced using the reaction chemistries set out herein are included within the
  • the number of polyethylene glycol moieties attached to each antibody of the invention may also vary.
  • the pegylated antibodies of the invention may be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules.
  • the average degree of substitution within ranges such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11- 13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per antibody molecule. Methods for determining the degree of substitution are discussed, for example, in Delgado et al, Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992).
  • Antibodies of the present invention may also be described or specified in terms of their binding to GLP-1 receptor polypeptides or fragments or variants of GLP-1 receptor polypeptides.
  • antibodies of the invention bind GLP-1 receptor polypeptides, or fragments or variants thereof, with a dissociation constant or K D of less than or equal to 5 X 10 "2 M, 10 "2 M, 5 X 10 "3 M, 10 "3 M, 5 X 10 "4 M, 10 "4 M, 5 X 10 "5 M, or 10 "5 M.
  • antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with a dissociation constant or K D less than or equal to 5 X 10 "6 M, 10 "6 M, 5 X 10 "7 M, 10 "7 M, 5 X 10 "8 M, or 10 " M.
  • antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with a dissociation constant or K D less than or equal to 5 X 10 '9 M, 10 "9 M, 5 X 10 "10 M, 10 "10 M, 5 X 10 "11 M, 10 "11 M, 5 X 10 "12 M, 10 "12 M, 5 X - 13 M, 10 "13 M, 5 X 10 "14 M, 10 "14 M, 5 X 10 "15 M, or 10 "15 M.
  • the invention encompasses antibodies that bind GLP-1 receptor polypeptides with a dissociation constant or K D that is within any one of the ranges that are between each of the individual recited values.
  • antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with an off rate (k of ) of less than or equal to 5 X 10 "2 sec “1 , 10 "2 sec “1 , 5 X 10 "3 sec “1 or 10 "3 sec “1 .
  • antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with an off rate (k off ) less than or equal to 5 X 10 "4 sec “1 , 10 "4 sec “1 , 5 X 10 '5 sec “1 , or 10 "5 sec “1 5 X 10 "6 1 r 1 7 1 7 1 sec “ , 10 " sec “ , 5 X 10 “ sec “ or 10 " sec “ .
  • the invention encompasses antibodies that bind GLP-1 receptor polypeptides with an off rate (k off ) that is within any one of the ranges that are between each of the individual recited values.
  • antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with an on rate (k on ) of greater than or equal to 10 3 M “1 sec “1 , 5 X 10 3 M “1 sec “1 , 10 4 M “1 sec “1 or 5 X 10 4 M “1 sec “1 . More preferably, antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with an on rate (k on ) greater than or equal to 10 5 M "1 sec “1 , 5 X 10 5 M “1 sec “1 , 10 6 M “1 sec “ l, or 5 X 10 6 M “1 sec “1 or 10 7 M _1 sec “1 .
  • the invention encompasses antibodies that bind GLP-1 receptor polypeptides with on rate (k on ) that is within any one of the ranges that are between each of the individual recited values.
  • the antibodies of the invention specifically bind to a polypeptide or polypeptide fragment or variant of human GLP-1 receptor (e.g., SEQ ID NO:2).
  • the antibodies of the invention specifically bind to a polypeptide or polypeptide fragment or variant of simian GLP-1 receptor polypeptides.
  • the antibodies of the invention specifically bind to a polypeptide or polypeptide fragment or variant of murine GLP-1 receptor polypeptides.
  • the antibodies of the invention bind specifically to human and simian GLP-1 receptor polypeptides.
  • the antibodies of the invention bind specifically to human GLP-1 receptor polypeptides and murine GLP-1 receptor polypeptides. More preferably, antibodies of the invention, preferentially bind to human GLP-1 receptor polypeptides compared to murine GLP-1 receptor polypeptides. [0164] In preferred embodiments, the antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), specifically bind to GLP-1 receptor polypeptides and do not cross-react with any other antigens.
  • the antibodies of the invention specifically bind to GLP-1 receptor polypeptides (e.g., SEQ ID NO:2 or fragments or variants thereof) and do not cross-react with one or more additional members of the PACAP/glucagon receptor superfamily.
  • GLP-1 receptor polypeptides e.g., SEQ ID NO:2 or fragments or variants thereof
  • the antibodies of the present invention specifically bind to GLP-1 receptor polypeptides and cross-react with other antigens.
  • the antibodies of the invention specifically bind to GLP- 1 receptor polypeptides (e.g., SEQ ID NO:2, or fragments or variants thereof) and cross- react with one or more additional members of the PACAP/glucagon receptor superfamily.
  • GLP- 1 receptor polypeptides e.g., SEQ ID NO:2, or fragments or variants thereof
  • an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with a dissociation constant (K D ) that is less than the antibody's KD for the second antigen.
  • K D dissociation constant
  • an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with an affinity (i.e., KD) that is at least one order of magnitude less than the antibody's K D for the second antigen.
  • an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with an affinity (i.e., KD) that is at least two orders of magnitude less than the antibody's K D for the second antigen.
  • an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with an off rate (k 0ff ) that is less than the antibody's k 0ff for the second antigen.
  • an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with a k 0ff that is at least one order of magnitude less than the antibody's k 0ff for the second antigen.
  • an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with a k off that is at least two orders of magnitude less than the antibody's k 0ff for the second antigen.
  • the invention also encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that have one or more of the same biological characteristics as one or more of the antibodies described herein.
  • biological characteristics is meant, the in vitro or in vivo activities or properties of the antibodies, such as, for example, the ability to bind to GLP-1 receptor polypeptides, the ability to stimulate GLP-1 receptor mediated biological activity (e.g., to stimulate cAMP production in cells expressing the GLP-1 receptor, to stimulate transcription of insulin in pancreatic beta cells, to stimulate glucose-dependent insulin secretion, to promote pancreatic beta cell proliferation and pancreatic islet neogenesis, to delay gastric emptying and slow small bowel motility, to promote satiety, to reduce fasting glucose and improve glucose tolerance in diabetic rat and mouse models, to promote neurite outgrowth, inhibit neuronal apoptosis, and reduce amyloid beta-peptide levels in the brain, or the ability to stimulate proliferation of GLP-1 receptor expressing cells.
  • GLP-1 receptor mediated biological activity e.g., to stimulate cAMP production in cells expressing the GLP-1 receptor, to stimulate transcription of insulin in pancreatic beta cells, to stimulate glucose-dependent insulin
  • the present invention also provides for antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), that block or inhibit the binding of GLP-1 receptor ligand to a GLP-1 receptor. Nucleic acid molecules encoding these antibodies are also encompassed by the invention. [0170] The present invention also provides for antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), that stimulate proliferation and/or chemotaxis of GLP-1 receptor expressing cells (e.g., cells of the pancreas, nervous system, heart, kidney, and GI tract). Nucleic acid molecules encoding these antibodies are also encompassed by the invention.
  • Antibodies of the present invention may be characterized in a variety of ways.
  • antibodies and related molecules of the invention may be assayed for the ability to specifically bind to GLP-1 receptor polypeptides or a fragment or variant of GLP-1 receptor polypeptides using techniques described herein or routinely modifying techniques known in the art.
  • Assays for the ability of the antibodies of the invention to specifically bind GLP-1 receptor polypeptides or a fragment of GLP-1 receptor polypeptides may be performed in solution (e.g., Houghten, Bio/Techniques 13:412-421(1992)), on beads (e.g., Lam, Nature 354:82-84 (1991)), on chips (e.g., Fodor, Nature 364:555-556 (1993)), on bacteria (e.g., U.S. Patent No. 5,223,409), on spores (e.g., Patent Nos. 5,571,698; 5,403,484; and 5,223,409), on plasmids (e.g., Cull et al., Proc. Natl.
  • Antibodies that have been identified to specifically bind to GLP-1 receptor polypeptides or a fragment or variant of GLP-1 receptor polypeptides can then be assayed for their specificity and affinity for GLP-1 receptor polypeptides or a fragment or variant of a GLP-1 receptor polypeptide using or routinely modifying techniques described herein or otherwise known in the art.
  • the antibodies of the invention may be assayed for specific binding to GLP-1 , receptor polypeptides and cross-reactivity with other antigens by any method known in the art.
  • Immunoassays which can be used to analyze specific binding and cross-reactivity include, but are not limited to, competitive and non-competitive assay systems using techniques such as BIAcore analysis, FACS (fluorescence activated cell sorter) analysis, immunofluorescence, immunocytochemistry, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoprecipitation assays, western blots, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, and protein A immunoassays, to name but a few.
  • ELISAs comprise preparing antigen, coating the well of a 96-well microtiter plate with the antigen, washing away antigen that did not bind the wells, adding the antibody of interest conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the wells and incubating for a period of time, washing away unbound antibodies or non-specifically bound antibodies, and detecting the presence of the antibodies specifically bound to the antigen coating the well.
  • a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase)
  • a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase)
  • the antigen need not be directly coated to the well; instead the ELISA plates may be coated with an anti-Ig Fc antibody, and the antigen in the form of a GLP-1 receptor-Fc fusion protein, may be bound to the anti-Ig Fc coated to the plate. This may be desirable so as to maintain the antigen protein (e.g., the GLP-1 receptor polypeptides) in a more native conformation than it may have when it is directly coated to a plate.
  • the antibody instead of coating the well with the antigen, may be coated to the well.
  • the detectable molecule could be the antigen conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase).
  • an enzymatic substrate e.g., horseradish peroxidase or alkaline phosphatase.
  • ELISAs see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 11.2.1.
  • the binding affinity of an antibody (including an scFv or other molecule comprising, or alternatively consisting of, antibody fragments or variants thereof) to an antigen and the off-rate of an antibody-antigen interaction can be determined by competitive binding assays.
  • a competitive binding assay is a radioimmunoassay comprising the incubation of labeled antigen (e.g., antigen labeled with H or I), or fragment or variant thereof with the antibody of interest in the presence of increasing amounts of unlabeled antigen, and the detection of the antibody bound to the labeled antigen.
  • labeled antigen e.g., antigen labeled with H or I
  • the affinity of the antibody of the present invention for the GLP-1 receptor and the binding off-rates can be determined from the data by Scatchard plot analysis.
  • Competition with a second antibody can also be determined using radioimmunoassays.
  • GLP-1 receptor polypeptide is incubated with an antibody of the present invention conjugated to a labeled compound (e.g., compound labeled with H or I) in the presence of increasing amounts of an unlabeled second anti- GLP-1 receptor antibody.
  • a labeled compound e.g., compound labeled with H or I
  • This kind of competitive assay between two antibodies may also be used to determine if two antibodies bind the same, closely associated (e.g., overlapping) or different epitopes.
  • BIAcore kinetic analysis is used to determine the binding on and off rates of antibodies (including antibody fragments or variants thereof) to GLP-1 receptor, or fragments of GLP-1 receptor.
  • BIAcore kinetic analysis comprises analyzing the binding and dissociation of antibodies from chips with immobilized GLP-1 receptor on their surface.
  • Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody of interest to the cell lysate, incubating for a period of time (e.g., 1 to 4 hours) at 40 degrees C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 40 degrees C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer.
  • a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium de
  • the ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis.
  • One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the binding of the antibody to an antigen and decrease the background (e.g., pre-clearing the cell lysate with sepharose beads).
  • immunoprecipitation protocols see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1.
  • Western blot analysis generally comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%- 20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-Tween 20), blocking the membrane with primary antibody (the antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., 32 P or 125 I) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the presence of the anti
  • the present invention encompasses antibodies (including antibody fragments or variants thereof), recombinantly fused or chemically conjugated (including both covalent and non-covalent conjugations) to a heterologous polypeptide (or portion thereof, preferably at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 amino acids of the polypeptide) to generate fusion proteins.
  • the fusion does not necessarily need to be direct, but may occur through linker sequences.
  • antibodies of the invention may be used to target heterologous polypeptides to particular cell types (e.g., cancer cells), either in vitro or in vivo, by fusing or conjugating the heterologous polypeptides to antibodies of the invention that are specific for particular cell surface antigens or which bind antigens that bind particular cell surface receptors.
  • Antibodies of the invention may also be fused to albumin (including but not limited to recombinant human serum albumin (see, e.g., U.S. Patent No. 5,876,969, issued March 2, 1999, EP Patent 0 413 622, and U.S. Patent No.
  • polypeptides and/or antibodies of the present invention are fused with the mature form of human serum albumin (i.e., amino acids 1 - 585 of human serum albumin as shown in Figures 1 and 2 of EP Patent 0 322 094) which is herein inco ⁇ orated by reference in its entirety.
  • polypeptides and/or antibodies of the present invention are fused with polypeptide fragments comprising, or alternatively consisting of, amino acid residues 1-z of human serum albumin, where z is an integer from 369 to 419, as described in U.S. Patent 5,766,883 herein inco ⁇ orated by reference in its entirety.
  • Polypeptides and/or antibodies of the present invention may be fused to either the N- or C-terminal end of the heterologous protein (e.g., immunoglobulin Fc polypeptide or human serum albumin polypeptide).
  • polynucleotides encoding fusion proteins of the invention are also encompassed by the invention.
  • fusion proteins may, for example, facilitate purification and may increase half-life in vivo.
  • Antibodies fused or conjugated to heterologous polypeptides may also be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., Harbor et al, supra, and PCT publication WO 93/2 1232; EP 439,095; Naramura et al, Immunol. Lett. 39:91-99 (1994); U.S. Patent 5,474,981; Gillies et al, PNAS 89:1428-1432 (1992); Fell et al, J. Immunol. 146:2446-2452 (1991), which are inco ⁇ orated by reference in their entireties.
  • the present invention further includes compositions comprising, or alternatively consisting of, heterologous polypeptides fused or conjugated to antibody fragments.
  • the heterologous polypeptides may be fused or conjugated to a Fab fragment, Fd fragment, Fv fragment, F(ab) 2 fragment, or a portion thereof.
  • Methods for fusing or conjugating polypeptides to antibody portions are known in the art. See, e.g., U.S. Patent Nos.
  • DNA shuffling may be employed to modulate the activities of antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), such methods can be used to generate antibodies with altered activity (e.g., antibodies with higher affinities and lower dissociation rates). See, generally, U.S. Patent Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al, Curr. Opinion Biotechnol.
  • polynucleotides encoding antibodies of the invention may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination.
  • one or more portions of a polynucleotide encoding an antibody which portions specifically bind to the GLP-1 receptor may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
  • the antibodies of the present invention can be fused to marker sequences, such as a polypeptides to facilitate purification.
  • the marker amino acid sequence is a hexa- histidine polypeptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available.
  • a pQE vector QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311
  • hexa-histidine provides for convenient purification of the fusion protein.
  • peptide tags useful for purification include, but are not limited to, the hemagglutinin "HA" tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al, Cell 37:767 (1984)) and the FLAG® tag (Stratagene, La Jolla, CA).
  • the present invention further encompasses antibodies (including antibody fragments or variants thereof), conjugated to a diagnostic or therapeutic agent.
  • the antibodies can be used diagnostically to, for example, monitor or prognose the development or progression of a tumor as part of a clinical testing procedure to, e.g., determine the efficacy of a given treatment regimen.
  • Detection can be facilitated by coupling the antibody to a detectable substance.
  • detectable substances include, but are not limited to, various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron emission tomographies, and nonradioactive paramagnetic metal ions.
  • the detectable substance may be coupled or conjugated either directly to the antibody or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Patent No. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention.
  • suitable enzymes include, but are not limited to, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include, but are not limited to, streptavidin biotin and avidin/biotin;
  • suitable fluorescent materials include, but are not limited to, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin;
  • an example of a luminescent material includes, but is not limited to, luminol;
  • examples of bioluminescent materials include, but are not Imited to, luciferase, luciferin, and aequorin;
  • suitable radioactive material include, but are not limited to, iodine ( 121 1, 123 I, 125 I, 131 I), carbon ( 14 C
  • an antibody of the invention may be coupled or conjugated to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters such as, for example, 213 Bi, or other radioisotopes such as, for example, l 3 Pd, 135 Xe, 131 I, 68 Ge, 57 Co, 65 Zn, 85 Sr, 32 P, 35 S, 90 Y, 153 Sm, 153 Gd, 169 Yb, 51 Cr, 54 Mn, 75 Se, 113 Sn, 90 Y, 117 Tin, 186 Re, 188 Re and 166 Ho.
  • a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters such as, for example
  • an antibody or fragment thereof is attached to macrocyclic chelators that chelate radiometal ions, including but not limited to, Lu, Y, Ho, and Sm, to polypeptides.
  • the macrocyclic chelator is 1,4,7, 10-tetraazacyclododecane-N,N',N",N'"-tetraacetic acid (DOTA).
  • DOTA is attached to the an antibody of the invention or fragment thereof via a linker molecule. Examples of linker molecules useful for conjugating DOTA to a polypeptide are commonly known in the art - see, for example, DeNardo et al, Clin Cancer Res.
  • a cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include, but are not limited to, paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, thymidine kinase, endonuclease, RNAse, and puromycin and frragments, variants or homologs thereof.
  • Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5- fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cisdicMorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
  • the antibodies of the invention which are conjugates can be used for modifying a given biological response, the therapeutic agent or drug moiety is not to be construed as limited to classical chemical therapeutic agents.
  • the drug moiety may be a protein or polypeptide possessing a desired biological activity.
  • Such proteins may include, but are not limited to, for example, a toxin such as abrin, ricin A, alpha toxin, pseudomonas exotoxin, or diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin; a protein such as tumor necrosis factor, alpha-interferon, beta-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I (see, International Publication No.
  • a toxin such as abrin, ricin A, alpha toxin, pseudomonas exotoxin, or diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin
  • a protein such as tumor necros
  • WO 97/35899 Fas Ligand (Takahashi et al, Int. Immunol, 6:1567-1574 (1994)), VEGI (see, International Publication No. WO 99/23105), a thrombotic agent or an anti-angiogenic agent, e.g., angiostatin or endostatin; or, biological response modifiers such as, for example, lymphokines, interleukin-1 (IL- 1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), or other growth factors.
  • IL-1 interleukin-1
  • IL-2 interleukin-2
  • IL-6 interleukin-6
  • GM-CSF granulocyte macrophage colony stimulating factor
  • G-CSF granulocyte colony stimulating factor
  • Antibodies of the invention may also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen.
  • solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
  • Techniques for conjugating a therapeutic moiety to antibodies are well known, see, e.g., Arnon et al, "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243- 56 (Alan R. Liss, Inc.
  • an antibody of the invention can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980, which is inco ⁇ orated herein by reference in its entirety.
  • An antibody of the invention (including an other molecules comprising, or alternatively consisting of, an antibody fragment or variant thereof), with or without a therapeutic moiety conjugated to it, administered alone or in combination with cytotoxic factor(s) and/or cytokine(s) can be used as a therapeutic.
  • Antibodies of the present invention may be used, for example, but not limited to, to purify, detect, and target the polypeptides of the present invention, including both in vitro and in vivo diagnostic and therapeutic methods.
  • the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of GLP-1 receptor polypeptides in biological samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (inco ⁇ orated by reference herein in its entirety).
  • the antibodies of the invention may be utilized for immunophenotyping of cell lines and biological samples.
  • the translation product of the gene of the present invention may be useful as a cell specific marker, or more specifically as a cellular marker that is differentially expressed at various stages of differentiation and/or maturation of particular cell types, such as T-cells (e.g., activated T-cells).
  • the antibodies of the invention may be useful as tumors and/or cancer cell markers. Monoclonal antibodies directed against a specific epitope, or combination of epitopes, will allow for the screening of cellular populations expressing the marker.
  • Various techniques can be utilized using monoclonal antibodies to screen for cellular populations expressing the marker(s), and include magnetic separation using antibody-coated magnetic beads, "panning" with antibody attached to a solid matrix (i.e., plate), and flow cytometry (See, e.g., U.S. Patent 5,985,660; and Morrison et al, Cell, 96:737-49 (1999)).
  • MRD minimal residual disease
  • GVHD Graft-versus- Host Disease
  • these techniques allow for the screening of hematopoietic stem and progenitor cells capable of undergoing proliferation and/or differentiation, as might be found in human umbilical cord blood.
  • the present invention provides antibodies (including antibody fragments or variants thereof), that can be used to identify epitopes of a GLP-1 receptor polypeptide.
  • the antibodies of the present invention can be used to identify epitopes of a human GLP-1 receptor polypeptide (e.g., SEQ ID NO:2); a murine GLP-1 receptor; a rat GLP-1 receptor polypeptide; or a monkey GLP-1 receptor polypeptide, using techniques described herein or otherwise known in the art.
  • Fragments which function as epitopes may be produced by any conventional means. (See, e.g., Houghten, Proc. Natl. Acad. Sci.
  • Identified epitopes of antibodies of the present invention may, for example, be used as vaccine candidates, i.e., to immunize an individual to elicit antibodies against the naturally occuring forms of GLP-1 receptor polypeptides.
  • Labeled antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) which specifically bind to a GLP-1 receptor polypeptides can be used for diagnostic pu ⁇ oses to detect, diagnose, prognose, or monitor diseases and/or disorders.
  • labeled antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) which specifically bind to a GLP-1 receptor polypeptide can be used for diagnostic pu ⁇ oses to detect, diagnose, prognose, or monitor diseases and/or disorders associated with the aberrant expression and/or activity of GLP-1 receptors or GLP-1 mediated activity.
  • the invention provides for the detection of expression of a GLP-1 receptor polypeptide comprising: (a) assaying the expression of a GLP-1 receptor polypeptide in a biological sample from an individual using one or more antibodies of the invention that specifically binds to a GLP-1 receptor polypeptide; and (b) comparing the level of a GLP- 1 receptor polypeptide with a standard level of a GLP-1 receptor polypeptide, (e.g., the level in normal biological samples).
  • the invention provides for the detection of aberrant expression of a GLP-1 receptor polypeptide comprising: (a) assaying the expression of a GLP-1 receptor polypeptide in a biological sample from an individual using one or more antibodies of the invention that specifically binds to a GLP-1 receptor polypeptide; and (b) comparing the level of a GLP-1 receptor polypeptide with a standard level of a GLP-1 receptor polypeptide, e.g., in normal biological samples, whereby an increase or decrease in the assayed level of a GLP-1 receptor polypeptide compared to the standard level of a GLP-1 receptor polypeptide is indicative of aberrant expression.
  • biological sample any fluids and/or cells obtained from an individual, body fluid, body tissue, body cell, cell line, tissue culture, or other source which may contain a GLP-1 receptor polypeptide protein or mRNA.
  • Body fluids include, but are not limited to, sera, plasma, urine, synovial fluid, spinal fluid, saliva, and mucous.
  • Tissues samples may be taken from virtually any tissue in the body. Tissue samples may also be obtained from autopsy material. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. Where the biological sample is to include mRNA, a tissue biopsy is the preferred source.
  • diagnosis comprises: a) administering (for example, parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically binds to a GLP-1 receptor polypeptide; b) waiting for a time interval following the administering for permitting the labeled antibody to preferentially concentrate at sites in the subject where GLP-1 receptor polypeptide is expressed (and for unbound labeled molecule to be cleared to background level); c) determining background level; and d) detecting the labeled antibody in the subject, such that detection of labeled antibody or fragment thereof above the background level and above or below the level observed in a person without the disease
  • the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images.
  • the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99 Tc.
  • the labeled antibody will then preferentially accumulate at the location of cells which contain the specific protein.
  • In vivo tumor imaging is described in S.W. Burchiel et al, "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments.” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).
  • the time interval following the administration for permitting the labeled molecule to preferentially concentrate at sites in the subject and for unbound labeled molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 5 to 10 days.
  • monitoring of the disease or disorder is carried out by repeating the method for diagnosing the disease or disorder, for example, one month after initial diagnosis, six months after initial diagnosis, one year after initial diagnosis, etc.
  • Presence of the labeled molecule can be detected in the patient using methods known in the art for in vivo scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the diagnostic methods of the invention include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography.
  • CT computed tomography
  • PET position emission tomography
  • MRI magnetic resonance imaging
  • sonography sonography
  • the molecule is labeled with a radioisotope and is detected in the patient using a radiation responsive surgical instrument (Thurston et al. , U.S. Patent No. 5,441,050).
  • the molecule is labeled with a fluorescent compound and is detected in the patient using a fluorescence responsive scanning instrument.
  • the molecule is labeled with a positron emitting metal and is detected in the patient using positron emission-tomography.
  • the molecule is labeled with a paramagnetic label and is detected in a patient using magnetic resonance imaging (MRI).
  • MRI magnetic resonance imaging
  • antibodies of the present invention may be used in wound healing and in the diagnosis, prevention, and treatment of proliferative disorders, as well as immune system diseases and disorders including autoimmune disease, inflammatory disorders, immunodeficiencies, infections, HIV, arthritis, allergy, psoriasis, dermatitis, and inflammatory bowel disease, particularly those diseases and/or disorders described in the "Therapeutic Uses of Antibodies" sections below.
  • One or more antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a GLP-1 receptor may be used locally or systemically in the body as a therapeutic.
  • the present invention is further directed to antibody-based therapies which involve administering antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) to an animal, preferably a mammal, and most preferably a human, for preventing or treating one or more of the disclosed diseases, disorders, or conditions.
  • Therapeutic compounds of the invention include, but are not limited to, antibodies of the invention and nucleic acids encoding antibodies (and anti-idiotypic antibodies) of the invention as described herein.
  • the antibodies of the invention can be used to treat, ameliorate or prevent diseases, disorders or conditions, including, but not limited to, any one or more of the diseases, disorders, or conditions described herein.
  • the treatment and/or prevention of diseases, disorders, or conditions includes, but is not limited to, alleviating symptoms associated with those diseases, disorders or conditions.
  • Antibodies of the invention may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.
  • antibodies and antibody compositions of the invention may be useful for treating, diagnosing, preventing, and/or detecting inflammatory diseases.
  • antibodies and antibody compositions of the invention are useful in the diagnosis, treatment, detection, and/or prevention of psoriasis, dermatitis, Langerhans cell histiocytosis, allergy, asthma, and inflammatory bowel disease.
  • antibodies and antibody compositions of the invention are useful in the diagnosis and treatment or prevention of immune diseases and disorders including, but not limited to, inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome), ischemia-reperfusion injury, endotoxin lethality, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, over production of cytokines (e.g., TNF or IL-1.), respiratory disorders (e.g., asthma and allergy); gastrointestinal disorders (e.g., inflammatory bowel disease); cancers (e.g., gastric, ovarian, lung, bladder, liver, and breast); CNS disorders (e.g., multiple sclerosis; ischemic brain injury and/or stroke, traumatic brain injury, neurodegenerative disorders (e.g., Parkinson's disease and Alzheimer's disease); AIDS- related dementia;
  • infection e.g.,
  • tissue-specific inflammatory disorders including, but not limited to, adrenalitis, alveolitis, angiocholecystitis, appendicitis, balanitis, blepharitis, bronchitis, bursitis, carditis, cellulitis, cervicitis, cholecystitis, chorditis, cochlitis, colitis, conjunctivitis, cystitis, dermatitis, diverticulitis, encephalitis, endocarditis, esophagitis, eustachitis, fibrositis, folliculitis, gastritis, gastroenteritis, gingivitis, glossitis, hepatosplenitis, keratitis, labyrinthitis, laryngitis, lymphangitis, mastitis, media otitis, tissue-specific inflammatory disorders, including, but not limited to, adrenalitis, alveolitis, angiocholecystitis, appendici
  • antibodies and antibody compositions of the invention are useful to diagnose, prognose, prevent, and/or treat organ transplant rejections and graft-versus-host disease.
  • Organ rejection occurs by host immune cell destruction of the transplanted tissue through an immune response.
  • an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues.
  • Polypeptides, antibodies, or polynucleotides of the invention, and/or agonists or antagonists thereof, that inhibit an immune response, particularly the activation, proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing organ rejection or GVHD.
  • antibodies and antibody compositions of the invention that inhibit an immune response may be an effective therapy in preventing allergic and hyperacute xenograft rejection.
  • antibodies of the present invention are useful to diagnose, prognose, prevent, and/or treat immune complex diseases, including, but not limited to, serum sickness, post streptococcal glomerulonephritis, polyarteritis nodosa, and immune complex-induced vasculitis.
  • Antibodies and antibody compositions of the invention are also useful in promoting angiogenesis and/or wound healing (e.g., wounds, burns, and bone fractures).
  • antibodies and antibody compositions of the invention may be used to stimulate epithelial cell proliferation and basal keratinocytes for the pu ⁇ ose of wound healing, and to stimulate hair follicle production and healing of dermal wounds.
  • Antibodies and antibody compositions of the invention may be clinically useful in stimulating wound healing including surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, burns resulting from heat exposure or chemicals, and other abnormal wound healing conditions such as uremia, malnutrition, vitamin deficiencies and complications associated with systemic treatment with steroids, radiation therapy and antineoplastic drugs and antimetabolites.
  • Antibodies and antibody compositions of the invention could be used to promote dermal reestablishment subsequent to dermal loss.
  • antibodies and antibody compositions of the invention may be used as an adjuvant to enhance immune responsiveness to specific antigen, such as in anti-viral immune responses.
  • antibodies and antibody compositions of the invention are useful in regulating (i.e., elevating or reducing) immune response.
  • antibodies and antibody compositions of the invention may be useful in preparation or recovery from surgery, trauma, radiation therapy, chemotherapy, and transplantation, or may be used to boost immune response and/or recovery in the elderly and immunocompromised individuals.
  • antibodies and antibody compositions of the invention are useful as immunosuppressive agents, for example in the treatment or prevention of autoimmune disorders.
  • antibodies and antibody compositions of the invention are used to treat or prevent chronic inflammatory, allergic or autoimmune conditions, such as those described herein or are otherwise known in the art.
  • antibodies of the invention that bind a GLP-1 receptor polypeptide and inhibit proliferation of GLP-1 receptor expressing cells are used to diagnose, treat, prevent or ameliorate cancer.
  • antibodies of the invention are used to inhibit the progression or metastasis of cancers of the pancreas, nervous system, heart, kidney, and GI tract.
  • antibodies of the invention that bind a GLP-1 receptor polypeptide and inhibit proliferation of GLP-1 receptor expressing cells are used to diagnose, treat, prevent or ameliorate cancers and related disorders including, but not limited to, colon cancer, cervical cancer, leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sarcomas
  • leukemia including acute leuk
  • antibodies of the invention used to treat the aforementioned cancers are administered with or conjugated to a cytotoxic and/or chemotherapeutic agent.
  • antibodies and antibody compositions of the invention are used to diagnose, treat, prevent or ameliorate autoimmune diseases, disorders, or conditions associated with such diseases or disorders.
  • Autoimmune disorders and related disorders include, but are not limited to, autoimmune hemolytic anemia, autoimmune neonatal thrombocytopenia, idiopathic thrombocytopenia pu ⁇ ura, autoimmunocytopenia, hemolytic anemia, antiphospholipid syndrome, dermatitis, allergic encephalomyelitis, myocarditis, relapsing polychondritis, ulcerative colitis, dense deposit disease, rheumatic heart disease, glomerulonephritis (e.g., IgA nephropathy), pemphigus vulgaris, discoid lupus, Multiple Sclerosis, Neuritis, Uveitis Ophthalmia, Polyendocrinopathies, Pu ⁇ ura (e.g., Henloch-Scoenlein pu ⁇ ura), Reiter's
  • antibodies of the invention can used to diagnose, treat, inhibit, prognose, diagnose or prevent rheumatoid arthritis.
  • antibodies of the invention can used to diagnose, treat, inhibit, prognose, diagnose or prevent systemic lupus erythematosus.
  • antibodies of the invention can used to diagnose, treat, inhibit, prognose, diagnose or prevent autoimmune encephalitis.
  • the antibodies of the invention can be used to diagnose, treat, inhibit or prevent diseases, disorders or conditions associated with immunodeficiencies including, but not limited to, severe combined immunodeficiency (SCID)-X linked, SCID-autosomal, adenosine deaminase deficiency (ADA deficiency), X-linked agammaglobulinemia (XLA), Bruton's disease, congenital agammaglobulinemia, X-linked infantile agammaglobulinemia, acquired agammaglobulinemia, adult onset agammaglobulinemia, late-onset agammaglobulinemia, dysgammaglobulinemia, hypogammaglobulinemia, transient hypogammaglobulinemia of infancy, unspecified hypogammaglobulinemia, agammaglobulinemia, common variable immunodeficiency (CVID) (acquired),
  • SCID severe combined immunodeficiency
  • Antibodies and antibody compositions of the present invention may be useful in treating, preventing, prognosing, and/or diagnosing diseases, disorders, and/or conditions of hematopoietic cells including, but not limited to, leukopenia, neutropenia, anemia, and thrombocytopenia.
  • antibodies of the invention could be used to decrease differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat or prevent those diseases, disorders, and/or conditions associated with an increase in certain (or many) types of hematopoietic cells, including but not limited to, histiocytosis.
  • the antibodies of the invention can be used to diagnose, treat, ameliorate or prevent diseases, disorders or conditions associated with aberrant expression and/or activity of GLP-1 receptor, including, but not limited to, any one or more of the diseases, disorders, or conditions described herein.
  • the treatment and/or prevention of diseases, disorders, or conditions associated with aberrant GLP-1 receptor expression and/or activity includes, but is not limited to, alleviating symptoms associated with those diseases, disorders or conditions.
  • Antibodies of the invention may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.
  • antibodies of the present invention can be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder described herein, particularly inflammatory and other immune disorders.
  • These antibodies may potentiate or activate either all or a subset of the biological activities of GLP-1 receptor, for example, by inducing a conformational change in GLP-1 receptor.
  • an antibody of the present invention that increases GLP-1 receptor activity by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least two-fold, at least three-fold, at least four fold, at least five fold, at least ten-fold, at least twenty-fold, at least fifty-fold, or at least one hundred-fold relative to GLP-1 receptor activity in absence of the antibody is administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder.
  • antibodies of the present invention which activate GLP-1 receptor-mediated biological activities can be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 signalling, especially cancer and other hype ⁇ roliferative disorders.
  • These antibodies may potentiate or activate either all or a subset of the biological activities of GLP-1 receptor, for example, by inducing a conformational change in GLP-1 receptor.
  • an antibody of the present invention that increases GLP-1 receptor activity by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least two-fold, at least three-fold, at least four fold, at least five fold, at least ten-fold, at least twenty-fold, at least fifty-fold, or at least one hundred-fold relative to GLP-1 receptor activity in absence of the antibody is administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 signalling.
  • Antibodies of the present invention can be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 signalling.
  • a GLP-1 receptor preferably of GLP-1 receptor signal fransduction
  • antibodies of the invention which mimic the action of GLP-1 binding to the GLP-1 receptor, in full or in part, (e.g., antibodies that act as GLP-1 receptor agonists), may be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated aberrant GLP-1 receptor expression, function, or aberrant GLP-1 signalling.
  • antibodies of the invention which disrupt or prevent the interaction between GLP-1 receptor and its receptor or inhibit, reduce, or prevent signal fransduction through one or more GLP-1 receptor, may be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 signalling.
  • Antibodies of the invention which do not prevent GLP-1 receptor from binding its ligand but inhibit or downregulate GLP-1 receptor signal fransduction can be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression, abberant GLP-1 receptor function, aberrant GLP-1 expression, or abberant GLP-1 function.
  • an antibody of the invention to enhance, inhibit, upregulate or downregulate GLP-1 receptor signal fransduction may be determined by techniques described herein or otherwise known in the art.
  • GLP-1 -induced receptor activation and the activation of signaling molecules can be determined by detecting the association of adaptor proteins with the GLP-1 receptors, by immunoprecipitation followed by western blot analysis (for example, as described herein).
  • an antibody of the present invention that enhances or stimulates, in full or in part, GLP-1 receptor activity (e.g., stimulates cAMP production in cells expressing the GLP-1 receptor, stimulates transcription of insulin in pancreatic beta cells, stimulates glucose-dependent insulin secretion, promotes pancreatic beta cell proliferation and pancreatic islet neogenesis, inhibits beta cell degeneration and apoptosis, delays gastric emptying and slows small bowel motility, promotes satiety, reduces fasting glucose and improves glucose tolerance in diabetic rat and mouse models, promotes neurite outgrowth, inhibits neuronal apoptosis, and reduces amyloid beta-peptide levels in the brain, or stimulates proliferation of cells expressing a GLP-1 receptor (e.g., cells of the pancreas, nervous system, heart, kidney, and GI tract)) by at least 95%, at
  • a combination of antibodies, a combination of antibody fragments, a combination of antibody variants, or a combination of antibodies, antibody fragments, and/or variants that enhance or stimulate GLP-1 receptor activity by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% relative to GLP-1 receptor activity in absence of said antibodies, antibody fragments, and/or antibody variants are administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 expression and/or function.
  • an antibody of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that inhibits or downregulates, in full or in part, GLP-1 receptor activity by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% relative to GLP-1 receptor activity in absence of the antibody is administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 expression and/or function.
  • a combination of antibodies, a combination of antibody fragments, a combination of antibody variants, or a combination of antibodies, antibody fragments, and/or variants that inhibit or downregulate GLP-1 receptor activity by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% relative to GLP-1 receptor activity in absence of said antibodies, antibody fragments, and/or antibody variants are administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 expression and/or function.
  • compositions of the invention are administered to an animal to diagnose, freat, prevent or ameliorate infectious diseases.
  • Infectious diseases include diseases associated with yeast, fungal, viral and bacterial infections.
  • Viruses associated with viral infections which can be treated or prevented in accordance with this invention include, but are not limited to, retroviruses (e.g., human T-cell lymphotrophic virus (HTLV) types I and II and human immunodeficiency virus (HIV)), he ⁇ es viruses (e.g., he ⁇ es simplex virus (HSV) types I and II, Epstein-Barr virus, HHV6-HHV8, and cytomegalovirus), arenavirues (e.g., lassa fever virus), paramyxo viruses (e.g., morbillivirus virus, human respiratory syncytial virus, mumps, and pneumovirus), adenoviruses, bunyaviruses (e.g., hantavirus), cornavirus
  • retroviruses
  • Microbial pathogens associated with bacterial infections include, but are not limited to, Streptococcus pyogenes, Streptococcus pneumoniae, Neisseria gonorrhoea, Neisseria meningitidis, Corynebacterium diphtheriae , Clostridium botulinum, Clostridium perfringens, Clostridium tetani, Haemophilus i ⁇ fluen ⁇ ae, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella rhinoscleromotis, Staphylococcus aureus, Vibrio cholerae, Escherichia coli, Pseudomonas aeruginosa, Campylobacter (Vibrio) fetus, Campylobacter jejuni, Aeromonas hydrophila, Bacillus cereus, Edwardsiella tarda, Yersinia enter ocolitica, Y
  • pseudotuberculosis Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Salmonella typhimurium, Treponema pallidum, Treponema per pneumonia, Treponema carateneum, Borrelia vincentii, Borrelia burgdorferi, Leptospira icterohemorrhagiae, Mycobacterium tuberculosis, Toxoplasma gondii, Pneumocystis carinii, Francisella tularensis, Brucella abortus, Brucella suis, Brucella melitensis, Mycoplasma spp., Rickettsia prowazeki, Rickettsia tsutsugumushi, Chlamydia spp., and Helicobacter pylori.
  • HIV Human immunodeficiency virus
  • antibodies and antibody compositions of the invention are used to treat AIDS and pathologies associated with AIDS.
  • Another embodiment of the present invention encompasses the use of antibodies of the invention to reduce death of T cells in HIV-infected patients.
  • the invention provides methods of treatment and prophylaxis by administration to a subject of an effective amount of antibody (or fragment or variant thereof) or pharmaceutical composition of the invention, preferably an antibody of the invention.
  • an antibody or fragment or variant thereof is substantially purified (i.e., substantially free from substances that limit its effect or produce undesired side-effects).
  • the subject is preferably an animal, including but not limited to, animals such as cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a mammal, and most preferably a human.
  • Formulations and methods of administration that can be employed when the compound comprises a nucleic acid or an immunoglobulin are described above; additional appropriate formulations and routes of administration can be selected from among those described herein below.
  • Various delivery systems are known and can be used to administer antibody or fragment or variant thereof of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the antibody or antibody fragment, receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as part of a retroviral or other vector, etc.
  • compositions may be administered by any convenient route, for example by infusion or bolus injection, by abso ⁇ tion through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
  • intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.
  • Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.
  • compositions of the invention may be desirable to administer locally to the area in need of freatment; this may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • a protein, including an antibody, of the invention care must be taken to use materials to which the protein does not absorb.
  • the composition can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1535 (1990); Treat et al, in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353- 365 (1989); Lopez-Berestein, ibid., pp. 3 17-327; see generally ibid.).
  • a liposome see Langer, Science 249:1527-1535 (1990); Treat et al, in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353- 365 (1989); Lopez-Berestein, ibid., pp. 3 17-327; see generally ibid.).
  • the composition can be delivered in a controlled release system.
  • a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref Biomed. Eng. 14:20 1 (1987); Buchwald et al, Surgery 88:507 (1980); Saudek et al, N. Engl. J. Med. 321:574 (1989)).
  • polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:71 (1983); see also Levy et al, Science 228:190 (1985); During et al, Ann. Neurol. 25:35 1 (1989); Howard et al, J.Neurosurg. 7 1:105 (1989)).
  • a controlled release system can be placed in proximity of the therapeutic target, i. e. , the brain, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
  • the nucleic acid can be administered in vivo to promote expression of its encoded protein, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by use of a refroviral vector (see U.S. Patent No.
  • a nucleic acid can be introduced intracellularly and inco ⁇ orated within host cell DNA for expression, by homologous recombination.
  • compositions comprise a therapeutically effective amount of an antibody or a fragment thereof, and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
  • Water is a preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.
  • Such compositions will contain a therapeutically effective amount of the antibody or fragment thereof, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
  • the formulation should suit the mode of administration.
  • the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition may also include a solubilizing agent and a local anesthetic such as lignocamne to ease pain at the site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • compositions of the invention can be formulated as neutral or salt forms.
  • Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
  • the amount of the composition of the invention which will be effective in the treatment, inhibition and prevention of a disease or disorder associated with aberrant expression and/or activity of a polypeptide of the invention can be determined by standard clinical techniques.
  • in vitro assays may optionally be employed to help identify optimal dosage ranges.
  • the precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
  • the dosage administered to a patient is typically 0.1 mg/kg to 100 mg kg of the patient's body weight.
  • the dosage administered to a patient is between 0.1 mg/kg and 20 mg/kg of the patient's body weight, more preferably 1 mg/kg to 10 mg/kg of the patient's body weight.
  • human antibodies have a longer half- life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration is often possible.
  • the dosage and frequency of administration of therapeutic or pharmaceutical compositions of the invention may be reduced by enhancing uptake and tissue penetration (e.g., into the brain) of the antibodies by modifications such as, for example, lipidation.
  • human antibodies, fragments, or variants, (e.g., derivatives), or nucleic acids are administered to a human patient for therapy or prophylaxis.
  • antibodies of the invention including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to one or more GLP-1 receptor polypeptides, or polynucleotides encoding antibodies that specifically bind to one or more GLP-1 receptor polypeptides, for both immunoassays and therapy of disorders related to GLP-1 receptor polynucleotides or polypeptides, including fragments thereof.
  • Such antibodies will preferably have an affinity for GLP-1 receptor polypeptides and/or GLP-1 receptor polypeptide fragments.
  • Preferred binding affinities include those with a dissociation constant or K D of less than or equal to 5 X 10 "2 M, 10 "2 M, 5 X 10 "3 M, 10 “3 M, 5 X 10 "4 M, 10 “4 M, 5 X 10 "5 M, or 10 "5 M. More preferably, antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with a dissociation constant or K D less than or equal to 5 X 10 "6 M, 10 “6 M, 5 X 10 "7 M, 10 “7 M, 5 X 10 “8 M, or 10 " M.
  • antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with a dissociation constant or K D less than or equal to 5 X 10 "9 M, 10 "9 M, 5 X 10 "10 M, 10 “10 M, 5 X 10 "11 M, 10 "11 M, 5 X 10 "12 M, 10 “12 M, 5 X “13 M, 10 "13 M, 5 X 10 "14 M, 10 “14 M, 5 X 10 "15 M, or 10 "15 M.
  • antibodies of the invention stimulate proliferation of GLP-1 receptor expressing cells, such as pancreatic beta cells.
  • the antibodies of the present invention may be used either alone or in combination with other compositions.
  • the antibodies may further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalent and non-covalent conjugations) to polypeptides or other compositions.
  • antibodies of the present invention may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, e.g., PCT publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP 396,387.
  • the antibody and antibody compositions of the invention may be administered alone or in combination with other therapeutic agents, including but not limited to antidiabetic agents (e.g., insulin and insulin receptor agonists, GLP-1 and GLP-1 receptor agonists, a biguanide antidiabetic agent, a glitazone antidiabetic agent, and a sulfonylurea antidiabetic agent), chemotherapeutic agents, antibiotics, antivirals, anti-retroviral agents, steroidal and non-steroidal anti-inflammatories, conventional immunotherapeutic agents and cytokines. Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially.
  • antidiabetic agents e.g., insulin and insulin receptor agonists, GLP-1 and GLP-1 receptor agonists, a biguanide antidiabetic agent, a glitazone antidiabetic agent, and a s
  • Anti-GLP-1 receptor antibodies may be administered in combination with other anti-GLP-1 receptor antibodies and/or chemotherapeutics.
  • an antibody of the invention that specifically binds GLP-1 receptor is used or administered in combination with a second antibody that specifically binds GLP-1 receptor.
  • the antibodies specific for GLP-1 receptor are agonistic antibodies that mimic some or all of the activities of GLP-1.
  • the anti-GLP-1 receptor antibodies can be administered either simultaneously, sequentially, or a combination of simultaneous or sequential administration throughout the dosage regimen.
  • anti-GLP-1 receptor antibodies are used or administered in combination with an antidiabetic agent (e.g., insulin, and insulin receptor agonist, GLP-1, a GLP-1 receptor agonist, a biguanide antidiabetic agent, a glitazone antidiabetic agent, and a sulfonylurea antidiabetic agent), a chemotherapeutic drug, antiviral drug, and/or immunomodulatory drug.
  • an antidiabetic agent e.g., insulin, and insulin receptor agonist, GLP-1, a GLP-1 receptor agonist, a biguanide antidiabetic agent, a glitazone antidiabetic agent, and a sulfonylurea antidiabetic agent
  • a chemotherapeutic drug e.g., antiviral drug, and/or immunomodulatory drug.
  • compositions of the invention are administered in combination with a chemotherapeutic agent.
  • Chemotherapeutic agents that may be administered with the compositions of the invention include, but are not limited to, antibiotic derivatives (e.g., doxorubicin (adriamycin), bleomycin, daunorubicin, and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin, and vincristine
  • antibiotic derivatives
  • antibody and antibody compositions of the invention are administered in combination with steroids, cyclosporine, cyclosporine analogs, cyclophosphamide methylprednisone, prednisone, azathioprine, FK-506, 15- deoxyspergualin, and other immunosuppressive agents that act by suppressing the function of responding T cells.
  • immunosuppressive agents that may be administered in combination with the compositions of the invention include, but are not limited to, prednisolone, methotrexate, thalidomide, methoxsalen, rapamycin, leflunomide, mizoribine (BREDiNINTM), brequinar, deoxyspergualin, and azaspirane (SKF 105685), ORTHOCLONE OKT® 3 (muromonab-CD3), SANDIMMUNETM, NEORALTM, SANGDYATM (cyclosporine), PROGRAF® (FK506, tacrolimus), CELLCEPT® (mycophenolate motef ⁇ l, of which the active metabolite is mycophenolic acid), IMURANTM (azathioprine), glucocorticosteroids, adrenocortical steroids such as DELTASONETM (prednisone) and HYDELTRASOLTM (prednisolone), FOLEXTM and MEX
  • compositions of the invention are administered in combination with immunostimulants including, but not limited to, levamisole (e.g., ERGAMISOLTM), isoprinosine (e.g., INOSIPLEXTM), interferons (e.g., interferon alpha), and interleukins (e.g., IL-2).
  • immunostimulants including, but not limited to, levamisole (e.g., ERGAMISOLTM), isoprinosine (e.g., INOSIPLEXTM), interferons (e.g., interferon alpha), and interleukins (e.g., IL-2).
  • antibody compositions of the invention may be administered in combination with anti-opportunistic infection agents.
  • Anti-opportunistic agents that may be administered in combination with the albumin fusion proteins and/or polynucleotides of the invention, include, but are not limited to, TRIMETHOPRTM-
  • NEUPOGENTM filgrastim/G-CSF
  • LEUKINETM sargramostim/GM-CSF
  • the antibodies of the invention may be administered alone or in combination with other therapeutic or prophylactic regimens (e.g., radiation therapy, chemotherapy, hormonal therapy, immunotherapy, anti-tumor agents, anti- angiogenesis and anti-inflammatory agents). Such combinatorial therapy may be administered sequentially and/or concomitantly.
  • therapeutic or prophylactic regimens e.g., radiation therapy, chemotherapy, hormonal therapy, immunotherapy, anti-tumor agents, anti- angiogenesis and anti-inflammatory agents.
  • Such combinatorial therapy may be administered sequentially and/or concomitantly.
  • the invention also encompasses combining the polynucleotides and/or polypeptides of the invention (and/or agonists or antagonists thereof) with other proposed or conventional hematopoietic therapies.
  • the polynucleotides and/or polypeptides of the invention (and/or agonists or antagonists thereof) can be combined with compounds that singly exhibit erythropoietic stimulatory effects, such as erythropoietin, testosterone, progenitor cell stimulators, insulin-like growth factor, prostaglandins, serotonin, cyclic AMP, prolactin, and triiodothyzonine.
  • aplastic anemia such as, for example, methenolene, stanozolol, and nandrolone
  • iron-deficiency anemia such as, for example, iron preparations
  • malignant anemia such as, for example, vitamin B 12 and/or folic acid
  • hemolytic anemia such as, for example, adrenocortical steroids, e.g., corticoids.
  • Compounds that enhance the effects of or synergize with erythropoietin are also useful as adjuvants herein, and include but are not limited to, adrenergic agonists, thyroid hormones, androgens, hepatic erythropoietic factors, erythrofropins, and erythrogenins, See for e.g., Dunn, "Current Concepts in Erythropoiesis", John Wiley and Sons (Chichester, England, 1983); Kalmani, Kidney Int., 22:383-391 (1982); Sha idi, New Eng. J. Med., 289:72-80 (1973); Urabe et al., J. Exp.
  • Methods for stimulating hematopoiesis comprise administering a hematopoietically effective amount (i.e., an amount which effects the formation of blood cells) of a pharmaceutical composition containing polynucleotides and/or poylpeptides of the invention (and/or agonists or antagonists thereof) to a patient.
  • a hematopoietically effective amount i.e., an amount which effects the formation of blood cells
  • the polynucleotides and/or polypeptides of the invention and/or agonists or antagonists thereof is administered to the patient by any suitable technique, including but not limited to, parenteral, sublingual, topical, intrapulmonary and intranasal, and those techniques further discussed herein.
  • the pharmaceutical composition optionally contains one or more members of the group consisting of erythropoietin, testosterone, progenitor cell stimulators, insulin-like growth factor, prostaglandins, serotonin, cyclic AMP, prolactin, triiodothyzonine, methenolene, stanozolol, and nandrolone, iron preparations, vitamin B 1 , folic acid and/or adrenocortical steroids.
  • members of the group consisting of erythropoietin, testosterone, progenitor cell stimulators, insulin-like growth factor, prostaglandins, serotonin, cyclic AMP, prolactin, triiodothyzonine, methenolene, stanozolol, and nandrolone, iron preparations, vitamin B 1 , folic acid and/or adrenocortical steroids.
  • the antibody and antibody compositions of the invention are administered in combination with hematopoietic growth factors.
  • Hematopoietic growth factors include, but are not limited to, LEUKINETM (SARGRAMOSTIMTM) and NEUPOGENTM (FILGRASTIMTM).
  • the antibody and antibody compositions of the invention are administered alone or in combination with an anti-angiogenic agent(s).
  • Anti-angiogenic agents that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, Angiostatin (Entremed, Rockville, MD), Troponin-1 (Boston Life Sciences, Boston, MA), anti-Invasive Factor, retinoic acid and derivatives thereof, paclitaxel (Taxol), Suramin, Tissue Inhibitor of Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2, VEGI, Plasminogen Activator Inhibitor- 1, Plasminogen Activator Inhibitor-2, and various forms of the lighter "d group" transition metals.
  • Lighter "d group" transition metals include, for example, vanadium, molybdenum, tungsten, titanium, niobium, and tantalum species. Such transition metal species may form transition metal complexes. Suitable complexes of the above- mentioned transition metal species include oxo transition metal complexes.
  • Representative examples of vanadium complexes include oxo vanadium complexes such as vanadate and vanadyl complexes. Suitable vanadate complexes include metavanadate and orthovanadate complexes such as, for example, ammonium metavanadate, sodium metavanadate, and sodium orthovanadate.
  • Suitable vanadyl complexes include, for example, vanadyl acetylacetonate and vanadyl sulfate including vanadyl sulfate hydrates such as vanadyl sulfate mono- and trihydrates.
  • Representative examples of tungsten and molybdenum complexes also include oxo complexes.
  • Suitable oxo tungsten complexes include tungstate and tungsten oxide complexes.
  • Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate, and tungstic acid.
  • Suitable tungsten oxides include tungsten (IV) oxide and tungsten (VI) oxide.
  • Suitable oxo molybdenum complexes include molybdate, molybdenum oxide, and molybdenyl complexes.
  • Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates.
  • Suitable molybdenum oxides include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic acid.
  • Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate.
  • Other suitable tungsten and molybdenum complexes include hydroxo derivatives derived from, for example, glycerol, tartaric acid, and sugars.
  • anti-angiogenic factors include, but are not limited to, platelet factor 4; protamine sulphate; sulphated chitin derivatives (prepared from queen crab shells), (Murata et al., Cancer Res.
  • SP- PG Sulphated Polysaccharide Peptidoglycan Complex
  • the function of this compound may be enhanced by the presence of steroids such as estrogen, and tamoxifen citrate
  • Staurosporine modulators of matrix metabolism, including for example, proline analogs, cishydroxyproline, d,L-3,4- dehydroproline, Thiaproline, alpha,alpha-dipyridyl, aminopropionitrile fumarate; 4- propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serurn; ChIMP-3 (Pavloff et al, J.
  • Anti-angiogenic agents that may be administered in combination with the compounds of the invention may work through a variety of mechanisms including, but not limited to, inhibiting proteolysis of the extracellular matrix, blocking the function of endothelial cell-extracellular matrix adhesion molecules, by antagonizing the function of angiogenesis inducers such as growth factors, and inhibiting integrin receptors expressed on proliferating endothelial cells.
  • anti-angiogenic inhibitors that interfere with extracellular matrix proteolysis and which may be administered in combination with the antibody and antibody compositions of the invention include, but are not limited to, AG-3540 (Agouron, La Jolla, CA), BAY-12-9566 (Bayer, West Haven , CT), BMS- 275291 (Bristol Myers Squibb, Princeton, NJ), CGS-27032A (Novartis, East Hanover, NJ), Marimastat (British Biotech, Oxford, UK), and Metastat (Aeterna, St-Foy, Quebec).
  • anti-angiogenic inhibitors that act by blocking the function of endothelial cell-extracellular matrix adhesion molecules and which may be administered in combination with the antibody and antibody compositions of the invention include, but are not limited to, EMD-121974 (Merck KcgaA Darmstadt, Germany) and Vitaxin (Ixsys, La Jolla, CA/Medimmune, Gaithersburg, MD).
  • anti-angiogenic agents that act by directly antagonizing or inhibiting angiogenesis inducers and which may be administered in combination with the antibody and antibody compositions of the invention include, but are not limited to, Angiozyme (Ribozyme, Boulder, CO), Anti- VEGF antibody (Genentech, S.
  • SU-101 S. San Francisco, CA
  • SU-5416 Sugen/ Pharmacia Upjohn, Bridgewater, NJ
  • SU-6668 Sugen
  • Other anti-angiogenic agents act to indirectly inhibit angiogenesis.
  • indirect inhibitors of angiogenesis which may be administered in combination with the antibody and antibody compositions of the invention include, but are not limited to, IM-862 (Cytran, Kirkland, WA), Interferon- alpha, IL-12 (Roche, Nutley, NJ), and Pentosan polysulfate (Georgetown University, Washington, DC).
  • antibody and antibody compositions of the invention in combination with anti-angiogenic agents is contemplated for the treatment, prevention, and/or amelioration of cancers and other hype ⁇ roliferative disorders.
  • antibody and antibody compositions of the invention are administered in combination with antiretroviral agents, nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs), and/or protease inhibitors (Pis).
  • NRTIs nucleoside/nucleotide reverse transcriptase inhibitors
  • NRTIs non-nucleoside reverse transcriptase inhibitors
  • Pis protease inhibitors
  • NRTIs that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, RETRO VIRTM (zidovudine/AZT), VIDEXTM (didanosine/ddl), HIVIDTM (zalcitabine/ddC), ZERITTM (stavudine/d4T), EPTVTRTM (lamivudine/3TC), and COMBIVIRTM (zidovudine/lamivudine).
  • NNRTIs that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, VIRAMUNETM (nevirapine), RESCRIPTORTM (delavirdine), and SUSTTVATM (efavirenz).
  • Protease inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, CRLXIVANTM (indinavir), NORVIRTM (ritonavir), INVIRASETM (saquinavir), and VIRACEPTTM (nelfinavir).
  • CRLXIVANTM indinavir
  • NORVIRTM ritonavir
  • INVIRASETM saquinavir
  • VIRACEPTTM shelfinavir
  • antiretroviral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse franscriptase inhibitors, and/or protease inhibitors may be used in any combination with Therapeutics of the invention to treat AIDS and/or to prevent or treat HIV infection.
  • the antibody and antibody compositions of the invention are administered in combination with an antibiotic agent.
  • Antibiotic agents that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, amoxicillin, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones, macrolides, metronidazole, penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprim-sulfamthoxazole, and vancomycin.
  • antibody and antibody compositions of the invention may be administered in combination with anti-opportunistic infection agents.
  • antibody and antibody compositions of the invention are used in any combination with TR ⁇ METHOPRIM-SULFAMETHOXAZOLETM, DAPSONETM, PENTAMIDTNETM, and/or ATOVAQUONETM to prophylactically treat, prevent, and/or diagnose an opportunistic Pneumocystis carinii pneumonia infection.
  • antibody and antibody compositions of the invention are used in any combination with ISONIAZIDTM, RiFAMPINTM, PYRAZINAMIDETM, and/or ETHAMBUTOLTM to prophylactically treat, prevent, and/or diagnose an opportunistic Mycobacterium avium complex infection.
  • antibody and antibody compositions of the invention are used in any combination with RIFABUTINTM, CLARITHROMYCTNTM, and/or AZITHROMYCINTM to prophylactically freat, prevent, and/or diagnose an opportunistic Mycobacterium tuberculosis infection.
  • antibody and antibody compositions of the invention are used in any combination with GANCICLOVIRTM, FOSCARNETTM, and/or CIDOFOVIRTM to prophylactically treat, prevent, and/or diagnose an opportunistic cytomegalovirus infection.
  • antibody and antibody compositions of the invention are used in any combination with FLUCONAZOLETM, ITRACONAZOLETM, and/or KETOCONAZOLETM to prophylactically treat, prevent, and/or diagnose an opportunistic fungal infection.
  • antibody and antibody compositions of the invention are used in any combination with ACYCLOVIRTM and/or FAMCICOLVIRTM to prophylactically treat, prevent, and/or diagnose an opportunistic he ⁇ es simplex virus type I and/or type II infection.
  • antibody and antibody compositions of the invention are used in any combination with PYRIMETHAM ⁇ NETM and/or LEUCOVORINTM to prophylactically treat, prevent, and/or diagnose an opportunistic Toxoplasma gondii infection.
  • antibody and antibody compositions of the invention are used in any combination with LEUCOVORINTM and/or NEUPOGENTM to prophylactically treat, prevent, and/or diagnose an opportunistic bacterial infection.
  • the antibody and antibody compositions of the invention are administered in combination with steroid therapy.
  • Steroids that may be administered in combination with the antibody and antibody compositions of the invention include, but are not limited to, oral corticosteroids, prednisone, and methylprednisolone (e.g., TV methy lprednisolone).
  • antibody and antibody compositions of the invention are administered in combination with prednisone.
  • the antibody and antibody compositions of the invention are administered alone or in combination with an anti-inflammatory agent.
  • Anti-inflammatory agents that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, glucocorticoids and the nonsteroidal anti-inflammatories, aminoarylcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic acid derivatives, pyrazoles, pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e- acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, arnixetrine, bendazac, benzydamine, bucolome, difenpiramide, ditazol, emorfazone, guaiazulene, nabumetone, nimesulide, orgotein
  • the antibodies and antibody compositions of the invention may be administered alone or in combination with other adjuvants.
  • Adjuvants that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Co ⁇ .), QS21 (Genentech, Inc.), BCG, and MPL.
  • antibody and antibody compositions of the invention are administered in combination with alum.
  • antibody and antibody compositions of the invention are administered in combination with QS-21.
  • Further adjuvants that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology.
  • Vaccines that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, vaccines directed toward protection against MMR (measles, mumps, rubella), polio, varicella, tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae B, whooping cough, pneumonia, influenza, Lyme's Disease, rotavirus, cholera, yellow fever, Japanese encephalitis, poliomyelitis, rabies, typhoid fever, and pertussis, and/or PNEUMOVAX- 23TM.
  • MMR measles, mumps, rubella
  • polio varicella
  • tetanus/diptheria hepatitis A
  • hepatitis B haemophilus influenzae B
  • whooping cough pneumonia, influenza, Lyme's Disease, rotavirus
  • cholera yellow fever
  • Japanese encephalitis polio
  • Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially.
  • Administration "in combination” further includes the separate administration of one of the compounds or agents given first, followed by the second.
  • antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23TM to freat, prevent, and/or diagnose infection and/or any disease, disorder, and/or condition associated therewith.
  • antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23TM to treat, prevent, and/or diagnose any Gram positive bacterial infection and/or any disease, disorder, and/or condition associated therewith.
  • antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23TM to treat, prevent, and/or diagnose infection and/or any disease, disorder, and/or condition associated with one or more members of the genus Enterococcus and/or the genus Streptococcus.
  • antibody and antibody compositions of the invention are used in any combination with PNEUMOVAX-23TM to treat, prevent, and/or diagnose infection and/or any disease, disorder, and/or condition associated with one or more members of the Group B streptococci.
  • antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23TM to treat, prevent, and/or diagnose infection and/or any disease, disorder, and/or condition associated with Streptococcus pneumoniae.
  • the antibody and antibody compositions of the invention are administered in combination with CD40 ligand (CD40L), a soluble form of CD40L (e.g., AVRENDTM), bioloigically active fragments, variants, or derivatives of CD40L, anti-CD40L antibodies (e.g., agonistic or antagonistic antibodies), and/or anti- CD40 antibodies (e.g., agonistic or antagonistic antibodies).
  • CD40L CD40 ligand
  • AVRENDTM soluble form of CD40L
  • bioloigically active fragments, variants, or derivatives of CD40L e.g., anti-CD40L antibodies (e.g., agonistic or antagonistic antibodies), and/or anti- CD40 antibodies (e.g., agonistic or antagonistic antibodies).
  • the antibody and antibody compositions of the invention are administered in combination with an NSAID.
  • the antibody and antibody compositions of the invention are administered in combination with one, two, three, four, five, ten, or more of the following drugs: NRD-101 (Hoechst Marion Roussel), diclofenac (Dimethaid), oxaprozin potassium (Monsanto), mecasermin (Chiron), T-714 (Toyama), pemetrexed disodium (Eli Lilly), atreleuton (Abbott), valdecoxib (Monsanto), kornac (Byk Gulden), campath, AGM-1470 (Takeda), CDP-571 (Celltech Chiroscience), CM-101 (CarboMed),
  • EF-5 (Scotia Pharmaceuticals), BIIL-284 (Boehringer Ingelheim), BIIF-1149 (Boehringer
  • the antibody and antibody compositions of the invention are administered in combination with one, two, three, four, five or more of the following drugs: methotrexate, sulfasalazine, sodium aurothiomalate, auranofin, cyclosporine, penicillamine, azathioprine, an antimalarial drug, cyclophosphamide, chlorambucil, gold, ENBRELTM (Etanercept), anti-TNF antibody, LJP 394 (La Jolla
  • antibody and antibody compositions of the invention are administered alone or in combination with one or more intravenous immune globulin preparations.
  • Intravenous immune globulin preparations that may be administered with the antibody and antibody compositions of the invention include, but not limited to, GAMMARTM, IVEEGAMTM, SANDOGLOBULINTM, GAMMAGARD
  • antibody and antibody compositions of the invention are administered in combination with intravenous immune globulin preparations in transplantation therapy (e.g., bone marrow transplant).
  • transplantation therapy e.g., bone marrow transplant.
  • CD40 ligand CD40L
  • a soluble form of CD40L e.g., AVRENDTM
  • biologically active fragments, variants, or derivatives of CD40L, anti-CD40L antibodies CD40 ligand (CD40L), a soluble form of CD40L (e.g., AVRENDTM), biologically active fragments, variants, or derivatives of CD40L, anti-CD40L antibodies
  • anti-CD40 antibodies e.g., agonistic or antagonistic antibodies
  • agonistic or antagonistic antibodies e.g., agonistic or antagonistic antibodies
  • anti-CD40 antibodies e.g., agonistic or antagonistic antibodies
  • the antibody and antibody compositions of the invention are administered in combination with cytokines.
  • Cytokines that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, GM-CSF, G-CSF, IL2, IL3, IL4, IL5, IL6, IL7, IL10, IL12, IL13, IL15, anti-CD40, CD40L, IFN-alpha, IFN-beta, IFN-gamma, TNF-alpha, and TNF-beta.
  • antibody and antibody compositions of the invention are administered with GLP-1 receptor.
  • antibody and antibody compositions of the invention may be administered with any interleukin, including, but not limited to, IL-lalpha, IL-lbeta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, and IL-22.
  • the antibody and antibody compositions of the invention are administered in combination with IL4 and IL10.
  • the antibody and antibody compositions of the invention are admimstered in combination with one or more chemokines.
  • the antibody and antibody compositions of the invention are administered in combination with an ⁇ (CxC) chemokine selected from the group consisting of gamma-interferon inducible protein- 10 ( ⁇ IP-10), interleukin-8 (IL-8), platelet factor-4 (PF4), neutrophil activating protein (NAP-2), GRO- ⁇ , GRO- ⁇ , GRO- ⁇ , neutrophil-activating peptide (ENA- 78), granulocyte chemoattractant protein-2 (GCP-2), and stromal cell-derived factor- 1 (SDF-1, or pre-B cell stimulatory factor (PBSF)); and/or a ⁇ (CC) chemokine selected from the group consisting of: RANTES (regulated on activation, normal T expressed and secreted), macrophage inflammatory protein- 1 alpha (MlP-l ⁇ ), macrophage inflammatory RI and IGF.
  • the antibody and antibody compositions of the invention are administered with chemokine beta- 8, chemokine beta-1, and/or macrophage inflammatory protein-4.
  • the antibody and antibody compositions of the invention are administered with chemokine beta-8.
  • the antibody and antibody compositions of the invention are administered in combination with an IL-4 antagonist.
  • IL-4 antagonists that may be administered with the antibody and antibody compositions of the invention include, but are not limited to: soluble IL-4 receptor polypeptides, multimeric forms of soluble IL-4 receptor polypeptides; anti-IL-4 receptor antibodies that bind the IL-4 receptor without transducing the biological signal elicited by IL-4, anti-IL4 antibodies that block binding of IL-4 to one or more IL-4 receptors, and muteins of IL-4 that bind IL-4 receptors but do not transduce the biological signal elicited by IL-4.
  • the antibodies employed according to this method are monoclonal antibodies (including antibody fragments, such as, for example, those described herein).
  • the antibody and antibody compositions of the invention are administered in combination with fibroblast growth factors.
  • Fibroblast growth factors that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF- 6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.
  • the compounds of the invention are preferably tested in vitro, and then in vivo for the desired therapeutic or prophylactic activity, prior to use in humans.
  • in vitro assays which can be used to determine whether administration of a specific antibody or composition of the present invention is indicated, include in vitro cell culture assays in which a patient tissue sample is grown in culture, and exposed to or otherwise administered an antibody or composition of the present invention, and the effect of such an antibody or composition of the present invention upon the tissue sample is observed.
  • in vitro assays can be carried out with representative cells of cell types involved in a patient's disorder, to determine if an antibody or composition of the present invention has a desired effect upon such cell types.
  • the antibodies or compositions of the invention are also tested in in vitro assays and animal model systems prior to administration to humans.
  • Antibodies or compositions of the present invention for use in therapy can be tested for their toxicity in suitable animal model systems, including but not limited to rats, mice, chicken, cows, monkeys, and rabbits.
  • suitable animal model systems including but not limited to rats, mice, chicken, cows, monkeys, and rabbits.
  • any animal model system known in the art may be used.
  • Antibodies or compositions of the invention can be tested for their ability to stimulate glucose-dependent insulin secretion in in vitro, ex vivo and in vivo assays.
  • Antibodies or compositions of the invention can also be tested for their ability to stimulate cAMP production in cells expressing the GLP-1 receptor in in vitro and in vivo assays.
  • Antibodies or compositions of the invention can also be tested for their ability to stimulate transcription of insulin in pancreatic beta cells in in vitro and in vivo assays known to those of skill in the art. Antibodies or compositions of the invention can also be tested for their ability to alleviate of one or more symptoms associated with diabetes, obesity, hyperglycemia, a neurological disorder or a cardiovascular disorder. Antibodies or compositions of the invention can also be tested for their ability to promote satiety in vivo. Further, antibodies or compositions of the invention can be tested for their ability to reduce fasting glucose and improve glucose tolerance in diabetic rat and mouse models.
  • Antibodies or compositions of the invention can also be tested for their ability to promote neurite outgrowth, inhibit neuronal apoptosis, and reduce amyloid beta-peptide levels in the brain; and to stimulate proliferation of cells expressing a GLP-1 receptor (e.g., cells of the pancreas, nervous system, heart, kidney, and GI tract). Techniques known to those of skill in the art can be used to analyze the function of the antibodies or compositions of the invention in vivo.
  • Antibodies or compositions of the invention can be tested for their ability to reduce tumor formation in in vitro, ex vivo and in vivo assays. Antibodies or compositions of the invention can also be tested for their ability to inhibit viral replication or reduce viral load in in vitro and in vivo assays. Antibodies or compositions of the invention can also be tested for their ability to reduce bacterial numbers in in vitj-o and in vivo assays known to those of skill in the art. Antibodies or compositions of the invention can also be tested for their ability to alleviate of one or more symptoms associated with cancer, an immune disorder (e.g., an inflammatory disease), a neurological disorder or an infectious disease.
  • an immune disorder e.g., an inflammatory disease
  • Antibodies or compositions of the invention can also be tested for their ability to decrease the time course of the infectious disease. Further, antibodies or compositions of the invention can be tested for their ability to increase the survival period of animals suffering from disease or disorder, including cancer, an immune disorder or an infectious disease. Techniques known to those of skill in the art can be used to analyze the function of the antibodies or compositions of the invention in vivo.
  • Efficacy in treating or preventing viral infection may be demonstrated by detecting the ability of an antibody or composition of the invention to inhibit the replication of the virus, to inhibit transmission or prevent the virus from establishing itself in its host, or to prevent, ameliorate or alleviate the symptoms of disease a progression.
  • the treatment is considered therapeutic if there is, for example, a reduction in viral load, amelioration of one or more symptoms, or a decrease in mortality and/or morbidity following administration of an antibody or composition of the invention.
  • Antibodies or compositions of the invention can be tested for their ability to modulate the biological activity of immune cells by contacting immune cells, preferably human immune cells (e.g., T cells, B-cells, and Natural Killer cells), with an antibody or composition of the invention or a control compound and determining the ability of the antibody or compostion of the invention to modulate (i.e, increase or decrease) the biological activity of immune cells.
  • immune cells preferably human immune cells (e.g., T cells, B-cells, and Natural Killer cells)
  • the ability of an antibody or composition of the invention to modulate the biological activity of immune cells can be assessed by detecting the expression of antigens, detecting the proliferation of immune cells (i.e., T-cell proliferation), detecting the activation of signaling molecules, detecting the effector function of immune cells, or detecting the differentiation of immune cells.
  • cellular proliferation can be assayed by ⁇ H-thymidine inco ⁇ oration assays and trypan blue cell counts.
  • Antigen expression can be assayed, for example, by immunoassays including, but not limited to, competitive and non-competitive assay systems using techniques such as western blots, immunohistochemistry radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays and FACS analysis.
  • immunoassays including, but not limited to, competitive and non-competitive assay systems using techniques such as western blots, immunohistochemistry radioimmunoassays, ELISA (enzyme linked immunosorbent assay
  • the activation of signaling molecules can be assayed, for example, by kinase assays and electrophoretic shift assays (EMSAs).
  • kinase assays and electrophoretic shift assays ESAs
  • the ability of an antibody or composition of the invention to induce cell proliferation is measured.
  • the ability of an antibody or composition of the invention to modulate chemotaxis is measured.
  • the present invention also provides for mixtures of antibodies (including scFvs and other molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to GLP-1 receptor or a fragment or variant thereof, wherein the mixture has at least one, two, three, four, five or more different antibodies of the invention.
  • the invention provides mixtures of at least 2, preferably at least 4, at least 6, at least 8, at least 10, at least 12, at least 15, at least 20, or at least 25 different antibodies that specifically bind to GLP-1 receptor or fragments or variants thereof, wherein at least 1, at least 2, at least 4, at least 6, or at least 10, antibodies of the mixture is an antibody of the invention.
  • each antibody of the mixture is an antibody of the invention.
  • the present invention also provides for panels of antibodies (including scFvs and other molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to GLP-1 receptor or a fragment or variant thereof, wherein the panel has at least one, two, three, four, five or more different antibodies of the invention.
  • the invention provides for panels of antibodies that have different affinities for GLP-1 receptor, different specificities for GLP-1 receptor, or different dissociation rates.
  • the invention provides panels of at least 10, preferably at least 25, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000, antibodies.
  • Panels of antibodies can be used, for example, in 96 well plates for assays such as ELISAs.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • kits that can be used in the above methods.
  • a kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers.
  • a kit comprises an antibody fragment that specifically binds to GLP-1 receptor polypeptides or fragments or variants thereof.
  • the kits of the present invention contain a substantially isolated GLP-1 receptor polypeptide or fragment or variant thereof as a control
  • the kits of the present invention further comprise a control antibody which does not react with any, some or all GLP-1 receptor.
  • kits of the present invention contain a means for detecting the binding of an antibody to GLP-1 receptor polypeptides (e.g., the antibody may be conjugated to a detectable substrate such as a fluorescent compound, an enzymatic substrate, a radioactive compound or a luminescent compound, or a second antibody which recognizes the first antibody may be conjugated to a detectable substrate).
  • the kit may include a recombinantly produced or chemically synthesized GLP-1 receptor.
  • the GLP-1 receptor provided in the kit may also be attached to a solid support.
  • the detecting means of the above-described kit includes a solid support to which GLP-1 receptor is attached.
  • the invention includes a diagnostic kit for use in screening serum containing antigens of the polypeptide of the invention.
  • the diagnostic kit includes a substantially isolated antibody specifically immunoreactive with GLP-1 receptor, and means for detecting the binding of GLP-1 receptor polypeptides to the antibody.
  • the antibody is attached to a solid support.
  • the antibody may be a monoclonal antibody.
  • the detecting means of the kit may include a second, labeled monoclonal antibody. Alternatively, or in addition, the detecting means may include a labeled, competing antigen.
  • test serum is reacted with a solid phase reagent having surface-bound GLP-1 receptor obtained by the methods of the present invention.
  • a solid phase reagent having surface-bound GLP-1 receptor obtained by the methods of the present invention.
  • the unbound serum components are removed by washing, reporter-labeled anti-human antibody is added, unbound anti-human antibody is removed by washing, and a reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-GLP-1 receptor antibody on the solid support.
  • the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate.
  • the solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96-well plate or filter material. These attachment methods generally include non- specific adso ⁇ tion of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, sfreptavidin coated plates can be used in conjunction with biotinylated antigen(s). [0298] Thus, the invention provides an assay system or kit for carrying out this diagnostic method.
  • the kit generally includes a support with surface-bound recombinant GLP-1 receptor, and a reporter-labeled anti-human antibody for detecting surface-bound anti-GLP-1 receptor antibody.
  • nucleic acids comprising sequences encoding antibodies or functional derivatives thereof, are administered to diagnose, treat, inhibit or prevent a disease or disorder associated with aberrant expression and/or activity of GLP-1 and/or its receptors (e.g., GLP-1 receptor), by way of gene therapy.
  • Gene therapy refers to therapy performed by the adminisfration to a subject of an expressed or expressible nucleic acid.
  • the nucleic acids produce their encoded protein that mediates a therapeutic effect.
  • a composition of the invention comprises, or alternatively consists of, nucleic acids encoding an antibody, said nucleic acids being part of an expression vector that expresses the antibody or fragments or chimeric proteins or heavy or light chains thereof in a suitable host.
  • nucleic acids have promoters, preferably heterologous promoters, operably linked to the antibody coding region, said promoter being inducible or constitutive, and, optionally, tissue-specific.
  • nucleic acid molecules are used in which the antibody coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the antibody encoding nucleic acids (Roller and Smithies, Proc. Natl Acad. Sci. USA 86:8932-8935 (1989); Zijlstra et al, Nature 342:435-438 (1989).
  • the expressed antibody molecule is an scFv; alternatively, the nucleic acid sequences include sequences encoding both the heavy and light chains, or fragments or variants thereof, of an antibody.
  • Delivery of the nucleic acids into a patient may be either direct, in which case the patient is directly exposed to the nucleic acid or nucleic acid- carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the patient. These two approaches are known, respectively, as in vivo or ex vivo gene therapy.
  • the nucleic acid sequences are directly administered in vivo, where it is expressed to produce the encoded product. This can be accomplished by any of numerous methods known in the art, e.g., by constructing them as part of an appropriate nucleic acid expression vector and administering it so that they become intracellular, e.g., by infection using defective or attenuated retro virals or other viral vectors (see U.S. Patent No.
  • microparticle bombardment e.g., a gene gun; Biolistic, Dupont
  • coating lipids or cell-surface receptors or transfecting agents, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to target cell types specifically expressing the receptors), etc.
  • nucleic acid-ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation.
  • the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publications WO 92/06 180; WO 92/22715; W092/203 16; W093/14188, WO 93/20221).
  • the nucleic acid can be introduced intracellularly and inco ⁇ orated within host cell DNA for expression, by homologous recombination (Roller and Smithies, Proc. Natl Acad. Sci.
  • viral vectors that contains nucleic acid sequences encoding an antibody of the invention or fragments or variants thereof are used.
  • a refroviral vector can be used (see Miller et al, Meth. Enzymol. 217:581-599 (1993)). These refroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA.
  • the nucleic acid sequences encoding the antibody to be used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene into a patient.
  • refroviral vectors More detail about refroviral vectors can be found in Boesen et al, Biotherapy 6:29 1-302 (1994), which describes the use of a refroviral vector to deliver the mdr 1 gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy.
  • Other references illustrating the use of refroviral vectors in gene therapy are: Clowes et al, J. Clin. Invest. 93:644-651(1994); Klein et al, Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel 3:110- 114 (1993).
  • Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy.
  • adenovirus vectors are used.
  • Adeno-associated virus has also been proposed for use in gene therapy (Walsh et al, Proc. Soc. Exp. Biol Med. 204:289-300 (1993); U.S. Patent No. 5,436,146).
  • Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer includes the fransfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a patient.
  • the nucleic acid is introduced into a cell prior to administration in vivo of the resulting recombinant cell.
  • introduction can be carried out by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell- mediated gene transfer, spheroplast fusion, etc.
  • Numerous techniques are known in the art for the introduction of foreign genes into cells (see, e.g., Loeffler and Behr, Meth. Enzymol. 217:599-718 (1993); Cohen et al, Meth.
  • the technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its cell progeny.
  • the resulting recombinant cells can be delivered to a patient by various methods known in the art.
  • Recombinant blood cells e.g., hematopoietic stem or progenitor cells
  • the amount of cells envisioned for use depends on the desired effect, patient state, etc., and can be determined by one skilled in the art.
  • Cells into which a nucleic acid can be introduced for pu ⁇ oses of gene therapy encompass any desired, available cell type, and include but are not limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc.
  • the cell used for gene therapy is autologous to the patient.
  • nucleic acid sequences encoding an antibody or fragment thereof are introduced into the cells such that they are expressible by the cells or their progeny, and the recombinant cells are then administered in vivo for therapeutic effect.
  • stem or progenitor cells are used. Any stem and/or progenitor cells which can be isolated and maintained in vitro can potentially be used in accordance with this embodiment of the present invention (see e.g., PCT Publication WO 94/08598; Stemple and Anderson, Cell 7 1:973-985 (1992); Rheinwald, Meth. Cell Bio. 21A:229 (1980); and Pittelkow and Scott, Mayo Clinic Proc. 71:771 (1986)).
  • the nucleic acid to be introduced for pu ⁇ oses of gene therapy comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by controlling the presence or absence of the appropriate inducer of transcription.
  • a library of scFvs is constructed from the RNA of human PBLs as described in WO92/01047 (which is hereby inco ⁇ orated by reference in its entirety).
  • a library of scFvs is constructed from the RNA of human PBLs as described in WO92/01047 (which is hereby inco ⁇ orated by reference in its entirety).
  • approximately 109 E. coli harboring the phagemid are used to inoculate 50 ml of 2x TY containing 1% glucose and 100 micrograms/ml of ampicillin (2xTY-AMP-GLU) and grown to an O.D. of 0.8 with shaking.
  • Ml 3 delta gene III is prepared as follows: Ml 3 delta gene III helper phage does not encode gene III protein, hence the phage(mid) displaying antibody fragments have a greater avidity of binding to antigen. Infectious Ml 3 delta gene III particles are made by growing the helper phage in cells harboring a pUC19 derivative supplying the wild type gene III protein during phage mo ⁇ hogenesis. The culture is incubated for 1 hour at 37°C without shaking and then for a further hour at 37°C with shaking.
  • Immunotubes are coated overnight in bicarbonate buffer, pH 9.0 or PBS with 1-4 ml of either 10-100 micrograms/ml of a GLP-1 receptor polypeptide.
  • bicarbonate buffer pH 9.0 is used as the coating buffer, allowing the GLP-1 receptor to dry onto the immunotube is preferable.
  • the immunotube can be coated with a polyclonal anti-GLP-1 reeceptor antibody. Then, GLP-1 receptor protein (0.5-10 micrograms/ml) is loaded onto the anti-GLP-1 receptor coated immuntobe. After a washing step to remove unbound GLP-1 receptor polypetides, such immunotubes may be used to pan the scFv library.
  • Tubes are blocked with 2% Marvel-PBS for 2 hours at 37°C and then washed 3 times in PBS. Approximately 10 13 TU of phage is applied to the tube and incubated for 30 minutes at room temperature tumbling on an over and under turntable and then left to stand for another 1.5 hours. Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with PBS. Phage are eluted by adding 1 ml of 100 mM triethylamine and rotating 15 minutes on an under and over turntable after which the solution is immediately monralized with 0.5 ml of l.OM Tris-HCl, pH 7.4. Phage are then used to infect 10 ml of mid-log E.
  • coli TGI by incubating eluted phage with bacteria for 30 minutes at 37°C.
  • the E. coli are then plated on TYE plates containing 1% glucose and 100 micrograms/ml ampicillin.
  • the resulting bacterial library is then rescued with delta gene 3 helper phage as described above to prepare phage for a subsequent round of selection. This process is usually repeated for a total of 2-4 rounds of affinity purification.
  • Binders [0320] Eluted phage from the final rounds of selection are used to infect E. coli HB 2151 and soluble scFv is produced (Marks, et al., 1991) from single colonies for assay. ELISAs are performed with microtiter plates coated with either 10 picograms/ml of the polypeptide of the present invention in 50 mM bicarbonate pH 9.6. Clones positive in ELISA are further characterized by PCR finge ⁇ rinting (see e.g., WO92/01047) and then by sequencing.
  • One method to identfy and clone VH and VL domains from cell lines expressing a particular antibody is to perform PCR with VH and VL specific primers on cDNA made from the antibody expressing cell lines. Briefly, RNA is isolated from the cell lines and used as a template for RT-PCR designed to amplify the VH and VL domains of the antibodies expressed by the EBV cell lines. Cells may lysed in the TRIzol® reagent
  • RNA is the dissolved in DEPC water and heated to 60°C for 10 minutes. Quantities of RNA can determined using optical density measurements.
  • cDNA may be synthesized, according to methods well-known in the art, from
  • RNA 1.5-2.5 micrograms of RNA using reverse transciptase and random hexamer primers. cDNA is then used as a template for PCR amplification of VH and VL domains.
  • DNA encoding an scFv may be used as template mateial for the following PCR reaction.
  • Primers used to amplify VH and VL genes are shown in Table 4.
  • a PCR reaction makes use of a single 5' primer and a single 3' primer.
  • RNA template is limiting, or for greater efficiency, groups of 5' and/or 3' primers may be used. For example, sometimes all five VH-5' primers and all JH3' primers are used in a single PCR reaction.
  • the PCR reaction is carried out in a 50 microliter volume containing IX PCR buffer, 2mM of each dNTP, 0.7 units of High Fidelity Taq polymerse, 5' primer mix, 3' primer mix and 7.5 microliters of cDNA.
  • the 5' and 3' primer mix of both VH and VL can be made by pooling together 22 pmole and 28 pmole, respectively, of each of the individual primers.
  • PCR conditions are: 96°C for 5 minutes; followed by 25 cycles of 94°C for 1 minute, 50°C for 1 minute, and 72°C for 1 minute; followed by an extension cycle of 72°C for 10 minutes. After the reaction is completed, sample tubes were stored 4°C.
  • Hu Vlambdal-5' 54 CAGTCTGTGTTGACGCAGCCGCC
  • PCR samples are then electrophoresed on a 1.3% agarose gel. DNA bands of the expected sizes (-506 base pairs for VH domains, and 344 base pairs for VL domains) can be cut out of the gel and purified using methods well known in the art. Purified PCR products can be ligated into a PCR cloning vector (TA vector from Invitrogen Inc., Carlsbad, CA). Individual cloned PCR products can be isolated after transfection of E. coli and blue/white color selection. Cloned PCR products may then be sequenced using methods commonly known in the art.
  • TA vector from Invitrogen Inc., Carlsbad, CA
  • Example 3 Detecting Stimulation of Intracellular cAMP using Anti-GLP-1 Receptor Antibodies
  • GLP-1 The ability of GLP-1 to mediate its cellular effects, including the induction of insulin secretion, is dependent on its engagement of the GLP-1 receptor and subsequent activation of adenylate cyclase and production of cAMP (Hoosein and Gurd 1984; Widmann et al, 1994; Flamez et al, 1999).
  • HEK293 cells can be engineered to stably express human GLP-1 receptor as previously described (Burcelin et al, 1999; Xiao et al, 2001).
  • This assay can be used to compare the potencies of anti-GLP- 1 receptor antibodies with that of the free GLP-1 peptide or other GLP-1 receptor agonists.
  • HEK293/GLP1R cells are treated with increasing doses of anti-GLP-1 receptor anitbodies and GLP-1 peptide. After a 2-hour incubation, cells are harvested and the intracellular level of cAMP determined using a commercially available chemiluminescent bioassay (Applied Biosystems) and quantified using a luminometer (Dyax).
  • GLP-1 insulinotropic action of GLP-1 is directly relevant to its anti-diabetogenic effect.
  • Insulinoma cell lines have been widely used to study insulin secretion in vitro.
  • the rat insulinoma cell line INS-1 has been useful because it retains the glucose- dependent insulin secreting capacity of isolated islets (Hohmeier et al, 2000).
  • a clonal variant of this cell line (INS-1 832/13) was genetically engineered to reliably maintain these features when passaged in culture (Hohmeier et al, 2000). This cell line can be used to evaluate the insulinotropic activity of anti-GLP-1 receptor antibodies compared to other GLP-1 receptor agonists, including GLP-1 peptides.
  • INS-1 832/13 cells are seeded in 48-well dish at the density of -0.2 X 106 per well in standard growth medium. After 2-3 days in culture, cells are 80-90% confluent and the medium is changed to regular growth medium containing 5 mM of glucose. After 18 hours in this normoglycemic medium, the cells are starved in Hank's buffered saline in the presence of 3 mM of glucose for 2 hours. Treatments are performed in this same buffer at the indicated protein concentrations. Following 3 hours of treatment, RNA is extracted using Trizol (Invitrogen). Insulin transcript and 18S RNA are quantified by real-time PCR. Insulin mRNA levels are expressed as the ratio to 18S RNA.
  • INS-1 832/13 cells are seeded in 48-well dish at the density of -0.2 X 106 per well in standard growth medium. After 2-3 days in culture (at 80-90% confluence), the medium is changed to regular growth medium containing 5 mM of glucose. After 18 hours in this normoglycemic medium, the cells are starved in Hank's buffered saline in the presence of 3 mM of glucose for 2 hours. Treatments (e.g., anti- GLP-1 receptor antibodies vs. GLP-1 vs. GLP-1 receptor agonists) are performed in this same buffer at varying drug and glucose concentrations. After a 3 hour treatment, supernatants are harvested by centrifugation and total insulin is measured by ELISA.
  • Exendin-4 a potent DPPIV-resistant analog of GLP-1, is used as a positive confrol based on its published efficacious dose (Young et al, 1999).
  • Agonistic GLP-1 receptor antibodies are expected to reduce the hypoglycemic levels achieved by controlled feeding and increase glucose clearance after IP glucose tolerance test.
  • the db/db mouse model can be used to measure the ability of anti-GLP-1 receptor antibodies to improve glucose tolerance in mice defective in the leptin receptor function (db/db mice).
  • mice are randomized into groups of 5.
  • mice are injected with an anti-GLP-1 receptor antibody, or another GLP-1 receptor agonists, such as GLP-1 or Exendin-4 for 6 days. Fasting glucose and oral glucose tolerance are measured on Days 1, 2 and 7.
  • GLP-1 receptor agonists are expected to increase glucose clearance compared to negative controls.
  • a high-fat diet is the major cause of obesity and insulin resistance (Saltiel and Kahn, 2001; Marx 2002).
  • normal lean mice fed a high-fat diet develop defective glycemic control, hyperglycemia, and obesity (Ahren et al, 1997; Tsunoda et al, 1998).
  • the acute effects of agonistic anti-GLP-1 antibody administration on oral glucose tolerance in high fat-fed diabetic mice can be examined. Fasted high fat-fed obese mice are administered an agonistic anti-GLP-1 antibody, GLP-1 agonist, or negative control injection. Mice are administered an oral glucose tolerance test 2 and 24 hour post drug administration.
  • mice are allowed access to food after the first OGTT, then fasted again prior to the second OGTT. Blood glucose is monitored by tail bleed using a glucometer. GLP-1 receptor agonists are expected to improved glucose tolerance in high fat-fed diabetic mice.

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Neurology (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Endocrinology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to antibodies and related molecules that specifically bind to the glucagon like peptide-1 (GLP-1) receptor. Such antibodies have uses, for example, in the treatment of diabetes, obesity, hyperglycemia, neurodegenerative disorders, and heart disease. The invention also relates to nucleic acid molecules encoding anti-GLP-1 receptor antibodies, vectors and host cells containing these nucleic acids, and methods for producing the same. The present invention relates to methods and compositions for preventing, detecting, diagnosing, treating or ameliorating a disease or disorder including diabetes, obesity, hyperglycemia, neurodegenerative disorders, and heart disease, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that specifically bind to the GLP-1 receptor.

Description

Agonist Antibodies that Specifically Bind the Glucagon Like Peptide-1 Receptor
Field of the Invention
[0001] The present invention relates to antibodies and related molecules that specifically bind to the glucagon like peptide-1 (GLP-1) receptor. Such antibodies have uses, for example, in the treatment of diabetes, obesity, hyperglycemia, neurodegenerative disorders, and heart disease. The invention also relates to nucleic acid molecules encoding anti-GLP-1 receptor antibodies, vectors and host cells containing these nucleic acids, and methods for producing the same. The present invention relates to methods and compositions for preventing, detecting, diagnosing, treating or ameliorating a disease or disorder including diabetes, obesity, hyperglycemia, neurodegenerative disorders, and heart disease, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that specifically bind to the GLP-1 receptor.
Background of the Invention
[0002] Glucagon-like peptide-1 (GLP-1) is a 30 amino acid peptide secreted by intestinal L cells in response to the ingestion of food (Mojsov et al., J Biol Chem. 1986; 261 (25): 11880- 11889). In a healthy individual, GLP-1 plays an important role in controlling post-prandial blood glucose levels. Increases in GLP-1 have two significant effects on pancreatic regulation of glucose metabolism: GLP-1 stimulates glucose- dependent insulin secretion resulting in increased glucose absorption in the periphery and it suppresses glucagon secretion leading to reduced hepatic glucose output. GLP-1 also delays gastric emptying and slows small bowel motility. These effects are considered beneficial because delayed food absorption will decrease the level of insulin necessary to maintain normoglycemia and may affect satiety. For reviews see, e.g., Drucker, Gastroenterology 2002; 122(2):531-44; Drucker, Diabetes 1998 47(2):159-69; Hellstrom et al, Physiol Behav 2001 74(4-5):735-41. In addition, GLP-1 has been shown to have neurotrophic and neuroprotective properties (see, e.g., Perry et al., J Neurosci Res. 2003 Jun 1;72(5):603-12; Perry et al., J Alzheimers Dis. 2002 Dec;4(6):487-96). [0003] All of the known direct effects of GLP-1 are mediated through its binding to the GLP-1 receptor (GLPIR) and subsequent signaling primarily through activation of adenylate cyclase (Goke et al, J Endocrinol. 1988; 116(3):357-362; Thorens, PNAS 1992; 89(18):8641-8645; Widmann et al, Mol Pharmacol. 1994; 45(5): 1029- 1035). Intracellular production of cAMP serves, therefore, as a simple measure of GLPIR signaling. [0004] In Type 2 diabetics the normal post-prandial rise in GLP-1 level is absent or reduced. Clinical studies have demonstrated that meal-related insulin requirements and plasma insulin levels in both insulin-dependent and non-insulin-dependent diabetic patients are greatly reduced after GLP-1 infusion, that recombinant GLP-1 effectively stimulates glucose-dependent insulin secretion (mimicking the natural incretin effect), and that GLP-1 infusion lowers blood glucose in the overnight fasting state, not just after meal ingestion. In addition to its acute actions on the pancreas, GLP-1 promotes continued beta cell competence by inhibiting beta cell apoptosis and degeneration, stimulating transcription of genes important for glucose dependent insulin secretion, and by promoting beta-cell neogenesis. Furthermore, numerous groups have reported increased satiety, reduced caloric intake and or weight loss in GLP-1 treated humans. See, e.g., Vilsbøll et al., Diabet Med. 2001; 18(2):144-149; Gutniak et al., N Engl J Med. 1992; 326(20):1316- 1322; Rachman et al., Diabetes. 1996; 45(11):1524-1530; Holz et al, Nature 1993; 361(6410):362-365; and Delgado-Aros Am J Physiol Gastrointest Liver Physiol. 2002; 282(3):G424-431.
[0005] Accordingly, GLP-1 receptor agonists have wide therapeutic applications. However, the use of GLP-1 as a therapeutic is limited by its very short serum half-life, about 5 minutes in man (Orskov et al, 1993). There is a clear need, therefore, for identification and characterization of compositions, such as antibodies, that exhibit extended serum half-lives relative to native GLP-1, and mimic some or all of the biological activities of GLP-1, in both normal and in disease states. In particular, there is a need to isolate and characterize antibodies that modulate the activity of GLP-1 receptors for the treatment of metabolic disorders such as diabetes, obesity, and hyperglycemia; neurodegenerative disorders such as Alzheimer's disease; and heart disease.
Summary of the Invention
[0006] The present invention encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a glucagon like peptide-1 receptor (GLP-1 receptor; described in International Publication Nos. WO 93/19175, WO 95/04821, and U.S Patents 5,670,360, 5,846,747, and 6,051,689, each of which are hereby incorporated by reference in their entireties) or a polypeptide fragment or variant of the GLP-1 receptor. In particular, the invention encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a GLP-1 receptor polypeptide or polypeptide fragment or variant of human GLP-1 receptor such as SEQ ID NO:2.
[0007] The present invention relates to methods and compositions for preventing, treating or ameliorating a disease or disorder comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that specifically bind to the GLP-1 receptor or a fragment or variant thereof. In specific embodiments, the present invention relates to methods and compositions for preventing, treating or ameliorating a disease or disorder associated with the GLP-1 receptor function or aberrant the GLP-1 receptor expression, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that specifically bind to the GLP-1 receptor or a fragment or variant thereof.
[0008] In highly preferred embodiments, the present invention encompasses methods for using the antibodies of the present invention to treat, prevent, diagnose and/or prognose a metabolic disease or disorder. In highly preferred embodiments, the present invention encompasses methods for using antibodies of the invention to treat, prevent, diagnose and/or prognose type 1 diabetes, type 2 diabetes, obesity, and hyperglycemia. In highly preferred embodiments, the present invention encompasses methods for using the antibodies of the present invention to promote satiety and weight loss in a patient. [0009] In additional preferred embodiments, the present invention relates to antibody- based methods and compositions for preventing, treating or ameliorating cardiovascular diseases and disorders.
[0010] In other preferred embodiments, the present invention relates to antibody-based methods and compositions for preventing, treating or ameliorating neurological diseases and conditions such as neurodegenerative disorders (e.g., Alzheimer's disease, Parkinson's disease, Huntington's disease, ALS) and stroke.
[0011] In other highly preferred embodiments, the invention encompasses methods for using the antibodies of the invention to stimulate cAMP production in cells expressing the GLP-1 receptor, and to stimulate transcription of insulin mRNA and glucose-dependent insulin secretion in pancreatic beta cells and other cell lines expressing the GLP-1 receptor. In specific embodiments, the invention encompasses methods for using the antibodies of the present invention to promote pancreatic beta cell proliferation and pancreatic islet neogenesis; and/or to inhibit beta cell degeneration and apoptosis. [0012] In other highly preferred embodiments, the invention encompasses methods for using the antibodies of the invention to delay gastric emptying and slow small bowel motility.
[0013] In other preferred embodiments, the invention encompasses methods for using the antibodies of the invention to promote neurite outgrowth, inhibit neuronal apoptosis, and reduce amyloid beta-peptide levels in the brain.
[0014] In other preferred embodiments, the invention encompasses methods for using the antibodies of the invention to stimulate proliferation of cells expressing a GLP-1 receptor (e.g., cells of the pancreas, nervous system, heart, kidney, and GI tract). [0015] Another embodiment of the present invention includes the use of the antibodies of the invention as a diagnostic tool to monitor the expression of GLP-1 receptors. [0016] The present invention also encompasses cell lines engineered to express the antibodies of the invention.
[0017] Further, the present invention encompasses polynucleotides encoding the antibodies of the invention, as well as the corresponding amino acid sequences of the antibodies of the invention. Molecules comprising, or alternatively consisting of, fragments or variants of these antibodies that specifically bind to the GLP-1 receptor polypeptide or fragments or variants thereof are also encompassed by the invention, as are nucleic acid molecules that encode these antibodies and/or molecules. [0018] The present invention also provides anti-GLP-1 receptor antibodies which are coupled to a detectable label, such as an enzyme, a fluorescent label, a luminescent label, or a bioluminescent label. The present invention also provides anti-GLP-1 receptor antibodies which are coupled to a therapeutic or cytotoxic agent. The present invention also provides anti-GLP-1 receptor antibodies which are coupled to a radioactive material. [0019] The present invention provides antibodies that specifically bind one or more GLP-1 receptor polypeptide and that act as GLP-1 receptor agonists. [0020] In specific embodiments, the antibodies of the invention stimulate cAMP production in cells that express the GLP-1 receptor. In specific embodiments, the antibodies of the invention stimulate transcription of insulin in pancreatic beta cells. In specific embodiments, the antibodies of the invention stimulate glucose-dependent insulin secretion in pancreatic beta cells.
[0021] In specific embodiments, the antibodies of the invention reduce fasting glucose in diabetic rat and mouse models (e.g., Zucker fatty diabetic rats, db/db mice, and high fat diet-induced diabetic mice). In specific embodiments, the antibodies of the invention improve glucose tolerance in diabetic rat and mouse models.
[0022] In further embodiments, the antibodies of the invention have a longer serum half-life in vivo than GLP-1. In preferred embodiments, the antibodies of the invention have an in vivo serum half-life of greater than 1 day. In preferred embodiments, the antibodies of the invention have an in vivo serum half-life of greater than 10 days. [0023] In further embodiments, the antibodies of the invention have a dissociation constant (KD) of 10"7 M or less. In preferred embodiments, the antibodies of the invention have a dissociation constant (KD) of 10"9 M or less.
[0024] In further embodiments, antibodies of the invention have an off rate (koff) of 10"3/sec or less. In preferred embodiments, antibodies of the invention have an off rate (koff) of lO^/sec or less. In other preferred embodiments, antibodies of the invention have an off rate (k0ff) of 10"5/sec or less.
[0025] The present invention also provides panels of antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants) wherein the panel members correspond to one, two, three, four, five, ten, fifteen, twenty, or more different antibodies of the invention (e.g., whole antibodies, Fabs, F(ab')2 fragments, Fd fragments, disulfide-linked Fvs (sdFvs), anti-idiotypic (anti-Id) antibodies, and scFvs). The present invention further provides mixtures of antibodies, wherein the mixture corresponds to one, two, three, four, five, ten, fifteen, twenty, or more different antibodies of the invention (e.g., whole antibodies, Fabs, F(ab')2 fragments, Fd fragments, disulfide- linked Fvs (sdFvs), anti-idiotypic (anti-Id) antibodies, and scFvs)). The present invention also provides for compositions comprising, or alternatively consisting of, one, two, three, four, five, ten, fifteen, twenty, or more antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof). A composition of the invention may comprise, or alternatively consist of, one, two, three, four, five, ten, fifteen, twenty, or more amino acid sequences of one or more antibodies or fragments or variants thereof. Alternatively, a composition of the invention may comprise, or alternatively consist of, nucleic acid molecules encoding one or more antibodies of the invention.
[0026] The present invention also provides for fusion proteins comprising an antibody (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) of the invention, and a heterologous polypeptide (i.e., a polypeptide unrelated to an antibody or antibody domain). Nucleic acid molecules encoding these fusion proteins are also encompassed by the invention. A composition of the present invention may comprise, or alternatively consist of, one, two, three, four, five, ten, fifteen, twenty or more fusion proteins of the invention. Alternatively, a composition of the invention may comprise, or alternatively consist of, nucleic acid molecules encoding one, two, three, four, five, ten, fifteen, twenty or more fusion proteins of the invention. [0027] The present invention also provides for a nucleic acid molecule(s), generally isolated, encoding an antibody (including molecules, such as scFvs, VH domains, or VL domains, that comprise, or alternatively consist of, an antibody fragment or variant tliereof) of the invention. The present invention also provides a host cell transformed with a nucleic acid molecule of the invention and progeny thereof. The present invention also provides a method for the production of an antibody (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof) of the invention. The present invention further provides a method of expressing an antibody (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof) of the invention from a nucleic acid molecule. These and other aspects of the invention are described in further detail below.
Detailed Description of the Invention Definitions
[0028] The term "GLP-1 receptor", as used herein, refers to the polypeptide, or portions thereof, corresponding to the amino acid sequence of SEQ ID NO:2, as well as polynucleotides encoding the GLP-1 receptor polypeptides, such as the nucleic acid sequence of SEQ ID NO:l, and portions thereof. In addition, the term "GLP-1 receptor" encompasses numerous variant polypeptide sequences known in the art. By way of non- limiting examples, variant GLP-1 receptor polypeptides include those disclosed in GenBank Accession Nos: AAA17021, AAA03614, AAC50050, AAA62471, AAA63787, P43220, as well polynucleotides encoding these variant GLP-1 receptor polypeptides. In specific embodiments, variant GLP-1 receptor polypeptides contain an amino acid substitution at one or more of the following residues of SEQ ID NO:2 : Leu-12, Arg-44, Arg-131, Ser-136, Pro-137, Gly-151, Gln-221, Phe-260, Tyr-289, and Gly-316. [0029] The term "antibody," as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that specifically binds an antigen. As such, the term antibody encompasses not only whole antibody molecules, but also antibody multimers and antibody fragments as well as variants (including derivatives) of antibodies, antibody multimers and antibody fragments. Examples of molecules which are described by the term "antibody" herein include, but are not limited to: single chain Fvs (scFvs), Fab fragments, Fab' fragments, F(ab')2, disulfide linked Fvs (sdFvs), Fvs, and fragments comprising or alternatively consisting of, either a VL or a VH domain. The term "single chain Fv" or "scFv" as used herein refers to a polypeptide comprising a VH domain of antibody linked to a VL domain of an antibody. Antibodies that specifically bind to the GLP-1 receptor may have cross-reactivity with other antigens. Preferably, antibodies that specifically bind to the GLP-1 receptor do not cross-react with other antigens (e.g., other members of the PACAP/glucagon receptor superfamily. See, e.g., Sherwood et al., Endocrine Reviews 21(6):619-670. Antibodies that specifically bind to the GLP-1 receptor can be identified, for example, by immunoassays or other techniques known to those of skill in the art.
[0030] Antibodies of the invention include, but are not limited to, monoclonal, multispecific, human or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), intracellularly-made antibodies (i.e., intrabodies), and epitope-binding fragments of any of the above. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGls IgG2, IgG3, IgG4, IgAi and IgA ) or subclass of immunoglobulin molecule. In a preferred embodiment, the immunoglobulin is an IgGi isotype. In another preferred embodiment, the immunoglobulin is an IgG4 isotype. Immunoglobulins may have both a heavy and light chain. An array of IgG, IgE, IgM, IgD, IgA, and IgY heavy chains may be paired with a light chain of the kappa or lambda forms. [0031] Antibodies of the invention may also include multimeric forms of antibodies. For example, antibodies of the invention may take the fonn of antibody dimers, trimers, or higher-order multimers of monomeric immunoglobulin molecules. Dimers of whole immunoglobulin molecules or of F(ab')2 fragments are tetravalent, whereas dimers of Fab fragments or scFv molecules are bivalent. Individual monomers withon an antibody multimer may be identical or different, i.e., they may be heteromeric or homomeric antibody multimers. For example, individual antibodies within a multimer may have the same or different binding specificities.
[0032] Multimerization of antibodies may be accomplished through natural aggregation of antibodies or through chemical or recombinant linking techniques known in the art. For example, some percentage of purified antibody preparations (e.g., purified IgGi molecules) spontaneously form protein aggregates containing antibody horiiodimers, and other higher-order antibody multimers. Alternatively, antibody homodimers may be formed through chemical linkage techniques known in the art. For example, heterobifunctional crosslinking agents including, but not limited to, SMCC [succinimidyl 4-(maleimidomethyl)cyclohexane-l-carboxylate] and SATA [N-succinimidyl S- acethylthio-acetate] (available, for example, from Pierce Biotechnology, Inc. (Rockford, IL)) can be used to form antibody multimers. An exemplary protocol for the formation of antibody homodimers is given in Ghetie et al., Proceedings of the National Academy of Sciences USA (1997) 94:7509-7514, which is hereby incorporated by reference in its entirety. Antibody homodimers can be converted to Fab'2 homodimers through digestion with pepsin. Another way to form antibody homodimers is through the use of the autophilic T15 peptide described in Zhao and Kohler, The Journal of Immunology (2002) 25:396-404, which is hereby incorporated by reference in its entirety. [0033] Alternatively, antibodies can be made to multimerize through recombinant DNA techniques. IgM and IgA naturally form antibody multimers through the interaction with the J chain polypeptide. Non-IgA or non-IgM molecules, such as IgG molecules, can be engineered to contain the J chain interaction domain of IgA or IgM, thereby conferring the ability to form higher order multimers on the non-IgA or non-IgM molecules, (see, for example, Chintalacharuvu et al., (2001) Clinical Immunology 101:21-31. and Frigerio et al, (2000) Plant Physiology 123:1483-94., both of which are hereby incorporated by reference in their entireties.) ScFv dimers can also be formed through recombinant techniques known in the art; an example of the construction of scFv dimers is given in Goel et al, (2000) Cancer Research 60:6964-6971 which is hereby incorporated by reference in its entirety. Antibody multimers may be purified using any suitable method known in the art, including, but not limited to, size exclusion chromatography. [0034] By "isolated antibody" is intended an antibody removed from its native environment. Thus, an antibody produced by, purified from and/or contained within a hybridoma and/or a recombinant host cell is considered isolated for purposes of the present invention.
[0035] Unless otherwise defined in the specification, specific binding or immunospecifc binding by an anti-GLP-1 receptor antibody means that the anti-GLP-1 receptor antibody binds the GLP-1 receptor but does not significantly bind to (i.e., cross- react with) proteins other than the GLP-1 receptor, such as other proteins in the same family of proteins. An antibody that binds the GLP-1 receptor protein and does not cross- react with other proteins is not necessarily an antibody that does not bind said other proteins in all conditions; rather, the GLP-1 receptor-specific antibody of the invention preferentially binds the GLP-1 receptor compared to its ability to bind said other proteins such that it will be suitable for use in at least one type of assay or treatment, i.e., give low background levels or result in no unreasonable adverse effects in treatment. It is well known that the portion of a protein bound by an antibody is known as the epitope. An epitope may either be linear (i.e., comprised of sequential amino acids residues in a protein sequences) or conformational (i.e., comprised of one or more amino acid residues that are not contiguous in the primary structure of the protein but that are brought together by the secondary, tertiary or quaternary structure of a protein). Given that GLP-1 receptor-specific antibodies bind to epitopes of the GLP-1 receptor, an antibody that specifically binds the GLP-1 receptor may or may not bind fragments of the GLP-1 receptor and/or variants of the GLP-1 receptor (e.g., proteins that are at least 90% identical to the GLP-1 receptor) depending on the presence or absence of the epitope bound by a given GLP-1 receptor-specific antibody in the GLP-1 receptor fragment or variant. Likewise, GLP-1 receptor-specific antibodies of the invention may bind species orthologues of the GLP-1 receptor (including fragments thereof) depending on the presence or absence of the epitope recognized by the antibody in the orthologue. Additionally, GLP-1 receptor-specific antibodies of the invention may bind modified forms of the GLP-1 receptor. Antibodies that specifically bind to the GLP-1 receptor can be identified, for example, by immunoassays or other techniques known to those of skill in the art, e.g., the immunoassays described in the Examples below. [0036] The term "variant" as used herein refers to a polypeptide that possesses a similar or identical amino acid sequence as a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, an anti-GLP-1 receptor antibody or antibody fragment thereof. A variant having a similar amino acid sequence refers to a polypeptide that satisfies at least one of the following: (a) a polypeptide comprising, or alternatively consisting of, an amino acid sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the amino acid sequence of a GLP-1 receptor polypeptide, a fragment thereof, an anti-GLP-1 receptor antibody or antibody fragment thereof (including a VH domain, VHCDR, VL domain, or VLCDR) described herein; (b) a polypeptide encoded by a nucleotide sequence, the complementary sequence of which hybridizes under stringent conditions to a nucleotide sequence encoding a GLP-1 receptor polypeptide (e.g., SEQ ID NO:l), a fragment of a GLP-1 receptor polypeptide, an anti-GLP-1 receptor antibody or antibody fragment thereof (including a VH domain, VHCDR, VL domain, or VLCDR), described herein, of at least 5 amino acid residues, at least 10 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 30 amino acid residues, at least 40 amino acid residues, at least 50 amino acid residues, at least 60 amino residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues, at least 125 amino acid residues, or at least 150 amino acid residues; and (c) a polypeptide encoded by a nucleotide sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%, identical to the nucleotide sequence encoding a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, an anti-GLP-1 receptor antibody or antibody fragment thereof (including a VH domain, VHCDR, VL domain, or VLCDR), described herein. A polypeptide with similar structure to a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, an anti- GLP-1 receptor antibody or antibody fragment thereof, described herein refers to a polypeptide that has a similar secondary, tertiary or quaternary structure of a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, an anti-GLP-1 receptor antibody, or antibody fragment thereof, described herein. The structure of a polypeptide can be determined by methods known to those skilled in the art, including but not limited to, X-ray crystallography, nuclear magnetic resonance, and crystallographic electron microscopy. Preferably, a variant GLP-1 receptor polypeptide, a variant fragment of a GLP-1 receptor polypeptide, or a variant anti-GLP-1 receptor antibody and/or antibody fragment possesses similar or identical function and/or structure as the reference GLP-1 receptor polypeptide, the reference fragment of a GLP-1 receptor polypeptide, or the reference anti-GLP-1 receptor antibody and/or antibody fragment, respectively. [0037] To determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical overlapping positions/total number of positions x 100%). In one embodiment, the two sequences are the same length.
[0038] The determination of percent identity between two sequences can be accomplished using a mathematical algorithm known to those of skill in the art. An example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-2268(1990), modified as in Karlin and Altschul Proc. Natl Acad. Sci. USA 90:5873-5877(1993). The BLASTn and BLASTx programs of Altschul, et al. J. Mol. Biol. 215:403-410(1990) have incorporated such an alogrithm. BLAST nucleotide searches can be performed with the BLASTn program (score = 100, wordlength = 12) to obtain nucleotide sequences homologous to a nucleic acid molecules of the invention. BLAST protein searches can be performed with the BLASTx program (score = 50, wordlength = 3) to obtain amino acid sequences homologous to a protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. Nucleic Acids Res. 25:3589-3402(1997). Alternatively, PSI-BLAST can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI-BLAST programs, the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. [0039] Another example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). The ALIGN program (version 2.0) which is part of the GCG sequence alignment software package has incoφorated such an alogrithm. Other algorithms for sequence analysis known in the art include ADVANCE and ADAM as described in Torellis and Robotti Comput. Appl Bioscl, 10 :3-5(1994); and FASTA described in Pearson and Lipman Proc. Natl. Acad. Sci. §5:2444-8(1988). Within FASTA, ktup is a control option that sets the sensitivity and speed of the search.
[0040] The term "derivative" as used herein, refers to a variant polypeptide of the invention that comprises, or alternatively consists of, an amino acid sequence of a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an antibody of the invention that specifically binds to a GLP-1 receptor polypeptide, which has been altered by the introduction of amino acid residue substitutions, deletions or additions. The term "derivative" as used herein also refers to a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an antibody that specifically binds to a GLP-1 receptor polypeptide which has been modified, e.g., by the covalent attachment of any type of molecule to the polypeptide. For example, but not by way of limitation, a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an anti-GLP-1 receptor antibody, may be modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. A derivative of a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an anti-GLP- 1 receptor antibody, may be modified by chemical modifications using techniques known to those of skill in the art, including, but not limited to, specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Further, a derivative of a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an anti- GLP-1 receptor antibody, may contain one or more non-classical amino acids. A polypeptide derivative possesses a similar or identical function as a GLP-1 receptor polypeptide, a fragment of a GLP-1 receptor polypeptide, or an anti-GLP-1 receptor antibody, described herein. [0041] The term "fragment" as used herein refers to a polypeptide comprising an amino acid sequence of at least 5 amino acid residues, at least 10 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 30 amino acid residues, at least 35 amino acid residues, at least 40 amino acid residues, at least 45 amino acid residues, at least 50 amino acid residues, at least 60 amino residues, at least 70 amino acid residues, at least 80 amino acid residues, or at least 90 amino acid residues, of the amino acid sequence of GLP-1 receptor, or an anti-GLP-1 receptor antibody (including molecules such as scFv's, that comprise, or alternatively consist of, antibody fragments or variants thereof) that specifically binds to GLP-1 receptor.
[0042] The term "host cell" as used herein refers to the particular subject cell transfected with a nucleic acid molecule and the progeny or potential progeny of such a cell. Progeny may not be identical to the parent cell transfected with the nucleic acid molecule due to mutations or environmental influences that may occur in succeeding generations or integration of the nucleic acid molecule into the host cell genome.
Antibody Structure
[0043] The basic antibody structural unit is known to comprise a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function. Human light chains are classified as kappa and lambda light chains. Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. See generally, Fundamental Immunology Ch. 7 (Paul, W., ed., 2nd ed. Raven Press, N.Y. (1989)) (incorporated by reference in its entirety for all purposes). The variable regions of each light/heavy chain pair form the antibody binding site. [0044] Thus, an intact IgG antibody has two binding sites. Except in bifunctional or bispecific antibodies, the two binding sites are the same.
[0045] The chains all exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions, also called complementarity determimng regions or CDRs. The CDRs from the heavy and the ligt chains of each pair are aligned by the framework regions, enabling binding to a specific epitope. From N-terminal to C-terminal, both light and heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of amino acids to each domain is in accordance with the definitions of Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia & Lesk J Mol. Biol. 196:901-917 (1987); Chothia et al. Nature 342:878-883 (1989).
[0046] A bispecific or bifunctional antibody is an artificial hybrid antibody having two different heavy/light chain pairs and two different binding sites. Bispecific antibodies can be produced by a variety of methods including fusion of hybridomas or linking of Fab' fragments. See, e.g., Songsivilai & Lachmann Clin. Exp. Immunol. 79: 315-321 (1990), Kostelny et al. J Immunol. 148:1547 1553 (1992). In addition, bispecific antibodies may be formed as "diabodies" (Holliger et al. "'Diabodies': small bivalent and bispecific antibody fragments" PNAS USA 90:6444-6448 (1993)) or "Janusins" (Traunecker et al. "Bispecific single chain molecules (Janusins) target cytotoxic lymphocytes on HIV infected cells" EMBO J 10:3655-3659 (1991) and Traunecker et al. "Janusin: new molecular design for bispecific reagents" Int. J. Cancer Suppl. 7:51-52 (1992)). [0047] Production of bispecific antibodies can be a relatively labor intensive process compared with production of conventional antibodies and yields and degree of purity are generally lower for bispecific antibodies. Bispecific antibodies do not exist in the form of fragments having a single binding site (e.g., Fab, Fab', and Fv).
Anti-GLP-1 receptor Antibodies
[0048] Using phage display technology, single chain antibody molecules ("scFvs") can be identified that specifically bind to the GLP-1 receptor (or fragments or variants thereof). Molecules comprising, or alternatively consisting of, fragments or variants of these scFvs (e.g., including VH domains, VH CDRs, VL domains, or VL CDRs), that specifically bind to GLP-1 receptor polypeptides (or fragments or variants thereof) are also encompassed by the invention, as are nucleic acid molecules that encode these scFvs, and/or molecules.
[0049] The present invention provides antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a polypeptide or a polypeptide fragment of the GLP-1 receptor. SCFvs may routinely be "converted" to immunoglobulin molecules by inserting, for example, the nucleotide sequences encoding the VH and/or VL domains of the scFv into an expression vector containing the constant domain sequences and engineered to direct the expression of the immunoglobulin molecule, as described in more detail in Example 2 below. [0050] Accordingly, in one embodiment, the invention provides antibodies that comprise the VH and VL domains of scFvs of the invention.
[0051] The present invention encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a GLP-1 receptor polypeptide or a fragment or variant thereof. A GLP-1 receptor polypeptide includes, but is not limited to, the GLP-1 receptor (SEQ ID NO:2). The GLP-1 receptor may be produced through recombinant expression of nucleic acids encoding the polypeptides of SEQ ID NO:2. Antibodies of the invention may specifically bind the GLP-1 receptor as well as fragments and variants thereof, and are described in more detail below.
GLP-1 Receptor Polypeptides
[0052] Antibodies of the present invention bind the GLP-1 receptor polypeptide, or fragments or variants thereof. The following section describes in more detail the GLP-1 receptor polypeptides, fragments and variants that antibodies of the invention may bind. [0053] In certain embodiments, the antibodies of the present invention specifically bind the GLP-1 receptor polypeptide. An antibody that specifically binds the GLP-1 receptor may, in some embodiments, bind fragments, variants (including species orthologs and allelic variants of the GLP-1 receptor), multimers or modified forms of the GLP-1 receptor. For example, an antibody specific for the GLP-1 receptor may bind the GLP-1 receptor moiety of a fusion protein comprising all or a portion of the GLP-1 receptor. [0054] Antibodies that bind GLP-1 receptor polypeptides may bind them as isolated polypeptides, in their naturally occurring state, and/or their native conformation. For example, antibodies of the present invention may bind recombinantly produced GLP-1 receptor.
[0055] Antibodies of the present invention may also bind GLP-1 receptor polypeptides purified from a cell culture, wherein said GLP-1 receptor polypeptides are encoded by a polynucleotide encoding amino acids 1 to 463 of SEQ ID NO:2 operably associated with a regulatory sequence that controls expression of said polynucleotide. [0056] Antibodies of the present invention may bind GLP-1 receptor polypeptide fragments comprising or alternatively, consisting of, an amino acid sequence contained in SEQ ID NO:2, or encoded by nucleic acids which hybridize (e.g., under stringent hybridization conditions) to the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:2. Protein fragments may be "free-standing," or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region. Antibodies of the present invention may bind polypeptide fragments, including, for example, fragments that comprise or alternatively, consist of from about amino acid residues: 1 to 23, 24 to 145, 146 to 168, 169 to 176, 177 to 196, 197 to 227, 228 to 252, 253 to 264, 265 to 288, 289 to 303, 304 to 329, 330 to 351, 352 to 372, 373 to 387, 388 to 408, 409 to 463 of SEQ ID NO:2. In this context "about" includes the particularly recited value, larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes. Moreover, polypeptide fragments that antibodies of the invention may bind can be at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, or 460 amino acids in length. In this context "about" includes the particularly recited value, larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes.
[0057] Preferably, antibodies of the present invention bind a polypeptide comprising, or alternatively consisting of, an extracellular domain of the GLP-1 receptor (from about amino acid residues 24 to 145, 197 to 227, 289 to 303, and 373 to 387 of SEQ ID NO:2), [0058] In highly preferred embodiments, the antibodies of the invention prevent the GLP-1 receptor from binding to GLP-1. In additional highly preferred embodiments, the antibodies of the invention that bind the GLP-1 receptor mimic some or all of the activities of GLP-1. In other highly preferred embodiments, the antibodies of the invention that bind the GLP-1 receptor stimulate cAMP production in cells expressing the GLP-1 receptor. In further highly preferred embodiments, the antibodies of the invention that bind the GLP-1 receptor stimulate transcription of insulin in pancreatic beta cells. In other highly preferred embodiments, the antibodies of the invention that bind the GLP-1 receptor stimulate glucose-dependent insulin secretion in pancreatic beta cells. In other highly preferred embodiments, the antibodies of the invention that bind the GLP-1 receptor reduces fasting glucose and improves glucose tolerance in diabetic rat and mouse models.
[0059] Antibodies of the invention may also bind fragments comprising, or alternatively, consisting of structural or functional attributes of the GLP-1 receptor. Such fragments include amino acid residues that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet-forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions"), coil and coil-forming regions ("coil-regions"), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, surface forming regions, and high antigenic index regions (i.e., containing four or more contiguous amino acids having an antigenic index of greater than or equal to 1.5, as identified using the default parameters of the Jameson- Wolf program) of complete (i.e., full-length) GLP-1 receptor. Certain preferred regions are those set out in Table 2 and include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence depicted in SEQ ID NO:2, such preferred regions include; Garnier-Robson predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted alpha-regions, beta-regions, and turn-regions; Kyte-Doolittle predicted hydrophilic regions; Eisenberg alpha and beta amphipathic regions; Emini surface-forming regions; and Jameson- Wolf high antigenic index regions, as predicted using the default parameters of these computer programs.
[0060] The data representing the structural or functional attributes of the GLP-1 receptor set forth in Table 2, as described above, was generated using the various modules and algorithms of the DNA* STAR set on default parameters. Column I represents the results of a Garnier-Robson analysis of alpha helical regions; Column II represents the results of a Chou-Fasman analysis of alpha helical regions; Column III represents the results of a Gamier Robson analysis of beta sheet regions; Column IV represents the results of a Chou-Fasman analysis of beta sheet regions; Column V represents the results of a Gamier Robson analysis of turn regions; Column VI represents the results of a Chou- Fasman analysis of turn regions; Column VII represents the results of a Gamier Robson analysis of coil regions; Column VIII represents a Kyte-Doolittle hydrophilicity plot; Column; Column IX represents a Hopp-Woods hydrophobicity plot; Column X represents the results of an Eisenberg analysis of alpha amphipathic regions; Column XI represents the results of an Eisenberg analysis of beta amphipathic regions; Column XII represents the results of a Karplus-Schultz analysis of flexible regions; Column XIII represents the Jameson- Wolf antigenic index score; and Column XIV represents the Emini surface probability plot.
[0061] In a preferred embodiment, the data presented in columns VIII, XIII, and XIV of Table 2 can be used to determine regions of the GLP-1 receptor which exhibit a high degree of potential for antigenicity. Regions of high antigenicity are determined from the data presented in columns VIII, XIII, and/or XIV by choosing values which represent regions of the polypeptide which are likely to be exposed on the surface of the polypeptide in an environment in which antigen recognition may occur in the process of initiation of an immune response.
[0062] The above-mentioned preferred regions set out in Table 2 include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set out in SEQ ID NO:2. As set out in Table 2, such preferred regions include Garnier-Robson alpha-regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and turn-regions, Kyte-Doolittle hydrophilic regions, Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Jameson- Wolf regions of high antigenic index and Emini surface-forming regions. Among preferred polypeptide fragments bound by one or more antibodies of the invention are those that comprise regions of the GLP-1 receptor that combine several structural features, such as several (e.g., 1, 2, 3 , or 4) of the same or different region features set out above and in Table 2.
T) T> Tl Cr\ CN t σ\ --ι --< *0 C o m * t~- l !— i en -tf oo o oo r-; ^3 Tl C X ' ' o o o o o o o o o o o o o o o o o o —i c -— i *-H .- ^H a 22 < τ> ^ ^ g g § g g § g g g o τ> o o τ> 2 S . . ^ co ^ o cN - ^ ^ ^ ^. ^ '^ ^ ^ i o i ON in o r'- — < oo ιn -* . "5 X 9 9 © d d --; d 9 9 9 9 9 9 9 9 9 9 d d © < en < cvi --; d 9 9
X . fc fc h fe fc fc fc fc fc fc fc fc fc
X
X _:
Figure imgf000020_0001
H H H H fr< b« i-< f→
CQ CQ ffl 03 PQ CQ a m rn m m . . . . o m « ffl n ffl m m m
< < < < < < <
< < . . < < < < a 0 --( t-~ oo 0 --ι cs cn -* T) y3 θ oo σs -→ en vo --< --<
Figure imgf000020_0002
--ι -H
Figure imgf000020_0003
cN C cs r-ι c N cs c rι o fc g S 3 δ fc 3 fc s _> C CΛ CΛ θs "* τι ι o fc C t- t- Tf O KO Ti -H X O O O O O .- ~-ι
Figure imgf000021_0001
—i a § § § § § 0 0 0 0 0 0 0 -3- —« r~ no as ro CN τι i 00 vo --< •n X 0 0 0 CN CN CN en CN CN CN CN en -*
X fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc
X
X
Figure imgf000021_0002
es o o u H H fc H H . . . H H H H
> H H H H fc E- fc fc r- fc . . . H H . . . H s≥ m m m m m m m m m a m m m m m m
. - : - ; α e r~ t~ oo Λ -H C ro l- T) y3 r~ _o en en en en en en en en rn
Figure imgf000021_0003
τf -* |- T> Tl Tl Tl Tl T) Tl T) 0 fc υ 3 u 3 "3 C a, Pi > £ 3 > 3 5" 5 o P ^ ^ σ o o ^ w j H O ^ fc ώ fc ^ cN CΛ ro cN ro ro cN — < in ιn τ cN co ι— i cN ro co ro
Figure imgf000022_0001
H o O X " '
Figure imgf000022_0002
Figure imgf000022_0003
X fc fc fc fc fc fc fc fc fc fc fc fc
X
X
Figure imgf000022_0004
a α o . u o H
Figure imgf000022_0005
H H H H H H H H . . H . . H r- H m m m m m . . a . m m m m m m m m m m m < < < . . . . < < < < < <
H-, θ '-ι cN m τr m vo oo oo oo oo oo oo oo
Figure imgf000022_0006
fc > : > cΛ U fc o 00 Tl o o m Tf Tl Tl τι ιn oo X O o o O o d d d
Figure imgf000023_0001
a o 2 2 o o o o m m τι ιn τι l2 § § § § S o § § § § en g ∞ CN g O " CN ^ ^ C O -H τf \θ en r . ^ ~i ~ ~; ^i rn X d 9 9 d d d d d d d d o 9 9 9 9 9 9 d 9 9 9 9 9 d d cN CN e^
X fc fc fc fc fc fc fc fc fc
X
Figure imgf000023_0002
> H H . . t→ fr* t→ t-< b-<
> t-< . . b* f-« . . . . S→ b* f→ f→ m m m m m m m m m m m m m m m m m
<; ; <; ; <; ; <;
<; <; <; <; <; ; τl- ι β —i --i
Figure imgf000023_0003
o fc w Ci lH 3 o fc cd iH "7ϊ o ι W -^ -- - ω w cd -» 3 r_- c- M Q H fi i H H J fc H ; co > fc O ) K > H <; fc U H -< O ) f-l H -J U H-) <; ; (7\ 00 T en <n ι-~ Tf Tf Tf Tf Tf CO τ> CO CN o 00 o en oo m in r-~ Tl in CO (N ϊ en en i— i- X <—I '—t '—ι © O *—I r-t *— i en ro •Φ T CN CN CO CO CO CN ά d d ό ό os o ;u O Tl- 00 N NO NO IN oo Tf o <r> m o o o Os Os CN Os ro NO Tf NO ro ON oo in ro o Tf ro NO NoO NoO X __: ,—; o o o o o CN CN ro CN CN o o o o
X fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc
X
X
Figure imgf000024_0001
CU > . o u α o υ o u
Figure imgf000024_0002
> H . . H H
> m m m m m m
<: <: <! ! <; ; : - «; - <: ;
<: ; <; <; <: <; <; : <; - : «: : : No r-~ oo σs o -^ cN ro τf ι No t^ oo σN θ — i CN ro Tf i No r^ oo CTN — cN ro τf 3 -_H -_< r-H ι— ι cN cN CN cN cN CN cN CN CN CN ro ro ro ro en ro ro en eo rn τf τf τf τf τf O fc ? O fc p0 fc t, S" 3 3 -- £5 p0 > =J WI ι- t. o 3 3 C 3 2 i w &O J fc H ^ ^ ^ w O O O O oQ j -^ l O -^ ai Ki fc O O O H-l H-l fc j >■ O ro O OI CN O CN CTN Tf C^ O Tf CN CN rO rn fc CN m en -^ τf Nθ en cN en τf eo cN CN ^H ^H --ι ,_ι ,_ι τ— < *— < co co »n co *n »n x © o o o o o o o o o o o o o o o o o o o o o o o o o o o O O O O O O O O O O O O O O O O O O O O O O O O O O O O — PJ \O o ^ ^O ^ ^ ^ ^ O 0 , , ^C) , , v , , v»D , vO , ,D ,*0 , g X O O O O O O O O O O O O O O O O O O O O O O O O O O O O
X
X
X
Figure imgf000025_0001
(
H
i≥ m m m m m m m m m m m m m m m m m m m m m m m m m m m m m a m m m m m m m m m m m m
<: : <: <: «: : ; <: <: <! -< : «: <: <: : <:
< < < < < < < < < <t, < i N r^ oo O O -^ CN m T in No r^ oo CTN -H N m Tf i No r^ oo O O i-i cN rn 3 f τf τf τι τι τι τι τι in ιn τι ι ιn N N0 Nθ θ N N N0 N Nθ No c^ t t^ c^ O fc b' i-l ,S >-' fc, cβ 3 ι-, ω ι-, κj 3 -S „ κ! l- t« „ 3 > U tιO m M pi H a H H u H <! 1-i c« fc iyD <; j <! a) <; 1--i j O fc li! 1-j W 9Z
ι_ f<ι r CD > fc > i— - > w * t CD fc H C», etl l&D- C«o fc ι3ι" rCD a > f s. 3 » OQ 3 cn -i s c 00 a o
NJ NJ t H— l-' H-i l— H- i-' i-. i-i l-i h- l-' H- l-' l-i l— H- l-> l-. H-> ι-> l-. l-- l-' l--ι >— l-. O O O NO N0 NO N0 NO N0 NO N0 N0 N0 00 00 00 00 00 00 C0 00 00 00 O ~J l ~4 -J ]
N> H- No » ^ι σN iΛ j-. ω ι ι-' θ No oo ~j Λ tΛ *. oj rθ H-ι o No oo ^j σs uι j-.
> > > > > > > > > > > > > >
> > > > > > a td C td td M B
CO td td td td td td Od td td td td td td td td rø ffl td td ts td
H H H H <
< H a £
Figure imgf000026_0001
X
X
X
P H3 vϋ a
O O
Figure imgf000026_0002
t o oo No υi i n cΛ J tNj J H-' NO No o o oj ω i— o o
Figure imgf000026_0003
H-i Nθ J <;
8£T0/™0ZSfl/I3<I 9CS8Ϊ0/S00Σ: OΛV *> rn in en O en r~ r- ro o O oo t- fc oo Tf t-~ f- en en en m m CN —i -i — i ,-i o -i X i—i O i—i i-i O O O O i-i i— CN NO O O
Figure imgf000027_0001
o d o
X fc fc
X
X Nθ τf Nθ Nθ τf eo t^ Λ —ι τf en -H θT^ NoO τeof eof O NO O NO O Oβ όo όo No ^H NO Tf' fc fc' NO i-i δ e O eo en Oδ CfcΛ' τ^ι NO ^ eo P t^ o a 2 fc ά ό ci ^ ό ό ci iό ό ό iό ό O i ό ό i o o i ό i t ό ci o r ' -*
5>
I fl 2 2 2 oo eo eo ON ^ NO en -H --, t- o c 2 o ^ ^ oo 2 S S « o S ^ S _- ^ ^ No oo τf ro Nθ No f cN θi No r^ c^ Nθ _- 2 o σN τ _. 2 - ^: - - - § > 9 9 9 d d d - ^ -; fc -; -; d d d d d 9 9 d d d 9 9 r ^ 'T TT, V f l
3 es H > H fc H fc . . t→ fr* ϊ→ f→ ϊ→ f→ ! t→
> H H r- - . . H H H fc" m m m m m m m m m . . . m m . . . m m m m m m m m m
< < < , < < < <
τf in No r- oo oo σN θ --ι § o _ O O O CN CN en en CN CN CN CN CN CN
Figure imgf000027_0002
CN CN CN CN O fc « ^ δ ^ « ^ « e .a « & & ≥> g g s £ & „ 3 δ & !? g « .g g Pi LZ
c rn t~-1 ■H H o H o g r SO S < a L "^ f E—T Α ?i fc <! β S- O ^ Si j-) P 3. w 3 a TJ o to to to to to LO LO LO LO LO
Figure imgf000028_0001
ON ui *. ω w
> >
td td td td td td Od W td td td td td tS td td W W a
U d U U td U O ud bd Cd td td U bd O U Q ' ' ' td td td td td td td t l-J
> >-i H ^ » a £ -si O > L0 O ) Nθ
Figure imgf000028_0002
X
X
X p p p p S p p p p p p p p p p p p p p C3 f> p> p p p < ' f} 'p £j W ON CA ^ Λ Λ Ol l ^ C l Λ A ft ^ Λ Λ t t t W Λ Cft h Λ A Φ o o o o o o o o o o o o o o o o o o o o o o o o o o o o o p p p p p p p o o p o o o o p p p p p p p p p p p o o p o N * N '^ " M uι io ^ ^ ^ uι ) iθ H iv ω ω Λ N Nθ CΛ iv i io i kι i ω >— j
998£T0/™0ZSfl/I3<I 9CS8Ϊ0/S00Σ: OΛV ■ CN CjN jN NO ^H t^ O O O O NO NO NO h CN CTN i — i i— i Tl OO Tf Tf OO O oo as fc Nθ m τι oθ τf en cN τι τf c CN '^ ι-ι -H CN -^ ι-1 ^H --H --ι --ι --ι --ι c en Tf i→ X O O O O O O O O O O O O O o o o o d d d d d d © d fc oO Tmf oNO oeo NoO NoO oNO oNO oO o oC oCN oCN oC NoO oN o^ o^ oQ oQ o^ o^ o^ O O O O Tf CN NO NO so --; X ό d d ό ό ό ό o ci d (D ci <ύ o ό ci ci d oi > i ci ά cS ci d
X
X
X
Figure imgf000029_0001
fc H H H fc fc fc fc fc
^ m m m m m m m m m m m m m m m m m m m m m . . . . m m m m m m m m m m m m m m m m m . m m m m m
_ < < — i cN r T i No r^ oo Oi O i— i cN ro Tf No c^ oo σs O i-i cN ro Tf in o r^ oo ON 3 N NOO NO NO NO NO NO NO NO No r~ t^ t-~ c-^ r^ t^ r^ c~- t t-~ oo o oo oo oo oo oo oo oo oo o CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN o fc Pi CO u O fc fc ^ fc H - a O H O fc fc _i fc fc H O a fc H > 00 CN o o τι τι O No rn O rn σN Tf CN oo oo NO NO fc rn ro oo eo cN co -H CN cN CN cN rt rt p rt rt X CN CN
Figure imgf000030_0001
rt d d d d d d d d d o d o o o o a r~ ∞ Tf o Tf O O O O O O O O O O O O B O NO CN rt p X - CN CO
Figure imgf000030_0002
rt
X fc fc fc fc fc fc fc fc fc
X
X
Figure imgf000030_0003
U
H . f^ b" i ' . H fc fc fc fc fc H fc
> . . H fc H fc fc . . fr< t→ fr< < ϊ≥ m m m m m m m m m m m m m m m m a m m m m m m m m m m m m m m m m
< O i— ι cN cn τf τi Nθ r^ oo σι \ θ rt N co f Tι No c^ oo θΛ - ι cN m Tf in t oo 3 i i— i — ^ rt — i i— i i— i i— i o CN cN cN C cN CN cN CN cN cN en eo ro ro en m en ro ro rn ro en eo m en eo eo ro ro O fc pi fc p ϋ τt; o σ u r? F -5 § P P fc a a ^ fc fc fc S θ a ϋ oε
o r a > H t-1 W W 2. 3 O C M '-' - C-. Si C. (ro C 3- > 3 ct 3
rt rt rt 4 rt-- 4-.
> > > > > > > > > > > > >
> > > > > > > > > > td td td u M td td w td td td td td td td td td td tfl W td ro td td i td td td |-j
<:
H H H H H »
Figure imgf000031_0001
x
X
O ^ H O^ . >— ' -t— ι P o ■ P o ' P g O^ Ω^ o • o ' o ■ o ■ o • o ■ o i o < o i o • o ■ o ■ o < o > © ■ g σ σ o 0 © σ " ^ © © o o © o © o o o o o © o o
w j.. όo oo όo A ^ ! ω w uι \ ^ NΛ W H b b H
8ST0/t00ZSfl/I3d 9CS8Ϊ0/S00Z OΛV o Tf in t rt m o o ^ cN t^ i i NO r^ O — H n t t r^ r^ oo in Tf NO oo rn rn CN CN -1 * in Tf Tf en cN rt o o CN Tf τι NO t r^ X o Oo irt-i o 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 -1' ii
X
Figure imgf000032_0001
X fc fc fc fc fc fc fc
X
X
Figure imgf000032_0002
H fc fc
m m m m m m m m m m m m m m m m m m m m m m
. m m m m m m m m a <; <c
oo σ θ rt cN e τf τ Nθ f~ oo ι O rt cN eo τf Tι No t oo σN θ rt cN eo τf i Nθ β f τf ι τι τι ιn τι τ ι ιn ιn ιn Nθ N Nθ Nθ Nθ Nθ Nθ Nθ Nθ Nθ t- r-~ r^ r^ t-~ t~ r^ O en en en m m m eo en en en en en eo eo eo eo eo ro eo eo eo eo eo en m m en ro eo O fc e on fc £tf) 3 δ .3cv OT > !Sι a δ -H9 3 u ω o g 3 δ 3 ω fc.> -iβι aen ;33 -3κ! u Λ W ιC2v JO- rtco ω^ Cw-i ;grl .c2 -C3 tHaC- i fc ^ fc c H fc fc fc fc fc fc θ H ffi ϋ > a fc :^ fc > 2 θ !ii : *> »r. o co m oo o o c O h-t θ '— < θ '— i co co X
Figure imgf000033_0001
o o o o o o o o o a a o rs s o rs o o o rs rs o o in Tl O O O O O O O O O O O O ro CO en NO NO NO CO CO NO NO ro NO NO Tf Tf NO N NO NO NO NO NO NO NO NO NO NO X i-i ci ό o ό ό o ci ι c> c> ci ό ci ci ό o o > ό > ό ci o ci ό ci ai
X fc fc fc fc
X
X r^ CO CO eO CO CO CO rt rt rt rt rt NO NO ON Tf NO NO Tf t^ NO CO CO CO Tf N No ON r- Oi O ON CN Ti Tf NO NO Ti cN
2 , ! = & O co NO Tf Tf eo o oo NO N m s W Υ ^T' O O O O O O O O O O O O O O O O O a n „ _. _. rt o r^ r^ oo oo τ cn - ^, oo r^ cN ι→ θN a n τf cN ιι σN θθ τι τι σN σN f r~. θ g rn ι ι/- ιι ιn o ζ! ^ ^ _: d d d d d d d d d _ _- d d rt rt rt cN rt CN CN cN c
> fc fc
m m m m m m m m m m m m m m m m m m m m m m m m m m m
. m m m m m m m m m m m m m
. < < < < < < < < < < . . . < < < < < < < < rt < < < < . . . . < < < < < < < < < < < < t oo θN θ rt cN m τf τi θ r~ oo σN θ ι— ι c m f i Nθ r^ oo N θ ι^ cN cn τf in 3 r- t~- r^ oo oo oo oo oo oo oo oo oo oo oN ON ON ON ON O\ Oi ON ON Oi O O O O _0 r en cn en en en m en cn en en cn m m en ro ro ro m m ro en en τf τf τf τf τf τf 'o O fc c ∞u rt* _ Hg δ 3 6 H0 _ Ud u c ^n 3 j<-_J> _H3 rt3 u i δι _<eD .Gtι i Bι Λ<D ^c! i,' 3u J'Si rteS itSv <u 3 o in, E«* .a 1> — <s 3 Pi θ H fc fc a 5 fc fc H θ ,rt W fc F c fc α ϋ fc S < a fc ϋ fc ^ cN ι o c3N No σN σN No o ιn τf c cN No m rt C^ o τf ι fc Tf O rt r~ N T ON ON CN co cN en c oo t N co r^ oo No No eo NO i-i o in X O O rt rt O —I rt Tf CN CN rt N d d d d d ι-5 ii CN CN CN i-i ii a rt t t-^ rn ^ ^J §~ N crtn θt- ! Tf O τf N r^ θ~ NNoθ θτf N Tf ro CO κ ° O " o § T o O ro CN O No r cn N in O °ι 0 po cιnN Nθ θfN rS i i ci ci c ci ό CN CN ro CN rt rt d d θ 9 9 9 θ ι-5 fc c rn rn cN ι-5 θ
X fc fc fc fc fc fc fc fc fc fc fc fc
X
X
Figure imgf000034_0001
b b* b b* H fc H H fc H fc H m m m m a . < < < < < < . . . . < < < < < < < < <; <;
< < < < < < < . <, < < < < < < < ι CN m τf τi No t-~ oo N θ rt rN cn τ τi No r~ oo N ^ cN en τf g o — O — - o — -n n ii r-i rt rt rt rt rt cN CN CN CN CN CN CN cN CN CN ro ro m en en _o Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf fc 3 3 - -* ci 3 ω » -3 H ^- |u " Λ l " i. ω r-! rt <u rt _≤ 7S 'a Ω ω ω rt ?~. Pi < 3 fc θ fc ^ fc c fc θ ^ H ^ fc ϋ W fc ffi σ - «; NVQ o 2 fc _ i cN oo o in ON O Tf Tf O ON Tf -H rn o o o m cN fc NO ON r^ N ON Tf OO NO Tf Tf NO Tf f NO Tl NO ON ON O Tf t Tf Tf X O O O O O O rt O O O O O O O O O O O O fc d d d d o in in in in in Ti Ti Ti in Ti m o in o o o o Tf O O CN CN CN CN Tf Tt ; CN O Tf NO Tf NO NO NO m X d d ό ci ci ci ci ci ci ci ci ci ci ά ά ά ci ci ci ci ci
X fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc x x
Figure imgf000035_0001
> υ u
H fc H fc fc fc fc fc fc fc fc fc fc
> fc fc m m m m m m m
. m m m m m m m m m m m . . m m m m m m m m m a < <
σN θ rt N en τf τi No r~ oo τf in τι τι τι τι τι τι ιn τι rt τf τf τf τf τf τf τf τf τf rt rt u cd ia ^ pC -a pa -
Figure imgf000035_0002
<^ O Oθ 2 fc fc < fc U > CN >—i NO NO fc CN C T en Tf X ci ci ci ci ci ii o B NO X o o o o
X
X
Figure imgf000036_0001
C* u
3
H fc fc fc fc
. fc fc fc fc" m a m m
rt en
Figure imgf000036_0002
[0063] In another aspect, the invention provides an antibody that binds a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide described herein. The epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide of the invention. An "immunogenic epitope" is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen. On the other hand, a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope." The number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen et al, Proc. Natl. Acad. Sci. USA 81:399%- 4002 (1983).
[0064] As to the selection of peptides or polypeptides bearing an antigenic epitope (i.e., that contain a region of a protein molecule to which an antibody can bind), it is well known in that art that relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, for instance, Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R.A. (1983) Antibodies that react with predetermined sites on proteins. Science 219:660-666. Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins nor to the amino or carboxyl terminals.
[0065] Antigenic epitope-bearing peptides and polypeptides are therefore useful to raise antibodies, including monoclonal antibodies, that bind to a GLP-1 receptor polypeptide. See, for instance, Wilson et al, Cell 57:767-778 (1984) at 777. Antigenic epitope-bearing peptides and polypeptides preferably contain a sequence of at least seven, more preferably at least nine and most preferably between at least about 15 to about 30 amino acids contained within the amino acid sequence of SEQ ID NO:2. [0066] Antibodies of the invention may bind one or more antigenic GLP-1 receptor polypeptides or peptides. Epitope-bearing GLP-1 receptor peptides and polypeptides may be produced by any conventional means. Houghten, R.A., "General method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids," Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985). This "Simultaneous Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,211 to Houghten et al. (1986). [0067] As one of skill in the art will appreciate, GLP-1 receptor polypeptides and the epitope-bearing fragments thereof described herein can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides. These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al, Nature 331:84- 86 (1988)). Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric GLP-1 receptor protein or protein fragment alone (Fountoulakis et al, J Biochem 270:3958-3964 (1995)). Thus, antibodies of the invention may bind fusion proteins that comprise all or a portion of a GLP-1 receptor polypeptide.
[0068] Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or "muteins" including single or multiple amino acid substitutions, deletions, additions or fusion proteins. Such modified polypeptides can show, e.g., enhanced activity or increased stability. In addition, they may be purified in higher yields and show better solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions. Antibodies of the present invention may also bind such modified GLP-1 receptor polypeptides or GLP-1 receptor polypeptide fragments or variants.
[0069] For instance, for many proteins, including the extracellular domain of a membrane associated protein or the mature form(s) of a secreted protein, it is known in the art that one or more amino acids may be deleted from the N-terminus or C-terminus without substantial loss of biological function, or loss of the ability to be bound by a specific antibody. For instance, Ron et al, J Biol Chem., 2(55:2984-2988 (1993) reported modified KGF proteins that had heparin binding activity even if 3, 8, or 27 amino-terminal amino acid residues were missing
[0070] However, even if deletion of one or more amino acids from the N-terminus of a protein results in modification or loss of one or more biological functions of the protein, other functional activities (e.g., biological activities, ability to multimerize, ability to bind a GLP-1 receptor) may still be retained. For example, the ability of shortened GLP-1 receptor polypeptides to induce and/or bind to antibodies which recognize the complete or mature forms of the GLP-1 receptor polypeptides generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the N-terminus. Whether a particular polypeptide lacking N-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that a GLP-1 receptor polypeptide with a large number of deleted N-terminal amino acid residues may retain some biological or immunogenic activities. In fact, peptides composed of as few as six GLP-1 receptor amino acid residues may often evoke an immune response. [0071] Accordingly, the present invention further provides antibodies that bind polypeptides having one or more residues deleted from the amino terminus of the GLP-1 receptor amino acid sequence of SEQ ID NO:2 and polynucleotides encoding such polypeptides. In particular, the present invention provides antibodies that bind polypeptides comprising the amino acid sequence of residues n1-463 of SEQ ID NO:2, where n1 is an integer from 2 to 458 corresponding to the position of the amino acid residue in SEQ ID NO:2.
[0072] More in particular, the invention provides antibodies that bind polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of: A-2 to S-463; G-3 to S-463; A-4 to S-463; P-5 to S-463; G-6 to S-463; P-7 to S-463; L-8 to S- 463; R-9 to S-463; L-10 to S-463; A-ll to S-463; L-12 to S-463; L-13 to S-463; L-14 to S-463; L-15 to S-463; G-16 to S-463; M-17 to S-463; V-18 to S-463; G-19 to S-463; R-20 to S-463; A-21 to S-463; G-22 to S-463; P-23 to S-463; R-24 to S-463; P-25 to S-463; Q- 26 to S-463; G-27 to S-463; A-28 to S-463; T-29 to S-463; V-30 to S-463; S-31 to S-463; L-32 to S-463; W-33 to S-463; E-34 to S-463; T-35 to S-463; V-36 to S-463; Q-37 to S- 463; K-38 to S-463; W-39 to S-463; R-40 to S-463; E-41 to S-463; Y-42 to S-463; R-43 to S-463; R-44 to S-463; Q-45 to S-463; C-46 to S-463; Q-47 to S-463; R-48 to S-463; S- 49 to S-463; L-50 to S-463; T-51 to S-463; E-52 to S-463; D-53 to S-463; P-54 to S-463; P-55 to S-463; P-56 to S-463; A-57 to S-463; T-58 to S-463; D-59 to S-463; L-60 to S- 463; F-61 to S-463; C-62 to S-463; N-63 to S-463; R-64 to S-463; T-65 to S-463; F-66 to S-463; D-67 to S-463; E-68 to S-463; Y-69 to S-463; A-70 to S-463; C-71 to S-463; W-72 to S-463; P-73 to S-463; D-74 to S-463; G-75 to S-463; E-76 to S-463; P-77 to S-463; G- 78 to S-463; S-79 to S-463; F-80 to S-463; V-81 to S-463; N-82 to S-463; V-83 to S-463; S-84 to S-463; C-85 to S-463; P-86 to S-463; W-87 to S-463; Y-88 to S-463; L-89 to S- 463; P-90 to S-463; W-91 to S-463; A-92 to S-463; S-93 to S-463; S-94 to S-463; V-95 to S-463; P-96 to S-463; Q-97 to S-463; G-98 to S-463; H-99 to S-463; V-100 to S-463; Y- 101 to S-463; R-102 to S-463; F-103 to S-463; C-104 to S-463; T-105 to S-463; A-106 to S-463; E-107 to S-463; G-108 to S-463; L-109 to S-463; W-110 to S-463; L-lll to S-463; Q-112 to S-463; K-113 to S-463; D-114 to S-463; N-115 to S-463; S-116 to S-463; S-117 to S-463; L-118 to S-463; P-119 to S-463; W-120 to S-463; R-121 to S-463; D-122 to S- 463; L-123 to S-463; S-124 to S-463; E-125 to S-463; C-126 to S-463; E-127 to S-463; E- 128 to S-463; S-129 to S-463; K-130 to S-463; R-131 to S-463; G-132 to S-463; E-133 to S-463; R-134 to S-463; S-135 to S-463; S-136 to S-463; P-137 to S-463; E-138 to S-463; E-139 to S-463; Q-140 to S-463; L-14Tto S-463; L-142 to S-463; F-143 to S-463; L-144 to S-463; Y-145 to S-463; 1-146 to S-463; 1-147 to S-463; Y-148 to S-463; T-149 to S- 463; V-150 to S-463; G-151 to S-463; Y-152 to S-463; A-153 to S-463; L-154 to S-463; S-155 to S-463; F-156 to S-463; S-157 to S-463; A-158 to S-463; L-159 to S-463; V-160 to S-463; 1-161 to S-463; A-162 to S-463; S-163 to S-463; A-164 to S-463; 1-165 to S- 463; L-166 to S-463; L-167 to S-463; G-168 to S-463; F-169 to S-463; R-170 to S-463; H-171 to S-463; L-172 to S-463; H-173 to S-463; C-174 to S-463; T-175 to S-463; R-176 to S-463; N-177 to S-463; Y-178 to S-463; 1-179 to S-463; H-180 to S-463; L-181 to S- 463; N-182 to S-463; L-183 to S-463; F-184 to S-463; A-185 to S-463; S-186 to S-463; F- 187 to S-463; 1-188 to S-463; L-189 to S-463; R-190 to S-463; A-191 to S-463; L-192 to S-463; S-193 to S-463; V-194 to S-463; F-195 to S-463; 1-196 to S-463; K-197 to S-463; D-198 to S-463; A-199 to S-463; A-200 to S-463; L-201 to S-463; K-202 to S-463; W- 203 to S-463; M-204 to S-463; Y-205 to S-463; S-206 to S-463; T-207 to S-463; A-208 to S-463; A-209 to S-463; Q-210 to S-463; Q-211 to S-463; H-212 to S-463; Q-213 to S- 463; W-214 to S-463; D-215 to S-463; G-216 to S-463; L-217 to S-463; L-218 to S-463; S-219 to S-463; Y-220 to S-463; Q-221 to S-463; D-222 to S-463; S-223 to S-463; L-224 to S-463; S-225 to S-463; C-226 to S-463; R-227 to S-463; L-228 to S-463; V-229 to S- 463; F-230 to S-463; L-231 to S-463; L-232 to S-463; M-233 to S-463; Q-234 to S-463; Y-235 to S-463; C-236 to S-463; V-237 to S-463; A-238 to S-463; A-239 to S-463; N-240 to S-463; Y-241 to S-463; Y-242 to S-463; W-243 to S-463; L-244 to S-463; L-245 to S- 463; V-246 to S-463; E-247 to S-463; G-248 to S-463; V-249 to S-463; Y-250 to S-463; L-251 to S-463; Y-252 to S-463; T-253 to S-463; L-254 to S-463; L-255 to S-463; A-256 to S-463; F-257 to S-463; S-258 to S-463; V-259 to S-463; F-260 to S-463; S-261 to S- 463; E-262 to S-463; Q-263 to S-463; W-264 to S-463; 1-265 to S-463; F-266 to S-463; R- 267 to S-463; L-268 to S-463; Y-269 to S-463; V-270 to S-463; S-271 to S-463; 1-272 to S-463; G-273 to S-463; W-274 to S-463; G-275 to S-463; V-276 to S-463; P-277 to S- 463; L-278 to S-463; L-279 to S-463; F-280 to S-463; V-281 to S-463; V-282 to S-463; P- 283 to S-463; W-284 to S-463; G-285 to S-463; 1-286 to S-463; V-287 to S-463; K-288 to S-463; Y-289 to S-463; L-290 to S-463; Y-291 to S-463; E-292 to S-463; D-293 to S-463; E-294 to S-463; G-295 to S-463; C-296 to S-463; W-297 to S-463; T-298 to S-463; R-299 to S-463; N-300 to S-463; S-301 to S-463; N-302 to S-463; M-303 to S-463; N-304 to S- 463; Y-305 to S-463; W-306 to S-463; L-307 to S-463; 1-308 to S-463; 1-309 to S-463; R- 310 to S-463; L-311 to S-463; P-312 to S-463; 1-313 to S-463; L-314 to S-463; F-315 to S-463; G-316 to S-463; 1-317 to S-463; G-318 to S-463; V-319 to S-463; N-320 to S-463; F-321 to S-463; L-322 to S-463; 1-323 to S-463; F-324 to S-463; V-325 to S-463; R-326 to S-463; V-327 to S-463; 1-328 to S-463; C-329 to S-463; 1-330 to S-463; V-331 to S- 463; V-332 to S-463; S-333 to S-463; K-334 to S-463; L-335 to S-463; K-336 to S-463; A-337 to S-463; N-338 to S-463; L-339 to S-463; M-340 to S-463; C-341 to S-463; K-342 to S-463; T-343 to S-463; D-344 to S-463; 1-345 to S-463; K-346 to S-463; C-347 to S- 463; R-348 to S-463; L-349 to S-463; A-350 to S-463; K-351 to S-463; S-352 to S-463; T-353 to S-463; L-354 to S-463; T-355 to S-463; L-356 to S-463; 1-357 to S-463; P-358 to S-463; L-359 to S-463; L-360 to S-463; G-361 to S-463; T-362 to S-463; H-363 to S-463; E-364 to S-463; V-365 to S-463; 1-366 to S-463; F-367 to S-463; A-368 to S-463; F-369 to S-463; V-370 to S-463; M-371 to S-463; D-372 to S-463; E-373 to S-463; H-374 to S- 463; A-375 to S-463; R-376 to S-463; G-377 to S-463; T-378 to S-463; L-379 to S-463; R-380 to S-463; F-381 to S-463; 1-382 to S-463; K-383 to S-463; L-384 to S-463; F-385 to S-463; T-386 to S-463; E-387 to S-463; L-388 to S-463; S-389 to S-463; F-390 to S- 463; T-391 to S-463; S-392 to S-463; F-393 to S-463; Q-394 to S-463; G-395 to S-463; L- 396 to S-463; M-397 to S-463; V-398 to S-463; A-399 to S-463; 1-400 to S-463; L-401 to S-463; Y-402 to S-463; C-403 to S-463; F-404 to S-463; V-405 to S-463; N-406 to S-463; N-407 to S-463; E-408 to S-463; V-409 to S-463; Q-410 to S-463; L-411 to S-463; E-412 to S-463; F-413 to S-463; R-414 to S-463; K-415 to S-463; S-416 to S-463; W-417 to S- 463; E-418 to S-463; R-419 to S-463; W-420 to S-463; R-421 to S-463; L-422 to S-463; E-423 to S-463; H-424 to S-463; L-425 to S-463; H-426 to S-463; 1-427 to S-463; Q-428 to S-463; R-429 to S-463; D-430 to S-463; S-431 to S-463; S-432 to S-463; M-433 to S- 463; K-434 to S-463; P-435 to S-463; L-436 to S-463; K-437 to S-463; C-438 to S-463; P- 439 to S-463; T-440 to S-463; S-441 to S-463; S-442 to S-463; L-443 to S-463; S-444 to S-463; S-445 to S-463; G-446 to S-463; A-447 to S-463; T-448 to S-463; A-449 to S-463; G-450 to S-463; S-451 to S-463; S-452 to S-463; M-453 to S-463; Y-454 to S-463; T-455 to S-463; A-456 to S-463; T-457 to S-463; and C-458 to S-463 of SEQ ID NO:2. [0073] As mentioned above, even if deletion of one or more amino acids from the C-terminus of a protein results in modification of loss of one or more biological functions of the protein, other functional activities (e.g., biological activities, ability to multimerize, ability to bind GLP-1 may still be retained. For example the ability of the shortened GLP- 1 receptor polypeptide to induce and/or bind to antibodies which recognize the complete form of the GLP-1 receptor polypeptide generally will be retained when less than the majority of the residues of the complete polypeptide are removed from the C-terminus. Whether a particular polypeptide lacking C-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that a GLP-1 receptor polypeptide with a large number of deleted C-terminal amino acid residues may retain some biological or immunogenic activities. In fact, peptides composed of as few as six GLP-1 receptor amino acid residues may often evoke an immune response. [0074] In another embodiment, antibodies of the invention bind C-terminal deletions of the GLP-1 receptor polypeptide that can be described by the general formula 1-m1 where m1 is a number from 7 to 462 corresponding to the amino acid sequence identified of SEQ ID NO:2. In specific embodiments, the invention provides antibodies that bind GLP-1 receptor polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues: M-l to C-462; M-l to S-461; M-l to A-460; M-l to Q-459; M-l to C-458; M- 1 to T-457; M-l to A-456; M-l to T-455; M-l to Y-454; M-l to M-453; M-l to S-452; M- 1 to S-451; M-l to G-450; M-l to A-449; M-l to T-448; M-l to A-447; M-l to G-446; M- 1 to S-445; M-l to S-444; M-l to L-443; M-l to S-442; M-l to S-441; M-l to T-440; M-l to P-439; M-l to C-438; M-l to K-437; M-l to L-436; M-l to P-435; M-l to K-434; M-l to M-433; M-l to S-432; M-l to S-431; M-l to D-430; M-l to R-429; M-l to Q-428; M-l to 1-427; M-l to H-426; M-l to L-425; M-l to H-424; M-l to E-423; M-l to L-422; M-l to R-421; M-l to W-420; M-l to R-419; M-l to E-418; M-l to W-417; M-l to S-416; M-l to K-415; M-l to R-414; M-l to F-413; M-l to E-412; M-l to L-411; M-l to Q-410; M-l to V-409; M-l to E-408; M-l to N-407; M-l to N-406; M-l to V-405; M-l to F-404; M-l to C-403; M-l to Y-402; M-l to L-401; M-l to 1-400; M-l to A-399; M-l to V-398; M-l to M-397; M-l to L-396; M-l to G-395; M-l to Q-394; M-l to F-393; M-l to S-392; M-l to T-391; M-l to F-390; M-l to S-389; M-l to L-388; M-l to E-387; M-l to T-386; M-l to F-385; M-l to L-384; M-l to K-383; M-l to 1-382; M-l to F-381; M-l to R-380; M-l to L-379; M-l to T-378; M-l to G-377; M-l to R-376; M-l to A-375; M-l to H-374; M-l to E-373; M-l to D-372; M-l to M-371; M-l to V-370; M-l to F-369; M-l to A-368; M-l to F-367; M-l to 1-366; M-l to V-365; M-l to E-364; M-l to H-363; M-l to T-362; M-l to G-361; M-l to L-360; M-l to L-359; M-l to P-358; M-l to 1-357; M-l to L-356; M-l to T-355; M-l to L-354; M-l to T-353; M-l to S-352; M-l to K-351; M-l to A-350; M-l to L-349; M-l to R-348; M-l to C-347; M-l to K-346; M-l to 1-345; M-l to D-344; M-l to T-343; M-l to K-342; M-l to C-341; M-l to M-340; M-l to L-339; M-l to N-338; M-l to A-337; M-l to K-336; M-l to L-335; M-l to K-334; M-l to S-333; M-l to V-332; M-l to V-331; M-l to 1-330; M-l to C-329; M-l to 1-328; M-l to V-327; M-l to R-326; M-l to V-325; M-l to F-324; M-l to 1-323; M-l to L-322; M-l to F-321; M-l to N-320; M-l to V-319; M-l to G-318; M-l to 1-317; M-l to G-316; M-l to F-315; M-l to L-314; M-l to 1-313; M-l to P-312; M-l to L-311; M-l to R-310; M-l to 1-309; M-l to 1-308; M-l to L-307; M-l to W-306; M-l to Y-305; M-l to N-304; M-l to M-303; M-l to N-302; M-l to S-301; M-l to N-300; M-l to R-299; M-l to T-298; M-l to W-297; M-l to C-296; M-l to G-295; M-l to E-294; M-l to D-293; M-l to E-292; M-l to Y-291; M-l to L-290; M-l to Y-289; M-l to K-288; M-l to V-287; M-l to 1-286; M-l to G-285; M-l to W-284; M-l to P-283; M-l to V-282; M-l to V-281; M-l to F-280; M-l to L-279; M-l to L-278; M-l to P-277; M-l to V-276; M-l to G-275; M-l to W-274; M-l to G-273; M-l to 1-272; M-l to S-271; M-l to V-270; M-l to Y-269; M-l to L-268; M-l to R-267; M-l to F-266; M-l to 1-265; M-l to W-264; M-l to Q-263; M-l to E-262; M-l to S-261; M-l to F-260; M-l to V-259; M-l to S-258; M-l to F-257; M-l to A-256; M-l to L-255; M-l to L-254; M-l to T-253; M-l to Y-252; M-l to L-251; M-l to Y-250; M-l to V-249; M-l to G-248; M-l to E-247; M-l to V-246; M-l to L-245; M-l to L-244; M-l to W-243; M-l to Y-242; M-l to Y-241; M-l to N-240; M-l to A-239; M-l to A-238; M-l to V-237; M-l to C-236; M-l to Y-235; M-l to Q-234; M-l to M-233; M-l to L-232; M-l to L-231; M-l to F-230; M-l to V-229; M-l to L-228; M-l to R-227; M-l to C-226; M-l to S-225; M-l to L-224; M-l to S-223; M-l to D-222; M-l to Q-221; M-l to Y-220; M-l to S-219; M-l to L-218; M-l to L-217; M-l to G-216; M-l to D-215; M-l to W-214; M-l to Q-213; M-l to H-212; M- 1 to Q-211; M-l to Q-210; M-l to A-209; M-l to A-208; M-l to T-207; M-l to S-206; M- 1 to Y-205; M-l to M-204; M-l to W-203; M-l to K-202; M-l to L-201; M-l to A-200; M-l to A-199; M-l to D-198; M-l to K-197; M-l to 1-196; M-l to F-195; M-l to V-194; M-l to S-193; M-l to L-192; M-l to A-191; M-l to R-190; M-l to L-189; M-l to 1-188; M-l to F-187; M-l to S-186; M-l to A-185; M-l to F-184; M-l to L-183; M-l to N-182 M-l to L-181; M-l to H-180; M-l to 1-179; M-l to Y-178; M-l to N-177; M-l to R-176 M-l to T-175; M-l to C-174; M-l to H-173; M-l to L-172; M-l to H-171; M-l to R-170; M-l to F-169; M-l to G-168; M-l to L-167; M-l to L-166; M-l to 1-165; M-l to A-164 M-l to S-163; M-l to A-162; M-l to 1-161; M-l to V-160; M-l to L-159; M-l to A-158 M-l to S-157; M-l to F-156; M-l to S-155; M-l to L-154; M-l to A-153; M-l to Y-152 M-l to G-151; M-l to V-150; M-l to T-149; M-l to Y-148; M-l to 1-147; M-l to 1-146 M-l to Y-145; M-l to L-144; M-l to F-143; M-l to L-142; M-l to L-141; M-l to Q-140 M-l to E-139; M-l to E-138; M-l to P-137; M-l to S-136; M-l to S-135; M-l to R-134 M-l to E-133; M-l to G-132; M-l to R-131; M-l to K-130; M-l to S-129; M-l to E-128 M-l to E-127; M-l to C-126; M-l to E-125; M-l to S-124; M-l to L-123; M-l to D-122 M-l to R-121; M-l to W-120; M-l to P-119; M-l to L-118; M-l to S-117; M-l to S-116 M-l to N-115; M-l to D-114; M-l to K-113; M-l to Q-112; M-l to L-lll; M-l to W- 110; M-l to L-109; M-l to G-108; M-l to E-107; M-l to A-106; M-l to T-105; M-l to C- 104; M-l to F-103; M-l to R-102; M-l to Y-101; M-l to V-100; M-l to H-99; M-l to G- 98; M-l to Q-97; M-l to P-96; M-l to V-95; M-l to S-94; M-l to S-93; M-l to A-92; M-l to W-91; M-l to P-90; M-l to L-89; M-l to Y-88; M-l to W-87; M-l to P-86; M-l to C- 85; M-l to S-84; M-l to V-83; M-l to N-82; M-l to V-81; M-l to F-80; M-l to S-79; M-l to G-78; M-l to P-77; M-l to E-76; M-l to G-75; M-l to D-74; M-l to P-73; M-l to W- 72; M-l to C-71; M-l to A-70; M-l to Y-69; M-l to E-68; M-l to D-67; M-l to F-66; M- 1 to T-65; M-l to R-64; M-l to N-63; M-l to C-62; M-l to F-61; M-l to L-60; M-l to D- 59; M-l to T-58; M-l to A-57; M-l to P-56; M-l to P-55; M-l to P-54; M-l to D-53; M-l to E-52; M-l to T-51; M-l to L-50; M-l to S-49; M-l to R-48; M-l to Q-47; M-l to C-46; M-l to Q-45; M-l to R-44; M-l to R-43; M-l to Y-42; M-l to E-41; M-l to R-40; M-l to W-39; M-l to K-38; M-l to Q-37; M-l to V-36; M-l to T-35; M-l to E-34; M-l to W-33; M-l to L-32; M-l to S-31; M-l to V-30; M-l to T-29; M-l to A-28; M-l to G-27; M-l to Q-26; M-l to P-25; M-l to R-24; M-l to P-23; M-l to G-22; M-l to A-21; M-l to R-20; M-l to G-19; M-l to V-18; M-l to M-17; M-l to G-16; M-l to L-15; M-l to L-14; M-l to L-13; M-l to L-12; M-l to A-11; M-l to L-10; M-l to R-9; M-l to L-8; M-l to P-7 of SEQ D NO:2.
[0075] The invention also provides antibodies that bind polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini of a GLP-1 receptor polypeptide, which may be described generally as having residues n1- m1 of SEQ ID NO:2, where n1 and m1 are integers as described above.
[0076] It will be recognized in the art that some amino acid sequence of the GLP-1 receptor can be varied without significant effect of the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there will be critical areas on the protein which determine activity. Such areas will usually comprise residues which make up the ligand binding site or which form tertiary structures which affect these domains (see, e.g., Xiao et al., J. Mol. Endocrinology (2000) 25, 321-335; Lopez de Maturana et al., J. Biol. Chem. (2003) 278:12, 10195-10200). [0077] Thus, the invention further includes antibodies that bind variations of the GLP- 1 receptor protein which show substantial GLP-1 receptor protein activity or which include regions of GLP-1 receptor such as the protein fragments discussed below. Such mutants include deletions, insertions, inversions, repeats, and type substitution. Guidance concerning which amino acid changes are likely to be phenotypically silent can be found in Bowie, J.U. et al, Science 247:1306-1310 (1990).
[0078] Thus, antibodies of the present invention may bind a fragment, derivative, or analog of the polypeptide of SEQ ID NO:2. Such fragments, variants or derivatives may be (i) one in which at least one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue(s), and more preferably at least one but less than ten conserved amino acid residues) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as an IgG Fc fusion region peptide or leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
[0079] Of particular interest are substitutions of charged amino acids with another charged amino acid and with neutral or negatively charged amino acids. The latter results in proteins with reduced positive charge to improve the characteristics of the protein. The prevention of aggregation is highly desirable. Aggregation of proteins not only results in a loss of activity but can also be problematic when preparing pharmaceutical formulations, because they can be immunogenic. (Pinckard et al, Clin Exp. Immunol. 2:331-340 (1967); Robbins et al, Diabetes 3(5:838-845 (1987); Cleland et al. Crit. Rev. Therapeutic Drug Carrier Systems 0:307-377 (1993)).
[0080] The replacement of amino acids can also change the selectivity of binding to cell surface receptors. Ostade et al, Nature 361:266-268 (1993) describes certain mutations resulting in selective binding of TNF-alpha to only one of the two known types of TNF receptors. Thus, the antibodies of the present invention may bind a GLP-1 receptor that contains one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation.
[0081] As indicated, changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (see Table 3).
TABLE 3. Conservative Amino Acid Substitutions.
Figure imgf000046_0001
[0082] In specific embodiments, the number of substitutions, additions or deletions in the amino acid sequence of SEQ ID NO: 2 and or any of the polypeptide fragments described herein is 75, 70, 60, 50, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 30- 20, 20-15, 20-10, 15-10, 10-1, 5-10, 1-5, 1-3 or 1-2.
[0083] Amino acids in the GLP-1 receptor protein of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alarήne-scanning mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro, or in vivo proliferative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol. Biol. 224:899-904 (1992) and de Vos et al. Science 255:306-312 (1992)). In preferred embodiments, antibodies of the present invention bind regions of the GLP-1 receptor that are essential for GLP-1 receptor function. In other preferred embodiments, antibodies of the present invention bind regions of GLP-1 receptor that are essential for GLP-1 receptor function and enhance GLP-1 receptor function.
[0084] Non-naturally occurring variants of the GLP-1 receptor may be produced using art-known mutagenesis techniques, which include, but are not limited to oligonucleotide mediated mutagenesis, alanine scanning, PCR mutagenesis, site directed mutagenesis (see e.g., Carter et al, Nucl Acids Res. 75:4331 (1986); and Zoller et al, Nucl Acids Res. 10:6487 (1982)), cassette mutagenesis (see e.g., Wells et al, Gene 34:315 (1985)), restriction selection mutagenesis (see e.g., Wells et al, Philos. Trans. R. Soc. London Ser A 317:4 5 (1986)).
[0085] Thus, the invention also encompasses antibodies that bind GLP-1 receptor derivatives and analogs that have one or more amino acid residues deleted, added, and/or substituted to generate GLP-1 receptor polypeptides that have better binding activity, better therapeutic activity, are expressed better, or are better suited to scale up, etc., in the host cells chosen. For example, cysteine residues can be deleted or substituted with another amino acid residue in order to eliminate disulfide bridges; N-linked glycosylation sites can be altered or eliminated to achieve, for example, expression of a homogeneous product that is more easily recovered and purified from yeast hosts which are known to hyperglycosylate N-linked sites. Additionally, one or more of the amino acid residues of GLP-1 receptor polypeptides (e.g., arginine and lysine residues) may be deleted or substituted with another residue to eliminate undesired processing by proteases such as, for example, furins or kexins.
[0086] By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of a GLP-1 receptor polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to one amino acid alterations per each 20 amino acids of the reference amino acid of the GLP-1 receptor polypeptide. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those teπriinal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
[0087] As a practical matter, whether any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence shown in SEQ ID NO:2 can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
[0088] In a specific embodiment, the identity between a reference (query) sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, is determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)). Preferred parameters used in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=l, Joining Penalty=20, Randomization Group Length=0, Cutoff Score=l, Window Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of the subject amino acid sequence, whichever is shorter. According to this embodiment, if the subject sequence is shorter than the query sequence due to N- or C-terminal deletions, not because of internal deletions, a manual correction is made to the results to take into consideration the fact that the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating global percent identity. For subject sequences truncated at the N- and C-termini, relative to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. A determination of whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of this embodiment. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence. For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. The deletion occurs at the N- terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%. In another example, a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-teπnini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are made for the purposes of this embodiment. [0089] The present application is also directed to antibodies that bind proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to the GLP- 1 receptor polypeptide sequence set forth herein as n^m1. In preferred embodiments, the application encompasses antibodies that bind proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the specific GLP-1 receptor N- and C-terminal deletions recited herein. [0090] In certain preferred embodiments, antibodies of the invention bind GLP-1 receptor fusion proteins as described above wherein the GLP-1 receptor portion of the fusion protein are those described as n^m1 herein.
Antibodies of the Invention May Bind Modified GLP-1 Receptor Polypeptides [0091] It is specifically contemplated that antibodies of the present invention may bind modified forms of the GLP-1 receptor protein.
[0092] In specific embodiments, antibodies of the present invention bind GLP-1 receptor polypeptides (such as those described above) including, but not limited to naturally purified GLP-1 receptor polypeptides, GLP-1 receptor polypeptides produced by chemical synthetic procedures, and GLP-1 receptor polypeptides produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells using, for example, the recombinant compositions and methods described above. Depending upon the host employed in a recombinant production procedure, the polypeptides may be glycosylated or non- glycosylated. In addition, GLP-1 receptor polypeptides may also include an initial modified methionine residue, in some cases as a result of host-mediated processes. [0093] In addition, GLP-1 receptor proteins that antibodies of the present invention may bind can be chemically synthesized using techniques known in the art (e.g., see Creighton, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y. (1983), and Hunkapiller, et al, Nature 370:105-111 (1984)). For example, a peptide corresponding to a fragment of a GLP-1 receptor polypeptide can be synthesized by use of a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the GLP-1 receptor polypeptide sequence. Non-classical amino acids include, but are not limited to, to the D- isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4- aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3 -amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitralline, cysteic acid, t-butylglycine, t- butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid can be D (dextrorotary) or L (levorotary).
[0094] The invention additionally, encompasses antibodies that bind GLP-1 receptor polypeptides which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited to, specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBE ^ acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin; etc. [0095] Additional post-translational modifications to GLP-1 receptor polypeptides include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of procaryotic host cell expression. The polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
[0096] Also provided by the invention are antibodies that bind chemically modified derivatives of GLP-1 receptor polypeptide which may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U. S. Patent No. 4,179,337). The chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties. [0097] The polymer may be of any molecular weight, and may be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 1 kDa and about 100 kDa (the term "about" indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing. Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog). For example, the polyethylene glycol may have an average molecular weight of about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa.
[0098] As noted above, the polyethylene glycol may have a branched structure. Branched polyethylene glycols are described, for example, in U.S. Patent No. 5,643,575; Morpurgo et al, Appl. Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al, Nucleosides Nucleotides 75:2745-2750 (1999); and Caliceti et al, Bioconjug. Chem. 10:638-646 (1999), the disclosures of each of which are incoφorated herein by reference. [0099] The polyethylene glycol molecules (or other chemical moieties) should be attached to the protein with consideration of effects on functional or antigenic domains of the protein. There are a number of attachment methods available to those skilled in the art, e.g., EP 0 401 384, herein incorporated by reference (coupling PEG to G-CSF), see also Malik et al, Exp. Hematol 20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl chloride). For example, polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound. The amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues, glutamic acid residues and the C-terminal amino acid residue. Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules. Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group. [0100] As suggested above, polyethylene glycol may be attached to proteins via linkage to any of a number of amino acid residues. For example, polyethylene glycol can be linked to a proteins via covalent bonds to lysine, histidine, aspartic acid, glutamic acid, or cysteine residues. One or more reaction chemistries may be employed to attach polyethylene glycol to specific amino acid residues (e.g., lysine, histidine, aspartic acid, glutamic acid, or cysteine) of the protein or to more than one type of amino acid residue (e.g., lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations thereof) of the protein.
[0101] One may specifically desire proteins chemically modified at the N-terminus. Using polyethylene glycol as an illustration of the present composition, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein. The method of obtaining the N-terminally pegylated preparation (i.e., separating this moiety from other monopegylated moieties if necessary) may be by purification of the N-terminally pegylated material from a population of pegylated protein molecules. Selective proteins chemically modified at the N-terminus modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N- terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.
[0102] As indicated above, pegylation of the proteins of the invention may be accomplished by any number of means. For example, polyethylene glycol may be attached to the protein either directly or by an intervening linker. Linkerless systems for attaching polyethylene glycol to proteins are described in Delgado et al, Crit. Rev. Ther a. Drug Carrier Sys. 9:249-304 (1992); Francis et al, Intern. J. of Hematol. 68:1-18 (1998); U.S. Patent No. 4,002,531; U.S. Patent No. 5,349,052; WO 95/06058; and WO 98/32466, the disclosures of each of which are incorporated herein by reference. [0103] One system for attaching polyethylene glycol directly to amino acid residues of proteins without an intervening linker employs tresylated MPEG, which is produced by the modification of monmethoxy polyethylene glycol (MPEG) using tresylchloride (ClSO CH2CF3). Upon reaction of protein with tresylated MPEG, polyethylene glycol is directly attached to amine groups of the protein. Thus, the invention includes protein- polyethylene glycol conjugates produced by reacting proteins of the invention with a polyethylene glycol molecule having a 2,2,2 -trifluoreothane sulphonyl group. [0104] Polyethylene glycol can also be attached to proteins using a number of different intervening linkers. For example, U.S. Patent No. 5,612,460, the entire disclosure of which is incorporated herein by reference, discloses urethane linkers for connecting polyethylene glycol to proteins. Protein-polyethylene glycol conjugates wherein the polyethylene glycol is attached to the protein by a linker can also be produced by reaction of proteins with compounds such as MPEG-succinimidylsuccinate, MPEG activated with l,r-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate, MPEG-p- nitrophenolcarbonate, and various MPEG-succinate derivatives. A number additional polyethylene glycol derivatives and reaction chemistries for attaching polyethylene glycol to proteins are described in WO 98/32466, the entire disclosure of which is incorporated herein by reference. Pegylated protein products produced using the reaction chemistries set out herein are included within the scope of the invention.
[0105] The number of polyethylene glycol moieties attached to each GLP-1 receptor polypeptide (i.e., the degree of substitution) may also vary. For example, the pegylated proteins of the invention may be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules. Similarly, the average degree of substitution within ranges such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11- 13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per protein molecule. Methods for determining the degree of substitution are discussed, for example, in Delgado etal, Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992). [0106] As mentioned the antibodies of the present invention may bind GLP-1 receptor polypeptides that are modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given GLP-1 receptor polypeptide. GLP-1 receptor polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic GLP-1 receptor polypeptides may result from posttranslation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. (See, for instance, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, pgs. 1-12 (1983); Seifter et al, Meth En∑ymol 182:626-646 (1990); Rattan et al, Ann NY Acad Sci 663:48- 62 (1992)).
Nucleic Acid Molecules Encoding anti-GLP-1 Receptor Antibodies [0107] The present invention also provides for nucleic acid molecules, generally isolated, encoding an antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof). [0108] The present invention also provides antibodies that comprise, or alternatively consist of, variants (including derivatives) of the antibody molecules described herein, which antibodies specifically bind to GLP-1 receptor or fragment or variant thereof. Standard techniques known to those of skill in the art can be used to introduce mutations in the nucleotide sequence encoding a molecule of the invention, including, for example, site-directed mutagenesis and PCR-mediated mutagenesis which result in amino acid substitutions. Preferably, the variants (including derivatives) encode less than 50 amino acid substitutions, less than 40 amino acid subsitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions relative to the reference VH domain. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a side chain with a similar charge. Families of amino acid residues having side chains with similar charges have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity (e.g., the ability to bind a GLP-1 receptor). [0109] For example, it is possible to introduce mutations only in framework regions or only in CDR regions of an antibody molecule. Introduced mutations may be silent or neutral missense mutations, i.e., have no, or little, effect on an antibody's ability to bind antigen. These types of mutations may be useful to optimize codon usage, or improve a hybridoma' s antibody production. Alternatively, non-neutral missense mutations may alter an antibody's ability to bind antigen. The location of most silent and neutral missense mutations is likely to be in the framework regions, while the location of most non-neutral missense mutations is likely to be in CDR, though this is not an absolute requirement. One of skill in the art would be able to design and test mutant molecules with desired properties such as no alteration in antigen binding activity or alteration in binding activity (e.g, improvements in antigen binding activity or change in antibody specificity). Following mutagenesis, the encoded protein may routinely be expressed and the functional and/or biological activity of the encoded protein, (e.g., ability to specifically bind the GLP-1 receptor) can be determined using techniques described herein or by routinely modifying techniques known in the art.
Methods of Producing Antibodies
[0110] Antibodies in accordance with the invention are preferably prepared utilizing a phage scFv display library. Technologies utilized for achieving the same are disclosed in the patents, applications, and references disclosed herein.
[0111] In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In particular, DNA sequences encoding VH and VL domains are amplified from animal cDNA libraries (e.g., human or murine cDNA libraries of lymphoid tissues) or synthetic cDNA libraries. The DNA encoding the VH and VL domains are joined together by an scFv linker by PCR and cloned into a phagemid vector (e.g., p CANTAB 6 or pComb 3 HSS). The vector is electroporated in E. coli and the E. coli is infected with helper phage. Phage used in these methods are typically filamentous phage including fd and Ml 3 and the VH and VL domains are usually recombinantly fused to either the phage gene III or gene VIII. Phage expressing an antigen binding domain that binds to an antigen of interest (i.e., a GLP-1 receptor polypeptide or a fragment thereof) can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Examples of phage display methods that can be used to make the antibodies of the present invention include, but are not limited to, those disclosed in Brinkman et al, J. Immunol. Methods 182:41-50 (1995); Ames et al, J. Immunol. Methods 184:177-186 (1995); Kettleborough et al, Eur. J. Immunol. 24:952-958 (1994); Persic et al, Gene 187 9-18 (1997); Burton et al, Advances in Immunology 57:191- 280(1994); PCT application No. PCT/GB91/O1 134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18719; WO 93/1 1236; WO 95/15982; WO 95/20401; WO97/13844; and U.S. Patent Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,717; 5,780,225; 5,658,727; 5,735,743 and 5,969,108; each of which is incorporated herein by reference in its entirety.
Additional Methods of Producing Antibodies
[0112] Antibodies of the invention (including antibody fragments or variants) can be produced by any method known in the art. For example, it will be appreciated that antibodies in accordance with the present invention can be expressed in cell lines including, but not limited to, myeloma cell lines and hybridoma cell lines. Sequences encoding the cDNAs or genomic clones for the particular antibodies can be used for transformation of a suitable mammalian or nonmammalian host cells or to generate phage display libraries, for example. Additionally, polypeptide antibodies of the invention may be chemically synthesized or produced through the use of recombinant expression systems.
[0113] The cloned VH and VL genes may be placed into one or more suitable expression vectors. By way of non-limiting example, PCR primers including VH or VL nucleotide sequences, a restriction site, and a flanking sequence to protect the restriction site may be used to amplify the VH or VL sequences. Utilizing cloning techniques known to those of skill in the art, the PCR amplified VH or VL domains may be cloned into vectors expressing the appropriate immunoglobulin constant region, e.g., the human IgGi or IgG4 constant region for VH domains, and the human kappa or lambda constant regions for kappa and lambda VL domains, respectively. Preferably, the vectors for expressing the VH or VL domains comprise a promoter suitable to direct expression of the heavy and light chains in the chosen expression system, a secretion signal, a cloning site for the immunoglobulin variable domain, immunoglobulin constant domains, and a selection marker such as neomycin. The VH and VL domains may also be cloned into a single vector expressing the necessary constant regions. The heavy chain conversion vectors and light chain conversion vectors are then co-transfected into cell lines to generate stable or transient cell lines that express full-length antibodies, e.g., IgG, using techniques known to those of skill in the art (See, for example, Guo et al., J. Clin. Endocrinol. Metab. 82:925- 31 (1997), and Ames et al., J. Immunol. Methods 184:177-86 (1995) which are herein incorporated in their entireties by reference).
[0114] The invention provides polynucleotides comprising, or alternatively consisting of, a nucleotide sequence encoding an antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof). The invention also encompasses polynucleotides that hybridize under high stringency, or alternatively, under intermediate or lower stringency hybridization conditions, e.g., as defined supra, to polynucleotides complementary to nucleic acids having a polynucleotide sequence that encodes an antibody of the invention or a fragment or variant thereof. [0115] The polynucleotides may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art. If the amino acid sequences of the VH domains, VL domains and CDRs thereof, are known, nucleotide sequences encoding these antibodies can be determined using methods well known in the art, i.e., the nucleotide codons known to encode the particular amino acids are assembled in such a way to generate a nucleic acid that encodes the antibody, of the invention. Such a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al, BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR. [0116] Alternatively, a polynucleotide encoding an antibody (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells or Epstein Barr virus transformed B cell lines that express an antibody of the invention) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art.
[0117] Once the nucleotide sequence of the antibody (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) is determined, the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al, 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al, eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by reference herein in their entireties), to generate antibodies having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions.
Xenomouse™ Technology
[0118] The ability to clone and reconstruct megabase-sized human loci in YACs and to introduce them into the mouse germline provides a powerful approach to elucidating the functional components of very large or crudely mapped loci as well as generating useful models of human disease. Furthermore, the utilization of such technology for substitution of mouse loci with their human equivalents could provide unique insights into the expression and regulation of human gene products during development, their communication with other systems, and their involvement in disease induction and progression.
[0119] An important practical application of such a strategy is the "humanization" of the mouse humoral immune system. Introduction of human immunoglobulin (Ig) loci into mice in which the endogenous Ig genes have been inactivated offers the opportunity to study the mechanisms underlying programmed expression and assembly of antibodies as well as their role in B cell development. Furthermore, such a strategy could provide an ideal source for production of fully human monoclonal antibodies (Mabs) an important milestone towards fulfilling the promise of antibody therapy in human disease. [0120] Fully human antibodies are expected to minimize the immunogenic and allergic responses intrinsic to mouse or mouse-derivatized Monoclonal antibodies and thus to increase the efficacy and safety of the administered antibodies. The use of fully human antibodies can be expected to provide a substantial advantage in the treatment of chronic and recurring human diseases, such as cancer, which require repeated antibody administrations.
[0121] One approach towards this goal was to engineer mouse strains deficient in mouse antibody production with large fragments of the human Ig loci in anticipation that such mice would produce a large repertoire of human antibodies in the absence of mouse antibodies. Large human Ig fragments would preserve the large variable gene diversity as well as the proper regulation of antibody production and expression. By exploiting the mouse machinery for antibody diversification and selection and the lack of immunological tolerance to human proteins, the reproduced human antibody repertoire in these mouse strains should yield high affinity antibodies against any antigen of interest, including human antigens. Using the hybridoma technology, antigen-specific human Monoclonal antibodies with the desired specificity could be readily produced and selected. [0122] This general strategy was demonstrated in connection with the generation of the first XenoMouse™strains as published in 1994. See Green et al. Nature Genetics 7:13-21 (1994). The XenoMouse™ strains were engineered with yeast artificial chromosomes (YACS) containing 245 kb andlO 190 kb-sized germline configuration fragments of the human heavy chain locus and kappa light chain locus, respectively, which contained core variable and constant region sequences. Id. The human Ig containing YACs proved to be compatible with the mouse system for both rearrangement and expression of antibodies and were capable of substituting for the inactivated mouse Ig genes. This was demonstrated by their ability to induce B-cell development, to produce an adult-like human repertoire of fully human antibodies, and to generate antigen-specific human monoclonal antibodies. These results also suggested that introduction of larger portions of the human Ig loci containing greater numbers of V genes, additional regulatory elements, and human Ig constant regions might recapitulate substantially the full repertoire that is characteristic of the human humoral response to infection and immunization. The work of Green et al. was recently extended to the introduction of greater than approximately 80% of the human antibody repertoire through introduction of megabase sized, germline configuration YAC fragments of the human heavy chain loci and kappa light chain loci, respectively, to produce XenoMouse™ mice. See Mendez et al. Nature Genetics 15:146-156 (1997), Green and Jakobovits J Exp. Med. 188:483-495 (1998), Green, Journal of Immunological Methods 231:11-23 (1999) and U.S. Patent Application Serial No. 08/759,620, filed December 3, 1996, the disclosures of which are hereby incorporated by reference.
[0123] Such approach is further discussed and delineated in U.S. Patent Application Serial Nos. 07/466,008, filed January 12, 1990, 07/710,515, filed November 8, 1990, 07/919,297, filed July 24, 1992, 07/922,649, filed July 30, 1992, filed 08/031,801, filed March 15,1993, 08/112,848, filed August 27, 1993, 08/234,145, filed April 28, 1994, 08/376,279, filed January 20, 1995, 08/430, 938, April 27, 1995, 0-8/464,584, filed June 5, 1995, 08/464,582, filed June 5, 1995, 08/471,191, filed June 5, 1995, 08/462,837, filed June 5, 1995, 08/486,853, filed June 5, 1995, 08/486,857, filed June 5, 1995, 08/486,859, filed June 5, 1995, 08/462,513, filed June 5, 1995, 08/724,752, filed October 2, 1996, and 08/759,620, filed December 3, 1996. See also Mendez et al. Nature Genetics 15:146-156 (1997) and Green and Jakobovits J Exp. Med. 188:483 495 (1998). See also European Patent No., EP 0 463 151 Bl, grant published June 12, 1996, International Patent Application No., WO 94/02602, published February 3, 1994, International Patent Application No., WO 96/34096, published October 31, 1996, and WO 98/24893, published June 11, 1998. The disclosures of each of the above-cited patents, applications, and references are hereby incorporated by reference in their entirety. [0124] Human anti-mouse antibody (HAMA) responses have led the industry to prepare chimeric or otherwise humanized antibodies. While chimeric antibodies have a human constant region and a murine variable region, it is expected that certain human anti-chimeric antibody (HACA) responses will be observed, particularly in chronic or multi-dose utilizations of the antibody. Thus, it would be desirable to provide fully human antibodies against GLP-1 receptor polypeptides in order to vitiate concerns and/or effects of HAMA or HACA responses.
[0125] Monoclonal antibodies specific for GLP-1 receptor polypeptides may be prepared using hybridoma technology. (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 571-681 (1981)). Briefly, XenoMouse™ mice may be immunized with GLP-1 receptor polypeptides. After immunization, the splenocytes of such mice may be extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP2O), available from the ATCC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981)). The hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the GLP-1 receptor polypetides. [0126] For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use human or chimeric antibodies. Completely human antibodies are particularly desirable for therapeutic treatment of human patients. See also, U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50435, WO 98/24893, WO98/16654, WO 96/34096, WO 96/35735, and WO 91/10741; each of which is incorporated herein by reference in its entirety. In a specific embodiment, antibodies of the present invention comprise one or more VH and VL domains of the invention and constant regions from another immunoglobulin molecule, preferably a human immunoglobulin molecule. In a specific embodiment, antibodies of the present invention comprise one or more CDRs corresponding to the VH and VL domains of the invention and framework regions from another immunoglobulin molecule, preferably a human immunoglobulin molecule.
[0127] A chimeric antibody is a molecule in which different portions of the antibody are derived from different immunoglobulin molecules such as antibodies having a human variable region and a non-human (e.g., murine) immunoglobulin constant region or vice versa. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science 229:1202 (1985); Oi et al, BioTechniques 4:214 (1986); Gillies et al, J. Immunol. Methods 125:191-202 (1989); U.S. Patent Nos. 5,807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their entirety. Chimeric antibodies comprising one or more CDRs from human species and framework regions from a non-human immunoglobulin molecule (e.g., framework regions from a murine, canine or feline immunoglobulin molecule) (or vice versa) can be produced using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Patent Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al, Protein Engineering 7(6):805-814 (1994); Roguska et al, PNAS 91:969-973 (1994)), and chain shuffling (U.S. Patent No. 5,565,352). Often, framework residues in the framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al, U.S. Patent No. 5,585,089; Riechmann et al, Nature 352:323 (1988), which are incorporated herein by reference in their entireties.)
[0128] Intrabodies are antibodies, often scFvs, that are expressed from a recombinant nucleic acid molecule and engineered to be retained intracellularly (e.g., retained in the cytoplasm, endoplasmic reticulum, or periplasm). Intrabodies may be used, for example, to ablate the function of a protein to which the intrabody binds. The expression of intrabodies may also be regulated through the use of inducible promoters in the nucleic acid expression vector comprising the intrabody. Intrabodies of the invention can be produced using methods known in the art, such as those disclosed and reviewed in Chen et al, Hum. Gene Ther. 5:595-601 (1994); Marasco, W.A., Gene Ther. 4:11-15 (1997); Rondon and Marasco, Annu. Rev. Microbiol 57:257-283 (1997); Proba et al, J. Mol Biol. 275:245-253 (1998); Cohen et al, Oncogene 77:2445-2456 (1998); Ohage and Steipe, J Mol Biol. 297:1119-1128 (1999); Ohage et al, J. Mol. Biol 297:1129-1134 (1999); Wirtz and Steipe, Protein Sci. 5:2245-2250 (1999); Zhu et al, J. Immunol. Methods 237:207- 222 (1999); and references cited therein.
[0129] Recombinant expression of an antibody of the invention (including antibody fragments or variants thereof (e.g., a heavy or light chain of an antibody of the invention), requires construction of an expression vector(s) containing a polynucleotide that encodes the antibody. Once a polynucleotide encoding an antibody molecule (e.g., a whole antibody, a heavy or light chain of an antibody, or portion thereof (preferably, but not necessarily, containing the heavy or light chain variable domain)), of the invention has been obtained, the vector(s) for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The invention, thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention (e.g., a whole antibody, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody, or a portion thereof, or a heavy or light chain CDR, a single chain Fv, or fragments or variants thereof), operably linked to a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., PCT Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Patent No. 5,122,464, the contents of each of which are hereby incorporated by reference in its entirety) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy chain, the entire light chain, or both the entire heavy and light chains.
[0130] The expression vector(s) is(are) transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention. Thus, the invention includes host cells containing polynucleotide(s) encoding an antibody of the invention (e.g., whole antibody, a heavy or light chain thereof, or portion thereof, or a single chain antibody, or a fragment or variant thereof), operably linked to a heterologous promoter. In preferred embodiments, for the expression of entire antibody molecules, vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.
[0131] A variety of host-expression vector systems may be utilized to express the antibody molecules of the invention. Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ. These include, but are not limited to, bacteriophage particles engineered to express antibody fragments or variants teherof (single chain antibodies), microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pi chid) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3, NSO cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et al, Gene 45:101 (1986); Cockett et al, Bio/Technology 8:2 (1990); Bebbington et al, Bio/Techniques 10:169 (1992); Keen and Hale, Cytotechnology 18:207 (1996)). These references are incorporated in their entirities by refernce herein. [0132] In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of pharmaceutical compositions of an antibody molecule, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruther et al, EMBO 1. 2:1791 (1983)), in which the antibody coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem. 24:5503-5509 (1989)); and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione 5- transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
[0133] In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) may be used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. Antibody coding sequences may be cloned individually into non-essential regions (for example, the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example, the polyhedrin promoter). [0134] In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the antibody coding sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts (e.g., see Logan & Shenk, Proc. Natl. Acad. Sci. USA 8 1:355-359 (1984)). Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see, e.g., Bittner et al, Methods in Enzymol. 153:51-544 (1987)).
[0135] In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include, but are not limited to, CHO, VERY, BHK, Hela, COS, NSO, MDCK, 293, 3T3, W138, and in particular, breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT2O and T47D, and normal mammary gland cell line such as, for example, CRL7O3O and HsS78Bst. [0136] For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the antibody may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express the antibody molecule. Such engineered cell lines may be particularly useful in screening and evaluation of compositions that interact directly or indirectly with the antibody molecule. [0137] A number of selection systems may be used, including but not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11:223 (1977)), hypoxanthine- guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48:202 (1992)), and adenine phosphoribosyltransferase (Lowy et al, Cell 22:8 17 (1980)) genes can be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhf. i", which confers resistance to methotrexate (Wigler et al, Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al, Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981)); neo, which confers resistance to the aminoglycoside G-418 (Clinical Pharmacy 12:488- 505; Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); TIB TECH l l(5):155-2 15 (May, 1993)); and hygro, which confers resistance to hygromycin (Santerre et al, Gene 30:147 (1984)). Methods commonly known in the art of recombinant DNA technology may be routinely applied to select the desired recombinant clone, and such methods are described, for example, in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al, J. Mol. Biol. 150:1 (1981), which are incorporated by reference herein in their entireties. [0138] The expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, "The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells" in DNA Cloning, Vol.3. (Academic Press, New York, 1987)). When a marker in the vector system expressing antibody is amplifiable, increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the coding sequence of the antibody, production of the antibody will also increase (Grouse et al, Mol. Cell. Biol. 3:257 (1983)).
[0139] Vectors which use glutamine synthase (GS) or DHFR as the selectable markers can be amplified in the presence of the drugs methionine sulphoximine or methotrexate, respectively. An advantage of glutamine synthase based vectors are the availabilty of cell lines (e.g., the murine myeloma cell line, NSO) which are glutamine synthase negative. Glutamine synthase expression systems can also function in glutamine synthase expressing cells (e.g., Chinese Hamster Ovary (CHO) cells) by providing additional inhibitor to prevent the functioning of the endogenous gene. A glutamine synthase expression system and components thereof are detailed in PCT publications: WO87/04462; WO86/05807; WO89/01036; WO89/10404; and WO91/06657 which are incoφorated in their entireties by reference herein. Additionally, glutamine synthase expression vectors that may be used according to the present invention are commercially available from suplliers, including, for example Lo za Biologies, Inc. (Portsmouth, NH). Expression and production of monoclonal antibodies using a GS expression system in murine myeloma cells is described in Bebbington et al, Bio/technology 10:169(1992) and in Biblia and Robinson Biotechnol. Prog. 11:1 (1995) which are incoφorated in their entirities by reference herein.
[0140] The host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain is preferably placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl. Acad. Sci. USA 77:2 197 (1980)). The coding sequences for the heavy and light chains may comprise cDNA or genomic DNA. [0141] Once an antibody molecule of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) has been chemically synthesized or recombinantly expressed, it may be purified by any method known in the art for purification of an immunoglobulin molecule, or more generally, a protein molecule, such as, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. Further, the antibodies of the present invention may be fused to heterologous polypeptide sequences described herein or otherwise known in the art, to facilitate purification.
[0142] Antibodies of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the antibodies of the present invention may be glycosylated or may be non-giycosylated. In addition, antibodies of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
[0143] Antibodies of the invention can be chemically synthesized using techniques known in the art (e.g., see Creighton, 1983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiller, M., et al., 1984, Nature 310:105-111). For example, a peptide corresponding to a fragment of an antibody of the invention can be synthesized by use of a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the antibody polypeptide sequence. Non-classical amino acids include, but are not limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3 -amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitralline, cysteic acid, t- butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na- methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid can be D (dextrorotary) or L (levorotary).
[0144] The invention encompasses antibodies which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
[0145] Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of procaryotic host cell expression. The antibodies may also be modified with a detectable label, such as an enzymatic, fluorescent, radioisotopic or affinity label to allow for detection and isolation of the antibody.
[0146] Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, glucose oxidase or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include biotin, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive material include a radioactive metal ion, e.g., alpha-emitters such as, for example, 213Bi, or other radioisotopes such as, for example, iodine (1311, 1251, 1231, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (115mln, 113mln, 112In, l l lln), and technetium (99Tc, 99mTc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re, 142Pr, 105Rh, 97Ru, 68Ge, 57Co, 65Zn, 85Sr, 32P, 153Gd, 169Yb, 51Cr, 54Mn, 75Se, 113Sn, and 117Tin. [0147] In specific embodiments, antibodies of the invention may be labeled with Europium. For example, antibodies of the invention may be labelled with Europium using the DELFIA Eu-labeling kit (catalog# 1244-302, Perkin Elmer Life Sciences, Boston, MA) following manufacturer's instructions.
[0148] In specific embodiments, antibodies of the invention are attached to macrocyclic chelators useful for conjugating radiometal ions, including but not limited to, l l lln, 177Lu, 90Y, 166Ho, 153Sm, 215Bi and 225 Ac to polypeptides. In a preferred embodiment, the radiometal ion associated with the macrocyclic chelators attached to antibodies of the invention is 11 Hn. In another preferred embodiment, the radiometal ion associated with the macrocyclic chelator attached to antibodies polypeptides of the invention is 90 Y. In specific embodiments, the macrocyclic chelator is 1,4,7,10- tetraazacyclododecane-N,N,,N",N'"-tetraacetic acid (DOTA). In specific embodiments, the macrocyclic chelator is D-(5-isothiocyanato-2-methoxyphenyl)- 1,4,7, 10-tetraaza- cyclododecane-l,4,7,10-tetraacetic acid. In other specific embodiments, the DOTA is attached to the antibody of the invention via a linker molecule. Examples of linker molecules useful for conjugatinga macrocyclic chelator such as DOTA to a polypeptide are commonly known in the art - see, for example, DeNardo et al., Clin Cancer Res. 4(10):2483-90, 1998; Peterson et al., Bioconjug. Chem. 10(4):553-7, 1999; and Zimmerman et al, Nucl. Med. Biol. 26(8):943-50, 1999 which are hereby incoφorated by reference in their entirety. In addition, U.S. Patents 5,652,361 and 5,756,065, which disclose chelating agents that may be conjugated to antibodies, and methods for making and using them, are hereby incoφorated by reference in their entireties. [0149] In one embodiment, antibodies of the invention are labeled with biotin. In other related embodiments, biotinylated antibodies of the invention may be used, for example, as an imaging agent or as a means of identifying one or more TRAIL receptor coreceptor or ligand molecules.
[0150] Also provided by the invention are chemically modified derivatives of antibodies of the invention which may provide additional advantages such as increased solubility, stability and in vivo or in vitro circulating time of the polypeptide, or decreased immunogenicity (see U. S. Patent No. 4,179,337). The chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The antibodies may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.
[0151] The polymer may be of any molecular weight, and may be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 1 kDa and about 100 kDa (the term "about" indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing. Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog). For example, the polyethylene glycol may have an average molecular weight of about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa.
[0152] As noted above, the polyethylene glycol may have a branched structure. Branched polyethylene glycols are described, for example, in U.S. Patent No. 5,643,575; Moφurgo et al., Appl. Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al., Nucleosides Nucleotides 18:2745-2750 (1999); and Caliceti et al., Bioconjug. Chem. 10:638-646 (1999), the disclosures of each of which are incoφorated herein by reference. [0153] The polyethylene glycol molecules (or other chemical moieties) should be attached to the antibody with consideration of effects on functional or antigenic domains of the antibody. There are a number of attachment methods available to those skilled in the art, e.g., EP 0 401 384, herein incoφorated by reference (coupling PEG to G-CSF), see also Malik et al., Exp. Hematol. 20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl chloride). For example, polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound. The amino acid residues having a free amino group may include, for example, lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues, glutamic acid residues, and the C-terminal amino acid residue. Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules. Preferred for therapeutic puφoses is attachment at an amino group, such as attachment at the N-terminus or lysine group. [0154] As suggested above, polyethylene glycol may be attached to proteins, e.g., antibodies, via linkage to any of a number of amino acid residues. For example, polyethylene glycol can be linked to a proteins via covalent bonds to lysine, histidine, aspartic acid, glutamic acid, or cysteine residues. One or more reaction chemistries may be employed to attach polyethylene glycol to specific amino acid residues (e.g., lysine, histidine, aspartic acid, glutamic acid, or cysteine) of the protein or to more than one type of amino acid residue (e.g., lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations thereof) of the protein.
[0155] One may specifically desire antibodies chemically modified at the N-terminus of either the heavy chain or the light chain or both. Using polyethylene glycol as an illustration, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein. The method of obtaining the N-terminally pegylated preparation (i.e., separating this moiety from other monopegylated moieties if necessary) may be by purification of the N-terminally pegylated material from a population of pegylated protein molecules. Selective chemical modification at the N-terminus may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved. [0156] As indicated above, pegylation of the antibodies of the invention may be accomplished by any number of means. For example, polyethylene glycol may be attached to the antibody either directly or by an intervening linker. Linkerless systems for attaching polyethylene glycol to proteins are described in Delgado et al., Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992); Francis et al, Intern. J. of Hematol. 68:1-18 (1998); U.S. Patent No. 4,002,531; U.S. Patent No. 5,349,052; WO 95/06058; and WO 98/32466, the disclosures of each of which are incoφorated herein by reference. [0157] One system for attaching polyethylene glycol directly to amino acid residues of antibodies without an intervening linker employs tresylated MPEG, which is produced by the modification of monmethoxy polyethylene glycol (MPEG) using tresylchloride (C1SO2CH2CF3). Upon reaction of protein with tresylated MPEG, polyethylene glycol is directly attached to amine groups of the protein. Thus, the invention includes antibody- polyethylene glycol conjugates produced by reacting antibodies of the invention with a polyethylene glycol molecule having a 2,2,2 -trifluoreothane sulphonyl group. [0158] Polyethylene glycol can also be attached to antibodies using a number of different intervening linkers. For example, U.S. Patent No. 5,612,460, the entire disclosure of which is incoφorated herein by reference, discloses urethane linkers for connecting polyethylene glycol to proteins. Antibody-polyethylene glycol conjugates wherein the polyethylene glycol is attached to the antibody by a linker can also be produced by reaction of antibodies with compounds such as MPEG- succinimidylsuccinate, MPEG activated with l,r-carbonyldiimidazole, MPEG- 2,4,5-trichloropenylcarbonate, MPEG-p-nitrophenolcarbonate, and various MPEG- succinate derivatives. A number additional polyethylene glycol derivatives and reaction chemistries for attaching polyethylene glycol to proteins are described in WO 98/32466, the entire disclosure of which is incoφorated herein by reference. Pegylated antibody products produced using the reaction chemistries set out herein are included within the scope of the invention.
[0159] The number of polyethylene glycol moieties attached to each antibody of the invention (i.e., the degree of substitution) may also vary. For example, the pegylated antibodies of the invention may be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules. Similarly, the average degree of substitution within ranges such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11- 13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per antibody molecule. Methods for determining the degree of substitution are discussed, for example, in Delgado et al, Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992).
Characterization of anti-GLP-1 receptor Antibodies
[0160] Antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) may also be described or specified in terms of their binding to GLP-1 receptor polypeptides or fragments or variants of GLP-1 receptor polypeptides. In specific embodiments, antibodies of the invention bind GLP-1 receptor polypeptides, or fragments or variants thereof, with a dissociation constant or KD of less than or equal to 5 X 10"2 M, 10"2 M, 5 X 10"3 M, 10"3 M, 5 X 10"4 M, 10"4 M, 5 X 10"5 M, or 10"5 M. More preferably, antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with a dissociation constant or KD less than or equal to 5 X 10"6 M, 10"6 M, 5 X 10"7 M, 10"7M, 5 X 10"8 M, or 10" M. Even more preferably, antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with a dissociation constant or KD less than or equal to 5 X 10'9 M, 10"9 M, 5 X 10"10 M, 10"10 M, 5 X 10"11 M, 10"11 M, 5 X 10"12 M, 10"12 M, 5 X -13 M, 10"13 M, 5 X 10"14 M, 10"14 M, 5 X 10"15 M, or 10"15 M. The invention encompasses antibodies that bind GLP-1 receptor polypeptides with a dissociation constant or KD that is within any one of the ranges that are between each of the individual recited values.
[0161] In specific embodiments, antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with an off rate (kof ) of less than or equal to 5 X 10"2 sec"1, 10"2 sec"1, 5 X 10"3 sec"1 or 10"3 sec"1. More preferably, antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with an off rate (koff) less than or equal to 5 X 10"4 sec"1, 10"4 sec"1, 5 X 10'5 sec"1, or 10"5 sec"1 5 X 10"6 1 r 1 7 1 7 1 sec" , 10" sec" , 5 X 10" sec" or 10" sec" . The invention encompasses antibodies that bind GLP-1 receptor polypeptides with an off rate (koff) that is within any one of the ranges that are between each of the individual recited values.
[0162] In other embodiments, antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with an on rate (kon) of greater than or equal to 103 M"1 sec"1, 5 X 103 M"1 sec"1, 104 M"1 sec"1 or 5 X 104 M"1 sec"1. More preferably, antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with an on rate (kon) greater than or equal to 105 M"1 sec"1, 5 X 105 M"1 sec"1, 106 M"1 sec"l, or 5 X 106 M"1 sec"1 or 107 M_1 sec"1. The invention encompasses antibodies that bind GLP-1 receptor polypeptides with on rate (kon) that is within any one of the ranges that are between each of the individual recited values.
[0163] The antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) specifically bind to a polypeptide or polypeptide fragment or variant of human GLP-1 receptor (e.g., SEQ ID NO:2). In another embodiment, the antibodies of the invention specifically bind to a polypeptide or polypeptide fragment or variant of simian GLP-1 receptor polypeptides. In yet another embodiment, the antibodies of the invention specifically bind to a polypeptide or polypeptide fragment or variant of murine GLP-1 receptor polypeptides. In one embodiment, the antibodies of the invention bind specifically to human and simian GLP-1 receptor polypeptides. In another embodiment, the antibodies of the invention bind specifically to human GLP-1 receptor polypeptides and murine GLP-1 receptor polypeptides. More preferably, antibodies of the invention, preferentially bind to human GLP-1 receptor polypeptides compared to murine GLP-1 receptor polypeptides. [0164] In preferred embodiments, the antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), specifically bind to GLP-1 receptor polypeptides and do not cross-react with any other antigens. In preferred embodiments, the antibodies of the invention specifically bind to GLP-1 receptor polypeptides (e.g., SEQ ID NO:2 or fragments or variants thereof) and do not cross-react with one or more additional members of the PACAP/glucagon receptor superfamily.
[0165] In another embodiment, the antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), specifically bind to GLP-1 receptor polypeptides and cross-react with other antigens. In other embodiments, the antibodies of the invention specifically bind to GLP- 1 receptor polypeptides (e.g., SEQ ID NO:2, or fragments or variants thereof) and cross- react with one or more additional members of the PACAP/glucagon receptor superfamily. [0166] By way of non-limiting example, an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with a dissociation constant (KD) that is less than the antibody's KD for the second antigen. In another non-limiting embodiment, an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with an affinity (i.e., KD) that is at least one order of magnitude less than the antibody's KD for the second antigen. In another non-limiting embodiment, an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with an affinity (i.e., KD) that is at least two orders of magnitude less than the antibody's KD for the second antigen.
[0167] In another non-limiting embodiment, an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with an off rate (k0ff) that is less than the antibody's k0ff for the second antigen. In another non-limiting embodiment, an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with a k0ff that is at least one order of magnitude less than the antibody's k0ff for the second antigen. In another non-limiting embodiment, an antibody may be considered to bind a first antigen preferentially if it binds said first antigen with a koff that is at least two orders of magnitude less than the antibody's k0ff for the second antigen. [0168] The invention also encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that have one or more of the same biological characteristics as one or more of the antibodies described herein. By "biological characteristics" is meant, the in vitro or in vivo activities or properties of the antibodies, such as, for example, the ability to bind to GLP-1 receptor polypeptides, the ability to stimulate GLP-1 receptor mediated biological activity (e.g., to stimulate cAMP production in cells expressing the GLP-1 receptor, to stimulate transcription of insulin in pancreatic beta cells, to stimulate glucose-dependent insulin secretion, to promote pancreatic beta cell proliferation and pancreatic islet neogenesis, to delay gastric emptying and slow small bowel motility, to promote satiety, to reduce fasting glucose and improve glucose tolerance in diabetic rat and mouse models, to promote neurite outgrowth, inhibit neuronal apoptosis, and reduce amyloid beta-peptide levels in the brain, or the ability to stimulate proliferation of GLP-1 receptor expressing cells. [0169] The present invention also provides for antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), that block or inhibit the binding of GLP-1 receptor ligand to a GLP-1 receptor. Nucleic acid molecules encoding these antibodies are also encompassed by the invention. [0170] The present invention also provides for antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), that stimulate proliferation and/or chemotaxis of GLP-1 receptor expressing cells (e.g., cells of the pancreas, nervous system, heart, kidney, and GI tract). Nucleic acid molecules encoding these antibodies are also encompassed by the invention.
[0171] Antibodies of the present invention (including antibody fragments or variants thereof) may be characterized in a variety of ways. In particular, antibodies and related molecules of the invention may be assayed for the ability to specifically bind to GLP-1 receptor polypeptides or a fragment or variant of GLP-1 receptor polypeptides using techniques described herein or routinely modifying techniques known in the art. Assays for the ability of the antibodies of the invention to specifically bind GLP-1 receptor polypeptides or a fragment of GLP-1 receptor polypeptides may be performed in solution (e.g., Houghten, Bio/Techniques 13:412-421(1992)), on beads (e.g., Lam, Nature 354:82-84 (1991)), on chips (e.g., Fodor, Nature 364:555-556 (1993)), on bacteria (e.g., U.S. Patent No. 5,223,409), on spores (e.g., Patent Nos. 5,571,698; 5,403,484; and 5,223,409), on plasmids (e.g., Cull et al., Proc. Natl. Acad. Sci. USA 89:1865-1869 (1992)) or on phage (e.g., Scott and Smith, Science 249:386-390 (1990); Devlin, Science 249:404-406 (1990); Cwirla et al, Proc. Natl. Acad. Sci. USA 87:7178-7182 (1990); and Felici, J. Mol. Biol. 222:301-310 (1991)) (each of these references is incoφorated herein in its entirety by reference). Antibodies that have been identified to specifically bind to GLP-1 receptor polypeptides or a fragment or variant of GLP-1 receptor polypeptides can then be assayed for their specificity and affinity for GLP-1 receptor polypeptides or a fragment or variant of a GLP-1 receptor polypeptide using or routinely modifying techniques described herein or otherwise known in the art.
[0172] The antibodies of the invention may be assayed for specific binding to GLP-1 , receptor polypeptides and cross-reactivity with other antigens by any method known in the art. Immunoassays which can be used to analyze specific binding and cross-reactivity include, but are not limited to, competitive and non-competitive assay systems using techniques such as BIAcore analysis, FACS (fluorescence activated cell sorter) analysis, immunofluorescence, immunocytochemistry, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, western blots, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, and protein A immunoassays, to name but a few. Such assays are routine and well known in the art (see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incoφorated by reference herein in its entirety). Exemplary immunoassays are described briefly below (but are not intended by way of limitation).
[0173] ELISAs comprise preparing antigen, coating the well of a 96-well microtiter plate with the antigen, washing away antigen that did not bind the wells, adding the antibody of interest conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the wells and incubating for a period of time, washing away unbound antibodies or non-specifically bound antibodies, and detecting the presence of the antibodies specifically bound to the antigen coating the well. In ELISAs, the antibody of interest does not have to be conjugated to a detectable compound; instead, a second antibody (which recognizes the antibody of interest) conjugated to a detectable compound may be added to the well. Alternatively, the antigen need not be directly coated to the well; instead the ELISA plates may be coated with an anti-Ig Fc antibody, and the antigen in the form of a GLP-1 receptor-Fc fusion protein, may be bound to the anti-Ig Fc coated to the plate. This may be desirable so as to maintain the antigen protein (e.g., the GLP-1 receptor polypeptides) in a more native conformation than it may have when it is directly coated to a plate. In another alternative, instead of coating the well with the antigen, the antibody may be coated to the well. In this case, the detectable molecule could be the antigen conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase). One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected as well as other variations of ELISAs known in the art. For further discussion regarding ELISAs see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 11.2.1.
[0174] The binding affinity of an antibody (including an scFv or other molecule comprising, or alternatively consisting of, antibody fragments or variants thereof) to an antigen and the off-rate of an antibody-antigen interaction can be determined by competitive binding assays. One example of a competitive binding assay is a radioimmunoassay comprising the incubation of labeled antigen (e.g., antigen labeled with H or I), or fragment or variant thereof with the antibody of interest in the presence of increasing amounts of unlabeled antigen, and the detection of the antibody bound to the labeled antigen. The affinity of the antibody of the present invention for the GLP-1 receptor and the binding off-rates can be determined from the data by Scatchard plot analysis. Competition with a second antibody can also be determined using radioimmunoassays. In this case, GLP-1 receptor polypeptide is incubated with an antibody of the present invention conjugated to a labeled compound (e.g., compound labeled with H or I) in the presence of increasing amounts of an unlabeled second anti- GLP-1 receptor antibody. This kind of competitive assay between two antibodies, may also be used to determine if two antibodies bind the same, closely associated (e.g., overlapping) or different epitopes.
[0175] In a preferred embodiment, BIAcore kinetic analysis is used to determine the binding on and off rates of antibodies (including antibody fragments or variants thereof) to GLP-1 receptor, or fragments of GLP-1 receptor. BIAcore kinetic analysis comprises analyzing the binding and dissociation of antibodies from chips with immobilized GLP-1 receptor on their surface.
[0176] Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody of interest to the cell lysate, incubating for a period of time (e.g., 1 to 4 hours) at 40 degrees C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 40 degrees C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer. The ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the binding of the antibody to an antigen and decrease the background (e.g., pre-clearing the cell lysate with sepharose beads). For further discussion regarding immunoprecipitation protocols see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1.
[0177] Western blot analysis generally comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%- 20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-Tween 20), blocking the membrane with primary antibody (the antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., 32P or 125I) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the presence of the antigen. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected and to reduce the background noise. For further discussion regarding western blot protocols see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.8.1.
Antibody Conjugates
[0178] The present invention encompasses antibodies (including antibody fragments or variants thereof), recombinantly fused or chemically conjugated (including both covalent and non-covalent conjugations) to a heterologous polypeptide (or portion thereof, preferably at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 amino acids of the polypeptide) to generate fusion proteins. The fusion does not necessarily need to be direct, but may occur through linker sequences. For example, antibodies of the invention may be used to target heterologous polypeptides to particular cell types (e.g., cancer cells), either in vitro or in vivo, by fusing or conjugating the heterologous polypeptides to antibodies of the invention that are specific for particular cell surface antigens or which bind antigens that bind particular cell surface receptors. Antibodies of the invention may also be fused to albumin (including but not limited to recombinant human serum albumin (see, e.g., U.S. Patent No. 5,876,969, issued March 2, 1999, EP Patent 0 413 622, and U.S. Patent No. 5,766,883, issued June 16, 1998, herein incoφorated by reference in their entirety)), resulting in chimeric polypeptides. In a preferred embodiment, polypeptides and/or antibodies of the present invention (including fragments or variants thereof) are fused with the mature form of human serum albumin (i.e., amino acids 1 - 585 of human serum albumin as shown in Figures 1 and 2 of EP Patent 0 322 094) which is herein incoφorated by reference in its entirety. In another preferred embodiment, polypeptides and/or antibodies of the present invention (including fragments or variants thereof) are fused with polypeptide fragments comprising, or alternatively consisting of, amino acid residues 1-z of human serum albumin, where z is an integer from 369 to 419, as described in U.S. Patent 5,766,883 herein incoφorated by reference in its entirety. Polypeptides and/or antibodies of the present invention (including fragments or variants thereof) may be fused to either the N- or C-terminal end of the heterologous protein (e.g., immunoglobulin Fc polypeptide or human serum albumin polypeptide). Polynucleotides encoding fusion proteins of the invention are also encompassed by the invention. Such fusion proteins may, for example, facilitate purification and may increase half-life in vivo. Antibodies fused or conjugated to heterologous polypeptides may also be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., Harbor et al, supra, and PCT publication WO 93/2 1232; EP 439,095; Naramura et al, Immunol. Lett. 39:91-99 (1994); U.S. Patent 5,474,981; Gillies et al, PNAS 89:1428-1432 (1992); Fell et al, J. Immunol. 146:2446-2452 (1991), which are incoφorated by reference in their entireties. [0179] The present invention further includes compositions comprising, or alternatively consisting of, heterologous polypeptides fused or conjugated to antibody fragments. For example, the heterologous polypeptides may be fused or conjugated to a Fab fragment, Fd fragment, Fv fragment, F(ab)2 fragment, or a portion thereof. Methods for fusing or conjugating polypeptides to antibody portions are known in the art. See, e.g., U.S. Patent Nos. 5,356,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 9 1/06570; Ashkenazi et al, Proc. Natl. Acad. Sci. USA 88: 10535-10539 (1991); Zheng et al, J. Immunol. 154:5590- 5600 (1995); and Vii et al, Proc. Natl. Acad. Sci. USA 89:11357- 11341 (1992) (said references incoφorated by reference in their entireties).
[0180] Additional fusion proteins of the invention may be generated through the techniques of gene-shuffling, motif-shuffling, exon-shuffling, and/or codon-shuffling (collectively referred to as "DNA shuffling"). DNA shuffling may be employed to modulate the activities of antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), such methods can be used to generate antibodies with altered activity (e.g., antibodies with higher affinities and lower dissociation rates). See, generally, U.S. Patent Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al, Curr. Opinion Biotechnol. 8:724-35 (1997); Harayama, Trends Biotechnol. 16(2):76-82 (1998); Hansson, et al, J. Mol. Biol. 287:265- 76 (1999); and Lorenzo and Blasco, Biotechniques 24(2):308-13 (1998) (each of these patents and publications are hereby incoφorated by reference in its entirety). In one embodiment, polynucleotides encoding antibodies of the invention may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. In another embodiment, one or more portions of a polynucleotide encoding an antibody which portions specifically bind to the GLP-1 receptor may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
[0181] Moreover, the antibodies of the present invention (including antibody fragments or variants thereof), can be fused to marker sequences, such as a polypeptides to facilitate purification. In preferred embodiments, the marker amino acid sequence is a hexa- histidine polypeptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available. As described in Gentz et al, Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. Other peptide tags useful for purification include, but are not limited to, the hemagglutinin "HA" tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al, Cell 37:767 (1984)) and the FLAG® tag (Stratagene, La Jolla, CA). [0182] The present invention further encompasses antibodies (including antibody fragments or variants thereof), conjugated to a diagnostic or therapeutic agent. The antibodies can be used diagnostically to, for example, monitor or prognose the development or progression of a tumor as part of a clinical testing procedure to, e.g., determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include, but are not limited to, various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron emission tomographies, and nonradioactive paramagnetic metal ions. The detectable substance may be coupled or conjugated either directly to the antibody or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Patent No. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention. Examples of suitable enzymes include, but are not limited to, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include, but are not limited to, streptavidin biotin and avidin/biotin; examples of suitable fluorescent materials include, but are not limited to, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes, but is not limited to, luminol; examples of bioluminescent materials include, but are not Imited to, luciferase, luciferin, and aequorin; and examples of suitable radioactive material include, but are not limited to, iodine (1211, 123I, 125I, 131I), carbon (14C), sulfur (35S), tritium (3H), indium (mIn, 112In, 113mIn, 115πTn), technetium (99Tc,99mTc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (135Xe), fluorine (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re, 142Pr, 105Rh, and 97Ru.
[0183] Further, an antibody of the invention (including an scFv or other molecule comprising, or alternatively consisting of> antibody fragments or variants thereof), may be coupled or conjugated to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters such as, for example, 213Bi, or other radioisotopes such as, for example, l 3Pd, 135Xe, 131I, 68Ge, 57Co, 65Zn, 85Sr, 32P, 35S, 90Y, 153Sm, 153Gd, 169Yb, 51Cr, 54Mn, 75Se, 113Sn, 90Y, 117Tin, 186Re, 188Re and 166Ho. In specific embodiments, an antibody or fragment thereof is attached to macrocyclic chelators that chelate radiometal ions, including but not limited to, Lu, Y, Ho, and Sm, to polypeptides. In specific embodiments, the macrocyclic chelator is 1,4,7, 10-tetraazacyclododecane-N,N',N",N'"-tetraacetic acid (DOTA). In other specific embodiments, the DOTA is attached to the an antibody of the invention or fragment thereof via a linker molecule. Examples of linker molecules useful for conjugating DOTA to a polypeptide are commonly known in the art - see, for example, DeNardo et al, Clin Cancer Res. 4(10):2483-90, 1998; Peterson et al, Bioconjug. Chem. 10(4):553-7, 1999; and Zimmerman et al, Nucl. Med. Biol. 26(8):943-50, 1999 which are hereby incoφorated by reference in their entirety.
[0184] A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include, but are not limited to, paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, thymidine kinase, endonuclease, RNAse, and puromycin and frragments, variants or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5- fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cisdicMorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine).
[0185] Techniques known in the art may be applied to label antibodies of the invention. Such techniques include, but are not limited to, the use of bifunctional conjugating agents (see e.g., U.S. Patent Nos. 5,756,065; 5,714,711; 5,696,239; 5,652,371; 5,505,931; 5,489,425; 5,435,990; 5,428,139; 5,342,604; 5,274,119; 4,994,560; and 5,808,003; the contents of each of which are hereby incoφorated by reference in its entirety) and direct coupling reactions (e.g., Bolton-Hunter and Chloramine-T reaction). [0186] The antibodies of the invention which are conjugates can be used for modifying a given biological response, the therapeutic agent or drug moiety is not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, but are not limited to, for example, a toxin such as abrin, ricin A, alpha toxin, pseudomonas exotoxin, or diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin; a protein such as tumor necrosis factor, alpha-interferon, beta-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I (see, International Publication No. WO 97/35899), Fas Ligand (Takahashi et al, Int. Immunol, 6:1567-1574 (1994)), VEGI (see, International Publication No. WO 99/23105), a thrombotic agent or an anti-angiogenic agent, e.g., angiostatin or endostatin; or, biological response modifiers such as, for example, lymphokines, interleukin-1 (IL- 1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), or other growth factors. [0187] Antibodies of the invention (including antibody fragments or variants thereof), may also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. [0188] Techniques for conjugating a therapeutic moiety to antibodies are well known, see, e.g., Arnon et al, "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243- 56 (Alan R. Liss, Inc. 1985); Hellstrom et al, "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thoφe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thoφe et al, "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev. 62:119-58 (1982).
[0189] Alternatively, an antibody of the invention can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980, which is incoφorated herein by reference in its entirety. [0190] An antibody of the invention (including an other molecules comprising, or alternatively consisting of, an antibody fragment or variant thereof), with or without a therapeutic moiety conjugated to it, administered alone or in combination with cytotoxic factor(s) and/or cytokine(s) can be used as a therapeutic.
Uses of Antibodies of the Invention
[0191] Antibodies of the present invention may be used, for example, but not limited to, to purify, detect, and target the polypeptides of the present invention, including both in vitro and in vivo diagnostic and therapeutic methods. For example, the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of GLP-1 receptor polypeptides in biological samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incoφorated by reference herein in its entirety).
Immunophenotyping
[0192] The antibodies of the invention may be utilized for immunophenotyping of cell lines and biological samples. The translation product of the gene of the present invention may be useful as a cell specific marker, or more specifically as a cellular marker that is differentially expressed at various stages of differentiation and/or maturation of particular cell types, such as T-cells (e.g., activated T-cells). In other embodiments, the antibodies of the invention may be useful as tumors and/or cancer cell markers. Monoclonal antibodies directed against a specific epitope, or combination of epitopes, will allow for the screening of cellular populations expressing the marker. Various techniques can be utilized using monoclonal antibodies to screen for cellular populations expressing the marker(s), and include magnetic separation using antibody-coated magnetic beads, "panning" with antibody attached to a solid matrix (i.e., plate), and flow cytometry (See, e.g., U.S. Patent 5,985,660; and Morrison et al, Cell, 96:737-49 (1999)). [0193] These techniques allow for the screening of particular populations of cells, such as might be found with hematological malignancies (i.e. minimal residual disease (MRD) in acute leukemic patients) and "non-self cells in transplantations to prevent Graft-versus- Host Disease (GVHD). Alternatively, these techniques allow for the screening of hematopoietic stem and progenitor cells capable of undergoing proliferation and/or differentiation, as might be found in human umbilical cord blood.
Epitope Mapping [0194] The present invention provides antibodies (including antibody fragments or variants thereof), that can be used to identify epitopes of a GLP-1 receptor polypeptide. In particular, the antibodies of the present invention can be used to identify epitopes of a human GLP-1 receptor polypeptide (e.g., SEQ ID NO:2); a murine GLP-1 receptor; a rat GLP-1 receptor polypeptide; or a monkey GLP-1 receptor polypeptide, using techniques described herein or otherwise known in the art. Fragments which function as epitopes may be produced by any conventional means. (See, e.g., Houghten, Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985), further described in U.S. Patent No. 4,711,211.) Identified epitopes of antibodies of the present invention may, for example, be used as vaccine candidates, i.e., to immunize an individual to elicit antibodies against the naturally occuring forms of GLP-1 receptor polypeptides.
Diagnostic Uses of Antibodies [0195] Labeled antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) which specifically bind to a GLP-1 receptor polypeptides can be used for diagnostic puφoses to detect, diagnose, prognose, or monitor diseases and/or disorders. In specific embodiments, labeled antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) which specifically bind to a GLP-1 receptor polypeptide can be used for diagnostic puφoses to detect, diagnose, prognose, or monitor diseases and/or disorders associated with the aberrant expression and/or activity of GLP-1 receptors or GLP-1 mediated activity.
[0196] The invention provides for the detection of expression of a GLP-1 receptor polypeptide comprising: (a) assaying the expression of a GLP-1 receptor polypeptide in a biological sample from an individual using one or more antibodies of the invention that specifically binds to a GLP-1 receptor polypeptide; and (b) comparing the level of a GLP- 1 receptor polypeptide with a standard level of a GLP-1 receptor polypeptide, (e.g., the level in normal biological samples).
[0197] The invention provides for the detection of aberrant expression of a GLP-1 receptor polypeptide comprising: (a) assaying the expression of a GLP-1 receptor polypeptide in a biological sample from an individual using one or more antibodies of the invention that specifically binds to a GLP-1 receptor polypeptide; and (b) comparing the level of a GLP-1 receptor polypeptide with a standard level of a GLP-1 receptor polypeptide, e.g., in normal biological samples, whereby an increase or decrease in the assayed level of a GLP-1 receptor polypeptide compared to the standard level of a GLP-1 receptor polypeptide is indicative of aberrant expression.
[0198] By "biological sample" is intended any fluids and/or cells obtained from an individual, body fluid, body tissue, body cell, cell line, tissue culture, or other source which may contain a GLP-1 receptor polypeptide protein or mRNA. Body fluids include, but are not limited to, sera, plasma, urine, synovial fluid, spinal fluid, saliva, and mucous. Tissues samples may be taken from virtually any tissue in the body. Tissue samples may also be obtained from autopsy material. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. Where the biological sample is to include mRNA, a tissue biopsy is the preferred source.
[0199] One aspect of the invention is the detection and diagnosis of a disease or disorder associated with aberrant expression of a GLP-1 receptor polypeptide or GLP-1 signaalling in an animal, preferably a mammal and most preferably a human. In one embodiment, diagnosis comprises: a) administering (for example, parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically binds to a GLP-1 receptor polypeptide; b) waiting for a time interval following the administering for permitting the labeled antibody to preferentially concentrate at sites in the subject where GLP-1 receptor polypeptide is expressed (and for unbound labeled molecule to be cleared to background level); c) determining background level; and d) detecting the labeled antibody in the subject, such that detection of labeled antibody or fragment thereof above the background level and above or below the level observed in a person without the disease or disorder indicates that the subject has a particular disease or disorder associated with aberrant expression of a GLP-1 receptor polypeptide or GLP-1 signalling. Background level can be determined by various methods including, comparing the amount of labeled molecule detected to a standard value previously determined for a particular system.
[0200] It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99Tc. The labeled antibody will then preferentially accumulate at the location of cells which contain the specific protein. In vivo tumor imaging is described in S.W. Burchiel et al, "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).
[0201] Depending on several variables, including the type of label used and the mode of administration, the time interval following the administration for permitting the labeled molecule to preferentially concentrate at sites in the subject and for unbound labeled molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 5 to 10 days.
[0202] In one embodiment, monitoring of the disease or disorder is carried out by repeating the method for diagnosing the disease or disorder, for example, one month after initial diagnosis, six months after initial diagnosis, one year after initial diagnosis, etc. [0203] Presence of the labeled molecule can be detected in the patient using methods known in the art for in vivo scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the diagnostic methods of the invention include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography.
[0204] In a specific embodiment, the molecule is labeled with a radioisotope and is detected in the patient using a radiation responsive surgical instrument (Thurston et al. , U.S. Patent No. 5,441,050). In another embodiment, the molecule is labeled with a fluorescent compound and is detected in the patient using a fluorescence responsive scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal and is detected in the patient using positron emission-tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and is detected in a patient using magnetic resonance imaging (MRI).
[0205] In specific embodiments, antibodies of the present invention may be used in wound healing and in the diagnosis, prevention, and treatment of proliferative disorders, as well as immune system diseases and disorders including autoimmune disease, inflammatory disorders, immunodeficiencies, infections, HIV, arthritis, allergy, psoriasis, dermatitis, and inflammatory bowel disease, particularly those diseases and/or disorders described in the "Therapeutic Uses of Antibodies" sections below.
Therapeutic Uses of Antibodies [0206] One or more antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to a GLP-1 receptor may be used locally or systemically in the body as a therapeutic. The present invention is further directed to antibody-based therapies which involve administering antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) to an animal, preferably a mammal, and most preferably a human, for preventing or treating one or more of the disclosed diseases, disorders, or conditions. Therapeutic compounds of the invention include, but are not limited to, antibodies of the invention and nucleic acids encoding antibodies (and anti-idiotypic antibodies) of the invention as described herein. In one embodiment, the antibodies of the invention can be used to treat, ameliorate or prevent diseases, disorders or conditions, including, but not limited to, any one or more of the diseases, disorders, or conditions described herein. The treatment and/or prevention of diseases, disorders, or conditions includes, but is not limited to, alleviating symptoms associated with those diseases, disorders or conditions. Antibodies of the invention may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.
Therapeutic Uses of Antibodies for Treating Inflammatory Disorders and Wound Healing
[0207] In highly preferred embodiments, antibodies and antibody compositions of the invention may be useful for treating, diagnosing, preventing, and/or detecting inflammatory diseases. In a specific embodiment, antibodies and antibody compositions of the invention are useful in the diagnosis, treatment, detection, and/or prevention of psoriasis, dermatitis, Langerhans cell histiocytosis, allergy, asthma, and inflammatory bowel disease.
[0208] In other highly preferred embodiments, antibodies and antibody compositions of the invention are useful in the diagnosis and treatment or prevention of immune diseases and disorders including, but not limited to, inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome), ischemia-reperfusion injury, endotoxin lethality, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, over production of cytokines (e.g., TNF or IL-1.), respiratory disorders (e.g., asthma and allergy); gastrointestinal disorders (e.g., inflammatory bowel disease); cancers (e.g., gastric, ovarian, lung, bladder, liver, and breast); CNS disorders (e.g., multiple sclerosis; ischemic brain injury and/or stroke, traumatic brain injury, neurodegenerative disorders (e.g., Parkinson's disease and Alzheimer's disease); AIDS- related dementia; and prion disease); cardiovascular disorders (e.g., atherosclerosis, myocarditis, cardiovascular disease, and cardiopulmonary bypass complications); as well as many additional diseases, conditions, and disorders that are characterized by inflammation (e.g., hepatitis, rheumatoid arthritis, gout, trauma, pancreatitis, sarcoidosis, dermatitis, renal ischemia-reperfusion injury, Grave's disease, systemic lupus erythematosus, diabetes mellitus, and allogenic transplant rejection). [0209] Because inflammation is a fundamental defense mechanism, inflammatory disorders can affect virtually any tissue of the body. Accordingly, antibodies of the invention have uses in the treatment of tissue-specific inflammatory disorders, including, but not limited to, adrenalitis, alveolitis, angiocholecystitis, appendicitis, balanitis, blepharitis, bronchitis, bursitis, carditis, cellulitis, cervicitis, cholecystitis, chorditis, cochlitis, colitis, conjunctivitis, cystitis, dermatitis, diverticulitis, encephalitis, endocarditis, esophagitis, eustachitis, fibrositis, folliculitis, gastritis, gastroenteritis, gingivitis, glossitis, hepatosplenitis, keratitis, labyrinthitis, laryngitis, lymphangitis, mastitis, media otitis, meningitis, metritis, mucitis, myocarditis, myosititis, myringitis, nephritis, neuritis, orchitis, osteochondritis, otitis, pericarditis, peritendonitis, peritonitis, pharyngitis, phlebitis, poliomyelitis, prostatitis, pulpitis, retinitis, rhinitis, salpingitis, scleritis, sclerochoroiditis, scrotitis, sinusitis, spondylitis, steatitis, stomatitis, synovitis, syringitis, tendonitis, tonsillitis, urethritis, and vaginitis.
[0210] In highly preferred embodiments, antibodies and antibody compositions of the invention are useful to diagnose, prognose, prevent, and/or treat organ transplant rejections and graft-versus-host disease. Organ rejection occurs by host immune cell destruction of the transplanted tissue through an immune response. Similarly, an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues. Polypeptides, antibodies, or polynucleotides of the invention, and/or agonists or antagonists thereof, that inhibit an immune response, particularly the activation, proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing organ rejection or GVHD. In specific embodiments, antibodies and antibody compositions of the invention that inhibit an immune response, particularly the activation, proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing allergic and hyperacute xenograft rejection. [0211] In other preferred embodiments, antibodies of the present invention are useful to diagnose, prognose, prevent, and/or treat immune complex diseases, including, but not limited to, serum sickness, post streptococcal glomerulonephritis, polyarteritis nodosa, and immune complex-induced vasculitis.
[0212] Antibodies and antibody compositions of the invention are also useful in promoting angiogenesis and/or wound healing (e.g., wounds, burns, and bone fractures). [0213] In a highly preferred embodiment, antibodies and antibody compositions of the invention may be used to stimulate epithelial cell proliferation and basal keratinocytes for the puφose of wound healing, and to stimulate hair follicle production and healing of dermal wounds. Antibodies and antibody compositions of the invention may be clinically useful in stimulating wound healing including surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, burns resulting from heat exposure or chemicals, and other abnormal wound healing conditions such as uremia, malnutrition, vitamin deficiencies and complications associated with systemic treatment with steroids, radiation therapy and antineoplastic drugs and antimetabolites. Antibodies and antibody compositions of the invention could be used to promote dermal reestablishment subsequent to dermal loss. [0214] In another highly preferred embodiment, antibodies and antibody compositions of the invention may be used as an adjuvant to enhance immune responsiveness to specific antigen, such as in anti-viral immune responses.
[0215] More generally, antibodies and antibody compositions of the invention are useful in regulating (i.e., elevating or reducing) immune response. For example, antibodies and antibody compositions of the invention may be useful in preparation or recovery from surgery, trauma, radiation therapy, chemotherapy, and transplantation, or may be used to boost immune response and/or recovery in the elderly and immunocompromised individuals. Alternatively, antibodies and antibody compositions of the invention are useful as immunosuppressive agents, for example in the treatment or prevention of autoimmune disorders. In specific embodiments, antibodies and antibody compositions of the invention are used to treat or prevent chronic inflammatory, allergic or autoimmune conditions, such as those described herein or are otherwise known in the art.
Therapeutic Uses of Antibodies for Treating Cancers [0216] In highly preferred embodiments, antibodies of the invention that bind a GLP-1 receptor polypeptide and inhibit proliferation of GLP-1 receptor expressing cells are used to diagnose, treat, prevent or ameliorate cancer. In specific embodiments, antibodies of the invention are used to inhibit the progression or metastasis of cancers of the pancreas, nervous system, heart, kidney, and GI tract.
[0217] In other preferred embodiments, antibodies of the invention that bind a GLP-1 receptor polypeptide and inhibit proliferation of GLP-1 receptor expressing cells are used to diagnose, treat, prevent or ameliorate cancers and related disorders including, but not limited to, colon cancer, cervical cancer, leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, • leiomyosarcoma, rhabdomyosarcoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and retinoblastoma.
[0218] In specific embodiments, antibodies of the invention used to treat the aforementioned cancers are administered with or conjugated to a cytotoxic and/or chemotherapeutic agent.
Therapeutic and Diagnostic Uses of Antibodies for Treating Autoimmune Disorders
[0219] In highly preferred embodiments, antibodies and antibody compositions of the invention are used to diagnose, treat, prevent or ameliorate autoimmune diseases, disorders, or conditions associated with such diseases or disorders. Autoimmune disorders and related disorders, include, but are not limited to, autoimmune hemolytic anemia, autoimmune neonatal thrombocytopenia, idiopathic thrombocytopenia puφura, autoimmunocytopenia, hemolytic anemia, antiphospholipid syndrome, dermatitis, allergic encephalomyelitis, myocarditis, relapsing polychondritis, ulcerative colitis, dense deposit disease, rheumatic heart disease, glomerulonephritis (e.g., IgA nephropathy), pemphigus vulgaris, discoid lupus, Multiple Sclerosis, Neuritis, Uveitis Ophthalmia, Polyendocrinopathies, Puφura (e.g., Henloch-Scoenlein puφura), Reiter's Disease, Stiff-Man Syndrome, Autoimmune Pulmonary Inflammation, Guillain-Barre Syndrome, insulin dependent diabetes mellitis, and autoimmune inflammatory eye, autoimmune thyroiditis, hypothyroidism (i.e., Hashimoto's thyroiditis), systemic lupus erhythematosus, Goodpasture's syndrome, Pemphigus, Receptor autoimmunities such as, for example, (a) Graves' Disease , (b) Myasthenia Gravis, and (c) insulin resistance, autoimmune hemolytic anemia, autoimmune thrombocytopenic puφura , rheumatoid arthritis, schleroderma with anti-collagen antibodies, mixed connective tissue disease, polymyositis/dermatomyositis, pernicious anemia, idiopathic Addison's disease, infertility, glomerulonephritis such as primary glomerulonephritis and IgA nephropathy, bullous pemphigoid, Sjogren's syndrome, diabetes millitus, and adrenergic drug resistance (including adrenergic drug resistance with asthma or cystic fibrosis), chronic active hepatitis, primary biliary cirrhosis, other endocrine gland failure, vitiligo, vasculitis, post-MI, cardiotomy syndrome, urticaria, atopic dermatitis, asthma, inflammatory myopathies, graft v. host diseases (GVHD) and other inflammatory, granulamatous, degenerative, and atrophic disorders).
[0220] In a specific embodiment, antibodies of the invention can used to diagnose, treat, inhibit, prognose, diagnose or prevent rheumatoid arthritis.
[0221] In a specific embodiment, antibodies of the invention can used to diagnose, treat, inhibit, prognose, diagnose or prevent systemic lupus erythematosus. [0222] In a specific embodiment, antibodies of the invention can used to diagnose, treat, inhibit, prognose, diagnose or prevent autoimmune encephalitis.
Additional Therapeutic Uses of Antibodies [0223] In an additional highly preferred embodiment, the antibodies of the invention can be used to diagnose, treat, inhibit or prevent diseases, disorders or conditions associated with immunodeficiencies including, but not limited to, severe combined immunodeficiency (SCID)-X linked, SCID-autosomal, adenosine deaminase deficiency (ADA deficiency), X-linked agammaglobulinemia (XLA), Bruton's disease, congenital agammaglobulinemia, X-linked infantile agammaglobulinemia, acquired agammaglobulinemia, adult onset agammaglobulinemia, late-onset agammaglobulinemia, dysgammaglobulinemia, hypogammaglobulinemia, transient hypogammaglobulinemia of infancy, unspecified hypogammaglobulinemia, agammaglobulinemia, common variable immunodeficiency (CVID) (acquired), Wiskott-Aldrich Syndrome (WAS), X-linked immunodeficiency with hyper IgM, non X-linked immunodeficiency with hyper IgM, selective IgA deficiency, IgG subclass deficiency (with or without IgA deficiency), antibody deficiency with normal or elevated Igs, immunodeficiency with thymoma, Ig heavy chain deletions, kappa chain deficiency, B cell lymphoproliferative disorder (BLPD), selective IgM immunodeficiency, recessive agammaglobulinemia (Swiss type), reticular dysgenesis, neonatal neutropenia, autoimmune neutropenia, severe congenital leukopenia, thymic alymphoplasia-aplasia or dysplasia with immunodeficiency, ataxia-telangiectasia, short limbed dwarfism, X-linked lymphoproliferative syndrome (XLP), Nezelof syndrome-combined immunodeficiency with Igs, purine nucleoside phosphorylase deficiency (PNP), MHC Class II deficiency (Bare Lymphocyte Syndrome) and severe combined immunodeficiency.
[0224] Antibodies and antibody compositions of the present invention may be useful in treating, preventing, prognosing, and/or diagnosing diseases, disorders, and/or conditions of hematopoietic cells including, but not limited to, leukopenia, neutropenia, anemia, and thrombocytopenia. Alternatively, antibodies of the invention could be used to decrease differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat or prevent those diseases, disorders, and/or conditions associated with an increase in certain (or many) types of hematopoietic cells, including but not limited to, histiocytosis.
[0225] The antibodies of the invention can be used to diagnose, treat, ameliorate or prevent diseases, disorders or conditions associated with aberrant expression and/or activity of GLP-1 receptor, including, but not limited to, any one or more of the diseases, disorders, or conditions described herein. The treatment and/or prevention of diseases, disorders, or conditions associated with aberrant GLP-1 receptor expression and/or activity includes, but is not limited to, alleviating symptoms associated with those diseases, disorders or conditions. Antibodies of the invention may be provided in pharmaceutically acceptable compositions as known in the art or as described herein. [0226] Further, antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) which activate GLP-1 receptor-mediated biological activities can be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder described herein, particularly inflammatory and other immune disorders. These antibodies may potentiate or activate either all or a subset of the biological activities of GLP-1 receptor, for example, by inducing a conformational change in GLP-1 receptor. In a specific embodiment, an antibody of the present invention that increases GLP-1 receptor activity by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least two-fold, at least three-fold, at least four fold, at least five fold, at least ten-fold, at least twenty-fold, at least fifty-fold, or at least one hundred-fold relative to GLP-1 receptor activity in absence of the antibody is administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder. In another embodiment, a combination of antibodies, a combination of antibody fragments, a combination of antibody variants, or a combination of antibodies, antibody fragments and/or antibody variants that increase GLP-1 receptor activity by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least twofold, at least three-fold, at least four fold, at least five fold, -at least ten-fold, at least twenty-fold, at least fifty-fold, or at least one hundred-fold relative to GLP-1 receptor activity in absence of the said antibodies or antibody fragments and/or antibody variants is administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder. [0227] Further, antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) which activate GLP-1 receptor-mediated biological activities can be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 signalling, especially cancer and other hypeφroliferative disorders. These antibodies may potentiate or activate either all or a subset of the biological activities of GLP-1 receptor, for example, by inducing a conformational change in GLP-1 receptor. In a specific embodiment, an antibody of the present invention that increases GLP-1 receptor activity by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least two-fold, at least three-fold, at least four fold, at least five fold, at least ten-fold, at least twenty-fold, at least fifty-fold, or at least one hundred-fold relative to GLP-1 receptor activity in absence of the antibody is administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 signalling. In another embodiment, a combination of antibodies, a combination of antibody fragments, a combination of antibody variants, or a combination of antibodies, antibody fragments and/or antibody variants that increase GLP-1 receptor activity by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least two-fold, at least three-fold, at least four fold, at least five fold, at least ten-fold, at least twenty-fold, at least fifty-fold, or at least one hundred-fold relative to GLP-1 receptor activity in absence of the said antibodies or antibody fragments and/or antibody variants is administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 signalling.
[0228] Antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that function as agonists or antagonists of a GLP-1 receptor, preferably of GLP-1 receptor signal fransduction, can be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 signalling. For example, antibodies of the invention which mimic the action of GLP-1 binding to the GLP-1 receptor, in full or in part, (e.g., antibodies that act as GLP-1 receptor agonists), may be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated aberrant GLP-1 receptor expression, function, or aberrant GLP-1 signalling. As an alternative example, antibodies of the invention which disrupt or prevent the interaction between GLP-1 receptor and its receptor or inhibit, reduce, or prevent signal fransduction through one or more GLP-1 receptor, may be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 signalling. Antibodies of the invention which do not prevent GLP-1 receptor from binding its ligand but inhibit or downregulate GLP-1 receptor signal fransduction can be administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression, abberant GLP-1 receptor function, aberrant GLP-1 expression, or abberant GLP-1 function. The ability of an antibody of the invention to enhance, inhibit, upregulate or downregulate GLP-1 receptor signal fransduction may be determined by techniques described herein or otherwise known in the art. For example, GLP-1 -induced receptor activation and the activation of signaling molecules can be determined by detecting the association of adaptor proteins with the GLP-1 receptors, by immunoprecipitation followed by western blot analysis (for example, as described herein).
[0229] In a specific embodiment, an antibody of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that enhances or stimulates, in full or in part, GLP-1 receptor activity (e.g., stimulates cAMP production in cells expressing the GLP-1 receptor, stimulates transcription of insulin in pancreatic beta cells, stimulates glucose-dependent insulin secretion, promotes pancreatic beta cell proliferation and pancreatic islet neogenesis, inhibits beta cell degeneration and apoptosis, delays gastric emptying and slows small bowel motility, promotes satiety, reduces fasting glucose and improves glucose tolerance in diabetic rat and mouse models, promotes neurite outgrowth, inhibits neuronal apoptosis, and reduces amyloid beta-peptide levels in the brain, or stimulates proliferation of cells expressing a GLP-1 receptor (e.g., cells of the pancreas, nervous system, heart, kidney, and GI tract)) by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% relative to GLP-1 receptor activity in the absence of the antibody is administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 signalling. In another embodiment, a combination of antibodies, a combination of antibody fragments, a combination of antibody variants, or a combination of antibodies, antibody fragments, and/or variants that enhance or stimulate GLP-1 receptor activity by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% relative to GLP-1 receptor activity in absence of said antibodies, antibody fragments, and/or antibody variants are administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 expression and/or function. [0230] In a specific embodiment, an antibody of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that inhibits or downregulates, in full or in part, GLP-1 receptor activity by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% relative to GLP-1 receptor activity in absence of the antibody is administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 expression and/or function. In another embodiment, a combination of antibodies, a combination of antibody fragments, a combination of antibody variants, or a combination of antibodies, antibody fragments, and/or variants that inhibit or downregulate GLP-1 receptor activity by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% relative to GLP-1 receptor activity in absence of said antibodies, antibody fragments, and/or antibody variants are administered to an animal to diagnose, treat, prevent or ameliorate a disease or disorder associated with aberrant GLP-1 receptor expression and/or function or aberrant GLP-1 expression and/or function. [0231] In another embodiment, therapeutic or pharmaceutical compositions of the invention are administered to an animal to diagnose, freat, prevent or ameliorate infectious diseases. Infectious diseases include diseases associated with yeast, fungal, viral and bacterial infections. Viruses associated with viral infections which can be treated or prevented in accordance with this invention include, but are not limited to, retroviruses (e.g., human T-cell lymphotrophic virus (HTLV) types I and II and human immunodeficiency virus (HIV)), heφes viruses (e.g., heφes simplex virus (HSV) types I and II, Epstein-Barr virus, HHV6-HHV8, and cytomegalovirus), arenavirues (e.g., lassa fever virus), paramyxo viruses (e.g., morbillivirus virus, human respiratory syncytial virus, mumps, and pneumovirus), adenoviruses, bunyaviruses (e.g., hantavirus), cornaviruses, filoviruses (e.g., Ebola virus), flaviviruses (e.g., hepatitis C virus (HCV), yellow fever virus, and Japanese encephalitis virus), hepadnaviruses (e.g., hepatitis B viruses (HBV)), orthomyo viruses (e.g., influenza viruses A, B and C), papovaviruses (e.g., papillomavirues), picornaviruses (e.g., rhino viruses, entero viruses and hepatitis A viruses), poxvirases, reoviruses (e.g., rotavirues), togaviruses (e.g., rubella virus), rhabdoviruses (e.g., rabies virus). Microbial pathogens associated with bacterial infections include, but are not limited to, Streptococcus pyogenes, Streptococcus pneumoniae, Neisseria gonorrhoea, Neisseria meningitidis, Corynebacterium diphtheriae , Clostridium botulinum, Clostridium perfringens, Clostridium tetani, Haemophilus iηfluen∑ae, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella rhinoscleromotis, Staphylococcus aureus, Vibrio cholerae, Escherichia coli, Pseudomonas aeruginosa, Campylobacter (Vibrio) fetus, Campylobacter jejuni, Aeromonas hydrophila, Bacillus cereus, Edwardsiella tarda, Yersinia enter ocolitica, Yersinia pestis, Yersinia. pseudotuberculosis, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Salmonella typhimurium, Treponema pallidum, Treponema pertenue, Treponema carateneum, Borrelia vincentii, Borrelia burgdorferi, Leptospira icterohemorrhagiae, Mycobacterium tuberculosis, Toxoplasma gondii, Pneumocystis carinii, Francisella tularensis, Brucella abortus, Brucella suis, Brucella melitensis, Mycoplasma spp., Rickettsia prowazeki, Rickettsia tsutsugumushi, Chlamydia spp., and Helicobacter pylori. [0232] Human immunodeficiency virus (HIV) targets chemokine receptors during entry into cells, and certain chemokines act as HIV suppressive factors (Garzino-Demo et al, Proc. Natl Acad. Sci U.S.A. 96:11986-11991 (1999)). Thus, in additional preferred embodiments, antibodies and antibody compositions of the invention are used to treat AIDS and pathologies associated with AIDS. Another embodiment of the present invention encompasses the use of antibodies of the invention to reduce death of T cells in HIV-infected patients.
Therapeutic/Prophylactic Compositions and Administration
[0233] The invention provides methods of treatment and prophylaxis by administration to a subject of an effective amount of antibody (or fragment or variant thereof) or pharmaceutical composition of the invention, preferably an antibody of the invention. In a preferred aspect, an antibody or fragment or variant thereof is substantially purified (i.e., substantially free from substances that limit its effect or produce undesired side-effects). The subject is preferably an animal, including but not limited to, animals such as cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a mammal, and most preferably a human.
[0234] Formulations and methods of administration that can be employed when the compound comprises a nucleic acid or an immunoglobulin are described above; additional appropriate formulations and routes of administration can be selected from among those described herein below. [0235] Various delivery systems are known and can be used to administer antibody or fragment or variant thereof of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the antibody or antibody fragment, receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as part of a retroviral or other vector, etc. Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compositions may be administered by any convenient route, for example by infusion or bolus injection, by absoφtion through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the pharmaceutical compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.
[0236] In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of freatment; this may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. Preferably, when administering a protein, including an antibody, of the invention, care must be taken to use materials to which the protein does not absorb.
[0237] In another embodiment, the composition can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1535 (1990); Treat et al, in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353- 365 (1989); Lopez-Berestein, ibid., pp. 3 17-327; see generally ibid.).
[0238] In yet another embodiment, the composition can be delivered in a controlled release system. In one embodiment, a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref Biomed. Eng. 14:20 1 (1987); Buchwald et al, Surgery 88:507 (1980); Saudek et al, N. Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:71 (1983); see also Levy et al, Science 228:190 (1985); During et al, Ann. Neurol. 25:35 1 (1989); Howard et al, J.Neurosurg. 7 1:105 (1989)). In yet another embodiment, a controlled release system can be placed in proximity of the therapeutic target, i. e. , the brain, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
[0239] Other controlled release systems are discussed in the review by Langer (Science 249:1527-1535 (1990)).
[0240] In a specific embodiment where the composition of the invention is a nucleic acid encoding a protein, the nucleic acid can be administered in vivo to promote expression of its encoded protein, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by use of a refroviral vector (see U.S. Patent No. 4,980,286), or by direct injection, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, or by administering it in linkage to a homeobox- like peptide which is known to enter the nucleus (see e.g., Joliot et al, Proc. Natl. Acad. Sci. USA 88:1864-1868 (1991)), etc. Alternatively, a nucleic acid can be introduced intracellularly and incoφorated within host cell DNA for expression, by homologous recombination.
[0241] The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of an antibody or a fragment thereof, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Such compositions will contain a therapeutically effective amount of the antibody or fragment thereof, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration.
[0242] In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocamne to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
[0243] The compositions of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc. [0244] The amount of the composition of the invention which will be effective in the treatment, inhibition and prevention of a disease or disorder associated with aberrant expression and/or activity of a polypeptide of the invention can be determined by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
[0245] For antibodies, the dosage administered to a patient is typically 0.1 mg/kg to 100 mg kg of the patient's body weight. Preferably, the dosage administered to a patient is between 0.1 mg/kg and 20 mg/kg of the patient's body weight, more preferably 1 mg/kg to 10 mg/kg of the patient's body weight. Generally, human antibodies have a longer half- life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration is often possible. Further, the dosage and frequency of administration of therapeutic or pharmaceutical compositions of the invention may be reduced by enhancing uptake and tissue penetration (e.g., into the brain) of the antibodies by modifications such as, for example, lipidation.
[0246] Generally, administration of products of a species origin or species reactivity (in the case of antibodies) that is the same species as that of the patient is preferred. Thus, in a preferred embodiment, human antibodies, fragments, or variants, (e.g., derivatives), or nucleic acids, are administered to a human patient for therapy or prophylaxis. [0247] It is preferred to use high affinity and/or potent in vivo agonistic antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to one or more GLP-1 receptor polypeptides, or polynucleotides encoding antibodies that specifically bind to one or more GLP-1 receptor polypeptides, for both immunoassays and therapy of disorders related to GLP-1 receptor polynucleotides or polypeptides, including fragments thereof. Such antibodies will preferably have an affinity for GLP-1 receptor polypeptides and/or GLP-1 receptor polypeptide fragments. Preferred binding affinities include those with a dissociation constant or KD of less than or equal to 5 X 10"2 M, 10"2 M, 5 X 10"3 M, 10"3 M, 5 X 10"4 M, 10"4 M, 5 X 10"5 M, or 10"5 M. More preferably, antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with a dissociation constant or KD less than or equal to 5 X 10"6 M, 10"6 M, 5 X 10"7 M, 10"7 M, 5 X 10"8 M, or 10" M. Even more preferably, antibodies of the invention bind GLP-1 receptor polypeptides or fragments or variants thereof with a dissociation constant or KD less than or equal to 5 X 10"9 M, 10"9 M, 5 X 10"10 M, 10"10 M, 5 X 10"11 M, 10"11 M, 5 X 10"12 M, 10"12 M, 5 X "13 M, 10"13 M, 5 X 10"14 M, 10"14 M, 5 X 10"15 M, or 10"15 M. In a preferred embodiment, antibodies of the invention stimulate proliferation of GLP-1 receptor expressing cells, such as pancreatic beta cells.
[0248] As discussed in more detail below, the antibodies of the present invention may be used either alone or in combination with other compositions. The antibodies may further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalent and non-covalent conjugations) to polypeptides or other compositions. For example, antibodies of the present invention may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, e.g., PCT publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP 396,387.
[0249] The antibody and antibody compositions of the invention may be administered alone or in combination with other therapeutic agents, including but not limited to antidiabetic agents (e.g., insulin and insulin receptor agonists, GLP-1 and GLP-1 receptor agonists, a biguanide antidiabetic agent, a glitazone antidiabetic agent, and a sulfonylurea antidiabetic agent), chemotherapeutic agents, antibiotics, antivirals, anti-retroviral agents, steroidal and non-steroidal anti-inflammatories, conventional immunotherapeutic agents and cytokines. Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously, e.g., as through separate intravenous lines into the same individual. Administration "in combination" further includes the separate administration of one of the compounds or agents given first, followed by the second. Combination Therapies with anti-GLP-1 Receptor Antibodies
[0250] Anti-GLP-1 receptor antibodies may be administered in combination with other anti-GLP-1 receptor antibodies and/or chemotherapeutics.
[0251] In specific embodiments, an antibody of the invention that specifically binds GLP-1 receptor is used or administered in combination with a second antibody that specifically binds GLP-1 receptor. In another embodiment, the antibodies specific for GLP-1 receptor are agonistic antibodies that mimic some or all of the activities of GLP-1. The anti-GLP-1 receptor antibodies can be administered either simultaneously, sequentially, or a combination of simultaneous or sequential administration throughout the dosage regimen. In another specific embodiment anti-GLP-1 receptor antibodies are used or administered in combination with an antidiabetic agent (e.g., insulin, and insulin receptor agonist, GLP-1, a GLP-1 receptor agonist, a biguanide antidiabetic agent, a glitazone antidiabetic agent, and a sulfonylurea antidiabetic agent), a chemotherapeutic drug, antiviral drug, and/or immunomodulatory drug.
[0252] In another embodiment, compositions of the invention are administered in combination with a chemotherapeutic agent. Chemotherapeutic agents that may be administered with the compositions of the invention include, but are not limited to, antibiotic derivatives (e.g., doxorubicin (adriamycin), bleomycin, daunorubicin, and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin, and vincristine sulfate); hormones (e.g., medroxyprogesterone, estramustine phosphate sodium, ethin l estradiol, estradiol, megesfrol acetate, mefhyltestosterone, diethylstilbesfrol diphosphate, chlorotrianisene, and testolactone); nitrogen mustard derivatives (e.g., mephalen, chorambucil, mechlorethamine (nitrogen mustard) and thiotepa); steroids and combinations (e.g., bethamethasone sodium phosphate); and others (e.g., dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, etoposide, Topotecan, 5 -Fluorouracil, paclitaxel (Taxol), Cisplatin, Cytarabine, and IFN-gamma, irinotecan (Camptosar, CPT-11), and gemcitabine (GEMZAR™)). [0253] In a preferred embodiment, antibody and antibody compositions of the invention are administered in combination with steroids, cyclosporine, cyclosporine analogs, cyclophosphamide methylprednisone, prednisone, azathioprine, FK-506, 15- deoxyspergualin, and other immunosuppressive agents that act by suppressing the function of responding T cells. Other immunosuppressive agents that may be administered in combination with the compositions of the invention include, but are not limited to, prednisolone, methotrexate, thalidomide, methoxsalen, rapamycin, leflunomide, mizoribine (BREDiNIN™), brequinar, deoxyspergualin, and azaspirane (SKF 105685), ORTHOCLONE OKT® 3 (muromonab-CD3), SANDIMMUNE™, NEORAL™, SANGDYA™ (cyclosporine), PROGRAF® (FK506, tacrolimus), CELLCEPT® (mycophenolate motefϊl, of which the active metabolite is mycophenolic acid), IMURAN™ (azathioprine), glucocorticosteroids, adrenocortical steroids such as DELTASONE™ (prednisone) and HYDELTRASOL™ (prednisolone), FOLEX™ and MEXATE™ (methotrxate), OXSORALEN-ULTRA™ (methoxsalen) and RAPAMUNE™ (sirolimus). In a specific embodiment, immunosuppressants may be used to prevent rejection of organ or bone marrow transplantation.
[0254] In other embodiments, the compositions of the invention are administered in combination with immunostimulants including, but not limited to, levamisole (e.g., ERGAMISOL™), isoprinosine (e.g., INOSIPLEX™), interferons (e.g., interferon alpha), and interleukins (e.g., IL-2).
[0255] In other embodiments, antibody compositions of the invention may be administered in combination with anti-opportunistic infection agents. Anti-opportunistic agents that may be administered in combination with the albumin fusion proteins and/or polynucleotides of the invention, include, but are not limited to, TRIMETHOPRTM-
SULFAMETHOXAZOLE™, DAPSONE™, PENTAMIDINE™, ATOVAQUONE™, ISONIAZID™, RTF AMPIN™, PYRAZINAMIDE™, ETHAMBUTOL™, RIFABUTIN™, CLARITHROMYCΓN™, AZITHROMYCΓN™, GANCICLOVIR™, FOSCARNET™, CΓDOFOVΓR™, FLUCONAZOLE™, ITRACONAZOLE™, KETOCONAZOLE™, ACYCLOVIR™, FAMCICOLVIR™, PYRIMETHAMINE™, LEUCOVORIN™,
NEUPOGEN™ (filgrastim/G-CSF), and LEUKINE™ (sargramostim/GM-CSF). Additional Combination Therapies
[0256] The antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) may be administered alone or in combination with other therapeutic or prophylactic regimens (e.g., radiation therapy, chemotherapy, hormonal therapy, immunotherapy, anti-tumor agents, anti- angiogenesis and anti-inflammatory agents). Such combinatorial therapy may be administered sequentially and/or concomitantly.
[0257] The invention also encompasses combining the polynucleotides and/or polypeptides of the invention (and/or agonists or antagonists thereof) with other proposed or conventional hematopoietic therapies. Thus, for example, the polynucleotides and/or polypeptides of the invention (and/or agonists or antagonists thereof) can be combined with compounds that singly exhibit erythropoietic stimulatory effects, such as erythropoietin, testosterone, progenitor cell stimulators, insulin-like growth factor, prostaglandins, serotonin, cyclic AMP, prolactin, and triiodothyzonine. Also encompassed are combinations of the antibody and antibody compositions of the invention with compounds generally used to treat aplastic anemia, such as, for example, methenolene, stanozolol, and nandrolone; to treat iron-deficiency anemia, such as, for example, iron preparations; to treat malignant anemia, such as, for example, vitamin B12 and/or folic acid; and to treat hemolytic anemia, such as, for example, adrenocortical steroids, e.g., corticoids. See e.g., Resegotti et al., Panminerva Medica, 23:243-248 (1981); Kurtz, FEBS Letters, 14a:105-108 (1982); McGonigle et al., Kidney Int., 25:437- 444 (1984); and Pavlovic-Kantera, Expt. Hematol, 8(supp. 8) 283-291 (1980), the contents of each of which are hereby incoφorated by reference in their entireties. [0258] Compounds that enhance the effects of or synergize with erythropoietin are also useful as adjuvants herein, and include but are not limited to, adrenergic agonists, thyroid hormones, androgens, hepatic erythropoietic factors, erythrofropins, and erythrogenins, See for e.g., Dunn, "Current Concepts in Erythropoiesis", John Wiley and Sons (Chichester, England, 1983); Kalmani, Kidney Int., 22:383-391 (1982); Sha idi, New Eng. J. Med., 289:72-80 (1973); Urabe et al., J. Exp. Med., 149:1314-1325 (1979); Billat et al., Expt. Hematol, 10:135-140 (1982); Naughton et al., Acta Haemat, 69:171-179 (1983); Cognote et al. in abstract 364, Proceedings 7th Intl. Cong, of Endocrinology (Quebec City, Quebec, July 1-7, 1984); and Rothman et al., 1982, J. Surg. Oncol, 20:105- 108 (1982). Methods for stimulating hematopoiesis comprise administering a hematopoietically effective amount (i.e., an amount which effects the formation of blood cells) of a pharmaceutical composition containing polynucleotides and/or poylpeptides of the invention (and/or agonists or antagonists thereof) to a patient. The polynucleotides and/or polypeptides of the invention and/or agonists or antagonists thereof is administered to the patient by any suitable technique, including but not limited to, parenteral, sublingual, topical, intrapulmonary and intranasal, and those techniques further discussed herein. The pharmaceutical composition optionally contains one or more members of the group consisting of erythropoietin, testosterone, progenitor cell stimulators, insulin-like growth factor, prostaglandins, serotonin, cyclic AMP, prolactin, triiodothyzonine, methenolene, stanozolol, and nandrolone, iron preparations, vitamin B1 , folic acid and/or adrenocortical steroids.
[0259] In an additional embodiment, the antibody and antibody compositions of the invention are administered in combination with hematopoietic growth factors. Hematopoietic growth factors that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, LEUKINE™ (SARGRAMOSTIM™) and NEUPOGEN™ (FILGRASTIM™).
[0260] In an additional embodiment, the antibody and antibody compositions of the invention are administered alone or in combination with an anti-angiogenic agent(s). Anti-angiogenic agents that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, Angiostatin (Entremed, Rockville, MD), Troponin-1 (Boston Life Sciences, Boston, MA), anti-Invasive Factor, retinoic acid and derivatives thereof, paclitaxel (Taxol), Suramin, Tissue Inhibitor of Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2, VEGI, Plasminogen Activator Inhibitor- 1, Plasminogen Activator Inhibitor-2, and various forms of the lighter "d group" transition metals.
[0261] Lighter "d group" transition metals include, for example, vanadium, molybdenum, tungsten, titanium, niobium, and tantalum species. Such transition metal species may form transition metal complexes. Suitable complexes of the above- mentioned transition metal species include oxo transition metal complexes. [0262] Representative examples of vanadium complexes include oxo vanadium complexes such as vanadate and vanadyl complexes. Suitable vanadate complexes include metavanadate and orthovanadate complexes such as, for example, ammonium metavanadate, sodium metavanadate, and sodium orthovanadate. Suitable vanadyl complexes include, for example, vanadyl acetylacetonate and vanadyl sulfate including vanadyl sulfate hydrates such as vanadyl sulfate mono- and trihydrates. [0263] Representative examples of tungsten and molybdenum complexes also include oxo complexes. Suitable oxo tungsten complexes include tungstate and tungsten oxide complexes. Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate, and tungstic acid. Suitable tungsten oxides include tungsten (IV) oxide and tungsten (VI) oxide. Suitable oxo molybdenum complexes include molybdate, molybdenum oxide, and molybdenyl complexes. Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates. Suitable molybdenum oxides include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic acid. Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate. Other suitable tungsten and molybdenum complexes include hydroxo derivatives derived from, for example, glycerol, tartaric acid, and sugars.
[0264] A wide variety of other anti-angiogenic factors may also be utilized within the context of the present invention. Representative examples include, but are not limited to, platelet factor 4; protamine sulphate; sulphated chitin derivatives (prepared from queen crab shells), (Murata et al., Cancer Res. 51:22-26, 1991); Sulphated Polysaccharide Peptidoglycan Complex (SP- PG) (the function of this compound may be enhanced by the presence of steroids such as estrogen, and tamoxifen citrate); Staurosporine; modulators of matrix metabolism, including for example, proline analogs, cishydroxyproline, d,L-3,4- dehydroproline, Thiaproline, alpha,alpha-dipyridyl, aminopropionitrile fumarate; 4- propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serurn; ChIMP-3 (Pavloff et al, J. Bio. Chem. 267:17321- 17326, 1992); Chymostatin (Tomkinson et al., Biochem J. 286:475-480, 1992); Cyclodextrin Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber et al., Nature 348:555-557, 1990); Gold Sodium Thiomalate ("GST"; Matsubara and Ziff, J. Clin. Invest. 79:1440-1446, 1987); anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol. Chem. 262(4): 1659-1664, 1987); Bisantrene (National Cancer Institute); Lobenzarit disodium (N-(2)-carboxyphenyl-4- chloroanthronilic acid disodium or "CCA"; (Takeuchi et al, Agents Actions 36:312-316, 1992); and metalloproteinase inhibitors such as BB94. [0265] Additional anti-angiogenic factors that may also be utilized within the context of the present invention include Thalidomide, (Celgene, Warren, NJ); Angiostatic steroid; AGM-1470 (H. Brem and J. Folkman J Pediatr. Surg. 28:445-51 (1993)); an integrin alpha v beta 3 antagonist (C. Storgard et al., J Clin. Invest. 103:47-54 (1999)); carboxynaminolmidazole; Carboxyamidotriazole (CAI) (National Cancer Institute, Bethesda, MD); Conbretastatin A-4 (CA4P) (OXiGENE, Boston, MA); Squalamine (Magainin Pharmaceuticals, Plymouth Meeting, PA); TNP-470, (Tap Pharmaceuticals, Deerfield, IL); ZD-0101 AstraZeneca (London, UK); APRA (CT2584); Benefin, Byrostatin-1 (SC359555); CGP-41251 (PKC 412); CM101; Dexrazoxane (ICRF187); DMXAA; Endostatin; Flavopridiol; Genestein; GTE; ImmTher; Iressa (ZD1839); Octreotide (Somatostatin); Panretin; Penacillamine; Photopoint; PI-88; Prinomastat (AG- 3540) Purlytin; Suradista (FCE26644); Tamoxifen (Nolvadex); Tazarotene; Tetrathiomolybdate; Xeloda (Capecitabine); and 5-Fluorouracil
[0266] Anti-angiogenic agents that may be administered in combination with the compounds of the invention may work through a variety of mechanisms including, but not limited to, inhibiting proteolysis of the extracellular matrix, blocking the function of endothelial cell-extracellular matrix adhesion molecules, by antagonizing the function of angiogenesis inducers such as growth factors, and inhibiting integrin receptors expressed on proliferating endothelial cells. Examples of anti-angiogenic inhibitors that interfere with extracellular matrix proteolysis and which may be administered in combination with the antibody and antibody compositions of the invention include, but are not limited to, AG-3540 (Agouron, La Jolla, CA), BAY-12-9566 (Bayer, West Haven , CT), BMS- 275291 (Bristol Myers Squibb, Princeton, NJ), CGS-27032A (Novartis, East Hanover, NJ), Marimastat (British Biotech, Oxford, UK), and Metastat (Aeterna, St-Foy, Quebec). Examples of anti-angiogenic inhibitors that act by blocking the function of endothelial cell-extracellular matrix adhesion molecules and which may be administered in combination with the antibody and antibody compositions of the invention include, but are not limited to, EMD-121974 (Merck KcgaA Darmstadt, Germany) and Vitaxin (Ixsys, La Jolla, CA/Medimmune, Gaithersburg, MD). Examples of anti-angiogenic agents that act by directly antagonizing or inhibiting angiogenesis inducers and which may be administered in combination with the antibody and antibody compositions of the invention include, but are not limited to, Angiozyme (Ribozyme, Boulder, CO), Anti- VEGF antibody (Genentech, S. San Francisco, CA), PTK-787/ZK-225846 (Novartis, Basel, Switzerland), SU-101 (Sugen, S. San Francisco, CA), SU-5416 (Sugen/ Pharmacia Upjohn, Bridgewater, NJ), and SU-6668 (Sugen). Other anti-angiogenic agents act to indirectly inhibit angiogenesis. Examples of indirect inhibitors of angiogenesis which may be administered in combination with the antibody and antibody compositions of the invention include, but are not limited to, IM-862 (Cytran, Kirkland, WA), Interferon- alpha, IL-12 (Roche, Nutley, NJ), and Pentosan polysulfate (Georgetown University, Washington, DC).
[0267] In particular embodiments, the use of antibody and antibody compositions of the invention in combination with anti-angiogenic agents is contemplated for the treatment, prevention, and/or amelioration of cancers and other hypeφroliferative disorders.
[0268] In certain embodiments, antibody and antibody compositions of the invention are administered in combination with antiretroviral agents, nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs), and/or protease inhibitors (Pis). NRTIs that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, RETRO VIR™ (zidovudine/AZT), VIDEX™ (didanosine/ddl), HIVID™ (zalcitabine/ddC), ZERIT™ (stavudine/d4T), EPTVTR™ (lamivudine/3TC), and COMBIVIR™ (zidovudine/lamivudine). NNRTIs that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, VIRAMUNE™ (nevirapine), RESCRIPTOR™ (delavirdine), and SUSTTVA™ (efavirenz). Protease inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, CRLXIVAN™ (indinavir), NORVIR™ (ritonavir), INVIRASE™ (saquinavir), and VIRACEPT™ (nelfinavir). In a specific embodiment, antiretroviral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse franscriptase inhibitors, and/or protease inhibitors may be used in any combination with Therapeutics of the invention to treat AIDS and/or to prevent or treat HIV infection. [0269] In a further embodiment, the antibody and antibody compositions of the invention are administered in combination with an antibiotic agent. Antibiotic agents that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, amoxicillin, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones, macrolides, metronidazole, penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprim-sulfamthoxazole, and vancomycin.
[0270] In other embodiments, antibody and antibody compositions of the invention may be administered in combination with anti-opportunistic infection agents. In a specific embodiment, antibody and antibody compositions of the invention are used in any combination with TRΓMETHOPRIM-SULFAMETHOXAZOLE™, DAPSONE™, PENTAMIDTNE™, and/or ATOVAQUONE™ to prophylactically treat, prevent, and/or diagnose an opportunistic Pneumocystis carinii pneumonia infection. In another specific embodiment, antibody and antibody compositions of the invention are used in any combination with ISONIAZID™, RiFAMPIN™, PYRAZINAMIDE™, and/or ETHAMBUTOL™ to prophylactically treat, prevent, and/or diagnose an opportunistic Mycobacterium avium complex infection. In another specific embodiment, antibody and antibody compositions of the invention are used in any combination with RIFABUTIN™, CLARITHROMYCTN™, and/or AZITHROMYCIN™ to prophylactically freat, prevent, and/or diagnose an opportunistic Mycobacterium tuberculosis infection. In another specific embodiment, antibody and antibody compositions of the invention are used in any combination with GANCICLOVIR™, FOSCARNET™, and/or CIDOFOVIR™ to prophylactically treat, prevent, and/or diagnose an opportunistic cytomegalovirus infection. In another specific embodiment, antibody and antibody compositions of the invention are used in any combination with FLUCONAZOLE™, ITRACONAZOLE™, and/or KETOCONAZOLE™ to prophylactically treat, prevent, and/or diagnose an opportunistic fungal infection. In another specific embodiment, antibody and antibody compositions of the invention are used in any combination with ACYCLOVIR™ and/or FAMCICOLVIR™ to prophylactically treat, prevent, and/or diagnose an opportunistic heφes simplex virus type I and/or type II infection. In another specific embodiment, antibody and antibody compositions of the invention are used in any combination with PYRIMETHAMΓNE™ and/or LEUCOVORIN™ to prophylactically treat, prevent, and/or diagnose an opportunistic Toxoplasma gondii infection. In another specific embodiment, antibody and antibody compositions of the invention are used in any combination with LEUCOVORIN™ and/or NEUPOGEN™ to prophylactically treat, prevent, and/or diagnose an opportunistic bacterial infection. [0271] In a preferred embodiment, the antibody and antibody compositions of the invention are administered in combination with steroid therapy. Steroids that may be administered in combination with the antibody and antibody compositions of the invention, include, but are not limited to, oral corticosteroids, prednisone, and methylprednisolone (e.g., TV methy lprednisolone). In a specific embodiment, antibody and antibody compositions of the invention are administered in combination with prednisone.
[0272] In an additional embodiment, the antibody and antibody compositions of the invention are administered alone or in combination with an anti-inflammatory agent. Anti-inflammatory agents that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, glucocorticoids and the nonsteroidal anti-inflammatories, aminoarylcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic acid derivatives, pyrazoles, pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e- acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, arnixetrine, bendazac, benzydamine, bucolome, difenpiramide, ditazol, emorfazone, guaiazulene, nabumetone, nimesulide, orgotein, oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole, and tenidap.
[0273] The antibodies and antibody compositions of the invention may be administered alone or in combination with other adjuvants. Adjuvants that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Coφ.), QS21 (Genentech, Inc.), BCG, and MPL. In a specific embodiment, antibody and antibody compositions of the invention are administered in combination with alum. In another specific embodiment, antibody and antibody compositions of the invention are administered in combination with QS-21. Further adjuvants that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology. Vaccines that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, vaccines directed toward protection against MMR (measles, mumps, rubella), polio, varicella, tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae B, whooping cough, pneumonia, influenza, Lyme's Disease, rotavirus, cholera, yellow fever, Japanese encephalitis, poliomyelitis, rabies, typhoid fever, and pertussis, and/or PNEUMOVAX- 23™. Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are admimstered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously, e.g., as through separate intravenous lines into the same individual. Administration "in combination" further includes the separate administration of one of the compounds or agents given first, followed by the second.
[0274] In another specific embodiment, antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23™ to freat, prevent, and/or diagnose infection and/or any disease, disorder, and/or condition associated therewith. In one embodiment, antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23™ to treat, prevent, and/or diagnose any Gram positive bacterial infection and/or any disease, disorder, and/or condition associated therewith. In another embodiment, antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23™ to treat, prevent, and/or diagnose infection and/or any disease, disorder, and/or condition associated with one or more members of the genus Enterococcus and/or the genus Streptococcus. In another embodiment, antibody and antibody compositions of the invention are used in any combination with PNEUMOVAX-23™ to treat, prevent, and/or diagnose infection and/or any disease, disorder, and/or condition associated with one or more members of the Group B streptococci. In another embodiment, antibody and antibody compositions of the invention are used in combination with PNEUMOVAX-23™ to treat, prevent, and/or diagnose infection and/or any disease, disorder, and/or condition associated with Streptococcus pneumoniae.
[0275] In a preferred embodiment, the antibody and antibody compositions of the invention are administered in combination with CD40 ligand (CD40L), a soluble form of CD40L (e.g., AVREND™), bioloigically active fragments, variants, or derivatives of CD40L, anti-CD40L antibodies (e.g., agonistic or antagonistic antibodies), and/or anti- CD40 antibodies (e.g., agonistic or antagonistic antibodies).
[0276] In a preferred embodiment, the antibody and antibody compositions of the invention are administered in combination with an NSAID. [0277] In a nonexclusive embodiment, the antibody and antibody compositions of the invention are administered in combination with one, two, three, four, five, ten, or more of the following drugs: NRD-101 (Hoechst Marion Roussel), diclofenac (Dimethaid), oxaprozin potassium (Monsanto), mecasermin (Chiron), T-714 (Toyama), pemetrexed disodium (Eli Lilly), atreleuton (Abbott), valdecoxib (Monsanto), eltenac (Byk Gulden), campath, AGM-1470 (Takeda), CDP-571 (Celltech Chiroscience), CM-101 (CarboMed),
ML-3000 (Merckle), CB-2431 (KS Biomedix), CBF-BS2 (KS Biomedix), IL-lRa gene therapy (Valentis), JTE-522 (Japan Tobacco), paclitaxel (Angiotech), DW-166HC (Dong
Wha), darbufelone mesylate (Warner-Lambert), soluble TNF receptor 1 (synergen;
Amgen), IPR-6001 (Institute for Pharmaceutical Research), trocade (Hoffman-La Roche),
EF-5 (Scotia Pharmaceuticals), BIIL-284 (Boehringer Ingelheim), BIIF-1149 (Boehringer
Ingelheim), LeukoVax (Inflammatics), MK-671 (Merck), ST- 1482 (Sigma-Tau), and butixocort propionate (WarnerLambert).
[0278] In a preferred embodiment, the antibody and antibody compositions of the invention are administered in combination with one, two, three, four, five or more of the following drugs: methotrexate, sulfasalazine, sodium aurothiomalate, auranofin, cyclosporine, penicillamine, azathioprine, an antimalarial drug, cyclophosphamide, chlorambucil, gold, ENBREL™ (Etanercept), anti-TNF antibody, LJP 394 (La Jolla
Pharmaceutical Company, San Diego, California) and prednisolone.
[0279] In an additional embodiment, antibody and antibody compositions of the invention are administered alone or in combination with one or more intravenous immune globulin preparations. Intravenous immune globulin preparations that may be administered with the antibody and antibody compositions of the invention include, but not limited to, GAMMAR™, IVEEGAM™, SANDOGLOBULIN™, GAMMAGARD
S/D™, and GAMIMUNE™. In a specific embodiment, antibody and antibody compositions of the invention are administered in combination with intravenous immune globulin preparations in transplantation therapy (e.g., bone marrow transplant).
[0280] CD40 ligand (CD40L), a soluble form of CD40L (e.g., AVREND™), biologically active fragments, variants, or derivatives of CD40L, anti-CD40L antibodies
(e.g., agonistic or antagonistic antibodies), and/or anti-CD40 antibodies (e.g., agonistic or antagonistic antibodies).
[0281] In an additional embodiment, the antibody and antibody compositions of the invention are administered in combination with cytokines. Cytokines that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, GM-CSF, G-CSF, IL2, IL3, IL4, IL5, IL6, IL7, IL10, IL12, IL13, IL15, anti-CD40, CD40L, IFN-alpha, IFN-beta, IFN-gamma, TNF-alpha, and TNF-beta. In preferred embodiments, antibody and antibody compositions of the invention are administered with GLP-1 receptor. In another embodiment, antibody and antibody compositions of the invention may be administered with any interleukin, including, but not limited to, IL-lalpha, IL-lbeta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, and IL-22. In preferred embodiments, the antibody and antibody compositions of the invention are administered in combination with IL4 and IL10.
[0282] In one embodiment, the antibody and antibody compositions of the invention are admimstered in combination with one or more chemokines. In specific embodiments, the antibody and antibody compositions of the invention are administered in combination with an α(CxC) chemokine selected from the group consisting of gamma-interferon inducible protein- 10 (γIP-10), interleukin-8 (IL-8), platelet factor-4 (PF4), neutrophil activating protein (NAP-2), GRO-α, GRO-β, GRO-γ, neutrophil-activating peptide (ENA- 78), granulocyte chemoattractant protein-2 (GCP-2), and stromal cell-derived factor- 1 (SDF-1, or pre-B cell stimulatory factor (PBSF)); and/or a β(CC) chemokine selected from the group consisting of: RANTES (regulated on activation, normal T expressed and secreted), macrophage inflammatory protein- 1 alpha (MlP-lα), macrophage inflammatory protein- 1 beta (MlP-lβ), monocyte chemotactic protein- 1 (MCP-1), monocyte chemotactic protein-2 (MCP-2), monocyte chemotactic protein-3 (MCP-3), monocyte chemotactic protein-4 (MCP-4) macrophage inflammatory protein-1 gamma (MlP-lγ), macrophage inflammatory protein-3 alpha (MIP-3α), macrophage inflammatory protein-3 beta (MIP-3β), macrophage inflammatory protein-4 (MIP-4/DC-CK-l/PARC), eotaxin, Exodus, and 1-309; and/or the γ(C) chemokine, lymphotactin.
[0283] In another embodiment, the antibody and antibody compositions of the invention are administered with chemokine beta- 8, chemokine beta-1, and/or macrophage inflammatory protein-4. In a preferred embodiment, the antibody and antibody compositions of the invention are administered with chemokine beta-8. [0284] In an additional embodiment, the antibody and antibody compositions of the invention are administered in combination with an IL-4 antagonist. IL-4 antagonists that may be administered with the antibody and antibody compositions of the invention include, but are not limited to: soluble IL-4 receptor polypeptides, multimeric forms of soluble IL-4 receptor polypeptides; anti-IL-4 receptor antibodies that bind the IL-4 receptor without transducing the biological signal elicited by IL-4, anti-IL4 antibodies that block binding of IL-4 to one or more IL-4 receptors, and muteins of IL-4 that bind IL-4 receptors but do not transduce the biological signal elicited by IL-4. Preferably, the antibodies employed according to this method are monoclonal antibodies (including antibody fragments, such as, for example, those described herein).
[0285] In an additional embodiment, the antibody and antibody compositions of the invention are administered in combination with fibroblast growth factors. Fibroblast growth factors that may be administered with the antibody and antibody compositions of the invention include, but are not limited to, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF- 6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.
Demonstration of Therapeutic or Prophylactic Utility of a Composition
[0286] The compounds of the invention are preferably tested in vitro, and then in vivo for the desired therapeutic or prophylactic activity, prior to use in humans. For example, in vitro assays which can be used to determine whether administration of a specific antibody or composition of the present invention is indicated, include in vitro cell culture assays in which a patient tissue sample is grown in culture, and exposed to or otherwise administered an antibody or composition of the present invention, and the effect of such an antibody or composition of the present invention upon the tissue sample is observed. In various specific embodiments, in vitro assays can be carried out with representative cells of cell types involved in a patient's disorder, to determine if an antibody or composition of the present invention has a desired effect upon such cell types. Preferably, the antibodies or compositions of the invention are also tested in in vitro assays and animal model systems prior to administration to humans.
[0287] Antibodies or compositions of the present invention for use in therapy can be tested for their toxicity in suitable animal model systems, including but not limited to rats, mice, chicken, cows, monkeys, and rabbits. For in vivo testing of an antibody or composition's toxicity any animal model system known in the art may be used. Antibodies or compositions of the invention can be tested for their ability to stimulate glucose-dependent insulin secretion in in vitro, ex vivo and in vivo assays. Antibodies or compositions of the invention can also be tested for their ability to stimulate cAMP production in cells expressing the GLP-1 receptor in in vitro and in vivo assays. Antibodies or compositions of the invention can also be tested for their ability to stimulate transcription of insulin in pancreatic beta cells in in vitro and in vivo assays known to those of skill in the art. Antibodies or compositions of the invention can also be tested for their ability to alleviate of one or more symptoms associated with diabetes, obesity, hyperglycemia, a neurological disorder or a cardiovascular disorder. Antibodies or compositions of the invention can also be tested for their ability to promote satiety in vivo. Further, antibodies or compositions of the invention can be tested for their ability to reduce fasting glucose and improve glucose tolerance in diabetic rat and mouse models. Antibodies or compositions of the invention can also be tested for their ability to promote neurite outgrowth, inhibit neuronal apoptosis, and reduce amyloid beta-peptide levels in the brain; and to stimulate proliferation of cells expressing a GLP-1 receptor (e.g., cells of the pancreas, nervous system, heart, kidney, and GI tract). Techniques known to those of skill in the art can be used to analyze the function of the antibodies or compositions of the invention in vivo.
[0288] Antibodies or compositions of the invention can be tested for their ability to reduce tumor formation in in vitro, ex vivo and in vivo assays. Antibodies or compositions of the invention can also be tested for their ability to inhibit viral replication or reduce viral load in in vitro and in vivo assays. Antibodies or compositions of the invention can also be tested for their ability to reduce bacterial numbers in in vitj-o and in vivo assays known to those of skill in the art. Antibodies or compositions of the invention can also be tested for their ability to alleviate of one or more symptoms associated with cancer, an immune disorder (e.g., an inflammatory disease), a neurological disorder or an infectious disease. Antibodies or compositions of the invention can also be tested for their ability to decrease the time course of the infectious disease. Further, antibodies or compositions of the invention can be tested for their ability to increase the survival period of animals suffering from disease or disorder, including cancer, an immune disorder or an infectious disease. Techniques known to those of skill in the art can be used to analyze the function of the antibodies or compositions of the invention in vivo.
[0289] Efficacy in treating or preventing viral infection may be demonstrated by detecting the ability of an antibody or composition of the invention to inhibit the replication of the virus, to inhibit transmission or prevent the virus from establishing itself in its host, or to prevent, ameliorate or alleviate the symptoms of disease a progression. The treatment is considered therapeutic if there is, for example, a reduction in viral load, amelioration of one or more symptoms, or a decrease in mortality and/or morbidity following administration of an antibody or composition of the invention. [0290] Antibodies or compositions of the invention can be tested for their ability to modulate the biological activity of immune cells by contacting immune cells, preferably human immune cells (e.g., T cells, B-cells, and Natural Killer cells), with an antibody or composition of the invention or a control compound and determining the ability of the antibody or compostion of the invention to modulate (i.e, increase or decrease) the biological activity of immune cells. The ability of an antibody or composition of the invention to modulate the biological activity of immune cells can be assessed by detecting the expression of antigens, detecting the proliferation of immune cells (i.e., T-cell proliferation), detecting the activation of signaling molecules, detecting the effector function of immune cells, or detecting the differentiation of immune cells. Techniques known to those of skill in the art can be used for measuring these activities. For example, cellular proliferation can be assayed by ^H-thymidine incoφoration assays and trypan blue cell counts. Antigen expression can be assayed, for example, by immunoassays including, but not limited to, competitive and non-competitive assay systems using techniques such as western blots, immunohistochemistry radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays and FACS analysis. The activation of signaling molecules can be assayed, for example, by kinase assays and electrophoretic shift assays (EMSAs). In a preferred embodiment, the ability of an antibody or composition of the invention to induce cell proliferation is measured. In another preferred embodiment, the ability of an antibody or composition of the invention to modulate chemotaxis is measured.
Panels/Mixtures
[0291] The present invention also provides for mixtures of antibodies (including scFvs and other molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to GLP-1 receptor or a fragment or variant thereof, wherein the mixture has at least one, two, three, four, five or more different antibodies of the invention. In specific embodiments, the invention provides mixtures of at least 2, preferably at least 4, at least 6, at least 8, at least 10, at least 12, at least 15, at least 20, or at least 25 different antibodies that specifically bind to GLP-1 receptor or fragments or variants thereof, wherein at least 1, at least 2, at least 4, at least 6, or at least 10, antibodies of the mixture is an antibody of the invention. In a specific embodiment, each antibody of the mixture is an antibody of the invention.
[0292] The present invention also provides for panels of antibodies (including scFvs and other molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that specifically bind to GLP-1 receptor or a fragment or variant thereof, wherein the panel has at least one, two, three, four, five or more different antibodies of the invention. In specific embodiments, the invention provides for panels of antibodies that have different affinities for GLP-1 receptor, different specificities for GLP-1 receptor, or different dissociation rates. The invention provides panels of at least 10, preferably at least 25, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000, antibodies. Panels of antibodies can be used, for example, in 96 well plates for assays such as ELISAs.
Kits
[0293] The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
[0294] The present invention provides kits that can be used in the above methods. In one embodiment, a kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers. In an alterative embodiment, a kit comprises an antibody fragment that specifically binds to GLP-1 receptor polypeptides or fragments or variants thereof. In a specific embodiment, the kits of the present invention contain a substantially isolated GLP-1 receptor polypeptide or fragment or variant thereof as a control Preferably, the kits of the present invention further comprise a control antibody which does not react with any, some or all GLP-1 receptor. In another specific embodiment, the kits of the present invention contain a means for detecting the binding of an antibody to GLP-1 receptor polypeptides (e.g., the antibody may be conjugated to a detectable substrate such as a fluorescent compound, an enzymatic substrate, a radioactive compound or a luminescent compound, or a second antibody which recognizes the first antibody may be conjugated to a detectable substrate). In specific embodiments, the kit may include a recombinantly produced or chemically synthesized GLP-1 receptor. The GLP-1 receptor provided in the kit may also be attached to a solid support. In a more specific embodiment the detecting means of the above-described kit includes a solid support to which GLP-1 receptor is attached. Such a kit may also include a non-attached reporter-labeled anti- human antibody. In this embodiment, binding of the antibody to GLP-1 receptor can be detected by binding of the said reporter-labeled antibody. [0295] In an additional embodiment, the invention includes a diagnostic kit for use in screening serum containing antigens of the polypeptide of the invention. The diagnostic kit includes a substantially isolated antibody specifically immunoreactive with GLP-1 receptor, and means for detecting the binding of GLP-1 receptor polypeptides to the antibody. In one embodiment, the antibody is attached to a solid support. In a specific embodiment, the antibody may be a monoclonal antibody. The detecting means of the kit may include a second, labeled monoclonal antibody. Alternatively, or in addition, the detecting means may include a labeled, competing antigen.
[0296] In one diagnostic configuration, test serum is reacted with a solid phase reagent having surface-bound GLP-1 receptor obtained by the methods of the present invention. After GLP-1 receptor polypeptides bind to a specific antibody, the unbound serum components are removed by washing, reporter-labeled anti-human antibody is added, unbound anti-human antibody is removed by washing, and a reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-GLP-1 receptor antibody on the solid support. Typically, the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate.
[0297] The solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96-well plate or filter material. These attachment methods generally include non- specific adsoφtion of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, sfreptavidin coated plates can be used in conjunction with biotinylated antigen(s). [0298] Thus, the invention provides an assay system or kit for carrying out this diagnostic method. The kit generally includes a support with surface-bound recombinant GLP-1 receptor, and a reporter-labeled anti-human antibody for detecting surface-bound anti-GLP-1 receptor antibody.
Gene Therapy
[0299] In a specific embodiment, nucleic acids comprising sequences encoding antibodies or functional derivatives thereof, are administered to diagnose, treat, inhibit or prevent a disease or disorder associated with aberrant expression and/or activity of GLP-1 and/or its receptors (e.g., GLP-1 receptor), by way of gene therapy. Gene therapy refers to therapy performed by the adminisfration to a subject of an expressed or expressible nucleic acid. In this embodiment of the invention, the nucleic acids produce their encoded protein that mediates a therapeutic effect.
[0300] Any of the methods for gene therapy available in the art can be used according to the present invention. Exemplary methods are described below.
[0301] For general reviews of the methods of gene therapy, see Goldspiel et al, Clinical Pharmacy 12:488-505 (1993); Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol 32:573-596 (1993); Mulligan, Science 260:926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May, TIBTECH 1 l(5):155-215 (1993). Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990). [0302] In a preferred aspect, a composition of the invention comprises, or alternatively consists of, nucleic acids encoding an antibody, said nucleic acids being part of an expression vector that expresses the antibody or fragments or chimeric proteins or heavy or light chains thereof in a suitable host. In particular, such nucleic acids have promoters, preferably heterologous promoters, operably linked to the antibody coding region, said promoter being inducible or constitutive, and, optionally, tissue-specific. In another particular embodiment, nucleic acid molecules are used in which the antibody coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the antibody encoding nucleic acids (Roller and Smithies, Proc. Natl Acad. Sci. USA 86:8932-8935 (1989); Zijlstra et al, Nature 342:435-438 (1989). In specific embodiments, the expressed antibody molecule is an scFv; alternatively, the nucleic acid sequences include sequences encoding both the heavy and light chains, or fragments or variants thereof, of an antibody.
[0303] Delivery of the nucleic acids into a patient may be either direct, in which case the patient is directly exposed to the nucleic acid or nucleic acid- carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the patient. These two approaches are known, respectively, as in vivo or ex vivo gene therapy.
[0304] In a specific embodiment, the nucleic acid sequences are directly administered in vivo, where it is expressed to produce the encoded product. This can be accomplished by any of numerous methods known in the art, e.g., by constructing them as part of an appropriate nucleic acid expression vector and administering it so that they become intracellular, e.g., by infection using defective or attenuated retro virals or other viral vectors (see U.S. Patent No. 4,980,286), or by direct injection of naked DNA, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to target cell types specifically expressing the receptors), etc. In another embodiment, nucleic acid-ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet another embodiment, the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publications WO 92/06 180; WO 92/22715; W092/203 16; W093/14188, WO 93/20221). Alternatively, the nucleic acid can be introduced intracellularly and incoφorated within host cell DNA for expression, by homologous recombination (Roller and Smithies, Proc. Natl Acad. Sci. USA 86:8932-8935 (1989); Zijlstra et al, Nature 342:435-438 (1989)). [0305] In a specific embodiment, viral vectors that contains nucleic acid sequences encoding an antibody of the invention or fragments or variants thereof are used. For example, a refroviral vector can be used (see Miller et al, Meth. Enzymol. 217:581-599 (1993)). These refroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA. The nucleic acid sequences encoding the antibody to be used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene into a patient. More detail about refroviral vectors can be found in Boesen et al, Biotherapy 6:29 1-302 (1994), which describes the use of a refroviral vector to deliver the mdr 1 gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of refroviral vectors in gene therapy are: Clowes et al, J. Clin. Invest. 93:644-651(1994); Klein et al, Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel 3:110- 114 (1993).
[0306] Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy. Bout et al, Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al, Science 252:431-434 (1991); Rosenfeld et al, Cell 68:143- 755 (1992); Masfrangeli et al, J. Clin. Invest. 91:225-234 (1993); PCT Publication W094/12649; and Wang, etal, Gene Therapy 2:775- 783 (1995). In a preferred embodiment, adenovirus vectors are used. [0307] Adeno-associated virus (AAV) has also been proposed for use in gene therapy (Walsh et al, Proc. Soc. Exp. Biol Med. 204:289-300 (1993); U.S. Patent No. 5,436,146). [0308] Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer includes the fransfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a patient.
[0309] In this embodiment, the nucleic acid is introduced into a cell prior to administration in vivo of the resulting recombinant cell. Such introduction can be carried out by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell- mediated gene transfer, spheroplast fusion, etc. Numerous techniques are known in the art for the introduction of foreign genes into cells (see, e.g., Loeffler and Behr, Meth. Enzymol. 217:599-718 (1993); Cohen et al, Meth. Enzymol 217:718-644 (1993); Clin. Pharma. Ther. 29:69-92m (1985)) and may be used in accordance with the present invention, provided that the necessary developmental and physiological functions of the recipient cells are not disrupted. The technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its cell progeny.
[0310] The resulting recombinant cells can be delivered to a patient by various methods known in the art. Recombinant blood cells (e.g., hematopoietic stem or progenitor cells) are preferably administered intravenously. The amount of cells envisioned for use depends on the desired effect, patient state, etc., and can be determined by one skilled in the art.
[0311] Cells into which a nucleic acid can be introduced for puφoses of gene therapy encompass any desired, available cell type, and include but are not limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc.
[0312] In a preferred embodiment, the cell used for gene therapy is autologous to the patient.
[0313] In an embodiment in which recombinant cells are used in gene therapy, nucleic acid sequences encoding an antibody or fragment thereof are introduced into the cells such that they are expressible by the cells or their progeny, and the recombinant cells are then administered in vivo for therapeutic effect. In a specific embodiment, stem or progenitor cells are used. Any stem and/or progenitor cells which can be isolated and maintained in vitro can potentially be used in accordance with this embodiment of the present invention (see e.g., PCT Publication WO 94/08598; Stemple and Anderson, Cell 7 1:973-985 (1992); Rheinwald, Meth. Cell Bio. 21A:229 (1980); and Pittelkow and Scott, Mayo Clinic Proc. 71:771 (1986)).
[0314] In a specific embodiment, the nucleic acid to be introduced for puφoses of gene therapy comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by controlling the presence or absence of the appropriate inducer of transcription.
[0315] Having generally described the invention, the same will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended as limiting.
Examples
Example 1: Generation of anti-GLP-1 receptor Antibodies
Rescue of the library.
[0316] A library of scFvs is constructed from the RNA of human PBLs as described in WO92/01047 (which is hereby incoφorated by reference in its entirety). To rescue phage displaying antibody fragments, approximately 109 E. coli harboring the phagemid are used to inoculate 50 ml of 2x TY containing 1% glucose and 100 micrograms/ml of ampicillin (2xTY-AMP-GLU) and grown to an O.D. of 0.8 with shaking. Five ml of this culture is used to inoculate 50 ml of 2xTY-AMP-GLU, 2 x 108 TU of delta gene 3 helper (M13 delta gene III, see WO92/01047) are added and the culture incubated at 37°C for 45 minutes without shaking and then at 37°C for 45 minutes with shaking. The culture is centrifuged at 4000 r.p.m. for 10 min. and the pellet resuspended in 2 liters of 2x TY containing 100 micrograms/ml ampicillin and 50 micrograms/ml kanamycin and grown overnight. Phage are prepared as described in WO92/01047.
[0317] Ml 3 delta gene III is prepared as follows: Ml 3 delta gene III helper phage does not encode gene III protein, hence the phage(mid) displaying antibody fragments have a greater avidity of binding to antigen. Infectious Ml 3 delta gene III particles are made by growing the helper phage in cells harboring a pUC19 derivative supplying the wild type gene III protein during phage moφhogenesis. The culture is incubated for 1 hour at 37°C without shaking and then for a further hour at 37°C with shaking. Cells were spun down (IEC-Centra 8, 4000 revs/min for 10 min), resuspended in 300 ml 2x TY broth containing 100 micrograms ampicillin/ml and 25 micrograms kanamycin/ml (2x TY- AMP-KAN) and grown overnight, shaking at 37°C. Phage particles are purified and concentrated from the culture medium by two PEG-precipitations (Sambrook et al, 1990), resuspended in 2 ml PBS and passed through a 0.45 micrometer filter (Minisart NML; Sartorius) to give a final concentration of approximately 10 transducing units/ml (ampicillin-resistant clones).
Panning the Library.
[0318] Immunotubes (Nunc) are coated overnight in bicarbonate buffer, pH 9.0 or PBS with 1-4 ml of either 10-100 micrograms/ml of a GLP-1 receptor polypeptide. When bicarbonate buffer, pH 9.0 is used as the coating buffer, allowing the GLP-1 receptor to dry onto the immunotube is preferable. Alternatively, the immunotube can be coated with a polyclonal anti-GLP-1 reeceptor antibody. Then, GLP-1 receptor protein (0.5-10 micrograms/ml) is loaded onto the anti-GLP-1 receptor coated immuntobe. After a washing step to remove unbound GLP-1 receptor polypetides, such immunotubes may be used to pan the scFv library.
[0319] Tubes are blocked with 2% Marvel-PBS for 2 hours at 37°C and then washed 3 times in PBS. Approximately 1013 TU of phage is applied to the tube and incubated for 30 minutes at room temperature tumbling on an over and under turntable and then left to stand for another 1.5 hours. Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with PBS. Phage are eluted by adding 1 ml of 100 mM triethylamine and rotating 15 minutes on an under and over turntable after which the solution is immediately neufralized with 0.5 ml of l.OM Tris-HCl, pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TGI by incubating eluted phage with bacteria for 30 minutes at 37°C. The E. coli are then plated on TYE plates containing 1% glucose and 100 micrograms/ml ampicillin. The resulting bacterial library is then rescued with delta gene 3 helper phage as described above to prepare phage for a subsequent round of selection. This process is usually repeated for a total of 2-4 rounds of affinity purification.
Characterization of Binders. [0320] Eluted phage from the final rounds of selection are used to infect E. coli HB 2151 and soluble scFv is produced (Marks, et al., 1991) from single colonies for assay. ELISAs are performed with microtiter plates coated with either 10 picograms/ml of the polypeptide of the present invention in 50 mM bicarbonate pH 9.6. Clones positive in ELISA are further characterized by PCR fingeφrinting (see e.g., WO92/01047) and then by sequencing.
Example 2: Identification and Cloning of VH and VL domains
[0321] One method to identfy and clone VH and VL domains from cell lines expressing a particular antibody is to perform PCR with VH and VL specific primers on cDNA made from the antibody expressing cell lines. Briefly, RNA is isolated from the cell lines and used as a template for RT-PCR designed to amplify the VH and VL domains of the antibodies expressed by the EBV cell lines. Cells may lysed in the TRIzol® reagent
(Life Technologies, Rockville. MD) and extracted with one fifth volume of chloroform.
After addition of chloroform, the solution is allowed to incubate at room temperature for
10 minutes, and the centrifuged at 14,000 rpm for 15 minutes at 4°C in a tabletop centrifuge. The supernatant is collected and RNA is precipitated using an equal volume of isopropanol. Precipitated RNA is pelleted by cenfrifuging at 14,000 rpm for 15 minutes at
4°C in a tabletop centrifuge. Following centrifugation, the supernatant is discarded and washed with 75% ethanol. Follwing washing, the RNA is centrifuged again at 800 rpm for 5 minutes at 4°C. The supernatant is discarded and the pellet allowed to air dry. RNA is the dissolved in DEPC water and heated to 60°C for 10 minutes. Quantities of RNA can determined using optical density measurements.
[0322] cDNA may be synthesized, according to methods well-known in the art, from
1.5-2.5 micrograms of RNA using reverse transciptase and random hexamer primers. cDNA is then used as a template for PCR amplification of VH and VL domains.
Alternatively, DNA encoding an scFv, e.g., a vector containing the scFv expression construct, may be used as template mateial for the following PCR reaction. Primers used to amplify VH and VL genes are shown in Table 4. Typically a PCR reaction makes use of a single 5' primer and a single 3' primer. Sometimes, when the amount of available
RNA template is limiting, or for greater efficiency, groups of 5' and/or 3' primers may be used. For example, sometimes all five VH-5' primers and all JH3' primers are used in a single PCR reaction. The PCR reaction is carried out in a 50 microliter volume containing IX PCR buffer, 2mM of each dNTP, 0.7 units of High Fidelity Taq polymerse, 5' primer mix, 3' primer mix and 7.5 microliters of cDNA. The 5' and 3' primer mix of both VH and VL can be made by pooling together 22 pmole and 28 pmole, respectively, of each of the individual primers. PCR conditions are: 96°C for 5 minutes; followed by 25 cycles of 94°C for 1 minute, 50°C for 1 minute, and 72°C for 1 minute; followed by an extension cycle of 72°C for 10 minutes. After the reaction is completed, sample tubes were stored 4°C.
Table 4: Primer Sequences Used to Amplify VH and VL domains.
Primer name SEQ ID NO Primer Sequence (5'-3') VH Primers
Hu VHl-5' 37 CAGGTGCAGCTGGTGCAGTCTGG
Hu VH2-5' 38 CAGGTCAACTTAAGGGAGTCTGG
Hu VH3-5' 39 GAGGTGCAGCTGGTGGAGTCTGG
Hu VH4-5' 40 CAGGTGCAGCTGCAGGAGTCGGG
Hu VH5-5' 41 GAGGTGCAGCTGTTGCAGTCTGC
Hu VH6-5' 42 CAGGTACAGCTGCAGCAGTCAGG
Hu JHl,2-5' 43 TGAGGAGACGGTGACCAGGGTGCC
Hu JH3-5' 44 TGAAGAGACGGTGACCATTGTCCC
Hu JH4,5-5' 45 TGAGGAGACGGTGACCAGGGTTCC
Hu JH6-5' 46 TGAGGAGACGGTGACCGTGGTCCC
VL Primers
Hu Vkappal-5' 47 GACATCCAGATGACCCAGTCTCC
Hu Vkappa2a-5' 48 GATGTTGTGATGACTCAGTCTCC
Hu Vkappa2b-5' 49 GATATTGTGATGACTCAGTCTCC
Hu Vkappa3-5' 50 GAAATTGTGTTGACGCAGTCTCC
Hu Vkappa4-5' 51 GACATCGTGATGACCCAGTCTCC
Hu Vkappa5-5' 52 GAAACGACACTCACGCAGTCTCC
Hu Vkappa6-5' 53 GAAATTGTGCTGACTCAGTCTCC
Hu Vlambdal-5' 54 CAGTCTGTGTTGACGCAGCCGCC
Hu Vlambda2-5' 55 CAGTCTGCCCTGACTCAGCCTGC
Hu Vlambda3-5' 56 TCCTATGTGCTGACTCAGCCACC
Hu Vlambda3b-5' 57 TCTTCTGAGCTGACTCAGGACCC
Hu Vlambda4-5' 58 CACGTTATACTGACTCAACCGCC
Hu Vlambda5-5' 59 CAGGCTGTGCTCACTCAGCCGTC
Hu Vlambda6-5' 60 AATTTTATGCTGACTCAGCCCCA
Hu Jkappal-3' 61 ACGTTTGATTTCCACCTTGGTCCC
Hu Jkappa2-3' 62 ACGTTTGATCTCCAGCTTGGTCCC
Hu Jkappa3-3' 63 ACGTTTGATATCCACTTTGGTCCC
Hu Jkappa4-3' 64 ACGTTTGATCTCCAGCTTGGTCCC
Hu Jkappa5-3' 65 ACGTTTAATCTCCAGTCGTGTCCC
Hu Jlambdal-3' 66 CAGTCTGTGTTGACGCAGCCGCC
Hu Jlambda2-3' 67 CAGTCTGCCCTGACTCAGCCTGC
Hu Jlambda3-3' 68 TCCTATGTGCTGACTCAGCCACC
Hu Jlambda3b-3' 69 TCTTCTGAGCTGACTCAGGACCC
Hu laιnbda4-3' 70 CACGTTATACTGACTCAACCGCC
Hu Jlambda5-3' 71 CAGGCTGTGCTCACTCAGCCGTC
Hu Jlambda6-3' 72 AATTTTATGCTGACTCAGCCCCA
[0323] PCR samples are then electrophoresed on a 1.3% agarose gel. DNA bands of the expected sizes (-506 base pairs for VH domains, and 344 base pairs for VL domains) can be cut out of the gel and purified using methods well known in the art. Purified PCR products can be ligated into a PCR cloning vector (TA vector from Invitrogen Inc., Carlsbad, CA). Individual cloned PCR products can be isolated after transfection of E. coli and blue/white color selection. Cloned PCR products may then be sequenced using methods commonly known in the art.
Example 3: Detecting Stimulation of Intracellular cAMP using Anti-GLP-1 Receptor Antibodies
[0324] The ability of GLP-1 to mediate its cellular effects, including the induction of insulin secretion, is dependent on its engagement of the GLP-1 receptor and subsequent activation of adenylate cyclase and production of cAMP (Hoosein and Gurd 1984; Widmann et al, 1994; Flamez et al, 1999). To determine if an anti-GLP-1 receptor antibody can activate cAMP production via the GLP-1 receptor, HEK293 cells can be engineered to stably express human GLP-1 receptor as previously described (Burcelin et al, 1999; Xiao et al, 2001). This assay can be used to compare the potencies of anti-GLP- 1 receptor antibodies with that of the free GLP-1 peptide or other GLP-1 receptor agonists. [0325] HEK293/GLP1R cells are treated with increasing doses of anti-GLP-1 receptor anitbodies and GLP-1 peptide. After a 2-hour incubation, cells are harvested and the intracellular level of cAMP determined using a commercially available chemiluminescent bioassay (Applied Biosystems) and quantified using a luminometer (Dyax).
Example 4: Insulinotropic Activity
[0327] The insulinotropic action of GLP-1 is directly relevant to its anti-diabetogenic effect. Insulinoma cell lines have been widely used to study insulin secretion in vitro. In particular, the rat insulinoma cell line INS-1 has been useful because it retains the glucose- dependent insulin secreting capacity of isolated islets (Hohmeier et al, 2000). A clonal variant of this cell line (INS-1 832/13) was genetically engineered to reliably maintain these features when passaged in culture (Hohmeier et al, 2000). This cell line can be used to evaluate the insulinotropic activity of anti-GLP-1 receptor antibodies compared to other GLP-1 receptor agonists, including GLP-1 peptides.
Stimulation of Beta Cell Transcription
[0328] INS-1 832/13 cells are seeded in 48-well dish at the density of -0.2 X 106 per well in standard growth medium. After 2-3 days in culture, cells are 80-90% confluent and the medium is changed to regular growth medium containing 5 mM of glucose. After 18 hours in this normoglycemic medium, the cells are starved in Hank's buffered saline in the presence of 3 mM of glucose for 2 hours. Treatments are performed in this same buffer at the indicated protein concentrations. Following 3 hours of treatment, RNA is extracted using Trizol (Invitrogen). Insulin transcript and 18S RNA are quantified by real-time PCR. Insulin mRNA levels are expressed as the ratio to 18S RNA.
Insulin Secretion
[0329] Secretion assays are performed according to published methods (Hohmeier et al, 2000). Briefly, INS-1 832/13 cells are seeded in 48-well dish at the density of -0.2 X 106 per well in standard growth medium. After 2-3 days in culture (at 80-90% confluence), the medium is changed to regular growth medium containing 5 mM of glucose. After 18 hours in this normoglycemic medium, the cells are starved in Hank's buffered saline in the presence of 3 mM of glucose for 2 hours. Treatments (e.g., anti- GLP-1 receptor antibodies vs. GLP-1 vs. GLP-1 receptor agonists) are performed in this same buffer at varying drug and glucose concentrations. After a 3 hour treatment, supernatants are harvested by centrifugation and total insulin is measured by ELISA.
Example 5: Diabetic Rodent Models
Zucker Fatty Diabetic Rats
[0330] Zucker fatty diabetic rats are insulin resistant and glucose intolerant (Clark et al, 1983; Peterson 1990). However, in this species fasting glucose levels are normal. To evaluate the effects of anti-GLP-1 receptor antibodies in this model, animals are fasted for 12 hours to achieve a normoglycemic baseline. The animals are then allowed access to food for 1 hour to achieve diabetic glucose levels. Three hours following IV drug administration, rats are administered 1 g/kg glucose IP and blood glucose concentrations are measured by glucometer just prior to the glucose administration and at 2, 7, 15, 30, 60 and 120 minutes following glucose adminisfration. In these experiments, Exendin-4, a potent DPPIV-resistant analog of GLP-1, is used as a positive confrol based on its published efficacious dose (Young et al, 1999). Agonistic GLP-1 receptor antibodies are expected to reduce the hypoglycemic levels achieved by controlled feeding and increase glucose clearance after IP glucose tolerance test. db/db Mice
[0331] The db/db mouse model can be used to measure the ability of anti-GLP-1 receptor antibodies to improve glucose tolerance in mice defective in the leptin receptor function (db/db mice). On study Day 0 mice are randomized into groups of 5. After a 9 hour fast, mice are injected with an anti-GLP-1 receptor antibody, or another GLP-1 receptor agonists, such as GLP-1 or Exendin-4 for 6 days. Fasting glucose and oral glucose tolerance are measured on Days 1, 2 and 7. GLP-1 receptor agonists are expected to increase glucose clearance compared to negative controls.
High Fat Diet-induced Diabetic Mice
[0332] In humans, a high-fat diet is the major cause of obesity and insulin resistance (Saltiel and Kahn, 2001; Marx 2002). Similarly, normal lean mice fed a high-fat diet develop defective glycemic control, hyperglycemia, and obesity (Ahren et al, 1997; Tsunoda et al, 1998). The acute effects of agonistic anti-GLP-1 antibody administration on oral glucose tolerance in high fat-fed diabetic mice can be examined. Fasted high fat-fed obese mice are administered an agonistic anti-GLP-1 antibody, GLP-1 agonist, or negative control injection. Mice are administered an oral glucose tolerance test 2 and 24 hour post drug administration. Mice are allowed access to food after the first OGTT, then fasted again prior to the second OGTT. Blood glucose is monitored by tail bleed using a glucometer. GLP-1 receptor agonists are expected to improved glucose tolerance in high fat-fed diabetic mice.
[0333] It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples.
[0334] Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.
[0335] The entire disclosure of all publications (including patents, patent applications, journal articles, laboratory manuals, books, or other documents) cited herein are hereby incoφorated by reference.
[0336] Further, the Sequence Listing submitted herewith, in both computer and paper forms, is hereby incoφorated by reference in its entirety. [0337] The entire disclosure (including the specification and sequence listing) of U.S. Provisional Application Serial Number 60/472,740, filed May 23, 2003; is herein incoφorated by reference in its entirety.

Claims

We claim:
1. An antibody that specifically binds to a GLP-1 receptor polypeptide and mimics the activity of a GLP-1 peptide.
2. The antibody of claim 1 that stimulates cAMP production in cells expressing the GLP-1 receptor.
3. The antibody of claim 1 that stimulates insulin mRNA transcription in cells expressing the GLP-1 receptor.
4. The antibody of claim 1 that stimulates insulin secretion from cells expressing the GLP-1 receptor.
5. The antibody of claim 1 wherein said antibody specifically binds to the human GLP-1 receptor.
6. The antibody of claim 1, wherein the GLP-1 receptor polypeptide is expressed by a cell comprising a polynucleotide encoding amino acids 1 to 463 of SEQ ID NO:2 operably associated with a regulatory sequence that controls expression of said polynucleotide.
7. The antibody of claim 1, wherein the antibody is selected from the group consisting of: (a) a whole immunoglobulin molecule; (b) an scFv; (c) a monoclonal antibody; (d) a human antibody; (e) a chimeric antibody; (f) a humanized antibody; (g) a Fab fragment; (h) an Fab' fragment; (i) an F(ab')2; (j) an Fv; and (k) a disulfide linked Fv.
8. The antibody of claim 1, wherein the antibody has a dissociation constant (KD) less than or equal to 10"7 M.
9. The antibody of claim 8, wherein the antibody has a dissociation constant (KD) less than or equal to 10"9 M.
10. The antibody of claim 9, wherein the antibody has a dissociation constant (KD) less than or equal to 10"10 M.
11. The antibody of claim 10, wherein the antibody has a dissociation constant (KD) less than or equal to 10"11 M.
12. The antibody of claim 11 , wherein the antibody has a dissociation constant (KD) less than or equal to 10"12 M.
13. The antibody of claim 8, wherein the antibody has an off rate less than or equal to 10" /sec.
14. The antibody of claim 13 , wherein the antibody has an off rate less than or equal to lO^/sec.
15. The antibody of claim 14, wherein the antibody has an off rate less than or equal to 10"5/sec.
16. The antibody of claim 15 , wherein the antibody has an off rate less than or equal to 10" /sec.
The antibody of claim 16, wherein the antibody has an off rate less than or equal to 10"7/sec.
17. A method of treating, preventing or ameliorating a metabolic disorder comprising administering to an animal in need thereof, the antibody of claim 1 in an amount effective to freat, prevent or ameliorate the disease or disorder.
18. The method of claim 17, wherein said metabolic disorder is selected from the group consisting of (a) type 1 diabetes; (b) type 2 diabetes; (c) hyperglycemia; and (d) obesity.
19. A method of treating, preventing or ameliorating a cardiovascular disease or disorder comprising administering to an animal in need thereof, the antibody of claim 1 in an amount effective to freat, prevent or ameliorate the disease or disorder.
20. A method of treating, preventing or ameliorating a neurological disease or disorder comprising administering to an animal in need thereof, the antibody of claim 1 in an amount effective to treat, prevent or ameliorate the disease or disorder.
21. The method of claim 20 , wherein said neurological disorder is selected from the group consisting of: (a) Alzheimer's disease; (b) Parkinson's disease; (c) Huntington's disease; and (d) stroke.
PCT/US2004/015866 2003-05-23 2004-05-20 Agonist antibodies that specifically bind the glucagon like peptide-1 receptor Ceased WO2005018536A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US47274003P 2003-05-23 2003-05-23
US60/472,740 2003-05-23

Publications (2)

Publication Number Publication Date
WO2005018536A2 true WO2005018536A2 (en) 2005-03-03
WO2005018536A3 WO2005018536A3 (en) 2005-09-15

Family

ID=34215795

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/015866 Ceased WO2005018536A2 (en) 2003-05-23 2004-05-20 Agonist antibodies that specifically bind the glucagon like peptide-1 receptor

Country Status (1)

Country Link
WO (1) WO2005018536A2 (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9062101B2 (en) 2010-08-14 2015-06-23 AbbVie Deutschland GmbH & Co. KG Amyloid-beta binding proteins
WO2017192820A1 (en) 2016-05-06 2017-11-09 Ionis Pharmaceuticals, Inc. Glp-1 receptor ligand moiety conjugated oligonucleotides and uses thereof
US9822171B2 (en) 2010-04-15 2017-11-21 AbbVie Deutschland GmbH & Co. KG Amyloid-beta binding proteins
US9951125B2 (en) 2006-11-30 2018-04-24 Abbvie Inc. Aβ conformer selective anti-Aβ globulomer monoclonal antibodies
US10208109B2 (en) 2005-11-30 2019-02-19 Abbvie Inc. Monoclonal antibodies against amyloid beta protein and uses thereof
US10464976B2 (en) 2003-01-31 2019-11-05 AbbVie Deutschland GmbH & Co. KG Amyloid β(1-42) oligomers, derivatives thereof and antibodies thereto, methods of preparation thereof and use thereof
US10538581B2 (en) 2005-11-30 2020-01-21 Abbvie Inc. Anti-Aβ globulomer 4D10 antibodies
WO2022046944A3 (en) * 2020-08-26 2022-04-07 Twist Bioscience Corporation Methods and compositions relating to glp1r variants
US12331427B2 (en) 2019-02-26 2025-06-17 Twist Bioscience Corporation Antibodies that bind GLP1R
WO2025257419A1 (en) * 2024-06-13 2025-12-18 4Moving Biotech Glp-1 receptor agonist compounds for treating a proliferative synovial disorder

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2124952A2 (en) 2007-02-27 2009-12-02 Abbott GmbH & Co. KG Method for the treatment of amyloidoses

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK39892D0 (en) * 1992-03-25 1992-03-25 Bernard Thorens PEPTIDE
AU6163196A (en) * 1995-06-07 1996-12-30 Smithkline Beecham Corporation Method for obtaining receptor agonist antibodies

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10464976B2 (en) 2003-01-31 2019-11-05 AbbVie Deutschland GmbH & Co. KG Amyloid β(1-42) oligomers, derivatives thereof and antibodies thereto, methods of preparation thereof and use thereof
US10208109B2 (en) 2005-11-30 2019-02-19 Abbvie Inc. Monoclonal antibodies against amyloid beta protein and uses thereof
US10538581B2 (en) 2005-11-30 2020-01-21 Abbvie Inc. Anti-Aβ globulomer 4D10 antibodies
US10323084B2 (en) 2005-11-30 2019-06-18 Abbvie Inc. Monoclonal antibodies against amyloid beta protein and uses thereof
US9951125B2 (en) 2006-11-30 2018-04-24 Abbvie Inc. Aβ conformer selective anti-Aβ globulomer monoclonal antibodies
US9822171B2 (en) 2010-04-15 2017-11-21 AbbVie Deutschland GmbH & Co. KG Amyloid-beta binding proteins
US10047121B2 (en) 2010-08-14 2018-08-14 AbbVie Deutschland GmbH & Co. KG Amyloid-beta binding proteins
US9062101B2 (en) 2010-08-14 2015-06-23 AbbVie Deutschland GmbH & Co. KG Amyloid-beta binding proteins
WO2017192820A1 (en) 2016-05-06 2017-11-09 Ionis Pharmaceuticals, Inc. Glp-1 receptor ligand moiety conjugated oligonucleotides and uses thereof
US12331427B2 (en) 2019-02-26 2025-06-17 Twist Bioscience Corporation Antibodies that bind GLP1R
WO2022046944A3 (en) * 2020-08-26 2022-04-07 Twist Bioscience Corporation Methods and compositions relating to glp1r variants
US12391762B2 (en) 2020-08-26 2025-08-19 Twist Bioscience Corporation Methods and compositions relating to GLP1R variants
WO2025257419A1 (en) * 2024-06-13 2025-12-18 4Moving Biotech Glp-1 receptor agonist compounds for treating a proliferative synovial disorder

Also Published As

Publication number Publication date
WO2005018536A3 (en) 2005-09-15

Similar Documents

Publication Publication Date Title
US7943741B2 (en) Antibodies that specifically bind to chemokine β-4
US7906119B1 (en) Antibodies against protective antigen
EP1572874B1 (en) Antibodies that immunospecifically bind to trail receptors
US20100292441A1 (en) Antibodies that specifically bind to GMAD
US20030059862A1 (en) Antibodies against tumor necrosis factor delta (APRIL)
US20090035319A1 (en) Antibodies Against C3a Receptor
US20100240875A1 (en) Antibodies That Specifically Bind to Reg IV
JP2005516958A (en) Antibodies that immunospecifically bind to TRAIL receptors
US7541441B2 (en) Antibodies that specifically bind to TL5
US12378312B2 (en) Polynucleotides encoding human beta klotho antibodies or binding fragments thereof and methods of use thereof
US20050065326A1 (en) Antibodies that specifically bind to TR2
US7109302B1 (en) Antibodies that specifically bind to GMAD
HK1075470B (en) Antibodies that immunospecifically bind to trail receptors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase