WO2005016889A1 - Compounds having antiestrogenic and tissue selective estrogenic properties - Google Patents

Compounds having antiestrogenic and tissue selective estrogenic properties Download PDF

Info

Publication number
WO2005016889A1
WO2005016889A1 PCT/US2004/025186 US2004025186W WO2005016889A1 WO 2005016889 A1 WO2005016889 A1 WO 2005016889A1 US 2004025186 W US2004025186 W US 2004025186W WO 2005016889 A1 WO2005016889 A1 WO 2005016889A1
Authority
WO
WIPO (PCT)
Prior art keywords
substituted
unsubstituted
compound
group
rll
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/025186
Other languages
French (fr)
Inventor
Richmond Danso-Danquah
Donald J. Abraham
Hsiang-Ru Lin
Jim Christian Burnett
Gajanan S. Joshi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Virginia Commonwealth University
Original Assignee
Virginia Commonwealth University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Virginia Commonwealth University filed Critical Virginia Commonwealth University
Publication of WO2005016889A1 publication Critical patent/WO2005016889A1/en
Priority to US11/349,339 priority Critical patent/US7601739B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • C07D217/12Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with radicals, substituted by hetero atoms, attached to carbon atoms of the nitrogen-containing ring
    • C07D217/14Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with radicals, substituted by hetero atoms, attached to carbon atoms of the nitrogen-containing ring other than aralkyl radicals
    • C07D217/16Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with radicals, substituted by hetero atoms, attached to carbon atoms of the nitrogen-containing ring other than aralkyl radicals substituted by oxygen atoms

Definitions

  • the invention generally relates to compounds that are useful for the treatment of estrogen-receptor related maladies.
  • the invention provides tetrahydroquinoline phenylamide derivatives that are useful for the treatment of breast and prostate cancer, and osteoporosis.
  • ERs estrogen and the estrogen receptors
  • SERMs Selective Estrogen Receptors Modulators
  • Tamoxifen antagonizes or mimics the effect of estrogen in a variety of tissues.
  • tamoxifen acts as an antiestrogen in breast tissues and CNS system, and exerts estrogenic effects in bone, cardiovascular and endometrium tissues, hi bone system, it initially was suspected that tamoxifen's antiestrogenic effects might accelerate bone resorption and increase the risk of developing osteoporosis.
  • tamoxifen performs as an estrogen in bone, promoting maintenance of bone density, and is thus useful in the treatment of osteoporosis.
  • tamoxifen shows some beneficial estrogenic effects, it also has been proposed to promote uterus and liver carcinogenesis.
  • tamoxifen Some tumors become resistant to treatment with tamoxifen over time. Only a few tamoxifen alternatives have been developed, e.g. Toremifene, GW 5638 and Idoxifene, and second generation SERMs such as Raloxifene, which is currently in clinical trials. Unfortunately, it appears that raloxifene may display cross-resistance to tamoxifen resistant tumors. Estrogen receptors also play a role in prostate cancer, and in the development of osteoporosis. Thus, agents that modulate estrogen-receptors may also be useful for the treatment of those diseases.
  • the invention provides a series of compounds possessing antiestrogenic and tissue- selective estrogenic properties.
  • the compounds may be used in the treatment of estrogen receptor related diseases, including breast and prostrate cancer, and osteoporosis. It is an object of the present invention to provide a compound of generic formula
  • Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are the same or different, and are selected from the group consisting of H, OH, halogens, R and OR, where R is a substituted or unsubstituted alkyl group having 1-4 carbons;
  • Y is selected from the group consisting of -CH 2 -O-R10 and -CH 2 -NH-R10;
  • the substituted and unsubstituted C r C 9 alkyl is -CH 2 CH 2 CH 2 CF 2 CF 3 .
  • Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are F, OCH 3 , OH, CH 3 or CI. It is a further object of the invention to provide compounds with the following formulas:
  • the invention further provides a method of inhibiting binding of estrogen in vivo or in vitro by providing a compound which binds to an estrogen binding site.
  • the compound has the generic formula
  • Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are the same or different, and are selected from the group consisting of H, OH, halogens, R and OR, where R is a substituted or unsubstituted alkyl group having 1-4 carbons;
  • Y is selected from the group consisting of -CH 2 -O-R10 and -CH 2 -NH-R10;
  • the substituted and unsubstituted C r C 9 alkyl is -CH 2 CH 2 CH 2 CF 2 CF 3 .
  • Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are F, OCH 3 , OH, CH 3 or CI.
  • the compound is
  • the invention further provides a method for treating tamoxifen-resistant breast cancer tumors in a patient in need thereof.
  • the method comprises the step of administering to the patient a compound of generic formula
  • the compounds are tetrahydroquinoline phenylamide derivatives and maybe used in the treatment of estrogen receptor related diseases, including breast and prostrate cancer.
  • the compounds will be of use in the treatment of advanced breast cancer, especially when tamoxifen (or other treatments modalities) have ceased to be effective.
  • tamoxifen can be used to treat breast cancer for only about five years due to the development of tamoxifen resistance by the tumor cells.
  • the related compound raloxifene may be cross-resistant to tamoxifen-resistant breast tumors, eliminating it as a potential alternative treatment.
  • the compounds of the present invention which are not cross-resistant to tamoxifen-resistant breast tumors, thus provide another much needed avenue of alternative treatment. Further, apart from their usefulness as a cancer treatment, the compounds of the present invention will be also useful in the treatment of osteoporosis in a manner similar to tamoxifen.
  • the compounds of the present invention offer the advantage that they are easy to prepare compared to commercial products based on naturally occurring molecules (e.g. tamoxifen).
  • the compounds are based on the generic structure depicted in Formula 1 :
  • Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are the same or different, and are selected from H,
  • Y is selected from -CH 2 -O-R10 and -CH 2 -NH-R10;
  • Rl 1 is selected from: substituted and unsubstituted C,-C 9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl;
  • Rl 1 is selected from: substituted and unsubstituted C C 9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl.
  • the substituted C r C 9 alkyl is -
  • Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are selected from
  • the present invention provides methods for the treatment of diseases involving estrogen receptors.
  • the disease is breast cancer.
  • the disease is prostate cancer.
  • breast cancer and prostate cancer we mean both tumors that develop in the breast/prostate, and metastatic tumors that originated in breast/prostate tissue.
  • treating cancer we mean that a compound is administered in order to alleviate symptoms of the disease (e.g. to slow or stop growth of a tumor or to decrease tumor size, halt metastasis, etc.).
  • the compounds of the present invention may completely eradicate symptoms of the disease, or, alternatively, may attenuate or slow the progression of disease, which is also beneficial to the patient.
  • the compounds of the present invention may be useful for the treatment of breast cancer tumors that are resistant to tamoxifen.
  • the disease that is treated is osteoporosis.
  • treating osteoporosis we mean that a compound is administered in order to alleviate symptoms of the disease (e.g. to increase bone density, or at least to prevent, stop or slow the loss of bone density).
  • administering may completely eradicate symptoms of the disease, or, alternatively, may attenuate or slow the progression of disease, which is also beneficial to the patient.
  • Use of the compounds will generally involve identifying patients suffering from estrogen-receptor related tumors (e.g. breast or prostate tumors), or alternatively, from osteoporosis, and administering the compounds in an acceptable form by an appropriate route. Administration may be oral or parenteral, including intravenously, intramuscularly, subcutaneously, etc., or by other routes (e.g. transdermal, sublingual, aerosol, suppository, etc.).
  • the compounds can be administered in the pure form or in a pharmaceutically acceptable formulation including suitable elixirs, binders, and the like or as pharmaceutically acceptable salts or other derivatives.
  • pharmaceutically acceptable formulations and salts include liquid and solid materials conventionally utilized to prepare injectable dosage forms and solid dosage forms such as tablets and capsules. Water may be used for the preparation of injectable compositions which may also include conventional buffers and agents to render the injectable composition isotonic.
  • Other potential additives include: colorants; surfactants (TWEEN, oleic acid, etc.); and binders or encapsulants (lactose, liposomes, etc).
  • Solid diluents and excipients include lactose, starch, conventional disintergrating agents, coatings and the like. Preservatives such as methyl paraben or benzalkium chloride may also be used. Depending on the formulation, it is expected that the active composition will consist of 1-99% of the composition and the vehicular "carrier" will constitute 1-99% of the composition.
  • the pharmaceutical compositions of the present invention may include any suitable pharmaceutically acceptable additives or adjuncts to the extent that they do not hinder or interfere with the therapeutic effect desired of the Pt complex.
  • the administration of pharmaceutical compositions of the present invention can be intermittent, or at a gradual or continuous, constant or controlled rate to a patient. In addition, the time of day and the number of times per day that the pharmaceutical formulation is administered can vary.
  • the preferred dosing schedule can vary depending upon factors such as the mode of delivery, gender, age, and other conditions of the patient, as well as tumor type, stage, grade and location.
  • the dosage to be administered may vary depending on the age, gender, weight and overall health status of the individual patient, as well as the nature of the cancer itself.
  • the level of efficacy and optimal amount of dosage may vary somewhat from compound to compound.
  • the resulted organic phase was dried by MgSO 4 .
  • the crude product was purified by column chromatography. The purified compound was dissolved in DMF, NaH and N-butyl- 11-bromoundecanamide was added into solution. The reaction solution was refluxed under nitrogen gas further. After 16 hrs, EtOAc was added into reaction solution and the solution was washed with H 2 O and brine. The resulted organic phase was dried by MgSO 4 . The crude product was further purified by column chromatograph to generate final pure product.
  • Plasmid preparation The plasmids employed were the mammalian expression plasmid containing full length human ER cDNA, pCMV-hER, ER cDNA, pcDNA3.1-hER, human AIBl cDNA, pcDNA3.1-AIBl and the reporter gene expression plasmid containing three repeated estrogen receptor response elements, pGL-TATA-Luc. These four plasmids were used in the transient transfection reporter assays for estrogen receptor in human breast cancer cells.
  • the yeast expression plasmid pCu424CUPl and reporter gene plasmid pLG 178 for yeast-based human estrogen receptor reporter assays were purchased from ATCC (American Type Culture Collection Manassas, VA).
  • the yeast expression plasmids, pGADT7 and pGBTT7, for yeast two-hybrid assay were purchased from Clontech (Palo Alto, CA).
  • the vector pCu424CUPl is constructed to express human estrogen receptor.
  • pCUP-hER contains full length hER cDNA and can express hER in yeasts BJ3505. The expression of hER is regulated by CUP1 promoter.
  • the hER cDNA was generated by PCR and the primers, 5'-GGATCCATGACCATGACCCTCCACACC-3' (SEQ ID NO. 1) and 5'-GTCGACTCAGACTGTGGCAGGAAACCC-3' (SEQ ID NO. 2) were designed by inserting a BamHI site in front of the hER start codon and a Sail site after the hER stop codon.
  • the pCMV-hER was used as the template of the PCR reaction.
  • the resulting PCR product was further cloned into pCu424CUPl between BamHI site and Sail site to generate pCUP-hER.
  • pCUP-hER contains long form full length hER cDNA and can express hER in yeasts BJ3505. The expression of hER is also regulated by CUPl promoter.
  • the hER cDNA was generated by PCR and the primers, 5'-GGATCCATGGATATAAAAAACTCACCATC-3' (SEQ ID NO. 3) and 5'- GTCGACTCACTGAGACTGTGGGTTCTGG-3' (SEQ TD NO. 4) were designed by inserting a BamHI site in front of the hER start codon and a Sail site after the hER stop codon.
  • the pcDNA3.1-hER was used as the template of the PCR reaction.
  • the PCR product was subsequently cloned into pCu424CUPl between BamHI site and Sail site to generate pCUP-hER .
  • the vectors, pGBKT7 and pGADT7 were used to perform yeast two-hybrid assays for hER.
  • pGBKT7 contains the Gal-4 DNA binding domain which was fused with the bait protein.
  • pGADT7 containing the Gal-4 activation domain which was fused further with the target protein.
  • pGBT-hER contains full length hER cDNA and can express Gal4 DNA binding/hER in yeasts Y190.
  • the hER cDNA was generated by PCR and the primers, 5'-CATATGACCATGACCCTCCACACC-3' (SEQ ID NO. 5) and 5'-GGATCCTCAGACTGTGGCAGGGAAACCC-3' (SEQ ID NO. 6) were designed by inserting an Ndel site in front of the hER start codon and a BamHI site after the hER stop codon.
  • the PCR product was cloned into pGBKT7 between Ndel and BamHI site.
  • pGAD-hER contains full length hER cDNA and can express hER conjugated with Gal4 activation domain in yeasts Y190.
  • the hER was generated by PCR which used the same primers mentioned in the construction of pGBT- hER .
  • the PCR product was cloned into pGADT7 between Ndel and BamHI site.
  • the vector, pLG 178 was used to construct reporter gene in yeast based estrogen receptor reporter transactivation assays.
  • the cDNA of three repeated ERE was generated by PCR in which the plasmid pERE3 -TATA-CAT was used as the template.
  • the primers, 5'-CTCGAGTGGTTTTTGACCCCGAACG-3' SEQ ID NO.
  • the yeast strain Y190 (MATa leu2-3 leu2-l 12 ura3-52 trpl-901 his3- 200 ade2-101 gal4 gal80 ura3 Gal-lacZ lys gal-his3 cyhR) obtained from ATCC was used in the yeast two-hybrid assays. All yeast transformation was carried out following the lithium acetate transformation protocol. Site-directed mutagenesis The tyrosine mutation (pCMV-D351Y) at amino acid 351 was introduced by using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and pCMV-ER was used as the template.
  • the primers constructed were as follows: 5' primer (5'- GGCTTACTGACCAACCTGGCAr CAGGGAGCTGGTTCAC -3') (SEQ ID NO. 9), the underlined nucleotide was changed to make the D351Y mutation) and a 3' primer (5'- GTGAACCAGCTCCCTGTATGCCAGGTTGGTCAGTAAGCC -3') (SEQ TD NO. 10).
  • Reporter gene transactivation and ⁇ -galactosidase assays for human estrogen receptor in yeast The transformed yeasts from early-mid-log phase growth (OD600 nm approximately 1.0) were diluted to an OD600 nm of 0.03 in selective medium plus 50 M CuSO 4 to induce estrogen receptor production.
  • the diluted yeasts were aliquoted into 15-ml cap tubes containing culture medium 5 ml per tube and doses of either estradiol or test molecules, or both in methanol or DMSO were added. A solvent (methanol or DMSO) control was included in each experiment. The cultures were incubated overnight at 30 C with vigorous orbital shaking (300 rpm). After incubation, the yeast samples were diluted in appropriate selective medium to OD600 of 0.3-0.4 and 100 ⁇ l was added to each well of a 96-well microtiter plate. Each sample was assayed in triplicate.
  • assay buffer 60mM Na 2 HPO 4 , 40mM NaH 2 PO 4 , lOmM KCl, lmM MgSO 4 , 2mg/ml 2-nitrophenyl-beta- D-galactosidase (ONPG), 0.1% SDS, 50 mM -mercaptoethanol, and 200U/ 1 oxalyticase (Enzogenetics, Corvallis, OR) was added.
  • the change of ortho nitrophenol, the yellow product that resulted from ⁇ -galactosidase cleavage of ONPG was measured by using a kinetic microtiter plate reader (Molecular Device, Sunnyvale, CA).
  • -galactosidase activity is expressed as Vmax (mOD420/min) divided by cell density (OD590).
  • the relative activity for test samples is the ⁇ -galactosidase activity of test sample over that of estradiol whose activity is 1.
  • Yeast two-hybrid and filter lift assays The transformed yeasts with yeast two-hybrid vectors were cultured in synthetic medium lacking trytophan, and leucine. The estradiol or/and test molecule was added to the cultured medium after the transformed yeast cells were plated on nitrocellulose membrane. After stimulation with estradiol or test molecules for overnight, the nitrocellulose membranes plated with yeast cells were transferred to a new filter and the yeast cells were permeablized by three heat-freeze cycles.
  • the membranes were soaked in 0.4 ml Z-buffer/Xgal (60 mM Na ⁇ O ⁇ 40mM NaH 2 PO 4 , lOmMKCl, ImM MgSO 4 , 0.1% SDS, 50mM -mercaptoethanol, 20 mM Xgal). The pictures of the results were taken within 2 and 3 hours after the -galactosidase assay was processed.
  • Chemiluminescence-based competitive binding assay The HitHunterTM EFC estrogen receptor chemilinescence assay kit (Discoverx, Fremont, CA) was used to determine the ability of test molecules to displace ED-estrogen conjugate from hER ⁇ - ED-estrogen conjugate complex.
  • the recombinant hER or hER (5 nM) was preincubated with ED-estrogen conjugate in screening buffer. After the preincubation, the test molecules and hER-ED-estrogen conjugate complex solution were added into the 96-well microplate to produce a final volume of 50 ⁇ l per well. After the reaction was incubated at room temperature for 1.5 hrs, the EA solution and chemiluminescence substrate buffer were added into each well for 1 hr incubation, and the luminescence values were measured by using luminescence microplate reader, LumiCount (Packard, Boston, MA). The IC 50 value of tested compounds was generated by graphfit software.
  • the IC 50 value was further converted to relative binding affinity (RBA) by using raloxifene's IC 50 as the standard that was set to 1.
  • RBA relative binding affinity
  • the RBA value of each test molecule was calculated by using the equation; RBA equals (IC 50 of raloxifene/lC 50 of test molecule).
  • Fluorescence-based competitive binding assays The estrogen receptor competitor assay kits (Panvera, Madison, WT) were used to determine the ability of test molecules to displace the fluormone, ES2, from hER -ES2 or hER -ES2 complex. Serial dilutions of each test molecule were prepared in methanol or DMSO.
  • the recombinant hER or hER (7 nM) was preincubated with ES2 (1 nM) in screening buffer. After the preincubation, the test molecules and ER-ES2 complex solution were added into the 96-well microplate to produce a final volume of 100 ⁇ l per well. The reaction was incubated at room temperature for 1 hr and the polarization values were measured by using fluorescence microplate reader, Polarion (Tecan, Research Triangle Park, NC) with excitation wavelength 495 nm and emission wavelength 535 nm. The polarization value versus test molecule concentration curves was analyzed by graphfit software to generate IC 50 values.
  • the IC 50 value was further converted to relative binding affinity (RBA) by using tamoxifen's IC 50 as the standard that was set to 1.
  • RBA relative binding affinity
  • the cells were plated in triplicate in 12- well plates at a density of 300000 cells/well in the phenol red-free DMEM (GIBCO/BRL, Grand Island, NY) supplemented with 10% charcoal-stripped fetal bovine serum (Hyclone, Logan, UT), Penicillin (100 unit/ml)/Streptomycin (100 g/ml), 2mML-glutamine and ImM sodium Pyruvate. 24 hrs later, the cells were transfected with three plasmids by using Superfect transfection kit (Qiagen, Valencia, CA).
  • hER activity For the detection of hER activity, cells were transfected with 2 g hER expression plasmid (pCMV-ER ), 6 g luciferase reporter plasmid containing estrogen receptor response element (PGL-TATA-Luc), and 600ng normalization control, ⁇ -galactosidase reporter plasmid (pCMV ).
  • pCMV-ER 2 g hER expression plasmid
  • PGL-TATA-Luc 6 g luciferase reporter plasmid containing estrogen receptor response element
  • 600ng normalization control ⁇ -galactosidase reporter plasmid
  • luciferase activity assay 20 ⁇ l of lysate and 100 ⁇ l luciferase assay buffer (Promega, Madison, WI) were added into a well of 96-well plate. The luminescence was detected by using luminescence microplate reader, LumiCount (Packard, Boston, MA).
  • ⁇ -galactosidase activity assay 20 ml of lysate and 185 ml ⁇ -galactosidase assay buffer (Clontech, Palo Alto, CA) were added into a well of 96-well plate. The ⁇ -galactosidase activity was measured as luminescence strength by using luminescence microplate reader, LumiCount (Packard, Boston, MA).
  • the normalized reporter activity was calculated by the luciferase activity divided by that of ⁇ -galactosidase. For the estrogenic or antiestrogenic effects of test molecules, the normalized reporter activity value was further converted to relative normalized reporter activity by using the value of estradiol or DMSO as a standard that was set to 1.
  • Cell proliferation assay MCF-7 or MDA-MB-231 cells were inoculated into 12-well culture plates at 10000 cells in 2ml maintained medium per well.
  • Fluorescence-based binding affinity testing for compounds of the invention hi this assay, recombinant hER and the commercial synthetic estrogen, ES2 containing fluorescence polarization property, are used.
  • This assay is a homogenous assay. When the assay solution only contains ES2, the solution exerts weak fluorescence polarization property due to the quick rotation of free ES2 molecule. On the contrary, when ES2 is mixed with hER , the rotation of ES2 is largely decreased due to its tight interaction with hER and the solution exerts strong fluorescence polarization property.
  • Table 1 shows the relative binding affinity of certain compounds of the present invention, designated compounds 1 to 12, where generic Tamoxifen was tested as reference and its binding affinity was set at 1. The result showed that among these compounds, compounds 6 and 7 have highest binding affinity and higher than tamoxifen.
  • the preferable physical property of the substituted group on the second aromatic ring is hydrogen bond donor and hydrogen bond acceptor, and the favorable tendency of substituent's physical property for binding affinity is OH> F> OCH 3 > CH 3 , CI.
  • substituents at 3 '-position are slightly better than 4'- position and 2'- position is the least preferred for binding. Essentially, when the binding affinity of compounds 2, 11 and 12 are compared, it reveals that the length of the bridge and side chain seem not to influence the compound's binding affinity.
  • Transient transfection reporter testing The transient transfection reporter assay was used to determine the estrogenic or antiestrogenic activity of tested compounds in employed human breast cancer cells, MCF-7 cells that are cotransfected with hER ⁇ expression and reporter plasmids. For estrogenic activity, 5 ⁇ M tested compound was added to transfected MCF-7 cells. For antiestrogenic activity, 5 ⁇ M tested compound and 1 nM estradiol are added to transfected MCF-7 cells. The estrogenic (antiestrogenic) activity was determined by dividing the luciferase activity by the ⁇ -galactosidase activity.
  • compounds 8, 9 and 12 have similar or higher estrogeic effects than tamoxifen.
  • the other compounds 1, 2, 3, 4, 5, 6, 10 and 11 do not exert any estrogenic effects.
  • those compounds containing substituent on the 3' position of the second aromatic ring don't possess estrogenic effects, except compound 8 containing methyl group on the 3 position and compound 12 with longer bridge length.
  • compound 8 containing methyl group on the 3 position and compound 12 with longer bridge length For compound containing hydroxyl group and compound 9 containing methyl group on the 4' position of the second aromatic ring, both exert significant estrogenic effects.
  • Table 3 shows the antiestrogenic effects of several compounds of the present invention.
  • InM estrogen was used as reference and tamoxifen was tested for comparison.
  • the compounds 2, 4, 6, 7, 8 and 10 showed 25% to 56% inhibition against estrogen, and tamoxifen showed 72% inhibition activity.
  • Compound 6 containing hydroxyl moiety on the 3' position of the second aromatic ring had the strongest inhibition activity among the compounds and the rest of the compounds with the substituent on the 3' position of the second aromatic ring showed moderate inhibition activity, except compound 12.
  • Compound 7 with hydroxyl group on the 4' position also exhibited moderate antiestrogenic activity.
  • Amino acid 351 (D351) of hER ⁇ plays an essential role in regulating estrogenic or antiestrogenic compound's binding to hER ⁇ and the recruitment of corepressors.
  • D351 to tyrosine (Y) was found to occur in tamoxifen treated breast tumors.
  • the mutated D351 Y can largely enhance 4-hydroxytamoxifen's estrogenic activity so the D351Y hER ⁇ mutant is implied to serve a key function for the formation of tamoxifen resistant breast tumors.
  • the hER ⁇ D351Y mutant is generated by PCR-based site directed mutagenesis method for use in the transient transfection reporter assay.
  • Figure 5 shows the estrogenic activity of compounds 4, 6, and 7 against hER ⁇ D351 Y.
  • DMSO was used as reference.
  • Estrogen and tamoxifen were used as the comparison.
  • the results shown in Figure 5 indicate that the estrogenic activity of estrogen does not increase and that of tamoxifen only moderately increases.However, the estrogenic activitys of compounds 4, 6, and 7, do not increase when their estrogenic effects against hER ⁇ D351Y and hER ⁇ wild type are compared.
  • hER negative breast cancer cell proliferation testing for compounds 2, 4 and 6 In this assay, MDA-MB-231 breast cancer cell line, a hER negative cell line, was used. DMSO was used as reference. Estrogen and tamoxifen were also tested for comparison.
  • Figure 6 shows the proliferation activities of compounds 2, 4 and 6.
  • estrogen does not promote the growth of MDA-MB-231 cells.
  • Compounds 2, 4, and 6 also do not inhibit or stimulate the growth of MDA-MB-231 cells.
  • tamoxifen still exerts moderate anti-proliferation effects against MDA-MB-231 cells.
  • Tamoxifen's ER independent anti-proliferation activity has been proposed by several groups. The results shown here further demonstrate that the inhibitory effects of compounds 2, 4, and 6 against hER ⁇ are specific.
  • Yeast two-hybrid/filter lifting testing for compounds 2 and 6 Dimerization of estrogen receptor plays an essential role in regulating estrogen receptor's functions including DNA binding, transactivation, and coactivator recruitment.
  • yeast two hybrid and filter lift assays were used to determine the ability of compounds 2 and 6 to interrupt the dimerization of hER ⁇ .
  • the full length hER ⁇ was inserted into pGAD-GAL4 and pGBD-GAL4 vectors, hi pGBD-GAL4, hER ⁇ was fused to the GAL4 DNA binding domain through its N terminus, hi pGAD-GAL4, hER ⁇ was fused to the GAL4 activation domain through its N terminus.
  • the GAL4 DNA binding domain binds to the repeated GAL4 response element located in front of the ⁇ -gal reporter gene and the whole complex, GAI -BD/hER ⁇ /hER ⁇ /GAL4-AD, turns on the synthesis of the product of ⁇ -gal reporter gene.
  • the compound's inhibitory activity is inversely related to the activity of the reporter gene product, ⁇ -galactosidase. The higher the activity of ⁇ -galactosidase, the lower the compound's inhibitory activity against hER ⁇ dimeriaztion. Filter lift assay in which X-gal was used, was employed to qualitatively determine the activity of ⁇ -galactosidase.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Compounds for the treatment of estrogen-receptor related maladies are provided. In particular, the invention provides compounds that are tetrahydroquinoline phenylamide derivatives and are useful for the treatment of breast and prostate cancer, and osteoporosis.

Description

COMPOUNDS HAVING ANTIESTROGENIC AND TISSUE SELECTIVE ESTROGENIC PROPERTIES
DESCRIPTION
BACKGROUND OF THE INVENTION
Field of the Invention The invention generally relates to compounds that are useful for the treatment of estrogen-receptor related maladies. In particular, the invention provides tetrahydroquinoline phenylamide derivatives that are useful for the treatment of breast and prostate cancer, and osteoporosis. Background of the Invention It is commonly acknowledged that estrogen and the estrogen receptors (ERs) play essential roles in the development of breast tumors, although the precise mechanisms involved have not been determined. Several treatment regimens for breast cancer have been developed that utilize Selective Estrogen Receptors Modulators (SERMs). Tamoxifen, a "first generation" SERM, (Figure 7 A) was developed more than 30 years ago and was . approved by the Food and Drug Administration in 1985 for the treatment of breast cancers. Tamoxifen antagonizes or mimics the effect of estrogen in a variety of tissues. For example, tamoxifen acts as an antiestrogen in breast tissues and CNS system, and exerts estrogenic effects in bone, cardiovascular and endometrium tissues, hi bone system, it initially was suspected that tamoxifen's antiestrogenic effects might accelerate bone resorption and increase the risk of developing osteoporosis. However, in vitro and in vivo studies have demonstrated that tamoxifen performs as an estrogen in bone, promoting maintenance of bone density, and is thus useful in the treatment of osteoporosis. Although tamoxifen shows some beneficial estrogenic effects, it also has been proposed to promote uterus and liver carcinogenesis. Some tumors become resistant to treatment with tamoxifen over time. Only a few tamoxifen alternatives have been developed, e.g. Toremifene, GW 5638 and Idoxifene, and second generation SERMs such as Raloxifene, which is currently in clinical trials. Unfortunately, it appears that raloxifene may display cross-resistance to tamoxifen resistant tumors. Estrogen receptors also play a role in prostate cancer, and in the development of osteoporosis. Thus, agents that modulate estrogen-receptors may also be useful for the treatment of those diseases. There is thus an ongoing need to develop new compounds for the treatment of diseases related to estrogen receptor function, in particular for the treatment of breast and prostate cancer, and osteoporosis. This need is particularly acute in light of the tendency of tumors to become resistant to treatment with therapeutic agents after extended use, and in view of the desirability of discovering compounds with reduced deleterious side effects than those exhibited by currently known compounds.
SUMMARY OF THE INVENTION The invention provides a series of compounds possessing antiestrogenic and tissue- selective estrogenic properties. The compounds may be used in the treatment of estrogen receptor related diseases, including breast and prostrate cancer, and osteoporosis. It is an object of the present invention to provide a compound of generic formula
Figure imgf000003_0001
wherein Z is selected from the group consisting of CO, CH2, and CO(CH2)n, where n = 1 or 2; Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are the same or different, and are selected from the group consisting of H, OH, halogens, R and OR, where R is a substituted or unsubstituted alkyl group having 1-4 carbons; Y is selected from the group consisting of -CH2-O-R10 and -CH2-NH-R10; and RIO is selected from the group consisting of : a) -(CH2)n-C(=O)-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted C,-C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; b) -(CH2)n-S(=O)-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted -Cc, alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; c) -(CH2)n-SO2-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted -Cg alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; d) -(CH2)n-S(=O)-Rl 1, here n = 1-10 and Rl 1 is selected from: substituted and unsubstituted - alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; and e) -(CH2)n-SO2-Rl 1, where n = 1-10 and Rl 1 is selected from the group consisting of substituted and unsubstituted C C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl. a preferred embodiment of the invention, the substituted and unsubstituted CrC9 alkyl is -CH2CH2CH2CF2CF3. In other preferred embodiments, Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are F, OCH3, OH, CH3 or CI. It is a further object of the invention to provide compounds with the following formulas:
Figure imgf000005_0001
Figure imgf000005_0002
Figure imgf000006_0001
Figure imgf000006_0002
Figure imgf000007_0001
Figure imgf000007_0002
Figure imgf000007_0003
Figure imgf000007_0004
Figure imgf000008_0001
Figure imgf000008_0002
Figure imgf000008_0003
Figure imgf000009_0001
Figure imgf000009_0002
Figure imgf000010_0001
Figure imgf000010_0002
Figure imgf000010_0003
The invention further provides a method of inhibiting binding of estrogen in vivo or in vitro by providing a compound which binds to an estrogen binding site. The compound has the generic formula
Figure imgf000011_0001
wherein Z is selected from the group consisting of CO, CH2, and CO(CH2)n, where n = 1 or 2; Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are the same or different, and are selected from the group consisting of H, OH, halogens, R and OR, where R is a substituted or unsubstituted alkyl group having 1-4 carbons; Y is selected from the group consisting of -CH2-O-R10 and -CH2-NH-R10; and RIO is selected from the group consisting of : a) -(CH2)n-C(=0)-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; b) -(CH2)n-S(=O)-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; c) -(CH2)n-SO2-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; d) -(CH2)n-S(=O)-Rll, where n = 1-10 and Rll is selected from: substituted and unsubstituted C,-C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; and e) -(CH2)n-SO2-Rl 1, where n = 1-10 and Rl 1 is selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl.
In a preferred embodiment of the invention, the substituted and unsubstituted CrC9 alkyl is -CH2CH2CH2CF2CF3. hi other preferred embodiments, Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are F, OCH3, OH, CH3 or CI. In preferred embodiments of the method, the compound is
Figure imgf000012_0001
or
Figure imgf000012_0002
The invention further provides a method for treating tamoxifen-resistant breast cancer tumors in a patient in need thereof. The method comprises the step of administering to the patient a compound of generic formula
Figure imgf000013_0001
wherein Z is selected from the group consisting of CO, CH2, and CO(CH2)n, where n = 1 or
2; Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are the same or different, and are selected from the group consisting of H, OH, halogens, R and OR, where R is a substituted or unsubstituted alkyl group having 1-4 carbons; Y is selected from the group consisting of -CH2-O-R10 and -CH2-NH-R10; and RIO is selected from the group consisting of : a) -(CH2)n-C(=O)-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; b) -(CH2)n-S(=O)-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted -Cg alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; c) -(CH2)n-SO2-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; d) -(CH2)n-S(=O)-Rll, where n = 1-10 and Rll is selected from: substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; and e) -(CH2)n-SO2-Rl 1, where n = 1-10 and Rl 1 is selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Schematic synthesis scheme.
Figure 2. Schematic synthesis scheme.
Figure 3. Schematic synthesis scheme.
Figure 4. Antiestrogenic activity of compound 1 against various concentrations of estrogen in transient transfection reporter assay for hERα in MCF-7 cells.
Figure 5. Estrogenic activity comparison of compounds 4, 6 and 7 for wild type hERα and hERα D351Y in transient transfection receptor assay.
Figure 6. Proliferation effects of compounds 2, 4 and 6 against MDA-MB-231 cells.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS OF THE INVENTION A series of compounds possessing antiestrogenic and tissue-selective estrogenic properties have been discovered. The compounds are tetrahydroquinoline phenylamide derivatives and maybe used in the treatment of estrogen receptor related diseases, including breast and prostrate cancer. In particular, the compounds will be of use in the treatment of advanced breast cancer, especially when tamoxifen (or other treatments modalities) have ceased to be effective. Currently, tamoxifen can be used to treat breast cancer for only about five years due to the development of tamoxifen resistance by the tumor cells. Unfortunately, it has been discovered that the related compound raloxifene may be cross-resistant to tamoxifen-resistant breast tumors, eliminating it as a potential alternative treatment. The compounds of the present invention, which are not cross-resistant to tamoxifen-resistant breast tumors, thus provide another much needed avenue of alternative treatment. Further, apart from their usefulness as a cancer treatment, the compounds of the present invention will be also useful in the treatment of osteoporosis in a manner similar to tamoxifen. The compounds of the present invention offer the advantage that they are easy to prepare compared to commercial products based on naturally occurring molecules (e.g. tamoxifen). The compounds are based on the generic structure depicted in Formula 1 :
Figure imgf000015_0001
Formula 1
in which
Z is selected from CO, CH2, and (COCH2)n, where n = 1 or 2;
Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are the same or different, and are selected from H,
OH, halogens, R and OR, where R is a substituted or unsubstituted alkyl group having 1-4 carbons;
Y is selected from -CH2-O-R10 and -CH2-NH-R10;
RIO is selected from: 1) -(CH2)n-C(=O)-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from: substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl;
2) -(CH2)n-S(=O)-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from: substituted and unsubstituted C C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; 3) -(CH2)n-SO2-N-Rl 1, R12, where n = 1-10 and Rl 1 and R12 are the same or different, and are selected from: substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl;
4) -(CH2)n-S(=O)-Rl 1, where n = 1-10 and Rl 1 is selected from: substituted and unsubstituted C,-C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl;
5) -(CH2)n-SO2-Rl l,where n = 1-10 and Rl 1 is selected from: substituted and unsubstituted C C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl.
In a preferred embodiment of the invention, the substituted CrC9 alkyl is -
CH2CH2CH2CF2CF3,
In other preferred embodiments, Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are selected from
F, OCH3, OOH, CH3 and CI. The following compounds illustrate preferred embodiments of the invention:
Figure imgf000016_0001
Formula 2. 1 l-[2-(3-Fluoro-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxyl- undecanoic acid butylamide.
Figure imgf000016_0002
Formula 3. 1 l-[2-(3-Fluoro-benzoyl)-6-hydroxy-l,2,3,4-tetrahydro-isoquinolin-3- ylrnethoxyl-undecanoic acid butylamide.
Figure imgf000017_0001
Formula 4. 1 l-[2-(3-Fluoro-benzoyl)-7-hydroxy-l,2,3,4-tetrahydro-isoquinolin-3- ylmethoxyl-undecanoic acid butylamide.
Figure imgf000017_0002
Formula 5. 1 l-[2-(2-Fluoro-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxyl- undecanoic acid butylamide.
Figure imgf000017_0003
Formula 6.11 -[2-(4-Fluoro-benzoyl)- 1 ,2,3,4-tetrahydro-isoquinolin-3-ylmethoxyl- undecanoic acid butylamide.
Figure imgf000018_0001
Formula 7. 1 l-[2-(3-Methoxy-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxyl- undecanoic acid butylamide.
Figure imgf000018_0002
Formula 8. 1 l-[2-(4-Methoxy-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxyl- undecanoic acid butylamide.
Figure imgf000018_0003
Formula 9. 1 l-[2-(3-Hydroxy-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxyl- undecanoic acid butylamide.
Figure imgf000019_0001
Formula 10. 1 l-[2-(4-Hydroxy-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxyl- undecanoic acid butylamide.
Figure imgf000019_0002
Formula 11. ll-[6-Hydroxy-2-(4-hydroxy-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3- ylmethoxyl-undecanoic acid butylamide.
Figure imgf000019_0003
Formula 12. 1 l-[7-Hydroxy-2-(4-hydroxy-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3- ylmethoxyl-undecanoic acid butylamide.
Figure imgf000020_0001
Formula 13. 9-[6-Hydroxy-2-(4-hydroxy-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3- ylmethoxyl-nonanoic acid butylamide.
Figure imgf000020_0002
Formula 14. 9-[7-Hydroxy-2-(4-hydroxy-benzoyl)-l ,2,3,4-tetrahydro-isoquinolin-3- ylmethoxyl-nonanoic acid butylamide.
Figure imgf000020_0003
Formula 15. {6-Hydroxy-3-[8-(4, 4, 5, 5, 5-pentafluoro-pentane-l-sulfinyl)-octyloxymethyl]- 3 ,4-dihydro- lH-isoquinolin-2-yl} -(4-hydroxy-phenyl)-methanone.
Figure imgf000021_0001
Formula 16.{7-Hydroxy-3-[8-(4, 4, 5, 5, 5-pentafluoro-pentane-l-sulfmyl)-octyloxymethyl]- 3 ,4-dihydro- lH-isoquinolin-2-yl} -(4-hydroxy-phenyl)-methanone.
Figure imgf000021_0002
Formula 17. {6-Hydroxy-3-[7-(4, 4, 5, 5, 5-pentafluoro-pentane-l-sulfinyl)- heptyloxymethyl]-3,4-dihydro-lH-isoquinolin-2-yl}-(4-hydroxy-phenyl)-methanone.
Figure imgf000022_0001
Formula 18. {-Hydroxy-3-[7-(4, 4, 5, 5, 5-pentafluoro-pentane-l-sulfinyl)-heptyloxymethyl]- 3 ,4-dihydro- lH-isoquinolin-2-yl} -(4-hydroxy-phenyl)-methanone.
Figure imgf000022_0002
Formula 19. 1 l-[2-(3-Methyl-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]- undecanoic acid butylamide
Figure imgf000022_0003
Formula 20.1 l-[2-(4-Methyl-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]- undecanoic acid butylamide
Figure imgf000023_0001
Formula 21. 1 l-[2-(3-Chloro-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]- undecanoic acid butylamide
Figure imgf000023_0002
Formula 22. 1 l-[2-(3-Fluoro-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]- undecanoic acid butylamide
Figure imgf000023_0003
Formula 23. 1 l-{2-[2-(3-Fluoro-phenyl)-acetyl]-l,2,3,4-tetrahydro-isoquinolin-3- ylmethoxyj-undecanoic acid butylamide
The present invention provides methods for the treatment of diseases involving estrogen receptors. In a preferred embodiment of the invention, the disease is breast cancer. In another embodiment of the invention, the disease is prostate cancer. By "breast cancer" and "prostate cancer" we mean both tumors that develop in the breast/prostate, and metastatic tumors that originated in breast/prostate tissue. By "treating" cancer we mean that a compound is administered in order to alleviate symptoms of the disease (e.g. to slow or stop growth of a tumor or to decrease tumor size, halt metastasis, etc.). Those of skill in the art will recognize that, in the treatment of cancer, administration of the compounds of the present invention may completely eradicate symptoms of the disease, or, alternatively, may attenuate or slow the progression of disease, which is also beneficial to the patient. In particular, the compounds of the present invention may be useful for the treatment of breast cancer tumors that are resistant to tamoxifen. In yet another embodiment of the invention, the disease that is treated is osteoporosis. By "treating" osteoporosis we mean that a compound is administered in order to alleviate symptoms of the disease (e.g. to increase bone density, or at least to prevent, stop or slow the loss of bone density). Those of skill in the art will recognize that, in the treatment of osteoporosis, administration of the compounds of the present invention may completely eradicate symptoms of the disease, or, alternatively, may attenuate or slow the progression of disease, which is also beneficial to the patient. Use of the compounds will generally involve identifying patients suffering from estrogen-receptor related tumors (e.g. breast or prostate tumors), or alternatively, from osteoporosis, and administering the compounds in an acceptable form by an appropriate route. Administration may be oral or parenteral, including intravenously, intramuscularly, subcutaneously, etc., or by other routes (e.g. transdermal, sublingual, aerosol, suppository, etc.). The compounds can be administered in the pure form or in a pharmaceutically acceptable formulation including suitable elixirs, binders, and the like or as pharmaceutically acceptable salts or other derivatives. It should be understood that the pharmaceutically acceptable formulations and salts include liquid and solid materials conventionally utilized to prepare injectable dosage forms and solid dosage forms such as tablets and capsules. Water may be used for the preparation of injectable compositions which may also include conventional buffers and agents to render the injectable composition isotonic. Other potential additives include: colorants; surfactants (TWEEN, oleic acid, etc.); and binders or encapsulants (lactose, liposomes, etc). Solid diluents and excipients include lactose, starch, conventional disintergrating agents, coatings and the like. Preservatives such as methyl paraben or benzalkium chloride may also be used. Depending on the formulation, it is expected that the active composition will consist of 1-99% of the composition and the vehicular "carrier" will constitute 1-99% of the composition. The pharmaceutical compositions of the present invention may include any suitable pharmaceutically acceptable additives or adjuncts to the extent that they do not hinder or interfere with the therapeutic effect desired of the Pt complex. The administration of pharmaceutical compositions of the present invention can be intermittent, or at a gradual or continuous, constant or controlled rate to a patient. In addition, the time of day and the number of times per day that the pharmaceutical formulation is administered can vary. Further, the preferred dosing schedule can vary depending upon factors such as the mode of delivery, gender, age, and other conditions of the patient, as well as tumor type, stage, grade and location. The dosage to be administered may vary depending on the age, gender, weight and overall health status of the individual patient, as well as the nature of the cancer itself. The level of efficacy and optimal amount of dosage may vary somewhat from compound to compound.
EXAMPLES
Experimental Methods and Materials
A. Synthesis of N-ButyHl-bromoundecanamide 11-Bromoundecanoic acid (45 mmol) was dissolved in dry CH2C12 (200 ml) and tributylamine (54 mmol). After the mixture had cooled at -10°C, isobutylchlorofomate (60 mmol) was added and allowed to react for 2hrs. At this moment, excess N-butylamine (225 mmol) was added and later the cooling bath was removed. After 3hrs, CH2C12 was added and the organic phase was washed with 1 N HCI, saturated NaHCO3, and water. After drying by MgSO4, the solvent was removed and the crude product was purified by column chromatography. The pure amide product was eluted with solvent, hexane (80)-EtOAc (20). The purified amide was further crystallized with hexane.
General procedures for the synthesis of compounds of the invention, designated compounds 1-13 Relative benzoic acid (phenyl acetic acid) and (s)-(-)-l, 2, 3, 4-tetrahydro-3- isoquinoline methanol were dissolved in DMF under nitrogen gas. The 1- hydroxybenzotriazole hydrate (HOBT) and 1 -(3 -(Dimethylamino) propyl)-3-ethyl- carbodiimide) hydrochloride (DEC) were added into the solution and the reaction were stirred further. After 16 hrs, EtOAc was added into reaction solution and the solution was washed with 10% KHSO4, saturated NaHCO3, and brine. The resulted organic phase was dried by MgSO4. The crude product was purified by column chromatography. The purified compound was dissolved in DMF, NaH and N-butyl- 11-bromoundecanamide was added into solution. The reaction solution was refluxed under nitrogen gas further. After 16 hrs, EtOAc was added into reaction solution and the solution was washed with H2O and brine. The resulted organic phase was dried by MgSO4. The crude product was further purified by column chromatograph to generate final pure product. ll-[2-(2-Fluoro-benzoyl)-l,2,3,4-tefrahydro-isoquinolin-3-ylmethoxy]-undecanoic acid butylamide (compound 11): Yield: 71 %; Η NMR(CDC13, 300 MHz): δθ.95 (t, 3H, CH3), 1.1-1.3 (m, 14Η, CH2), 1.35-1.48 (m, 2Η, CH2), 1.35-1.48 (m, 4Η, CH2), 2.16-2.18(m, 2Η, C(O)CH2), 2.75 (m, 2Η, CH2), 3.1-3.26 (m, 4Η, OCH2 and NCH2), 3.41-3.52 (m, 2Η, OCH2), 4.19 (s, broad, 1Η, CH), 4.42 (s, 2Η, NCH2), 6.92 (dd, 1Η, ArH), 7.05-7.15 (m, 3Η, ArH), 7.28-7.31 (m, 2Η, ArH), 7.32-7.43 (m, 2Η, ArH); Anal. Calcd. for C32Η45FN2O3: C, 73.25 ; H, 8.64; N, 5.34. Found: C, 73.05; H, 8.41; N, 5.14. ll-[2-(3-Fluoro-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]-undecanoic acid butylamide (compound 12): Yield: 68 %; Η NMR(CDC13, 300 MHz): δθ.93 (t, 3H, CH3), 1.2-1.3 (m, 14Η, CH2), 1.36-1.51 (m, 2Η, CH2), 1.58-1.61 (m, 4Η, CH2), 2.14 (t, 2Η, C(O)CH2), 2.6 (m, 2Η, CH2,), 3.13-3.20 (m, 2Η, NCH2), 3.24 (t, 2Η, OCH2), 3.70-3.75 (m, 2Η, OCH2), 3.95-4.1 (m, 3Η, CHand NCH2), 6.78 (m, 1Η, ArH), 7.15 (m, 3Η, ArH), 7.28 (m, 3H, ArH), 7.47 (s, 1Η, ArH); Anal. Calcd. for C32Η45FN2O3: C, 73.25 ; H, 8.64; N.5.34. Found: C, 73.13; H, 8.38; N, 5.21. ll-[2-(4-Fluoro-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]-undecanoic acid butylamide (compound 13): Yield: 70 %; Η NMR(CDCI3, 300 MHz): δθ.88 (t, 3H, CH3), 1.2-1.28 (m, 14Η, CH2), 1.43-1.49 (m, 2Η, CH2), 1.59-1.62 (m, 4Η, CH2), 2.14 (m, 2Η, C(O)CH2), 2.69 (m, 2Η, CH2), 3.11-3.16 (m, 2Η, NCH2), 3.23 (t, 2Η, OCH2), 3.42 (m, 2Η, OCH2), 4.36 (m, 3Η, CHand NCH2 ), 7.06 (m, 1Η, ArH), 7.10-7.14 (m, 3Η, ArH), 7.19 (m, 2Η, ArH), 7.45-7.49 (m, 2Η, ArH); Anal. Calcd. for C32Η45FN2O3: C/73.25; H, 8.64; N, 5.34. Found: C, 73.08; H, 8.33; N, 5.18. l l-[2-(3-Methoxy-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]-undecanoic acid butylamide (compound 14): Yield: 71 %; 'H NMR(CDC13, 300 MHz): δθ.91 (t, 3H, CH3), 1.27-1.47 (m, 16Η, CH2), 1.53-1.58 (m, 4Η, CH2), 2.12 (t, 2Η, C(O)CH2), 2.65 (m, 2Η, CH2), 3.2-3.3 (m, 4Η, OCH2 and NCH2), 3.61 (d, 2Η, OCH2>J=6Hz), 3.82, (s, 3H, OCH3), 4.27-4.37 (m, 2H, CHand NCH2), 6.95-7.01 (m, 4Η, ArH), 7.12-7.19 (m, 2Η, ArH), 7.28-7.32 (m, 2Η, ArH); Anal. Calcd. for C33Η48N2O4: C, 73.84; H, 9.01; N, 5.22. Found: C, 73.58; H, 8.77; N, 5.03. ll-[2-(4-Methoxy-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3~ylmethoxy]-undecanoic acid butylamide (compound 15): Yield: 73 %; Η NMR(CDC13, 300 MHz): δ0.95 (t, 3H, CH3), 1.30 (m, 14Η, CH2), 1.51 (m, 2Η, CH2), 1.65 (m, 4Η, CH2), 2.17 (t, 2Η, C(O)CH2), 2.74 (m, 2Η, CH2), 3.26 (m, 4Η, OCH2 and NCH2), 3.45-3.47 ( , 2Η, OCH2), 3.89, (s, 3Η, OCH3), 4.35-4.50 (m, 2H, CHand NCH2), 6.95-6.98 (m, 4Η, ArH), 7.26-7.30 (m, 2Η, ArH), 7.46 (m, 2Η, ArH); Anal. Calcd. for C33Η48N2O4: C, 73.84; H, 9.01; N, 5.22. Found: C, 73.64; H, 8.89; N, 5.08. 11 - [2-(3 -Hydroxy-benzoyl)- 1 ,2,3 ,4-tetrahydro-isoquinolin-3 -ylmethoxy] -undecanoic acid butylamide (compound 16): Yield: 58 %; Η NMR(CDC13, 300 MHz): δθ.91 (t, 3H, CH3), 1.33-1.66 (m, 20Η, CH2), 2.18(t, 2Η, C(O)CH2), 2.74 (m, 2Η, CH2), 3.11 (m, 2Η, NCH2), 3.4 (m, 2Η, OCH2), 3.75 (m, 2Η, OCH2), 4.36 (m, 3Η, CHand NCH2), 6.85 (m, 1Η, ArH), 6.88 (m, 1Η, ArH), 7.08-7.19 (m, 5Η, ArH), 7.4 (s, 1Η, ArH); Anal. Calcd. for C32Η46N2O4: C, 73.53; H, 8.87; N, 5.36. Found: C, 73.21; H, 8.72; N, 5.51. ll-[2-(4-Hydroxy-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]-undecanoic acid butylamide (compound 17): Yield: 55 %; Η NMR(CDC13, 300 MHz): δθ.92 (t, 3H, CH3), 1.27 (m, 14Η, CH2), 1.29-1.59 (m, 6Η, CH2), 2.19 (t, 2Η, C(O)CH2), 2.74 (m, 2Η, CH2), 3.34-3.41 (m, 4Η, OCH2 and NCH2), 3.65 (m, 2Η, OCH2), 4.4 (m, 3Η, CHand NCH2), 6.84 (m, 2Η, ArH), 7.18 (m, 3Η, ArH), 7.32 (m, 3Η, ArH); Anal. Calcd. for C32Η46N2O4: C, 73.53; H, 8.87; N, 5.36. Found: C, 73.58; H, 8.63; N, 5.41. ll-[2-(3-Methyl-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]-undecanoic acid butylamide (compound 18): Yield: 75 %; 'H NMR(CDC13, 300 MHz): δθ.91 (t, 3H, CH3), 1.26 (m, 14Η, CH2), 1.43-1.45 (m, 2Η, CH2), 1.58 (m, 4Η, CH2), 2.12 (t, 2Η, C(O)CH2), 2.38 (s, 2Η, CH3), 2.68 ( , 2Η, CH2), 3.18-3.29 (m, 4Η, OCH2 andNCH2), 3.41- 3.44 (m, 2Η, OCH2), 4.2 (m, 3Η, CHandNCH2), 6.88 (s, broad, 1Η, ArH), 7.05-7.27 (m, 7Η, ArH); Anal. Calcd. for C33Η48N2O3: C, 76.11; H, 9.29; N, 5.38. Found: C, 75.98; H, 9.37; N, 5.57. 11 - [2-(4-Methyl-benzoyl)- 1,2,3 ,4-tetrahydro-isoquinolin-3-ylmethoxy] -undecanoic acid butylamide (compound 19): Yield: 71 %; Η NMR(CDC13, 300 MHz): δθ.91 (t, 3H, CH3), 1.26 (m, 14Η, CH2), 1.40-1.45 (m, 2Η, CH2), 1.59 (m, 4Η, CH2), 2.11 (t, 2Η, (O)CH2), 2.67 (m, 2Η, CH2), 3.10-3.23 (m, 4Η, OCH2 andNCH2), 3.40-3.44 (m, 2Η, OCH2), 4.28- 4.48 (m, 3Η, CHand NCH2), 6.89 (s, broad, 1Η, ArH), 7.10-7.21 (m, 5Η, ArH), 7.34 (m, 2Η, ArH); Anal. Calcd. for C33Η48N2O3: C, 76.11; H, 9.29; N, 5.38. Found: C, 75.87; H, 9.58; N, 5.43. ll-[2-(3-Chloro-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]-undecanoic acid butylamide (compound 20): Yield: 77 %; Η NMR(CDC13, 300 MHz): δ0.92 (t, 3H, CH3), 1.27-1.35 (m, 14Η, CH2), 1.43-1.49 (m, 2Η, CH2), 1.62 ( , 4Η, CH2), 2.15 (t, 2Η, C(O)CH2), 2.65 (m, 2Η, CH2), 3.13-3.16 (m, 2Η, NCH2), 3.25 (t, 2Η, OCH2), 3.40 (d, 2Η, OCH2) J=8.4Ηz), 4.28-4.34 (m, IH, CH), 4.45 (s, 2Η, NCH2), 6.92 (m, 1Η, ArH), 7.12-7.20 (m, 3Η, ArH), 7.35-7.41 (m, 3Η, ArH), 7.49 (s, 1Η, ArH); Anal. Calcd. for C32Η45ClN2O3: C, 71.02; H, 8.38; N, 5.18. Found: C, 71.28; H, 8.53; N, 5.01. ll-[2-(3-Fluoro-benzoyl)-l,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy]-undecanoic acid octylamide (compound 21): Yield: 69 %; Η NMR(CDC13, 300 MHz): δ0.88 (t, 3H, CH3), 1.26 (m, 22Η, CH2), 1.48 (m, 2Η, CH2), 1.61 (m, 4Η, CH2), 2.14 (t, 2Η, C(O)CH2), 2.64 (m, 2Η, CH2), 3.21-3.25 (m, 4Η, OCH2 and NCH2), 3.41 (m, 2Η, OCH2), 4.29 (m, 1Η, CH), 4.34 (s, 2Η, NCH2), 6.90 (m, 1Η, ArH), 7.12-7.2 (m, 6Η, ArH), 7.38 (s, 1Η, ArH); Anal. Calcd. for C36Η53FN2O3: C, 74.44; H, 9.20; N, 4.82. Found: C, 74.28; H, 9.36; N, 4.91. 11- {2-[2-(3-Fluoro-phenyl)-acetyl]-l ,2,3,4-tetrahydro-isoquinolin-3-ylmethoxy}- undecanoic acid butylamide (compound 22): Yield: 53 %; !H NMR(CDC13, 300 MHz): δθ.92 (t, 3H, CH3), 1.25 (m, 14Η, CH2), 1.45-1.47 (m, 2Η, CH2), 1.61-1.66 (m, 4Η, CH2), 2.13 (t, 2Η, C(O)CH2), 2.85 (m, 2Η, CH2), 3.02 (s, 2Η, C(O)CH2), 3.23 (m, 4Η, OCH2 and NCH2), 3.33 (m, 2Η, OCH2), 4.31 (s, broad, 1Η, CH), 4.46 (s, 2Η, NCH2), 6.89-6.99 (m, 4Η, ArH), 7.05-7.15 (m, 4Η, ArH); Anal. Calcd. for C33Η47FN2O3: C, 73.57; H, 8.79; N, 5.20. Found: C, 73.67; H, 8.50; N, 4.91. B. Biological assays Plasmid preparation The plasmids employed were the mammalian expression plasmid containing full length human ER cDNA, pCMV-hER, ER cDNA, pcDNA3.1-hER, human AIBl cDNA, pcDNA3.1-AIBl and the reporter gene expression plasmid containing three repeated estrogen receptor response elements, pGL-TATA-Luc. These four plasmids were used in the transient transfection reporter assays for estrogen receptor in human breast cancer cells. The yeast expression plasmid pCu424CUPl and reporter gene plasmid pLG 178 for yeast-based human estrogen receptor reporter assays were purchased from ATCC (American Type Culture Collection Manassas, VA). The yeast expression plasmids, pGADT7 and pGBTT7, for yeast two-hybrid assay were purchased from Clontech (Palo Alto, CA). The vector pCu424CUPl is constructed to express human estrogen receptor. pCUP-hER contains full length hER cDNA and can express hER in yeasts BJ3505. The expression of hER is regulated by CUP1 promoter. For the construction of pCUP-hER, the hER cDNA was generated by PCR and the primers, 5'-GGATCCATGACCATGACCCTCCACACC-3' (SEQ ID NO. 1) and 5'-GTCGACTCAGACTGTGGCAGGAAACCC-3' (SEQ ID NO. 2) were designed by inserting a BamHI site in front of the hER start codon and a Sail site after the hER stop codon. The pCMV-hER was used as the template of the PCR reaction. The resulting PCR product was further cloned into pCu424CUPl between BamHI site and Sail site to generate pCUP-hER. pCUP-hER contains long form full length hER cDNA and can express hER in yeasts BJ3505. The expression of hER is also regulated by CUPl promoter. For the construction of pCUP-hER, the hER cDNA was generated by PCR and the primers, 5'-GGATCCATGGATATAAAAAACTCACCATC-3' (SEQ ID NO. 3) and 5'- GTCGACTCACTGAGACTGTGGGTTCTGG-3' (SEQ TD NO. 4) were designed by inserting a BamHI site in front of the hER start codon and a Sail site after the hER stop codon. The pcDNA3.1-hER was used as the template of the PCR reaction. The PCR product was subsequently cloned into pCu424CUPl between BamHI site and Sail site to generate pCUP-hER . The vectors, pGBKT7 and pGADT7 were used to perform yeast two-hybrid assays for hER. pGBKT7 contains the Gal-4 DNA binding domain which was fused with the bait protein. pGADT7 containing the Gal-4 activation domain which was fused further with the target protein. pGBT-hER contains full length hER cDNA and can express Gal4 DNA binding/hER in yeasts Y190. For the construction of pGBT-hER , the hER cDNA was generated by PCR and the primers, 5'-CATATGACCATGACCCTCCACACC-3' (SEQ ID NO. 5) and 5'-GGATCCTCAGACTGTGGCAGGGAAACCC-3' (SEQ ID NO. 6) were designed by inserting an Ndel site in front of the hER start codon and a BamHI site after the hER stop codon. The PCR product was cloned into pGBKT7 between Ndel and BamHI site. pGAD-hER contains full length hER cDNA and can express hER conjugated with Gal4 activation domain in yeasts Y190. For the construction of pGAD-hER, the hER was generated by PCR which used the same primers mentioned in the construction of pGBT- hER . The PCR product was cloned into pGADT7 between Ndel and BamHI site. The vector, pLG 178 was used to construct reporter gene in yeast based estrogen receptor reporter transactivation assays. There are three repeated estrogen receptor response element GGTCACGCTGACC cloned in front of lacZ, reporter gene. The cDNA of three repeated ERE was generated by PCR in which the plasmid pERE3 -TATA-CAT was used as the template. The primers, 5'-CTCGAGTGGTTTTTGACCCCGAACG-3' (SEQ ID NO. 7) and 5'-CTCGAGCCCGGGGTCTAGAAGATCC-3'(SEQ ID NO. 8), used in generating PCR product were designed by inserting Xhol site at 5' and 3' terminus. The PCR product was cloned into pLG 178 within Xhol sites to generate pLG 178ERE3. The sequence of all plasmids was confirmed by DNA sequence reactions performed by Iowa State University DNA sequencing facility (Ames, IA). Yeast strains The S. cerevisiae strain BJ3505 (MAT pep4: His3 prbl- 1.6R his3- 200 lys2-801 ura3-52 gal2 canl) obtained from ATCC was used in the estrogen receptor reporter transactivation assays. The yeast strain Y190 (MATa leu2-3 leu2-l 12 ura3-52 trpl-901 his3- 200 ade2-101 gal4 gal80 ura3 Gal-lacZ lys gal-his3 cyhR) obtained from ATCC was used in the yeast two-hybrid assays. All yeast transformation was carried out following the lithium acetate transformation protocol. Site-directed mutagenesis The tyrosine mutation (pCMV-D351Y) at amino acid 351 was introduced by using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and pCMV-ER was used as the template. The primers constructed were as follows: 5' primer (5'- GGCTTACTGACCAACCTGGCAr CAGGGAGCTGGTTCAC -3') (SEQ ID NO. 9), the underlined nucleotide was changed to make the D351Y mutation) and a 3' primer (5'- GTGAACCAGCTCCCTGTATGCCAGGTTGGTCAGTAAGCC -3') (SEQ TD NO. 10). Reporter gene transactivation and β-galactosidase assays for human estrogen receptor in yeast The transformed yeasts from early-mid-log phase growth (OD600 nm approximately 1.0) were diluted to an OD600 nm of 0.03 in selective medium plus 50 M CuSO4 to induce estrogen receptor production. The diluted yeasts were aliquoted into 15-ml cap tubes containing culture medium 5 ml per tube and doses of either estradiol or test molecules, or both in methanol or DMSO were added. A solvent (methanol or DMSO) control was included in each experiment. The cultures were incubated overnight at 30 C with vigorous orbital shaking (300 rpm). After incubation, the yeast samples were diluted in appropriate selective medium to OD600 of 0.3-0.4 and 100 μl was added to each well of a 96-well microtiter plate. Each sample was assayed in triplicate. To each well, 100 μl of assay buffer (60mM Na2HPO4, 40mM NaH2PO4, lOmM KCl, lmM MgSO4, 2mg/ml 2-nitrophenyl-beta- D-galactosidase (ONPG), 0.1% SDS, 50 mM -mercaptoethanol, and 200U/ 1 oxalyticase (Enzogenetics, Corvallis, OR) was added. The change of ortho nitrophenol, the yellow product that resulted from β-galactosidase cleavage of ONPG, was measured by using a kinetic microtiter plate reader (Molecular Device, Sunnyvale, CA). -galactosidase activity is expressed as Vmax (mOD420/min) divided by cell density (OD590). The relative activity for test samples is the β-galactosidase activity of test sample over that of estradiol whose activity is 1. Yeast two-hybrid and filter lift assays The transformed yeasts with yeast two-hybrid vectors were cultured in synthetic medium lacking trytophan, and leucine. The estradiol or/and test molecule was added to the cultured medium after the transformed yeast cells were plated on nitrocellulose membrane. After stimulation with estradiol or test molecules for overnight, the nitrocellulose membranes plated with yeast cells were transferred to a new filter and the yeast cells were permeablized by three heat-freeze cycles. After that, the membranes were soaked in 0.4 ml Z-buffer/Xgal (60 mM Na^O^ 40mM NaH2PO4, lOmMKCl, ImM MgSO4, 0.1% SDS, 50mM -mercaptoethanol, 20 mM Xgal). The pictures of the results were taken within 2 and 3 hours after the -galactosidase assay was processed. Chemiluminescence-based competitive binding assay The HitHunter™ EFC estrogen receptor chemilinescence assay kit (Discoverx, Fremont, CA) was used to determine the ability of test molecules to displace ED-estrogen conjugate from hERα - ED-estrogen conjugate complex. The recombinant hER or hER (5 nM) was preincubated with ED-estrogen conjugate in screening buffer. After the preincubation, the test molecules and hER-ED-estrogen conjugate complex solution were added into the 96-well microplate to produce a final volume of 50 μl per well. After the reaction was incubated at room temperature for 1.5 hrs, the EA solution and chemiluminescence substrate buffer were added into each well for 1 hr incubation, and the luminescence values were measured by using luminescence microplate reader, LumiCount (Packard, Boston, MA). The IC50 value of tested compounds was generated by graphfit software. The IC50 value was further converted to relative binding affinity (RBA) by using raloxifene's IC50 as the standard that was set to 1. The RBA value of each test molecule was calculated by using the equation; RBA equals (IC50 of raloxifene/lC50 of test molecule). Fluorescence-based competitive binding assays The estrogen receptor competitor assay kits (Panvera, Madison, WT) were used to determine the ability of test molecules to displace the fluormone, ES2, from hER -ES2 or hER -ES2 complex. Serial dilutions of each test molecule were prepared in methanol or DMSO. The recombinant hER or hER (7 nM) was preincubated with ES2 (1 nM) in screening buffer. After the preincubation, the test molecules and ER-ES2 complex solution were added into the 96-well microplate to produce a final volume of 100 μl per well. The reaction was incubated at room temperature for 1 hr and the polarization values were measured by using fluorescence microplate reader, Polarion (Tecan, Research Triangle Park, NC) with excitation wavelength 495 nm and emission wavelength 535 nm. The polarization value versus test molecule concentration curves was analyzed by graphfit software to generate IC50 values. The IC50 value was further converted to relative binding affinity (RBA) by using tamoxifen's IC50 as the standard that was set to 1. The RBA value of each test molecule was calculated by using the equation; RBA equals (IC50 of tamoxifen/IC50 of test molecule).
Cell culture, transfection, luciferase assay and β-galactosidase assay Human breast cancer cells, MCF-7 (ER positive) and MDA-MB-231(ER negative), were purchased from ATCC. The cells routinely were cultured as monolayer in Dulbecco's modified minimal essential medium (GIBCO/BRL, Grand Island, NY) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), Penicillin (100 unit/ml)/Streptomycin (100 g/ml) and bovine insulin (0.005 mg/ml) (GIBCO/BRL, Grand Island, NY), and incubated at 37 °C in a humidified atmosphere of 5% CO2/air. For the transient transfection reporter assays, the cells were plated in triplicate in 12- well plates at a density of 300000 cells/well in the phenol red-free DMEM (GIBCO/BRL, Grand Island, NY) supplemented with 10% charcoal-stripped fetal bovine serum (Hyclone, Logan, UT), Penicillin (100 unit/ml)/Streptomycin (100 g/ml), 2mML-glutamine and ImM sodium Pyruvate. 24 hrs later, the cells were transfected with three plasmids by using Superfect transfection kit (Qiagen, Valencia, CA). For the detection of hER activity, cells were transfected with 2 g hER expression plasmid (pCMV-ER ), 6 g luciferase reporter plasmid containing estrogen receptor response element (PGL-TATA-Luc), and 600ng normalization control, β-galactosidase reporter plasmid (pCMV ). For the detection of hER activity, cells were transfected with 3ug hER expression plasmid (pcDNA3.1-hER ), 6 g luciferase reporter plasmid containing estrogen receptor response element (PGL-TATA- Luc), and 600ng pCMV . For determining the influence of ER's major coactivator in breast, AIBl, 2 g ρcDNA3.1-ATBl was added into the transfection plasmid solution mentioned previously. The transfected cells were rinsed with PBS and treated with various concentrations of test molecules and one positive control (vehicle, DMSO or methanol) in phenol red-free culture medium. After incubation for further 24 hrs, the cells were washed with PBS and lysed with lysis buffer (Pierce, Rockford, IL). The lysate was used to determine the luciferase activity for ER's activity and the β-galactosidase activity for the normalization of transfection efficiency. For the luciferase activity assay, 20 μl of lysate and 100 μl luciferase assay buffer (Promega, Madison, WI) were added into a well of 96-well plate. The luminescence was detected by using luminescence microplate reader, LumiCount (Packard, Boston, MA). For the β-galactosidase activity assay, 20 ml of lysate and 185 ml β-galactosidase assay buffer (Clontech, Palo Alto, CA) were added into a well of 96-well plate. The β-galactosidase activity was measured as luminescence strength by using luminescence microplate reader, LumiCount (Packard, Boston, MA). The normalized reporter activity was calculated by the luciferase activity divided by that of β-galactosidase. For the estrogenic or antiestrogenic effects of test molecules, the normalized reporter activity value was further converted to relative normalized reporter activity by using the value of estradiol or DMSO as a standard that was set to 1. Cell proliferation assay MCF-7 or MDA-MB-231 cells were inoculated into 12-well culture plates at 10000 cells in 2ml maintained medium per well. Cells were allowed to attach to the bottom for 24 hrs incubation, then the seeding medium was removed and replaced by the experimental medium (phenol red-free DMEM supplemented with 5% charcoal-stripped fetal bovine serum and Penicillin (100 unit/ml)/Streptomycin (100 g/ml)). After 24 hr incubation, the test molecules dissolved in DMSO were added in the wells. The final concentration of DMSO in the culture medium did not exceed 0.1%. The culture was continued for 3 days and the medium and tested compounds were replaced every two days. The final cell numbers were estimated with CellTiter proliferation assay kit (Promega, Madison, WI) by measuring the absorbance at 570 nm, which is directly proportional to the number of living cells in the culture. Experiments were at least duplicated for each compound and the results are shown as average value of at least three individual testing with less than 15% error. Results and Discussion Fluorescence-based binding affinity testing for compounds of the invention hi this assay, recombinant hER and the commercial synthetic estrogen, ES2 containing fluorescence polarization property, are used. This assay is a homogenous assay. When the assay solution only contains ES2, the solution exerts weak fluorescence polarization property due to the quick rotation of free ES2 molecule. On the contrary, when ES2 is mixed with hER , the rotation of ES2 is largely decreased due to its tight interaction with hER and the solution exerts strong fluorescence polarization property. Addition of the antiestrogen to the ES2/hER displaces ES2 from hER and results in the whole solution exerting less fluorescence polarization property than the solution without antiestrogen. Based on this principle, the higher the binding affinity of the tested compound, the lower fluorescence polarization value the tested solution would exert. Table 1 shows the relative binding affinity of certain compounds of the present invention, designated compounds 1 to 12, where generic Tamoxifen was tested as reference and its binding affinity was set at 1. The result showed that among these compounds, compounds 6 and 7 have highest binding affinity and higher than tamoxifen. The preferable physical property of the substituted group on the second aromatic ring is hydrogen bond donor and hydrogen bond acceptor, and the favorable tendency of substituent's physical property for binding affinity is OH> F> OCH3> CH3, CI. For the substituted position on the second aromatic ring, substituents at 3 '-position are slightly better than 4'- position and 2'- position is the least preferred for binding. Essentially, when the binding affinity of compounds 2, 11 and 12 are compared, it reveals that the length of the bridge and side chain seem not to influence the compound's binding affinity.
Table 1. Relative binding affinity of compound 1 to compound 12 for hER in fluorescence- based binding assay
Figure imgf000035_0001
Figure imgf000035_0002
Figure imgf000036_0001
Transient transfection reporter testing The transient transfection reporter assay was used to determine the estrogenic or antiestrogenic activity of tested compounds in employed human breast cancer cells, MCF-7 cells that are cotransfected with hERα expression and reporter plasmids. For estrogenic activity, 5 μM tested compound was added to transfected MCF-7 cells. For antiestrogenic activity, 5 μM tested compound and 1 nM estradiol are added to transfected MCF-7 cells. The estrogenic (antiestrogenic) activity was determined by dividing the luciferase activity by the β-galactosidase activity. To determine the influence of estrogen receptor's major coactivator in breast cancer, ATBl, for the compounds' estrogenic activity, the expression vector of ATBl was additionally cotransfected with the plasmids mentioned above. The results are shown in Figure 4. As can be seen, compound 1 can antagonize estrogen's action in a dose dependent manner. Table 2 shows the estrogenic effects of compounds 1 to 12. In the same assay, DMSO was tested as reference and its estrogenic effect was set as 1. Tamoxifen and estrogen were also tested for comparison. Shown in the Table 2, tamoxifen' s relative estrogenic effect is 1.385. Among the compounds 1 to 12, compound 7 exerts the highest estrogenic effect. Apart from compound 7, compounds 8, 9 and 12 have similar or higher estrogeic effects than tamoxifen. The other compounds 1, 2, 3, 4, 5, 6, 10 and 11 do not exert any estrogenic effects. Essentially, those compounds containing substituent on the 3' position of the second aromatic ring don't possess estrogenic effects, except compound 8 containing methyl group on the 3 position and compound 12 with longer bridge length. For compound containing hydroxyl group and compound 9 containing methyl group on the 4' position of the second aromatic ring, both exert significant estrogenic effects.
Table 2. Relative estrogenic activity of compound 1 to 12 in transient transfection reporter assay for hERα in MCF-7 cells
Figure imgf000037_0001
Figure imgf000037_0002
Table 3 shows the antiestrogenic effects of several compounds of the present invention. In this assay, InM estrogen was used as reference and tamoxifen was tested for comparison. The compounds 2, 4, 6, 7, 8 and 10 showed 25% to 56% inhibition against estrogen, and tamoxifen showed 72% inhibition activity. Compound 6 containing hydroxyl moiety on the 3' position of the second aromatic ring, had the strongest inhibition activity among the compounds and the rest of the compounds with the substituent on the 3' position of the second aromatic ring showed moderate inhibition activity, except compound 12. Compound 7 with hydroxyl group on the 4' position also exhibited moderate antiestrogenic activity. Based on the physical property of the substituents, hydrogen bond donor group, like hydroxyl, was optimal, and hydrogen bond acceptor group, like fluoro and methoxy, was secondly optimal. Unexpectedly, compound 8 with methyl group substituent on the 3 position exerts moderate antiestrogenic effect and it also possesses a moderate estrogenic effect.
Table 3. Relative antiestrogenic activity of compound 1 to 12 in transient transfection reporter assay for hERa in MCF-7 cells
Figure imgf000038_0001
Figure imgf000038_0002
Figure imgf000039_0001
Amino acid 351 (D351) of hERα plays an essential role in regulating estrogenic or antiestrogenic compound's binding to hERα and the recruitment of corepressors. Importantly, the point mutation of D351 to tyrosine (Y) was found to occur in tamoxifen treated breast tumors. The mutated D351 Y can largely enhance 4-hydroxytamoxifen's estrogenic activity so the D351Y hERα mutant is implied to serve a key function for the formation of tamoxifen resistant breast tumors. Based on this observation the hERα D351Y mutant is generated by PCR-based site directed mutagenesis method for use in the transient transfection reporter assay. The main goal of this testing is to elucidate the existence of the pure antiestrogenic property of the compounds of the invention and to determine whether the compounds estrogenic activity will increase due to the presence of hERα D351 Y or not. Figure 5 shows the estrogenic activity of compounds 4, 6, and 7 against hERα D351 Y. In this assay, DMSO was used as reference. Estrogen and tamoxifen were used as the comparison. The results shown in Figure 5 indicate that the estrogenic activity of estrogen does not increase and that of tamoxifen only moderately increases.However, the estrogenic activitys of compounds 4, 6, and 7, do not increase when their estrogenic effects against hERα D351Y and hERα wild type are compared. Interestingly, the estrogenic effects of compounds 4, 6, and 7 against mutant hERα D351Y are even lower than that of DMSO. This result demonstrates that these compounds can act as pure antiestrogens and they provide antiestrogenic effects against basal hERα effects. hERα positive breast cancer cell proliferation testing for compounds 1-13 MCF-7 cell line was used to perform this assay and the description of this assay as mentioned above. Table 4 shows the inhibition activity of compounds 1 to 13 against MCF-7 cell proliferation. DMSO was used as reference. Estrogen and tamoxifen are also tested for comparison. 2nM estrogen stimulates the growth of DMSO-treated MCF-7 cells 150% compared to 58%» by tamoxifen. For compounds 1 to 13, compounds 3, 8 and 10 only show slight inhibition effects. Compound 6 exerts the strongest inhibition effects with 38% inhibition. However, compounds 2 and 4 exert slightly lower inhibition effects than compound 6. The results show that the compounds with substituent on the 3' position of the second aromatic ring exert much better anti-proliferation activity against hERα dependent breast cancer cells than those with substituent on the 4' position. The relationship between physical property of substituent and anti-proliferation activity is that hydrogen bond donor > hydrogen bond acceptor > hydrophobic group. This trend correlates with the trend from transient transfection reporter assay's antiestrogenic testing. In fact, those compounds that show good antiestrogenic effects in transient transfection reporter assay also possess good anti- proliferation activity against MCF-7 cells. These results confirm that compounds of the present invention exhibit inhibition ability against hERα.
Table 4. Proliferation effects of compound 1 to 13 against MCF-7 cells
Figure imgf000040_0001
Figure imgf000040_0002
Figure imgf000041_0001
hER negative breast cancer cell proliferation testing for compounds 2, 4 and 6 In this assay, MDA-MB-231 breast cancer cell line, a hER negative cell line, was used. DMSO was used as reference. Estrogen and tamoxifen were also tested for comparison.
Figure 6 shows the proliferation activities of compounds 2, 4 and 6. As expected, estrogen does not promote the growth of MDA-MB-231 cells. Compounds 2, 4, and 6 also do not inhibit or stimulate the growth of MDA-MB-231 cells. However, tamoxifen still exerts moderate anti-proliferation effects against MDA-MB-231 cells. Tamoxifen's ER independent anti-proliferation activity has been proposed by several groups. The results shown here further demonstrate that the inhibitory effects of compounds 2, 4, and 6 against hERα are specific. Yeast two-hybrid/filter lifting testing for compounds 2 and 6 Dimerization of estrogen receptor plays an essential role in regulating estrogen receptor's functions including DNA binding, transactivation, and coactivator recruitment. In this study, yeast two hybrid and filter lift assays were used to determine the ability of compounds 2 and 6 to interrupt the dimerization of hERα. For setting up yeast two hybrid assay, the full length hERα was inserted into pGAD-GAL4 and pGBD-GAL4 vectors, hi pGBD-GAL4, hERα was fused to the GAL4 DNA binding domain through its N terminus, hi pGAD-GAL4, hERα was fused to the GAL4 activation domain through its N terminus. When the dimerization of hERα occurs mainly through its C terminus, the GAL4 DNA binding domain binds to the repeated GAL4 response element located in front of the β-gal reporter gene and the whole complex, GAI -BD/hERα/hERα/GAL4-AD, turns on the synthesis of the product of β-gal reporter gene. The compound's inhibitory activity is inversely related to the activity of the reporter gene product, β-galactosidase. The higher the activity of β-galactosidase, the lower the compound's inhibitory activity against hERα dimeriaztion. Filter lift assay in which X-gal was used, was employed to qualitatively determine the activity of β-galactosidase. Increase in blue color formed from the tested yeast colony indicates that the tested compound does not possess significant inhibition activity. Compound 2 and tamoxifen were tested either alone or in combination with estrogen. The results indicated that compound 2 and tamoxifen alone did not induce the dimerization of hERα based on the fact that their relative tested yeast colony did not change color. When combined with estrogen, both compounds exert only a weak inhibitory activity. Compound 6 and tamoxifen were also tested. The results showed that compound 6 and tamoxifen did not induce hERα dimerization. When estrogen's colony was used as a reference colony, the colony tested with compound 6 in combination with estrogen shows slight blue color change. However, the colony tested with tamoxifen in combination with estrogen shows moderate blue color change. Results observed for this test after one additional hour of color development further confirmed the result. This result demonstrates that compound 6 can exert inhibitory activity against estrogen for the dimerization of hERα and its inhibitory activity is higher than tamoxifen' s. Since compound 6 has a hydrophobic side chain similar to ICI type of compounds, ICIl 82,780 (Figure 7B) was also tested in this assay for comparison. The results showed that Compound 6 and ICIl 82,780 alone do not promote the dimerization of hERα. However, when combined with estrogen, both compounds exert an obvious inhibitory activity against the dimerization of hERα. Unexpectedly, compound 6's inhibitory activity is similar to that of ICIl 82,780. Taken together, these experimental results demonstrate that the compounds of the present invention function in vivo and in vitro as competitive inhibitors of estrogen binding to estrogen receptors. While the invention has been described in terms of its preferred embodiments, those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the appended claims. Accordingly, the present invention should not be limited to the embodiments as described above, but should further include all modifications and equivalents thereof within the spirit and scope of the description provided herein.

Claims

CLAIMSWe claim:
1. A compound of formula
Figure imgf000043_0001
wherein Z is selected from the group consisting of CO, CH2, and CO(CH2)n, where n = 1 or
2; Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are the same or different, and are selected from the group consisting of H, OH, halogens, R and OR, where R is a substituted or unsubstituted alkyl group having 1-4 carbons; Y is selected from the group consisting of -CH2-O-R10 and -CH2-NH-R10; and RIO is selected from the group consisting of : a) -(CH2)n-C(=O)-N-Rll, R12, where n = 1-10 and Rll and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted Cj-C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; b) -(CH2)n-S(=O)-N-Rll, R12, where n = 1-10 and Rll and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; c) -(CH2)n-SO2-N-Rll, R12, where n = 1-10 and Rll and Rl 2 are the same or different, and are selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; d) -(CH2)n-S(=O)-Rll, where n = 1-10 and Rll is selected from: substituted and unsubstituted -Cc, alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; and e) -(CH2)n-SO2-Rll, where n = 1-10 and Rll is selected from the group consisting of substituted and unsubstituted C C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl.
2. The compound of claim 1 wherein said substituted and unsubstituted CrC9 alkyl is -CH2CH2CH2CF2CF3.
3. The compound of claim 1 wherein Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are selected from the group consisting of F, OCH3, OH, CH3 and CI.
4. A compound of formula
Figure imgf000044_0001
5. A compound of formula
Figure imgf000044_0002
6. A compound of formula
7. A compound of formula
Figure imgf000045_0002
8. A compound of formula
Figure imgf000045_0003
. A compound of formula
Figure imgf000046_0001
10. A compound of formula
Figure imgf000046_0002
11. A compound of formula
Figure imgf000046_0003
12. A compound of formula
Figure imgf000047_0001
13. A compound of formula
Figure imgf000047_0002
14. A compound of formula
Figure imgf000047_0003
15. A compound of formula
Figure imgf000048_0001
16. A compound of formula
Figure imgf000048_0002
17. A compound of formula
Figure imgf000048_0003
18. A compoxmd of formula
Figure imgf000049_0001
19. A compound of formula
Figure imgf000049_0002
20. A compound of formula
Figure imgf000049_0003
21. A compound of formula
Figure imgf000050_0001
22. A compound of formula
Figure imgf000050_0002
23. A compound of formula
Figure imgf000050_0003
24. A compound of formula
Figure imgf000051_0001
25. A compound of formula
Figure imgf000051_0002
26. A method of inhibiting binding of estrogen in vivo or in vitro by providing a compound which binds to an estrogen binding site, said compound having the generic formula
Figure imgf000051_0003
wherein Z is selected from the group consisting of CO, CH2, and CO(CH2)n, where n = 1 or 2; Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are the same or different, and are selected from the group consisting of H, OH, halogens, R and OR, where R is a substituted or unsubstituted alkyl group having 1-4 carbons; Y is selected from the group consisting of -CH2-O-R10 and -CH2-NH-R10; and RIO is selected from the group consisting of : a) -(CH2)n-C(=O)-N-Rll, R12, where n = 1-10 and Rll and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted Cι-C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; b) -(CH2)n-S(=O)-N-Rll, R12, where n = 1-10 and Rll and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; c) -(CH2)n-SO2-N-Rll, R12, where n = 1-10 and Rll and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; d) -(CH2)n-S(=O)-Rll, where n = 1-10 and Rll is selected from: substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; and e) -(CH2)n-SO2-Rll, where n = 1-10 and Rll is selected from the group consisting of substituted and unsubstituted C,-C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl.
27. The method of claim 26, wherein said substituted and unsubstituted CrC9 alkyl is -CH2CH2CH2CF2CF3.
28. The compound of claim 26 wherein Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are selected from the group consisting of F, OCH3, OH, CH3 and CI.
29. The method of claim 26, wherein said compound is
Figure imgf000053_0001
30. The method of claim 26, wherein said compound is
Figure imgf000053_0002
31. A method for treating tamoxifen-resistant breast cancer tumors in a patient in need thereof, comprising the step of administering to said patient a compound of generic formula
Figure imgf000054_0001
wherein Z is selected from the group consisting of CO, CH2, and CO(CH2)n, where n = 1 or
2; Rl, R2, R3, R4, R5, R6, R7, R8 and R9 are the same or different, and are selected from the group consisting of H, OH, halogens, R and OR, where R is a substituted or unsubstituted alkyl group having 1-4 carbons; Y is selected from the group consisting of -CH2-O-R10 and -CH2-NH-R10; and RIO is selected from the group consisting of : a) -(CH2)n-C(=O)-N-Rll, R12, where n = 1-10 and Rll and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted CrC9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; b) -(CH2)n-S(=O)-N-Rll, R12, where n - 1-10 and Rll and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted C C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; c) -(CH2)n-SO2-N-Rll, R12, where n = 1-10 and Rll and R12 are the same or different, and are selected from the group consisting of substituted and unsubstituted -Cg alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; d) -(CH2)n-S(=O)-Rll, where n = 1-10 and Rll is selected from: substituted and unsubstituted C,-C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl; and e) -(CH2)n-SO2-Rll, here n = 1-10 and Rll is selected from the group consisting of substituted and unsubstituted C,-C9 alkyl, substituted and unsubstituted cycloalkyl, and substituted and unsubstituted aryl.
PCT/US2004/025186 2003-08-08 2004-08-06 Compounds having antiestrogenic and tissue selective estrogenic properties Ceased WO2005016889A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/349,339 US7601739B2 (en) 2003-08-08 2006-02-08 Compounds having antiestrogenic and tissue selective estrogenic properties, and compounds with anti-androgenic properties for treatment of prostate cancer and androgen receptor dependent diseases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US49336303P 2003-08-08 2003-08-08
US60/493,363 2003-08-08

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/349,339 Continuation-In-Part US7601739B2 (en) 2003-08-08 2006-02-08 Compounds having antiestrogenic and tissue selective estrogenic properties, and compounds with anti-androgenic properties for treatment of prostate cancer and androgen receptor dependent diseases

Publications (1)

Publication Number Publication Date
WO2005016889A1 true WO2005016889A1 (en) 2005-02-24

Family

ID=34193178

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/025186 Ceased WO2005016889A1 (en) 2003-08-08 2004-08-06 Compounds having antiestrogenic and tissue selective estrogenic properties

Country Status (1)

Country Link
WO (1) WO2005016889A1 (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7700625B2 (en) 2005-04-13 2010-04-20 Astex Therapeutics Ltd. Hydroxybenzamide derivatives and their use as inhibitors of Hsp90
US7754725B2 (en) 2006-03-01 2010-07-13 Astex Therapeutics Ltd. Dihydroxyphenyl isoindolymethanones
US8277807B2 (en) 2006-10-12 2012-10-02 Astex Therapeutics Limited Pharmaceutical combinations
US8383619B2 (en) 2008-04-11 2013-02-26 Astex Therapeutics Limited Pharmaceutical compounds
EP2323997A4 (en) * 2008-07-31 2013-05-01 Senomyx Inc METHODS AND INTERMEDIATES FOR PRODUCING SUGAR TASTE FATHERS
US8883790B2 (en) 2006-10-12 2014-11-11 Astex Therapeutics Limited Pharmaceutical combinations
US8916552B2 (en) 2006-10-12 2014-12-23 Astex Therapeutics Limited Pharmaceutical combinations
US9371317B2 (en) 2013-02-19 2016-06-21 Senomyx, Inc. Sweet flavor modifier
US9420814B2 (en) 2012-08-06 2016-08-23 Senomyx, Inc. Sweet flavor modifier
US9428439B2 (en) 2006-10-12 2016-08-30 Astex Therapeutics Ltd. Hydrobenzamide derivatives as inhibitors of Hsp90
US9603848B2 (en) 2007-06-08 2017-03-28 Senomyx, Inc. Modulation of chemosensory receptors and ligands associated therewith
US9730912B2 (en) 2006-10-12 2017-08-15 Astex Therapeutics Limited Pharmaceutical compounds
US11945813B2 (en) 2018-08-07 2024-04-02 Firmenich Incorporated 5-substituted 4-amino-1H-benzo[c][1,2,6]thiadiazine 2,2-dioxides and formulations and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995035316A1 (en) * 1994-06-20 1995-12-28 Astra Aktiebolag New opioid peptide antagonists

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995035316A1 (en) * 1994-06-20 1995-12-28 Astra Aktiebolag New opioid peptide antagonists

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8816087B2 (en) 2005-04-13 2014-08-26 Astex Therapeutics Limited Hydroxybenzamide derivatives and their use as inhibitors of Hsp90
US7700625B2 (en) 2005-04-13 2010-04-20 Astex Therapeutics Ltd. Hydroxybenzamide derivatives and their use as inhibitors of Hsp90
US8101648B2 (en) 2005-04-13 2012-01-24 Astex Therapeutics, Ltd. Hydroxybenzamide derivatives and their use as inhibitors of HSP90
US9914719B2 (en) 2005-04-13 2018-03-13 Astex Therapeutics Ltd. Hydroxybenzamide derivatives and their use as inhibitors of HSP90
US8530469B2 (en) 2005-04-13 2013-09-10 Astex Therapeutics Ltd. Therapeutic combinations of hydroxybenzamide derivatives as inhibitors of HSP90
US8106057B2 (en) 2006-03-01 2012-01-31 Astex Therapeutics, Ltd. Dihydroxyphenyl isoindolylmethanones
US7754725B2 (en) 2006-03-01 2010-07-13 Astex Therapeutics Ltd. Dihydroxyphenyl isoindolymethanones
US8277807B2 (en) 2006-10-12 2012-10-02 Astex Therapeutics Limited Pharmaceutical combinations
US9730912B2 (en) 2006-10-12 2017-08-15 Astex Therapeutics Limited Pharmaceutical compounds
US9428439B2 (en) 2006-10-12 2016-08-30 Astex Therapeutics Ltd. Hydrobenzamide derivatives as inhibitors of Hsp90
US8883790B2 (en) 2006-10-12 2014-11-11 Astex Therapeutics Limited Pharmaceutical combinations
US8916552B2 (en) 2006-10-12 2014-12-23 Astex Therapeutics Limited Pharmaceutical combinations
US9603848B2 (en) 2007-06-08 2017-03-28 Senomyx, Inc. Modulation of chemosensory receptors and ligands associated therewith
US8383619B2 (en) 2008-04-11 2013-02-26 Astex Therapeutics Limited Pharmaceutical compounds
US9732052B2 (en) 2008-07-31 2017-08-15 Senomyx, Inc. Processes and intermediates for making sweet taste enhancers
EP2323997A4 (en) * 2008-07-31 2013-05-01 Senomyx Inc METHODS AND INTERMEDIATES FOR PRODUCING SUGAR TASTE FATHERS
US10570105B2 (en) 2008-07-31 2020-02-25 Firmenich Incorporated Processes and intermediates for making sweet taste enhancers
EP3085699A3 (en) * 2008-07-31 2016-11-23 Senomyx, Inc. Processes and intermediates for making sweet taste enhancers
US9382196B2 (en) 2008-07-31 2016-07-05 Senomyx, Inc. Processes and intermediates for making sweet taste enhancers
US10308621B2 (en) 2008-07-31 2019-06-04 Senomyx, Inc. Processes and intermediates for making sweet taste enhancers
US10087154B2 (en) 2008-07-31 2018-10-02 Senomyx, Inc. Processes and intermediates for making sweet taste enhancers
US8586733B2 (en) 2008-07-31 2013-11-19 Senomyx, Inc. Processes and intermediates for making sweet taste enhancers
US9745293B2 (en) 2012-08-06 2017-08-29 Senomyx, Inc. Sweet flavor modifier
US9420814B2 (en) 2012-08-06 2016-08-23 Senomyx, Inc. Sweet flavor modifier
US9687015B2 (en) 2012-08-06 2017-06-27 Senomyx, Inc. Sweet flavor modifier
US9371317B2 (en) 2013-02-19 2016-06-21 Senomyx, Inc. Sweet flavor modifier
US9695162B2 (en) 2013-02-19 2017-07-04 Senomyx, Inc. Sweet flavor modifier
US9475803B2 (en) 2013-02-19 2016-10-25 Senomyx, Inc. Sweet flavor modifier
US11945813B2 (en) 2018-08-07 2024-04-02 Firmenich Incorporated 5-substituted 4-amino-1H-benzo[c][1,2,6]thiadiazine 2,2-dioxides and formulations and uses thereof

Similar Documents

Publication Publication Date Title
WO2005016889A1 (en) Compounds having antiestrogenic and tissue selective estrogenic properties
EP1572113B1 (en) Calcium receptor modulating compound and use thereof
EP3148974B1 (en) Cyclopropylamine compounds as histone demethylase inhibitors
DK2697191T3 (en) BRANCHED 3-PHENYLPROPIONIC ACID DERIVATIVES AND THEIR USE
EA003190B1 (en) Aryl fused azapolycyclic compounds
JP2005505603A (en) N-aroylpiperazine derivatives as orexin receptor antagonists
TW200940550A (en) Selective androgen receptor modulators (SARMs) and uses thereof
WO2002085850A1 (en) Cyclic amidine derivative
ES2374582T3 (en) ESPIROBENZAZEPINAS USED AS VASOPRESINE ANTAGONISTS.
JP2003528847A (en) Malonamic acids and their derivatives as thyroid receptor ligands
JP4372001B2 (en) Bis aromatic alkanols
JP5973429B2 (en) Fused heterocyclic derivatives as S1P modulators
US7601739B2 (en) Compounds having antiestrogenic and tissue selective estrogenic properties, and compounds with anti-androgenic properties for treatment of prostate cancer and androgen receptor dependent diseases
TW201113263A (en) (Thio) Morpholine derivatives as S1P modulators
KR20110096174A (en) Spiroindolinone derivative prodrug
TW201639846A (en) 1-[2-(aminomethyl)benzyl]-2-thioxo-1,2,3,5-tetrahydro-4H-pyrrolo[3,2-d]pyrimidin-4-ones as inhibitors of myeloperoxidase
UA125043C2 (en) ESTROGEN RECEPTOR MODULATORS
JPH08311067A (en) Novel heterocyclic spiro compound,its production,and medicine composition containing it
EP3240547A1 (en) Novel calcium modulators
Ilies et al. Pyridinium‐based cationic lipids as gene‐transfer agents
EP0641301A1 (en) Stilbene derivatives as anticancer agents
JP2013507419A (en) Spirocyclic derivatives as histone deacetylase inhibitors
AU594489B2 (en) Substituted pyrido(2,3-b)(1,4) Benzodiazepin-6-ones
Khedekar et al. Synthesis and anti-inflammatory activity of alkyl/arylidene-2-aminobenzothiazoles and 1-benzothiazol-2-yl-3-chloro-4-substituted-azetidin-2-ones
WO2004069243A1 (en) Breast cancer resistance protein (bcrp) inhibitor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 11349339

Country of ref document: US

122 Ep: pct application non-entry in european phase
WWP Wipo information: published in national office

Ref document number: 11349339

Country of ref document: US