WO2005016323A2 - Use of c-kit inhibitors for treating type ii diabetes - Google Patents

Use of c-kit inhibitors for treating type ii diabetes Download PDF

Info

Publication number
WO2005016323A2
WO2005016323A2 PCT/IB2004/002934 IB2004002934W WO2005016323A2 WO 2005016323 A2 WO2005016323 A2 WO 2005016323A2 IB 2004002934 W IB2004002934 W IB 2004002934W WO 2005016323 A2 WO2005016323 A2 WO 2005016323A2
Authority
WO
WIPO (PCT)
Prior art keywords
methyl
phenyl
thiazol
ylamino
pyridin
Prior art date
Application number
PCT/IB2004/002934
Other languages
French (fr)
Other versions
WO2005016323A3 (en
Inventor
Alain Moussy
Jean-Pierre Kinet
Original Assignee
Ab Science
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ab Science filed Critical Ab Science
Priority to DE602004013792T priority Critical patent/DE602004013792D1/en
Priority to US10/567,557 priority patent/US20070032521A1/en
Priority to CA002535242A priority patent/CA2535242A1/en
Priority to JP2006523710A priority patent/JP2007502809A/en
Priority to EP04769332A priority patent/EP1653934B1/en
Publication of WO2005016323A2 publication Critical patent/WO2005016323A2/en
Publication of WO2005016323A3 publication Critical patent/WO2005016323A3/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404Indoles, e.g. pindolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/4261,3-Thiazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives

Definitions

  • the present invention relates to a method for treating type II diabetes, obesity and related disorders comprising administering a compound capable of depleting mast cells or a compound inhibiting mast cells degranulation, to a human in need of such treatment.
  • a compound capable of depleting mast cells or a compound inhibiting mast cells degranulation can be chosen from c-kit inhibitors and more particularly non-toxic, selective and potent c-kit inhibitors.
  • said inhibitor is unable to promote death of IL-3 dependent cells cultured in presence of IL-3.
  • Non-insulin-dependent diabetes mellitus also known as type IT diabetes, is defined as a chronic disease appearing when the insulin turns out to be inefficient in promoting glucose uptake by cells, which results in increased levels of glucose in the blood. This disease affects about 100 million people world-wide, 75% of which are obese at the time of diagnosis.
  • Hypoglycemic agents such as sulfonylureas work by triggering the pancreas to make more insulin, which lower blood glucose.
  • the side effects of sulfonylureas include hypoglycemia, renal and hepatic disease, gastrointestinal disturbances, increased cardiovascular mortality, dermatological reactions, drowsiness and headache. Biguanides lower blood glucose levels by reducing intestinal glucose absorption and hepatic glucose, but not by stimulating insulin secretion.
  • the major side effects of biguanidine are lactic acidosis and increased cardiovascular mortality.
  • Alpha-glucosidase inhibitors decrease the absorption of carbohydrates from the digestive tract, thereby lowering the after-meal glucose level, but gastrointestinal side effects and hypoglycemia are observed.
  • Thiazolidinediones such as rosiglitazone are PPARgamma agonists and increase the cell's sensitivity to insulin. However, they may be responsible for water retention, liver diseases, cardiovascular diseases, red blood cell abnormalities, and headache.
  • c-kit inhibitors lower the level of glucose, cholesterol, triglycerides and non esterified fatty acids in blood.
  • adipose tissue is a dynamic endocrine organ that secretes a number of factors that are increasingly recognized to contribute to systemic and vascular inflammation.
  • adipokines The major secretory compartment of adipose tissue consists of adipocytes, fibroblasts, and mast cells. These cells, using endocrine, paracrine and autocrine pathways, secrete multiple bioactive molecules, conceptualized as "adipokines".
  • mast cells regulate, directly or indirectly, a number of the processes that contribute to the development of atherosclerosis, including hypercholesterolemia, hypergycemia, hypertension, endothelial dysfunction, insulin resistance, and vascular remodeling. But, as this point, other mechanisms may not be ruled out.
  • a new route for treating type H diabetes, obesity and related disorders is provided, which consists of administering c-kit inhibitors to patients.
  • the present invention relates to a method for treating type IT diabetes, obesity and related disorders comprising administering a compound capable of depleting mast cells or blocking mast cells degranulation to a human in need of such treatment.
  • Said method for treating type II diabetes can comprise administering a c-kit inhibitor to a human in need of such treatment
  • it may also consist of administering an antihistamine compound or a compound that blocks mast cells exocytosis such as the Rigel's pharmaceuticals Rl 12.
  • Preferred compounds are c-kit inhibitor, more particularly a non-toxic, selective and potent c-kit inhibitor.
  • Such inhibitors can be selected from the group consisting of 2-(3- amino)arylamino-4-aryl-thiazoles, pyrimidine derivatives, pyrrolopyrimidine derivatives, quinazoline derivatives, quinoxaline derivatives, pyrazoles derivatives, bis monocyclic, bicyclic or heterocyclic aryl compounds, vinylene-azaindole derivatives and pyridyl- quinolones derivatives, styryl compounds, styryl-substituted pyridyl compounds, seleoindoles, selenides, tricyclic polyhydroxylic compounds and benzylphosphonic acid compounds.
  • pyrimidine derivatives such as N-phenyl-2-pyrimidine-amine derivatives (US 5,521,184 and WO 99/03854), indolinone derivatives and pyrrol-substituted indolinones (US 5,792,783, EP 934 931, US 5,834,504), US 5,883,116, US 5,883,113, US 5, 886,020, WO 96/40116 and WO 00/38519), as well as bis monocyclic, bicyclic aryl and heteroaryl compounds (EP 584 222, US 5,656,643 and WO 92/20642), quinazoline derivatives (EP 602 851, EP 520 722, US 3,772,295 and US 4,343,940), 4-amino-substituted quinazolines (US 3,470,182), 4Jhienyl-2-(lH)-quinazolones, 6,7-dialkoxyquinazolines (US 3,800,
  • the invention relates to a method for treating type TJ diabetes comprising administering a non toxic, potent and selective c-kit inhibitor is a pyrimidine derivatives, more particularly N-phenyl-2-pyrimidine-amine derivatives of formula I :
  • Rl, R2, R3, R13 to R17 groups have the meanings depicted in EP 564409 Bl, inco ⁇ orated herein in the description.
  • the N-phenyl-2-pyrimidine-amine derivative is selected from the compounds corresponding to formula LT :
  • Rl, R2 and R3 are independently chosen from H, F, CI, Br, I, a C1-C5 alkyl or a cyclic or heterocyclic group, especially a pyridyl group;
  • R4, R5 and R6 are independently chosen from H, F, CI, Br, I, a C1-C5 alkyl, especially a methyl group; and R7 is a phenyl group bearing at least one substituent, which in turn possesses at least one basic site, such as an amino function.
  • R7 is the following group :
  • Rl is a heterocyclic group, especially a pyridyl group
  • R2 and R3 are H
  • R4 is a C1-C3 alkyl, especially a methyl group
  • R5 and R6 are H
  • R7 is a phenyl group bearing at least one substituent, which in turn possesses at least one basic site, such as an amino function, for example the group :
  • the invention relates to a method for treating type IT diabetes comprising the administration of an effective amount of the compound known in the art as CGP57148B : 4-(4-mehylpiperazine-l-ylmethyl)-N-[4-methyl-3-(4-pyridine-3-yl)pyrimidine-2 ylamino)phenyl]-benzamide corresponding to the following formula :
  • the c-kit inhibitor can be selected from :
  • indolinone derivatives more particularly pyrrol-substituted indolinones
  • quinaxolines such as 2-phenyl-quinaxoline derivatives, for example 2-phenyl- 6,7-dimethoxy quinaxoline.
  • the invention contemplated the method mentioned above, wherein said c-kit inhibitor is selected from 2-(3-amino)arylamino-4- aryl-thiazoles such as those chosen from formula III for which the applicant filed US 60/400064 :
  • R 1 is : a) a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; b) an aryl or heteroaryl group optionally substituted by an alkyl or aryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; c) a -CO-NH-R, -CO-R, -CO-OR or a -CO-NRR' group, wherein R and R' are independently chosen from H or an aryl, heteroaryl, alkyl and cycloalkyl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • R 2 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
  • R 3 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
  • R 4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
  • R 5 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
  • R 6 is one of the following:
  • an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
  • a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
  • R 7 is one of the following:
  • an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
  • a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-th ⁇ enyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
  • H a halogen selected from I, F, CI or Br
  • NH2, NO2 or SO2-R wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
  • R is H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality.
  • R is H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; or a a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F and /
  • R is H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or an alkyl, cycloalkyl, aryl or heteroaryl group substituted by a alkyl, cycloalkyl, aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl group optionally substituted with an heteroatom, notably a
  • R is H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; or an alkyl, cycloalkyl, aryl or heteroaryl group substituted by a alkyl, cycloalkyl, aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl group optionally substituted with at
  • R is H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
  • Y is a linear or branched alkyl group containing from 1 to 10 carbon atoms; wherein Z represents an aryl or heteroaryl group, optionally substituted at one or more ring position with any permutation of the following groups: - a halogen such as F, CI, Br, I; - a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a hal
  • Ra and Rb represents a hydrogen, or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality or a cycle; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • Ra and Rb are a hydrogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • Ra and Rb are a hydrogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - an OSO R, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally
  • R »2 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy
  • R 3 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy
  • R 4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy
  • R 5 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy
  • R 6 is one of the following:
  • an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
  • a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
  • H a halogen selected from I, F, CI or Br
  • NH2, NO2 or SO2-R wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
  • R 7 is one of the following:
  • an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
  • a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
  • H an halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
  • the invention is particularly embodied by the compounds of the following formula TV :
  • X is R or NRR' and wherein R and R' are independently chosen from H, an aryl, a heteroaryl, an alkyl , or a cycloalkyl group optionally substituted with at least one heteroatom, such as for example a halogen chosen from F, I, CI and Br and optionally bearing a pendant basic nitrogen functionality; or an aryl, a heteroaryl, an alkyl or a cycloalkyl group substituted with an aryl, a heteroaryl, an alkyl or a cycloalkyl group optionally substituted with at least one heteroatom, such as for example a halogen chosen from F, I, CI and Br and optionally bearing a pendant basic nitrogen functionality,
  • R 2 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy
  • R 3 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy
  • R 4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
  • R 5 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
  • R 6 is one of the following:
  • an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
  • a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy.
  • R6 which in the formula IT is connected to position 4 of the thiazole ring, may instead occupy position 5 of the thiazole ring.
  • the invention is directed to compounds in which X is a substituted alkyl, aryl or heteroaryl group bearing a pendant basic nitrogen functionality represented for example by the structures a to f shown below, wherein the wavy line corresponds to the point of attachment to core structure of formula IV:
  • X (see formula TJ) is preferentially group d.
  • the invention concerns the compounds in which R 2 and R 3 are hydrogen.
  • R 4 is a methyl group and R 5 is H.
  • R 6 is preferentially a 3-pyridyl group (cf. structure g below), or a 4-pyridyl group (cf. structure h below).
  • the wavy line in structure g and h correspond to the point of attachment to the core structure of formula HI or IV.
  • the invention contemplates: 1- A compound of formula TV as depicted above, wherein X is group d and R 6 is a 3-pyridyl group.
  • 2- A compound of formula TV as depicted above, wherein X is group d and R 4 is a methyl group.
  • 3- A compound of formula TIT or TV as depicted above, wherein R 1 is group d and R 2 is H.
  • 4- A compound of formula TH or IV as depicted above, wherein R 1 is group d and R 3 is H.
  • 5- A compound of formula TIT or IV as depicted above, wherein R 1 is group d and R 2 and/or R 3 and or R 5 is H.
  • 6- A compound of formula TIT or IV as depicted above, wherein R 6 is a 3-pyridyl group and R 3 is a methyl group.
  • 7- A compound of formula Til or IV as depicted above, wherein R 6 is a 3-pyridyl group and R 2 is H.
  • 8- A compound of formula TIT or TV as depicted above, wherein R and/or R and/or R 5 is H and R 4 is a methyl group.
  • 9- A compound of formula III or TV as depicted above wherein R 2 and/or R 3 and/or R 5 is H, R 4 is a methyl group and R 6 is a 3-pyridyl group.
  • the invention is particularly embodied by the compounds wherein R2, R3, R5 are hydrogen, corresponding to the following formula rv-i :
  • X is R or NRR' and wherein R and R' are independently chosen from H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with a heteroatom, notably a halogen selected from I
  • an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
  • a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
  • H a halogen selected from I, F, CI or Br
  • NH2, NO2 or SO2-R wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
  • substituent R6 which in the formula TT is connected to position 4 of the thiazole ring, may instead occupy position 5 of the thiazole ring.
  • Ra, Rb are independently chosen from H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing
  • R 4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy
  • R 6 is one of the following: (i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy; (ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy.
  • H a halogen selected from I, F, CI or Br
  • NH2, NO2 or SO2-R wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
  • 012 1 -(4-Fluoro-phenyl)-3-[4-methyl-3-(4-pyridin -3-yl-thiazol-2 -ylamino)-phenyl] -urea
  • 017 l-(2,4-Dimethoxy-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl]-urea
  • 018 l-(2Jodo-phenyl)-l-(N(2Jodo-phenyl)-formamide)-3-[4-methyl-3-(4-pyridin-3-yl- thiazol-2-ylamino)-phenyl]-urea
  • 019 l-(3,5-Dimethyl-isoxazol-4-yl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl]-urea
  • the invention is particularly embodied by the compounds wherein X is a -substituted Aryl group, corresponding to the N-[3-(Thiazol- 2-ylamino)-phenyl]-amide family and the following formula IV-3 :
  • Ra, Rb, Re, Rd, Re are independently chosen from H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with a heteroatom, notably a halogen selected from I,
  • R 6 is one of the following:
  • an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
  • a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
  • H a halogen selected from I, F, CI or Br
  • NH2, NO2 or SO2-R wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
  • the invention is particularly embodied by the compounds wherein X is a -substituted-aryl group, corresponding to the 4-(4- substituted-l-ylmethyl)-N[3-(thiazol-2-ylamino)-phenyl]-benzamide family and the following formula IV-4 :
  • X is a heteroatom, such as O or N
  • Ra, Rb, Rd, Re, Rf, Rg, Rh are independently chosen from H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
  • R and R' are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
  • R is H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R' group wherein R' is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
  • Ra and Rb are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
  • Ra and Rb are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
  • R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • Ra and Rb are a hydrogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - an OSO 2 R, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen)
  • Ra and Rb are a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality;
  • Ra can also be a hydrogen; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a -CO-R or a -CO-NRR' group, wherein R and R' are independently chosen from H, an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
  • Ra, Rb, Rd, Re can also be halogen such as CI, F, Br, I or trifluoromethyl;
  • R 4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
  • R 6 is one of the following:
  • an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
  • a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy; iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
  • substituents such as halogen, an alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy
  • H a halogen selected from I, F, CI
  • the invention is particularly embodied by the compounds wherein X is a -aryl-substituted group, corresponding to the 3-Disubstituted- amino-N[3-(thiazol-2-ylamino)-phenyl]-benzamide family and the following formula
  • Ra, Rb, Re, Re, Rf, Rg are independently chosen from H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
  • R and R' are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
  • R is H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R' group wherein R' is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
  • Ra and Rb are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
  • Ra and Rb are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
  • R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • Ra and Rb are a hydrogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
  • Ra and Rb are a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; Ra can also be a hydrogen; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - or a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl
  • Ra, Rb, Re, Re can also be halogen such as CI, F, Br, I or trifluoromethyl;
  • R 4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
  • R 6 is one of the following:
  • an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
  • a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
  • H a halogen selected from I, F, CI or Br
  • NH2, NO2 or SO2-R wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
  • the invention is particularly embodied by the compounds wherein X is a -OR group, corresponding to the family [3-(Thiazol-2- ylamino)-phenyl]-carbamate and the following formula IV-6
  • R is independently chosen from an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; R 4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
  • R 6 is one of the following:
  • an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
  • a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
  • a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
  • H a halogen selected from I, F, CI or Br
  • NH2, NO2 or SO2-R wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
  • Substituent "L” in formula 10 is a nucleofugal leaving group in nucleophilic substitution reactions (for example, L can be selected from chloro, bromo, iodo, toluenesulfonyloxy, methanesulfonyloxy, trifluoromethanesulfonyloxy, etc., with L being preferentially a bromo group).
  • Group Rl in formula 11a corresponds to group Rl as described in formula m.
  • Group "PG" in formula 1 lc is a suitable protecting group of a type commonly utilized by the person skilled in the art.
  • Formula 12b describes a precursor to compounds of formula III which lack substituent Rl. Therefore, in a second phase of the synthesis, substituent Rl is connected to the free amine group in 12b, leading to the complete structure embodied by formula Til: 12b + "Rl" -> ⁇ T
  • Rl the nature of which is as described on page 3 for the general formula HI, is achieved by the use of standard reactions that are well known to the person skilled in the art, such as alkylation, acylation, sulfonylation, formation of ureas, etc.
  • Formula 12c describes an N-protected variant of compound 12b.
  • Group "PG" in formula 12c represents a protecting group of the type commonly utilized by the person skilled in the art. Therefore, in a second phase of the synthesis, group PG is cleaved to transform compound 12c into compound 12b. Compound 12b is subsequently advanced to structures of formula I as detailed above.
  • Formula 12d describes a nitro analogue of compound 12b.
  • the nitro group of compound 12d is reduced by any of the several methods utilized by the person skilled in the art to produce the corresponding amino group, namely compound 12b.
  • Compound 12b thus obtained is subsequently advanced to structures of formula m as detailed above.
  • aqueous phase was then basified (pH>12) by addition of 2.5N aqueous sodium hydroxyde solution.
  • the crude product was extracted with ethyl acetate (4x30 mL). The combined organic layers were dried over MgSO 4 and concentrated under reduced pressure to afford a slightly yellow oil which became colorless after purification by Kugelrohr distillation (190°C) in 68% yield.
  • Benzoyl chloride (5.64 g, 80 mmol) was added dropwise to a well-stirred solution of ammonium thiocyanate (3.54 g, 88 mmol) in acetone (50 mL). The mixture was refluxed for 15 min, then, the hydrobromide salt of 2-methyl-5-tert-butoxycarbonylamino-aniline (8.4g, 80 mmol) was added slowly portionswise. After lh, the reaction mixture was poured into ice-water (350 mL) and the bright yellow precipitate was isolated by filtration. This crude solid was then refluxed for 45 min in 70 mL of 2.5 N sodium hydroxide solution. The mixture was cooled down and basified with ammonium hydroxide.
  • type TT diabetes as referred herein includes obesity, hypercholesterolemia, hypergycemia, hypertension, endothelial dysfunction, insulin resistance, and vascular remodelling.
  • c-kit inhibitors as mentioned above are inhibitors of activated c-kit.
  • the expression "activated c-kit” means a constitutively activated-mutant c-kit including at least one mutation selected from point mutations, deletions, insertions, but also modifications and alterations of the natural c-kit sequence (SEQ TD N°l). Such mutations, deletions, insertions, modifications and alterations can occur in the transphosphorylase domain, in the juxtamembrane domain as well as in any domain directly or indirectly responsible for c-kit activity.
  • the expression “activated c- kit” also means herein SCF-activated c-kit.
  • Preferred and optimal SCF concentrations ⁇ c for activating c-kit are comprised between 5.10 " M and 5.10 " M, preferably around 2.10 " M.
  • the activated-mutant c-kit in step a) has at least one mutation proximal to Y823, more particularly between amino acids 800 to 850 of SEQ TD No 1 involved in c-kit autophosphorylation, notably the D816V, D816Y, D816F and D820G mutants.
  • the activated-mutant c-kit in step a) has a deletion in the juxtamembrane domain of c-kit. Such a deletion is for example between codon 573 and 579 called c-kit d(573-579).
  • the point mutation V559G proximal to the juxtamembrane domain c-kit is also of interest.
  • the invention contemplates a method for treating type TT diabetes as defined above comprising administering to a human in need of such treatment a compound that is a selective, potent and non toxic inhibitor of activated c-kit obtainable by a screening method which comprises : a) bringing into contact (i) activated c-kit and (ii) at least one compound to be tested; under conditions allowing the components (i) and (ii) to form a complex, b) selecting compounds that inhibit activated c-kit, c) testing and selecting a subset of compounds identified in step b), which are unable to promote death of IL-3 dependent cells cultured in presence of TL-3.
  • This screening method can further comprise the step consisting of testing and selecting a subset of compounds identified in step b) that are inhibitors of mutant activated c-kit (for example in the transphosphorylase domain), which are also capable of inhibiting SCF- activated c-kit wild.
  • activated c-kit is SCF-activated c-kit wild.
  • a best mode for practicing this method consists of testing putative inhibitors at a concentration above 10 ⁇ M in step a). Relevant concentrations are for example 10, 15, 20, 25, 30, 35 or 40 ⁇ M.
  • TL-3 is preferably present in the culture media of TL-3 dependent cells at a concentration comprised between 0.5 and 10 ng/ml, preferably between 1 to 5 ng/ml.
  • TL-3 dependent cells include but are not limited to :
  • human mast cell lines naturally expressing and depending on c-kit for growth and survival.
  • human mast cell lines can be established using the following procedures : normal human mast cells can be infected by retroviral vectors containing sequences coding for a mutant c-kit comprising the c-kit signal peptide and a TAG sequence allowing to differentiate mutant c-kits from c-kit wild expressed in hematopoetic cells by means of antibodies.
  • CD34+ cells are then cultured at 37°C in 5 % CO 2 atmosphere at a concentration of 10 5 cells per ml in the medium MCCM ( ⁇ -MEM supplemented with L-glutamine, penicillin, streptomycin,- 5 10 "5 M ⁇ -mercaptoethanol, 20 % veal foetal serum, 1 % bovine albumin serum and 100 ng/ml recombinant human SCF.
  • the medium is changed every 5 to 7 days.
  • the percentage of mast cells present in the culture is assessed each week, using May-Grunwal Giemsa or Toluidine blue coloration.
  • Anti-tryptase antibodies can also be used to detect mast cells in culture.
  • c-kit After 10 weeks of culture, a pure cellular population of mast cells (> 98 %) is obtained. It is possible using standard procedures to prepare vectors expressing c-kit for transfecting the cell lines established as mentioned above.
  • the cDNA of human c-kit has been described in Yarden et al., (1987) EMBO J.6 (11), 3341-3351.
  • the coding part of c-kit (3000 bp) can be amplified by PCR and cloned, using the following oligonucleotides : 5 ⁇ AGAAGAGATGGTACCTCGAGGGGTGACCC3' (SEQ TD No2) sens 5'CTGCTTCGCGGCCGCGTTAACTCTTCTCAACCA3' (SEQ TD No3) antisens
  • the PCR products, digested with Notl and Xhol, has been inserted using T4 ligase in the pFlag-CMV vector (SIGMA), which vector is digested with Notl and Xhol and dephosphorylated using OP (Biolabs).
  • the pFlag-CMV-c-kit is used to transform bacterial clone XLl-blue.
  • the transformation of clones is verified using the following primers : - 5 ⁇ GCTCGTTTAGTGAACCGTC3' (SEQ TD No4) sens, - 5'GTCAGACAAAATGATGCAAC3' (SEQ TD No5) antisens.
  • the vector Migr-1 (ABC) can be used as a basis for constructing retroviral vectors used for transfecting mature mast cells.
  • This vector is advantageous because it contains the sequence coding for GFP at the 3' and of an IRES.
  • TL-3 dependent cell lines that can be used include but are not limited to: - BaF3 mouse cells expressing wild-type or mutated form of c-kit (in the juxtamembrane and in the catalytic sites) are described in Kitayama et al, (1996), Blood 88, 995-1004 and Tsujimura et al, (1999), Blood 93, 1319-1329. - IC-2 mouse cells expressing either c-kit or c-k_P l are presented in Piao et al, (1996), Proc. Natl. Acad. Sci. USA 93, 14665-14669.
  • TL-3 independent cell lines are :
  • - HMC-1 a factor-independent cell line derived from a patient with mast cell leukemia, expresses a juxtamembrane mutant c-kit polypeptide that has constitutive kinase activity (Furitsu T et al, J Clin Invest. 1993;92:1736-1744 ; Butterfield et al, Establishment of an immature mast cell line from a patient with mast cell leukemia. Leuk Res. 1988;12:345- 355 and Nagata et al, Proc Natl Acad Sci U S A. 1995;92:10560-10564).
  • - P815 cell line mastocytoma naturally expressing c-kit mutation at the 814 position has been described in Tsujimura et al, (1994), Blood 83, 2619-2626.
  • component (ii) inhibits activated c-kit can be measured in vitro or in vivo.
  • cell lines expressing an activated-mutant c-kit which has at least one mutation proximal to Y823, more particularly between amino acids 800 to 850 of SEQ TD No 1 involved in c-kit autophosphorylation, notably the D816V,
  • D816Y, D816F and D820G mutants are preferred.
  • Example of cell lines expressing an activated-mutant c-kit are as mentioned above.
  • the method further comprises the step consisting of testing and selecting compounds capable of inhibiting c-kit wild at concentration below
  • compounds are identified and selected according to the method described above are potent, selective and non-toxic c-kit wild inhibitors.
  • the screening method as defined above can be practiced in vitro.
  • the inhibition of mutant-activated c-kit and/or c-kit wild can be measured using standard biochemical techniques such as immunoprecipitation and western blot.
  • the amount of c-kit phosphorylation is measured.
  • the invention contemplates a method for treating type TT diabetes as depicted above wherein the screening comprises : a) performing a proliferation assay with cells expressing a mutant c-kit (for example in the transphosphorylase domain), which mutant is a permanent activated c-kit, with a plurality of test compounds to identify a subset of candidate compounds targeting activated c-kit, each having an IC50 ⁇ 10 ⁇ M, by measuring the extent of cell death, b) performing a proliferation assay with cells expressing c-kit wild said subset of candidate compounds identified in step (a), said cells being TL-3 dependent cells cultured in presence of TL-3, to identify a subset of candidate compounds targeting specifically c- kit, c) performing a proliferation assay with cells expressing c-kit, with the subset of compounds identified in step b) and selecting a subset of candidate compounds targeting c-kit wild, each having an IC50 ⁇ 10 ⁇ M, preferably an IC50 ⁇ 1
  • the extent of cell death can be measured by 3H thymidine incorporation, the trypan blue exclusion method or flow cytometry with propidium iodide. These are common techniques routinely practiced in the art.
  • the method according to the invention includes preventing, delaying the onset and/or treating type II diabetes and associated damages in humans.
  • any compound capable of depleting mast cells can be used.
  • Such compounds can belong to, as explicated above, tyrosine kinase inhibitors, such as c-kit inhibitors, but are not limited to any particular family so long as said compound shows capabilities to deplete mast cells.
  • Depletion of mast cells can be evaluated using for example one of the mast cell lines depicted above using routine procedure. Best compounds are compounds exhibiting the greatest selectivity.
  • Control cell lines include other hematopoeitic cells that are not mast cells or related cells or cell lines. These control cell lines include SCF independent expanded human CD34+ normal cells.
  • control cells also include but are not limited to the human T lymphocyte Jurkat cell line (ATCC N° TIB- 152 and mutant cell lines derived thereof), the human B lymphocyte Daudi or Raji cell line (ATCC N° CCL-213 and CCL-86 respectively), the human monocytic U 937 cell line (ATCC N° CRL-1593.2) and the human HL-60 cell line (ATCC N° CCL-240) and mutant cell lines derived thereof CRL- 2258 and CRL-2392).
  • human T lymphocyte Jurkat cell line ATCC N° TIB- 152 and mutant cell lines derived thereof
  • the human B lymphocyte Daudi or Raji cell line ATCC N° CCL-213 and CCL-86 respectively
  • the human monocytic U 937 cell line ATCC N° CRL-1593.2
  • the human HL-60 cell line ATCC N° CCL-240
  • Such compounds can be selected with a method for identifying compounds capable of depleting mast cells, said compound being non-toxic for cell types other than mast cells, comprising the step consisting of : a) culturing mast cells in vitro in a culture medium suitable for mast cells, b) adding to said culture medium at least one compound to be tested and incubating said cells for a prolonged period of time, c) selecting compounds that promote mast cells death, d) identifying a subset of compounds selected in step c) that are unable to promote death of cells selected from the above mentioned control cell lines.
  • the invention embraces the use of the compounds defined above to manufacture a medicament for treating type II diabetes including obesity, hypercholesterolemia, hypergycemia, hypertension, endothelial dysfunction, insulin resistance, and vascular remodelling. More particularly, the above compounds are useful for preventing the onset or development of type IT diabetes in obese persons.
  • compositions utilized in this invention may be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra- arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, sublingual, or rectal means.
  • these pharmaceutical compositions may contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.).
  • compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration.
  • Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • the invention relates to a pharmaceutical composition intended for oral administration.
  • compositions suitable for use in the invention include compositions wherein compounds for depleting mast cells, such as c-kit inhibitors, or compounds inhibiting mast cells degranulation are contained in an effective amount to achieve the intended purpose.
  • a therapeutically effective dose refers to that amount of active ingredient, which ameliorates the symptoms or condition.
  • Therapeutic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population).
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50.
  • Pharmaceutical compositions which exhibit large therapeutic indices are preferred.
  • Example 1 Effect of different c-kit inhibitors on serum glucose, insulin, triglycerides, cholesterol and non esterified fatty acids levels in db/db mice
  • the objective of this study is to assess the effects of different c-kit inhibitors on serum glucose, insulin, triglycerides, cholesterol and non esterified fatty acids levels in male db/db mice dosed orally, once-a-day, for 5 days.
  • Substance tested code substances N°l and N°2 Reference substance Code : rosiglitazone 10 mg/kg Source : Sequoia Research Products Ltd, UK
  • the vehicle will be defined by the Sponsor but, if no indication is supplied, a 3% Arabic gum aqueous solution (w/v) will be used.
  • Group 1 vehicle Group 2 : test substance N°l, dose 1, route of administration
  • Group 5 test substance N°2, dose 2, route of administration
  • Group 6 rosiglitazone, 10 mg/kg, route of administration
  • the doses will be expressed in terms of free active substance.
  • test and reference substances will be extemporaneously prepared as instructed.
  • test and reference substances and the vehicle will be administered in a volume of 5 ml/kg adjusted according to individual body weight values.
  • mice will be weighed and blood samples will be collected through the retro-orbital plexus under isoflurane anesthesia. Blood samples will be kept at room temperature for 5 to 10 min to form a spontaneous clot, then put in ice until they are centrifuged at 3500 x g for 10-15 min at 4 °C. An aliquot of serum will be used for measuring glucose levels.
  • Six groups of 5 mice will be formed with respect to homogeneous glycemia values by using a randomization table. Animal showing glycemia below 20 mM will be excluded from the study.
  • mice From Tl to T5, the mice will be weighed and dosed once daily for 5 consecutive days at constant time.
  • mice will be euthanized by cervical dislocation.
  • Serum glucose and triglycerides levels will be determined using the Synchron CX4 analyzer. Serum non esterified fatty acids levels will be measured manually using a colorimetric method, and insulin levels determined by ELISA.
  • a % of effect will be calculated according to following formula ((vehicle group - test group)/ vehicle group)* 100 Statistical analysis will consist in a one-way analysis of variance followed by multiple comparisons versus the vehicle group (Dunnett's test). In case the equal variance test fails, a Kruskall-Wallis one-way analysis of variance on ranks will be proposed. A difference will be considered significant for p ⁇ 0.05.
  • Example 2 in vitro TK inhibition assays • Procedure Experiments were performed using purified intracellular domain of c-kit expressed in baculovirus. Estimation of the kinase activity was assessed by the phosphorylation of tyrosine containing target peptide estimated by established ELISA assay.
  • Table 2 shows the potent inhibitory action of the catalytic activity of c-kit with an IC50 ⁇ 10 ⁇ M. Further experiments (not shown) indicates that at least one compound acts as perfect competitive inhibitors of ATP.
  • Table 2 Compounds In vitro Inhibition assay results c-kit IC50 ( ⁇ M) 066; 074; 078; 084; 012; 016; 073; 021; 088; ⁇ 10 ⁇ M 023; 025; 047; 048; 055; 049; 026; 087; 075; 089; 051 082; 090 ; 060; 085; 052; 053, 096
  • Ba/F3 murine kit and human kit are derived from the murine TL-3 dependent Ba/F3 proB lymphoid cells.
  • the FMA3 and P815 cell lines are mastocytoma cells expressing endogenous mutated forms of Kit, i.e., frame deletion in the murine juxtamembrane coding region of the receptor-codons 573 to 579.
  • the human leukaemic MC line HMC-1 expresses mutations JM-V560G; Immunoprecipitation assays and western blotting analysis
  • 5.106 Ba/F3 cells and Ba/F3-derived cells with various c-kit mutations were lysed and immunoprecipitated as described (Beslu et ah, 1996), excepted that cells were stimulated with 250 ng / ml of rmKL.
  • Cell lysates were immunoprecipitated with a rabbit immunserum anti murine KIT, directed against the KIT cytoplasmic domain (Rottapel et ah, 1991).
  • Western blot was hybridized either with the 4G10 anti- phosphotyrosine antibody (UBI) or with the rabbit immunserum anti -murine KIT or with different antibodies (described in antibodies paragraph).
  • the membrane was then incubated either with HRP-conjugated goat anti mouse IgG antibody or with HRP- conjugated goat anti rabbit IgG antibody (Immunotech), Proteins of interest were then visualized by incubation with ECL reagent (Amersham).
  • Target IC50 Compounds c-Kit WT IC50 ⁇ 10 ⁇ M 002; 005; 006; 007; 008; 009; 010; 012; 017; 019; 020; 021; 023; 024; 025; 026; 028; 029; 030; 032; 042; 043; 045; 047; 048; 049; 050; 051 052053; 054; 055; 056 057; 059; 060; 061; 062; 063 064065; 066; 067; 072 073; 074; 075; 077; 078; 079 080081; 082; 083; 084 085; 086; 087; 088; 089; 090 092 093; 094; 095; 096 097; 106; 105; 104; 103;128 129 130; 131; 117;

Landscapes

  • Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Diabetes (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Thiazole And Isothizaole Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to a method for treating type II diabetes, comprising administering a compound capable of depleting mast cells to a human in need of such treatment. Such compounds can be chosen from non-toxic, selective and potent c-kit inhibitors.

Description

Use of c-kit inhibitors for treating type II diabetes
The present invention relates to a method for treating type II diabetes, obesity and related disorders comprising administering a compound capable of depleting mast cells or a compound inhibiting mast cells degranulation, to a human in need of such treatment. Such compounds can be chosen from c-kit inhibitors and more particularly non-toxic, selective and potent c-kit inhibitors. Preferably, said inhibitor is unable to promote death of IL-3 dependent cells cultured in presence of IL-3.
Non-insulin-dependent diabetes mellitus (NTDDM), also known as type IT diabetes, is defined as a chronic disease appearing when the insulin turns out to be inefficient in promoting glucose uptake by cells, which results in increased levels of glucose in the blood. This disease affects about 100 million people world-wide, 75% of which are obese at the time of diagnosis.
Diminution in the ability of the cells to respond adequately to insulin is often referred as insulin resistance. Excessive weight and lack of physical activity are regarded as being responsible for inducing insulin resistance. Over many years, the failure of the glucose uptake regulation leads to the development of Type IT diabetes and the blood glucose level needs to be regulated with medicinal products. Ultimately, unregulated blood glucose level is responsible for blood vessels, kidney and eye damages, as well as cardiovascular diseases. This tissue damages contribute to mortality in diabetics.
Hypoglycemic agents such as sulfonylureas work by triggering the pancreas to make more insulin, which lower blood glucose. The side effects of sulfonylureas include hypoglycemia, renal and hepatic disease, gastrointestinal disturbances, increased cardiovascular mortality, dermatological reactions, drowsiness and headache. Biguanides lower blood glucose levels by reducing intestinal glucose absorption and hepatic glucose, but not by stimulating insulin secretion. The major side effects of biguanidine are lactic acidosis and increased cardiovascular mortality. Alpha-glucosidase inhibitors decrease the absorption of carbohydrates from the digestive tract, thereby lowering the after-meal glucose level, but gastrointestinal side effects and hypoglycemia are observed. Thiazolidinediones, such as rosiglitazone are PPARgamma agonists and increase the cell's sensitivity to insulin. However, they may be responsible for water retention, liver diseases, cardiovascular diseases, red blood cell abnormalities, and headache.
Because treatment of Type TJ diabetes requires long term administration of compounds lowering blood glucose level, there is still a great need for improved and safer methods.
In connection with the present invention, we have unexpectedly discovered that c-kit inhibitors lower the level of glucose, cholesterol, triglycerides and non esterified fatty acids in blood.
In addition, these inhibitors do not affect significantly the level of insulin contrary to compounds of the thiazolidinedione family. This observation is surprising and we can only speculate at this time of the mechanism of action of c-kit inhibitors. We know that c-kit is of crucial importance for activation of mast cells. Following mast cells activation, released granules liberate various factors which could directly or indirectly participate in the regulation of different metabolites uptake and processing by the cells. Among such factors, we can cite a cocktail of different proteases, lipid-derived mediators (prostaglandins, thromboxanes and leucotrienes) and various cytokines (IL-1, IL-2, IL-3, IL-4, IL-5, E.-6, IL-8, TNF-α, GM- CSF, MTP-la, MLP-lb, MJ -2 and TFN-γ). In Lyon CJ, et al, Proc Nutr Soc 2001 Aug; 60(3): 329-39 is it mentioned that adipose tissue is a dynamic endocrine organ that secretes a number of factors that are increasingly recognized to contribute to systemic and vascular inflammation.
The major secretory compartment of adipose tissue consists of adipocytes, fibroblasts, and mast cells. These cells, using endocrine, paracrine and autocrine pathways, secrete multiple bioactive molecules, conceptualized as "adipokines".
Here, based on our observation that c-kit inhibitors works in lowering notably blood glucose, we postulate that mast cells regulate, directly or indirectly, a number of the processes that contribute to the development of atherosclerosis, including hypercholesterolemia, hypergycemia, hypertension, endothelial dysfunction, insulin resistance, and vascular remodeling. But, as this point, other mechanisms may not be ruled out.
A new route for treating type H diabetes, obesity and related disorders is provided, which consists of administering c-kit inhibitors to patients.
Description
The present invention relates to a method for treating type IT diabetes, obesity and related disorders comprising administering a compound capable of depleting mast cells or blocking mast cells degranulation to a human in need of such treatment.
Said method for treating type II diabetes can comprise administering a c-kit inhibitor to a human in need of such treatment
Alternatively, it may also consist of administering an antihistamine compound or a compound that blocks mast cells exocytosis such as the Rigel's pharmaceuticals Rl 12.
Preferred compounds are c-kit inhibitor, more particularly a non-toxic, selective and potent c-kit inhibitor. Such inhibitors can be selected from the group consisting of 2-(3- amino)arylamino-4-aryl-thiazoles, pyrimidine derivatives, pyrrolopyrimidine derivatives, quinazoline derivatives, quinoxaline derivatives, pyrazoles derivatives, bis monocyclic, bicyclic or heterocyclic aryl compounds, vinylene-azaindole derivatives and pyridyl- quinolones derivatives, styryl compounds, styryl-substituted pyridyl compounds, seleoindoles, selenides, tricyclic polyhydroxylic compounds and benzylphosphonic acid compounds.
Among preferred compounds, it is of interest to focus on pyrimidine derivatives such as N-phenyl-2-pyrimidine-amine derivatives (US 5,521,184 and WO 99/03854), indolinone derivatives and pyrrol-substituted indolinones (US 5,792,783, EP 934 931, US 5,834,504), US 5,883,116, US 5,883,113, US 5, 886,020, WO 96/40116 and WO 00/38519), as well as bis monocyclic, bicyclic aryl and heteroaryl compounds (EP 584 222, US 5,656,643 and WO 92/20642), quinazoline derivatives (EP 602 851, EP 520 722, US 3,772,295 and US 4,343,940), 4-amino-substituted quinazolines (US 3,470,182), 4Jhienyl-2-(lH)-quinazolones, 6,7-dialkoxyquinazolines (US 3,800,039), aryl and heteroaryl quinazoline (US 5,721,237, US 5,714,493, US 5,710,158 and WO 95/15758), 4-anilinoquinazoline compounds (US 4,464,375), and 4-thienyl-2-(lH)- quinazolones (US 3,551,427).
So, preferably, the invention relates to a method for treating type TJ diabetes comprising administering a non toxic, potent and selective c-kit inhibitor is a pyrimidine derivatives, more particularly N-phenyl-2-pyrimidine-amine derivatives of formula I :
Figure imgf000006_0001
wherein the Rl, R2, R3, R13 to R17 groups have the meanings depicted in EP 564409 Bl, incoφorated herein in the description.
Preferably, the N-phenyl-2-pyrimidine-amine derivative is selected from the compounds corresponding to formula LT :
Figure imgf000006_0002
Wherein Rl, R2 and R3 are independently chosen from H, F, CI, Br, I, a C1-C5 alkyl or a cyclic or heterocyclic group, especially a pyridyl group;
R4, R5 and R6 are independently chosen from H, F, CI, Br, I, a C1-C5 alkyl, especially a methyl group; and R7 is a phenyl group bearing at least one substituent, which in turn possesses at least one basic site, such as an amino function. Preferably, R7 is the following group :
Figure imgf000007_0001
Among these compounds, the preferred are defined as follows : Rl is a heterocyclic group, especially a pyridyl group, R2 and R3 are H,
R4 is a C1-C3 alkyl, especially a methyl group, R5 and R6 are H, and R7 is a phenyl group bearing at least one substituent, which in turn possesses at least one basic site, such as an amino function, for example the group :
Figure imgf000007_0002
Therefore, in a preferred embodiment, the invention relates to a method for treating type IT diabetes comprising the administration of an effective amount of the compound known in the art as CGP57148B : 4-(4-mehylpiperazine-l-ylmethyl)-N-[4-methyl-3-(4-pyridine-3-yl)pyrimidine-2 ylamino)phenyl]-benzamide corresponding to the following formula :
Figure imgf000008_0001
The preparation of this compound is described in example 21 of EP 564409 and the β- form, which is particularly useful is described in WO 99/03854.
Alternatively, the c-kit inhibitor can be selected from :
- indolinone derivatives, more particularly pyrrol-substituted indolinones,
- monocyclic, bicyclic aryl and heteroaryl compounds, quinazoline derivatives,
- and quinaxolines, such as 2-phenyl-quinaxoline derivatives, for example 2-phenyl- 6,7-dimethoxy quinaxoline.
In a preferred another preferred embodiment, the invention contemplated the method mentioned above, wherein said c-kit inhibitor is selected from 2-(3-amino)arylamino-4- aryl-thiazoles such as those chosen from formula III for which the applicant filed US 60/400064 :
Figure imgf000008_0002
FORMULA ET! and wherein R1 is : a) a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; b) an aryl or heteroaryl group optionally substituted by an alkyl or aryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; c) a -CO-NH-R, -CO-R, -CO-OR or a -CO-NRR' group, wherein R and R' are independently chosen from H or an aryl, heteroaryl, alkyl and cycloalkyl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
R2 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R3 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R5 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R6 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy; (ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
(iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
1 to 10 carbon atoms, trifluoromethyl, and alkoxy, iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
Br and F, and / or bearing a pendant basic nitrogen functionality; and R7 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
(ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
(iii) a five-membered ring aromatic heterocyclic group such as for example 2-thϊenyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
1 to 10 carbon atoms, trifluoromethyl, and alkoxy. iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
Br and F, and / or bearing a pendant basic nitrogen functionality. In another preferred embodiment, when R1 has the meaning depicted in c) above, the invention is directed to compounds of the following formula:
Figure imgf000011_0001
wherein R is H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality.
Among the particular compounds in which Rl has the meaning as depicted in c) above, the invention is directed to amide-aniline compounds of the following formula:
Figure imgf000011_0002
wherein R is H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; or a a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; or a -CO-R or a -CO-NRR' group, wherein R and R' are independently chosen from H, an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
Among the particular compounds in which Rl has the meaning as depicted in c) above, the invention is directed to amide-benzylamine compounds of the following formula:
Figure imgf000012_0001
wherein R is H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or an alkyl, cycloalkyl, aryl or heteroaryl group substituted by a alkyl, cycloalkyl, aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a -CO-R or a -CO-NRR' group, wherein R and R' are independently chosen from H or an aryl heteroaryl, alkyl and cycloalkyl group optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality.
Among the particular compounds in which Rl has the meaning as depicted in c) above, the invention is directed to amide-phenol compounds of the following formula:
Figure imgf000013_0001
wherein R is H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; or an alkyl, cycloalkyl, aryl or heteroaryl group substituted by a alkyl, cycloalkyl, aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; or a -CO-R or a -CO-NRR' group, wherein R and R' are independently chosen from H or an aryl, heteroaryl, alkyl and cycloalkyl group optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality.
Among the particular compounds in which Rl has the meaning as depicted in c) above, the invention is directed to urea compounds of the following formula:
Figure imgf000014_0001
wherein R is H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality. Among the particular compounds in which Rl has the meaning as depicted in a) and b) above, the invention is directed to N-Aminoalkyl-N-thiazol-2-yl-benzene-l,3-diamine compounds of the following formula:
Figure imgf000015_0001
wherein Y is a linear or branched alkyl group containing from 1 to 10 carbon atoms; wherein Z represents an aryl or heteroaryl group, optionally substituted at one or more ring position with any permutation of the following groups: - a halogen such as F, CI, Br, I; - a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - an O-R, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- an NRaRb, where Ra and Rb represents a hydrogen, or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality or a cycle; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- a COOR, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- a CONRaRb, where Ra and Rb are a hydrogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- an NHCOR, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- an NHCOOR, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- an NHCONRaRb, where Ra and Rb are a hydrogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - an OSO R, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - an NRaOSO2Rb, where Ra and Rb are a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; Ra can also be a hydrogen; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
R »2 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy; R3 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy; R5 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R6 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
(ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy; (iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
1 to 10 carbon atoms, trifluoromethyl, and alkoxy. iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
Br and F, and / or bearing a pendant basic nitrogen functionality; and R7 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
(ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy; (iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
1 to 10 carbon atoms, trifluoromethyl, and alkoxy. iv) H, an halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
An example of preferred compounds of the above formula is depicted below:
001 : 4-{[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenylamino]-methyl}-benzoic acid methyl ester
Figure imgf000020_0001
Among the compounds of formula I, the invention is particularly embodied by the compounds of the following formula TV :
Figure imgf000020_0002
FORMULA IV
wherein X is R or NRR' and wherein R and R' are independently chosen from H, an aryl, a heteroaryl, an alkyl , or a cycloalkyl group optionally substituted with at least one heteroatom, such as for example a halogen chosen from F, I, CI and Br and optionally bearing a pendant basic nitrogen functionality; or an aryl, a heteroaryl, an alkyl or a cycloalkyl group substituted with an aryl, a heteroaryl, an alkyl or a cycloalkyl group optionally substituted with at least one heteroatom, such as for example a halogen chosen from F, I, CI and Br and optionally bearing a pendant basic nitrogen functionality,
R2 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy; R3 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R5 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy; R6 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy; (ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
(iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy. iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality. In another alternative, substituent R6, which in the formula IT is connected to position 4 of the thiazole ring, may instead occupy position 5 of the thiazole ring.
Among the preferred compounds corresponding formula IN, the invention is directed to compounds in which X is a substituted alkyl, aryl or heteroaryl group bearing a pendant basic nitrogen functionality represented for example by the structures a to f shown below, wherein the wavy line corresponds to the point of attachment to core structure of formula IV:
Figure imgf000022_0001
Among group a to f, X (see formula TJ) is preferentially group d.
Furthermore, among the preferred compounds of formula III or IV, the invention concerns the compounds in which R2 and R3 are hydrogen. Preferentially, R4 is a methyl group and R5 is H. In addition, R6 is preferentially a 3-pyridyl group (cf. structure g below), or a 4-pyridyl group (cf. structure h below). The wavy line in structure g and h correspond to the point of attachment to the core structure of formula HI or IV.
Figure imgf000023_0001
g
Thus, the invention contemplates: 1- A compound of formula TV as depicted above, wherein X is group d and R6 is a 3-pyridyl group. 2- A compound of formula TV as depicted above, wherein X is group d and R4 is a methyl group. 3- A compound of formula TIT or TV as depicted above, wherein R1 is group d and R2 is H. 4- A compound of formula TH or IV as depicted above, wherein R1 is group d and R3 is H. 5- A compound of formula TIT or IV as depicted above, wherein R1 is group d and R2 and/or R3 and or R5 is H. 6- A compound of formula TIT or IV as depicted above, wherein R6 is a 3-pyridyl group and R3 is a methyl group. 7- A compound of formula Til or IV as depicted above, wherein R6 is a 3-pyridyl group and R2 is H. 8- A compound of formula TIT or TV as depicted above, wherein R and/or R and/or R5 is H and R4 is a methyl group. 9- A compound of formula III or TV as depicted above wherein R2 and/or R3 and/or R5 is H, R4 is a methyl group and R6 is a 3-pyridyl group.
Among the compounds of formula TV, the invention is particularly embodied by the compounds wherein R2, R3, R5 are hydrogen, corresponding to the following formula rv-i :
FORMULA IV-1
Figure imgf000024_0001
wherein X is R or NRR' and wherein R and R' are independently chosen from H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a -CO-R or a -CO-NRR' group, wherein R and R' are independently chosen from H, an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality. R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy; R is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy; (ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
(iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
1 to 10 carbon atoms, trifluoromethyl, and alkoxy. iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
Br and F, and / or bearing a pendant basic nitrogen functionality.
In another alternative, substituent R6, which in the formula TT is connected to position 4 of the thiazole ring, may instead occupy position 5 of the thiazole ring.
Examples : 002 : 2-(2-methyl-5-amino)phenyl-4-(3-pyridyl)-thiazole
Figure imgf000025_0001
003 : 4-(4-Methyl-piperazin-l-ylmethyl)-N-[3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl]-benzamide
Figure imgf000025_0002
004 : N-[4-Methyl-3-(4-phenyl-thiazol-2-ylamino)-phenyl]-4-(4-methyl-piperazin-l- ylmethyl)-benzamide
Figure imgf000026_0001
005 : N-[3-([2,4']Bithiazolyl-2'-ylamino)-4-methyl-phenyl]-4-(4-methyl-piperazin-l- ylmethyl)-benzamide
Figure imgf000026_0002
006 : 4-(4-Methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyrazin-2-yl-thiazol-2- ylamino)-phenyl]-benzamide
Figure imgf000026_0003
007 : 2-[5-(3-Iodo-benzoylamino)-2-methyl-phenylamino] -thiazole-4-carboxylic acid ethyl ester
Figure imgf000027_0001
008: 2-{2-Methyl-5-[4-(4-methyl-piperazin-l-ylmethyl)-benzoylamino]-phenylamino}- thiazole-4-carboxylic acid ethyl ester
Figure imgf000027_0002
Etqc
027 : 2-(2-chloro-5-amino)phenyl-4-(3-pyridyl)-thiazole
Figure imgf000027_0003
128: 3-Bromo-N-{3-[4-(4-chloro-phenyl)-5-methyl-thiazol-2-ylamino]-4-methyl- phenyl } -benzamide
Figure imgf000027_0004
129: {3-[4-(4-Chloro-phenyl)-5-methyl-thiazol-2-ylamino]-4-methyl-phenyl}-carbamic acid isobutyl ester
Figure imgf000028_0001
130: 2-[5-(3-Bromo-benzoylamino)-2-methyl-phenylamino]-5-(4-chloro-phenyl)- thiazole-4-carboxylic acid ethyl ester
Figure imgf000028_0002
131: 2-[5-(3-Bromo-benzoylamino)-2-methyl-phenylamino]-5-(4-chloro-phenyl)- thiazole-4-carboxylic acid (2-dimethylamino-ethyl)-amide
Figure imgf000028_0003
110: N-{3-[4-(4-Methoxy-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- piperazin-1 ylmethyl)-benzamide
Figure imgf000029_0001
116: 4-(4-Methyl-piperazin-l-ylmethyl)-N-{4-methyl-3-[4-(3-trifluoromethyl-phenyl)- thiazol-2-ylamino]-phenyl}-benzamide
Figure imgf000029_0002
117 : N-{4-Methyl-3-[4-(3-nitro-phenyl)-thiazol-2-ylamino]-phenyl}-4-(4-methyl- piperazin-l-ylmethyl)-benzamide
Figure imgf000029_0003
124 : N-{3-[4-(2,5-DimethyI-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- piperazin-l-ylmethyl)-benzamide
Figure imgf000029_0004
108: N-{3-[4-(4-Chloro-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- piperazin-l-ylmethyl)-benzamide
Figure imgf000030_0001
113: N-{3-[4-(3-Methoxy-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- piperazin-l-ylmethyl)-benzamide
Figure imgf000030_0002
063: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-isonicotinamide
Figure imgf000030_0003
064: 2,6-Dichloro-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- isonicotinamide
Figure imgf000031_0001
091: 3-Phenyl-propynoic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- amide
Figure imgf000031_0002
092: Cyclohexanecarboxylic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)- phenyTJ-amide
Figure imgf000031_0003
093: 5-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenylcarbamoyl]-pentanoic acid ethyl ester
Figure imgf000031_0004
094: 1-Methyl-cyclohexanecarboxylic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylmethyl)-phenyl] -amide
Figure imgf000032_0001
095: 4-tert-Butyl-cyclohexanecarboxylic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl] -amide
Figure imgf000032_0002
096: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-morpholin-4-yl- butyramide
Figure imgf000032_0003
beige powder mp : 116-120°C
1H RMN (DMSO-d6) δ = 1.80-2.00 (m, 2H) ; 2.29 (s, 3H) ; 2.30-2.45 (m, 6H) ; 3.55- 3.65 (m, 6H) ; 7J5-7.25 (m, 2H) ; 7.46-7.50 (m, 2H) ; 7.52 (s, IH) ; 8.35 (d, j = 6.2 Hz, IH) ; 8.55 (dd, j = 1.5 Hz, J = 4.7 Hz, 2H) ; 9.22 (s, IH) ; 9.45 (s, IH) ; 9.93 (s, IH) Among the compounds of formula TV, the invention is particularly embodied by the compounds wherein X is a urea group, a -CO-NRR' group, corresponding to the [3- (thiazol-2-ylamino)-phenyTJ-urea family and the following formula IN-2 :
FORMULA TN-2
Figure imgf000033_0001
wherein Ra, Rb are independently chosen from H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a -CO-R or a -CO- RR' group, wherein R and R' are independently chosen from H, an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably selected from I, CI, Br and F, or bearing a pendant basic nitrogen functionality. R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy; R6 is one of the following: (i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy; (ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
(iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy. iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
Examples
009: l-(4-Methoxy-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- urea
Figure imgf000034_0001
010: l-(4-Bromo-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-urea
Figure imgf000035_0001
Oil: l-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-(4-trifluoromethyl- phenyl)-urea
Figure imgf000035_0002
012: 1 -(4-Fluoro-phenyl)-3-[4-methyl-3-(4-pyridin -3-yl-thiazol-2 -ylamino)-phenyl] -urea
Figure imgf000035_0003
013: l-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-(3,4,5-trimethoxy- phenyl)-urea
Figure imgf000036_0001
014: 4-{3-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-ureido}-benzoic acid ethyl ester
Figure imgf000036_0002
015: 1- [4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-thiophen-2-yl-urea
Figure imgf000036_0003
016: l-Cyclohexyl-l-(NCyclohexyl-formamide)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol- 2-ylamino)-phenyl]-urea
Figure imgf000037_0001
017: l-(2,4-Dimethoxy-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl]-urea
Figure imgf000037_0002
018: l-(2Jodo-phenyl)-l-(N(2Jodo-phenyl)-formamide)-3-[4-methyl-3-(4-pyridin-3-yl- thiazol-2-ylamino)-phenyl]-urea
Figure imgf000037_0003
019: l-(3,5-Dimethyl-isoxazol-4-yl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl]-urea
Figure imgf000038_0001
020: l-(2-Iodo-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-urea
Figure imgf000038_0002
021: l-(4-Difluoromethoxy-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl]-urea
Figure imgf000038_0003
022: l-(4-Dimethylamino-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylj-urea
Figure imgf000039_0001
023: l-(2-Fluoro-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-urea
Figure imgf000039_0002
light brown powder mp : 203-206°C 1H NMR (DMSO-d6) : δ^ 2.24 (s, 3H) ; 6.98-7.00 (m, 2H) ; 7.10-7.23 (m, 3H) ; 7.40 (m, IH) ; 7.48 (s, IH) ; 8.25 (m, IH) ; 8.37 (d, J = 7.8 Hz, IH) ; 8.51 (m, 3H) ; 9.03 (s, IH) ; 9.19 (s, IH) ; 9.39 (s, IH)
024: l-(2-Chloro-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-urea
Figure imgf000040_0001
025: l-(3-Fluoro-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-urea
Figure imgf000040_0002
white powder mp : 210-215°C
1H NMR (DMSO-d6) : δ 2.24 (s, 3H) ; 6.79 (t, J = 6.3 Hz, IH) ; 6.99 (m, IH) ; 7.09- 7.14 (m, 2H) ; 7.30 (m, IH) ; 7.41 (t, J = 4.7 Hz, IH) ; 7.48 (s, IH) ; 7.56 (d, J = 1.2Hz, IH) ; 8.39 (d, J = 8.0 Hz, IH) ; 8.49-8.52 (m, 2H) ; 8.71 (s, IH) ; 8.87 (s, IH) ; 9.18 (s, IH) ; 9.38 (s, IH)
026: l-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-p-tolyl-urea
Figure imgf000040_0003
white powder mp : 238-240°C 1HRMN (DMSO-d6) δ = 2.29 (s, 3H) ; 2.31 (s, 3H) ; 7.05 (d, J = 6.2 Hz, IH) ; 7J0-1J6 (m, 3H) ; 7.42-7.49 (m, 3H) ; 7.53 (s, IH) ; 8.35-8.62 (m, 5H) ; 9.22 (d, j = 1.6 Hz, IH) ; 9.43 (s, IH)
Among the compounds of formula TV, the invention is particularly embodied by the compounds wherein X is a -substituted Aryl group, corresponding to the N-[3-(Thiazol- 2-ylamino)-phenyl]-amide family and the following formula IV-3 :
FORMULA
Figure imgf000041_0001
wherein Ra, Rb, Re, Rd, Re are independently chosen from H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a -CO-R or a -CO- RR' group, wherein R and R' are independently chosen from H, an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably selected from I, CI, Br and F, and or bearing a pendant basic nitrogen functionality; Ra, Rb, Re, Rd, Re may also be - a halogen such as I, CI, Br and F - a NRR' group where R and R' are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; - an OR group where R is H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R' group wherein R' is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; - a NRaCORb group where Ra and Rb are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; - a NRaCONRbRc group where Ra and Rb are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; - a COOR, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - a CONRaRb, where Ra and Rb are a hydrogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - an NHCOOR, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - an OSO2R, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - an NRaOSO2Rb, where Ra and Rb are a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; Ra can also be a hydrogen; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - a CN group - a trifluoromethyl group R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R6 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
(ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy; (iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
1 to 10 carbon atoms, trifluoromethyl, and alkoxy; iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
Br and F, and / or bearing a pendant basic nitrogen functionality.
Examples 028: 3-Bromo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000045_0001
029: 3-Iodo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000046_0001
030: 4-Hydroxymethyl-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide
Figure imgf000046_0002
031 : 4-Amino-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000046_0003
032: 2-Iodo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000047_0001
033: 4-Iodo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000047_0002
034: 4-(3-{4- [4-Methyl-3 -(4-pyridin-3 -yl-thiazol-2-ylamino)-phenylcarbamoyl] -phenyl} - ureido)-benzoic acid ethyl ester
Figure imgf000047_0003
035: N-[4-Methyl-3-(4-pyridin-3-ylJhiazol-2-ylamino)-phenyl]-4-[3-(4-trifluoromethyl- phenyl)-ureido]-benzamide
Figure imgf000048_0001
036: 4-[3-(4-Bromo-phenyl)-ureido]-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl] -benzamide
Figure imgf000048_0002
037: 4-Hydroxy-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000048_0003
038: N-[4-Methyl-3-(4-ρyridin-3-ylJhiazol-2-ylamino)-phenyl]-4-(3Jhiophen-2-yl- ureido)-benzamide
Figure imgf000049_0001
039: 4-[3-(3,5-Dimethyl-isoxazol-4-yl)-ureido]-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl] -benzamide
Figure imgf000049_0002
040: 4-[3-(4-Methoxy-phenyl)-ureido]-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl] -benzamide
Figure imgf000049_0003
041: 4-[3-(4-Difluoromethoxy-phenyl)-ureido]-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl]-benzamide
Figure imgf000050_0001
042: Thioρhene-2-sulfonic acid 4-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylcarbamoyl] -phenyl ester
Figure imgf000050_0002
043: 4-Iodo-benzenesulfonic acid 4-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylcarbamoyl]-phenyl ester
Figure imgf000050_0003
044: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-(thiophene-2- sulfonylamino)-benzamide
Figure imgf000051_0001
brown powder mp : 230-233°C
1H NMR (DMSO-d6) δ = 2.29 (s, 3H) ; 7J5-7J8 (m, 2H) ; 7.22-7.32 (m, 3H) ; 7.48 (m, 2H) ; 7.67 (dd, j = 1.3 Hz, J = 3.7 Hz, IH) ; 7.90-7.96 (m, 3H) ; 8.38-8.42 (m, IH) ; 8.51 (m, IH) ; 8.57 (d, J = 1.9 Hz, IH) ; 9.17 (d, J = 1.7 Hz, IH) ; 9.44 (s, IH) ; 10.12 (s, IH) ; 10.82 (s, IH)
045 : 3-Fluoro- [4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000051_0002
off-white foam mp : 184-186°C
1H NMR (CD3OD-d4) : δ = 2.23 (s, 3H) ; 7.12-7.14 (m, 2H) ; 7.20-7.23 (m, 2H) ; 7.30 (m, IH) ; 7.43 (m, IH) ; 7.50 (m, IH) ; 7.66 (d, J = 1.0 Hz, IH) ; 8.23 (m, IH) ; 8.33 (m, IH) ; 8.38 (s, IH) ; 8.98 (s, IH)
046: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-pyridin-4-yl- benzamide
Figure imgf000052_0001
yellow powder mp : 254-256°C
1H NMR (DMSO-d6) : δ 2.34 (s, 3H) ; 7.28 (d, J = 8.0 Hz, IH) ; 7.45-7.49 (m, 2H) ; 7.54 (s, IH) ; 7.78 (t, J = 7.6 Hz, IH) ; 7.89-7.91 (m, 2H) ; 8.10 (t, J = 7.8 Hz, 2H) ; 8.37-8.42 (m, 2H) ; 8.55 (d, J = 4.7 Hz, IH) ; 8.73-8.77 (m, 3H) ; 9.24 (s, IH) ; 9.52 (s, IH) ; 10.43 (s, lH)
047: 4-Dimethylamino-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide
Figure imgf000052_0002
beige powder mp : 147-150°C
1H NMR (DMSO-d6) : δ 2.25 (s, 3H) ; 2.99 (s, 6H) ; 6.76 (d, J = 8.9 Hz, 2H> ; 7.16 (d, J = 8.3 Hz, IH) ; 7.35 (d, J - 2.0 Hz, IH) ; 7.44-7.47 (m, 2H) ; 7.86-7.89 (m, 2H) ; 8.34- 8.36 (m, IH) ; 8.48-8.50 (m, IH) ; 8.56-8.57 (m, IH) ; 9.16 (s, IH) ; 9.44 (s, IH) ; 9.85 (s, lH)
048: 2-Fluoro-5-methyl-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide
Figure imgf000053_0001
brown orange powder mp : 103-106°C
1H RMN (DMSO-d6) δ = 2.26 (s, 3H) ; 2.35 (s, 3H) ; 7.17-7.47 (m, 7H) ; 8.29 (dd, J = 1.6 Hz, J = 7.9 Hz, IH) ; 8.47 (d, J= 3.5 Hz, IH) ; 8.57 (s, IH) ; 9.15 (d, J = 2.0 Hz, IH) ; 9.44 (s, IH) ; 10.33 (s, IH)
049: 4-tert-Butyl-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000053_0002
brown powder mp : 145-150°C
1H RMN (DMSO-d6) δ = 1.32 (s, 9H) ; 2.04 (s, 3H) ; 7.18 (d, J = 8.4 Hz, IH) ; 7.35-7.44 (m, 2H) ; 7.46 (s, IH) ; 7.55 (d, J = 8.5 Hz, IH) ; 7.90 (d, J = 8.5 Hz, IH) ; 8.32 (d, J = 7.9 Hz, IH) ; 8.47 (dd, J = 1.5 Hz, J = 4.7 Hz, IH) ; 8.60 (d, J = 2.0 Hz, IH) ; 9.15 (d, J = 1.7 Hz, IH) ; 9.43 (s, IH) ; 10.15 (s, IH)
050: 4-Isopropoxy-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)-phenyl]- benzamide
Figure imgf000054_0001
brown powder mp : 154-155°C
H RMN (DMSO-d6) δ = 1.34 (d, J = 5.9 Hz, 6H) ; 4.72 (hept, J = 5.9 Hz, IH) ; 7.01 (d, J = 7.0 Hz, 2H) ; 7.18 (d, J = 8.5 Hz, IH) ; 7.35-7.44 (m, 2H) ; 7.46 (s, IH) ; 7.94 (dd, J = 2.0 Hz, J = 6.7 Hz, 2H) ; 8.32 (d, J = 8.3 Hz, IH) ; 8.48 (dd, J = 3.3 Hz, J = 4.8 Hz, IH) ; 8.58 (d, J = 2.0 Hz, IH) ; 9.15 (d, J = 1.8 Hz, IH) ; 9.43 (s, IH) ; 10.4 (s, IH)
051: Benzo[l,3]dioxole-5-carboxylic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylmethyl)-phenyl]-amide
Figure imgf000054_0002
brown orange powder mp : 130-132°C
H RMN (DMSO-d6) δ = 2.23 (s, 3H) ; 6.10 (s, 2H) ; 7.03 (d, J = 8.1 Hz, IH) ; 7.15 (d, J = 8.3 Hz, IH) ; 7.25-7.55 (m, 6H) ; 8.26 (s, IH) ; 8.45 (dd, J = 1.5 Hz, J = 4.7, IH) ; 8.55 (d, J = 2.0 Hz, IH) ; 9.12 (d, J = 1.7 Hz, IH) ; 9.40 (s, IH) ; 10.01 (s, IH)
052: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-(2-morpholin-4-yl- ethoxy)-benzamide
Figure imgf000054_0003
beige yellow powder mp : 75-80°C
1H RMN (DMSO-d6) δ = 2.10-225 (m, 4H) ; 2.50-2.60 (m, 2H) ; 3.19 (s, 3H) ; 3.41- 3.48 (m, 4H) ; 4.00-4.06 (m, 2H) ; 7.00-7J 1 (m, 2H) ; 7.22-7.35 (m, 6H), 8J8 (d, J = 8.0 Hz, IH) ; 8.33 (d, j = 0.9 Hz, IH) ; 8.49 (d, j = 1.7 Hz, IH) ; 9.03 (s, IH) ; 9.31 (s, IH) ; 10.05 (s, IH)
053: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)-phenyl]-4-pyridin-4-yl- benzamide
Figure imgf000055_0001
brown powder mp : dec. 250°C
1H RMN (DMSO-d6) δ = 2.28 (s, 3H) ; 7.21 (d, J = 7.9 Hz, IH) ; 7.30-7.50 (m, 3H) ; 7.81 (d, J = 4.7 Hz, IH) ; 7.98 (d, j = 7.5 Hz, 2H) ; 8.13 (d, J = 7.9 Hz, 2H) ; 8.32 (d, j = 7.7 Hz, IH) ; 8.48 (d, j = 4.9 Hz, IH) ; 8.62-8.69 (m, 3H) ; 9.16 (s, IH). ; 9.45 (s, IH) ; 10.34 (s, lH)
054: 3-Cyano-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000055_0002
055: 2-Fluoro-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3- trifluoromethyl-benzamide
Figure imgf000056_0001
056: 3-Fluoro-benzenesulfonic acid 4-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylcarbamoyl] -phenyl ester
Figure imgf000056_0002
057: 4-Aminomethyl-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide
Figure imgf000056_0003
058: 2-Fluoro-benzenesulfonic acid 4-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylcarbamoyl] -phenyl ester
Figure imgf000057_0001
059: 3-Methoxy-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)-phenyl]-benzamide
Figure imgf000057_0002
white powder mp : 76-79°C
1H RMN (DMSO-d6) δ = 2.32 (s, 3H) ; 3.89 (s, 3H) ; 7.22-7.25 (m, 2H), 7.44-7.58 (m, 4H), 8.28-8.35 (m, IH) ; 8.52 (dd, J = 1.6 Hz, J = 4.7 Hz, IH) ; 8.66 (d, J = 2.0 Hz, IH) 9.20 (d, J = 1.4 Hz, IH) ; 9.50 (s, IH) ; 10.25 (s, IH)
060: 4-(4-Methyl-piperazin-l-yl)-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)- phenyl] -benzamide
Figure imgf000057_0003
beige brown powder mp : 128-130°C
1H RMN (DMSO-d6) δ = 2.15 (s, 3H) ; 2.18 (s, 3H) ; 2.35-2.41 (m, 4H) ; 3.18-3.3.24 (m, 4H) ; 6.94 (d, J = 8.9 Hz, 2H) ; 7.09 (d, J = 8.4 Hz, IH) ; 7.28-7.38 (m, 3H) ; 7.81 (d, J = 8.9 Hz, 2H) ; 8.20-8.25 (m, IH) ; 8.40 (dd, J = 1.6 Hz, J = 4.7 , IH) ; 8.48 (d, J = 1.9 Hz, IH) ; 9.07 (d, J = 1.5 Hz, IH) ; 9.35 (s, IH) ; 9.84 (s, IH) 061: 3-Methyl-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000058_0001
062: Biphenyl-3-carboxylic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl] -amide
Figure imgf000058_0002
065: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-trifluoromethyl- benzamide
Figure imgf000058_0003
099: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-pyrrolidin-l-ylmethyl- benzamide
Figure imgf000059_0001
100: 4-[3-(2,4-Dimethoxy-phenyl)-ureido]-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl] -benzamide
Figure imgf000059_0002
101: 4-[3-(2-Iodo-phenyl)-ureido]-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylj-benzamide
Figure imgf000059_0003
102: 4-[3-(4-Fluoro-phenyl)-ureido]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl]-benzamide
Figure imgf000059_0004
105: 3-Bromo-4-methyl-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide
Figure imgf000060_0001
106: 4-Fluoro-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000060_0002
103 : 4-Cyano-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000060_0003
104: 4-Fluoro-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000060_0004
Among compounds of formula TV, the invention is particularly embodied by the compounds wherein X is a -substituted-aryl group, corresponding to the 4-(4- substituted-l-ylmethyl)-N[3-(thiazol-2-ylamino)-phenyl]-benzamide family and the following formula IV-4 :
FORMULA TV-4
Figure imgf000061_0001
wherein X is a heteroatom, such as O or N wherein Ra, Rb, Rd, Re, Rf, Rg, Rh are independently chosen from H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
■ or a NRR' group where R and R' are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
- or an OR group where R is H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R' group wherein R' is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
- or a NRaCORb group where Ra and Rb are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
- or a NRaCONRbRc group where Ra and Rb are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
- or a COOR, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- or a CONRaRb, where Ra and Rb are a hydrogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- or an NHCOOR, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - an OSO2R, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- or an NRaOSO2Rb, where Ra and Rb are a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; Ra can also be a hydrogen; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- or a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a -CO-R or a -CO-NRR' group, wherein R and R' are independently chosen from H, an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
Ra, Rb, Rd, Re can also be halogen such as CI, F, Br, I or trifluoromethyl;
R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy; R6 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy; (ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
(iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy; iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
Examples
066 : 4-(4-methyl-piperazin- 1 -ylmethyl)-N-[4-methyl-3 -(4-pyridin-3 -yl-thiazol-2- ylamino)-phenyl]-benzamide
Figure imgf000065_0001
067: 3,5-Dibromo-4-(4-methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl- thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000066_0001
068: 4-Diethylaminomethyl-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide
Figure imgf000066_0002
069: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-morpholin-4- ylmethyl-benzamide
Figure imgf000066_0003
070: 4-Dipropylaminomethyl-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide
Figure imgf000066_0004
071: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-piperidin-l-ylmethyl- benzamide
Figure imgf000067_0001
072: 4-[(Diisopropylamino)-methyl]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl] -benzamide
Figure imgf000067_0002
073 : {4-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenylcarbamoyl]-benzyl}- carbamic acid tert-butyl ester
Figure imgf000067_0003
074: 3-Fluoro-4-(4-methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl-thiazol- 2-ylamino)-phenyl] -benzamide
Figure imgf000068_0001
075: 4-(4-Methyl-piperazin-l-ylmethyl)-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylmethyl)-phenyl] -3 -trifluoromethyl-benzamide
Figure imgf000068_0002
yellow crystals mp : 118-120°C
1H RMN (DMSO-d6) δ = 2.22 (s, 3H) ; 2.33 (s, 3H) ; 2.34-2.50 (m, 8H) ; 3.74 (s, 2H) ;
7.26 (d, J = 8.3Hz, IH) ; 7.41-7.49 (m, 2H) ; 7.53 (s, IH) ; 7.99 (d, J = 8.0 Hz, IH) ;
8.28-8.31 (m, 2H) ; 8.38 (d, J = 1. Hz, IH) ; 8.53 (dd, J = 1.3 Hz, J = 4.7 Hz, IH) ; 8.68
(d, J = 1.9 Hz, IH) ; 9.21 (d, J = 2.0 Hz, IH) ; 9.53 (s, IH) ; 10.49 (s, IH)
076: 2,3,5,6-Tetrafluoro-4-(4-methyl-piperazin-l-ylmethyl)-N[4-methyl-3-(4-pyridin-3- yl-thiazol-2-ylamino)-phenyl]-benzamide
Figure imgf000068_0003
077: N-{3-[4-(4-Fluoro-phenyl)-miazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- piperazin- l-ylmethyl)-benzami de
Figure imgf000069_0001
078: 3-Bromo-4-(4-methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl-thiazol- 2-ylamino)-phenyl]-benzamide
Figure imgf000069_0002
079: 3-Chloro-4-(4-methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl-thiazol- 2-ylamino)-phenyl] -benzamide
Figure imgf000069_0003
080: 4-(4-Methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-4-yl-thiazol-2- ylamino)-phenyl]-benzamide
Figure imgf000070_0001
081: N-{3-[4-(4-Cyano-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- piperazin- l-ylmethyl)-benzamide
Figure imgf000070_0002
082: 4-[l-(4-Methyl-piperazin-l-yl)-ethyl]-N[4-methyl-3-(4-pyridin-3-ylJhiazol-2- ylmethyι)-phenyl]-benzamide
Figure imgf000070_0003
beige powder mp : 153-155°C
H RMN (DMSO-d6) δ = 1.29 (d, J = 6.6 Hz, 3H) ; 2.15 (s, 3H) ; 2.26 (s, 3H) ; 3.15-3.25 (m, 9H) ; 7.18 (d, J = 8.4Hz, IH) ; 7.35-7.47 (m, 5H) ; 7.91 (d, J = 8.2Hz, 2H) ; 8.31 (d, J = 8.0 Hz, IH) ; 8.47 (dd, J = 1.6 Hz, J = 4.7 Hz, IH) ; 8.60 (d, J = 2.0, IH) ; 9.15 (d, J = 0.6, IH) ; 9.45 (s, IH) ; 10.18 (s, IH)
083: 4-(l-Methoxy-ethyl)-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)-phenyl]- benzamide
Figure imgf000071_0001
084: N-{4-Methyl-3-[4-(5-methyl-pyridin-3-yl)-thiazol-2-ylamino]-phenyl}-4-(4-methyl- piperazin-l-ylmethyl)-benzamide
Figure imgf000071_0002
085: 3-Iodo-4-(4-methyl-piperazin-l-ylmethyl)-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylmethyl)-phenyl]-benzamide
Figure imgf000071_0003
086: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-[3-(4-trifluoromethyl- phenyl)-ureidomethyl]-benzamide
Figure imgf000071_0004
087: 3,5-Dibromo-N-[4-methyl-3-(4-pyridin-3-ylJhiazol-2-ylamino)-phenyl]-4-[(3- mo holin-4-yl-propylamino)-methyl]-benzamide
Figure imgf000072_0001
107: 3,5-Dibromo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4- piperidin- 1 -ylmethyl-benzamide
Figure imgf000072_0002
122 : 4-(4-Methyl-piperazin- 1 -ylmethyl)- N[4-methyl-3-(4-pyridin-2-yl-thiazol-2- ylamino)-phenyl]-benzamide
Figure imgf000072_0003
: - - -3-Fuoro-p eny -t azo- -yamno- -met y-p eny - - -met y- piperazin-l-ylmethyl)-benzamide
Figure imgf000072_0004
118: N-{3-[4-(2-Fluoro-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- piperazin-l-ylmethyl)-benzamides
Figure imgf000073_0001
Among compounds of formula TV, the invention is particularly embodied by the compounds wherein X is a -aryl-substituted group, corresponding to the 3-Disubstituted- amino-N[3-(thiazol-2-ylamino)-phenyl]-benzamide family and the following formula
FORMULA TN-5
Figure imgf000073_0002
wherein Ra, Rb, Re, Re, Rf, Rg are independently chosen from H or an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
- or a NRR' group where R and R' are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
- or an OR group where R is H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; a -SO2-R' group wherein R' is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
- or a NRaCORb group where Ra and Rb are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
- or a NRaCONRbRc group where Ra and Rb are H or a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality;
- or a COOR, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- or a CONRaRb, where Ra and Rb are a hydrogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- or an NHCOOR, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- an OSO2R, where R is a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
- or an NRaOSO2Rb, where Ra and Rb are a linear or branched alkyl group containing from 1 to 10 carbon atoms atoms optionally substituted with at least one heteroatom (for example a halogen) and / or bearing a pendant basic nitrogen functionality; Ra can also be a hydrogen; a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group substituted by an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; - or a -SO2-R group wherein R is an alkyl, cycloalkyl, aryl or heteroaryl optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; or a -CO-R or a -CO-NRR' group, wherein R and R' are independently chosen from H, an alkyl, a cycloalkyl, an aryl or heteroaryl group optionally substituted with at least one heteroatom, notably selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
Ra, Rb, Re, Re can also be halogen such as CI, F, Br, I or trifluoromethyl;
R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R6 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
(ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
(iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
1 to 10 carbon atoms, trifluoromethyl, and alkoxy; iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
Br and F, and / or bearing a pendant basic nitrogen functionality.
Examples 088: 3-Dimethylamino-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide
Figure imgf000078_0001
beige powder mp : 197-198°C
1H NMR (DMSO-d6) : δ = 2.32 (s, 3H) ; 3.03 (s, 6H) ; 6.97 (d, J = 6.4 Hz, IH) ; 7.23- 7.56 (m, 7H) ; 8.37 (d, J = 7.3 Hz, IH) ; 8.53 (d, J - 4.7 Hz, IH) ; 8.63 (s, IH) ; 9.20 (s, IH) ; 9.48 (s, lH) ; 10.15 (s, lH)
089: 3-(4-Methyl-piperazin-l-yl)-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylj-benzamide
Figure imgf000078_0002
beige powder mp : 274-246°C
1H RMN (DMSO-d6) δ = 2.23 (s, 3H) ; 2.24-2.30 (m, 4H) ; 3.22-3.27 (m, 4H) ; 7.07- 7.20 (m, 2H) ; 7.36-7.53 (m, 6H) ; 8.31 (d, J = 7.5 Hz, IH) ; 8.47 (d, J = 3.7 Hz, IH) ; 8.58 (s, IH) ; 9.12 (d, J = 7.8 Hz, IH) ; 9.44 (s, IH) ; 10.12 (s, IH)
090: N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-moφholin-4-yl- benzamide
Figure imgf000079_0001
beige powder mp : 247-248°C
1H RMN (CDCI3) δ = 1.50 (s, 3H) ; 3.15-3.18 (m, 4H) ; 3.79-3.82 (m, 3H) ; 6.85 (s, IH) ; 7.00-7.30 (m, 7H) ; 7.41 (s, IH) ; 7.75 (s, IH) ; 8.08 (d, J = 7.9 Hz, IH) ; 8.22 (d, J = 1.7 Hz, IH) ; 8.46 (dd, J = 1.3 Hz, J = 4.7 Hz, IH) ; 9.01 (d, J = 1.6 Hz, IH)
Among the compounds of formula TV, the invention is particularly embodied by the compounds wherein X is a -OR group, corresponding to the family [3-(Thiazol-2- ylamino)-phenyl]-carbamate and the following formula IV-6
FORMULA IV-6
Figure imgf000079_0002
wherein R is independently chosen from an organic group that can be selected for example from a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom and / or bearing a pendant basic nitrogen functionality; a cycloalkyl, an aryl or heteroaryl group optionally substituted with an heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; or a cycloalkyl, an aryl or heteroaryl group optionally substituted with a cycloalkyl, an aryl or heteroaryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F and / or bearing a pendant basic nitrogen functionality; R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R6 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
(ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy; (iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
1 to 10 carbon atoms, trifluoromethyl, and alkoxy;s iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
Br and F, and / or bearing a pendant basic nitrogen functionality.
Examples 097: [4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-carbamic acid isobutyl ester
Figure imgf000080_0001
098: 2-(2-methyl-5-tert-butoxycarbonylamino)phenyl-4-(3-pyridyl)-thiazole
Figure imgf000081_0001
Process for manufacturing a compound of formula III depicted above.
This entails the condensation of a substrate of general formula 10 with a thiourea of the type 11.
Figure imgf000081_0002
ll a: X = NH-Rl 10 l l b: X = NH2 ll c: X = NH-PG ll d: X = NO2
Substituent "L" in formula 10 is a nucleofugal leaving group in nucleophilic substitution reactions (for example, L can be selected from chloro, bromo, iodo, toluenesulfonyloxy, methanesulfonyloxy, trifluoromethanesulfonyloxy, etc., with L being preferentially a bromo group). Group Rl in formula 11a corresponds to group Rl as described in formula m. Group "PG" in formula 1 lc is a suitable protecting group of a type commonly utilized by the person skilled in the art.
The reaction of 10 with 1 a-d leads to a thiozole-type product of formula 12a-d.
Figure imgf000082_0001
12 b: X = NH2 12 c: X = NH-PG 12 d: X = NO2 Formula 12a is the same as formula I. Therefore, Rl in 12a corresponds to Rl in formula TTT.
Formula 12b describes a precursor to compounds of formula III which lack substituent Rl. Therefore, in a second phase of the synthesis, substituent Rl is connected to the free amine group in 12b, leading to the complete structure embodied by formula Til: 12b + "Rl" -> ΠT The introduction of Rl, the nature of which is as described on page 3 for the general formula HI, is achieved by the use of standard reactions that are well known to the person skilled in the art, such as alkylation, acylation, sulfonylation, formation of ureas, etc.
Formula 12c describes an N-protected variant of compound 12b. Group "PG" in formula 12c represents a protecting group of the type commonly utilized by the person skilled in the art. Therefore, in a second phase of the synthesis, group PG is cleaved to transform compound 12c into compound 12b. Compound 12b is subsequently advanced to structures of formula I as detailed above.
Formula 12d describes a nitro analogue of compound 12b. In a second phase of the synthesis, the nitro group of compound 12d is reduced by any of the several methods utilized by the person skilled in the art to produce the corresponding amino group, namely compound 12b. Compound 12b thus obtained is subsequently advanced to structures of formula m as detailed above.
Examples of Compound synthesis
General: All chemicals used were commercial reagent grade products. Dimethylformamide (DMF), methanol (MeOH) were of anhydrous commercial grade and were used without further purification. Dichlorornethane and tetrahydrofuran (THF) were freshly distilled under a stream of argon before use. The progress of the reactions was monitored by thin layer chromatography using precoated silica gel 60F 254, Fluka TLC plates, which were visualized under UV light. Multiplicities in l HNMR spectra are indicated as singlet (s), broad singlet (br s), doublet (d), triplet (t), quadruplet (q), and multiplet (m) and the NMR spectrum were realized on a 300MHz Bruker spectrometer.
3-Bromoacetyl-pyridine, HBr salt
Figure imgf000083_0001
Dibromine (17.2g, 108 mmol) was added dropwise to a cold (0°C) solution of 3-acetyl- pyridine (12 g, 99 mmol) in acetic acid containing 33% of HBr (165 mL) under vigourous stirring. The vigorously stirred mixture was warmed to 40°C for 2h and then to 75°C. After 2h at 75°C, the mixture was cooled and diluted with ether (400 mL) to precipitate the product, which was recovered by filtration and washed with ether and acetone to give white crystals (100%). This material may be recrystallised from methanol and ether.
TR (neat) : 3108, 2047,2982, 2559, 1709, 1603, 1221, 1035, 798 cm"1 - 1HNMR (DMSO- d6) δ = 5.09 (s, 2H, CH2Br) ; 7.88 (m, IH, pyridyl-H) ; 8.63 (m, IH, pyridyl-H) ; 8.96 (m, IH, pyridyl-H) ; 9.29 (m, IH, pyridyl-H).
Methyl -[4-( 1 - N-methyl-piperazino)-methyl] -benzoate
Figure imgf000084_0001
To methyl-4-formyl benzoate (4.92 g, 30 mmol) and N-methyl-piperazine (3.6 mL, 32 mmol) in acetonitrile (100 mL) was added dropwise 2.5 mL of.trifluoroacetic acid. The reaction mixture was stirred at room temperature for lh. After slow addition of sodium cyanoborohydride ( 2 g, 32 mmol), the solution was left stirring overnight at room temperature. Water (10 mL) was then added to the mixture, which was further acidified with IN HCI to pH=6-7. The acetonitrile was removed under reduced pressure and the residual aqueous solution was extracted with diethyl ether (4x30 mL). These extracts were discarded. The aqueous phase was then basified (pH>12) by addition of 2.5N aqueous sodium hydroxyde solution. The crude product was extracted with ethyl acetate (4x30 mL). The combined organic layers were dried over MgSO4 and concentrated under reduced pressure to afford a slightly yellow oil which became colorless after purification by Kugelrohr distillation (190°C) in 68% yield.
TR(neat) : 3322, 2944, 2802, 1721, 1612, 1457, 1281, 1122, 1012 - H NMR (CDC13) δ = 2.27 (s, 3H, NCH3); 2.44 (m, 8H, 2xNCH2CH2N); 3.53 (s, 2H, ArCH2N); 3.88 (s, 3H,
OCH3); 7.40 (d, 2H, J= 8.3 Hz,2xArH); 7.91 (d, 2H, J= 8.3 Hz, 2xArH) - 13C NMR
(CDC13) δ = 45.8 (NCH3); 51.8 (OCH3); 52.9 (2xCH2N); 54.9 (2xCH2N); 62.4 (ArCH2N); 128.7 (2xArC); 129.3 (2xArC); 143.7(ArC); 166.7 (ArCO2CH3) - MS CI (m/z) (%) : 249 (M+l, 100%).
2-Methyl-5-tert-butoxycarbonylamino-aniline
Figure imgf000085_0001
A solution of di-tert-butyldicarbonate (70 g, 320 mmol) in methanol (200 mL) was added over 2 h to a cold (-10°C) solution of 2,4-diaminotoluene (30 g, 245 mmol) and triethylamine (30 mL) in methanol (15 mL). The reaction was followed by thin layer chromatography (hexane/ethyl acetate, 3 :1) and stopped after 4h by adding 50 mL of water. The mixture was concentrated in vacuo and the residue was dissolved in 500 mL of ethyl acetate. This organic phase was washed with water (1x150 mL) and brine (2x150 mL), dried over MgSO , and concentrated under reduced pressure. The resulting light brown solid was washed with small amounts of diethyl ether to give off-white crystals of 2-methyl-5-tert-butoxycarbonylamino-aniline in 67% yield.
IR (neat) : 3359 ; 3246 ; 2970 ; 1719 ; 1609 ; 1557 ; 1173 ; 1050 cm'1- 1H NMR (CDC13): δ = 1.50 (s, 9H, tBu); 2.10 (s, 3H, ArCH3); 3.61 (br s, 2H, NH2); 6.36 (br s, IH, NH); 6.51 (dd, IH, J= 7.9 Hz, 2.3 Hz, ArH); 6.92 (d, IH, J= 7.9 Hz, ArH); 6.95 (s, IH, ArH) - 13C NMR (CDC13) δ = 16.6 (ArCH3); 28.3 (C(CH3)3); 80.0 (C(CH3)3); 105.2 (ArC); 108.6 (ArC); 116.9 (ArC); 130.4 (ArC-CH3); 137.2 (ArC-NH); 145.0 (ArC- NH2); 152.8 (COOtBu) MS ESI (m/z) (%) : 223 (M+l), 167 (55, 100%). N-(2-methyl-5-tert-butoxycarbonylamino)phenyl-thiourea
Figure imgf000086_0001
Benzoyl chloride (5.64 g, 80 mmol) was added dropwise to a well-stirred solution of ammonium thiocyanate (3.54 g, 88 mmol) in acetone (50 mL). The mixture was refluxed for 15 min, then, the hydrobromide salt of 2-methyl-5-tert-butoxycarbonylamino-aniline (8.4g, 80 mmol) was added slowly portionswise. After lh, the reaction mixture was poured into ice-water (350 mL) and the bright yellow precipitate was isolated by filtration. This crude solid was then refluxed for 45 min in 70 mL of 2.5 N sodium hydroxide solution. The mixture was cooled down and basified with ammonium hydroxide. The precipitate of crude thiourea was recovered by filtration and dissolved in 150 mL of ethyl acetate. The organic phase was washed with brine, dried over Na2SO , and concentrated under reduced pressure. The residue was purified by column chromatography (hexane/ethyl acetate, 1 :1) to afford 63 % of N -(2-methyl-5-tert- butoxycarbonylamino)phenyl-thiourea as a white solid.
TR (neat) : 3437, 3292, 3175, 2983, 1724, 1616, 1522, 1161, 1053 cm-1- H NMR (DMSO-d6) δ = 1.46 (s, 9H, tBu) ; 2.10 (s, 3H, ArCH3) ; 3.60 (br s, 2H, NH2) ; 7.10 (d, IH, J = 8.29 Hz, ArH) ; 7.25 (d, IH, J = 2.23 Hz, ArH) ; 7.28 (d, IH, J = 2.63 Hz, ArH) ; 9.20 (s, IH, ArNH) ; 9.31 (s, IH, ArNH) - 13C NMR (DMSO-d6) δ = 25.1 (ArCH3); 28.1 (C(CH3)3); 78.9 (C(CH3)3); 116.6 (ArC); 117.5 (ArC); 128.0 (ArC); 130.4 (ArC-CH3); 136.5 (ArC-NH); 137.9 (ArC-NH); 152.7 (COOtBu); 181.4 (C=S) - MS CI(m/z) : 282 (M+l, 100%) ; 248 (33) ; 226 (55) ; 182 (99) ; 148 (133) ; 93 (188).
2-(2-methyl-5-tert-butoxycarbonyIamino)phenyl-4-(3-pyridyI)-thiazole
Figure imgf000087_0001
A mixture of 3-bromoacetyl-pyridine, HBr salt (0.8 lg, 2.85 mmol), N -(2-methyl-5-tert- butoxycarbonylamino)phenyl-thiourea (0.8g, 2.85 mmol) and KHCO3 (~0.4g) in ethanol (40 mL) was heated at 75 °C for 20h. The mixture was cooled, filtered (removal of KHCO3) and evaporated under reduced pressure. The residue was dissolved in CHC13 (40 mL) and washed with saturated aqueous sodium hydrogen carbonate solution and with water. The organic layer was dried over Νa2SO and concentrated. Colum chromatographic purification of the residue (hexane/ethyl acetate, 1 :1) gave the desired thiazole in 70% yield as an orange solid
IR(neat) : 3380, 2985, 2942, 1748, 1447, 1374, 1239, 1047, 938 - H NMR (CDC13) δ = 1.53 (s, 9H, tBu) ; 2.28 (s, 3H, ArCH3) ; 6.65 (s, IH, thiazole-H) ; 6.89 (s, IH) ; 6.99 ( dd, IH, = 8.3 Hz, 2.3 Hz) ; 7.12 ( d, 2H, .7=8.3 Hz) ; 7.35 (dd, IH, J = 2.6 Hz, 4.9 Hz) ; 8.03 ( s, IH) ; 8.19 (dt, IH, J= 1.9 Hz, 7.9 Hz) ; 8.54 (br s, IH, NH) ; 9.09 (s, IH, NH) - 13C NMR (CDC13) δ = 18.02 (ArCH3) ; 29.2 (C(CH3)3) ; 81.3 (C(CH3)3) ; 104.2 (thiazole-C) ; 111.6 ; 115.2 ; 123.9 ; 124.3 ; 131.4 ; 132.1 ; 134.4 ; 139.5 ; 148.2 ; 149.1 ; 149.3 ; 153.6 ; 167.3 (C=O) - MS CI (m/z) (%) : 383 (M+l, 100%) ; 339 (43) ; 327 (55) ; 309 (73) ; 283 (99) ; 71 (311).
2-(2-methyl-5-amino)phenyl-4-(3-pyridyl)-thiazole
Figure imgf000088_0001
2-(2-methyl-5-tert-butoxycarbonylamino)phenyl-4-(3-pyridyl)-thiazole (0.40g, 1.2 mmol) was dissolved in 10 mL of 20% TFA/CH2CI2. The solution was stirred at room temperature for 2h, then it was evaporated under reduced pressure. The residue was dissolved in ethyl acetate. The organic layer was washed with aqueous IN sodium hydroxide solution, dried over MgSO , and concentrated to afford 2-(2-methyl-5~ amino)phenyl-4-(3-pyridyl)-thiazole as a yellow-orange solid in 95% yield. This crude product was used directly in the next step.
A 2M solution of trimethyl aluminium in toluene ( 2.75 mL) was added dropwise to a cold (0° C) solution of 2-(2-methyl-5-amino)phenyl-4-(3-pyridyl)-thiazole (0.42 g, 1.5 mmol) in anhydrous dichloromethane (10 mL) under argon atmosphere. The mixture was warmed to room temperature and stirred at room temperature for 30 min. A solution of methyl-4-(l-N-methyl-piperazino)-methyl benzoate (0.45 g, 1.8 mmol) in anhydrous dichloromethane (1 mL) and added slowly, and the resulting mixture was heated at reflux for 5h. The mixture was cooled to 0°C and quenched by dropwise addition of a 4N aqueous sodium hydroxide solution (3 mL). The mixture was extracted with dichloromethane (3x20 mL). The combined organic layers were washed with brine (3x20 mL) and dried over anhydrous MgSO4. (2-(2-methyl-5-amino)phenyl-4-(3- pyridyl)-thiazole) is obtained in 72% after purification by column chromatography (dichloromethane/ methanol, 3 :1)
TR (neat) : 3318, 2926, 1647, 1610, 1535, 1492, 1282, 1207, 1160, 1011, 843 - J HNMR (CDCI3) δ = 2.31 (br s, 6H, ArCH3+NCH3) ; 2.50 ( br s, 8H, 2xNCH2CH2N) ; 3.56 (s, 2H, ArCH2N) ; 6.89 (s, IH, thiazoleH) ; 7.21-7.38 (m, 4H); 7.45 (m, 2H) ; 7.85 ( d, 2H, J = 8.3Hz) ; 8.03 ( s, IH ) ; 8.13 (s, IH) ; 8.27 (s, IH) ; 8.52 (br s, IH) ; 9.09 (s, IH, NH) - 13C NMR (CDC13) δ = 17.8 (ArCH3) ; 46.2 ( NCH3) ; 53.3 (NCH2) ; 55.3 (NCH2) ; 62.8 (ArCH2N) ; 99.9 (thiazole-C) ; 112.5 ; 123.9 ; 125.2 ; 127.5 ; 129.6 ; 131.6 ; 133.7 ; 134.0 ; 137.6; 139.3 ; 142.9 ; 148.8 ; 149.1 ; 166.2 (C=O) ; 166.7 (thiazoleC-NH) - MS CI (m/z) (%) : 499 (M+H, 100%) ; 455 (43) ; 430 (68) ; 401 (97) ; 374 (124) ; 309 (189) ; 283 (215) ; 235 (263) ; 121 (377) ; 99 (399).
Figure imgf000089_0001
The expression "type TT diabetes" as referred herein includes obesity, hypercholesterolemia, hypergycemia, hypertension, endothelial dysfunction, insulin resistance, and vascular remodelling.
In a further embodiment, c-kit inhibitors as mentioned above are inhibitors of activated c-kit. In frame with the invention, the expression "activated c-kit" means a constitutively activated-mutant c-kit including at least one mutation selected from point mutations, deletions, insertions, but also modifications and alterations of the natural c-kit sequence (SEQ TD N°l). Such mutations, deletions, insertions, modifications and alterations can occur in the transphosphorylase domain, in the juxtamembrane domain as well as in any domain directly or indirectly responsible for c-kit activity. The expression "activated c- kit" also means herein SCF-activated c-kit. Preferred and optimal SCF concentrations η c for activating c-kit are comprised between 5.10" M and 5.10" M, preferably around 2.10" M. In a preferred embodiment, the activated-mutant c-kit in step a) has at least one mutation proximal to Y823, more particularly between amino acids 800 to 850 of SEQ TD No 1 involved in c-kit autophosphorylation, notably the D816V, D816Y, D816F and D820G mutants. In another preferred embodiment, the activated-mutant c-kit in step a) has a deletion in the juxtamembrane domain of c-kit. Such a deletion is for example between codon 573 and 579 called c-kit d(573-579). The point mutation V559G proximal to the juxtamembrane domain c-kit is also of interest.
In this regard, the invention contemplates a method for treating type TT diabetes as defined above comprising administering to a human in need of such treatment a compound that is a selective, potent and non toxic inhibitor of activated c-kit obtainable by a screening method which comprises : a) bringing into contact (i) activated c-kit and (ii) at least one compound to be tested; under conditions allowing the components (i) and (ii) to form a complex, b) selecting compounds that inhibit activated c-kit, c) testing and selecting a subset of compounds identified in step b), which are unable to promote death of IL-3 dependent cells cultured in presence of TL-3.
This screening method can further comprise the step consisting of testing and selecting a subset of compounds identified in step b) that are inhibitors of mutant activated c-kit (for example in the transphosphorylase domain), which are also capable of inhibiting SCF- activated c-kit wild.
Alternatively, in step a) activated c-kit is SCF-activated c-kit wild.
A best mode for practicing this method consists of testing putative inhibitors at a concentration above 10 μM in step a). Relevant concentrations are for example 10, 15, 20, 25, 30, 35 or 40 μM.
In step c), TL-3 is preferably present in the culture media of TL-3 dependent cells at a concentration comprised between 0.5 and 10 ng/ml, preferably between 1 to 5 ng/ml. Examples of TL-3 dependent cells include but are not limited to :
- cell lines naturally expressing and depending on c-kit for growth and survival. Among such cells, human mast cell lines can be established using the following procedures : normal human mast cells can be infected by retroviral vectors containing sequences coding for a mutant c-kit comprising the c-kit signal peptide and a TAG sequence allowing to differentiate mutant c-kits from c-kit wild expressed in hematopoetic cells by means of antibodies.
This technique is advantageous because it does not induce cellular mortality and the genetic transfer is stable and gives satisfactory yields (around 20 %). Pure normal human mast cells can be routinely obtained by culturing precursor cells originating from blood obtained from human umbilical vein. In this regard, heparinated blood from umbilical vein is centrifuged on a Ficoll gradient so as to isolate mononucleated cells from other blood components. CD34+ precursor cells are then purified from the isolated cells mentioned above using the immunomagnetic selection system MACS (Miltenyi biotech). CD34+ cells are then cultured at 37°C in 5 % CO2 atmosphere at a concentration of 10 5 cells per ml in the medium MCCM (α-MEM supplemented with L-glutamine, penicillin, streptomycin,- 5 10"5 M β-mercaptoethanol, 20 % veal foetal serum, 1 % bovine albumin serum and 100 ng/ml recombinant human SCF. The medium is changed every 5 to 7 days. The percentage of mast cells present in the culture is assessed each week, using May-Grunwal Giemsa or Toluidine blue coloration. Anti-tryptase antibodies can also be used to detect mast cells in culture. After 10 weeks of culture, a pure cellular population of mast cells (> 98 %) is obtained. It is possible using standard procedures to prepare vectors expressing c-kit for transfecting the cell lines established as mentioned above. The cDNA of human c-kit has been described in Yarden et al., (1987) EMBO J.6 (11), 3341-3351. The coding part of c-kit (3000 bp) can be amplified by PCR and cloned, using the following oligonucleotides : 5ΑAGAAGAGATGGTACCTCGAGGGGTGACCC3' (SEQ TD No2) sens 5'CTGCTTCGCGGCCGCGTTAACTCTTCTCAACCA3' (SEQ TD No3) antisens
The PCR products, digested with Notl and Xhol, has been inserted using T4 ligase in the pFlag-CMV vector (SIGMA), which vector is digested with Notl and Xhol and dephosphorylated using OP (Biolabs). The pFlag-CMV-c-kit is used to transform bacterial clone XLl-blue. The transformation of clones is verified using the following primers : - 5ΑGCTCGTTTAGTGAACCGTC3' (SEQ TD No4) sens, - 5'GTCAGACAAAATGATGCAAC3' (SEQ TD No5) antisens.
Directed mutagenesis is performed using relevant cassettes is performed with routine and common procedure known in the art.. The vector Migr-1 (ABC) can be used as a basis for constructing retroviral vectors used for transfecting mature mast cells. This vector is advantageous because it contains the sequence coding for GFP at the 3' and of an IRES. These features allow to select cells infected by the retrovirus using direct analysis with a fluorocytometer. As mentioned above, the N-terminal sequence of c-kit c-DNA can be modified so as to introduce a Flag sequence that will be useful to discriminating heterogeneous from endogenous c-kit.
Other TL-3 dependent cell lines that can be used include but are not limited to: - BaF3 mouse cells expressing wild-type or mutated form of c-kit (in the juxtamembrane and in the catalytic sites) are described in Kitayama et al, (1996), Blood 88, 995-1004 and Tsujimura et al, (1999), Blood 93, 1319-1329. - IC-2 mouse cells expressing either c-kit or c-k_P l are presented in Piao et al, (1996), Proc. Natl. Acad. Sci. USA 93, 14665-14669.
TL-3 independent cell lines are :
- HMC-1, a factor-independent cell line derived from a patient with mast cell leukemia, expresses a juxtamembrane mutant c-kit polypeptide that has constitutive kinase activity (Furitsu T et al, J Clin Invest. 1993;92:1736-1744 ; Butterfield et al, Establishment of an immature mast cell line from a patient with mast cell leukemia. Leuk Res. 1988;12:345- 355 and Nagata et al, Proc Natl Acad Sci U S A. 1995;92:10560-10564). - P815 cell line (mastocytoma naturally expressing c-kit mutation at the 814 position) has been described in Tsujimura et al, (1994), Blood 83, 2619-2626.
The extent to which component (ii) inhibits activated c-kit can be measured in vitro or in vivo. In case it is measured in vivo, cell lines expressing an activated-mutant c-kit, which has at least one mutation proximal to Y823, more particularly between amino acids 800 to 850 of SEQ TD No 1 involved in c-kit autophosphorylation, notably the D816V,
D816Y, D816F and D820G mutants, are preferred.
Example of cell lines expressing an activated-mutant c-kit are as mentioned above.
In another preferred embodiment, the method further comprises the step consisting of testing and selecting compounds capable of inhibiting c-kit wild at concentration below
1 μM. This can be measured in vitro or in vivo.
Therefore, compounds are identified and selected according to the method described above are potent, selective and non-toxic c-kit wild inhibitors. Alternatively, the screening method as defined above can be practiced in vitro. In this regard, the inhibition of mutant-activated c-kit and/or c-kit wild can be measured using standard biochemical techniques such as immunoprecipitation and western blot. Preferably, the amount of c-kit phosphorylation is measured.
In a still further embodiment, the invention contemplates a method for treating type TT diabetes as depicted above wherein the screening comprises : a) performing a proliferation assay with cells expressing a mutant c-kit (for example in the transphosphorylase domain), which mutant is a permanent activated c-kit, with a plurality of test compounds to identify a subset of candidate compounds targeting activated c-kit, each having an IC50 < 10 μM, by measuring the extent of cell death, b) performing a proliferation assay with cells expressing c-kit wild said subset of candidate compounds identified in step (a), said cells being TL-3 dependent cells cultured in presence of TL-3, to identify a subset of candidate compounds targeting specifically c- kit, c) performing a proliferation assay with cells expressing c-kit, with the subset of compounds identified in step b) and selecting a subset of candidate compounds targeting c-kit wild, each having an IC50 < 10 μM, preferably an IC50 < 1 μM, by measuring the extent of cell death.
Here, the extent of cell death can be measured by 3H thymidine incorporation, the trypan blue exclusion method or flow cytometry with propidium iodide. These are common techniques routinely practiced in the art.
The method according to the invention includes preventing, delaying the onset and/or treating type II diabetes and associated damages in humans.
In the method defined above, any compound capable of depleting mast cells can be used. Such compounds can belong to, as explicated above, tyrosine kinase inhibitors, such as c-kit inhibitors, but are not limited to any particular family so long as said compound shows capabilities to deplete mast cells. Depletion of mast cells can be evaluated using for example one of the mast cell lines depicted above using routine procedure. Best compounds are compounds exhibiting the greatest selectivity. Control cell lines include other hematopoeitic cells that are not mast cells or related cells or cell lines. These control cell lines include SCF independent expanded human CD34+ normal cells. These control cells also include but are not limited to the human T lymphocyte Jurkat cell line (ATCC N° TIB- 152 and mutant cell lines derived thereof), the human B lymphocyte Daudi or Raji cell line (ATCC N° CCL-213 and CCL-86 respectively), the human monocytic U 937 cell line (ATCC N° CRL-1593.2) and the human HL-60 cell line (ATCC N° CCL-240) and mutant cell lines derived thereof CRL- 2258 and CRL-2392).
Such compounds can be selected with a method for identifying compounds capable of depleting mast cells, said compound being non-toxic for cell types other than mast cells, comprising the step consisting of : a) culturing mast cells in vitro in a culture medium suitable for mast cells, b) adding to said culture medium at least one compound to be tested and incubating said cells for a prolonged period of time, c) selecting compounds that promote mast cells death, d) identifying a subset of compounds selected in step c) that are unable to promote death of cells selected from the above mentioned control cell lines.
Therefore, the invention embraces the use of the compounds defined above to manufacture a medicament for treating type II diabetes including obesity, hypercholesterolemia, hypergycemia, hypertension, endothelial dysfunction, insulin resistance, and vascular remodelling. More particularly, the above compounds are useful for preventing the onset or development of type IT diabetes in obese persons.
The pharmaceutical compositions utilized in this invention may be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra- arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, sublingual, or rectal means.
In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.).
Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
More particularly, the invention relates to a pharmaceutical composition intended for oral administration.
Pharmaceutical compositions suitable for use in the invention include compositions wherein compounds for depleting mast cells, such as c-kit inhibitors, or compounds inhibiting mast cells degranulation are contained in an effective amount to achieve the intended purpose. The determination of an effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient, which ameliorates the symptoms or condition. Therapeutic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population). The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50. Pharmaceutical compositions which exhibit large therapeutic indices are preferred.
Example 1: Effect of different c-kit inhibitors on serum glucose, insulin, triglycerides, cholesterol and non esterified fatty acids levels in db/db mice
1.1 PURPOSE OF THE STUDY
The objective of this study is to assess the effects of different c-kit inhibitors on serum glucose, insulin, triglycerides, cholesterol and non esterified fatty acids levels in male db/db mice dosed orally, once-a-day, for 5 days.
1.2 MATERIALS AND METHODS
1.2.2 Test system
30 male 9/11 weeks old C57BL/Ks J Rj-db (db/db) mice (Janvier, France or Harlan, France), weighing in the target range of 30 to 50 g, will be included in this study.
They will be housed in a temperature (19.5-24.5°C) and relative humidity (45-65%) controlled room with a 12-h light/dark cycle, with ad libitum access to filtered tap- water and irradiated pelleted laboratory chow (ref. A04, U.A.R., France) throughout the study. Upon receipt at animal facilities, they will be housed 5 per cage and at least a 5-day acclimatization period will be observed. Animals will be individually identified on the tail.
1.2.3 Study materials
Substance tested code: substances N°l and N°2 Reference substance Code : rosiglitazone 10 mg/kg Source : Sequoia Research Products Ltd, UK
• Vehicle
The vehicle will be defined by the Sponsor but, if no indication is supplied, a 3% Arabic gum aqueous solution (w/v) will be used.
• Reagents Glucose kit (ref. 442640, Beckman Coulter, France) Insulin ELIT Plus kit (ref. INSRAT01-8N, Eurobio, France) Triglycerides kit (ref. 445850, Beckman Coulter, France) - Total cholesterol kit (ref. 467825, Beckman Coulter, France) Non esterified fatty acids kit (NEF A, ref. FA115, Randox, France) Isoflurane (Forene®, Abbott, UK)
• Principal Equipment - Balances (AT261 model, Mettler, France ) Centrifuge (2K15 model, Sigma, France) Multi -parametric analyzer (Synchron CX-4 model, Beckman Coulter, France) Microplate reader (Multiskan RC model, Labsystem, France) Principal Data Processing Systems Excel (Microsoft v.2000), Biolise (Labsystem v.2.65) and SigmaStat (SPSS v.2.03)
1.2.4 Study design
6 groups of 5 animals each will be included in this study :
Group 1 : vehicle Group 2 : test substance N°l, dose 1, route of administration
Group 3 : test substance N°l, dose 2, route of administration
Group 4 : test substance N°2, dose 1, route of administration
Group 5 : test substance N°2, dose 2, route of administration
Group 6 : rosiglitazone, 10 mg/kg, route of administration
The doses will be expressed in terms of free active substance.
The test and reference substances will be extemporaneously prepared as instructed.
The test and reference substances and the vehicle will be administered in a volume of 5 ml/kg adjusted according to individual body weight values.
1.2.5 Experimental protocol
One to three days before beginning the treatments (TO), mice will be weighed and blood samples will be collected through the retro-orbital plexus under isoflurane anesthesia. Blood samples will be kept at room temperature for 5 to 10 min to form a spontaneous clot, then put in ice until they are centrifuged at 3500 x g for 10-15 min at 4 °C. An aliquot of serum will be used for measuring glucose levels. Six groups of 5 mice will be formed with respect to homogeneous glycemia values by using a randomization table. Animal showing glycemia below 20 mM will be excluded from the study.
From Tl to T5, the mice will be weighed and dosed once daily for 5 consecutive days at constant time.
At T5, 2 hours after the last administration, blood samples will be collected through the retro-orbital plexus under isoflurane anesthesia. Blood samples will be kept at room temperature for 5 to 10 min to form a spontaneous clot, then put in ice until they are centrifuged at 3500 x g for 10 min at 4 °C. Serum will be aliquoted and frozen at -20°C until use. After blood collection, the mice will be euthanized by cervical dislocation.
Serum glucose and triglycerides levels will be determined using the Synchron CX4 analyzer. Serum non esterified fatty acids levels will be measured manually using a colorimetric method, and insulin levels determined by ELISA.
1.2.6 Analysis and expression of results
The results will be expressed as mean ± SEM : Glucose levels (mM) at T5 Insulin levels (nM) at T5 Triglycerides levels (mM) at T5 Non esterified fatty acids levels (mM) at T5
For each parameter, a % of effect will be calculated according to following formula ((vehicle group - test group)/ vehicle group)* 100 Statistical analysis will consist in a one-way analysis of variance followed by multiple comparisons versus the vehicle group (Dunnett's test). In case the equal variance test fails, a Kruskall-Wallis one-way analysis of variance on ranks will be proposed. A difference will be considered significant for p<0.05.
This study has been performed according to the model described in Grasa et al. , Oleoyl- estrone lowers the body weight of ob/ob and db/db mice. Horm. Metab. Res. 2000, 32, 246-250 and has be subjected to Quality Assurance monitoring.
3. RESULTS : Effects of AB compounds on serum biomarkers in male db/db mice dosed P.O. for 5 days Table 1 : Treatment Vehicle N°l N°l (mg/kg) 100 200 (n=5) (n=5) (ι=5)
Glucose 27,46 ± 2,95 21,90 ± 3,01 19,72 + 1,23 (mM) Effect (%) 20 28
Cholesterol 3,38 ± 0,08 3,37 ± 0,12 2,79 ± 0,29 (mM) Effect (%) 0 17
Triglycerides 1,57 + 0,11 1,00 ± 0.08 ** (mM) 0,89 ± £f Effect (%) 36 43
NEFA 0,82 ± 0,05 0,68 ± 0,14 0,79 ± 0,084 (mM) Effect (%) 17 3
Insulin 3,69 + 0,86 3,31 + 0,89 2,06 ± 0,38 (nM) Effect (%) 10 44 Treatment N°2 N°2 Rosiglitazone ANOVA (mg/kg) 100 200 1° (P value) (n=5) (n=5) (ι=5)
Glucose 18,16 + 2,22 15,64 + 3.23 * 11,25 ± 2.65 ** 0,006 (mM) Effect (%) 34 43 59
Cholesterol 3,24 ± 0,09 2,72 + 0,13 2,74 + 0,47 0,163 (mM) Effect (%) 4 19 19
Triglycerides + 0.08 + 0.05 0,77 — ** 0,66 (mM) — ** 0,46 + 0.10 ** < 0.001 Effect (%) 51 58 71
NEFA 0,70 + 0,048 0,71 + 0,07 0,31 + 0.061 * 0.036 (°) (mM) Effect (%) 14 13 63
Insulin 2,15 + 0,42 2,82 ± 0,59 0,82 + 0.27 * 0,039 (nM) Effect (%) 42 24 77
Values are expressed as mean ± SEM
Statistics : One-way analysis of variance (ANOVA) followed by a Dunnett's test, or (°) Kruskal Wallis analysis of variance on the ranks followed by a Dunn's test. *p<0.05, ** p<0.01 as compared to vehicle Effect % as compared to vehicle
Example 2 : in vitro TK inhibition assays • Procedure Experiments were performed using purified intracellular domain of c-kit expressed in baculovirus. Estimation of the kinase activity was assessed by the phosphorylation of tyrosine containing target peptide estimated by established ELISA assay.
• Experimental results on tested compounds
Result in Table 2 shows the potent inhibitory action of the catalytic activity of c-kit with an IC50 <10 μM. Further experiments (not shown) indicates that at least one compound acts as perfect competitive inhibitors of ATP. Table 2: Compounds In vitro Inhibition assay results c-kit IC50 (μM) 066; 074; 078; 084; 012; 016; 073; 021; 088; <10μM 023; 025; 047; 048; 055; 049; 026; 087; 075; 089; 051 082; 090; 060; 085; 052; 053, 096
Exampl e 2 : ex vivo TK inhibition assays • Procedures o C-Kit WT and mutated C-Kit (JM) assay
Proliferation assays
Cells were washed two times in PBS before plating at 5 x 104 cells per well of 96-well plates in triplicate and stimulated either with hematopoietic growth factors (HGF) or without. After 2 days of culture, 37 Bq (1.78 Tbq/mmol) of [3H] thymidine (Amersham Life Science, UK) was added for 6 hours. Cells were harvested and filtered through glass fiber filters and [3H] thymidine incorporation was measured in a scintillation counter. For proliferation assay, all drugs were prepared as 20mM stock solutions in DMSO and conserved at -80°C. Fresh dilutions in PBS were made before each experiment. DMSO dissolved drugs were added at the beginning of the culture. Control cultures were done with corresponding DMSO dilutions. Results are represented in percentage by taking the proliferation without inhibitor as 100%. Cells
Ba/F3 murine kit and human kit, Ba/F3 mkitΔ27 (juxtamembrane deletion) are derived from the murine TL-3 dependent Ba/F3 proB lymphoid cells. The FMA3 and P815 cell lines are mastocytoma cells expressing endogenous mutated forms of Kit, i.e., frame deletion in the murine juxtamembrane coding region of the receptor-codons 573 to 579. The human leukaemic MC line HMC-1 expresses mutations JM-V560G; Immunoprecipitation assays and western blotting analysis For each assay, 5.106 Ba/F3 cells and Ba/F3-derived cells with various c-kit mutations were lysed and immunoprecipitated as described (Beslu et ah, 1996), excepted that cells were stimulated with 250 ng / ml of rmKL. Cell lysates were immunoprecipitated with a rabbit immunserum anti murine KIT, directed against the KIT cytoplasmic domain (Rottapel et ah, 1991). Western blot was hybridized either with the 4G10 anti- phosphotyrosine antibody (UBI) or with the rabbit immunserum anti -murine KIT or with different antibodies (described in antibodies paragraph). The membrane was then incubated either with HRP-conjugated goat anti mouse IgG antibody or with HRP- conjugated goat anti rabbit IgG antibody (Immunotech), Proteins of interest were then visualized by incubation with ECL reagent (Amersham).
• Experimental results The experimental results for various compounds according to the invention using above- described protocols are set forth at Table 3:
Table 3: Target IC50 (μM) Compounds c-Kit WT IC50 < 10 μM 002; 005; 006; 007; 008; 009; 010; 012; 017; 019; 020; 021; 023; 024; 025; 026; 028; 029; 030; 032; 042; 043; 045; 047; 048; 049; 050; 051 052053; 054; 055; 056 057; 059; 060; 061; 062; 063 064065; 066; 067; 072 073; 074; 075; 077; 078; 079 080081; 082; 083; 084 085; 086; 087; 088; 089; 090 092 093; 094; 095; 096 097; 106; 105; 104; 103;128 129 130; 131; 117; 110 116; 124; 108; 122; 111; 113; 118; 107; c-Kit JM IC50 < 1 μM 028 074; 029; 009 061 065; 088 Ml 025 048; 049; 050 083 059; 052 053 066; 103; 067 081 084; 030 010 021; 043; 054 064 047; 055 026 087; 075; 085 032017; 063 093 094; 095; 086
Figure imgf000105_0001
122008; 080 111; 118; 113; 007; 072; 019; 056; 057; 107; 097;

Claims

1. A method for treating type II diabetes, obesity and related disorders comprising administering a compound capable of depleting mast cells or a compound inhibiting mast cells degranulation in a human in need of such treatment.
2. A method according to claim 1 for treating type II diabetes comprising administering a c-kit inhibitor to a human in need of such treatment.
3. A method according to claim 2, wherein said c-kit inhibitor c-kit inhibitor is a nontoxic, selective and potent c-kit inhibitor wherein it is unable to promote death of TL-3 dependent cells cultured in presence of TL-3.
4 A method according to claim 1 or 3 wherein said inhibitor is selected from the group consisting of :
- 2-(3-amino)arylamino-4-aryl-thiazoles,
- pyrimidine derivatives, more particularly N-phenyl-2-pyrimidine-amine derivatives, - indolinone derivatives, more particularly pyrrol-substituted indolinones,
- monocyclic, bicyclic aryl and heteroaryl compounds,
- and quinazoline derivatives.
5. A method according to claim 4, wherein said inhibitor is selected from the group consisting of N-phenyl-2-pyrimidine-amine derivatives having the formula TJ :
Figure imgf000107_0001
Wherein Rl, R2 and R3 are independently chosen from H, F, CI, Br, I, a C1-C5 alkyl or a cyclic or heterocyclic group, especially a pyridyl group; R4, R5 and R6 are independently chosen from H, F, CI, Br, I, a C1-C5 alkyl, especially a methyl group; and R7 is a phenyl group bearing at least one substituent, which in turn possesses at least one basic site, such as an amino function, preferably the following group :
Figure imgf000107_0002
6. A method according to claim 5, wherein said inhibitor is the 4-(4-mehylpiperazine-l- ylmethyl)-N-[4-methyl-3-(4-pyridine-3-yl)pyrimidine-2 ylamino)phenyl]-benzamide.
7. A method according to one of claims 3 to 6, wherein said c-kit inhibitor is an inhibitor of activated c-kit.
8. A method according to claim 7, wherein said inhibitor is capable of inhibiting constitutively activated-mutant c-kit.
9. A method according to one of claims 7, wherein said activated c-kit inhibitor is capable of inhibiting SCF-activated c-kit.
10. A method according to claim 4, wherein said c-kit inhibitor is selected from compounds belonging to the 2-(3-amino)arylamino-4-aryl-thiazoles of formula III:
Figure imgf000108_0001
FORMULA IH
and wherein R1 is : a) a linear or branched alkyl group containing from 1 to 10 carbon atoms optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality; b) an aryl or heteroaryl group optionally substituted by an alkyl or aryl group optionally substituted with a heteroatom, notably a halogen selected from I, CI, Br and F or bearing a pendant basic nitrogen functionality; c) a -CO-NH-R, -CO-R, -CO-OR or a -CO-NRR' group, wherein R and R' are independently chosen from H or an aryl, heteroaryl, alkyl and cycloalkyl group optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality;
R2 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R3 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy; R5 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R6 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
(ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy; (iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
1 to 10 carbon atoms, trifluoromethyl, and alkoxy, iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI,
Br and F, and / or bearing a pendant basic nitrogen functionality; and R7 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy;
(ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy; (iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from
1 to 10 carbon atoms, trifluoromethyl, and alkoxy. iv) H, a halogen selected from I, F, CI or Br; NH2, NO2 or SO2-R, wherein R is a linear or branched alkyl goup containing one or more group such as 1 to 10 carbon atoms, and optionally substituted with at least one heteroatom, notably a halogen selected from I, CI, Br and F, and / or bearing a pendant basic nitrogen functionality.
11. A method according to claim 10, wherein said c-kit inhibitor is selected from compounds belonging to the 2-(3-amino)arylamino-4-aryl-thiazoles of formula IV:
Figure imgf000110_0001
FORMULA IV
wherein X is R or NRR' and wherein R and R' are independently chosen from H, an aryl, an heteroaryl, an alkyl and a cycloalkyl group optionally substituted with at least one heteroatom, such as for example a halogen chosen from F, I, CI and Br and optionally bearing a pendant basic nitrogen functionality; or an aryl, an heteroaryl, an alkyl and a cycloalkyl group substituted with an aryl, an heteroaryl, an alkyl and a cycloalkyl group optionally substituted with at least one heteroatom, such as for example a halogen chosen from F, I, CI and Br and optionally bearing a pendant basic nitrogen functionality,
R2 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R3 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy; R4 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy;
R5 is hydrogen, halogen or a linear or branched alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl or alkoxy; R6 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy; (ii) a heteroaryl group such as a 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
(iii) a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy.
12. A method according to claim 11, wherein X is a substituted alkyl, aryl or heteroaryl group bearing a pendant basic nitrogen functionality represented for example by the structures a to f shown below, wherein the wavy line corresponds to the point of attachment to core structure of formula IV:
Figure imgf000111_0001
Figure imgf000111_0002
3. A method according to claim 12, wherein said c-kit inhibitor is selected from : 4-Diethylaminomethyl-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylj-benzamide, N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-morpholin-4- ylmethyl-benzami de, 4-Dipropylaminomethyl-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl]-benzamide, • N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-piperidin-l- ylmethyl-benzami de, 3-Iodo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide, 4-Hydroxymethyl-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide, • 4-{[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenylamino]-methyl}- benzoic acid methyl ester, 3-Phenyl-propynoic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- amide, 4-Amino-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide, • 2-Iodo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide, 4-Iodo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide, 4-(3-{4-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenylcarbamoyl]- phenyl}-ureido)-benzoic acid ethyl ester, N-[4-Methyl-3-(4-pyridin-3-ylJhiazol-2-ylamino)-phenyl]-4-[3-(4- trifluoromethyl-phenyl)-ureido]-benzamide, 4-[3-(4-Bromo-phenyl)-ureido]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl]-benzamide, {4-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenylcarbamoyl]-benzyl}- carbamic acid tert-butyl ester,
4-Hydroxy-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide
4-[(Diisopropylamino)-methyl]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl]-benzamide,
N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-(3-thiophen-2-yl- ureido)-benzamide,
4-[3-(3,5-Dimethyl-isoxazol-4-yl)-ureido]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-
2-ylamino)-phenyl]-benzamide,
4-[3-(4-Methoxy-phenyl)-ureido]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl]-benzamide,
4-[3-(4-Difluoromethoxy-phenyl)-ureido]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-
2-ylamino)-phenyl]-benzamide,
Thiophene-2-sulfonic acid 4-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylcarbamoyl] -phenyl ester,
4-Iodo-benzenesulfonic acid 4-[4-methyl-3-(4-pyridin-3-yl-thiazol-2 -ylamino)- phenylcarbamoyl] -phenyl ester,
N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-pyrrolidin-l- ylmethyl-benzami de,
3-Methyl-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide,
N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-trifluoromethyl- benzamide,
4-[3-(2,4-Dimethoxy-phenyl)-ureido]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl] -benzami de,
N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-[3-(4- trifluoromethyl-phenyl)-ureidomethyl]-benzamide,
N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-[3-(3,4,5- trimethoxy-phenyl)-ureido]-benzamide, 4-[3-(2-Iodo-phenyl)-ureido]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl] -benzamide, 4-[3-(4-Fluoro-phenyl)-ureido]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl] -benzami de, 2-Fluoro-benzenesulfonic acid 4-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylcarbamoyl] -phenyl ester, 3-Fluoro-benzenesulfonic acid 4-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenylcarbamoyl] -phenyl ester, 2-(2-methyl-5-tert-butoxycarbonylamino)phenyl-4-(3-pyridyl)-thiazole, 2-(2-methyl-5-amino)phenyl-4-(3-pyridyl)-thiazole 4-(4-Methyl-piperazin-l-ylmethyl)-N-[3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl]-benzamide N-[4-Methyl-3-(4-phenyl-thiazol-2-ylamino)-phenyl]-4-(4-methyl-piperazin-l- ylmethyl)-benzamide N-[3-([2,4']Bithiazolyl-2'-ylamino)-4-methyl-phenyl]-4-(4-methyl-piperazin-l- ylmethyl)-benzamide 4-(4-Methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyrazin-2-yl-thiazol-2- ylamino)-phenyl]-benzamide 2-[5-(3-Iodo-benzoylamino)-2-methyl-phenylamino]-thiazole-4-carboxylic acid ethyl ester 2-{2-Methyl-5-[4-(4-methyl-piperazin-l-ylmethyl)-benzoylamino]-phenylamino}- thiazole-4-carboxylic acid ethyl ester N-[4-Chloro-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-(4-methyl-piperazin- 1 -ylmethyl)-benzamide 3-Bromo-N-{3-[4-(4-chloro-phenyl)-5-methyl-thiazol-2-ylamino]-4-methyl- phenyl}-benzamide {3-[4-(4-Chloro-phenyl)-5-methyl-thiazol-2-ylamino]-4-methyl-phenyl}-carbamic acid isobutyl ester 2-[5-(3-Bromo-benzoylamino)-2-methyl-phenylamino]-5-(4-chloro-phenyl)- thiazole-4-carboxylic acid ethyl ester 2-[5-(3-Bromo-benzoylamino)-2-methyl-phenylamino]-5-(4-chloro-phenyl)- thiazole-4-carboxylic acid (2-dimethylamino-ethyl)-amide N-{3-[4-(4-Methoxy-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- pi perazin- 1 -ylmethyl)-benzamide 4-(4-Methyl-piperazin-l-ylmethyl)-N-{4-methyl-3-[4-(3-trifluoromethyl-phenyl)- thiazol-2-ylamino]-phenyl}-benzamide N-{4-Methyl-3-[4-(3-nitro-phenyl)-thiazol-2-ylamino]-phenyl}-4-(4-methyl- pi perazin- 1 -ylmethyl)-benzamide N-{3-[4-(2,5-Dimethyl-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- pi perazin- 1 -ylmethyl)-benzamide N-{3-[4-(4-Chloro-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- pi perazin- 1 -ylmethyl)-benzamide 3-Bromo-4-methyl-N[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide 4-Fluoro-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide 3,5-Dibromo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4- pi peridin- 1 -ylmethyl-benzamide N-{3-[4-(3-Fluoro-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- pi perazin- 1 -ylmethyl)-benzamide N-{3-[4-(3-Methoxy-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- pi perazin- 1 -ylmethyl)-benzamide N- { 3 -[4-(2-Fluoro-phenyl)-thi azol-2-ylamino] -4-methyl-phenyl } -4-(4-methyl- pi perazin- 1 -ylmethyl)-benzamide 4-(4-Methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-2-yl-thiazol-2- ylamino)-phenylj-benzamide 4-Cyano-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide 4-Fluoro-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide l-(2-Fluoro-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- urea l-(2-Chloro-phenyl)-3-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- urea 1 -(3 -Fluoro-phenyl)-3 -[4-methyl-3 -(4-pyridin-3 -yl-thiazol-2-ylamino)-phenyl] - urea l-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-p-tolyl-urea 3-Bromo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-(thiophene-2- sulfonylamino)-benzami de 3-Fluoro-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-pyridin-4-yl- benzamide 4-Dimethylamino-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide 2-Fluoro-5-methyl-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide 4-tert-Butyl-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide 4-Isopropoxy-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)-phenyl]- benzamide Benzo[l,3]dioxole-5-carboxylic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylmethyl)-phenyl] -amide N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-(2-morpholin-4-yl- ethoxy)-benzamide N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)-phenyl]-4-pyridin-4-yl- benzamide 3-Cyano-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-benzamide 2-Fluoro-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3- trifluoromethyl-benzamide 4-Aminomethyl-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide 3-Methoxy-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)-phenyl]-benzamide 4-(4-Methyl-piperazin-l-yl)-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)- phenylj-benzamide Biphenyl-3-carboxylic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyl] -amide N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-isonicotinamide 2,6-Dϊchloro-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- isonicotinamide 3,5-Dibromo-4-(4-methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl- thiazol-2-ylamino)-phenyl]-benzamide 3-Fluoro-4-(4-methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl- thiazol-2-ylamino)-phenyl]-benzamide 4-(4-Methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylmethyl)-phenyl]-3-trifluoromethyl-benzamide 2,3,5,6-Tetrafluoro-4-(4-methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin- 3-yl-thiazol-2-ylamino)-phenyl]-benzamide N-{3-[4-(4-Fluoro-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- pi perazin- 1 -ylmethyl)-benzamide 3-Bromo-4-(4-methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl- thiazol-2-ylamino)-phenyl]-benzamide 3-Chloro-4-(4-methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl- thiazol-2-ylamino)-phenyl]-benzamide 4-(4-Methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-4-yl-thiazol-2- ylamino)-phenyl]-benzamide N-{3-[4-(4-Cyano-phenyl)-thiazol-2-ylamino]-4-methyl-phenyl}-4-(4-methyl- pi perazin- 1 -ylmethyl)-benzamide 4-[l-(4-Methyl-piperazin-l-yl)-ethyl]-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylmethyl)-phenyl]-benzamide 4-(l-Methoxy-ethyl)-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)-phenyl]- benzamide N-{4-Methyl-3-[4-(5-methyl-pyridin-3-yl)-thiazol-2-ylamino]-phenyl}-4-(4- methyl-piperazin- 1 -ylmethyl)-benzamide 3-Iodo-4-(4-methyl-piperazin-l-ylmethyl)-N-[4-methyl-3-(4-pyridin-3-yl-thiazol- 2-ylmethyl)-phenyl]-benzamide 3,5-Dibromo-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-[(3- morpholin-4-yl-propylamino)-methyl]-benzamide 3-Dimethylamino-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]- benzamide 3-(4-Methyl-piperazin-l-yl)-N-[4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)- phenyTJ-benzamide N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-3-morpholin-4-yl- benzamide Cyclohexanecarboxylic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2-ylmethyl)- phenyl]-amide 5-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenylcarbamoyl]-pentanoic acid ethyl ester 1-Methyl-cyclohexanecarboxylic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylmethyl)-phenyl]-amide 4-tert-Butyl-cyclohexanecarboxylic acid [4-methyl-3-(4-pyridin-3-yl-thiazol-2- ylamino)-phenyl]-amide N-[4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-4-mo holin-4-yl- butyramide • [4-Methyl-3-(4-pyridin-3-yl-thiazol-2-ylamino)-phenyl]-carbamic acid isobutyl ester • 2-(2-methyl-5-tert-butoxycarbonylamino)phenyl-4-(3-pyridyl)-thiazole
14. A method for treating type TT diabetes, obesity and related disorders comprising administering to a human in need of such treatment a compound that is a selective, potent and non toxic inhibitor of activated c-kit obtainable by a screening method which comprises : a) bringing into contact (i) activated c-kit and (ii) at least one compound to be tested; under conditions allowing the components (i) and (ii) to form a complex, b) selecting compounds that inhibit activated c-kit, c) testing and selecting a subset of compounds identified in step b), which are unable to promote death of IL-3 dependent cells cultured in presence of TL-3.
15. A method according to claim 14, wherein the screening method further comprises the step consisting of testing and selecting a subset of compounds identified in step b) that are inhibitors of mutant activated c-kit, which are also capable of inhibiting SCF- activated c-kit wild.
16. A method according to claim 14, wherein activated c-kit is SCF-activated c-kit wild in step a).
17. A method according to one of claims 14 to 16, wherein putative inhibitors are tested at a concentration above 10 μM in step a).
18. A method according to one of claims 14 to 16, wherein TL-3 is preferably present in the culture media of TL-3 dependent cells at a concentration comprised between 0.5 and 10 ng/ml, preferably between 1 to 5 ng/ml.
19. A method according to claim 14, wherein TL-3 dependent cells are selected from the group consisting of mast cells, transfected mast cells, BaF3 and IC-2.
20. A method according to one of claims 14 to 19, wherein the extent to which component (ii) inhibits activated c-kit is measured in vitro or in vivo.
21. A method according to one of claims 14 to 20, further comprising the step consisting of testing and selecting compounds capable of inhibiting c-kit wild at concentration below 1 μM.
22. A method according to claim 17 or 21, wherein the testing is performed in vitro or in vivo.
23. A method according to one of claims 14 to 22, wherein the inhibition of mutant- activated c-kit and/or c-kit wild is measured using standard biochemical techniques such as immunoprecipitation and western blot.
24. A method according to one of claims 14 to 22, wherein the amount of c-kit phosphorylation is measured.
25. A method according to one of claims 14 to 24, wherein identified and selected compounds are potent, selective and non-toxic c-kit wild inhibitors.
26. A method for treating type TJ diabetes, obesity and related disorders comprising administering to a human in need of such treatment a c-kit inhibitor obtainable by a screening method comprising : a) performing a proliferation assay with cells expressing a mutant c-kit (for example in the transphosphorylase domain), which mutant is a permanent activated c-kit, with a plurality of test compounds to identify a subset of candidate compounds targeting activated c-kit, each having an IC50 < 10 μM, by measuring the extent of cell death, b) performing a proliferation assay with cells expressing c-kit wild said subset of candidate compounds identified in step (a), said cells being TL-3 dependent cells cultured in presence of TL-3, to identify a subset of candidate compounds targeting specifically c- kit, c) performing a proliferation assay with cells expressing c-kit, with the subset of compounds identified in step b) and selecting a subset of candidate compounds targeting c-kit wild, each having an IC50 < 10 μM, preferably an IC50 < 1 μM, by measuring the extent of cell death.
27. A method according to claim 26, wherein the extent of cell death is measured by 3H thymidine incorporation, the trypan blue exclusion method or flow cytometry with propidium iodide.
28. A method according to one of claims 1 to 27 for preventing, delaying the onset and/or treating type TT diabetes and obesity in human.
29. A method according to one of claims 1 to 27 for preventing, delaying the onset and/or treating of hypercholesterolemia, hypergycemia, hypertension, endothelial dysfunction, insulin resistance, and vascular remodelling.
30. Use of a c-kit inhibitor to manufacture a medicament for treating for preventing, delaying the onset and/or treating type TJ diabetes and obesity in human including hypercholesterolemia, hypergycemia, hypertension, endothelial dysfunction, insulin resistance, and vascular remodelling.
31. A composition suitable for oral administration comprising a compound capable of depleting mast cells, preferably a tyrosine kinase inhibitor, more particularly a c-kit inhibitor for treating for preventing, delaying the onset and/or treating type TT diabetes and obesity including hypercholesterolemia, hypergycemia, hypertension, endothelial dysfunction, insulin resistance, and vascular remodelling.
32. A composition according to claim 31 suitable for intravenous, intramuscular, intra- arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, enteral, sublingual, or rectal administration.
PCT/IB2004/002934 2003-08-15 2004-08-16 Use of c-kit inhibitors for treating type ii diabetes WO2005016323A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
DE602004013792T DE602004013792D1 (en) 2003-08-15 2004-08-16 USE OF C-KIT INHIBITORS FOR THE TREATMENT OF TYPE-2 DIABETES
US10/567,557 US20070032521A1 (en) 2003-08-15 2004-08-16 Use of c-kit inhibitors for treating type II diabetes
CA002535242A CA2535242A1 (en) 2003-08-15 2004-08-16 Use of c-kit inhibitors for treating type ii diabetes
JP2006523710A JP2007502809A (en) 2003-08-15 2004-08-16 Methods of using c-kit inhibitors for treating type II diabetes
EP04769332A EP1653934B1 (en) 2003-08-15 2004-08-16 Use of c-kit inhibitors for treating type ii diabetes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US49508803P 2003-08-15 2003-08-15
US60/495,088 2003-08-15

Publications (2)

Publication Number Publication Date
WO2005016323A2 true WO2005016323A2 (en) 2005-02-24
WO2005016323A3 WO2005016323A3 (en) 2005-04-07

Family

ID=34193274

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2004/002934 WO2005016323A2 (en) 2003-08-15 2004-08-16 Use of c-kit inhibitors for treating type ii diabetes

Country Status (7)

Country Link
US (1) US20070032521A1 (en)
EP (1) EP1653934B1 (en)
JP (1) JP2007502809A (en)
AT (1) ATE395052T1 (en)
CA (1) CA2535242A1 (en)
DE (1) DE602004013792D1 (en)
WO (1) WO2005016323A2 (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1702917A1 (en) * 2003-12-25 2006-09-20 Nippon Shinyaku Co., Ltd. Amide derivative and medicine
DE102005062986A1 (en) * 2005-12-28 2007-07-05 Grünenthal GmbH New substituted propiolic acid amides, useful for treatment and prevention of e.g. pain, anxiety and panic attacks, are inhibitors of the mGluR5 receptor
EP2060565A1 (en) 2007-11-16 2009-05-20 4Sc Ag Novel bifunctional compounds which inhibit protein kinases and histone deacetylases
US7772254B2 (en) 2003-09-22 2010-08-10 Purdue Pharma L.P. Therapeutic agents useful for treating pain
US7799807B2 (en) 2003-09-22 2010-09-21 Purdue Pharma L.P. Therapeutic agents useful for treating pain
EP2366703A1 (en) 2007-02-13 2011-09-21 AB Science Polymorph form of 2-amino (nitroaryl) thiazole derivative
US8088806B2 (en) 2005-05-09 2012-01-03 Achillion Pharmaceuticals, Inc. Thiazole compounds and methods of use
US8106209B2 (en) 2008-06-06 2012-01-31 Achillion Pharmaceuticals, Inc. Substituted aminothiazole prodrugs of compounds with anti-HCV activity
US8183263B2 (en) 2007-05-22 2012-05-22 Achillion Pharmaceuticals, Inc. Heteroaryl substituted thiazoles
US9675544B2 (en) 2008-01-22 2017-06-13 The Board Of Regents Of The University Of Texas System Volatile anesthetic compositions comprising extractive solvents for regional anesthesia and/or pain relief
US9713613B2 (en) 2007-02-02 2017-07-25 Motonari Uesugi Methods and compositions for the treatment of cancer and related hyperproliferative disorders
US10357464B2 (en) 2006-09-20 2019-07-23 The Board Of Regents Of The University Of Texas System Methods for delivering volatile anesthetics for regional anesthesia and/or pain relief
WO2022036104A1 (en) * 2020-08-12 2022-02-17 University Of Iowa Research Foundation Insulin sensitizers for the treatment of diabetes mellitus

Families Citing this family (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE60134679D1 (en) * 2000-10-20 2008-08-14 Eisai R&D Man Co Ltd Nitrogen-containing aromatic heterocycles
EP1604665B1 (en) * 2003-03-10 2011-05-11 Eisai R&D Management Co., Ltd. C-kit kinase inhibitor
EP1683785B1 (en) * 2003-11-11 2013-10-16 Eisai R&D Management Co., Ltd. Urea derivative and process for producing the same
ES2322175T3 (en) * 2004-09-17 2009-06-17 EISAI R&amp;D MANAGEMENT CO., LTD. MEDICINAL COMPOSITION WITH IMPROVED STABILITY AND REDUCED GELIFICATION.
WO2007015569A1 (en) * 2005-08-01 2007-02-08 Eisai R & D Management Co., Ltd. Method for prediction of the efficacy of vascularization inhibitor
JP4989476B2 (en) 2005-08-02 2012-08-01 エーザイ・アール・アンド・ディー・マネジメント株式会社 Methods for assaying the effects of angiogenesis inhibitors
WO2007026864A1 (en) * 2005-09-01 2007-03-08 Eisai R & D Management Co., Ltd. Method for preparation of pharmaceutical composition having improved disintegradability
US20090053236A1 (en) * 2005-11-07 2009-02-26 Eisai R & D Management Co., Ltd. USE OF COMBINATION OF ANTI-ANGIOGENIC SUBSTANCE AND c-kit KINASE INHIBITOR
EP1964837A4 (en) * 2005-11-22 2010-12-22 Eisai R&D Man Co Ltd Anti-tumor agent for multiple myeloma
WO2007136103A1 (en) * 2006-05-18 2007-11-29 Eisai R & D Management Co., Ltd. Antitumor agent for thyroid cancer
JPWO2008001956A1 (en) * 2006-06-29 2009-12-03 エーザイ・アール・アンド・ディー・マネジメント株式会社 Liver fibrosis treatment
WO2008026748A1 (en) * 2006-08-28 2008-03-06 Eisai R & D Management Co., Ltd. Antitumor agent for undifferentiated gastric cancer
KR101445892B1 (en) * 2007-01-29 2014-09-29 에자이 알앤드디 매니지먼트 가부시키가이샤 Composition for treatment of undifferentiated-type of gastric cancer
US8952035B2 (en) 2007-11-09 2015-02-10 Eisai R&D Management Co., Ltd. Combination of anti-angiogenic substance and anti-tumor platinum complex
MX2010008187A (en) * 2008-01-29 2010-08-10 Eisai R&D Man Co Ltd Combined use of angiogenesis inhibitor and taxane.
BR112012032462A2 (en) 2010-06-25 2016-11-08 Eisai R&D Man Co Ltd antitumor agent employing compounds which, in combination, have kinase inhibiting effect.
US8962650B2 (en) 2011-04-18 2015-02-24 Eisai R&D Management Co., Ltd. Therapeutic agent for tumor
EP3444363B1 (en) 2011-06-03 2020-11-25 Eisai R&D Management Co., Ltd. Biomarkers for prediciting and assessing responsiveness of thyroid and kidney cancer subjects to lenvatinib compounds
MX2015004979A (en) 2012-12-21 2015-07-17 Eisai R&D Man Co Ltd Amorphous form of quinoline derivative, and method for producing same.
ES2687968T3 (en) 2013-05-14 2018-10-30 Eisai R&D Management Co., Ltd. Biomarkers to predict and evaluate the reactivity of subjects with endometrial cancer to compounds with lenvatinib
BR112017002827B1 (en) 2014-08-28 2023-04-18 Eisai R&D Management Co., Ltd HIGHLY PURE QUINOLINE DERIVATIVE AND METHOD FOR PRODUCING THE SAME
MX2017010474A (en) 2015-02-25 2017-11-28 Eisai R&D Man Co Ltd Method for suppressing bitterness of quinoline derivative.
KR20240064733A (en) 2015-03-04 2024-05-13 머크 샤프 앤드 돔 코포레이션 Combination of a pd-1 antagonist and a vegfr/fgfr/ret tyrosine kinase inhibitor for treating cancer
SG11201710198YA (en) 2015-06-16 2018-01-30 Eisai R&D Man Co Ltd Anticancer agent

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0934931A2 (en) * 1995-06-07 1999-08-11 Sugen, Inc. 3-Benzylidene-2-indolinones and their analogues as tyrosine kinase activity modulators
WO2001064200A2 (en) * 2000-03-03 2001-09-07 Novartis Ag Use of pdgf receptor tyrosine kinase inhibitors for the treatment of diabetic nephropathy
WO2004014903A1 (en) * 2002-08-02 2004-02-19 Ab Science 2-(3-aminoaryl)amino-4-aryl-thiazoles and their use as c-kit inhibitors
WO2004076693A1 (en) * 2003-02-27 2004-09-10 Ab Science Tailored treatment suitable for different forms of mastocytosis
WO2004098612A2 (en) * 2003-05-07 2004-11-18 Ab Science Calcitriol analogs of uses thereof
WO2004105763A2 (en) * 2003-05-27 2004-12-09 Haegerkvist Robert Per Use of tyrosine kinase inhibitor to treat diabetes

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0934931A2 (en) * 1995-06-07 1999-08-11 Sugen, Inc. 3-Benzylidene-2-indolinones and their analogues as tyrosine kinase activity modulators
WO2001064200A2 (en) * 2000-03-03 2001-09-07 Novartis Ag Use of pdgf receptor tyrosine kinase inhibitors for the treatment of diabetic nephropathy
WO2004014903A1 (en) * 2002-08-02 2004-02-19 Ab Science 2-(3-aminoaryl)amino-4-aryl-thiazoles and their use as c-kit inhibitors
WO2004076693A1 (en) * 2003-02-27 2004-09-10 Ab Science Tailored treatment suitable for different forms of mastocytosis
WO2004098612A2 (en) * 2003-05-07 2004-11-18 Ab Science Calcitriol analogs of uses thereof
WO2004105763A2 (en) * 2003-05-27 2004-12-09 Haegerkvist Robert Per Use of tyrosine kinase inhibitor to treat diabetes

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MA Y ET AL: "INDOLINONE DERIVATIVES INHIBIT CONSTITUTIVELY ACTIVATED KIT MUTANTS AND KILL NEOPLASTIC MAST CELLS" JOURNAL OF INVESTIGATIVE DERMATOLOGY, NEW YORK, NY, US, vol. 114, no. 2, February 2001 (2001-02), pages 392-394, XP001127437 ISSN: 0022-202X *
See also references of EP1653934A2 *
ZERMATI Y ET AL: "Effect of tyrosine kinase inhibitor STI571 on the kinase activity of wild-type and various mutated c - kit receptors found i mast cell neoplasms" ONCOGENE, BASINGSTOKE, HANTS, GB, vol. 22, 2003, pages 660-664, XP002286458 ISSN: 0950-9232 *

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7994177B2 (en) 2003-09-22 2011-08-09 Purdue Pharma L.P. Therapeutic agents useful for treating pain
US8129388B2 (en) 2003-09-22 2012-03-06 Purde Pharma L.P. Therapeutic agents useful for treating pain
US7772254B2 (en) 2003-09-22 2010-08-10 Purdue Pharma L.P. Therapeutic agents useful for treating pain
US7799807B2 (en) 2003-09-22 2010-09-21 Purdue Pharma L.P. Therapeutic agents useful for treating pain
US7964606B2 (en) 2003-09-22 2011-06-21 Purdue Pharma L.P. Therapeutic agents useful for treating pain
EP1702917A1 (en) * 2003-12-25 2006-09-20 Nippon Shinyaku Co., Ltd. Amide derivative and medicine
EP1702917A4 (en) * 2003-12-25 2009-06-03 Nippon Shinyaku Co Ltd Amide derivative and medicine
US8088806B2 (en) 2005-05-09 2012-01-03 Achillion Pharmaceuticals, Inc. Thiazole compounds and methods of use
US8008304B2 (en) 2005-12-28 2011-08-30 Grüenthal GmbH Substituted propiolic acid amides and their use for producing drugs
WO2007079959A1 (en) * 2005-12-28 2007-07-19 Grünenthal GmbH Substituted propiolic acid amides and their use for producing analgesics
DE102005062986A1 (en) * 2005-12-28 2007-07-05 Grünenthal GmbH New substituted propiolic acid amides, useful for treatment and prevention of e.g. pain, anxiety and panic attacks, are inhibitors of the mGluR5 receptor
US10799466B2 (en) 2006-09-20 2020-10-13 The Board Of Regents Of The University Of Texas System Methods for delivering volatile anesthetics for regional anesthesia and/or pain relief
US10357464B2 (en) 2006-09-20 2019-07-23 The Board Of Regents Of The University Of Texas System Methods for delivering volatile anesthetics for regional anesthesia and/or pain relief
US9713613B2 (en) 2007-02-02 2017-07-25 Motonari Uesugi Methods and compositions for the treatment of cancer and related hyperproliferative disorders
EP2366703A1 (en) 2007-02-13 2011-09-21 AB Science Polymorph form of 2-amino (nitroaryl) thiazole derivative
US8183263B2 (en) 2007-05-22 2012-05-22 Achillion Pharmaceuticals, Inc. Heteroaryl substituted thiazoles
EP2060565A1 (en) 2007-11-16 2009-05-20 4Sc Ag Novel bifunctional compounds which inhibit protein kinases and histone deacetylases
US9675544B2 (en) 2008-01-22 2017-06-13 The Board Of Regents Of The University Of Texas System Volatile anesthetic compositions comprising extractive solvents for regional anesthesia and/or pain relief
US10420720B2 (en) 2008-01-22 2019-09-24 The Board Of Regents Of The University Of Texas System Volatile anesthetic compositions comprising extractive solvents for regional anesthesia and/or pain relief
US8106209B2 (en) 2008-06-06 2012-01-31 Achillion Pharmaceuticals, Inc. Substituted aminothiazole prodrugs of compounds with anti-HCV activity
WO2022036104A1 (en) * 2020-08-12 2022-02-17 University Of Iowa Research Foundation Insulin sensitizers for the treatment of diabetes mellitus

Also Published As

Publication number Publication date
US20070032521A1 (en) 2007-02-08
CA2535242A1 (en) 2005-02-24
EP1653934A2 (en) 2006-05-10
WO2005016323A3 (en) 2005-04-07
JP2007502809A (en) 2007-02-15
DE602004013792D1 (en) 2008-06-26
ATE395052T1 (en) 2008-05-15
EP1653934B1 (en) 2008-05-14

Similar Documents

Publication Publication Date Title
WO2005016323A2 (en) Use of c-kit inhibitors for treating type ii diabetes
KR101036866B1 (en) 2-3-aminoarylamino-4-aryl-thiazoles and their use as c-kit inhibitors
US20070191267A1 (en) Use of tyrosine kinase inhibitors for treating cerebral ischemia
CA2564568A1 (en) Use of c-kit inhibitors for treating inflammatory muscle disorders including myositis and muscular dystrophy
WO2005115304A2 (en) Use of c-kit inhibitors for treating fibrodysplasia
US8450302B2 (en) 2-(3-aminoaryl) amino-4-aryl-thiazoles and their use as c-kit inhibitors
US20070225293A1 (en) Use of C-Kit Inhibitors for Treating Fibrosis
US8614222B2 (en) Methods of preventing and treating low bone mass diseases
KR20160029024A (en) Purine diones as wnt pathway modulators
AU6387799A (en) Method for treating diabetes employing an ap2 inhibitor and combination
JP2007533731A (en) Use of c-kit inhibitors for treating malaria parasite-related diseases
EP2282756A1 (en) Methods of diagnosing, preventing and treating bone mass diseases
AU2003253195B2 (en) 2-(3-aminoaryl)amino-4-aryl-thiazoles and their use as c-kit inhibitors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2535242

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2004769332

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2006523710

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2004769332

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2007032521

Country of ref document: US

Ref document number: 10567557

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10567557

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 2004769332

Country of ref document: EP