WO2005014850A2 - Systems and methods for analyzing nucleic acid sequences - Google Patents

Systems and methods for analyzing nucleic acid sequences Download PDF

Info

Publication number
WO2005014850A2
WO2005014850A2 PCT/US2004/025526 US2004025526W WO2005014850A2 WO 2005014850 A2 WO2005014850 A2 WO 2005014850A2 US 2004025526 W US2004025526 W US 2004025526W WO 2005014850 A2 WO2005014850 A2 WO 2005014850A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nos
primer
primers
assay
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/025526
Other languages
French (fr)
Other versions
WO2005014850A3 (en
Inventor
Edward I. Ginns
Marzena Galdzicka
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Massachusetts Amherst
Original Assignee
University of Massachusetts Amherst
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Massachusetts Amherst filed Critical University of Massachusetts Amherst
Publication of WO2005014850A2 publication Critical patent/WO2005014850A2/en
Anticipated expiration legal-status Critical
Publication of WO2005014850A3 publication Critical patent/WO2005014850A3/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G01N35/00584—Control arrangements for automatic analysers
    • G01N35/00722—Communications; Identification
    • G01N35/00871—Communications between instruments or with remote terminals

Definitions

  • the present invention provides novel automated systems and methods to perform assays on nucleic acid sequences (e.g., clinically relevant nucleic acid sequences).
  • the system can provide assay results quickly, accurately, and in a format easily accessible by health care providers and/or third party payors-(e.g., insurance companies).
  • the invention also provides novel and highly accurate assays using mass spectrometry (e.g., matrix-assisted laser desorption/ionization (MALDI)).
  • MALDI matrix-assisted laser desorption/ionization
  • the invention provides a system for performing a diagnostic assay on a biological sample.
  • the system includes, as its main components (a) a central controller programmed to: (i) exchange infomiation about the biological sample with an outside system or database; and (ii) exchange information about the biological sample with one or more modules of the system; (b) a sample transfer module for transferring a portion of the sample to a first container; (c) a nucleic acid extraction module for extracting nucleic acids from cells within the portion and for transferring the portion from the first container to a second container; (d) a nucleic acid measurement module for measuring the concentration of nucleic acids in the portion; (e) a PCR preparation module for adding polymerase chain reaction (PCR) reaction materials (e.g., individual nucleotides, primers, polymerase enzymes, and reagents) to the portion; (f) a thermocyling module for amplifying a target sequence and extending a primer in the portion; (g) a primer extension preparation module for adding primer extension reaction materials to the portion; (h) a mass spectrometry
  • the central controller can be a computer system, e.g., a commercially available personal computer system, and can include linking software that enables the central controller to communicate with at least one other module in the system.
  • the system can also include a plate editor module that provides sample information to the PCR preparation module, a transport module comprising one or more robotic arms or tracks to transport a biological sample, or portion thereof, between at least two modules of (a) to (i), and arranged to receive information from and transmit information to the central controller.
  • the system can also include a detection module for detecting the presence of a sample and monitoring the progress of the sample through the system, and arranged to receive information from and transmit information to the central controller.
  • the nucleic acids measurement system can include an ultraviolet light spectrophotometer or a fluorometer.
  • the PCR preparation module can include a pipetting robot, and the thermocycling system can include a thermocyler.
  • the system can further include a computer-readable medium comprising one or more programs for instructing a given module.
  • the PCR preparation module can include PCR materials, e.g., at least one primer set described herein, e.g., a primer set selected from among SEQ ID NOS:l to 504, each primer set including two amplification primers and one detection extension primer.
  • the sample transfer system can include a pipetting robot.
  • the invention provides a method of performing a diagnostic assay on a biological sample.
  • the method includes (a) performing on a biological sample an assay using a clinical assay system, wherem the assay comprises mass spectrometry analysis of a target nucleic acid; and (b) automatically reporting information about the assay from a central controller of the clinical assay system to an outside system or database accessible by at least one health care provider (e.g., at least 2, 10, or more than 10) or at least one third party payor (e.g., at least 2, 10, or more than 10).
  • a health care provider e.g., at least 2, 10, or more than 10
  • third party payor e.g., at least 2, 10, or more than 10
  • the clinical assay system can include at least one component selected from the group consisting of: a central controller, a sample transfer module, a nucleic acid extraction module, a nucleic acid measurement module, a PCR preparation module, a thermocyling module, a primer extension preparation module, a mass spectrometry preparation module, and a mass spectrometry module.
  • the invention provides a method of performing a diagnostic assay on a biological sample.
  • the method includes (a) receiving a biological sample, generating information about the biological sample, and transmitting the information to a central controller; (b) transferring a portion of the biological sample to a first container; (c) extracting nucleic acids from cells within the portion and transferring the portion to a second container; (d) measuring the concentration of extracted nucleic acids in the portion; (e) adding polymerase chain reaction (PCR) materials to the portion; (f) amplifying target nucleic acids in the portion; (g) adding primer extension reaction materials to the portion; (h) extending a detection extension primer in the portion; (i) transferring a sample of the portion from the second container to a support; (j) analyzing the sample and exporting data to the central controller using a mass spectrometry system; and (k) transmitting the data from the central controller to an output device, external system, or database.
  • PCR polymerase chain reaction
  • steps (a) to (k) can be performed automatically by an automated system.
  • the automated system can include at least one component selected from the group consisting of: a central controller, a sample transfer module, a nucleic acid extraction module, a nucleic acid measurement module, a PCR preparation module, a thermocyling module, a primer extension preparation module, a mass spectrometry preparation module, and a mass spectrometry module.
  • the diagnostic assay can be an assay for detecting mutations in a gene.
  • the gene can be a gene selected from the group consisting of: 5,10- Methylenetetrahydrofolate Reductase (MTFR); Coagulation Factor II; Coagulation Factor N; hemochromatosis (HFE); and a glucocerebrosidase (GC).
  • MTFR 5,10- Methylenetetrahydrofolate Reductase
  • Coagulation Factor II Coagulation Factor N
  • HFE hemochromatosis
  • GC glucocerebrosidase
  • fibroblast growth factor receptor 3 aspartoacylase
  • Glucocerebrosidase Coagulation Factor Nil
  • Fanconi Anemia Complementation
  • Group C (FA ⁇ CC); inhibitor of kappa light polypeptide gene enhancer in b cells, kinase complex-associated protem; acid sphingomyelinase; hexosaminidase; angiotensin i-converting enzyme; adenylate cyclase 9; apolipoprotein A-l; apolipoprotein E; endothelial leukocyte adhesion molecule 1; fc fragment of IGG, low affinity Ila, receptor; fibrinogen beta chain; coagulation factor II, factor XIII; guanine nucleotide-binding protein beta-3; integrin, alpha-2, glycoprotein Ia/Iia; glycoprotein lb, platelet, alpha polypeptide; intercellular adhesion molecule 1; glycoprotein Ia/IIa (a2), integrin, alpha-2; platelet glycoprotein lib, integrin, alpha- 2b; glycoprotein Ilb/IIIa, integrin, beta-3;
  • the diagnostic assay is an assay for detecting a pathogen in the sample, e.g., a virus, bacterium, or fungus.
  • the virus can be a virus of the family Herpesviridae, e.g., cytomegalovirus (CMN).
  • CMV cytomegalovirus
  • the invention provides an method, e.g., an automated method, for detecting mutations in a target gene.
  • the method includes a) amplifying a target sequence using PCR and performing, e.g., automatically, a primer extension reaction using a set of three primers, each set of primers including two amplification primers and one detection extension primer; b) ⁇ transferring, e.g., automatically, detection extension primers to a mass spectrometry device; and c) determining, e.g., automatically, the molecular weights of the detection extension primers by mass spectrometry following the primer extension reaction, wherein a change in the molecular weight of the extended primer, as compared to a control, indicates the presence of a mutation in the gene.
  • the method can include automatically transmitting information related to the presence of the mutation to a central controller.
  • the gene is a 5,10-Methylenetetrahydrofolate Reductase (MTFR) gene, and the set of three primers is selected from the group .consisting of: SEQ ID ⁇ OS: 1, 2, and 3; SEQ ID ⁇ OS: 4, 5 and 6; SEQ ID ⁇ OS: 1, 8, and 9; and SEQ ID ⁇ OS: 10, 11, and 12; each set of primers including two amplification primers and one detection extension primer.
  • the gene is a Coagulation Factor II gene, and the set of three primers is selected from the group consisting of: SEQ ID NOS: 13, 14, and 15 and SEQ ID NOS: 16, 17 and 18; each primer set including two amplification primers and one detection extension primer.
  • the gene is a Coagulation Factor Ngene
  • the set of three primers is selected from the group consisting of: SEQ ID ⁇ OS: 19, 20, and 21 or SEQ ID ⁇ OS: 22, 23 and 24; each primer set including two amplification primers and one detection extension primer.
  • the gene is a hemochromatosis (HFE) gene
  • the set of three primers is selected from the group consisting of: SEQ ID ⁇ OS: 40, 41, and 42, SEQ ID ⁇ OS: 43, 44 and 45; SEQ ID ⁇ OS: 46, 47 and 48; SEQ ID ⁇ OS: 49, 50 and 51; SEQ ID ⁇ OS: 52, 53 and 54; or SEQ ID ⁇ OS: 55, 56 and 57; each set of primers including two amplification primers and one detection extension primer.
  • the invention includes a method, e.g., an automated method, for detecting a pathogen in a biological sample.
  • the method includes a) amplifying a target sequence using PCR and performing, e.g., automatically, a primer extension reaction using a set of three primers, each set of primers including two amplification primers and one detection extension primer; b) transferring,e.g., automatically, detection extension primers to a mass spectrometry device; and c) determining, e.g., automatically, the molecular weights of the detection extension primers by mass spectrometry following the primer extension reaction, wherein a change in the molecular weight of the extended primer, as compared to controls, indicates the presence presence of a pathogen in the sample.
  • the controls can include an internal control for determining the amount of the pathogen in the sample.
  • the pathogen is cytomegaloviras (CMN)
  • the three primers are selected from the group consisting of: SEQ ID ⁇ OS: 25, 26, and 27; SEQ ID ⁇ OS: 28, 29 and 30; SEQ ID ⁇ OS: 31, 32, and 33; SEQ ID ⁇ OS: 34, 35, and 36; SEQ ID ⁇ OS: 37, 38, and 39; and SEQ ID ⁇ OS: 58, 59, and 60; each primer set including two amplification primers and one detection extension primer.
  • the mvention includes an isolated D ⁇ A selected from the group consisting of SEQ ID ⁇ OS .: 1 to 504.
  • the invention includes a kit that includes at least one primer set described herein, e.g., a primer set selected from among SEQ ID NOS:l to 504, each primer set including two amplification primers and one detection extension primer, and instructions for using the primer set to detect or analyze a target nucleic acid sequence in a biological sample.
  • instructions can be provided to describe how to use the primers to detect the presence of, or identify mutations in, a particular nucleic acid sequence or gene.
  • the instructions can describe how to use the primers to detect the presence of a pathogen (e.g., a virus, bacterium, and/or fungus), the quantity of the pathogen, and/or the genotype of the pathogen.
  • a pathogen e.g., a virus, bacterium, and/or fungus
  • the mvention includes a computer readable medium that includes a program for instructing a central controller in an automated system for performing an assay on a biological sample to: (a) receive a biological sample, generate information about the biological sample, and transmit the information into a central controller; (b) transfer a portion of the biological sample to a first container; (c) extract nucleic acids from cells within the portion and transfer the portion to a second container; (d) measure the concentration of extracted nucleic acids in the portion; (e) add polymerase chain reaction (PCR) materials to the portion; (f) amplify target nucleic acids in the portion; (g) add primer extension reaction materials to the portion; (h) extend a detection extension primer in the portion; (i) transfer a sample of the portion from the second container to a support; (j) analyze the sample and exporting data to the central controller using a mass spectrometry system; and (k) transmit the data from the central controller to an output device, external system, or database.
  • PCR polymerase chain reaction
  • FIG. 1 is a diagram illustrating the main components of a clinical assay system and the flow of biological samples and information through the system.
  • FIG. 2 is a flow diagram illustrating the steps of the clinical assay system.
  • FIG. 3 is a mass spectrum of a heterozygous "TC" allele (heterozygous positive) generated using a screen for a C677T mutation in the 5,10-Methylenetetrahydrofolate Reductase (MTFR) gene.
  • FIG. 4 is a mass spectrum of a heterozygous "GA” allele (heterozygous positive) generated using a screen for a G20210A mutation in the Coagulation Factor II (FII) gene.
  • FIG. 5 is a mass spectrum of a heterozygous "GA” allele (heterozygous positive) generated using a screen for a R506Q mutation in the Coagulation Factor V gene.
  • FIG. 6 is a mass spectrum of a heterozygous "GA” allele (heterozygous positive) generated using a screen for a R506Q mutation in the Coagulation Factor V gene.
  • FIG. 7 is a mass spectrum of heterozygous "GC” alleles (heterozygous positive) for H63D Histidine to Aspartic acid (C187G) mutation in the FM3-E assay.
  • FIG. 8 is a mass spectrum of heterozygous "GC” alleles (heterozygous positive) for H63D Histidine to Aspartic acid (C187G) mutation in the HFE-E3 assay.
  • FIG. 9 is a mass spectrum of heterozygous "GA” alleles (heterozygous positive) for S65C Serine to Cysteine (A193T) mutation in the HFE S65C El assay.
  • FIG. 10 is a mass spectrum of heterozygous "GA” alleles (heterozygous positive) for S65C Serine to Cysteine (A193T) mutation in the HFE S65C E5 assay.
  • FIG. 11 is a mass spectrum of heterozygous "GA” alleles (heterozygous positive) for
  • FIG. 12 is a mass spectrum of heterozygous "GA" alleles (heterozygous positive) for C282Y cysteine to tyrosine (G845A) mutation in the HFE-E6 assay.
  • FIG. 13A1-13A3 is a set of mass spectra in a CMV quantitative assay on samples containing 400 CMV copies/ml.
  • FIG. 13B1-13B3 is a set of mass spectra in a CMN quantitative assay on samples containing 4000 CMN copies/ml.
  • FIG. 13C1-13C3 is a set of mass spectra in a CMN quantitative assay on samples containing 40,000 CMN copies/ml.
  • FIG. 13D-13D3 is a set of mass spectra in a CMN quantitative assay on samples containing 400,000 CMN copies/ml.
  • FIG. 13E1-13E3 is a set of mass spectra in a CMN quantitative assay on samples containing 4,000,000 CMN copies/ml.
  • FIG. 13F1-13F3 is a set of mass spectra in a CMN quantitative assay on samples containing 40,000,000 CMN copies/ml.
  • FIG. 13G1-13G3 is a set of mass spectra in a CMN quantitative assay on samples containing 400,000,000 CMN copies/ml.
  • FIG. 14 is a graph that plots CMN plasma samples versus internal standards.
  • a CMN control (4xl0 9 copies per ml) was diluted down to 40 copies/ml in 10-fold increments, mixed with the Internal Standard of appropriate concentration, extracted (240 ⁇ l) on MDX (Qiagen), eluted in 75 ⁇ l of buffer and assayed (2 ⁇ l) by PCR, followed by SAP treatment, extension reaction and mass spectrometry analysis.
  • FIG. 15A-15GG is a table that lists a number of genetic targets for the assays of the invention, along with exemplary primers for those targets.
  • the invention provides a new highly automated system for performing clinical assays, optionally with automatic billing to third party providers such as insurance companies.
  • the invention also provides novel assays using mass spectrometry (e.g., matrix-assisted laser desorption/ionization (MALDI).
  • MALDI matrix-assisted laser desorption/ionization
  • the assays are highly accurate and can detect, for example, sequence variations (e.g., mutations and/or polymorphisms) and foreign sequences (e.g., viral sequences) incorporated into a target gene.
  • sequence variations e.g., mutations and/or polymorphisms
  • foreign sequences e.g., viral sequences
  • the assays are also useful for infectious disease/pathogen testing.
  • the entire process, or portions thereof, can be automated, i.e., performed by machine(s).
  • the present invention also includes a high-throughput process for performing the assays described herein.
  • the new system can perform dozens (e.g., 96, 128, 384) of different assays on dozens of different biological samples at the same time.
  • FIG. 1 provides an overview of the clinical assay system 2 of the present invention.
  • the clinical assay system includes, as its main components, the following modules.
  • a central controller 4 for exchanging information about the biological sample with an outside system or database 8 and with one or more modules or systems within clinical assay system, and an input device 6;
  • a sample transfer system 10 for transferring a portion of the sample to a first container;
  • a nucleic acid extraction system 12 for extracting nucleic acids from the portion and for transferring the portion from the first container to a second container;
  • a nucleic acid measurement system 14 for measuring the concentration of nucleic acids in the portion;
  • a PCR preparation system 16 for adding polymerase chain reaction (PCR) reaction materials to the portion;
  • a thermocycling system 18 for amplifying a target sequence and extending a primer in the portion;
  • a primer extension preparation system 20 for adding primer extension reaction materials to the portion;
  • a mass spectrometry preparation system 22 for removing a sample of the portion from
  • the central controller is capable of controlling one or more system modules, collecting and organizing data obtained from one or more of the system modules and an outside system or database, and of sending data to one or more of the system modules and an outside database (e.g., a database accessible by healthcare providers or third parties) or system (e.g., an outside computer through which health care providers or third parties can access the data).
  • the input device 6 associated with the central controller can be a bar code reader.
  • the system can optionally include a detection system 5 for detecting and tracking a sample as it progresses through the system.
  • the system can also include a transport subsystem 25, e.g., a system of one or more robotic arms and/or tracks, for transporting samples between two or more modules within the system.
  • the central controller 4 is a computer system.
  • the computer systems that can be used are commonly available personal computers having read-write memory, or industrial counterparts thereof.
  • the central controller is provided with a suitable input device 6 such as a keyboard, touch screen, card reader, bar code scanner, or another computer (e.g., for inputting biological sample processing instructions and patient identification information).
  • the central controller 4 is run by linking software, which directs the central controller to receive information from, and/or transmit information to, each of the modules in the overall system.
  • the central controller can be configured to exchange information with one or more modules within the clinical assay system, and to relay that information to one or more other modules.
  • Such information may include information about a biological sample, e.g., sample identification, information as to which assay(s) is to be/has been performed on a sample, and the location of a sample within the clinical assay system and within a given batch of samples being processed.
  • the central controller 4 is also configured to exchange information with outside systems and/or databases 8 (i.e., systems or databases not part of the clinical assay system). This configuration allows the central controller to report, e.g., the results of the clinical assays described herein, along with other data, e.g., billing amounts, patient identification, and other data to health-care providers (e.g., technicians, nurses, physicians) and/or third parties (e.g., insurance providers) at other sites. Reporting can occur automatically.
  • health-care providers e.g., technicians, nurses, physicians
  • third parties e.g., insurance providers
  • Exemplary of outside systems are systems capable of interfacing directly with the central controller, or with a database accessible by both the outside system and the central controller.
  • MeditechTM provides a laboratory application that allows multisite and/or multifacility specimen tracking, through which the central controller can exchange information with outside systems.
  • Sample Transfer Module The sample transfer system 10 can be any system capable of receiving a biological sample, e.g., a blood sample, removing an aliquot of the sample, and placing the aliquot into one or more receptacles.
  • Exemplary systems are pipetting robots, such as the Genesis® FreedomTM Automated Workstation.
  • the system is capable of scanning sample tube barcodes and multiwell (e.g., 96-well) plates, and creating a file that indicates where on the multiwell plate a sample is located following the ' transfer.
  • the file can include information such as the barcodes of scanned sample tubes, the location of these samples on the multiwell plate, the volume transferred from the sample tube to the plate, and overall identifying information (e.g., a barcode) for of the multiwell plate (called DNA plate).
  • the nucleic acid extraction system 12 can be any system capable of carrying out techniques, such as those described herein, for purifying nucleic acids (i.e., DNA and/or RNA) from one or more biological samples.
  • nucleic acids i.e., DNA and/or RNA
  • An example of such a system is the BioRobot® MDx produced by Qiagen.
  • the nucleic acids measurement system 14 can be any system capable of measuring the concentration of nucleic acids in a sample.
  • the system can be a commercially available ultraviolet (UN) light spectrophotometer, which is capable of determining the concentration of nucleic acids using optical density measurements.
  • the system can be capable of measuring the UN-induced fluorescence of dye (e.g., ethidium bromide or Pico Green) intercalated into the nucleic acid, such as a fluorometer.
  • the Genesis® FreedomTM Automated Workstation produced by Tecan can include such a fluorometer.
  • the nucleic acid measurement system can be associated with (e.g., a part of) the sample transfer system, or it can be a stand-alone module.
  • the PCR preparation system 16 can be any system capable of adding appropriate materials, e.g., enzymes (e.g., Taq polymerase), nucleic acid primers, individual nucleotides, and reagents, to an aliquot in preparation for amplifying a target sequence in the aliquot.
  • the PCR preparation also prepares appropriate control reaction mixes. Examples of such systems are the Genesis® Automated Workstation and the Tecan TeMOTM multi-pipetting module.
  • the PCR preparation system is capable of performing at least two steps. The first is to dispense appropriate assay mixes. Assay mixes can be prepared by an individual, e.g., a technician, or by a robot, according to typical laboratory procedures, and placed into holders.
  • PCR preparation system dispenses the mixes from the holders to a position on a second multiwell (e.g., 384) plate, according to instructions (e.g., sample identification and assays to be performed) it receives from a plate editor 7 (described in detail below).
  • the second is to add samples to the appropriate assay mix.
  • the PCR preparation system uses the file received by the PCR preparation system 16 from the sample transfer system 10, the PCR preparation system transfers samples from the first multiwell (e.g., 96 well) plate to the second multiwell (e.g., 384 well) plate. In this way, the PCR preparation system is able to transfer samples from a first plate to a second plate, while keeping track of the location of the samples, and to ensure that the appropriate assays are performed on each sample.
  • thermocycling system 18 can be any system capable of performing PCR reactions, e.g., PCR amplification and/or primer extension reactions, and is typically a commercially available thermocycler.
  • Exemplary systems include the GeneAmp PCR System 9700 manufactured by Applied Biosystems, the Perkin Elmer 2000 PCR thermocycler, and the PTC- 200 thermocycler manufactured by MJ Research.
  • the primer extension preparation system 20 can be any system capable of adding appropriate materials, e.g., Shrimp Alkaline Phosphatase (SAP; to dephosphorylate unincorporated dNTPs), extension primers (e.g., the extension primers described herein), and appropriate mixtures of dNTPs and ddNTPs, to an aliquot in preparation for performing primer extension reactions.
  • SAP Shrimp Alkaline Phosphatase
  • extension primers e.g., the extension primers described herein
  • appropriate mixtures of dNTPs and ddNTPs e.g., the extension primers described herein
  • An exemplary system is the MultimekTM manufactured by Beckman- Coulter Mass Spectrometry Preparation Module
  • the mass spectrometry preparation system 22 can be any system capable of removing a sample of an aliquot and placing the sample on a support, e.g., a chip, for analysis by mass spectroscopy.
  • the support can be composed of any material known to those skilled in the art to be usable in mass spectrometry, e.g., silicon, plastic, glass, and/or ceramic.
  • a wide variety of chips are commercially available. Exemplary of chips is the Sequenom® SpectroCHIPTM, which is supplied in 384 well format and are pre-spotted with a specially formulated matrix assisted laser desorption ionization (MALDI) matrix.
  • MALDI matrix assisted laser desorption ionization
  • the matrix can be of any composition known in the art of mass spectrometry, e.g., a -cyano-4-hydroxy cinnamic acid (CHCA), 2,4,6-trihydroxy acetophenone (THAP), or 3-dydroxypicolinic acid (3 -HP A) in ammonium citrate, the choice of which will depend, e.g., on the mass spectrometry system used and the assay to be performed.
  • exemplary of the mass spectrometry preparation systems is the Sequenom® SpectroPOINTTM, a nanoliter sample dispensing instrument.
  • the mass spectrometry system 24 can be any commercially available mass spectrometer.
  • the clinical assay system of the present mvention can be configured to utilize mass spectrometer formats including matrix assisted laser desorption ionization (MALDI), electrospray (ES), ion cyclotron resonance (ICR) and Fourier Transform.
  • maMALDI is utilized in the clinical assay system of the present invention.
  • An exemplary mass spectrometry system is the Sequenom® AutoflexTM Mass Spectrometer.
  • MALDI mass spectrometry various mass analyzers can be used, e.g., magnetic sector/magnetic deflection instruments in single or triple quadrupole mode (MS/MS), Fourier transform and time-of-flight (TOF) configurations as is known in the art of mass spectrometry.
  • mass analyzers e.g., magnetic sector/magnetic deflection instruments in single or triple quadrupole mode (MS/MS), Fourier transform and time-of-flight (TOF) configurations as is known in the art of mass spectrometry.
  • TOF time-of-flight
  • MALDI-TOF is employed to analyze the biological samples.
  • the clinical assay system includes a transport system 25.
  • the transport system can be capable of (i) transporting containers, e.g., containing biological samples, from a source (e.g., a separate site in which biological samples are obtained from a patient) to the clinical assay system; (ii) transporting containers between at least two modules within the clinical assay system; and/or (iii) transporting containers away from the clinical assay system to a predefined destination after completion of the assay.
  • the transport system is capable of communicating with the central controller so the central controller can direct the transport system and/or receive information as to the location of sample within the clinical assay system.
  • the transport system can comprise one or more robotic arms or tracks, or a combination of robotic arms and tracks.
  • the clinical assay system includes a detection system 5 for detecting the presence of a biological sample and monitoring the progress of the sample through the system.
  • the detection system is capable of receiving information from and transmitting information to the central controller.
  • the detection system can include a network of sensors, e.g., barcode readers, reed switches, weight systems (where the detector detects the presence of a sample by its weight); or optical interrupters, or combinations thereof, arranged throughout the clinical assay system, each of which are capable of transmitting information, directly or indirectly, to the central controller.
  • the clinical assay system includes novel software for adapting one or more modules to be used in the system.
  • the central controller includes a novel software program to provide an interface between itself and an outside system or database (e.g., Meditech).
  • the software causes the central controller to send information (e.g., automatically) about the clinical assays (e.g., the results and/or billing information) to at least one outside system (e.g., a computer not associated with the clinical assay system) or at least one outside database (e.g., a Meditech database).
  • This configuration allows the clinical assay system to directly report results and billing information to at least one healthcare provider, at least one third party payor (e.g., an insurance company), or to both.
  • the software can be written such that the central controller performs a final check of assay results before sending to the outside system or database, halting transmission of the data and/or alerting a technician of potential problems with the results.
  • the interface program can include a checking scheme to ensure that the results of the duplicate analyses agree with each other.
  • the central controller also includes a software program for linking at least one other module of the system to the central controller ("linking software").
  • the module(s) also include linking software allowing the module(s) to communicate with the central controller.
  • the linking software can allow the central controller to control the module (e.g., to instruct the module as to when and whether to execute a function), and to provide to the module(s) information about the biological sample (e.g., the tests to be performed on the sample).
  • the linking software also allows the central controller to receive information from the module(s), e.g., assay results, information about the location of the sample, and the like.
  • plate editor software 7 can be loaded on the central controller and/or on a separate computer, e.g., a second computer system.
  • the plate editor software can receive information from an outside system or database, such as patient information, tests to be performed, billing information, etc., and create a file that maps on a hypothetical 384-well plate where each assay for each sample will be located, and links this location to all data and information associated with each assay (one sample can have several assays, e.g., 1, 2, 3, or 4 assays).
  • the plate editor software "maps out,” in advance of processing a batch of samples through the clinical assay system, an arrangement of assays on a 384-well plate.
  • This file can be used by other modules in the system, e.g., the sample PCR preparation system and the mass spectrometry system, to track the samples and their associated assay results as they move through the system.
  • a relational database e.g., Oracle software.
  • the relational database can be loaded on the central controller and/or a separate controller, e.g., a second computer system.
  • the relational database stores information from the plate editor and from an outside database or system (e.g., Meditech), and can be accessed by the outside system or database.
  • the sample transfer system 10 can include software causing it to receive at least one biological sample (e.g., a batch of samples), to obtain information about each sample (e.g., from a bar code associated with the sample), and to place an aliquot of the sample into a multiwell plate while keeping track of the location of the aliquot within the multiwell (e.g., a 96 well) plate.
  • the software can instruct the sample transfer system to compile the information (e.g., identity of the sample and the location of the sample in the multiwell plate) into a file, which can then be transmitted to the central controller and/or other modules, e.g., the PCR preparation system.
  • An example of software that can be used, for example, with sample transfer system 10 is attached hereto as Appendix 1 and is described in detail below.
  • OutFileGenerator. exe Laboratory software, e.g., GeminiTM (Tecan) software, allows users to control robotic and liquid handling functions and to write specific application scripts based on the user's needs.
  • OutFileGenerator.exe is part of the Gemini program that performs specimen transfer from original bar-coded tubes into a 96-well destination plate, prior to extraction. First, all racks, test tubes, and destination plates are scanned by the barcode seamier. The positions of all racks, tubes, and destination plates, are loaded to the file C: ⁇ Program Files ⁇ Gemini ⁇ Output ⁇ " created by Gemini the function.
  • the PCR preparation system can include software causing it to obtain information (e.g., sample identification and assays to be performed on each sample) about each sample from the sample transfer system and the plate editor, and causing it to add specific PCR materials (e.g., specific primers, nucleotides, etc.) to each sample.
  • specific PCR materials e.g., specific primers, nucleotides, etc.
  • the software can cause the PCR preparation system to (a) dispense appropriate assay mixes; and (b) to add samples to the appropriate assay mix. Examples of programs instructing functions (a) and (b) are attached hereto as Appendix 2 and 3, respectively, and are described in further detail below.
  • Assay Transfer is an exemplary Gemini program (Appendix 2) for dispensing an aliquot 3 ⁇ l, e.g., of assay mixes to PCR plates, e.g., 384-well plates, (i.e., performing function (a) as discussed above). It uses a file called "input file,” which is exported from Plate Editor MassARRAY (Sequenom). This file contains all information about the PCR plate, e.g., the location on a plate a particular assay will be run and into which a particular DNA sample should be placed, as well as the barcode of the plate.
  • Module 1 changes the name of a letter/number well (e.g., Al, A2) description, into a well number for a 96 well plate;
  • Module 2 performs the same function as Module 1, but for a 384 well plate;
  • Module 3 includes comments for module 4 execution; and
  • Module 4 generates a worklist for making the transfer of assay mixes into a 384 well plate.
  • a letter/number well e.g., Al, A2
  • the events as dictated by the program are as follows: 1) the barcode of the PCR plate is read by barcode reader (Gemini script); 2) the major part of the program is run by PCRMix Transfer.exe, NB script: a) the input file is opened and the column "Well Position" containing alphanumeric characters is divided into two columns: one contains alpha- characters and the second contains numerical characters; b) the file is sorted by column containing numerical characters, meaning that assay mixes will be dispensed later by columns.
  • the DNA Transfer.gem program (Appendix 3) is an exemplary Gemini program for obtaining an aliquot, e.g., 2 ⁇ l, of DNA aspirated from DNA plate, e.g., a 96-well plate, and dispensing it to PCR plate, e.g., a 384 well plate, which contains a particular PCR mix.
  • PCR plate e.g., a 384 well plate, which contains a particular PCR mix.
  • the program uses two files.
  • the first, “friputFile,” is exported from the Plate Editor of MassARRAY software saved in csv format (which is the same file used in AssayTranfer.gem for dispensing the PCR mixes). This file dictates where the DNA will be dispensed in the PCR plate (e.g., 384-well plate) by giving for each specimen ID an exact destination, i.e., a specific plate and well.
  • the second, “Output'barcode#.csv,” (made on FreedomTM (Tecan) by OutFileGenerator.exe) specifies the location of DNA samples in a particular 96-well DNA plate.
  • a worklist is prepared, which dictates where the DNA samples are dispensed to the PCR plate (destination plate).
  • the following commands are contained in this Gemini program: How many DNA plates will be run (in Gemini)?; How many PCR plates will be run (in Gemini)?; Reading the plates barcodes (instructions in Gemini); Execute: C: ⁇ programFiles ⁇ DNATransfer ⁇ DNATransfer.exe; Loading worklist C: ⁇ Gemini ⁇ Data ⁇ DNAtransfer ⁇ DNA list gwl; Execute loaded worklist; Export Data; Execute:
  • Module 1 instructs that the 'input file' is opened and the column "Well Position" containing alphanumeric characters is divided into two columns: one contain alpha- characters and second containing numerical characters; the file is sorted by column containing numerical characters first and then by column with alpha-characters.
  • Module 4 (a) contains a loop that takes each D ⁇ A ID from the 'inputfile'and goes through all files in the Output directory (containing Output'barcode#.csv" files) looking for the match of the ID to determine which well of the source plate from which a sample should be taken; and (b) creates a workfile containing all information needed for each D ⁇ A transfer, such as D ⁇ A ID, source well number, source plate type, source plate ID (that is a barcode of the 96-well D ⁇ A plate), volume to transfer, destination plate type, destination plate ID (barcode of 384-well PCR plate), destination well and tip number to be used; (c) CreatesTextFile("C: ⁇ Gemini ⁇ Logfiles ⁇ D ⁇ AIdLog.txt”); (d) instructs when, where and how the washes are performed.
  • Each wash is carried out as follows: (i) aspiration of 290 - 400 ⁇ l of bleach; (ii) tips are immersed in the bleach for 10 seconds; (iii) bleach is dispensed into wash station; followed by (iv) three washes with water, for example: 10 ml, 5 ml, 5 ml each. Bleach washes of the tips are performed if the Mix ID is different. A full wash (both bleach and water) is always performed at the end of worklist; and e) instructs termination of the run if it cannot file DNA in the outputbarcode file .csv plate, giving the message: "DNA Ids missing!
  • FinalOutputConverter.exe module 1 converts the original output file and puts it in a readable format containing: "DNA ID,” “Destination Well ID,” “Destination plate ID,” “Source Well ID,” and “Source Plate Id.”
  • Module 2 converts well number from integer (1) back to alphanumeric well number (Al).
  • Module 3 scans the directory and looks for files and converts them by adding the date to the files.
  • the primer extenstion preparation system can include similar software, i.e., software that causes it to receive information about each sample and the assays to be performed, so that the primer extension preparation system adds the specific primer extension reaction materials (e.g., specific detection extension primers, termination mixes, etc.) appropriate for performing that test(s) on the sample.
  • specific primer extension reaction materials e.g., specific detection extension primers, termination mixes, etc.
  • the methods and systems described herein can use a communications network to transmit information from the system (e.g., from the central controller) to healthcare providers and/or insurance companies.
  • These communications networks can use either wired or wireless interfaces.
  • a communications network can be the internet, or a wire or optical cable.
  • the new methods can be carried out using various means of data storage.
  • the information or data relating to each sample can be stored on a computer-readable medium or in a computer memory.
  • the information can be transferred physically on diskettes or electronically, e.g., on a dedicated intranet, or on the Internet.
  • the data can be encrypted using standard encryption software from such companies as RSA Security (Bedford, MA) and
  • the data can be stored in various formats, e.g., spreadsheets or databases.
  • the invention can be implemented in hardware or software, or a combination of both.
  • the invention can be implemented in computer programs using standard programming techniques following the method steps and figures disclosed herein.
  • the programs (or scripts) should be designed to execute on the various modules or in the central controller.
  • the output information is transmitted to one or more output devices such as a printer, or a CRT or other monitor, or a web page on a computer monitor with access to a website.
  • Each program used in the new methods can be implemented in a procedural or object oriented programming language to communicate with a computer system.
  • the programs can be implemented in assembly or machine language, if desired. In any case, the language can be a compiled or interpreted language.
  • Each computer program can be stored on a storage medium or device (e.g., ROM or magnetic diskette) readable by a general or special purpose programmable computer, for configuring and operating the central controller when the storage media or device is read by the controller (or a given module) to perform the steps or procedures described herein.
  • a storage medium or device e.g., ROM or magnetic diskette
  • the system can also be considered to be implemented as a computer-readable medium, configured or encoded with a computer program, where the storage medium so configured causes a computer to operate in a specific and predefined manner to perform the functions described herein.
  • the Internet provides a useful choice to transmit data, i this method, files of data are transmitted from the system to a user in encrypted form, with each party privy to the decryption technique necessary to process the particular data, ending with the completely processed data being sent to the health care provider over the Internet in a similarly encrypted manner, hi this method, the entire process can be performed in minutes once the biological sample has been obtained and processed.
  • sequence information refers to any nucleotide and/or amino acid sequence information, including but not limited to full-length nucleotide and/or amino acid sequences, partial nucleotide and/or amino acid sequences, or mutated sequences.
  • information "related to" the sequence information includes detection of the presence or absence of a sequence (e.g., detection of a mutation or deletion), determination of the concentration of a sequence in the sample, and the like.
  • sequences can be read by electronic apparatus and can be stored on any suitable medium for storing, holding, or containing data or information that can be read and accessed by an electronic apparatus.
  • Such media can include, but are not limited to: magnetic storage media, such as floppy discs, hard disc storage medium, and magnetic tape; optical storage media such as compact disc; electronic storage media such as RAM, ROM, EPROM, EEPROM and the like; general hard disks and hybrids of these categories such as magnetic/optical storage media.
  • the medium is adapted or configured for having recorded thereon sequence information.
  • the term "electronic apparatus" is intended to include any suitable computing or processing apparatus or other device configured or adapted for storing data or information.
  • Examples of electronic apparatus suitable for use with the present invention include stand-alone computing apparatus; communications networks, including local area networks (LAN), wide area networks (WAN), Internet, Intranet, and Extranet; and local and distributed processing systems.
  • "stored” refers to a process for encoding information on the electronic apparatus readable medium.
  • LAN local area networks
  • WAN wide area networks
  • Internet Internet
  • Intranet and Extranet
  • stored refers to a process for encoding information on the electronic apparatus readable medium.
  • Those skilled in the art can readily adopt any of the presently known methods for recording infoimation on known media to generate manufactures comprising the sequence information.
  • a variety of software programs and formats can be used to store the sequence information on the electronic apparatus readable medium. Any number of data processor structuring formats (e.g., text file or database) can be employed to obtain or create a medium having recorded thereon the sequence information.
  • Biological samples to be processed e.g., blood samples
  • Information about the samples e.g., patient identification, tests to be performed, expected turn-around time
  • the information is first entered into the central controller (step 28) and/or the plate editor, e.g., using a keyboard or bar code scanner, and optionally coordinated (e.g., matched) with information about the sample received by the central controller from an outside system or database (step 30) (e.g., via a Meditech interface).
  • Information obtained by the central controller can be transmitted to one or more modules of the clinical assay system immediately and/or at appropriate intervals during operation of the system.
  • the biological samples are deposited in holders in the sample transfer system. Aliquots of the biological samples are removed from the biological sample containers and deposited into multiwell plates by the sample transfer system (step 32).
  • the sample transfer system can include a subsystem, e.g., a barcode scanner and appropriate software, capable of tracking where each aliquot of a biological sample is deposited within the multiwell plate.
  • the information generated via the subsystem can be transmitted to the subsequent modules in the system and/or to the central controller.
  • the plate containing the aliquots is then transferred to the nucleic acid extraction system for DNA or total nucleic acids extraction (step 34).
  • the aliquots are transferred by the nucleic acid extraction system to a different multiwell plate.
  • the plate containing extracted nucleic acid samples is then transferred to the nucleic acid measurement system wherein the concentration of extracted nucleic acids in each aliquot is measured (step 36).
  • the nucleic acid measurement system can include a subsystem, e.g., appropriate software, for assigning the data generated during the measurement process to each individual aliquot and transmitting this data to the central controller.
  • the plate is then transferred to the PCR preparation system.
  • the PCR preparation system performs at least related two steps: (1) dispensing appropriate assay mixes, which include all components required for carrying out PCR reactions (e.g., buffers, dNTPs, primers, and polymerase enzyme(s)) (step 37); and (2) dispensing nucleic acid samples, e.g., control and patient DNA samples (step 38).
  • the PCR preparation system can also include a subsystem, e.g., appropriate software, which allows the PCR preparation system to receive from the central controller information specifying which assay(s) is to be performed on a given aliquot, to locate the aliquot on the plate, and to dispense appropriate primers and nucleic acid samples based on those specifications into the aliquot.
  • the plate is then transferred to the theromcycling system for amplification of the target nucleic acid sequence (step 40) .
  • the PCR reactions can be performed using any appropriate thermocycling protocol, e.g., a protocol as described in the Examples section of the present application. Following execution of the PCR reaction, the plate is transferred from the thermocycling system to the primer extension preparation system.
  • the primer extension preparation system adds a dephosphorylating enzyme, e.g., Shrimp Alkaline Phosphatase (SAP), to each aliquot to dephosphorylate unincorporated dNTPs leftover from the PCR reaction (step 41).
  • a dephosphorylating enzyme e.g., Shrimp Alkaline Phosphatase (SAP)
  • SAP Shrimp Alkaline Phosphatase
  • An extension mix which includes the extension primer, appropriate enzymes, and a mixture of dNTPs and ddNTPs, is added to each aliquot by the primer extension preparation system (step 42).
  • the primer extension preparation system can also include a subsystem, e.g., appropriate software, which allows the primer extension preparation system to receive from the plate editor information specifying which assay(s) is to be performed on a given aliquot, to locate the aliquot on the plate, and to dispense into each aliquot appropriate extension primers and mixtures of dNTPs and ddNTPs based to those specifications.
  • the plates are then transferred back to the thermocycling system, or to a second thermocycling system (e.g., a second thermocycling system contained within the primer extension preparation system), to allow the primer extension reaction to occur (step 44).
  • the plates are optionally transferred back to the primer extension preparation system, where resin is added by the system to the plates to remove salts, which could potentially interfere with MALDI-TOF analysis.
  • the plates are then transferred to the mass spectrometry preparation system.
  • the system transfers a sample (e.g., nanoliter volume samples) of each aliquot on the plate to a chip (e.g., a silicon chip) for MALDI-TOF analysis (step 46). Chips containing the samples are transferred from the the mass spectrometry preparation system to the mass spectrometry system.
  • the mass spectrometry system analyzes the samples using MALDI-TOF mass spectrometry (step 48).
  • the mass spectrometry system analyzes extended detection extension primers on the basis of molecular weight.
  • Software associated with the mass spectrometry system receives the raw mass spectrometry data, performs digital signal processing (e.g., de-noise, baseline determination, and data compression), analyzes the data, and calls the geneotype according to the resulting data (e.g., mass data).
  • the software associated with the mass spectrometry system optionally receives information from the central controller and matches the data with information about the sample (e.g., patient identification and the assay performed).
  • the data is exported from the mass spectrometry system to the relational database and/or central controller (step 49).
  • the finalized data e.g., patient name, assays performed, and genotype
  • an outside system or database e.g., a Meditech database
  • the outside system or database is accessible by healthcare providers and/or third party payors.
  • the information exported from the central controller to the outside system or database can include billing information, e.g., billing codes for the test or tests performed, allowing direct billing of a third party payor for services rendered.
  • the central controller can be programmed to include with the test results diagnosis information. Such information can be used to facilitate, or give a definitive, diagnosis.
  • the diagnostic information can include an indication that a patient has been infected with a particular pathogen, the severity of the infection, the genotype of the organism (e.g., to facilitate the tailoring of a treatment, e.g., to treat a drug resistant organism with a drag to which it is sensitive), and a recommended regimen of treatment.
  • the information can indicate whether the patient is hetero- or homozygous for the mutation, the likelihood that the patient will develop a disease or condition because of the mutation, and recommend a course of action such as a regimen of treatment or prevention.
  • Such information can be associated with the patient data as necessary and exported from the central controller to the outside database or system.
  • the present invention provides novel diagnostic assays.
  • the assays employ novel primer sequences and mass spectrometry (e.g., MALDI) to detect the presence of target nucleic acid sequences and/or sequence variations (e.g., insertions, mutations and/or polymorphisms) in biological samples.
  • the assays can be categorized into two groups: genetic tests (e.g., to detect mutations) and infectious disease/pathogen testing (e.g., to detect the presence and/or amount of foreign, e.g., viral and/or bacterial, nucleic acids, and/or to genotype the pathogen).
  • a general description of the assays is provided below, and several exemplary assays are described in the Examples.
  • the novel genetic assays of the present invention require primers for PCR amplification of a target sequence and detection extension primers for carrying out primer extension reactions.
  • a target sequence can be, e.g., a sequence that is part of a gene, or a mutation (e.g., insertions, deletions, transitions, or transversions), which is known, or suspected, to be associated with (e.g., cause, increase, or decrease the risk of) a genetic disease or disorder.
  • a target sequence can also be a sequence that is part of a pathogen's (e.g., a virus, bacterium, or fungus) genome, which optionally is known or suspected to include variations (e.g., insertions, deletions, transitions, transversions, etc.) conferring special characteristics, e.g., possession of virulence factors and/or drug resistance, and/or which serve to differentiate among strains of the organism.
  • a 100 bp stretch of nucleotides is first selected from either or both sides of a target sequence.
  • a set of primers is then created manually and/or by using commercially available primer-generating software.
  • the second generation of amplification and/or extension primers is then compared to other known sequences, e.g., using a BLAST program (see, e.g., the National Institutes of Health's National Center for Biotechnology Information (NCBI) website on the World Wide Web at address ncbi.nlm.nih.gov). Primers that match with a sequence other than the target sequence are disregarded. Primers that match with only the target sequence are considered a third generation of amplification primers and are retained for further analysis. All possible combinations of the third generation of amplification primers and the detection extension primers are run through the diagnostic genetic assay with positive and negative controls to identify sets of primers that are accurate in 100% of genotype calls.
  • NCBI National Institutes of Health's National Center for Biotechnology Information
  • Amplification primers so identified are considered a fourth generation of amplification primers, and are suitable for use in the assays of the present invention.
  • the procedures discussed above can be modified for designing primers for a target gene when a homologous pseudogene(s) is known to be present, e.g., the glucocerebrosidase (GC) gene, which is involved in Gaucher Disease.
  • GC glucocerebrosidase
  • Many commercially available software packages are not able to design specific primers when a homologous sequence to the target gene is present in the genome.
  • Many design primers that amplify short stretches of DNA sequence 60 bp to 150 bp) because PCR is more efficient when short fragments of DNA are amplified.
  • a primer can be designed, manually or using software, e.g., software other than SpectroDESIGNERTM, that will prime the target gene, but not the pseudogene (homologous) sequence.
  • the extension primer can then be designed using software, e.g., SpectroDESIGNERTM.
  • SpectroDESIGNERTM software other than SpectroDESIGNERTM.
  • duplicative confirming assays are used.
  • an assay is designed around a target using both the sense and antisense strand sequences, designing both forward and reverse detection extension primers. The results from both assays can be compared.
  • Duplicative confirming assays can be beneficial, for example, if the region surrounding the target includes polymorphisms that prevent the PCR amplification and/or extension primers from working, which would cause erroneous results.
  • primers for targets can be designed using more than one type of software, e.g., using SpectroDESIGNER with the input of another sequence aligning software, for additional security when manipulating sequences.
  • the sequence having the deletion/insertion is duplicated.
  • One of the sequences is used to design a forward extension primer, while the other sequence is used to design a reverse extension primer.
  • SpectroDESIGNERTM is used to design extension primers in the forward or reverse direction.
  • the letter "N" can be introduced into the sequence at a position 3' to the deletion/insertion site when designing the forward extend primer, or 5' to the deletion/insertion site when designing a reverse extension primer.
  • the targets for SpectroDESIGNERTM when designing primers for a deletion/insertion site is the first base in the deletion or insertion and the first base after the deletion or insertion.
  • these two nucleotide targets differ for the forward and reverse extension primers.
  • the sequence following the target nucleotides for a forward extend primer can omit the first nucleotide after the deletion/insertion; and, similarly for the reverse extend primer, the nucleotide prior to the deletion/insertion can be omitted.
  • the sequence following a target should be the sequence that actually follows the deletion/insertion site in genomic DNA. In other cases, the target should be followed by the deleted/inserted sequence. Similar considerations are applicable to designing reverse primers.
  • SpectroDESIGNERTM The choices of how to design the primers in view of these considerations can be dictated to SpectroDESIGNERTM by a second type of software, e.g., software other than SpectroDESIGNERTM.
  • the validity of the extension primer designed by SpectroDESIGNERTM is checked by aligning the extended primer sequences (Extl and Ex2) with the template sequence, with and without the insertion/deletion in order to check the validity of assay design.
  • Novel Primers A number of novel primers were isolated for use in the assays of the present invention. Accordingly, the present invention includes the following nucleic acid sequences, in which the MTHFR primers are used to detect mutations in the 5,10-Methylenetetrahydrofolate Reductase gene, the Fall primers are used to detect mutations in the Coagulation Factor II (FII) gene, the
  • FaN primers are used to detect mutations in the Coagulation Factor N (FaN) gene
  • HFE and FM primers are used to detect mutations in the HFE gene. All others are used to detect the presence and amount of cytomegalo virus (CMN) in a biological sample.
  • CCN cytomegalo virus
  • 607 R29 5'-ACGTTGGATGTTGCTCTTTAAGCACGCCGG- 3' (SEQ ID NO:35) 607 E30 5'-GCCGCCAGAATGAGCAGA- 3' (SEQ ID NO:36) CV-F31 5'-ACGTTGGATGGAGACGACGTGGACGGCAC- 3' (SEQ ID NO:37) CV-R32 5'-ACGTTGGATGCGTGCTTGGACACGCGACTT- 3' (SEQ ID NO:38) CV33 E 5'-CTCCTTGTCCGAAGCCGC- 3' (SEQ ID NO:39)
  • HFE-F1 5'-ACGTTGGATGATGACCAGCTGTTCGTGTTC-3'(SEQ ID NO:40)
  • HFE-R2 5'-ACGTTGGATGTCTACTGGAAACCCATGGAG-3'(SEQ ID NO:41)
  • FM3-E 5* CTCCACACGGCGACTCTCAT-3'(SEQ ID NO:42)
  • HFE-F7 5'-ACGTTGGATGTTCATGGGTGCCTCAGAGC-3'(SEQ ID NO:43)
  • HFE-R8 5'-ACGTTGGATGCCACATCTGGCTTGAAATTC-3'(SEQ ID NO:44)
  • HFE-E3 5' CAGCTGTTCGTGTTCTATGAT 3' (SEQ ID NO:45)
  • HFE-F4 5'-ACGTTGGATGTGGATAACCTTGGCTGTACC-3'(SEQ ID NO:46)
  • HFE-R5 5'-ACGTTGGATGTATCACNATGAGGGGCTGATC-3'(SEQ ID ⁇ O:47)
  • FM6-E 5' GCCTGGGTGCTCCACCTGG 3'(SEQ ID NO:48)
  • HFE-F9 5'-ACGTTGGATGTAATGGGGATGGGACCTACC-3'(SEQ ID NO:49)
  • HFE-R10 5'-ACGTTGGATGTGCTCTCATCAGTCACATACC-3'(SEQ ID NO:50)
  • HFE-E6 5' GGGAAGAGCAGAGATATACGT 3'(SEQ ID NO:51)
  • HFE-F1 5'-ACGTTGGATGATGACCAGCTGTTCGTGTTC-3'(SEQ ID NO:52)
  • HFE-R2 5'-ACGTTGGATGTCTACTGGAAACCCATGGAG-3'(SEQ ID NO:53)
  • HFE S65CJB1 5' GGGCTCCACACGGCGAC 3* (SEQ ID NO:54)
  • HFE-F7 5 '-ACGTTGGATGTTCATGGGTGCCTCAGAGC-3 '(SEQ ID NO:55)
  • HFE-R8 5'-ACGTTGGATGCCACATCTGGCTTGAAATTC-3'(SEQ ID NO:56)
  • HFE S65C_E5 5' TTCGTGTTCTATGATCAT
  • an assay of the present invention can be performed as follows.
  • a biological sample is obtained.
  • a biological sample is material obtained from any living source (e.g. human, animal, plant, bacteria, fungi, protist, virus) that can be solid material (e.g. tissue, cell pellets, biopsies, fecal matter, nucleic acid samples) and/or fluids (e.g., urine, blood, saliva, sputum, amniotic fluid, mouth wash). If necessary (i.e., when the starting material is an intact biological sample and not previously-extracted nucleic acids), nucleic acids are extracted from the biological sample.
  • Extractions can be performed using any art-known method, the choice of which will depend, e.g., on the biological sample from which the nucleic acids are to be isolated. For example, freeze-thaw and alkaline lysis procedures can be useful for obtaining nucleic acid molecules from solid materials; heat and alkaline lysis procedures can be useful for obtaining nucleic acid molecules from urine; and proteinase K extraction can be used to obtain nucleic acid from blood (see, e.g., Rolff, A et al. PCR: Clinical Diagnostics and Research, Springer (1994)).
  • RNA e.g., viral RNA
  • RT-PCR reverse transcriptase PCR
  • an oligo base extension method is then used to detect mutations in, or the presence of, a target nucleic acid.
  • the method is based on the extension of a detection primer (i.e., a detection extension primer designed as described above) that anneals adjacent to a variable nucleotide position on the amplified target DNA, using a DNA polymerase, a mixture of dNTPs (e.g., 3 dNTPs), and the missing dideoxy nucleotides (e.g., one missing dideoxy nucleotide). Any art known primer extension method can be utilized.
  • the sample is then analyzed using mass spectrometry.
  • any mass spectrometer format can be used to analyze the samples, e.g., matrix assisted laser desorption ionization (MALDI), electrospray (ES), ion cyclotron resonance (ICR) and Fourier Transfonn.
  • MALDI matrix assisted laser desorption ionization
  • ES electrospray
  • ICR ion cyclotron resonance
  • TOF time-of-flight
  • samples are analyzed using MALDI-TOF mass spectrometry.
  • the molecular weight of extended primers is determined by mass spectrometry, and a change in the molecular weight of the extended primer, as compared to a control, indicates the presence of the target sequence and/or whether a mutation (e.g., insertion or deletion), is present in the target sequence.
  • the results are analyzed using methods described in the Examples section below, and an analysis report is generated.
  • the assay described above is modified to include, e.g., homogenous MassCLEAVAGETM (l MC) reactions (Sequenom GmbH, Hamburg, Germany).
  • a T7 promoter for in vitro transcritpion is introduced to the 5' end of one strand of the amplicon.
  • PCR is performed with a T7 promotor in the forward primer to mediate transcription of the forward DNA strand
  • a second PCR is performed with the T7 promotor inco ⁇ orated in the reverse primer to mediate transcription of the reverse DNA strand.
  • SAP is added to each reaction to degrade any unincorporated nucleotides from the PCR reactions.
  • each PCR reaction is split into two transcription reactions and performed.
  • base-specific cleavage using RNase A is conducted, yielding fragmented RNA molecules.
  • the final steps in the hMC reaction are sample conditioning and MALDI-TOF MS followed by spectra pattern analysis.
  • the hMC reaction is a high throughput tool for sequence variation identification by comparative sequence analysis. The principle behind it is to generate signal patterns that are specific to a reference sequence in which changes, when compared to a sample sequence, can be tracked as a sequence variation in the form of SNPs or insertion deletions .
  • the assays described above can be used to diagnose genetic diseases (or a patient's or subjects increased risk therefore), to identify foreign sequences (e.g., viral sequences) incorporated into a target gene, and for infectious disease/pathogen testing.
  • subject refers to an animal, or a human, and includes, but is not limited to, mammals, e.g., primates, pigs, rodents such as mice and rats, rabbits, guinea pigs, hamsters, cows, horses, cats, dogs, sheep, and goats.
  • Agricultural analyses e.g., analysis of biological samples from plants can also be made with the new systems and methods.
  • the assays can be adapted to diagnose any of the more than 3000 genetic diseases or disorders currently known (e.g. hemophilias, Gaucher's disease, thalassemias, Duchemie Muscular Dystrophy (DMD), Huntington's Disease (HD), Alzheimer's Disease and Cystic Fibrosis (CF)). and lysosomal and metabolic diseases.
  • genetic diseases or disorders currently known (e.g. hemophilias, Gaucher's disease, thalassemias, Duchemie Muscular Dystrophy (DMD), Huntington's Disease (HD), Alzheimer's Disease and Cystic Fibrosis (CF)). and lysosomal and metabolic diseases.
  • the assays can also be used to diagnose chromosomal abnormalities such as Trisomy 21 (Down's syndrome), Trisomy 13 (Platau Syndrome), Trisomy 18 (Edward's Syndrome), Monosomy X (Turner's Syndrome) and other sex chromosome aneuploidies such as Khenfelter's Syndrome (XXY), which result in birth defects, and to determine whether an individual has a genetic mutation(s) that predispose the individual to any of a number of disorders such as diabetes, arteriosclerosis, obesity, various autoimmune diseases, stroke, and cancer (e.g.
  • the assays can also be used in the detection of "DNA fingerprints," e.g., polymorphisms, such as "microsatelhte sequences,” which are useful for determining identity or heredity (e.g. paternity or maternity). Further, the assays can be used to detect or quantify in a biological sample nucleic acid sequences that are specific to infectious organisms.
  • Retroviridae e.g., human immunodeficiency virases, such as HTV-1 (also referred to as HTLV-III, LAV or HTLV- III/LAV, see Ratner, L. et al, Nature, 313: 227-284 (1985); and Wain Hobson, S. et al., Cell, 40: 9-17 (1985)
  • HIV-2 see Guyader et al., Nature, 328: 662-669 (1987); European Patent
  • HIN-LP International Publication No. WO 94/00562 entitled "A Novel Human Immunodeficiency Virus”
  • Picornaviridae e.g., polio virases, hepatitis A virus, (Gust, I. D., et al., Intervirology, Vol. 20, pp.
  • entero viruses human coxsackie virases, rhinovirases, echo virases
  • Calciviridae e.g., strains that cause gastroenteritis
  • Togaviridae e.g., equine encephalitis virases, rubella virases
  • Flaviridae e.g., dengue virases, encephalitis virases, yellow fever virases
  • Coronaviridae e.g., coronavirases
  • Rhabdoviridae e.g., vesicular stomatitis virases, rabies virases
  • Filoviridae e.g., ebola viruses
  • Paramyxoviridae e.g., parainfluenza viruses, mumps virus, measles viras, respiratory syncytial viras
  • Orthomyxoviridae e.g., influenza viruses
  • Bungaviridae e.g
  • infectious bacteria examples include: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M.
  • infectious fungi examples include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
  • Other infectious organisms i.e., protists
  • Plasmodium falciparum and Toxoplasma gondii examples include: Plasmodium falciparum and Toxoplasma gondii .
  • FIG. 15A-15GG describes a number of specific genetic targets that can be assayed according to the invention, as well as exemplary primers that can be used in those assays.
  • exemplary primers are provided for the following genetic targets: 5,10- Methylenetetrahydrofolate Reductase (MTFR); Coagulation Factor II; Coagulation Factor V; hemochromatosis (HFE); and a glucocerebrosidase (GC).
  • MTFR 5,10- Methylenetetrahydrofolate Reductase
  • Coagulation Factor II Coagulation Factor II
  • Coagulation Factor V hemochromatosis
  • HFE hemochromatosis
  • GC glucocerebrosidase
  • fibroblast growth factor receptor 3 aspartoacylase; Glucocerebrosidase; Coagulation Factor VII; Fanconi Anemia, Complementation Group C (FANCC); inhibitor of kappa light polypeptide gene enhancer in b cells, kinase complex-associated protein; acid sphingomyelinase; hexosaminidase; angiotensin i-converting enzyme; adenylate cyclase 9; apolipoprotein A-l; apolipoprotein E; endothelial leukocyte adhesion molecule 1; fc fragment of IGG, low affinity Ila, receptor; fibrinogen beta chain; coagulation factor II, factor XIII; guanine nucleotide-binding protein beta-3; integrin, alpha-2, glycoprotein Ia/Iia; glycoprotein lb, platelet, alpha polypeptide; intercellular adhesion molecule 1; glycoprotein Ia/IIa (a2),
  • the gene information e.g., gene number, symbol, and name
  • the target mutation e.g., gene number, symbol, and name
  • the termination mix that can be used in and assay
  • the amplification primers e.g., the extension primers
  • the analytes e.g., the extension primer as it would appear after extension
  • Example. 1 Screen for 5,10-Methylenetetrahvdrofolate Reductase (MTHFR) mutations
  • a biological sample e.g., a blood sample
  • MTHFR catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a cosubstrate for homocysteine remethylation to methionine.
  • MTHFR plays a key role in folate metabolism by channeling one- carbon units between nucleotide synthesis and methylation reactions. Severe enzyme deficiency leads to hyperhomocysteinemia and homocystinuria, with altered folate distribution and a phenotype that is characterized by damage to the nervous and vascular systems.
  • MTHFR C677T or Ala222Nal
  • MTHFR A1298C or Glu429Ala
  • Assays to detect these mutations are described below.
  • the C677T mutation is common in the general population, with a variable frequency depending on the subpopulation studied. In Caucasians of European descent, the frequency of homozygotes for this mutation ranges from approximately 5% (in Dutch and Finnish populations) to 12-15% (in French Canadian and other European populations). African Americans have a low frequency of 1.4%
  • A1298C mutation is also common in the general population with an allele frequency estimated at 0.33. Individuals homozygous for the C677T mutation have significantly elevated plasma homocysteine levels.
  • the 677T variant of the MTHFR gene is a genetic risk factor for preeclampsia. From studies of the C677T mutation in cardiovascular patients and controls, investigators have concluded that homozygosity for this frequent mutation in the MTHFR gene is associated with a 3 -fold increase in risk for premature cardiovascular disease. The association was stronger in homozygotes than in heterozygotes. Therefore, the C677T polymorphism may be a risk factor for coronary artery disease.
  • at least 22 other mutations in MTHFR gene are known and assays similar to those described herein can be designed to detect those mutations as well.
  • the test can be used to screen for the MTHFR gene mutation before surgery, which may identify patients at an increased risk of graft thrombosis.
  • the MTHFR mutation assay is also useful for patients with early-onset arteriosclerotic vascular disease or thrombosis, particularly those with hyperhomocysteinemia or significant family histories. The clinical scenario should be considered carefully, since additional genetic and non-genetic factors are important in the development of cardiovascular disease.
  • MTHFR mutation analysis is also useful for patients with variable or ambiguous homocysteine levels, since plasma levels are dependent on nutritional status or sample handling before testing.
  • MTHFR mutational analysis can also be offered for patients with a neural tube defect (NTD).
  • NTE idiopathic venous thromboembohsm
  • MTHFR-C677T E3 Assay This section describes the amplification and detection extension primers for the MTHFR- C677T E3 Assay and provides the sequences of the primers.
  • the sequences of the resulting extended primers are provided in Table 1, below. Wild type target: AAAGCTGCGTGATGATGAAATCGGCTCCCGCAGACACCTTCTCCTTCA
  • MTHFR C677T E6 Assay This section describes the amplification and detection extension primers for the MTHFR C677T E6 Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Table 2, below.
  • Amplification primers MTHFR-F17 5 '-acgttggatgAGTGATGCCCATGTCGGTG -3 ' (SEQ ID NO:4) MTHFR-R18 5'-acgttggatgCTGACCTGAAGCACTTGAAG -3' (SEQ ID NO:5) Amplicon length: 122 bp * amplification primers have the 10-mer tag specific for the hME method: acgttggatg.
  • Termination mix ddA/ddC/ddG
  • amplification primers have the 10-mer tag specific for the hME method:acgttggatg (SEQ ID No.816)
  • MTHFR A1298C E14 Assay (SEQ ID NOS: 817, 818, and 819) MTHFR A1298C E14 Assay This section describes the amplification and detection extension primers for the MTHFR A1298C E14 Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Table 4, below.
  • Amplicon length: 159 bp * amplification primers have the 10-mer tag specific for the hME method:acgttggatg.
  • SPECIMEN STORAGE AND STABILITY 1. After arrival, blood was extracted on the same or next day. Specimen was not allowed to remain at +15°C to +30°C longer than 8 hours. If assays were not completed within 8 hours, specimen was stored at +2°C to +8°C. 2. Tubes of blood should were kept closed at all times in a vertical, stopper-up position. 3. Blood specimen were not frozen. SAMPLE VOLUME The minimum volume was 1.0 mL of sample.
  • SPECIMEN HANDLING Blood samples were received with the lab barcode identification numbers. Sample identification is ensured throught out the process by the tracking system on Freedom, BioRobot MDx, Genesis, and MassARRAY systems.
  • PROCEDURES INVOLVED INASSAYS Nucleic acids extraction, nucleic acid concentration measurement, Uniplex and Multiplex PCR Procedure on GenesisTM in conjuction with FreedomTM and MassARRAYTM software, Homogeneous MassEXTENDTM Reaction using the MassARRAYTM System.
  • QUALITY CONTROL PCR primers were analyzed ensure specificity for the prothrombin gene in the BLAST search and that the PCR product did not show allelic dropout. Validation of each assay was accomplished.
  • Four types of control material were analyzed with each PCR plate: (A) blank control (water), (B) DNA negative control (wild type), (C) heterozygous positive controls and (D) positive homozygous mutant, i each run at least two samples of each control were used if available. More frequent use of controls or the use of additional controls was left to the discretion of the user based on work load and work flow. Tables 5 and 6, below, provide a list of control DNAs used in the presently described assays.
  • PCR PROCEDURE The master PCR mix was made, bianually or as necessary, in 11.954 ml total volume and aliquoted into 47 Sarstedt tubes, 250 ⁇ l each.
  • the composition of the PCR master mix is provided in Table 7, below. Table 7. Composition of master PCR mix
  • the 5 ⁇ M primer mix was made by diluting 10 times 50 ⁇ M stock primers.
  • the volumes used to malce 2000 ⁇ l of 5 ⁇ M primer mix is shown in Table 8, below.
  • the primer mix was aliquoted to 10 Sarstedt tubes, 200 ⁇ l each.
  • the composition of the PCR reaction is shown in Table 9. To calculate the volumes per ran, the volumes per reaction of PCR mix, Primer Mix, and HotStarTaqTM need to be multiplied by number of reactions and then by 1.5. Table 9 shows an example of the calculations per 384 reactions. Increasing the final volume by 50% is to account for pipetting losses and 'dead' volume when using the robotics.
  • SAP Silicone Phosphatase
  • hME HOMOGENEOUS MASSEXTEND
  • Genotyper® Analyzer software reads the spectrum generated for each sample by the mass spectrometer, and uses a 3-parameter model to calculate the significance of each putative genotype: 1. Conservative: The most conservative set makes no error in reading the data.
  • Moderate The moderate set is a compromise between the two extremes. The interpretation of the results is as follows: If the results of two assays for the same mutation are called (i.e., interpreted) identically by conservative or moderate calls or conservative and aggressive calls, the result is acceptable. If the assays are called identically by moderate and aggressive calls, the test needs to be looked at by the director or the designee. If the assays are called only by aggressive calls, the test needs to be repeated. If there is a call on one but not the other assay, the "non call" assay needs to be repeated.
  • the non-calls can be further categorized into the following groups: (a) Low Probability: Implies that the spectrum in question contains peaks that fail any criteria of significance even for the aggressive parameter set; (b) Conflict: hnplies that there is more that one read or spectrum corresponding to one sample, and these reads give rise to different and conflicting genotypes; (c) Bad spectrum: The spectrum for the sample doesn't exist above noise level; and (d) Bad Assay: results of analyst or operator input errors in defining the assays. The most common errors are mass values of analytes or contaminants that are out of range of the spectrum, or contaminants and analytes having the same mass; and (e) user call: The analyst or operator select a genotype in the table and performs a manual call.
  • results of the assays were 100% in agreement with results from Associated Regional and University Pathologists (ARUP).
  • negative controls homozygous wild type
  • GM12783, GM7798, NA14641 (Coriell) were homozygous CC
  • positive heterozygous controls NA13591, NA14646, NA14702, and NA16000 (Coriell) were TC
  • positive homozygous control NA8810 (Coriell) was TT.
  • Example 2 Screen for Coagulation Factor II (FII) G20210A Mutations
  • Mutation G20210A in the prothrombin gene is associated with hype ⁇ rothrombinemia and increased risk of venous thromboembohsm (VTE). It has been established that the FII G20210A mutation increases the risk of VTE 2-5 fold.
  • the 20210A prothrombin allele also represents an inherited risk factor for acute coronary syndrome among patients who have limited extent of coronary disease at angiography or who lack major metabolic and acquired risk factors.
  • Mutation G20210A involves the last nucleotide of the transcribed prothrombin RNA. The mechanism by which prothrombin levels are altered is unknown. One explanation is that increased adenylation and increased mRNA stability are involved. In southern Europe, the prevalence of the G20210A mutation is 3.0 percent (CI95 2.3 to
  • prothrombin Mutations G20210A Mutation Frequency: The 20210G-A variation in the prothrombin gene is predominant only in the Caucasian population, among whom the prevalence of heterozygous carriers varies between 1% to 8%, and depends on the geographical location and ethnic background.
  • OMIM number 176930 mRNA NCBI Ace No.: NM_000506 coagulation factor II mRNA; Ml 7262.
  • Clinical Significance Prothrombin (G20210A) testing can be recommended, for example, in the following - cases: when inherited thrombophiha is suspected; when the testing for factor V Leiden muatation is recommended; in patients with a history of recurrent VTE; in patients with a first episode of VTE before the age of 50 years; in patients with a history of an unprovoked VTE at any age; where thrombosis occurs in unusual anatomic sites, such as cerebral, mesenteric, portal, or hepatic veins; where there is a first-degree relative with VTE; in patients with a first VTE related to pregnancy, the pue ⁇ erium, or oral contraceptive use; where there is a history of VTE related to pregnancy loss during the second or third trimesters; in young women smokers (age ⁇ 50 years) with an MI; in older patients (age > 50 years) with a first provoked VTE event in the absence of a cancer or an blinkravascular device; where there is a first VTE related
  • ASSAY FaII-E16 This section describes the amplification and detection extension primers for the FaII-E16
  • Amplification primers* FaII-F18 5'-ACGTTGGATGACTCATATTCTGGGCTCCTG -3' (SEQ ID NO:13) FaII-R19 5'-ACGTTGGATGAGAGAGCTGCCCATGAATAG -3' (SEQ ID NO.T4)
  • Detection Extension Primer FaII-E16 5'- CACTGGGAGCATTGAGGCT-3' (SEQ ID NO:15)
  • FaII-E15 ASSAY This section describes the amplification and detection extension primers for the FaII-E15 Assay and provides the sequences of the primers.
  • the sequences of the resulting extended primers are provided in Table 17, below:
  • Amplification Primers* Fall-FlO 5'- ACGTTGGATGTGGAACCAATCCCGTGAAAG -3' (SEQ ID NO: 16) Fall-Rl 1 5 '- ACGTTGGATGAGAGAGCTGCCCATGAATAG -3 '(SEQ ID NO: 17) Amplicon length: 112 bp * amplification primers have the 10-mer tag specific for the hME method: acgttggatg.
  • Detection Extension Primer FaII-E15 5'-CAATAAAAGTGACTCTCAGC-3' (SEQ ID NO: 18)
  • Termination mix ddA/ddC/ddT Table 17. Sequence, length and mass of extension primer, extended primer (G and A) and pause product)
  • FIG. 4 is a mass spectrum of a heterozygous "GA" allele (heterozygous positive) generated using a screen for a G20210A mutation in the Coagulation Factor II (FII) gene. Exemplary test results are provided in Tables 19 and 20, below. Table 19: FaII-E15
  • Results of this assay were in 100% in agreement with results from ARUP.
  • Negative controls (homozygous wild type) GM7798, GM8810, GM9729, GM14899, NA14646, NA14650 (Coriell Institute) were homozygous GG, and positive heterozygous control NA1 028 (Coriell) was AG, and positive homozygous mutant control NA16000 (Coriell Institute) was AA. Due to blood clogging the DNA was not extracted and could not be re-extracted because of the too small volume of blood obtained ( ⁇ 0.5 ml). Two samples that had no DNA gave no signal. As indicated in Table 20, out of 140 samples tested, the majority of geneotype calls for this assay were conservative calls, indicating a high level of accuracy.
  • Example 3 Screen for Coagulation Factor V R506Q mutations
  • the Factor V mutation (Factor V Leiden) is the most common genetic cause of venous thrombosis. It is involved in 20-40% of cases and is present in 3% of the general population. In a population study of 180 individuals from Germany, the heterozygosity rate was 7.8% with a confidence interval 4 to 11%.
  • the mutation causes resistance to activated protein C (APC) and induces a defect in the natural anticoagulation system.
  • APC activated protein C
  • the other major genetic causes of venous thrombosis (deficiencies of protein C, protein S and antithrombin HI) together account for only 5-10% of cases.
  • Presence of the factor V mutation increases the risk for venous thrombosis 7-fold in heterozygotes and 80-fold in homozygotes. This risk is increased still further when the factor V mutation is present along with situations such as pregnancy, oral contraceptive use, estrogen therapy, malignancy, diabetes mellitus, immobilization or surgery. Ten percent of heterozygotes and almost all homozygotes experience venous thrombosis in their lifetime.
  • the discovery of the factor V mutation has revolutionized the diagnostic work-up of patients with hypercoagulability, and the ability to detect this mutation in asymptomatic relatives offers the opportunity to prevent venous thrombosis through special management of those at risk.
  • Clinical Significance Testing can be recommended, for example, in patients: having venous thrombosis or pulmonary embolism, transient ischemic attacks or premature stroke, peripheral vascular disease, particularly lower extremity occlusive disease, a history of a thrombotic event, family history of thrombosis or known factor V mutation in a relative; prior to major surgery, pregnancy, postpartum, oral contraceptive use or estrogen therapy if there is a personal or family history of thrombosis; or where there has been a previous finding of activated protein C resistance by laboratory analysis.
  • FaV-ElO Assay This section describes the amplification and detection extension primers for the FaV-ElO Assay and provides the sequences of the primers.
  • FaV-F16 5' -acgttggatgAAGACCATACTACAGTGACG- 3' (SEQ ID NO: 19)
  • FaV-R17 5' -acgttggatgCATTATTTAGCCAGGAGACC- 3' (SEQ ID NO:20)
  • FaV-ElO 5'- GACAAAATACCTGTATTCCT -3' (SEQ ID NO:21) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Amplicon length: 189 bp Termination mix: ddA/ddC/ddG
  • FaV-E9 Assay This section describes the amplification and detection extension primers for the FaV-E9 Ass and provides the sequences of the primers.
  • the sequences of the resulting extended primers are provided in Table 22, below.
  • FaV-F18 5' -acgttggatgCTCTGGGCTAATAGGACTAC- 3' (SEQ ID NO.22)
  • FaV-R19 5' -acgttggatgCTGAAAGGTTACTTCAAGGAC - 3' (SEQ ID NO:23)
  • Detection Extension Primers FaV-E9: 5'-GCAGATCCCTGGACAGGC- 3 ' (SEQ ID NO:24) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Amplicon length: 92 bp Termination mix: ddA ddC/ddT
  • FIG. 5 is a mass spectrum of a heterozygous "GA” allele (heterozygous positive) generated using the FaV-ElO screen for a mutation in the Coagulation Factor V gene.
  • FIG. 6 is a mass spectram of a heterozygous "GA” allele (heterozygous positive) generated using the FaV-E9 screen for a mutation in the Coagulation Factor V gene. Exemplary test results are provided m Tables 24 and 25, below.
  • CMV Cytomegaloviras Testing Clinical Significance
  • CMV is an opportunistic infection found throughout all geographic locations and socioeconomic groups, infecting about 50% of the general population of the United States by 40 years of age and 90% of people with HIV.
  • CMV is transmitted from person to person by close personal contact. Infectious CMV may be shed in the bodily fluids of any previously infected person, and thus may be found in urine, saliva, blood, tears, semen, and breast milk.
  • CMV can be sexually transmitted and can also be transmitted via breast milk, transplanted organs, and rarely from blood transfusions. In most healthy people, CMV remains in the body indefinitely without causing any harm.
  • CMV infection may not be a serious problem for the vast majority of infected individuals.
  • a CMV infection can cause serious and possibly fatal complications.
  • generalized infection and infections of the central nervous system may occur and can be fatal.
  • CMV is also frequently transmitted to a developing child before birth.
  • CMV infection is widespread in developing countries and in areas of lower socioeconomic conditions. For most healthy individuals who acquire CMV after birth, there are few symptoms and no long-term health consequences. Some individuals with symptoms experience a mononucleosis-like syndrome with prolonged fever and a mild hepatitis.
  • patients without CMV infection should be given organs and/or blood products that are free of the viras.
  • the risk of developing CMV disease in patients is directly related to the presence and quantity of CMV DNA in blood.
  • the ability to measure CMV viral load is a valuable tool in the management of HIV- 1 infected patients.
  • the infection is treatable with drugs. Optimum treatment depends on early and accurate detection.
  • CMN assay combines competitive PCR with MassEXTE ⁇ DTM procedures and matrix assisted laser deso ⁇ tion/ionization time-of-flight mass spectrometry (MALDI-TOF MS).
  • MALDI-TOF MS matrix assisted laser deso ⁇ tion/ionization time-of-flight mass spectrometry
  • PCR amplification is performed on CMN D ⁇ A mixed with a known amount of internal standard (oligo - synthetic D ⁇ A molecule), which resembles the sequence of the targeted CMN D ⁇ A region in all positions except a single base winch serves as an assay target.
  • MassARRAY Typer Gene Expression AnalysisTM software allows calculating the ratio of internal standard and patient CMN on each spot and the viral concentration in the extracted sample, which is further recalculated into viral particles per ml of patient sample.
  • the method can be used for sensitive and accurate detection of viral nucleic acid with abroad dynamic range (e.g., from 100 to 4x10 s viral copies/ml).
  • the CMN560 quantitative assay quantifies CMN D ⁇ A extracted from plasma of CMN infected individuals using PCR and mass spectrometry.
  • the test can quantify CMN D ⁇ A over the range of 100-400,000,000 CMN copies/ml.
  • the assay can be used in conjunction with clinical presentation and other laboratory markers of disease status as an aid to management of individuals infected with CMN.
  • CMN quantitative results from the assay can be used to assess prognosis of disease progression and to monitor the efficacy of antiretroviral therapy by measuring changes in CMN levels during the course of therapy.
  • This example generally describes amplification and detection extension primers for detecting the presence and amount of CMN in a biological sample.
  • the sequences of the primers are provided below.
  • the procedures described in Example 1, above, can be modified as necessary for handling and analyzing biological samples containing virases.
  • Amplification Primers* 460 FI 5'-ACGTTGGATGGTCGTGTATGCCACTTTGAC- 3' (SEQ ID NO:25) 460 R2 5'-ACGTTGGATGTGAGGCTGTAATCGCACAGC- 3' (SEQ ID NO:26)
  • amplification primers have the 10-mer tag specific for hME method: acgttggatg. Termination mix: ddA/ddC/ddT
  • Amplification Primers* 520 F8 5'-ACGTTGGATGTCTTTCAGGAGACGGGTACG- 3' (SEQ ID NO:28) 520 R9 5'-ACGTTGGATGAGATGAGCAGCTTCTGCAGC- 3' (SEQ ID NO:29)
  • Detection Extension Primer 520 E10: 5'-TCTGCGCGAATGTTACCA- 3' (SEQ ID NO:30) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Termination mix: ddA/ddC/ddT The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 27, below.
  • Amplification Primers* 591 F12 5'-ACGTTGGATGAGGCGTTGCTCTTTAAGCAC- 3' (SEQ ID NO:31) 591 R13 5'-ACGTTGGATGAGTGCGTGAGCTTACCGTTC- 3' (SEQ ID NO:32) Detection Extension Primer: 591 E14 5'-TTAAGCACGCCGGCGCGG- 3' (SEQ ID NO:33) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Termination mix: ddA ddC/ddG The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 28, below.
  • Amplification Primers* 607 F28 5'-ACGTTGGATGTCATTTGCGCCGCCAGAATG- 3' (SEQ ID NO:34) 607 R29 5'-ACGTTGGATGTTGCTCTTTAAGCACGCCGG- 3' (SEQ ID NO:35)
  • Detection Extension Primer 607 E30 5'-GCCGCCAGAATGAGCAGA- 3' (SEQ ID NO:36) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Termination mix: ddA/ddC/ddG The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 29, below.
  • Amplification Primers* CV-F31 5'-ACGTTGGATGGAGACGACGTGGACGGCAC- 3' (SEQ ID NO:37)
  • CV-R32 5'-ACGTTGGATGCGTGCTTGGACACGCGACTT- 3' (SEQ ID NO:38)
  • Detection Extension Primer CV33 E 5'-CTCCTTGTCCGAAGCCGC- 3' (SEQ ID NO:39) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Termination mix: ddA/ddC/ddT The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 30, below.
  • CMV 560 Assay For quantitative PCR the region chosen is situated in the human CMN UL97 region that codes for a viral serine/threonine protein kinase.
  • a standardized quantitation panel was prepared with CMN strain AD169.
  • the CMN stock of 4xl0 10 was diluted with human negative plasma (Accrometrix) to concentrations of 40 copies/ml to 4xl0 8 CMN copies per mililiter.
  • FIG. 13A1-13G3 illustrate typical results of the CMN assay.
  • FIG. 13A1-13A3 are a set of mass spectra in a CMN quantitative assay on samples containing 400 CMV copies/ml compared to internal controls.
  • FIG. 13B1-13B3 are a set of mass spectra in a CMV quantitative assay on samples containing 4000 CMV copies/ml compared to internal controls.
  • FIG. 13C1- 13C3 is a set of mass spectra in a CMV quantitative assay on samples containing 40,000 CMV copies/mlcompared to internal controls.
  • FIG. 13D-13D3 is a set of mass spectra in a CMV quantitative assay on samples containing 400,000 CMV copies/ml compared to internal controls.
  • FIG. 13E1-13E3 are a set of mass spectra in a CMV quantitative assay on samples containing 4,000,000 CMV copies/ml compared to internal controls.
  • FIG. 13F1-13F3 is a set of mass spectra in a CMV quantitative assay on samples containing 40,000,000 CMV copies/ml compared to internal controls.
  • FIG. 13G1-13G3 is a set of mass spectra in a CMN quantitative assay on samples containing 400,000,000 CMN copies/ml compared to internal controls.
  • Wild type CMV template 5 '-CCACGAATGCTCGCAGACgATGCTGCACGAATACGTCAGAA-3 '
  • Amplification Primers* CMV560-S : 5' -ACGTTGGATGCGCTTCTACCACGAATGCTC-3'(SEQ. IDN0:58)
  • CMV560-L 5' -ACGTTGGATGATAAATACAGCCCGTCGCTC-3'(SEQ. ID NO:59)
  • Detection Extension Primer CMV560-E 5 '- CTTTCTGACGTATTCGTGCAGCAT-3 ' (SEQ. ID NO:60) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Amplicon length: 94 bp ( Termination mix: ddA ddC/ddT The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 31, below. Table 31. Sequence, length and mass of extension primer
  • This section generally describes exemplary procedures used in CMV assays.
  • Plasma samples blood was collected in sterile tubes containing EDTA (K2) or ACD, and stored at room temperature. Plasma was removed from cells within 4 hours of collection. The samples were separated by centrifugation at 1000 x g for 10 to 15 minutes and standard laboratory procedures were used to remove the plasma. Specimens were not clarified by filtration or further centrifugation.
  • SPECIMEN STORAGE AND STABILITY Specimens were stored at -60° to -80 °C in sterile, screw-capped tubes. Specimens may also be stored at 2° to 8°C for up to 48 hours or at -20°C in a non-frost free freezer for up to 72 hours prior to freezing at -60° to -80 °C. Repeated freeze/thaw of samples was avoided. Specimens were shipped frozen on dry ice and packaged and labeled in compliance with federal and international regulations covering the transport of clinical samples and etiologicalagents.
  • SAMPLE VOLUME This assay was perfonned with 500 ⁇ l of sample for a single determination. At least 1 ml of plasma was used in the tube.
  • PROCESSING WHOLE BLOOD Specimens were centrifuged at 1000 x g for 10-15 minutes within 4 hours of blood collection. Plasma was aseptically removed and aliquoted (without disturbing the white cell layer or clot) into sterile unbreakable tubes (duplicate aliquots of at least 1 mL plasma are advised to avoid freeze-thaw of specimen in case of repeat testing). Plasma was immediately frozen at -60°C to -80°C within 30 minutes of separation. Specimens can be stored at -20°C in a non-frost-free freezer for up to 72 hours.
  • CRITERIA FOR UNACCEPTABLE SPECIMENS Volume of plasma was below 1 ml. Barcode of the tube was missing or not readable. Inappropriate specimens, e.g., blood instead of plasma. Specimen as received was already defrosted.
  • SPECIMEN HANDLING Blood samples were received with the lab barcode identification numbers. The sample identification was ensured throught out the process by the tracking system on FreedomTM, BioRobot MDxTM, GenesisTM, and MasARRAYTM systems. Specimens were handled as if capable of transmitting infection. Specimen was stored immediately after receipt in the -80C freezer were not processed immediately.
  • MATERIALS AND EQUIPMENT I Reagents used for PCR amplification: 10 mM dNTPs (Invitrogen), 10 ⁇ M primer mix (forward and reverse) (IDT), internal control - oligo (IDT), PCR kit (Qiagen), sterile water, 10%> bleach.
  • kit (Qiagen) contains the following reagents: lOx PCR MgCl 2 buffer; 25 mM MgCl 2; and HotStar Taq DNA Polymerase. Volumes that were used for the PCR reactions are provided in Table 32, below.
  • Oligo-standard (internal control or internal standard) stock solutions were made.
  • the oligo-standard comes in dry-form.
  • the 20 ⁇ M solution of the oligo-standard oligo-standard was thawed and vortexed before use if frozen.
  • a 1 ⁇ M stock of oligo-standard was made by diluting 20 ⁇ l of 20 ⁇ M oligo-standard solution in 380 ⁇ l of a 1 ng/ ⁇ l earner DNA.
  • Reagents used for MassARRAYTM SpectroCHIP, 384-well microplates for PCR (Marsh #SP0401Sequen); 96-well polypropylene skirted microplates for resin addition (Marsh #AB-0800); 96-well polystyrene v-bottom microplates for use with liquid handler (Sarstedt #82.1583); Adhesive PCR foil seals for freezing plates (Marsh #AB-0626); Adhesive Plate seals for temporary sealing (Marsh #AB-0580); Adhesive PCR seals for use in thermocycling (Marsh #AB-0558 or ABI MicroAmp #4306311); 20ul tips for the liquid handler (VWR #BK717254); tips for manual pipettors; tubes for mixing reagents
  • hME buffer hME SAP enzyme (Shrimp Alkaline Phosphatase); ACT MassEXTENDTM Mix; ThermoSequenaseTM enzyme; SpectroCLEANTM resin; 3 point calibrant; Autoclaved or sterile water >18.2MegaOhm cm resistivity (store in plastic); Deionized >18.2MegaOhm/cm resistivity water for instrument wash stations; isopropanol for liquid handler cleaning; 50% ethanol for nanodispenser operation (stored in sealed, plastic container); , oligonucleotide primers; Desiccant (silica gel with moisture indicator).
  • hME buffer hME SAP enzyme (Shrimp Alkaline Phosphatase); ACT MassEXTENDTM Mix
  • ThermoSequenaseTM enzyme SpectroCLEANTM resin
  • 3 point calibrant Autoclaved or sterile water >18.2MegaOhm cm resistivity (store
  • Exemplary Hardware/Software MassARRAYTM Liquid handler (Beckman Multimek) automated 96-channel pipettor with controller PC; MassARRAYTM Nanodispenser (RoboDesign pin tool) micro-a ⁇ ayer with controller PC; 384-well microplate Thermocycler; MassARRAYTM Genotype Analyzer (Braker Autoflex MALDI-TOF Mass Spectrometer controlled by SpectroACQUIRE software); MassARRAYTM RT Workstation; MassARRAYTM Assay Design Software; MassARRAYTM Oracle Database; Plate centrifuge; universal plate holders; SpectroCLEANTM resin plate, spoon and scraper; dessiccator for chip storage; single and multi-channel pipettors; plate rotator for mixing resin after a plate has been stored frozen.
  • MassARRAYTM Liquid handler (Beckman Multimek) automated 96-channel pipettor with controller PC; MassARRAYTM Nanodispenser (RoboDesign pin tool) micro-
  • hME Homogeneous MassExtend Reaction hME cocktail was prepared in a tube according to Table 34, below. One reaction volume was multiplied by the number of samples and then by 1.38 (volumes were for a 384- well microplate and included a 38% overage to account for possible pipetting loss and dead volume in the 96-well microtiter plate used on a Multimek). Volumes that can be used for the hME reactions are provided in Table 34, below.
  • ThermoSequenase was kept at -20° C until added to the reaction cocktail. 2 ⁇ l of the hME cocktail mix was dispensed to the appropriate wells containing 7 ⁇ l dephosphorylated PCR product (see Testing Procedure). SPECTROCLEAN RESIN CLEAN UP Using the SpectroCLEANTM plate, resin was transferred into the 96-well Marsh plate. The SpectroCLEANTM plate controls the volume of resin added. ACCEPTABLE REAGENT PERFORMANCE The acceptability of a reagent was determined by ensuring that quality control results (negative, high, and low controls) were within acceptance criteria +/-0.51og 1( )Value when received from the manufacturer (Affimetrix).
  • Pre-assigned values for internal standards were: 1pm, lOOfM, lOfM, lfM, lOOaM, lOaM, laM. Standards were assayed with each ran according to the plate 384 well map.
  • the assay must be repeated, then do the following: review instructions to ensure that the assay is perfonned according to the procedure; verify that the standards and controls are in the appropriate location specified by the plate map; verify that the materials are not expired; verify that the liquid handling robotics are pipetting correct volumes (should be done before the original run).
  • CMV DNA Extraction CMV DNA was extracted on MDX, Qiagen according to standard procedures. The external standards (240 ⁇ l) were diluted and pipetted to S-block under the biological hood.
  • the volumes of reagents per reaction in Table 32 were multiplied by the number of reactions and by multiplication factor which depended on the sample number run with each oligo-standard concentration (see Table 36). Increasing the final volume allowed for pipetting losses and 'dead' volume when using robotics. The mix was stored at 4 ° C until use.
  • hME Homogeneous MassExtend Reaction Procedure: hME cocktail was prepared according to Table 37, above. One reaction volume was multiplied by the number of samples and then by 1.38. The composition of a typical hME preparation are provided in Table 38, below.
  • Volumes are for a 384- well microplate and include a 38 % overage to account for possible pipetting loss and dead volume in the 96-well microtiter plate used on the Multimek. & ThermoSequenaseTM was kept at -20° C in a portable cooler or freezer at all times.
  • Chips were read according to the manufacturer's instructions. The specific issues in quantitative assays were: (1) Sample Group in Plate Editor contained in SamplelD column: name of the samples
  • FIGS. 13A-13G are spectra in CMV quantitative assays for samples containing 400 to 4xl0 8 copies/ml.
  • the CMV target was read as "C” allele, and the internal standard (IS) as "T” allele.
  • the areas under the signal peaks are were used by Sequenom Quantification software for quantitation of CMV concentration in the sample.
  • the data from the Quantitative Assay was measured as the area under the curve
  • NEGATIVE CONTROLS 1.
  • the area under the curve of the Negative Control should be less than the corresponding value of the cutoff (100 copies/mL). 2.
  • the assay should be flagged as "Invalid” if the above condition is not met.
  • POSITIVE CONTROLS 1.
  • the Positive Controls should quantitate within the range +/-0.51og of the value on the standard label for home made standards or on the package insert for Acrometrix standard. 2. If the Positive Controls quantitate outside the above range, the assay should be flagged "Invalid".
  • SPECIFICITY of the CMN560 ASSAY- He ⁇ es Virus GROUP CMV is a member of the he ⁇ es viras group, which includes he ⁇ es simplex virus types 1 and 2, varicella-zoster viras, HSV type 4, (which causes chickenpox), and Epstein-Barr virus, HSV type 3, (which causes infectious mononucleosis).
  • Specificity of the CMV560 assay was determined by testing amplification primers and extend probe against each of the four types, above mention, he ⁇ es viras reference standards using 10 3 D ⁇ A copies in each reaction.
  • CMV560 assay was specific only for CMV virus. Also, positive specific tests were run for each of the other type viruses to ensure that there was specific D ⁇ A target.
  • the Linearity of the CMV assay extends over seven logs.
  • the linear range of the CMV assay in this experiment was from 400 - 40,000,000 copies/ml (FIG. 14).
  • Example 5 Screen for Hemachromatosis Mutations Hereditary hemochromatosis is classically inherited as a recessive trait but is genetically heterogenous. Mutations in the HFE and the TFR2 (transferrin receptor2; Y250X) genes account for about 80% of patients, while a third locus on chromosome lq is responsible for juvenile hemochromatosis. The nonclassical form of iron overload inherited as an autosomal dominant trait is caused by the mutation N144H in the SLCll A3 protein. Hematochromatosis is a condition that causes the intestine to absorb too much iron.
  • Juvenile hemochromatosis or hemochromatosis type 2 is an autosomal recessive disorder.
  • One form, which is designated HFE2A maps to lq21.
  • a second form, designated HFE2B, is caused by mutation in the gene encoding hepcidin antimicrobial peptide and maps to 19ql3.
  • Hemochromatosis type 3 is an autosomal recessive disorder.
  • HFE3 is an autosomal recessive disorder, caused by mutation in the gene encoding transferrin receptor-2 isoform (TFR2), which maps to 7q22.
  • Hemochromatosis type 4 (HFE4), an autosomal dominant disorder, is caused by mutation N144H in the SLCll A3 gene (604653) that maps to 2q32 and encodes ferroportin 1/IREG1/MTP1 - an intestinal iron transporter.
  • Hemochromatosis type 5 is autosomal dominant and caused by mutation in H-ferritin - iron responsive element.
  • HEE Gene Product HEE protein Mutations: ⁇ 63D; C282Y; S65C Mutation Frequency: The prevalence of C282Y homozygosity, H63D homozygosity, and C282Y/ H63D compound heterozygosity is estimated to be 0.26%, 1.89% and 1.97%, respectively.
  • the prevalence estimates for C282Y heterozygosity i.e. C282Y/wild type) are 9.54% among non-Hispanic white population, 2.33% among non-Hispanic blacks, and 2.75% among Mexican- Americans.
  • the prevalence estimates of the C282Y mutation in the US population and of the H63D mutation are 5.4% and 13.5%, respectively.
  • CYS282TYR C282Y
  • HIS63ASP H63D
  • S65C S65C
  • CYS282TYR is a missense mutation caused by a G-to-A change at nucleotide position 845 in exon 4 that results in a cysteine to tyrosine transition at position 282 [Cys282Tyr (C282Y)] in the HF ⁇ protein. More than 80% of patients with hereditary hemochromatosis are homozygous for this mutation.
  • HIS63 ASP is a mutation caused by a C-to-G change in exon 2 that results in a histidine to asparagine subsitution at position 63 [His63Asp (H63D)] in the HF ⁇ protein. Heterozygotes for this mutation are highly prevalent in the general population. This mutation has been found in higher frequency in patients heterozygous for the C282Y substitution than in control individuals. In the homozygous state, His63Asp has been also been observed in a few patients with hereditary hemochromatosis. It is still unclear, however, whether this mutation is a neutral polymo ⁇ hism or a mutation that in the presence of the C282Y mutation results in a more affected phenotype.
  • S65C is a mutation, A193T, resulting in a serine to cysteine change at amino acid 65 (S65C) that appears to be associated with milder forms of hereditary hemochromatosis.
  • the HFE screens described herein can be recommended for a patient, for example, when a member of the patient's family has been diagnosed with HFE and/or when evidence of iron overload exists.
  • HFE-F1 5'-ACGTTGGATGATGACCAGCTGTTCGTGTTC-3' (SEQ ID NO:40)
  • HFE-R2 5'-ACGTTGGATGTCTACTGGAAACCCATGGAG-3'(SEQ ID NO:41)
  • Terminator Bases Mix ACT Extend Primer (FM3-E): 5' CTCCACACGGCGACTCTCAT-3' (reverse primer) (SEQ ID NO:42)
  • Analyte C 5' CTCCACACGGCGACTCTCATGA (SEQ ID NO:876)
  • Analyte G 5' CTCCACACGGCGACTCTCATC 3' (SEQ ID NO:877)
  • HFE-E3 Overview Wild type template GGATGACCAGCTGTTCGTGTTCTATGAT CATGAGAGTCGCCGTGTGGAGCCCCGA (SEQ ID NO:881) Mutated template GGATGACCAGCTGTTCGTGTTCTATGAT GATGAGAGTCGCCGTGTGGAGCCCCG (SEQ ID NO:882)
  • Analyte C 5' CAGCTGTTCGTGTTCTATGATC 3 ' (SEQ ID NO:883)
  • Analyte G 5' CAGCTGTTCGTGTTCTATGATGA 3' (SEQ ID NO:884)
  • HFE C282Y (G845A) mutation in exon 4 This section describes the amplification and detection extension primers for the C282Y Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Tables 33 and 34, below.
  • HFE-F4 5'-ACGTTGGATGTGGATAACCTTGGCTGTACC-3'(SEQ ID NO:46)
  • HFE-R5 5 '-ACGTTGGATGTATCACAATGAGGGGCTGATC-3 '(SEQ ID NO:47)
  • Amplicon length: 89 bp * amplification primers have the 10-mer tag specific for hME method: acgttggatg.
  • Analyte G 5' GCCTGGGTGCTCCACCTGGC 3' (SEQ ID NO:891)
  • Analyte A 5' GCCTGGGTGCTCCACCTGGTA 3' (SEQ ID NO:892)
  • HFE-F9 5'-ACGTTGGATGTAATGGGGATGGGACCTACC-3' (SEQ ID NO:49)
  • HFE-R10 5'-ACGTTGGATGTGCTCTCATCAGTCACATACC-3' (SEQ ID NO:50)
  • Amplicon length: 137 bp * amplification primers have the 10-mer tag specific for hME method: acgttggatg.
  • Terminator Bases Mix ACT Extend Primer (HFE-E6): 5' GGGAAGAGCAGAGATATACGT 3' (SEQ ID NO:51)
  • Analyte A 5' GGGAAGAGCAGAGATATACGTA 3' (SEQ ID NO:899)
  • Analyte G 5' GGGAAGAGCAGAGATATACGTGC 3' (SEQ ID NO:900)
  • HFE S65C (A193T) mutation in exon 2 This section describes the amplification and detection extension primers for the A193T Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Tables 35 and 36, below.
  • HFE-F1 5'-ACGTTGGATGATGACCAGCTGTTCGTGTTC-3' (SEQ ID NO:52)
  • HFE-R2 5'-ACGTTGGATGTCTACTGGAAACCCATGGAG-3'(SEQ ID NO:53)
  • HFE S65C_E1 5' GGGCTCCACACGGCGAC 3' (reverse primer) (SEQ ID NO:54)
  • Analyte A 5' GGGCTCCACACGGCGACT 3' (reverse primer) (SEQ ID NO:908)
  • Analyte T 5 * GGGCTCCACACGGCGACAC 3' (reverse primer) (SEQ ID NO:909)
  • Analyte A 5' TTCGTGTTCTATGATCATGAGAG 3' (7068.6 Da) (SEQ ID NO:917)
  • Analyte T 5'-TTCGTGTTCTATGATCATGAGT-3' (6730.4 Da) (SEQ ID NO:918)
  • FIG. 7 is a mass spectram of heterozygous "GA” alleles (heterozygous positive) for H63D Histidine to Aspartic acid (C187G) mutation in the FM3-E assay.
  • FIG. 8 is a mass spectram of heterozygous "GC” alleles (heterozygous positive) for H63D Histidine to Aspartic acid (C187G) mutation in the HFE-E3 assay.
  • FIG. 9 is a mass spectrum of heterozygous "GA” alleles (heterozygous positive) for S65C Serine to Cysteine (A193T) mutation in the HFE S65C El assay.
  • FIG. 7 is a mass spectram of heterozygous "GA” alleles (heterozygous positive) for H63D Histidine to Aspartic acid (C187G) mutation in the FM3-E assay.
  • FIG. 8 is a mass spectram of heterozygous "GC”
  • HFE assays HFE S65C_Eland HFE S65CJE5, were at total of 103 samples.
  • the samples were obtained from ARUP and our results are compared to the results from ARUP.
  • the results from 98 samples agree with ARUP results for both assays.
  • For six samples 01hFE_021220 & 101hFE_021220, 04hFE_021220 & 104hFE_021220, 41hFE_021126 & 141hFE_021126) our results differ from those from ARUP.
  • the samples: 101hFE_021220, 104hFE_021220, and 141hFE_021126 are duplicates (re-extracted and PCRed second time) of the samples 01hFE_021220, 04hFE_021220, and 41hFE_021126. All 4 of our results agree for each sample. e) In addition, since samples 01hFE_021220 and 04hFE_021220 had different calls for two mutations suggesting a mixup in the ARUP samples.
  • testskipline testskipline + 1
  • SkipLine Instreaml. SkipLine 'Always skip one line, for headers, or extraneous info.
  • DNATrans.txtDataFile.text CommonDialogl .FileName
  • DNATrans.txtWklName.text Mid$(txtDataFile.text, 1, Len(txtDataFile.text) - 4) &
  • DNATrans.txtWklName.text Mid$(txtDataFile.text, 1, Len(txtDataFile.text) - 4) &
  • 371 strRow "C" Case 4, 20, 36, 52, 68, 84, 100, 116, 132, 148, 164, 180, 196, 212, 228, 244, 260,
  • strRow "G" Case 8
  • strRow "O" Case 16, 32, 48, 64, 80, 96, 112, 128, 144, 160, 176, 192, 208, 224, 240, 256, 272,

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Other Investigation Or Analysis Of Materials By Electrical Means (AREA)

Abstract

The invention relates to systems and methods for analyzing clinically relevant nucleic acid sequences.

Description

Systems and Methods for Analyzing Nucleic Acid Sequences
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application Nos. 60/493,238, filed on August 6, 2003, and 60/568,958, filed on May 7, 2004. The contents of both of those provisional applications is incorporated herein by reference in its entirety. TECHNICAL FIELD This invention relates to systems and methods for analyzing clinically relevant nucleic acid sequences.
BACKGROUND The healthcare delivery system has changed remarkably over the past several decades. Clinical laboratories are under increasing pressure to deliver low cost and highly accurate analytical services with the rapid turn-around time required by physicians and patients. Laboratory testing has changed and improved in recent years to meet the challenge. Robotics has been introduced to the laboratory to increase efficiency and reduce the need for human ■, participation, and laboratory instruments have been designed to decrease the biological sample volumes needed to perform various assays. However, more improvement in the clinical laboratory area is required to meet the demands of the ever-changing healthcare system.
SUMMARY The present invention provides novel automated systems and methods to perform assays on nucleic acid sequences (e.g., clinically relevant nucleic acid sequences). The system can provide assay results quickly, accurately, and in a format easily accessible by health care providers and/or third party payors-(e.g., insurance companies). The invention also provides novel and highly accurate assays using mass spectrometry (e.g., matrix-assisted laser desorption/ionization (MALDI)). In one aspect, the invention provides a system for performing a diagnostic assay on a biological sample. The system includes, as its main components (a) a central controller programmed to: (i) exchange infomiation about the biological sample with an outside system or database; and (ii) exchange information about the biological sample with one or more modules of the system; (b) a sample transfer module for transferring a portion of the sample to a first container; (c) a nucleic acid extraction module for extracting nucleic acids from cells within the portion and for transferring the portion from the first container to a second container; (d) a nucleic acid measurement module for measuring the concentration of nucleic acids in the portion; (e) a PCR preparation module for adding polymerase chain reaction (PCR) reaction materials (e.g., individual nucleotides, primers, polymerase enzymes, and reagents) to the portion; (f) a thermocyling module for amplifying a target sequence and extending a primer in the portion; (g) a primer extension preparation module for adding primer extension reaction materials to the portion; (h) a mass spectrometry preparation module for removing a sample of the portion from the second container to a support (e.g., chip or microwell) for analysis by mass spectrometry; and (i) a mass spectrometry module for analyzing the sample. The central controller can be a computer system, e.g., a commercially available personal computer system, and can include linking software that enables the central controller to communicate with at least one other module in the system. The system can also include a plate editor module that provides sample information to the PCR preparation module, a transport module comprising one or more robotic arms or tracks to transport a biological sample, or portion thereof, between at least two modules of (a) to (i), and arranged to receive information from and transmit information to the central controller. The system can also include a detection module for detecting the presence of a sample and monitoring the progress of the sample through the system, and arranged to receive information from and transmit information to the central controller. The nucleic acids measurement system can include an ultraviolet light spectrophotometer or a fluorometer. The PCR preparation module can include a pipetting robot, and the thermocycling system can include a thermocyler. The system can further include a computer-readable medium comprising one or more programs for instructing a given module. The PCR preparation module can include PCR materials, e.g., at least one primer set described herein, e.g., a primer set selected from among SEQ ID NOS:l to 504, each primer set including two amplification primers and one detection extension primer. The sample transfer system can include a pipetting robot. In another aspect, the invention provides a method of performing a diagnostic assay on a biological sample. The method includes (a) performing on a biological sample an assay using a clinical assay system, wherem the assay comprises mass spectrometry analysis of a target nucleic acid; and (b) automatically reporting information about the assay from a central controller of the clinical assay system to an outside system or database accessible by at least one health care provider (e.g., at least 2, 10, or more than 10) or at least one third party payor (e.g., at least 2, 10, or more than 10). The clinical assay system can include at least one component selected from the group consisting of: a central controller, a sample transfer module, a nucleic acid extraction module, a nucleic acid measurement module, a PCR preparation module, a thermocyling module, a primer extension preparation module, a mass spectrometry preparation module, and a mass spectrometry module. i another aspect, the invention provides a method of performing a diagnostic assay on a biological sample. The method includes (a) receiving a biological sample, generating information about the biological sample, and transmitting the information to a central controller; (b) transferring a portion of the biological sample to a first container; (c) extracting nucleic acids from cells within the portion and transferring the portion to a second container; (d) measuring the concentration of extracted nucleic acids in the portion; (e) adding polymerase chain reaction (PCR) materials to the portion; (f) amplifying target nucleic acids in the portion; (g) adding primer extension reaction materials to the portion; (h) extending a detection extension primer in the portion; (i) transferring a sample of the portion from the second container to a support; (j) analyzing the sample and exporting data to the central controller using a mass spectrometry system; and (k) transmitting the data from the central controller to an output device, external system, or database. In certain embodiments, steps (a) to (k) can be performed automatically by an automated system. The automated system can include at least one component selected from the group consisting of: a central controller, a sample transfer module, a nucleic acid extraction module, a nucleic acid measurement module, a PCR preparation module, a thermocyling module, a primer extension preparation module, a mass spectrometry preparation module, and a mass spectrometry module. In certain embodiments, the diagnostic assay can be an assay for detecting mutations in a gene. The gene can be a gene selected from the group consisting of: 5,10- Methylenetetrahydrofolate Reductase (MTFR); Coagulation Factor II; Coagulation Factor N; hemochromatosis (HFE); and a glucocerebrosidase (GC). fibroblast growth factor receptor 3; aspartoacylase; Glucocerebrosidase; Coagulation Factor Nil; Fanconi Anemia, Complementation
Group C (FAΝCC); inhibitor of kappa light polypeptide gene enhancer in b cells, kinase complex-associated protem; acid sphingomyelinase; hexosaminidase; angiotensin i-converting enzyme; adenylate cyclase 9; apolipoprotein A-l; apolipoprotein E; endothelial leukocyte adhesion molecule 1; fc fragment of IGG, low affinity Ila, receptor; fibrinogen beta chain; coagulation factor II, factor XIII; guanine nucleotide-binding protein beta-3; integrin, alpha-2, glycoprotein Ia/Iia; glycoprotein lb, platelet, alpha polypeptide; intercellular adhesion molecule 1; glycoprotein Ia/IIa (a2), integrin, alpha-2; platelet glycoprotein lib, integrin, alpha- 2b; glycoprotein Ilb/IIIa, integrin, beta-3;3-hydroxy-3-methylglutaryl-coa reductase; lymphocyte adhesion molecule 1; methylene tetrahydrofolate reductase; plasminogen activator inhibitor 1; platelet alpha-granule membrane protein; transforming growth factor-beta receptor, type III; thrombomodulin; tumor necrosis factor; vascular cell adhesion molecule; coagulation factor II receptor; glycoprotein VI, platelet; purinergic receptor P2Y,g protein-coupled, 1 ; purinergic receptor P2Y, G protein-coupled, 12; prostaglandin-endoperoxide synthase 1 ; prostaglandin- endoperoxide synthase 2; thromboxane A2 receptor, platelet; and thrombospondin I. In other embodiments, the diagnostic assay is an assay for detecting a pathogen in the sample, e.g., a virus, bacterium, or fungus. The virus can be a virus of the family Herpesviridae, e.g., cytomegalovirus (CMN). In another aspect, the invention provides an method, e.g., an automated method, for detecting mutations in a target gene. The method includes a) amplifying a target sequence using PCR and performing, e.g., automatically, a primer extension reaction using a set of three primers, each set of primers including two amplification primers and one detection extension primer; b)< transferring, e.g., automatically, detection extension primers to a mass spectrometry device; and c) determining, e.g., automatically, the molecular weights of the detection extension primers by mass spectrometry following the primer extension reaction, wherein a change in the molecular weight of the extended primer, as compared to a control, indicates the presence of a mutation in the gene. The method can include automatically transmitting information related to the presence of the mutation to a central controller. In certain embodiments, the gene is a 5,10-Methylenetetrahydrofolate Reductase (MTFR) gene, and the set of three primers is selected from the group .consisting of: SEQ ID ΝOS: 1, 2, and 3; SEQ ID ΝOS: 4, 5 and 6; SEQ ID ΝOS: 1, 8, and 9; and SEQ ID ΝOS: 10, 11, and 12; each set of primers including two amplification primers and one detection extension primer. In other embodiments, the gene is a Coagulation Factor II gene, and the set of three primers is selected from the group consisting of: SEQ ID NOS: 13, 14, and 15 and SEQ ID NOS: 16, 17 and 18; each primer set including two amplification primers and one detection extension primer. In still other embodiments, the gene is a Coagulation Factor Ngene, and the set of three primers is selected from the group consisting of: SEQ ID ΝOS: 19, 20, and 21 or SEQ ID ΝOS: 22, 23 and 24; each primer set including two amplification primers and one detection extension primer. hi yet other embodiments, the gene is a hemochromatosis (HFE) gene, and the set of three primers is selected from the group consisting of: SEQ ID ΝOS: 40, 41, and 42, SEQ ID ΝOS: 43, 44 and 45; SEQ ID ΝOS: 46, 47 and 48; SEQ ID ΝOS: 49, 50 and 51; SEQ ID ΝOS: 52, 53 and 54; or SEQ ID ΝOS: 55, 56 and 57; each set of primers including two amplification primers and one detection extension primer. In another aspect, the invention includes a method, e.g., an automated method, for detecting a pathogen in a biological sample. The method includes a) amplifying a target sequence using PCR and performing, e.g., automatically, a primer extension reaction using a set of three primers, each set of primers including two amplification primers and one detection extension primer; b) transferring,e.g., automatically, detection extension primers to a mass spectrometry device; and c) determining, e.g., automatically, the molecular weights of the detection extension primers by mass spectrometry following the primer extension reaction, wherein a change in the molecular weight of the extended primer, as compared to controls, indicates the presence presence of a pathogen in the sample. The controls can include an internal control for determining the amount of the pathogen in the sample. In some embodiments, the the pathogen is cytomegaloviras (CMN), and the three primers are selected from the group consisting of: SEQ ID ΝOS: 25, 26, and 27; SEQ ID ΝOS: 28, 29 and 30; SEQ ID ΝOS: 31, 32, and 33; SEQ ID ΝOS: 34, 35, and 36; SEQ ID ΝOS: 37, 38, and 39; and SEQ ID ΝOS: 58, 59, and 60; each primer set including two amplification primers and one detection extension primer. In another aspect, the mvention includes an isolated DΝA selected from the group consisting of SEQ ID ΝOS .: 1 to 504. In still another aspect, the invention includes a kit that includes at least one primer set described herein, e.g., a primer set selected from among SEQ ID NOS:l to 504, each primer set including two amplification primers and one detection extension primer, and instructions for using the primer set to detect or analyze a target nucleic acid sequence in a biological sample. For example, instructions can be provided to describe how to use the primers to detect the presence of, or identify mutations in, a particular nucleic acid sequence or gene. As another example, the instructions can describe how to use the primers to detect the presence of a pathogen (e.g., a virus, bacterium, and/or fungus), the quantity of the pathogen, and/or the genotype of the pathogen. hi yet another aspect, the mvention includes a computer readable medium that includes a program for instructing a central controller in an automated system for performing an assay on a biological sample to: (a) receive a biological sample, generate information about the biological sample, and transmit the information into a central controller; (b) transfer a portion of the biological sample to a first container; (c) extract nucleic acids from cells within the portion and transfer the portion to a second container; (d) measure the concentration of extracted nucleic acids in the portion; (e) add polymerase chain reaction (PCR) materials to the portion; (f) amplify target nucleic acids in the portion; (g) add primer extension reaction materials to the portion; (h) extend a detection extension primer in the portion; (i) transfer a sample of the portion from the second container to a support; (j) analyze the sample and exporting data to the central controller using a mass spectrometry system; and (k) transmit the data from the central controller to an output device, external system, or database. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and equipment or software similar or equivalent to those described herein can be used in the practice of the present invention, suitable methods, equipment, and software are described below. All publications and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control, i addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features and advantages of the invention will be apparent from the description and drawings, and from the claims.
DESCRIPTION OF DRAWINGS FIG. 1 is a diagram illustrating the main components of a clinical assay system and the flow of biological samples and information through the system. FIG. 2 is a flow diagram illustrating the steps of the clinical assay system. FIG. 3 is a mass spectrum of a heterozygous "TC" allele (heterozygous positive) generated using a screen for a C677T mutation in the 5,10-Methylenetetrahydrofolate Reductase (MTFR) gene. FIG. 4 is a mass spectrum of a heterozygous "GA" allele (heterozygous positive) generated using a screen for a G20210A mutation in the Coagulation Factor II (FII) gene. FIG. 5 is a mass spectrum of a heterozygous "GA" allele (heterozygous positive) generated using a screen for a R506Q mutation in the Coagulation Factor V gene. FIG. 6 is a mass spectrum of a heterozygous "GA" allele (heterozygous positive) generated using a screen for a R506Q mutation in the Coagulation Factor V gene. FIG. 7 is a mass spectrum of heterozygous "GC" alleles (heterozygous positive) for H63D Histidine to Aspartic acid (C187G) mutation in the FM3-E assay. FIG. 8 is a mass spectrum of heterozygous "GC" alleles (heterozygous positive) for H63D Histidine to Aspartic acid (C187G) mutation in the HFE-E3 assay. FIG. 9 is a mass spectrum of heterozygous "GA" alleles (heterozygous positive) for S65C Serine to Cysteine (A193T) mutation in the HFE S65C El assay. FIG. 10 is a mass spectrum of heterozygous "GA" alleles (heterozygous positive) for S65C Serine to Cysteine (A193T) mutation in the HFE S65C E5 assay. FIG. 11 is a mass spectrum of heterozygous "GA" alleles (heterozygous positive) for
C282Y cysteine to tyrosine (G845A) mutation in the FM6-E assay. FIG. 12 is a mass spectrum of heterozygous "GA" alleles (heterozygous positive) for C282Y cysteine to tyrosine (G845A) mutation in the HFE-E6 assay. FIG. 13A1-13A3 is a set of mass spectra in a CMV quantitative assay on samples containing 400 CMV copies/ml. FIG. 13B1-13B3 is a set of mass spectra in a CMN quantitative assay on samples containing 4000 CMN copies/ml. FIG. 13C1-13C3 is a set of mass spectra in a CMN quantitative assay on samples containing 40,000 CMN copies/ml. FIG. 13D-13D3 is a set of mass spectra in a CMN quantitative assay on samples containing 400,000 CMN copies/ml. FIG. 13E1-13E3 is a set of mass spectra in a CMN quantitative assay on samples containing 4,000,000 CMN copies/ml. FIG. 13F1-13F3 is a set of mass spectra in a CMN quantitative assay on samples containing 40,000,000 CMN copies/ml. FIG. 13G1-13G3 is a set of mass spectra in a CMN quantitative assay on samples containing 400,000,000 CMN copies/ml. FIG. 14 is a graph that plots CMN plasma samples versus internal standards. A CMN control (4xl09 copies per ml) was diluted down to 40 copies/ml in 10-fold increments, mixed with the Internal Standard of appropriate concentration, extracted (240 μl) on MDX (Qiagen), eluted in 75 μl of buffer and assayed (2 μl) by PCR, followed by SAP treatment, extension reaction and mass spectrometry analysis. FIG. 15A-15GG is a table that lists a number of genetic targets for the assays of the invention, along with exemplary primers for those targets. DETAILED DESCRIPTION The invention provides a new highly automated system for performing clinical assays, optionally with automatic billing to third party providers such as insurance companies. The invention also provides novel assays using mass spectrometry (e.g., matrix-assisted laser desorption/ionization (MALDI). The assays are highly accurate and can detect, for example, sequence variations (e.g., mutations and/or polymorphisms) and foreign sequences (e.g., viral sequences) incorporated into a target gene. The assays are also useful for infectious disease/pathogen testing. The entire process, or portions thereof, can be automated, i.e., performed by machine(s). Accordingly, the present invention also includes a high-throughput process for performing the assays described herein. Thus, the new system can perform dozens (e.g., 96, 128, 384) of different assays on dozens of different biological samples at the same time.
Clinical Assay System Overview of System FIG. 1 provides an overview of the clinical assay system 2 of the present invention. The clinical assay system includes, as its main components, the following modules. A central controller 4 for exchanging information about the biological sample with an outside system or database 8 and with one or more modules or systems within clinical assay system, and an input device 6; a sample transfer system 10 for transferring a portion of the sample to a first container; a nucleic acid extraction system 12 for extracting nucleic acids from the portion and for transferring the portion from the first container to a second container; a nucleic acid measurement system 14 for measuring the concentration of nucleic acids in the portion; a PCR preparation system 16 for adding polymerase chain reaction (PCR) reaction materials to the portion; a thermocycling system 18 for amplifying a target sequence and extending a primer in the portion; a primer extension preparation system 20 for adding primer extension reaction materials to the portion; a mass spectrometry preparation system 22 for removing a sample of the portion from the second container to a platform for analysis by mass spectrometry; and a mass spectrometry system 24 for analyzing the sample. The central controller is capable of controlling one or more system modules, collecting and organizing data obtained from one or more of the system modules and an outside system or database, and of sending data to one or more of the system modules and an outside database (e.g., a database accessible by healthcare providers or third parties) or system (e.g., an outside computer through which health care providers or third parties can access the data). The input device 6 associated with the central controller can be a bar code reader. The system can optionally include a detection system 5 for detecting and tracking a sample as it progresses through the system. The system can also include a transport subsystem 25, e.g., a system of one or more robotic arms and/or tracks, for transporting samples between two or more modules within the system.
Central Controller Typically, the central controller 4 is a computer system. The computer systems that can be used are commonly available personal computers having read-write memory, or industrial counterparts thereof. The central controller is provided with a suitable input device 6 such as a keyboard, touch screen, card reader, bar code scanner, or another computer (e.g., for inputting biological sample processing instructions and patient identification information). The central controller 4 is run by linking software, which directs the central controller to receive information from, and/or transmit information to, each of the modules in the overall system. For example, the central controller can be configured to exchange information with one or more modules within the clinical assay system, and to relay that information to one or more other modules. Such information may include information about a biological sample, e.g., sample identification, information as to which assay(s) is to be/has been performed on a sample, and the location of a sample within the clinical assay system and within a given batch of samples being processed. The central controller 4 is also configured to exchange information with outside systems and/or databases 8 (i.e., systems or databases not part of the clinical assay system). This configuration allows the central controller to report, e.g., the results of the clinical assays described herein, along with other data, e.g., billing amounts, patient identification, and other data to health-care providers (e.g., technicians, nurses, physicians) and/or third parties (e.g., insurance providers) at other sites. Reporting can occur automatically. Exemplary of outside systems are systems capable of interfacing directly with the central controller, or with a database accessible by both the outside system and the central controller. For example, Meditech™ provides a laboratory application that allows multisite and/or multifacility specimen tracking, through which the central controller can exchange information with outside systems. Sample Transfer Module The sample transfer system 10 can be any system capable of receiving a biological sample, e.g., a blood sample, removing an aliquot of the sample, and placing the aliquot into one or more receptacles. Exemplary systems are pipetting robots, such as the Genesis® Freedom™ Automated Workstation. The system is capable of scanning sample tube barcodes and multiwell (e.g., 96-well) plates, and creating a file that indicates where on the multiwell plate a sample is located following the' transfer. The file can include information such as the barcodes of scanned sample tubes, the location of these samples on the multiwell plate, the volume transferred from the sample tube to the plate, and overall identifying information (e.g., a barcode) for of the multiwell plate (called DNA plate).
Nucleic Acid Extraction Module The nucleic acid extraction system 12 can be any system capable of carrying out techniques, such as those described herein, for purifying nucleic acids (i.e., DNA and/or RNA) from one or more biological samples. An example of such a system is the BioRobot® MDx produced by Qiagen.
Nucleic Acids Measurement Module The nucleic acids measurement system 14 can be any system capable of measuring the concentration of nucleic acids in a sample. For example, the system can be a commercially available ultraviolet (UN) light spectrophotometer, which is capable of determining the concentration of nucleic acids using optical density measurements. As another example, the system can be capable of measuring the UN-induced fluorescence of dye (e.g., ethidium bromide or Pico Green) intercalated into the nucleic acid, such as a fluorometer. The Genesis® Freedom™ Automated Workstation produced by Tecan can include such a fluorometer. The nucleic acid measurement system can be associated with (e.g., a part of) the sample transfer system, or it can be a stand-alone module.
PCR Preparation Module The PCR preparation system 16 can be any system capable of adding appropriate materials, e.g., enzymes (e.g., Taq polymerase), nucleic acid primers, individual nucleotides, and reagents, to an aliquot in preparation for amplifying a target sequence in the aliquot. The PCR preparation also prepares appropriate control reaction mixes. Examples of such systems are the Genesis® Automated Workstation and the Tecan TeMO™ multi-pipetting module. Overall, the PCR preparation system is capable of performing at least two steps. The first is to dispense appropriate assay mixes. Assay mixes can be prepared by an individual, e.g., a technician, or by a robot, according to typical laboratory procedures, and placed into holders. These PCR preparation system dispenses the mixes from the holders to a position on a second multiwell (e.g., 384) plate, according to instructions (e.g., sample identification and assays to be performed) it receives from a plate editor 7 (described in detail below). The second is to add samples to the appropriate assay mix. Using the file received by the PCR preparation system 16 from the sample transfer system 10, the PCR preparation system transfers samples from the first multiwell (e.g., 96 well) plate to the second multiwell (e.g., 384 well) plate. In this way, the PCR preparation system is able to transfer samples from a first plate to a second plate, while keeping track of the location of the samples, and to ensure that the appropriate assays are performed on each sample. Thermocycling Module The thermocycling system 18 can be any system capable of performing PCR reactions, e.g., PCR amplification and/or primer extension reactions, and is typically a commercially available thermocycler. Exemplary systems include the GeneAmp PCR System 9700 manufactured by Applied Biosystems, the Perkin Elmer 2000 PCR thermocycler, and the PTC- 200 thermocycler manufactured by MJ Research.
Primer Extension Preparation Module The primer extension preparation system 20 can be any system capable of adding appropriate materials, e.g., Shrimp Alkaline Phosphatase (SAP; to dephosphorylate unincorporated dNTPs), extension primers (e.g., the extension primers described herein), and appropriate mixtures of dNTPs and ddNTPs, to an aliquot in preparation for performing primer extension reactions. An exemplary system is the Multimek™ manufactured by Beckman- Coulter Mass Spectrometry Preparation Module The mass spectrometry preparation system 22 can be any system capable of removing a sample of an aliquot and placing the sample on a support, e.g., a chip, for analysis by mass spectroscopy. The support can be composed of any material known to those skilled in the art to be usable in mass spectrometry, e.g., silicon, plastic, glass, and/or ceramic. A wide variety of chips are commercially available. Exemplary of chips is the Sequenom® SpectroCHIP™, which is supplied in 384 well format and are pre-spotted with a specially formulated matrix assisted laser desorption ionization (MALDI) matrix. The matrix can be of any composition known in the art of mass spectrometry, e.g., a -cyano-4-hydroxy cinnamic acid (CHCA), 2,4,6-trihydroxy acetophenone (THAP), or 3-dydroxypicolinic acid (3 -HP A) in ammonium citrate, the choice of which will depend, e.g., on the mass spectrometry system used and the assay to be performed. Exemplary of the mass spectrometry preparation systems is the Sequenom® SpectroPOINT™, a nanoliter sample dispensing instrument.
Mass Spectrometry Module The mass spectrometry system 24 can be any commercially available mass spectrometer. The clinical assay system of the present mvention can be configured to utilize mass spectrometer formats including matrix assisted laser desorption ionization (MALDI), electrospray (ES), ion cyclotron resonance (ICR) and Fourier Transform. In one embodiment, maMALDI is utilized in the clinical assay system of the present invention. An exemplary mass spectrometry system is the Sequenom® Autoflex™ Mass Spectrometer. With MALDI mass spectrometry, various mass analyzers can be used, e.g., magnetic sector/magnetic deflection instruments in single or triple quadrupole mode (MS/MS), Fourier transform and time-of-flight (TOF) configurations as is known in the art of mass spectrometry. For the desorption ionization process, numerous matrix/laser combinations can be used. Ion-trap and reflectron configurations can also be employed. In one embodiment of the present invention, MALDI-TOF is employed to analyze the biological samples.
Transport Subsystem Optionally, the clinical assay system includes a transport system 25. The transport system can be capable of (i) transporting containers, e.g., containing biological samples, from a source (e.g., a separate site in which biological samples are obtained from a patient) to the clinical assay system; (ii) transporting containers between at least two modules within the clinical assay system; and/or (iii) transporting containers away from the clinical assay system to a predefined destination after completion of the assay. The transport system is capable of communicating with the central controller so the central controller can direct the transport system and/or receive information as to the location of sample within the clinical assay system. The transport system can comprise one or more robotic arms or tracks, or a combination of robotic arms and tracks.
Detection System Optionally, the clinical assay system includes a detection system 5 for detecting the presence of a biological sample and monitoring the progress of the sample through the system. The detection system is capable of receiving information from and transmitting information to the central controller. The detection system can include a network of sensors, e.g., barcode readers, reed switches, weight systems (where the detector detects the presence of a sample by its weight); or optical interrupters, or combinations thereof, arranged throughout the clinical assay system, each of which are capable of transmitting information, directly or indirectly, to the central controller.
Software The clinical assay system includes novel software for adapting one or more modules to be used in the system. For example, the central controller includes a novel software program to provide an interface between itself and an outside system or database (e.g., Meditech). In addition to causing the central controller to receive data from an outside source, the software causes the central controller to send information (e.g., automatically) about the clinical assays (e.g., the results and/or billing information) to at least one outside system (e.g., a computer not associated with the clinical assay system) or at least one outside database (e.g., a Meditech database). This configuration allows the clinical assay system to directly report results and billing information to at least one healthcare provider, at least one third party payor (e.g., an insurance company), or to both. Optionally, the software can be written such that the central controller performs a final check of assay results before sending to the outside system or database, halting transmission of the data and/or alerting a technician of potential problems with the results. For example, where two samples from the same patient are submitted for duplicate analyses by the clinical assay system, the interface program can include a checking scheme to ensure that the results of the duplicate analyses agree with each other. If the duplicates do not agree (e.g., where both a positive and a negative result are reported to the central controller by the clinical assay system), the interface program can halt transmission of the results so that the mass spectroscopy data can be reanalyzed or to allow the assays to be performed again. The central controller also includes a software program for linking at least one other module of the system to the central controller ("linking software"). The module(s) also include linking software allowing the module(s) to communicate with the central controller. For example, the linking software can allow the central controller to control the module (e.g., to instruct the module as to when and whether to execute a function), and to provide to the module(s) information about the biological sample (e.g., the tests to be performed on the sample). The linking software also allows the central controller to receive information from the module(s), e.g., assay results, information about the location of the sample, and the like. Also included within the clinical assay system is plate editor software 7. The plate editor software can be loaded on the central controller and/or on a separate computer, e.g., a second computer system. The plate editor software can receive information from an outside system or database, such as patient information, tests to be performed, billing information, etc., and create a file that maps on a hypothetical 384-well plate where each assay for each sample will be located, and links this location to all data and information associated with each assay (one sample can have several assays, e.g., 1, 2, 3, or 4 assays). In this way, the plate editor software "maps out," in advance of processing a batch of samples through the clinical assay system, an arrangement of assays on a 384-well plate. This file can be used by other modules in the system, e.g., the sample PCR preparation system and the mass spectrometry system, to track the samples and their associated assay results as they move through the system. Also included is a relational database 9, e.g., Oracle software. Like the plate editor software, the relational database can be loaded on the central controller and/or a separate controller, e.g., a second computer system. The relational database stores information from the plate editor and from an outside database or system (e.g., Meditech), and can be accessed by the outside system or database. The sample transfer system 10 can include software causing it to receive at least one biological sample (e.g., a batch of samples), to obtain information about each sample (e.g., from a bar code associated with the sample), and to place an aliquot of the sample into a multiwell plate while keeping track of the location of the aliquot within the multiwell (e.g., a 96 well) plate. The software can instruct the sample transfer system to compile the information (e.g., identity of the sample and the location of the sample in the multiwell plate) into a file, which can then be transmitted to the central controller and/or other modules, e.g., the PCR preparation system. An example of software that can be used, for example, with sample transfer system 10 is attached hereto as Appendix 1 and is described in detail below.
OutFileGenerator. exe Laboratory software, e.g., Gemini™ (Tecan) software, allows users to control robotic and liquid handling functions and to write specific application scripts based on the user's needs. OutFileGenerator.exe is part of the Gemini program that performs specimen transfer from original bar-coded tubes into a 96-well destination plate, prior to extraction. First, all racks, test tubes, and destination plates are scanned by the barcode seamier. The positions of all racks, tubes, and destination plates, are loaded to the file C:\Program Files\Gemini\Output\" created by Gemini the function. OutFileGenerator.exe creates another file, called "outputdestlD.csv" (destID=barcode of the destination plate), by rewriting the original "Output" file such that it contains the following information in a consistent order: DNA ID, DestWelllD (well number in the destination plate), Dest ID (ID of destination plate (as determined by the barcode of the plate), SourceWell ID (position of the tube in the rack), and Source ID (barcode of the rack). Because samples are often transferred from one plate to another during the extraction process, both plates can be assigned the same barcode number. Alternatively, a script similar to "output file generator" can be used to rename the file and destination plate ID after extraction is complete. The PCR preparation system can include software causing it to obtain information (e.g., sample identification and assays to be performed on each sample) about each sample from the sample transfer system and the plate editor, and causing it to add specific PCR materials (e.g., specific primers, nucleotides, etc.) to each sample. In this way, the PCR preparation system is instructed as to which test(s) is to be performed on a given sample, and the PCR preparation system adds the materials appropriate for performing that test(s). In particular and as discussed above, the software can cause the PCR preparation system to (a) dispense appropriate assay mixes; and (b) to add samples to the appropriate assay mix. Examples of programs instructing functions (a) and (b) are attached hereto as Appendix 2 and 3, respectively, and are described in further detail below.
(a) Assay Transfer, gem Assay Transfer.gem is an exemplary Gemini program (Appendix 2) for dispensing an aliquot 3 μl, e.g., of assay mixes to PCR plates, e.g., 384-well plates, (i.e., performing function (a) as discussed above). It uses a file called "input file," which is exported from Plate Editor MassARRAY (Sequenom). This file contains all information about the PCR plate, e.g., the location on a plate a particular assay will be run and into which a particular DNA sample should be placed, as well as the barcode of the plate. The following fields are exported from the Plate Editor and are contained in "input file": Plate ID - PCR plate barcode number; Group ID - name of the MassARRAY file; Assay ID - name of the assay; Sample ID - specimen's barcode; and Well Position - position in the plate. Hence, each position in the plate(s) is described by the fields described above, i.e., plate ID, Assay ID, and Sample ID. This file is used in both Assay Transfer.gem and DNA Transfer.gem, which is described in further detail below. hi this Gemini program are imbedded three executable scripts written in Visual Basic (NB): PCRMix Transfer.exe, Move File Assays.exe, and MoveFileProcessed.exe. Generally, in this program, Module 1 changes the name of a letter/number well (e.g., Al, A2) description, into a well number for a 96 well plate; Module 2 performs the same function as Module 1, but for a 384 well plate; Module 3 includes comments for module 4 execution; and Module 4 generates a worklist for making the transfer of assay mixes into a 384 well plate. Specifically, the events as dictated by the program are as follows: 1) the barcode of the PCR plate is read by barcode reader (Gemini script); 2) the major part of the program is run by PCRMix Transfer.exe, NB script: a) the input file is opened and the column "Well Position" containing alphanumeric characters is divided into two columns: one contains alpha- characters and the second contains numerical characters; b) the file is sorted by column containing numerical characters, meaning that assay mixes will be dispensed later by columns. Hence, all 8 tips will be used at the same time in most cases, speeding up the process of dispensing PCR mixes; c) module 2 PCR Mix takes a combination letter/number well description and converts it to a well number for a plate (e.g., Al=l); d) the Gemini program loads "worklist," and Module 3 contains directions to read the .ini file which describes the location and names of: Input File= C:Gemini\Data\Assays\Input File; Worklist file =C:\Gemini\Data\Assays\assays.gwl; Source Type= Trough 1 column; Dest Plate=384 well Marsh; Nolume= 3 (volume of assay mix dispensed); and WashWorklist; and e) module 4: (1) opens the sorted Input file and parses it to determine the well into which a particular PCR mix goes into; (2) gives information about where to find the PCR Mix - the ID of the PCR Mix (assay) is written in Gemini file by naming the Trough with the PCR Mix ID; (3) directs when, where and how washes are performed. Each wash is carried out as follows: (i) aspiration, of 290 - 400 μl of bleach; (ii) tips are immersed in the bleach for 10 seconds; (iii) bleach is dispensed into wash station; followed by (iv) three washes with water, for example: 10 ml, 5 ml, 5 ml each. Bleach washes of the tips are performed if the Mix ID is different. A full wash (both bleach and water) is always performed at the end of worklist. 3) the data from the run is exported into an output file by the "Export Data" command in the Gemini program; 4) the worklist is copied and saved under a barcode.txt file name (i.e., barcode of 384- well PCR plate) by Move File Assays.exe. Hence, the worklist file is emptied and ready for the next run; and 5) the above file is moved from the original directory into an Output Processed Directory by MoveFileProcessed.exe script. In short, the following commands are contained in the Gemini program: number of plates to be run (in Gemini); reading of barcodes (instructions in Gemini); Execute: C:\programFiles\PCRMixTransfer\PCRMix Transfer.exe; Load Worklist; C;Gemini\Data\Assays\assays.gwl; Execute loaded worklist; Export Data; Execute: C:\Pro gramFiles\ Project\Move File Assays.exe; and Execute:
C:\ProgramFiles\MoveFileProcessed\ MoveFileProcessed.exe. (b) DNA Transfer.gem The DNA Transfer.gem program (Appendix 3) is an exemplary Gemini program for obtaining an aliquot, e.g., 2 μl, of DNA aspirated from DNA plate, e.g., a 96-well plate, and dispensing it to PCR plate, e.g., a 384 well plate, which contains a particular PCR mix. There are four executable scripts written in NB in this program: DNATransfer.exe; MoveFile.exe; FinalOutputConverter.exe; and CompareFiles.exe. Generally, the program uses two files. The first, "friputFile," is exported from the Plate Editor of MassARRAY software saved in csv format (which is the same file used in AssayTranfer.gem for dispensing the PCR mixes). This file dictates where the DNA will be dispensed in the PCR plate (e.g., 384-well plate) by giving for each specimen ID an exact destination, i.e., a specific plate and well. The second, "Output'barcode#.csv," (made on Freedom™ (Tecan) by OutFileGenerator.exe) specifies the location of DNA samples in a particular 96-well DNA plate. Based on these two files, a worklist is prepared, which dictates where the DNA samples are dispensed to the PCR plate (destination plate). In short, the following commands are contained in this Gemini program: How many DNA plates will be run (in Gemini)?; How many PCR plates will be run (in Gemini)?; Reading the plates barcodes (instructions in Gemini); Execute: C:\programFiles\DNATransfer\DNATransfer.exe; Loading worklist C:\Gemini\Data\DNAtransfer\DNA list gwl; Execute loaded worklist; Export Data; Execute:
C:\programFiles\MoveExistFiles\MoveFile.exe; Execute: C:\programFiles\FinalOutputConverter\ FinalOutputConverter.exe; and Execute: C:\programFiles\CompareFiles\CompareFiles.exe The details of the program are provided below. 1) At the start of the program, there are instructions written in Gemini which ask: how many DNA plates will be run? How many PCR plates will be run? Instructions for reading the barcodes of each DNA plate and PCR plate are provided. 2) The major part of the DNA Transfer.gem is run by DNA Transfer.exe inNB script: Module 1: instructs that the 'input file' is opened and the column "Well Position" containing alphanumeric characters is divided into two columns: one contain alpha- characters and second containing numerical characters; the file is sorted by column containing numerical characters first and then by column with alpha-characters. Module 2: instructs conversion of combination letter/number well descriptions to a well number for a 384 well plate, (for example Al=l). Module 3: contains instructions to read the .ini file which describes the location and names of : DataFile-=Input File; Worklist;Source Type = 96 well plate Sarstedt; Destination Plate=384 well Marsh; and Nolume=2 (volume of dispensed DΝA). Module 4: (a) contains a loop that takes each DΝA ID from the 'inputfile'and goes through all files in the Output directory (containing Output'barcode#.csv" files) looking for the match of the ID to determine which well of the source plate from which a sample should be taken; and (b) creates a workfile containing all information needed for each DΝA transfer, such as DΝA ID, source well number, source plate type, source plate ID (that is a barcode of the 96-well DΝA plate), volume to transfer, destination plate type, destination plate ID (barcode of 384-well PCR plate), destination well and tip number to be used; (c) CreatesTextFile("C:\Gemini\Logfiles\DΝAIdLog.txt"); (d) instructs when, where and how the washes are performed. Each wash is carried out as follows: (i) aspiration of 290 - 400 μl of bleach; (ii) tips are immersed in the bleach for 10 seconds; (iii) bleach is dispensed into wash station; followed by (iv) three washes with water, for example: 10 ml, 5 ml, 5 ml each. Bleach washes of the tips are performed if the Mix ID is different. A full wash (both bleach and water) is always performed at the end of worklist; and e) instructs termination of the run if it cannot file DNA in the outputbarcode file .csv plate, giving the message: "DNA Ids missing! See DNAIdLog, fix files, and rerun"; (f) when all DNAs are found, the worklist is made and the files Output'barcode#.csv are moved from :\Gemini\Output directory to C:\Gemini\OutputProcessed. 3) Worklist is loaded to Gemini and executed by Gemini command. 4) Worklist is copied and saved under 'outbarcode.txt' file name (barcode of 384-well PCR plate) by MoveFile.exe. Hence, the worklist file is emptied (cleaned out) and ready for the next run. 5) FinalOutputConverter.exe module 1 converts the original output file and puts it in a readable format containing: "DNA ID," "Destination Well ID," "Destination plate ID," "Source Well ID," and "Source Plate Id." Module 2 converts well number from integer (1) back to alphanumeric well number (Al). Module 3 scans the directory and looks for files and converts them by adding the date to the files. 6) In addition to checking DNA IDs between two files: 'InputFile' and 'BarcodeOutput file(s)' before the transfer starts (DNATransfer.exe module 4) CompareFiles.exe compares the "InputFile" with LogFile for correctness in transfer from source 96-well ρlate(s) to destination 384-well plate(s). It gives an error message if DNA is found to be missing. The primer extenstion preparation system can include similar software, i.e., software that causes it to receive information about each sample and the assays to be performed, so that the primer extension preparation system adds the specific primer extension reaction materials (e.g., specific detection extension primers, termination mixes, etc.) appropriate for performing that test(s) on the sample.
Implementation The methods and systems described herein can use a communications network to transmit information from the system (e.g., from the central controller) to healthcare providers and/or insurance companies. These communications networks can use either wired or wireless interfaces. For example, a communications network can be the internet, or a wire or optical cable. The new methods can be carried out using various means of data storage. For example, the information or data relating to each sample can be stored on a computer-readable medium or in a computer memory. The information can be transferred physically on diskettes or electronically, e.g., on a dedicated intranet, or on the Internet. The data can be encrypted using standard encryption software from such companies as RSA Security (Bedford, MA) and
Baltimore®. The data can be stored in various formats, e.g., spreadsheets or databases. The invention can be implemented in hardware or software, or a combination of both. The invention can be implemented in computer programs using standard programming techniques following the method steps and figures disclosed herein. The programs (or scripts) should be designed to execute on the various modules or in the central controller. The output information is transmitted to one or more output devices such as a printer, or a CRT or other monitor, or a web page on a computer monitor with access to a website. Each program used in the new methods can be implemented in a procedural or object oriented programming language to communicate with a computer system. However, the programs can be implemented in assembly or machine language, if desired. In any case, the language can be a compiled or interpreted language. Each computer program can be stored on a storage medium or device (e.g., ROM or magnetic diskette) readable by a general or special purpose programmable computer, for configuring and operating the central controller when the storage media or device is read by the controller (or a given module) to perform the steps or procedures described herein. The system can also be considered to be implemented as a computer-readable medium, configured or encoded with a computer program, where the storage medium so configured causes a computer to operate in a specific and predefined manner to perform the functions described herein. Although any communications network can be used, the Internet provides a useful choice to transmit data, i this method, files of data are transmitted from the system to a user in encrypted form, with each party privy to the decryption technique necessary to process the particular data, ending with the completely processed data being sent to the health care provider over the Internet in a similarly encrypted manner, hi this method, the entire process can be performed in minutes once the biological sample has been obtained and processed.
Electronic Data Storage and Processing The data is typically provided in digital form that can be transmitted and read electronically, e.g., via the Internet, on diskette, or any other mode of electronic or non-electronic communication. 1 As used herein, "sequence information" refers to any nucleotide and/or amino acid sequence information, including but not limited to full-length nucleotide and/or amino acid sequences, partial nucleotide and/or amino acid sequences, or mutated sequences. Moreover, information "related to" the sequence information includes detection of the presence or absence of a sequence (e.g., detection of a mutation or deletion), determination of the concentration of a sequence in the sample, and the like. These sequences can be read by electronic apparatus and can be stored on any suitable medium for storing, holding, or containing data or information that can be read and accessed by an electronic apparatus. Such media can include, but are not limited to: magnetic storage media, such as floppy discs, hard disc storage medium, and magnetic tape; optical storage media such as compact disc; electronic storage media such as RAM, ROM, EPROM, EEPROM and the like; general hard disks and hybrids of these categories such as magnetic/optical storage media. The medium is adapted or configured for having recorded thereon sequence information. As used herein, the term "electronic apparatus" is intended to include any suitable computing or processing apparatus or other device configured or adapted for storing data or information. Examples of electronic apparatus suitable for use with the present invention include stand-alone computing apparatus; communications networks, including local area networks (LAN), wide area networks (WAN), Internet, Intranet, and Extranet; and local and distributed processing systems. As used herein, "stored" refers to a process for encoding information on the electronic apparatus readable medium. Those skilled in the art can readily adopt any of the presently known methods for recording infoimation on known media to generate manufactures comprising the sequence information. A variety of software programs and formats can be used to store the sequence information on the electronic apparatus readable medium. Any number of data processor structuring formats (e.g., text file or database) can be employed to obtain or create a medium having recorded thereon the sequence information. By providing sequence information in computer-readable form, one can routinely access the sequence information for a variety of purposes. For example, one skilled in the art can use the sequence information in readable form to compare a specific sequence with the sequence information stored within a database. Search means are used to identify fragments or regions of the sequences that match a particular sequence. The present invention therefore provides a medium for holding instructions for performing a method for determining whether an individual has a specific disease or disorder or a pre-disposition for a specific disease or disorder based on genetic information.
Methods of Using the Clinical Assay System The new methods make use of the new clinical assay systems described herein. One method 26 of using an exemplary configuration of the clinical assay system is described below and illustrated in FIG. 2. Biological samples to be processed (e.g., blood samples) typically arrive at the clinical assay system in multiple containers such as test tubes. Information about the samples (e.g., patient identification, tests to be performed, expected turn-around time) can accompany the sample and/or can be encoded within a barcode associated with the sample. Referring to FIG. 2, the information is first entered into the central controller (step 28) and/or the plate editor, e.g., using a keyboard or bar code scanner, and optionally coordinated (e.g., matched) with information about the sample received by the central controller from an outside system or database (step 30) (e.g., via a Meditech interface). Information obtained by the central controller can be transmitted to one or more modules of the clinical assay system immediately and/or at appropriate intervals during operation of the system. The biological samples are deposited in holders in the sample transfer system. Aliquots of the biological samples are removed from the biological sample containers and deposited into multiwell plates by the sample transfer system (step 32). The sample transfer system can include a subsystem, e.g., a barcode scanner and appropriate software, capable of tracking where each aliquot of a biological sample is deposited within the multiwell plate. The information generated via the subsystem can be transmitted to the subsequent modules in the system and/or to the central controller. The plate containing the aliquots is then transferred to the nucleic acid extraction system for DNA or total nucleic acids extraction (step 34). Following execution of the extraction process, the aliquots are transferred by the nucleic acid extraction system to a different multiwell plate. The plate containing extracted nucleic acid samples is then transferred to the nucleic acid measurement system wherein the concentration of extracted nucleic acids in each aliquot is measured (step 36). The nucleic acid measurement system can include a subsystem, e.g., appropriate software, for assigning the data generated during the measurement process to each individual aliquot and transmitting this data to the central controller. The plate is then transferred to the PCR preparation system. The PCR preparation system performs at least related two steps: (1) dispensing appropriate assay mixes, which include all components required for carrying out PCR reactions (e.g., buffers, dNTPs, primers, and polymerase enzyme(s)) (step 37); and (2) dispensing nucleic acid samples, e.g., control and patient DNA samples (step 38). The PCR preparation system can also include a subsystem, e.g., appropriate software, which allows the PCR preparation system to receive from the central controller information specifying which assay(s) is to be performed on a given aliquot, to locate the aliquot on the plate, and to dispense appropriate primers and nucleic acid samples based on those specifications into the aliquot. The plate is then transferred to the theromcycling system for amplification of the target nucleic acid sequence (step 40) . The PCR reactions can be performed using any appropriate thermocycling protocol, e.g., a protocol as described in the Examples section of the present application. Following execution of the PCR reaction, the plate is transferred from the thermocycling system to the primer extension preparation system. The primer extension preparation system adds a dephosphorylating enzyme, e.g., Shrimp Alkaline Phosphatase (SAP), to each aliquot to dephosphorylate unincorporated dNTPs leftover from the PCR reaction (step 41). The plate is then optionally incubated. An extension mix, which includes the extension primer, appropriate enzymes, and a mixture of dNTPs and ddNTPs, is added to each aliquot by the primer extension preparation system (step 42). The primer extension preparation system can also include a subsystem, e.g., appropriate software, which allows the primer extension preparation system to receive from the plate editor information specifying which assay(s) is to be performed on a given aliquot, to locate the aliquot on the plate, and to dispense into each aliquot appropriate extension primers and mixtures of dNTPs and ddNTPs based to those specifications. The plates are then transferred back to the thermocycling system, or to a second thermocycling system (e.g., a second thermocycling system contained within the primer extension preparation system), to allow the primer extension reaction to occur (step 44). After the primer extension reaction is complete, the plates are optionally transferred back to the primer extension preparation system, where resin is added by the system to the plates to remove salts, which could potentially interfere with MALDI-TOF analysis. The plates are then transferred to the mass spectrometry preparation system. The system transfers a sample (e.g., nanoliter volume samples) of each aliquot on the plate to a chip (e.g., a silicon chip) for MALDI-TOF analysis (step 46). Chips containing the samples are transferred from the the mass spectrometry preparation system to the mass spectrometry system. The mass spectrometry system analyzes the samples using MALDI-TOF mass spectrometry (step 48). Specifically, the mass spectrometry system analyzes extended detection extension primers on the basis of molecular weight. Software associated with the mass spectrometry system receives the raw mass spectrometry data, performs digital signal processing (e.g., de-noise, baseline determination, and data compression), analyzes the data, and calls the geneotype according to the resulting data (e.g., mass data). The software associated with the mass spectrometry system optionally receives information from the central controller and matches the data with information about the sample (e.g., patient identification and the assay performed). The data is exported from the mass spectrometry system to the relational database and/or central controller (step 49). The finalized data, e.g., patient name, assays performed, and genotype, are exported from the relational database and/or the central controller to an outside system or database (e.g., a Meditech database) (step 50), e.g., via an interface program, e.g., automatically. The outside system or database is accessible by healthcare providers and/or third party payors. Optionally, the information exported from the central controller to the outside system or database can include billing information, e.g., billing codes for the test or tests performed, allowing direct billing of a third party payor for services rendered. Optionally, the central controller can be programmed to include with the test results diagnosis information. Such information can be used to facilitate, or give a definitive, diagnosis. For example, with regard to infectious diseases, the diagnostic information can include an indication that a patient has been infected with a particular pathogen, the severity of the infection, the genotype of the organism (e.g., to facilitate the tailoring of a treatment, e.g., to treat a drug resistant organism with a drag to which it is sensitive), and a recommended regimen of treatment. As another example, with respect to genetic mutations that predispose an individual to genetic disease, the information can indicate whether the patient is hetero- or homozygous for the mutation, the likelihood that the patient will develop a disease or condition because of the mutation, and recommend a course of action such as a regimen of treatment or prevention. Such information can be associated with the patient data as necessary and exported from the central controller to the outside database or system. Clinical Assays In addition to the new system, the present invention provides novel diagnostic assays. The assays employ novel primer sequences and mass spectrometry (e.g., MALDI) to detect the presence of target nucleic acid sequences and/or sequence variations (e.g., insertions, mutations and/or polymorphisms) in biological samples. The assays can be categorized into two groups: genetic tests (e.g., to detect mutations) and infectious disease/pathogen testing (e.g., to detect the presence and/or amount of foreign, e.g., viral and/or bacterial, nucleic acids, and/or to genotype the pathogen). A general description of the assays is provided below, and several exemplary assays are described in the Examples.
Design of Primers and Specific Considerations hi one embodiment, the novel genetic assays of the present invention require primers for PCR amplification of a target sequence and detection extension primers for carrying out primer extension reactions. A target sequence can be, e.g., a sequence that is part of a gene, or a mutation (e.g., insertions, deletions, transitions, or transversions), which is known, or suspected, to be associated with (e.g., cause, increase, or decrease the risk of) a genetic disease or disorder. A target sequence can also be a sequence that is part of a pathogen's (e.g., a virus, bacterium, or fungus) genome, which optionally is known or suspected to include variations (e.g., insertions, deletions, transitions, transversions, etc.) conferring special characteristics, e.g., possession of virulence factors and/or drug resistance, and/or which serve to differentiate among strains of the organism. Generally, to generate amplification primers, a 100 bp stretch of nucleotides is first selected from either or both sides of a target sequence. A set of primers is then created manually and/or by using commercially available primer-generating software. An example of such a program is the Sequenom® Spectro Designer™ program. This results in a first generation of amplification primers and appropriate detection extension primers. The first generation of extension and/or amplification primers is analyzed using a second program, such as OLIGO® Primer Analysis Software (Macintosh, Molecular Biology Insights, Inc.), which evaluates each primer with regard to melting temperature of the primer (Tm), potential hairpins in each primer (judged by free energy (ΔG), number of nucleotides in the loop, and Tm of the hairpin), and potential for primer dimerization. This analysis results in a second generation of primers. The second generation of amplification and/or extension primers is then compared to other known sequences, e.g., using a BLAST program (see, e.g., the National Institutes of Health's National Center for Biotechnology Information (NCBI) website on the World Wide Web at address ncbi.nlm.nih.gov). Primers that match with a sequence other than the target sequence are disregarded. Primers that match with only the target sequence are considered a third generation of amplification primers and are retained for further analysis. All possible combinations of the third generation of amplification primers and the detection extension primers are run through the diagnostic genetic assay with positive and negative controls to identify sets of primers that are accurate in 100% of genotype calls. Amplification primers so identified are considered a fourth generation of amplification primers, and are suitable for use in the assays of the present invention. The procedures discussed above can be modified for designing primers for a target gene when a homologous pseudogene(s) is known to be present, e.g., the glucocerebrosidase (GC) gene, which is involved in Gaucher Disease. Many commercially available software packages are not able to design specific primers when a homologous sequence to the target gene is present in the genome. Many design primers that amplify short stretches of DNA sequence (60 bp to 150 bp) because PCR is more efficient when short fragments of DNA are amplified. Where pseudogenes are present, however, the amplified fragments of DNA often must be as large as 1000 bp or more. In such cases, at least one of the amplification primer sequences directed against the functional gene must not be present in the pseudogene sequence. For example, based on a comparison of the target gene and pseudogene sequences, a primer can be designed, manually or using software, e.g., software other than SpectroDESIGNER™, that will prime the target gene, but not the pseudogene (homologous) sequence. The extension primer can then be designed using software, e.g., SpectroDESIGNER™. Each amplification and extend primer can then be analyzed using a program like BLAST for specificity (i.e. absence of repetitive or homologous sequences) of the sequence. At least one of the amplification primers should be specific. In certain embodiments of the invention, duplicative confirming assays are used. In such cases, an assay is designed around a target using both the sense and antisense strand sequences, designing both forward and reverse detection extension primers. The results from both assays can be compared. Duplicative confirming assays can be beneficial, for example, if the region surrounding the target includes polymorphisms that prevent the PCR amplification and/or extension primers from working, which would cause erroneous results. They can also reduce the occurrence of mistaken calls, e.g., the calling of a heterozygote as a homozygote in an instance when one primer on one allele does not work because of a polymorphic sequence. Generally, when designing these types of confirming assays, two sets of amplification primers are prepared, each extend primer having its own pair of amplification primers. The second pair of amplification primers are designed either manually or using a program, e.g., a program other than SpectroDESIGNER™. In certain other embodiments, primers for targets can be designed using more than one type of software, e.g., using SpectroDESIGNER with the input of another sequence aligning software, for additional security when manipulating sequences. For example, in one assay design protocol, the sequence having the deletion/insertion is duplicated. One of the sequences is used to design a forward extension primer, while the other sequence is used to design a reverse extension primer. SpectroDESIGNER™ is used to design extension primers in the forward or reverse direction. To force SpectroDESIGNER™ to design extend primers in the forward or reverse direction, the letter "N" can be introduced into the sequence at a position 3' to the deletion/insertion site when designing the forward extend primer, or 5' to the deletion/insertion site when designing a reverse extension primer. The targets for SpectroDESIGNER™ when designing primers for a deletion/insertion site is the first base in the deletion or insertion and the first base after the deletion or insertion. Often, these two nucleotide targets differ for the forward and reverse extension primers. The sequence following the target nucleotides for a forward extend primer can omit the first nucleotide after the deletion/insertion; and, similarly for the reverse extend primer, the nucleotide prior to the deletion/insertion can be omitted. For the purpose of designing the assay with a forward extension primer, in certain instances the sequence following a target should be the sequence that actually follows the deletion/insertion site in genomic DNA. In other cases, the target should be followed by the deleted/inserted sequence. Similar considerations are applicable to designing reverse primers. The choices of how to design the primers in view of these considerations can be dictated to SpectroDESIGNER™ by a second type of software, e.g., software other than SpectroDESIGNER™. The validity of the extension primer designed by SpectroDESIGNER™ is checked by aligning the extended primer sequences (Extl and Ex2) with the template sequence, with and without the insertion/deletion in order to check the validity of assay design.
Novel Primers A number of novel primers were isolated for use in the assays of the present invention. Accordingly, the present invention includes the following nucleic acid sequences, in which the MTHFR primers are used to detect mutations in the 5,10-Methylenetetrahydrofolate Reductase gene, the Fall primers are used to detect mutations in the Coagulation Factor II (FII) gene, the
FaN primers are used to detect mutations in the Coagulation Factor N (FaN) gene, and the HFE and FM primers are used to detect mutations in the HFE gene. All others are used to detect the presence and amount of cytomegalo virus (CMN) in a biological sample. MTHFR-F1 5 '-ACGTTGGATGATGCCTTCACAAAGCGGAAG -3 ' (SEQ ID NO: 1) MTHFR-R2 5 '-ACGTTGGATGCTTGAAGGAGAAGGTGTCTG -3 ' (SEQ ID NO:2) MTHFR-E3 5 '-TGCGTGATGATGAAATCG-3 ' (SEQ ID NO:3) MTHFR-F17 5'-ACGTTGGATGAGTGATGCCCATGTCGGTG -3' (SEQ ID NO:4) MTHFR-R18 5 '-ACGTTGGATGCTGACCTGAAGCACTTGAAG -3 ' (SEQ ID NO:5) MTHFR-E6 5 '-GGAGAAGGTGTCTGCGGGAG-3 ' (SEQ ID NO:6) MTHFR-F4 5 '-ACGTTGGATGTCTACCTGAAGAGCAAGTCC -3 ' (SEQ ID NO:7) MTHFR-R5 5'-ACGTTGGATGTCTCCCGAGAGGTAAAGAAC -3 '(SEQ ID NO:8) MTHFR-E11 5 '-AACAAAGACTTCAAAGACACTT-3 ' (SEQ ID NO:9) MTHFR-F7 5'-ACGTTGGATGACTACTACCTCTTCTACCTG -3' (SEQ ID NO:10) MTHFR-R8 5'- ACGTTGGATGCTCCAGCATCACTCACTTTG -3' (SEQ ID NO:l 1) MTHFR-E14 5'- GAGGAGCTGACCAGTGAAG -3' (SEQ ID NO:12) FaII-F18 5'-ACGTTGGATGACTCATATTCTGGGCTCCTG -3' (SEQ ID NO:13) FaII-R19 5'-ACGTTGGATGAGAGAGCTGCCCATGAATAG -3' (SEQ ID NO:14) Faϋ-Elό 5'- CACTGGGAGCATTGAGGCT-3' (SEQ ID NO:15) Fall-FlO 5'- ACGTTGGATGTGGAACCAATCCCGTGAAAG -3' (SEQ ID NO:16) Fall-Rl 1 5'- ACGTTGGATGAGAGAGCTGCCCATGAATAG -3' (SEQ ID NO:17) FaII-E15 5'-CAATAAAAGTGACTCTCAGC-3' (SEQ ID NO:18) FaV-F16 : 5' -ACGTTGGATGAAGACCATACTACAGTGACG- 3' (SEQ ID NO: 19) FaN-R17: 5' -ACGTTGGATGCATTATTTAGCCAGGAGACC- 3' (SEQ ID ΝO:20) FaV-El 0: 5 '- GACAAAATACCTGTATTCCT -3 ' (SEQ ID NO:21) FaV-F18 : 5' -ACGTTGGATGCTCTGGGCTAATAGGACTAC- 3' (SEQ ID NO:22) FaV-R19: 5' -ACGTTGGATGCTGAAAGGTTACTTCAAGGAC - 3' (SEQ ID NO:23) FaV-E9: 5 '-GCAGATCCCTGGACAGGC- 3 ' (SEQ ED NO:24)
460 FI 5'-ACGTTGGATGGTCGTGTATGCCACTTTGAC- 3' (SEQ ID NO:25) 460 R2 5'-ACGTTGGATGTGAGGCTGTAATCGCACAGC- 3' (SEQ ID NO:26) 460 E3 5'-CCACTTTGACATTACACCC- 3' (SEQ ID NO:27) 520 F8 5'-ACGTTGGATGTCTTTCAGGAGACGGGTACG- 3' (SEQ ID NO:28) 520 R9 5'-ACGTTGGATGAGATGAGCAGCTTCTGCAGC- 3' (SEQ ID NO:29)
520 E10: 5'-TCTGCGCGAATGTTACCA- 3' (SEQ ID NO:30) 591 F12 5'-ACGTTGGATGAGGCGTTGCTCTTTAAGCAC- 3' (SEQ ID NO:31) 591 R13 5'-ACGTTGGATGAGTGCGTGAGCTTACCGTTC- 3' (SEQ ID NO:32) 591 E14 5'-TTAAGCACGCCGGCGCGG- 3' (SEQ ID NO:33) 607 F28 5 ' -ACGTTGGATGTCATTTGCGCCGCCAGAATG- 3 ' (SEQ ID NO:34)
607 R29 5'-ACGTTGGATGTTGCTCTTTAAGCACGCCGG- 3' (SEQ ID NO:35) 607 E30 5'-GCCGCCAGAATGAGCAGA- 3' (SEQ ID NO:36) CV-F31 5'-ACGTTGGATGGAGACGACGTGGACGGCAC- 3' (SEQ ID NO:37) CV-R32 5'-ACGTTGGATGCGTGCTTGGACACGCGACTT- 3' (SEQ ID NO:38) CV33 E 5'-CTCCTTGTCCGAAGCCGC- 3' (SEQ ID NO:39)
HFE-F1 5'-ACGTTGGATGATGACCAGCTGTTCGTGTTC-3'(SEQ ID NO:40) HFE-R2 5'-ACGTTGGATGTCTACTGGAAACCCATGGAG-3'(SEQ ID NO:41) FM3-E 5* CTCCACACGGCGACTCTCAT-3'(SEQ ID NO:42) HFE-F7 5'-ACGTTGGATGTTCATGGGTGCCTCAGAGC-3'(SEQ ID NO:43) HFE-R8 5'-ACGTTGGATGCCACATCTGGCTTGAAATTC-3'(SEQ ID NO:44)
HFE-E3 5' CAGCTGTTCGTGTTCTATGAT 3' (SEQ ID NO:45) HFE-F4 5'-ACGTTGGATGTGGATAACCTTGGCTGTACC-3'(SEQ ID NO:46) HFE-R5 5'-ACGTTGGATGTATCACNATGAGGGGCTGATC-3'(SEQ ID ΝO:47) FM6-E 5' GCCTGGGTGCTCCACCTGG 3'(SEQ ID NO:48) HFE-F9 5'-ACGTTGGATGTAATGGGGATGGGACCTACC-3'(SEQ ID NO:49)
HFE-R10 5'-ACGTTGGATGTGCTCTCATCAGTCACATACC-3'(SEQ ID NO:50) HFE-E6 5' GGGAAGAGCAGAGATATACGT 3'(SEQ ID NO:51) HFE-F1 5'-ACGTTGGATGATGACCAGCTGTTCGTGTTC-3'(SEQ ID NO:52) HFE-R2 5'-ACGTTGGATGTCTACTGGAAACCCATGGAG-3'(SEQ ID NO:53) HFE S65CJB1 5' GGGCTCCACACGGCGAC 3* (SEQ ID NO:54) HFE-F7 5 '-ACGTTGGATGTTCATGGGTGCCTCAGAGC-3 '(SEQ ID NO:55) HFE-R8 5'-ACGTTGGATGCCACATCTGGCTTGAAATTC-3'(SEQ ID NO:56) HFE S65C_E5 5' TTCGTGTTCTATGATCATGAG 3' (SEQ ID NO:57) CMV560-S : 5' -ACGTTGGATGCGCTTCTACCACGAATGCTC-3' (SEQ ID NO:58) CMV560-L: 5' -ACGTTGGATGATAAATACAGCCCGTCGCTC-3' (SEQ ID NO:59) CMV560-E 5 '- CTTTCTGACGTATTCGTGCAGCAT-3 ' (SEQ ID NO:60) Additional primers are set forth in FIG. 15A-15GG, which includes a listing of the target gene, amplification primers and extension primers for that target, and the analytes.
Assays In general, an assay of the present invention can be performed as follows. A biological sample is obtained. As used herein, a "biological sample" is material obtained from any living source (e.g. human, animal, plant, bacteria, fungi, protist, virus) that can be solid material (e.g. tissue, cell pellets, biopsies, fecal matter, nucleic acid samples) and/or fluids (e.g., urine, blood, saliva, sputum, amniotic fluid, mouth wash). If necessary (i.e., when the starting material is an intact biological sample and not previously-extracted nucleic acids), nucleic acids are extracted from the biological sample. Extractions can be performed using any art-known method, the choice of which will depend, e.g., on the biological sample from which the nucleic acids are to be isolated. For example, freeze-thaw and alkaline lysis procedures can be useful for obtaining nucleic acid molecules from solid materials; heat and alkaline lysis procedures can be useful for obtaining nucleic acid molecules from urine; and proteinase K extraction can be used to obtain nucleic acid from blood (see, e.g., Rolff, A et al. PCR: Clinical Diagnostics and Research, Springer (1994)). There are numerous kits available for extracting nucleic acids from samples, e.g., the MagneSil® ONE, the Fixed Yield Blood Genomic System (Promega), and kits manufactured by Qiagen. The target gene is then amplified via polymerase chain reaction (PCR) using fourth generation primers designed as described herein. Procedures for performing PCR are well known in the art, and are described in, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989. Where the nucleic acids to be analyzed are RNA (e.g., viral RNA), the assays of the present invention can be adapted to include reverse transcriptase PCR (RT-PCR) reactions, if necessary. hi certain embodiments of the invention, an oligo base extension method is then used to detect mutations in, or the presence of, a target nucleic acid. The method is based on the extension of a detection primer (i.e., a detection extension primer designed as described above) that anneals adjacent to a variable nucleotide position on the amplified target DNA, using a DNA polymerase, a mixture of dNTPs (e.g., 3 dNTPs), and the missing dideoxy nucleotides (e.g., one missing dideoxy nucleotide). Any art known primer extension method can be utilized. The sample is then analyzed using mass spectrometry. Any mass spectrometer format can be used to analyze the samples, e.g., matrix assisted laser desorption ionization (MALDI), electrospray (ES), ion cyclotron resonance (ICR) and Fourier Transfonn. Various mass analyzers can be used, e.g., magnetic sector/magnetic deflection instruments in single or triple quadrupole mode (MS/MS), Fourier transform, and time-of-flight (TOF) configurations as is known in the art of mass spectrometry. In an embodiment of the present invention, samples are analyzed using MALDI-TOF mass spectrometry. The molecular weight of extended primers is determined by mass spectrometry, and a change in the molecular weight of the extended primer, as compared to a control, indicates the presence of the target sequence and/or whether a mutation (e.g., insertion or deletion), is present in the target sequence. The results are analyzed using methods described in the Examples section below, and an analysis report is generated. hi other embodiments of the present invention, the assay described above is modified to include, e.g., homogenous MassCLEAVAGE™ (l MC) reactions (Sequenom GmbH, Hamburg, Germany). During PCR amplification of the target region, a T7 promoter for in vitro transcritpion is introduced to the 5' end of one strand of the amplicon. One PCR is performed with a T7 promotor in the forward primer to mediate transcription of the forward DNA strand, and a second PCR is performed with the T7 promotor incoφorated in the reverse primer to mediate transcription of the reverse DNA strand. Following the PCR reaction, SAP is added to each reaction to degrade any unincorporated nucleotides from the PCR reactions. For in vitro transcription production, each PCR reaction is split into two transcription reactions and performed. Next, base-specific cleavage using RNase A is conducted, yielding fragmented RNA molecules. The final steps in the hMC reaction are sample conditioning and MALDI-TOF MS followed by spectra pattern analysis. The hMC reaction is a high throughput tool for sequence variation identification by comparative sequence analysis. The principle behind it is to generate signal patterns that are specific to a reference sequence in which changes, when compared to a sample sequence, can be tracked as a sequence variation in the form of SNPs or insertion deletions .
Uses of Assays and the Clinical Assay System The assays described above can be used to diagnose genetic diseases (or a patient's or subjects increased risk therefore), to identify foreign sequences (e.g., viral sequences) incorporated into a target gene, and for infectious disease/pathogen testing. The term "subject" as used herein, refers to an animal, or a human, and includes, but is not limited to, mammals, e.g., primates, pigs, rodents such as mice and rats, rabbits, guinea pigs, hamsters, cows, horses, cats, dogs, sheep, and goats. Agricultural analyses, e.g., analysis of biological samples from plants can also be made with the new systems and methods. For example, the assays can be adapted to diagnose any of the more than 3000 genetic diseases or disorders currently known (e.g. hemophilias, Gaucher's disease, thalassemias, Duchemie Muscular Dystrophy (DMD), Huntington's Disease (HD), Alzheimer's Disease and Cystic Fibrosis (CF)). and lysosomal and metabolic diseases. The assays can also be used to diagnose chromosomal abnormalities such as Trisomy 21 (Down's syndrome), Trisomy 13 (Platau Syndrome), Trisomy 18 (Edward's Syndrome), Monosomy X (Turner's Syndrome) and other sex chromosome aneuploidies such as Khenfelter's Syndrome (XXY), which result in birth defects, and to determine whether an individual has a genetic mutation(s) that predispose the individual to any of a number of disorders such as diabetes, arteriosclerosis, obesity, various autoimmune diseases, stroke, and cancer (e.g. colorectal, breast, ovarian, lung); chromosomal abnormality (either prenatally or postnatally); or a predisposition to a disease or condition (e.g. obesity, atherosclerosis, cancer, venous thromboembohsm (NTE), neural tube defects (ΝTD), and the like) and lysosomal and metabolic diseases. The assays can also be used in the detection of "DNA fingerprints," e.g., polymorphisms, such as "microsatelhte sequences," which are useful for determining identity or heredity (e.g. paternity or maternity). Further, the assays can be used to detect or quantify in a biological sample nucleic acid sequences that are specific to infectious organisms. Such assays are useful for diagnosing or monitoring infection. Examples of disease-causing viruses that infect humans and animals and that may be detected by the disclosed processes include: Retroviridae (e.g., human immunodeficiency virases, such as HTV-1 (also referred to as HTLV-III, LAV or HTLV- III/LAV, see Ratner, L. et al, Nature, 313: 227-284 (1985); and Wain Hobson, S. et al., Cell, 40: 9-17 (1985)); HIV-2 (see Guyader et al., Nature, 328: 662-669 (1987); European Patent
Publication No. 0 269 520; Chakraborti et al., Nature 328: 543-547 (1987); and European Patent Application No. 0 655 501); and other isolates, such as HIN-LP (International Publication No. WO 94/00562 entitled "A Novel Human Immunodeficiency Virus"; Picornaviridae (e.g., polio virases, hepatitis A virus, (Gust, I. D., et al., Intervirology, Vol. 20, pp. 1-7 (1983); entero viruses, human coxsackie virases, rhinovirases, echo virases); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis virases, rubella virases); Flaviridae (e.g., dengue virases, encephalitis virases, yellow fever virases); Coronaviridae (e.g., coronavirases); Rhabdoviridae (e.g., vesicular stomatitis virases, rabies virases); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumps virus, measles viras, respiratory syncytial viras); Orthomyxoviridae (e.g., influenza viruses); Bungaviridae (e.g.,
Hantaan virases, bunga virases, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviurses and rotavirases); Birnaviridae; Hepadnaviridae (Hepatitis B viras); Parvoviridae (parvovirases); Papovaviridae (papilloma virases, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex viras (HSV) 1 and 2, varicella zoster viras, cytomegaloviras (CMV), herpes virases); Poxviridae (variola virases, vaccinia virases, pox virases); and Iridoviridae (e.g., African swine fever viras); and unclassified virases (e.g., the etiological agents of Spongiform encephalopathies, the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), the agents of non- A, non-B hepatitis (class l=internally transmitted; class 2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related viruses, and astrovirases), and Epstein-Barr viras (EBV) . Examples of infectious bacteria include: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria memngitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, and Actinomyces israelli. Examples of infectious fungi include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans. Other infectious organisms (i.e., protists) include: Plasmodium falciparum and Toxoplasma gondii . FIG. 15A-15GG describes a number of specific genetic targets that can be assayed according to the invention, as well as exemplary primers that can be used in those assays. For example, exemplary primers are provided for the following genetic targets: 5,10- Methylenetetrahydrofolate Reductase (MTFR); Coagulation Factor II; Coagulation Factor V; hemochromatosis (HFE); and a glucocerebrosidase (GC). fibroblast growth factor receptor 3; aspartoacylase; Glucocerebrosidase; Coagulation Factor VII; Fanconi Anemia, Complementation Group C (FANCC); inhibitor of kappa light polypeptide gene enhancer in b cells, kinase complex-associated protein; acid sphingomyelinase; hexosaminidase; angiotensin i-converting enzyme; adenylate cyclase 9; apolipoprotein A-l; apolipoprotein E; endothelial leukocyte adhesion molecule 1; fc fragment of IGG, low affinity Ila, receptor; fibrinogen beta chain; coagulation factor II, factor XIII; guanine nucleotide-binding protein beta-3; integrin, alpha-2, glycoprotein Ia/Iia; glycoprotein lb, platelet, alpha polypeptide; intercellular adhesion molecule 1; glycoprotein Ia/IIa (a2), integrin, alpha-2; platelet glycoprotein lib, integrin, alpha- 2b; glycoprotein Ilb/IIIa, integrin, beta-3;3-hydroxy-3-methylglutaryl-coa reductase; lymphocyte adhesion molecule 1 ; methylene tetrahydrofolate reductase; plasminogen activator inhibitor 1 ; platelet alpha-granule membrane protein; transforming growth factor-beta receptor, type III; thrombomodulin; tumor necrosis factor; vascular cell adhesion molecule; coagulation factor II receptor; glycoprotein NI, platelet; purinergic receptor P2Y,g protein-coupled, 1; purinergic receptor P2Y, G protein-coupled, 12; prostaglandin-endoperoxide synthase 1; prostaglandin- endoperoxide synthase 2; thromboxane A2 receptor, platelet; and thrombospondm I. The figure lists the disorder associated with the mutation, the gene information (e.g., gene number, symbol, and name), the target mutation, the termination mix that can be used in and assay, the amplification primers, the extension primers, the analytes, and the extended primers (Ext 1, 2, and 3, i.e., the extension primer as it would appear after extension). The invention will be further described in the following examples, which do not limit the scope of the invention defined by the claims.
EXAMPLES
Example. 1: Screen for 5,10-Methylenetetrahvdrofolate Reductase (MTHFR) mutations
Introduction In one exemplary assay, a biological sample (e.g., a blood sample) is tested for the presence or absence of mutations in the MTHFR gene. MTHFR catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a cosubstrate for homocysteine remethylation to methionine. MTHFR plays a key role in folate metabolism by channeling one- carbon units between nucleotide synthesis and methylation reactions. Severe enzyme deficiency leads to hyperhomocysteinemia and homocystinuria, with altered folate distribution and a phenotype that is characterized by damage to the nervous and vascular systems. Two common mutations that can occur in MTHFR include MTHFR C677T (or Ala222Nal) and MTHFR A1298C (or Glu429Ala). Assays to detect these mutations are described below. The C677T mutation is common in the general population, with a variable frequency depending on the subpopulation studied. In Caucasians of European descent, the frequency of homozygotes for this mutation ranges from approximately 5% (in Dutch and Finnish populations) to 12-15% (in French Canadian and other European populations). African Americans have a low frequency of 1.4% The A1298C mutation is also common in the general population with an allele frequency estimated at 0.33. Individuals homozygous for the C677T mutation have significantly elevated plasma homocysteine levels. It has been suggested that the 677T variant of the MTHFR gene is a genetic risk factor for preeclampsia. From studies of the C677T mutation in cardiovascular patients and controls, investigators have concluded that homozygosity for this frequent mutation in the MTHFR gene is associated with a 3 -fold increase in risk for premature cardiovascular disease. The association was stronger in homozygotes than in heterozygotes. Therefore, the C677T polymorphism may be a risk factor for coronary artery disease. Currently, at least 22 other mutations in MTHFR gene are known and assays similar to those described herein can be designed to detect those mutations as well.
Gene Information Gene Locus: lp36.3. Gene Symbol: MTHFR. Gene Product: 5,10-METHYLENETETRAHYDROFOLATE REDUCTASE. Mutations: MTHFR C677T, Ala222Val, FR A1298C, Glu429Ala. Gene OMIM number: 607093 mRNA NCBI Ace Nos.: XM_030156 5,10- methylenetetrahydrofolate reductase mRNA; AJ237672 Homo sapiens mRNA for 5,10-methylenetetrahydrofolate reductase mRNA; NM_005957 Homo sapiens 5,10-methylenetetrahydrofolate reductase (NADPH) (MTHFR) mRNA; U09806 Synthetic construct methylenetetrahydrofolate reductase (MTHFR) mRNA, complete cds. (Goyette, 1994 Frosst 1995) Genomic Ace No.: GA_x5L2HTUlNlE CELERA DataBase
Clinical Significance The test can be used to screen for the MTHFR gene mutation before surgery, which may identify patients at an increased risk of graft thrombosis. The MTHFR mutation assay is also useful for patients with early-onset arteriosclerotic vascular disease or thrombosis, particularly those with hyperhomocysteinemia or significant family histories. The clinical scenario should be considered carefully, since additional genetic and non-genetic factors are important in the development of cardiovascular disease. MTHFR mutation analysis is also useful for patients with variable or ambiguous homocysteine levels, since plasma levels are dependent on nutritional status or sample handling before testing. MTHFR mutational analysis can also be offered for patients with a neural tube defect (NTD). The MTHFR mutation assay is also useful in the elderly and in patients with idiopathic venous thromboembohsm (NTE) disease and arterial disease.
MTHFR-C677T E3 Assay This section describes the amplification and detection extension primers for the MTHFR- C677T E3 Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Table 1, below. Wild type target: AAAGCTGCGTGATGATGAAATCGGCTCCCGCAGACACCTTCTCCTTCA
(SEQ ID NO.: 804) Mutated target: AAAGCTGCGTGATGATGAAATCGACTCCCGCAGACACCTTCTCCTTCA (SEQ ID NO.:805) Extension primer ► MTHFR-E3
Amplification primers*:
MTHFR-F1 5'-acgttggatgATGCCTTCACAAAGCGGAAG -3' (SEQ ID NO:l) ' MTHFR-R2 5 '-acgttggatgCTTGAAGGAGAAGGTGTCTG -3 ' (SEQ ID NO:2) Resulting Amplicon length: 89 bp * amplification primers have the 10-mer tag specific for the homogeneous MassEXTEND™ assay (hME) method: acgttggatg.
Detection Extension Primer: MTHFR-E3 5'-TGCGTGATGATGAAATCG-3' (SEQ ID NO:3)
Teπnination mix: ddA/ddC/ddT
Table 1. Sequence, length and mass of extension primer, extended primer (G and A) and pause product for MTHFR-C677T
Figure imgf000040_0001
Figure imgf000041_0001
(SEQ ID NOS.:806, 807, and 808)
MTHFR C677T E6 Assay This section describes the amplification and detection extension primers for the MTHFR C677T E6 Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Table 2, below.
Wild type target: AAAGCTGCGTGATGATGAAATCGGCTCCCGCAGACACCTTCTCCTTCA (SEQ ID NO:809) Mutated target: AAAGCTGCGTGATGATGAAATCGACTCCCGCAGACACCTTCTCCTTCA (SEQ ID NO.:810) Extension primer -^ MTHFR-E6
Amplification primers* MTHFR-F17 5 '-acgttggatgAGTGATGCCCATGTCGGTG -3 ' (SEQ ID NO:4) MTHFR-R18 5'-acgttggatgCTGACCTGAAGCACTTGAAG -3' (SEQ ID NO:5) Amplicon length: 122 bp * amplification primers have the 10-mer tag specific for the hME method: acgttggatg.
Detection Extension Primer: MTHFR-E6 5 '-GGAGAAGGTGTCTGCGGGAG-3 ' (SEQ ID NO:6)
Termination mix: ddA/ddC/ddG
Table 2. Sequence, length and mass of extension primer, extended primer (G and A) and pause product for MTHFR-C677T
Figure imgf000041_0002
[SEQ ID NOS:811, 812, and 813) MTHFR-A1298C Assay This section describes the amplification and detection extension primers for the MTHFR- A1298C assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Table 3, below. Wild type target: GGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTTGTTCTTT (SEQ ID NO:814) Mutated target: GGGAGGAGCTGACCAGTGAAGCAAGTGTCTTTGAAGTCTTTGTTCTTT (SEQ ID NO: 815) Extension primer -4 MTHFR-E11 (reverse sequence)
Amplification primers*
MTHFR-F4 5 '-acgttggatgTCTACCTGAAGAGCAAGTCC -3 ' (SEQ ID NO:7) MTHFR-R5 5'-acgttggatgTCTCCCGAGAGGTAAAGAAC -3 '(SEQ ID NO:8) Amplicon length: 109 bp
* amplification primers have the 10-mer tag specific for the hME method:acgttggatg (SEQ ID No.816)
Detection Extension Primer: MTHFR-E11 5'-AACAAAGACTTCAAAGACACTT-3' (SEQ ID NO:9)
Termination mix: ddA/ddC/ddT
Table 3. Sequence, length and mass of extension primer, extended primers and pause product for MTHFR- A1298C El l:
Figure imgf000042_0001
(SEQ ID NOS: 817, 818, and 819) MTHFR A1298C E14 Assay This section describes the amplification and detection extension primers for the MTHFR A1298C E14 Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Table 4, below.
Wild type target: GGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTTGTTCTTT (SEQ ID NO:820) Mutated target: GGGAGGAGCTGACCAGTGAAGAACGTGTCTTTGAAGTCTTTGTTCTTT (SEQ ID: NO: 821) Extension primer ^ MTHFR-E14
Amplification primers"
MTHFR-F7 5 '-acgttggatgACTACTACCTCTTCTACCTG -3 ' (SEQ ID NO: 10) MTHFR-R8 5 '- acgttggatgCTCCAGCATCACTCACTTTG -3 ' (SEQ ID NO: 11) Amplicon length: 159 bp * amplification primers have the 10-mer tag specific for the hME method:acgttggatg.
Detection Extension Primer MTHFR-E14 5'- GAGGAGCTGACCAGTGAAG -3' (SEQ ID NO:12)
Tennination mix: ddC/ddG/ddT
Table 4. Sequence, length and mass of extension primer, extended primers and pause product for MTHFR- A1298C E14
Figure imgf000043_0001
(SEQ ID NOS:822, 823, and 824)
Testing Procedure This section generally describes procedures useful in the MTHFR assays. Specimens: Whole blood samples were collected in the same manner routinely used for any laboratory test. Exemplary test results, with specific numbers of samples, are provided below in Tables 12, 13, 14, and 15. SPECIMEN STORAGE AND STABILITY 1. After arrival, blood was extracted on the same or next day. Specimen was not allowed to remain at +15°C to +30°C longer than 8 hours. If assays were not completed within 8 hours, specimen was stored at +2°C to +8°C. 2. Tubes of blood should were kept closed at all times in a vertical, stopper-up position. 3. Blood specimen were not frozen. SAMPLE VOLUME The minimum volume was 1.0 mL of sample.
CRITERIA FOR UNACCEPTABLE SPECIMENS • Unlabeled specimens. τ*r Insufficient quantity. -A- Clotted specimen.
SPECIMEN HANDLING Blood samples were received with the lab barcode identification numbers. Sample identification is ensured throught out the process by the tracking system on Freedom, BioRobot MDx, Genesis, and MassARRAY systems.
PROCEDURES INVOLVED INASSAYS: Nucleic acids extraction, nucleic acid concentration measurement, Uniplex and Multiplex PCR Procedure on Genesis™ in conjuction with Freedom™ and MassARRAY™ software, Homogeneous MassEXTEND™ Reaction using the MassARRAY™ System.
QUALITY CONTROL PCR primers were analyzed ensure specificity for the prothrombin gene in the BLAST search and that the PCR product did not show allelic dropout. Validation of each assay was accomplished. Four types of control material were analyzed with each PCR plate: (A) blank control (water), (B) DNA negative control (wild type), (C) heterozygous positive controls and (D) positive homozygous mutant, i each run at least two samples of each control were used if available. More frequent use of controls or the use of additional controls was left to the discretion of the user based on work load and work flow. Tables 5 and 6, below, provide a list of control DNAs used in the presently described assays.
Table 5: Controls used in MTHFR- C677T assay
39354 T MTHFR homozygous
GM881 T MTHFR homozygous
GM1278 C MTHFR negative- wild
NA1464 C MTHFR negative- wild
GM779 C MTHFR negative- wild
NA1465 C MTHFR negative- wild
GM972 CT MTHFR heterozygo
NA0375 CT MTHFR heterozygo
NA1359 CT MTHFR heterozygo
NA1464 CT MTHFR heterozygo
NA1470 CT MTHFR heterozygo
NA1600 CT MTHFR heterozygo
NA1602 CT MTHFR heterozygo
Table 6: Controls used in MTHFR-A1298C assay GM7798 C MTHFRA1298C homozygous mutant GM8810 A MTHFRA1298C negative- wild type NA16028 A MTHFRA1298C negative- wild type GM12783 AC MTHFRA1298C heterozygous NA14641 AC MTHFRA1298C heterozygous NA16000 AC MTHFRA1298C heterozygous
PCR PROCEDURE The master PCR mix was made, bianually or as necessary, in 11.954 ml total volume and aliquoted into 47 Sarstedt tubes, 250 μl each. The composition of the PCR master mix is provided in Table 7, below. Table 7. Composition of master PCR mix
Figure imgf000046_0001
The 5 μM primer mix was made by diluting 10 times 50 μM stock primers. The volumes used to malce 2000 μl of 5 μM primer mix is shown in Table 8, below. The primer mix was aliquoted to 10 Sarstedt tubes, 200 μl each.
Table 8. Composition of 5 μM Primer Mix
Figure imgf000046_0002
The composition of the PCR reaction is shown in Table 9. To calculate the volumes per ran, the volumes per reaction of PCR mix, Primer Mix, and HotStarTaq™ need to be multiplied by number of reactions and then by 1.5. Table 9 shows an example of the calculations per 384 reactions. Increasing the final volume by 50% is to account for pipetting losses and 'dead' volume when using the robotics.
Table 9. Composition of single PCR reaction and PCR reaction for 384-well plate
Figure imgf000046_0003
Figure imgf000047_0001
3 μl of PCR mix were dispensed into each well of the 384-well plate. The protocol "PCR Procedure" (MD008) was utilized. 2 μl of DNA (2.5 ng/μl) were added to each well. The standard PCR program on the PCR machine was ran:
95° C 15 minutes 95° C 20 seconds 56° C 30 seconds 1 4455 ccyycclles 72° C 1 minute 72° C 3 minutes 4° C forever (hold)
DEPHOSPHORYLATION PROCEDURE
SAP (Shrimp Alkaline Phosphatase) was diluted according to Table 10, multiplying the volumes by the number of the samples and then by 1.5. Table 10. Composition of SAP mix
Figure imgf000047_0002
2μl of the diluted Shrimp Alkaline Phosphatase were dispensed to each well (Refer to MassARRAY procedure MD 009). The SAP PCR program was ran on the PCR machine: 37 ° C 20 minutes 85 ° C 5 minutes, 4 ° C forever (hold)
HOMOGENEOUS MASSEXTEND (hME) REACTION PROCEDURE: The hME cocktail was prepared according to Table 11. Multiply one reaction volume by the number of samples and then by 1.38.
Table 11. Components of hME cocktail
Figure imgf000048_0001
* Volumes are for a 384- well microplate and include a 38 % overage to account for possible pipetting loss and dead volume in the 96-well microtiter plate used on the Multimek. & ThermoSequenase is stored at (-20)° C until it is added to the reaction cocktail.
2 μl of the hME cocktail mix were dispensed to the appropriate wells containing 7 μl dephosphorylated PCR product. Refer to MassARRAY procedure MD008. The Extension Reaction program was ran on the PCR machine: 94° C 2 minutes 94 ° C 5 seconds ] 52 ° C 5 seconds I" 45 cycles 72 ° C 5 seconds J 4 ° C forever (hold) SPECTROCLEAN RESIN CLEAN UP PROCEDURE Using the SpectroClean plate, transfer resin into the 96-well Marsh plate. Run the hME cation Cleanup method on the Multimeck. Refer for details to MassARRAY protocol MD008. RESULTS ANALYSIS The Genotyper® Analyzer software reads the spectrum generated for each sample by the mass spectrometer, and uses a 3-parameter model to calculate the significance of each putative genotype: 1. Conservative: The most conservative set makes no error in reading the data.
2. Aggressive: The most aggressive set makes the most errors (still less than 1 percent).
3. Moderate: The moderate set is a compromise between the two extremes. The interpretation of the results is as follows: If the results of two assays for the same mutation are called (i.e., interpreted) identically by conservative or moderate calls or conservative and aggressive calls, the result is acceptable. If the assays are called identically by moderate and aggressive calls, the test needs to be looked at by the director or the designee. If the assays are called only by aggressive calls, the test needs to be repeated. If there is a call on one but not the other assay, the "non call" assay needs to be repeated. The non-calls can be further categorized into the following groups: (a) Low Probability: Implies that the spectrum in question contains peaks that fail any criteria of significance even for the aggressive parameter set; (b) Conflict: hnplies that there is more that one read or spectrum corresponding to one sample, and these reads give rise to different and conflicting genotypes; (c) Bad spectrum: The spectrum for the sample doesn't exist above noise level; and (d) Bad Assay: results of analyst or operator input errors in defining the assays. The most common errors are mass values of analytes or contaminants that are out of range of the spectrum, or contaminants and analytes having the same mass; and (e) user call: The analyst or operator select a genotype in the table and performs a manual call. In the presently described examples, each sample will have at least two different assays that together will confirm, e.g., the presence of a mutation. However, in many instances, accurate results can be obtained using one assay per sample and, therefore, performing two different assays is optional. FIG. 3 is a mass spectrum of a heterozygous "TC" allele (heterozygous positive) generated using a screen for a C677T mutation in the 5,10-Methylenetetrahydrofolate Reductase (MTFR) gene. Exemplary test results are provided in Tables 12, 13, 14, and 15, below. Table 12: MTHFR C677T E3
Figure imgf000050_0002
Figure imgf000050_0001
Figure imgf000050_0003
Table 14: MTHFR A1298C Ell
Figure imgf000050_0004
Table 15: MTHFR A1298C E14
Figure imgf000050_0005
The results of the assays were 100% in agreement with results from Associated Regional and University Pathologists (ARUP). In both (E3 and E6) MTHFR-C677T assays, negative controls (homozygous wild type) GM12783, GM7798, NA14641 (Coriell) were homozygous CC, positive heterozygous controls NA13591, NA14646, NA14702, and NA16000 (Coriell) were TC, and positive homozygous control NA8810 (Coriell) was TT. In both MTHFR-A1298C assays, negative control (homozygous wild type) GM7798 (Coriell) was homozygous CC, positive heterozygous controls NA14641 and NA16000 (Coriell) were both AC, and positive homozygous control NA16028 (Coriell) was AA. As indicated in Tables 12, 13, 14, and 15, above, the majority of geneotype calls (i.e., the genotype called by the software for each sample) for each assay were conservative calls, indicating a high level accuracy. Example 2: Screen for Coagulation Factor II (FII) G20210A Mutations Mutation G20210A in the prothrombin gene is associated with hypeφrothrombinemia and increased risk of venous thromboembohsm (VTE). It has been established that the FII G20210A mutation increases the risk of VTE 2-5 fold. The 20210A prothrombin allele also represents an inherited risk factor for acute coronary syndrome among patients who have limited extent of coronary disease at angiography or who lack major metabolic and acquired risk factors. Mutation G20210A involves the last nucleotide of the transcribed prothrombin RNA. The mechanism by which prothrombin levels are altered is unknown. One explanation is that increased adenylation and increased mRNA stability are involved. In southern Europe, the prevalence of the G20210A mutation is 3.0 percent (CI95 2.3 to
3.7%), nearly twice as high as the prevalence in northern Europe 1.7% (CI95 1.3 to 2.2%), the highest of 7.8% reported in a Greek-Cypriot population. In the United States, the overall prevalence estimates are between 1% and 2%, although this is highly dependent on race. The mutation is fairly uncommon in African Americans (~0.2%), and is also rarely seen in Asians and Native Americans . At least 28 missense mutations, one insertion, one deletion, and one substitution (in the regulatory region) are known to occur in the prothrombin gene. Accordingly, assays similar to those described herein can be designed to detect those mutations as well.
Gene Information Gene Locus: llpll-ql2 Gene Symbol: F2, PRT Gene Product: COAGULATION FACTOR II, prothrombin Mutations: G20210A Mutation Frequency: The 20210G-A variation in the prothrombin gene is predominant only in the Caucasian population, among whom the prevalence of heterozygous carriers varies between 1% to 8%, and depends on the geographical location and ethnic background. OMIM number: 176930 mRNA NCBI Ace No.: NM_000506 coagulation factor II mRNA; Ml 7262. Human prothrombin mRNA Genomic Ace No.: AF478696 H.coagulation factor II (thrombin) (F2) gene. Clinical Significance Prothrombin (G20210A) testing can be recommended, for example, in the following - cases: when inherited thrombophiha is suspected; when the testing for factor V Leiden muatation is recommended; in patients with a history of recurrent VTE; in patients with a first episode of VTE before the age of 50 years; in patients with a history of an unprovoked VTE at any age; where thrombosis occurs in unusual anatomic sites, such as cerebral, mesenteric, portal, or hepatic veins; where there is a first-degree relative with VTE; in patients with a first VTE related to pregnancy, the pueφerium, or oral contraceptive use; where there is a history of VTE related to pregnancy loss during the second or third trimesters; in young women smokers (age < 50 years) with an MI; in older patients (age > 50 years) with a first provoked VTE event in the absence of a cancer or an iritravascular device; where there is a first VTE related to serum estrogen receptor modifier or tamoifen; in selected cases of women with unexplained severe preeclampsia, placental abruption, or intrauterine growth restriction; in asympthomatic adult family members of probands with known prothrombin G20210 A mutations, especially those with a strong family history of thrombosis at young age; and asymptomatic female family members who are pregnant or are considering oral contraceptives or pregnancy.
ASSAY FaII-E16 This section describes the amplification and detection extension primers for the FaII-E16
Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Table 16, below. Wild type target CCAATAAAAGTGACTCTCAGCGAGCCTCAATGCTCCCA Mutated target CCAATAAAAGTGACTCTCAGCAAGCCTCAATGCTCCCA Extension primer Fall-E 16 -^
Amplification primers*: FaII-F18 5'-ACGTTGGATGACTCATATTCTGGGCTCCTG -3' (SEQ ID NO:13) FaII-R19 5'-ACGTTGGATGAGAGAGCTGCCCATGAATAG -3' (SEQ ID NO.T4)
Detection Extension Primer: FaII-E16 5'- CACTGGGAGCATTGAGGCT-3' (SEQ ID NO:15) Termination mix: ddA/ddC/ddG * amplification primers have the 10-mer tag specific for the hME method:acgttggatg.
Table 16. Sequence, length and mass of extension primer, extended primer (G and A) and pause product)
Figure imgf000053_0001
(SEQ ID NOS: 825 826, and 827)
FaII-E15 ASSAY This section describes the amplification and detection extension primers for the FaII-E15 Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Table 17, below:
Wild type target CCAATAAAAGTGACTCTCAGCGAGCCTCAATGCTCCCA (SEQ ID NO:828) Mutated target CCAATAAAAGTGACTCTCAGCAAGCCTCAATGCTCCCA (SEQ ID NO:829) Extension primer Fall-E 15 "
Amplification Primers*: Fall-FlO 5'- ACGTTGGATGTGGAACCAATCCCGTGAAAG -3' (SEQ ID NO: 16) Fall-Rl 1 5 '- ACGTTGGATGAGAGAGCTGCCCATGAATAG -3 '(SEQ ID NO: 17) Amplicon length: 112 bp * amplification primers have the 10-mer tag specific for the hME method: acgttggatg.
Detection Extension Primer: FaII-E15 5'-CAATAAAAGTGACTCTCAGC-3' (SEQ ID NO: 18) Termination mix: ddA/ddC/ddT Table 17. Sequence, length and mass of extension primer, extended primer (G and A) and pause product)
Figure imgf000054_0002
(SEQ ID NOS:830, 831, and 832) Testing Procedure Blood specimens and quality control procedures were performed according to protocols described in Example 1. Table 18, below, provides a list of controls used in the presently described assay.
Table 18: Controls used in Coagulation Factor II assay
Figure imgf000054_0001
iil
PCR, dephosphorylation, homogenous MASSEXTEND (HME), and spectroclean resin clean up procedures were carried out as described in Example 1, above.
RESULTS ANALYSIS Results were analyzed as described in Example 1, above. FIG. 4 is a mass spectrum of a heterozygous "GA" allele (heterozygous positive) generated using a screen for a G20210A mutation in the Coagulation Factor II (FII) gene. Exemplary test results are provided in Tables 19 and 20, below. Table 19: FaII-E15
Figure imgf000055_0001
Results of this assay were in 100% in agreement with results from ARUP. Negative controls (homozygous wild type) GM7798, GM8810, GM9729, GM14899, NA14646, NA14650 (Coriell Institute) were homozygous GG, and positive heterozygous control NA16028 (Coriell) was AG, and positive homozygous mutant control NA16000 (Coriell Institute) was AA. Due to blood clogging the DNA was not extracted and could not be re-extracted because of the too small volume of blood obtained (< 0.5 ml). Two samples that had no DNA gave no signal. As indicated in Table 19, out of 140 samples tested, the majority of geneotype calls for this assay were conservative calls, indicating a high level of accuracy.
Table 20: FaII-E16
Figure imgf000055_0002
Results of this assay were in 100% in agreement with results from ARUP. Negative controls (homozygous wild type) GM7798, GM8810, GM9729, GM14899, NA14646, NA14650 (Coriell Institute) were homozygous GG, and positive heterozygous control NA1 028 (Coriell) was AG, and positive homozygous mutant control NA16000 (Coriell Institute) was AA. Due to blood clogging the DNA was not extracted and could not be re-extracted because of the too small volume of blood obtained (<0.5 ml). Two samples that had no DNA gave no signal. As indicated in Table 20, out of 140 samples tested, the majority of geneotype calls for this assay were conservative calls, indicating a high level of accuracy.
Example 3: Screen for Coagulation Factor V R506Q mutations The Factor V mutation (Factor V Leiden) is the most common genetic cause of venous thrombosis. It is involved in 20-40% of cases and is present in 3% of the general population. In a population study of 180 individuals from Germany, the heterozygosity rate was 7.8% with a confidence interval 4 to 11%. The mutation causes resistance to activated protein C (APC) and induces a defect in the natural anticoagulation system. The other major genetic causes of venous thrombosis (deficiencies of protein C, protein S and antithrombin HI) together account for only 5-10% of cases. Presence of the factor V mutation increases the risk for venous thrombosis 7-fold in heterozygotes and 80-fold in homozygotes. This risk is increased still further when the factor V mutation is present along with situations such as pregnancy, oral contraceptive use, estrogen therapy, malignancy, diabetes mellitus, immobilization or surgery. Ten percent of heterozygotes and almost all homozygotes experience venous thrombosis in their lifetime. The discovery of the factor V mutation has revolutionized the diagnostic work-up of patients with hypercoagulability, and the ability to detect this mutation in asymptomatic relatives offers the opportunity to prevent venous thrombosis through special management of those at risk.
Gene Information Gene Locus: lq23 Gene Symbol: F5 (FV) Gene Product: Coagulation Factor V Mutations: 1691 G - A; R506Q; Factor V Leiden Mutation Frequency: 2-8% in most populations OMIM number: 227400 mRNA NCBI Ace No.: XM 171908, XM 118651, XM 069970 Genomic Ace No.: NM_000130
Clinical Significance Testing can be recommended, for example, in patients: having venous thrombosis or pulmonary embolism, transient ischemic attacks or premature stroke, peripheral vascular disease, particularly lower extremity occlusive disease, a history of a thrombotic event, family history of thrombosis or known factor V mutation in a relative; prior to major surgery, pregnancy, postpartum, oral contraceptive use or estrogen therapy if there is a personal or family history of thrombosis; or where there has been a previous finding of activated protein C resistance by laboratory analysis. FaV-ElO Assay This section describes the amplification and detection extension primers for the FaV-ElO Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Table 21, below. Wild type target CTTCAAGGACAAAATACCTGTATTCCTCGCCTGTCCAGGGATCTGCT (SEQ ID NO:833) Mutated target CTTCAAGGACAAAATACCTGTATTCCTTGCCTGTCCAGGGATCTGCT (SEQ ID NO:834) Extension primer ^ FaV-ElO
Amplification primers*: FaV-F16 : 5' -acgttggatgAAGACCATACTACAGTGACG- 3' (SEQ ID NO: 19) FaV-R17: 5' -acgttggatgCATTATTTAGCCAGGAGACC- 3' (SEQ ID NO:20)
Extension Primer: FaV-ElO: 5'- GACAAAATACCTGTATTCCT -3' (SEQ ID NO:21) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Amplicon length: 189 bp Termination mix: ddA/ddC/ddG
Table 21. Sequence, length and mass of extension primer, extended primer (C and T) and pause product
Figure imgf000057_0001
(SEQ ID NOS:835, 836, and 837)
FaV-E9 Assay This section describes the amplification and detection extension primers for the FaV-E9 Ass and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Table 22, below.
Wild type target CTTCAAGGACAAAATACCTGTATTCCTCGCCTGTCCAGGGATCTGCT (SEQ ID NO:838) Mutated target CTTCAAGGACAAAATACCTGTATTCCTTGCCTGTCCAGGGATCTGCT (SEQ ID NO:839) Extension primer FaV-E9
Amplification Primers*: FaV-F18 : 5' -acgttggatgCTCTGGGCTAATAGGACTAC- 3' (SEQ ID NO.22) FaV-R19: 5' -acgttggatgCTGAAAGGTTACTTCAAGGAC - 3' (SEQ ID NO:23)
Detection Extension Primers: FaV-E9: 5'-GCAGATCCCTGGACAGGC- 3 ' (SEQ ID NO:24) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Amplicon length: 92 bp Termination mix: ddA ddC/ddT
Table 22. Sequence, length and mass of extension primer, extended primer (C and T) and pause product
Figure imgf000058_0001
(SEQ ID NOS:840, 841, and 842)
Testing Procedure Blood specimens and quality control procedures were performed according to protocols described in Example 1. Table 23, below, provides a list of controls used in the presently described assay.
Table 23: Controls used in Coagulation Factor V assay 11313817 T Factor V R506Q homozygous mutant 3109017 T Factor V R506Q homozygous mutant GM 10701 C Factor V R506Q negative- wild type [GM11053 C Factor V R506Q negative- wild type » GM 12784 C Factor V R506Q negative- wild type GM 14646 C Factor V R506Q negative- wild type NA14646 C Factor V R506Q negative- wild type GM9730 C Factor V R506Q negative- wild type GM8811 C Factor V R506Q negative- wild type GM8914 CT Factor V R506Q heterozygous , GM8915 CT Factor V R506Q heterozygous NA14641 CT Factor V R506Q heterozygous NA14650 CT Factor V R506Q heterozygous
.NA16028 __. C QTA factor V R506Q ^ heterozygous PCR, dephosphorylation, homogenous MASSEXTEND (HME), and spectroclean resin clean up procedures were carried out as described in Example 1, above.
RESULTS ANALYSIS Results were analyzed as descπbed in Example 1, above. FIG. 5 is a mass spectrum of a heterozygous "GA" allele (heterozygous positive) generated using the FaV-ElO screen for a mutation in the Coagulation Factor V gene. FIG. 6 is a mass spectram of a heterozygous "GA" allele (heterozygous positive) generated using the FaV-E9 screen for a mutation in the Coagulation Factor V gene. Exemplary test results are provided m Tables 24 and 25, below.
Table 24: FaV-E9
Figure imgf000059_0001
Due to blood clogging the DNA was not extracted and could not be re-extracted because of the too small volume of blood obtained (< 0.5 ml). As indicated in Tables 24 and 25, above, the majority of geneotype calls for each assay were conservative calls, indicating a high level of accuracy.
Example 4: Cytomegaloviras (CMV) Testing Clinical Significance CMV is an opportunistic infection found throughout all geographic locations and socioeconomic groups, infecting about 50% of the general population of the United States by 40 years of age and 90% of people with HIV. CMV is transmitted from person to person by close personal contact. Infectious CMV may be shed in the bodily fluids of any previously infected person, and thus may be found in urine, saliva, blood, tears, semen, and breast milk. CMV can be sexually transmitted and can also be transmitted via breast milk, transplanted organs, and rarely from blood transfusions. In most healthy people, CMV remains in the body indefinitely without causing any harm. Therefore, CMV infection may not be a serious problem for the vast majority of infected individuals. However, for those with a weakened immune system, including those infected with HIV, or who have undergone bone marrow transplantation or chemotherapy related to cancer, a CMV infection can cause serious and possibly fatal complications. Furthermore, generalized infection and infections of the central nervous system may occur and can be fatal. CMV is also frequently transmitted to a developing child before birth. CMV infection is widespread in developing countries and in areas of lower socioeconomic conditions. For most healthy individuals who acquire CMV after birth, there are few symptoms and no long-term health consequences. Some individuals with symptoms experience a mononucleosis-like syndrome with prolonged fever and a mild hepatitis. Once an individual becomes infected, the virus remains within that individual's body for life, often in a dormant state. Recurrent disease rarely occurs unless the individual's immune system is suppressed, e.g., due to therapeutic drags or disease. Infection with CMN is a major cause of disease and death in immunocompromised patients, including organ transplant recipients, patients undergoing hemodialysis, patients with cancer, patients receiving immunosuppressive drugs, and HIV-infected patients. Pneumonia, retinitis (an infection of the eyes), and gastrointestinal disease are the common manifestations of disease. Because of this risk, exposing immunosuppressed patients to outside sources of CMV should be minimized. Whenever possible, patients without CMV infection should be given organs and/or blood products that are free of the viras. The risk of developing CMV disease in patients is directly related to the presence and quantity of CMV DNA in blood. The ability to measure CMV viral load is a valuable tool in the management of HIV- 1 infected patients. The infection is treatable with drugs. Optimum treatment depends on early and accurate detection.
Overview of Assay A quantitative CMN assay combines competitive PCR with MassEXTEΝD™ procedures and matrix assisted laser desoφtion/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Following isolation of DΝA from plasma, PCR amplification is performed on CMN DΝA mixed with a known amount of internal standard (oligo - synthetic DΝA molecule), which resembles the sequence of the targeted CMN DΝA region in all positions except a single base winch serves as an assay target. MassARRAY Typer Gene Expression Analysis™ software allows calculating the ratio of internal standard and patient CMN on each spot and the viral concentration in the extracted sample, which is further recalculated into viral particles per ml of patient sample. The method can be used for sensitive and accurate detection of viral nucleic acid with abroad dynamic range (e.g., from 100 to 4x10s viral copies/ml). The CMN560 quantitative assay quantifies CMN DΝA extracted from plasma of CMN infected individuals using PCR and mass spectrometry. The test can quantify CMN DΝA over the range of 100-400,000,000 CMN copies/ml. The assay can be used in conjunction with clinical presentation and other laboratory markers of disease status as an aid to management of individuals infected with CMN. CMN quantitative results from the assay can be used to assess prognosis of disease progression and to monitor the efficacy of antiretroviral therapy by measuring changes in CMN levels during the course of therapy. This example generally describes amplification and detection extension primers for detecting the presence and amount of CMN in a biological sample. The sequences of the primers are provided below. The procedures described in Example 1, above, can be modified as necessary for handling and analyzing biological samples containing virases.
460 E3 Assay
Wild type target TGTATGCCACTTTGACATTACACCCATGAACGTGCTCATCGACGTGAACCCG (SEQ ID ΝO:843)
Mutated target TGTATGCCACTTTGACATTACACCCGTGAACGTGCTCATCGACGTGAACCCG (SEQ ID NO: 844)
Amplification Primers*: 460 FI 5'-ACGTTGGATGGTCGTGTATGCCACTTTGAC- 3' (SEQ ID NO:25) 460 R2 5'-ACGTTGGATGTGAGGCTGTAATCGCACAGC- 3' (SEQ ID NO:26)
Detection Extension Primer: 460 E3 5'-CCACTTTGACATTACACCC- 3' (SEQ ID NO:27)
* amplification primers have the 10-mer tag specific for hME method: acgttggatg. Termination mix: ddA/ddC/ddT
The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 26, below.
Table 26. Sequence, length and mass of extension primer
Figure imgf000062_0001
(SEQ ID NOS:845, 846, and 847)
520 E10 Assay Wild type target CTCGCACCGTCTGCGCGAATGTTACCACCCTGCTTTCCGACCCA (SEQ ID NO.: 848) Mutated target CTCGCACCGTCTGCGCGAATGTTACCAGCCTGCTTTCCGACCCA (SEQ ID NO.:849)
Amplification Primers* : 520 F8 5'-ACGTTGGATGTCTTTCAGGAGACGGGTACG- 3' (SEQ ID NO:28) 520 R9 5'-ACGTTGGATGAGATGAGCAGCTTCTGCAGC- 3' (SEQ ID NO:29)
Detection Extension Primer: 520 E10: 5'-TCTGCGCGAATGTTACCA- 3' (SEQ ID NO:30) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Termination mix: ddA/ddC/ddT The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 27, below.
Table 27. Sequence, length and mass of extension primer
Figure imgf000063_0001
(SEQ ID NOS:850, 851, and 852)
591 E14 Assay
Wild type target CGTTGCTCTTTAAGCACGCCGGCGCGGCCTGCCGCGCGTTGGAGAACGGTAA (SEQ ID NO:853)
Mutated target CGTTGCTCTTTAAGCACGCCGGCGCGGTCTGCCGCGCGTTGGAGAACGGTAA (SEQ ID NO:854)
Amplification Primers* : 591 F12 5'-ACGTTGGATGAGGCGTTGCTCTTTAAGCAC- 3' (SEQ ID NO:31) 591 R13 5'-ACGTTGGATGAGTGCGTGAGCTTACCGTTC- 3' (SEQ ID NO:32) Detection Extension Primer: 591 E14 5'-TTAAGCACGCCGGCGCGG- 3' (SEQ ID NO:33) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Termination mix: ddA ddC/ddG The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 28, below.
Table 28. Sequence, length and mass of extension primer
Figure imgf000064_0001
(SEQ ID NOS:855, 856, and 857)
607 E30 Assay
Wild type target AAGCTCACGCACTGCTCCGACGCCTATCTGCTCATTCTGGCGGCGCAAATGA (SEQ ID NO:858)
Mutated target AAGCTCACGCACTGCTCCGACGCCTATTTGCTCATTCTGGCGGCGCAAATGA (SEQ ID NO: 859)
Amplification Primers*: 607 F28 5'-ACGTTGGATGTCATTTGCGCCGCCAGAATG- 3' (SEQ ID NO:34) 607 R29 5'-ACGTTGGATGTTGCTCTTTAAGCACGCCGG- 3' (SEQ ID NO:35)
Detection Extension Primer: 607 E30 5'-GCCGCCAGAATGAGCAGA- 3' (SEQ ID NO:36) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Termination mix: ddA/ddC/ddG The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 29, below.
Table 29. Sequence, length and mass of extension primer
Figure imgf000065_0001
(SEQ ID NOS:860, 861, and 862) CV33-E Assay
Wild type target CGTGATGCGTGACGGAGAAAAAGAGGACGCGGCTTCGGACAAGGAGAACCT (SEQ ID NO:863)
Mutated target CGTGATGCGTGACGGAGAAAAAGAGGATGCGGCTTCGGACAAGGAGAACCT (SEQ ID NO:864)
Amplification Primers*: CV-F31 5'-ACGTTGGATGGAGACGACGTGGACGGCAC- 3' (SEQ ID NO:37) CV-R32 5'-ACGTTGGATGCGTGCTTGGACACGCGACTT- 3' (SEQ ID NO:38)
Detection Extension Primer: CV33 E 5'-CTCCTTGTCCGAAGCCGC- 3' (SEQ ID NO:39) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Termination mix: ddA/ddC/ddT The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 30, below.
Table 30. Sequence, length and mass of extension primer
Figure imgf000065_0002
(SEQ ID NOS:865, 866, and 867)
CMV 560 Assay For quantitative PCR the region chosen is situated in the human CMN UL97 region that codes for a viral serine/threonine protein kinase. A standardized quantitation panel was prepared with CMN strain AD169. The CMN stock of 4xl010 was diluted with human negative plasma (Accrometrix) to concentrations of 40 copies/ml to 4xl08 CMN copies per mililiter. FIG. 13A1-13G3 illustrate typical results of the CMN assay. FIG. 13A1-13A3 are a set of mass spectra in a CMN quantitative assay on samples containing 400 CMV copies/ml compared to internal controls. FIG. 13B1-13B3 are a set of mass spectra in a CMV quantitative assay on samples containing 4000 CMV copies/ml compared to internal controls. FIG. 13C1- 13C3 is a set of mass spectra in a CMV quantitative assay on samples containing 40,000 CMV copies/mlcompared to internal controls. FIG. 13D-13D3 is a set of mass spectra in a CMV quantitative assay on samples containing 400,000 CMV copies/ml compared to internal controls. FIG. 13E1-13E3 are a set of mass spectra in a CMV quantitative assay on samples containing 4,000,000 CMV copies/ml compared to internal controls. FIG. 13F1-13F3 is a set of mass spectra in a CMV quantitative assay on samples containing 40,000,000 CMV copies/ml compared to internal controls. FIG. 13G1-13G3 is a set of mass spectra in a CMN quantitative assay on samples containing 400,000,000 CMN copies/ml compared to internal controls.
Wild type CMV template 5 '-CCACGAATGCTCGCAGACgATGCTGCACGAATACGTCAGAA-3 '
(SEQ ID NO: 868)
Mutated oligo template 5 '-CCACGAATGCTCGCAGAC|ATGCTGCACGAATACGTCAGAA-3 '
(SEQ ID No:869) Extension primer ^ CMV560
Amplification Primers*: CMV560-S : 5' -ACGTTGGATGCGCTTCTACCACGAATGCTC-3'(SEQ. IDN0:58) CMV560-L: 5' -ACGTTGGATGATAAATACAGCCCGTCGCTC-3'(SEQ. ID NO:59)
Detection Extension Primer: CMV560-E 5 '- CTTTCTGACGTATTCGTGCAGCAT-3 ' (SEQ. ID NO:60) * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Amplicon length: 94 bp ( Termination mix: ddA ddC/ddT The sequences of the detection extension primers as they would exist after the extension reaction are provided in Table 31, below. Table 31. Sequence, length and mass of extension primer
Figure imgf000067_0001
(SEQ ID NOS:870, 871, and 872) Testing Procedure
This section generally describes exemplary procedures used in CMV assays.
TYPE OF SPECIMEN Blood was collected observing universal precautions for venipuncture. For plasma samples, blood was collected in sterile tubes containing EDTA (K2) or ACD, and stored at room temperature. Plasma was removed from cells within 4 hours of collection. The samples were separated by centrifugation at 1000 x g for 10 to 15 minutes and standard laboratory procedures were used to remove the plasma. Specimens were not clarified by filtration or further centrifugation.
SPECIMEN STORAGE AND STABILITY Specimens were stored at -60° to -80 °C in sterile, screw-capped tubes. Specimens may also be stored at 2° to 8°C for up to 48 hours or at -20°C in a non-frost free freezer for up to 72 hours prior to freezing at -60° to -80 °C. Repeated freeze/thaw of samples was avoided. Specimens were shipped frozen on dry ice and packaged and labeled in compliance with federal and international regulations covering the transport of clinical samples and etiologicalagents.
SAMPLE VOLUME This assay was perfonned with 500 μl of sample for a single determination. At least 1 ml of plasma was used in the tube.
PROCESSING WHOLE BLOOD Specimens were centrifuged at 1000 x g for 10-15 minutes within 4 hours of blood collection. Plasma was aseptically removed and aliquoted (without disturbing the white cell layer or clot) into sterile unbreakable tubes (duplicate aliquots of at least 1 mL plasma are advised to avoid freeze-thaw of specimen in case of repeat testing). Plasma was immediately frozen at -60°C to -80°C within 30 minutes of separation. Specimens can be stored at -20°C in a non-frost-free freezer for up to 72 hours.
CRITERIA FOR UNACCEPTABLE SPECIMENS Volume of plasma was below 1 ml. Barcode of the tube was missing or not readable. Inappropriate specimens, e.g., blood instead of plasma. Specimen as received was already defrosted.
SPECIMEN HANDLING Blood samples were received with the lab barcode identification numbers. The sample identification was ensured throught out the process by the tracking system on Freedom™, BioRobot MDx™, Genesis™, and MasARRAY™ systems. Specimens were handled as if capable of transmitting infection. Specimen was stored immediately after receipt in the -80C freezer were not processed immediately.
MATERIALS AND EQUIPMENT I. Reagents used for PCR amplification: 10 mM dNTPs (Invitrogen), 10 μM primer mix (forward and reverse) (IDT), internal control - oligo (IDT), PCR kit (Qiagen), sterile water, 10%> bleach. Each kit (Qiagen) contains the following reagents: lOx PCR MgCl2 buffer; 25 mM MgCl2; and HotStar Taq DNA Polymerase. Volumes that were used for the PCR reactions are provided in Table 32, below.
Table 32. Composition of PCR reaction
Figure imgf000068_0001
Figure imgf000069_0001
REAGENT PREPARATION Oligo-standard (internal control or internal standard) stock solutions were made. The oligo-standard comes in dry-form. The 20 μM solution was made using the following equation for calculating the volume of water needed: μl water = nmol of oligo x 1000μl/ 20nmol. The 20μM solution of the oligo-standard oligo-standard was thawed and vortexed before use if frozen. A 1 μM stock of oligo-standard was made by diluting 20 μl of 20 μM oligo-standard solution in 380μl of a 1 ng/μl earner DNA. A series of working solutions was made in 10E-10M to 10E-20M in 10-fold increments by diluting the Oligo Standard (internal control) 1 μM stock solution using the Tecan Gemini program Diluting ohgoslOx.gem on C:\Gemini\Data\CMV. lOx dilutions were made in 1 ng/μl carrier DNA. Master mix was prepared with primers as follows: the lOx PCR Buffer, dNTP mix, 25 mM MgCl2, and stock primers were thawed and vortexed before use. The solutions were mixed completely before use to avoid localized salt concentrations. The PCR mixes w/ primers were made according to Table 32, above, multiplying the reagent volumes by number of samples and factor which depends on number of samples run.
II. Reagents used for MassARRAY™: SpectroCHIP, 384-well microplates for PCR (Marsh #SP0401Sequen); 96-well polypropylene skirted microplates for resin addition (Marsh #AB-0800); 96-well polystyrene v-bottom microplates for use with liquid handler (Sarstedt #82.1583); Adhesive PCR foil seals for freezing plates (Marsh #AB-0626); Adhesive Plate seals for temporary sealing (Marsh #AB-0580); Adhesive PCR seals for use in thermocycling (Marsh #AB-0558 or ABI MicroAmp #4306311); 20ul tips for the liquid handler (VWR #BK717254); tips for manual pipettors; tubes for mixing reagents
III. Other Materials: hME buffer; hME SAP enzyme (Shrimp Alkaline Phosphatase); ACT MassEXTEND™ Mix; ThermoSequenase™ enzyme; SpectroCLEAN™ resin; 3 point calibrant; Autoclaved or sterile water >18.2MegaOhm cm resistivity (store in plastic); Deionized >18.2MegaOhm/cm resistivity water for instrument wash stations; isopropanol for liquid handler cleaning; 50% ethanol for nanodispenser operation (stored in sealed, plastic container); , oligonucleotide primers; Desiccant (silica gel with moisture indicator).
IV. Exemplary Hardware/Software MassARRAY™ Liquid handler (Beckman Multimek) automated 96-channel pipettor with controller PC; MassARRAY™ Nanodispenser (RoboDesign pin tool) micro-aπayer with controller PC; 384-well microplate Thermocycler; MassARRAY™ Genotype Analyzer (Braker Autoflex MALDI-TOF Mass Spectrometer controlled by SpectroACQUIRE software); MassARRAY™ RT Workstation; MassARRAY™ Assay Design Software; MassARRAY™ Oracle Database; Plate centrifuge; universal plate holders; SpectroCLEAN™ resin plate, spoon and scraper; dessiccator for chip storage; single and multi-channel pipettors; plate rotator for mixing resin after a plate has been stored frozen.
REAGENT PREPARATION Appropiate buffer, primers and EXTEND™ mix were defrosted and vortexed to ensure suspension before using, except for enzymes which were mixed by inversion or pipetting. Enzymes were kept in the freezer or cooler at all times. As enzymes are in low viscosity buffer, they were pipetted slowly to make sure correct volume was applied. Autoclaved Type II water was used to make up solutions.
REAGENT VOLUMES FOR SAP AND HME REACTIONS Dephosphorylation Shrimp Alkaline Phosphatase (SAP) was prepared in a tube according to Table 33, multiplying the volumes by the number of the samples and then by 1.5 (volumes were for a 384- well microplate and included a 50% overage to account for possible pipetting loss and dead volume in the 96-well microtiter plate used on the Multimek). Volumes that can be used for the SAP reactions are provided in Table 33, below.
Table 33. Composition of SAP mix
Figure imgf000071_0001
2μl of the diluted SAP was dispensed to each well (see testing procedure).
Homogeneous MassExtend (hME) Reaction hME cocktail was prepared in a tube according to Table 34, below. One reaction volume was multiplied by the number of samples and then by 1.38 (volumes were for a 384- well microplate and included a 38% overage to account for possible pipetting loss and dead volume in the 96-well microtiter plate used on a Multimek). Volumes that can be used for the hME reactions are provided in Table 34, below.
Table 34. Components of hME cocktail
Figure imgf000071_0002
& ThermoSequenase was kept at -20° C until added to the reaction cocktail. 2 μl of the hME cocktail mix was dispensed to the appropriate wells containing 7 μl dephosphorylated PCR product (see Testing Procedure). SPECTROCLEAN RESIN CLEAN UP Using the SpectroCLEAN™ plate, resin was transferred into the 96-well Marsh plate. The SpectroCLEAN™ plate controls the volume of resin added. ACCEPTABLE REAGENT PERFORMANCE The acceptability of a reagent was determined by ensuring that quality control results (negative, high, and low controls) were within acceptance criteria +/-0.51og1()Value when received from the manufacturer (Affimetrix). REAGENT STORAGE AND STABILITY hME buffer, hME Mix (lOxbuffer w/ d/ddNTPs), SAP enzyme and ThermoSequenase™ enzyme, calibrant and oligonucleotide primers were stored at -20° C (tube of calibrant in use was stored at 4° C). SpectroCLEAN™ resin, water and alcohols were stored at room temperature. The resin was stored away from direct sunlight. SpectroCHIPS™ were stored dessicated.
CALIBRATION Calibration of the Multimek and Autoflex was performed as daily maintenance. Calibration of the SpectroPOhNT™ was performed as monthly maintenance. Calibration of the ABI Thermocycler was performed as yearly maintenance. The high, low and negative external standards were run with appropriate internal standards with each ran to ensure that oligo- standards were at appropriate concentrations. The eight internal standards (mutated oligos) were ran with each patient sample (eight wells).
STANDARDS The high, low and negative external standards 0/500/5,000/50,000 copies/ml were made from human CMV purified viras, strain AD 169 from Advanced Biotechnologies Inc., diluted in human CMV negative plasma (Acrometrix). Standards were diluted from the stock 4xl010 c/ml when needed, assayed concurrently with the previous batch before being used for the quantification of patient specimens. Diluted standards were stored in -80°C. Alternatively, CMV DNA 4 member panel: 0/500/5,000/50,000 copies/ml from Acrometrix (catalog number 94-2014) was used. Pre-assigned values for internal standards were: 1pm, lOOfM, lOfM, lfM, lOOaM, lOaM, laM. Standards were assayed with each ran according to the plate 384 well map.
INTERPRETING RESULTS Procedures involved in assays DNA extraction and concentration measurement, Uniplex PCR Procedure on Genesis with internal standard, and Homogeneous MassEXTEND Reaction using the MassARRAY System were performed using standard procedures. QUALITY CONTROL To monitor assay performance, at least three levels of control material were included with every assay. The assay was considered valid if all the following conditions occurred: the values determined for the CMV positive controls were within +/-0.51ogιo specified range and the CMV negative control did not give a positive result. If any of the above conditions are not met: patient results from the affected ran should not be reported, the cause for quality control failure should be determined, and the ran should be repeated if needed. If the assay must be repeated, then do the following: review instructions to ensure that the assay is perfonned according to the procedure; verify that the standards and controls are in the appropriate location specified by the plate map; verify that the materials are not expired; verify that the liquid handling robotics are pipetting correct volumes (should be done before the original run).
CONTROLS All controls were diluted in HIN/HCN/CMN negative human plasma. Pre-assigned > values for controls appeared on the tubes: a) The negative control was non-reactive for CMV; b) the positive controls contained a specific CMV titer determined previously or stated by manufacturer (Acrometrix). All controls were be assayed in every plate ran according to the order on the tray map. The performance of each control are discussed in the Results section.
TESTING PROCEDURES I. CMV DNA Extraction CMV DNA was extracted on MDX, Qiagen according to standard procedures. The external standards (240 μl) were diluted and pipetted to S-block under the biological hood.
II. PCR Procedure The composition of a typical PCR reaction is shown in Table 35, below.
Table 35. Composition of single PCR reaction in 384-well plate
Figure imgf000074_0001
To calculate the volumes per run, the volumes of reagents per reaction in Table 32 were multiplied by the number of reactions and by multiplication factor which depended on the sample number run with each oligo-standard concentration (see Table 36). Increasing the final volume allowed for pipetting losses and 'dead' volume when using robotics. The mix was stored at 4 ° C until use.
Table 36. Multiplication factor in calculations reagent volumes for PCR reaction using Tecan AssayTransfer.gem program (8 wells of the same assay mix)
Figure imgf000074_0002
Figure imgf000075_0001
4 μl of PCR mix were dispensed into each well of the 384-well plate. 16 μl of extracted CMV DNA was added to each well using TEMO (Tecan). The following PCR program was run on the thermocycler: 95° C 15 minutes 95° C 20 seconds 56° C 30 seconds f 65 cycl 72° C 1 minute 72° C 3 minutes 4° C forever (hold)
III. Dephosphorylation Procedure: Before running SAP procedure, 5 μl of the sample were transfeπed from each well of the original 20 μl 384-well plate to a new 384-well plate using Multimek (program: "PCR-5μl to 1 384 plate"). If needed, 3 sister plates can be made this way using program "PCR-5μl to 3 384 plate." SAP was diluted according to Table 36, above, multiplying the volumes by the number of the samples and then by 1.5. The composition of a typical SAP mix is provided in Table 37, below. Table 37. Composition of SAP Mix
Figure imgf000075_0002
2μl of the diluted SAP were dispensed to each well. The SAP PCR program was ran on the thermocycler as follows: 37 ° C 20 minutes 85 ° C 5 minutes, 4 ° C forever (hold) IV. Homogeneous MassExtend (hME) Reaction Procedure: hME cocktail was prepared according to Table 37, above. One reaction volume was multiplied by the number of samples and then by 1.38. The composition of a typical hME preparation are provided in Table 38, below.
Table 38. Components of hME cocktail
Figure imgf000076_0001
* Volumes are for a 384- well microplate and include a 38 % overage to account for possible pipetting loss and dead volume in the 96-well microtiter plate used on the Multimek. & ThermoSequenase™ was kept at -20° C in a portable cooler or freezer at all times.
2 μl of the hME cocktail mix was dispensed to the appropriate wells containing 7 μl dephosphorylated PCR product. The Extension Reaction program was run on the PCR machine as follows: 94° C 2 minutes 94° C 5 seconds 52 ° C 5 seconds r 99 cycl. 72 ° C 5 seconds 4 ° C forever (hold)
V. SpectroCLEAN Resin Clean Up Procedure: Using a SpectroClean plate, resin was transfeπed into the 96-well Marsh plate. The hME cation Cleanup method was run on the Biomek.
VI. Dispensing Extended Product on a Chip Using Nanodispenser Extended product was dispensed on chips according to the manufacturer's instructions.
VII. Reading the Chip on Autoflex. Chips were read according to the manufacturer's instructions. The specific issues in quantitative assays were: (1) Sample Group in Plate Editor contained in SamplelD column: name of the samples
(barcodes) and standards, and Description column contained the concentrations of the standards as molar integers for example 1 aM, 10 aM, lfM etc. (2) After the ran was finished, "Gene Expression" report was used for calculating the molar concentration (M) of the CMV DNA in extracted sample. (3) The molar concentrations needed to be recalculated into copies/ml by macro in excel file or written script.
Exemplary Test Results FIGS. 13A-13G are spectra in CMV quantitative assays for samples containing 400 to 4xl08 copies/ml. The CMV target was read as "C" allele, and the internal standard (IS) as "T" allele. The areas under the signal peaks are were used by Sequenom Quantification software for quantitation of CMV concentration in the sample. Internal Standards (IS): IS5=10E-1 IM; IS6-10E-12M; IS7=10E-13M; IS8-10E-14M; IS9-10E-15M; IS10=16E-13M; IS11=10E-17M; IS12=10E-18M; IS13=10E-19M. The data from the Quantitative Assay was measured as the area under the curve
(spectrum) for standards, controls, and patient specimens. The concentration of the unknown samples was calculated based on known standards concentration automatically by the Sequenom software MassArray Typer™ version 3.1.4. The external CMV controls were included in each run to ensure the quality of the results. The lower limit for the assay was 100 copies/mL. Specimens quantitating below this cut-off value can be reported as < 100 copies/ml. Specimens with values greater than lxl 0E8 copies/mL were above the upper limit of quantitation and can be reported as >lxl0E8 copies/ml. Quantitation of CMV required individual inteφretation because of the lack of well- established standard levels and the different rates of progression of the infection to overt disease from the time of first detection in different illness (rapid in bone maπow transplant patients, less rapid in patients with HIV- AIDS). The most consistent marker of progression is a rising viral load in an individual patient, rather than an absolute value.
STANDARDS External standards were diluted CMV: High - 4xl0E6, Medium - 4xl0E4, Low - 4xl0E2 copies/ml. The original stock with 4xl0E10 titer was purchesed from ABI Tech, hie. Internal standards were diluted oligos containing one mismatch at the site that was assayed. Concentration of the internal standards: lpM, lOOfM, lOflVI, lfM, lOOaM, lOaM, laM, O.aM, O.OlaM.
NEGATIVE CONTROLS 1. The area under the curve of the Negative Control should be less than the corresponding value of the cutoff (100 copies/mL). 2. The assay should be flagged as "Invalid" if the above condition is not met.
POSITIVE CONTROLS 1. The Positive Controls should quantitate within the range +/-0.51og of the value on the standard label for home made standards or on the package insert for Acrometrix standard. 2. If the Positive Controls quantitate outside the above range, the assay should be flagged "Invalid".
REPORTING OF RESULTS Results are reported in CMV copies/ml. Results can be saved into a Laboratory computer system and released to the Meditech System after ran approval by a Director or designee through the Interface System. LIMITATIONS The following quantitation limits are defined for CMV QUANT assay: • The Limit of Quantitaion (LoQ) is 100 CMV DNA copies/ml. • The Upper Quantitation Limit (UQL) for this assay has been determined to be 400,000,000 CMV copies/ml. • The quantitation range of the assay is from 100 to 400,000,000 CMV copies/ml.
MULTIPLE FREEZE/THAW CYCLES The effect of 1, 2, 3 and 4 freeze-thaw cycles frozen at -60° to -80°C was tested on 40 CMV negative and 25 CMV-positive serum specimens. Up to 3 freeze-thaw cycles on CMN- negative or CMN-positive specimens had no effect on the CMN Quant assay performance.
SPECIFICITY of the CMN560 ASSAY- Heφes Virus GROUP CMV (HSV type 5) is a member of the heφes viras group, which includes heφes simplex virus types 1 and 2, varicella-zoster viras, HSV type 4, (which causes chickenpox), and Epstein-Barr virus, HSV type 3, (which causes infectious mononucleosis). Specificity of the CMV560 assay was determined by testing amplification primers and extend probe against each of the four types, above mention, heφes viras reference standards using 103 DΝA copies in each reaction. CMV560 assay was specific only for CMV virus. Also, positive specific tests were run for each of the other type viruses to ensure that there was specific DΝA target.
LINEARITY The Linearity of the CMV assay extends over seven logs. An aliquot of quantitated CMV strain AD 169 (Advanced Biotechnologies, Columbia, MD) serially diluted with CMV negative human plasma to concentrations of 4x10 to 40 tcopies/ml was used for assessing the linearity of the assay. Sixteen tests were ran for each viral concentration in 10-fold increments from 40 to 4x10 copies/ml (4 4 replicates) and 12 tests for viral concentrations of 4x10 and 4x108 copies/ml (3 4 replicates). The linear range of the CMV assay in this experiment was from 400 - 40,000,000 copies/ml (FIG. 14). The standard deviation of values in this linear range (over 7 logio) was from 0.001-0.29 loglO, and viral load values agreed within 2-fold. SENSITIVITY OF THE ASSAY To increase sensitivity of the assay, total volume of the reaction was increased from 5 to 20 μl and the volume of CMV DNA in the reaction was increased 8 folds (from 2 to 16 μl ). After this change the MassARRAY™ assay reached a sensitivity of 100% (all samples called) when the input target amount was greater than 100 copies/ml.
Example 5: Screen for Hemachromatosis Mutations Hereditary hemochromatosis is classically inherited as a recessive trait but is genetically heterogenous. Mutations in the HFE and the TFR2 (transferrin receptor2; Y250X) genes account for about 80% of patients, while a third locus on chromosome lq is responsible for juvenile hemochromatosis. The nonclassical form of iron overload inherited as an autosomal dominant trait is caused by the mutation N144H in the SLCll A3 protein. Hematochromatosis is a condition that causes the intestine to absorb too much iron. Over time (often several years) this excess iron is deposited in the cells of the liver, heart, pancreas, joints, and pituitary gland. If untreated, organ damage can result. Iron overload can cause, e.g., liver cancer, diabetes, cirrhosis of the liver, heart disease, arthritis, gray or bronze skin pigmentation, impotence, infertility, and amenorrhea. The age of onset varies, but symptoms generally begin during middle age. Since hemochromatosis is a hereditary disease, the individuals in the family of a diagnosed individual are at higher risk for having gene mutations. Individuals having a mutation(s) should have iron overload screening since affected individuals are at higher risk for developing iron overload. There are at least five types of hemochromatosis. Juvenile hemochromatosis or hemochromatosis type 2 (HFE2) is an autosomal recessive disorder. One form, which is designated HFE2A, maps to lq21. A second form, designated HFE2B, is caused by mutation in the gene encoding hepcidin antimicrobial peptide and maps to 19ql3. Hemochromatosis type 3
(HFE3) is an autosomal recessive disorder, caused by mutation in the gene encoding transferrin receptor-2 isoform (TFR2), which maps to 7q22. Hemochromatosis type 4 (HFE4), an autosomal dominant disorder, is caused by mutation N144H in the SLCll A3 gene (604653) that maps to 2q32 and encodes ferroportin 1/IREG1/MTP1 - an intestinal iron transporter. Hemochromatosis type 5 is autosomal dominant and caused by mutation in H-ferritin - iron responsive element. Gene Information
Gene Locus: 6p21.3 Gene Symbol: HEE Gene Product: HEE protein Mutations: Η63D; C282Y; S65C Mutation Frequency: The prevalence of C282Y homozygosity, H63D homozygosity, and C282Y/ H63D compound heterozygosity is estimated to be 0.26%, 1.89% and 1.97%, respectively. The prevalence estimates for C282Y heterozygosity (i.e. C282Y/wild type) are 9.54% among non-Hispanic white population, 2.33% among non-Hispanic blacks, and 2.75% among Mexican- Americans. The prevalence estimates of the C282Y mutation in the US population and of the H63D mutation are 5.4% and 13.5%, respectively. OMM number: 235200 mRNA NCBI Ace No.: NM_000410: hemochromatosis mRNA (HFΕ); U60319: haemochromatosis protein (HLA-H); XM_030153: human hemochromatosis mRNA (HFΕ) Genomic Ace No.: NG_001335 Homo sapiens genomic large histone family cluster
(HFL@) on chromosome 6 (NCBI); NT _007592 Homo sapiens chromosome 6 genomic contig (NCBI); chr 6|GA_x5L2HTUTQ9V (Celera Database)
Clinical Significance The test can indicate the presence or absence of three mutations that are associated with hereditary hemochromatosis: CYS282TYR (C282Y), HIS63ASP (H63D), and S65C. CYS282TYR is a missense mutation caused by a G-to-A change at nucleotide position 845 in exon 4 that results in a cysteine to tyrosine transition at position 282 [Cys282Tyr (C282Y)] in the HFΕ protein. More than 80% of patients with hereditary hemochromatosis are homozygous for this mutation. HIS63 ASP is a mutation caused by a C-to-G change in exon 2 that results in a histidine to asparagine subsitution at position 63 [His63Asp (H63D)] in the HFΕ protein. Heterozygotes for this mutation are highly prevalent in the general population. This mutation has been found in higher frequency in patients heterozygous for the C282Y substitution than in control individuals. In the homozygous state, His63Asp has been also been observed in a few patients with hereditary hemochromatosis. It is still unclear, however, whether this mutation is a neutral polymoφhism or a mutation that in the presence of the C282Y mutation results in a more affected phenotype. S65C is a mutation, A193T, resulting in a serine to cysteine change at amino acid 65 (S65C) that appears to be associated with milder forms of hereditary hemochromatosis. The HFE screens described herein can be recommended for a patient, for example, when a member of the patient's family has been diagnosed with HFE and/or when evidence of iron overload exists.
ASSAY For H63D: This section describes the amplification and detection extension primers for the H63D
Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Tables 31 and 32, below.
HFE H63D (C187G) mutation in exon 2:
Assay: FM3-E
Overview: Reverse reaction:
Wild type template TTCGTGTTCTATGATCATGAGAGTCGCCGTGTGGAGCCCCGA (SEQ ID NO: 873) Mutated template TTCGTGTTCTATGATGATGAGAGTCGCCGTGTGGAGCCCCGA (SEQ ID NO: 874) Extension primer ATGAGAGTCGCCGTGTGGAG (SEQ ID NO:875)
Amplification by PCR*:
HFE-F1 5'-ACGTTGGATGATGACCAGCTGTTCGTGTTC-3' (SEQ ID NO:40) HFE-R2 5'-ACGTTGGATGTCTACTGGAAACCCATGGAG-3'(SEQ ID NO:41)
Amplicon length: 74 bp * amplification primers have the 10-mer tag specific for hME method: acgttggatg.
Extension: Terminator Bases Mix: ACT Extend Primer (FM3-E): 5' CTCCACACGGCGACTCTCAT-3' (reverse primer) (SEQ ID NO:42)
Analyte C: 5' CTCCACACGGCGACTCTCATGA (SEQ ID NO:876) Analyte G: 5' CTCCACACGGCGACTCTCATC 3' (SEQ ID NO:877)
Genotype Calls: C: negative (wild type), G : homozygous (mutant), GC: heterozygous.
Table 39. Sequence, length and mass of extension primer, extended primers and pause product for HFE FM3-E assay, mutation H63D (C187G)
Figure imgf000083_0001
(SEQ ID NOS:878, 879, 880)
Assay: HFE-E3 Overview: Wild type template GGATGACCAGCTGTTCGTGTTCTATGAT CATGAGAGTCGCCGTGTGGAGCCCCGA (SEQ ID NO:881) Mutated template GGATGACCAGCTGTTCGTGTTCTATGAT GATGAGAGTCGCCGTGTGGAGCCCCG (SEQ ID NO:882)
Extension primer CAGCTGTTCGTGTTCTATGAT (SEQ ID NO:45)
Amplification by PCR*:
HFE-F7 5 '-ACGTTGGATGTTCATGGGTGCCTCAGAGC-3 ' (SEQ ID NO:43) HFE-R8 5 '-ACGTTGGATGCCACATCTGGCTTGAAATTC-3 ' (SEQ ID NO :44) Amplicon length: 153 bp * amplification primers have the 10-mer tag specific for hME method:acgttggatg. Extension: Terminator Bases Mix: ACT
Extend Primer (HFE-E3): 5' CAGCTGTTCGTGTTCTATGAT 3' (SEQ ID NO:45)
Analyte C: 5' CAGCTGTTCGTGTTCTATGATC 3 ' (SEQ ID NO:883)
Analyte G: 5' CAGCTGTTCGTGTTCTATGATGA 3' (SEQ ID NO:884)
Genotype Calls: C negative (wild type), G homozygous (mutant), GC heterozygous.
Table 40. Sequence, length and mass of extension primer, extended primers and pause product for HFE-E3 assay, mutation H63D (C187G)
Figure imgf000084_0001
(SEQ ID NOS:885, 886, and 887)
HFE C282Y (G845A) mutation in exon 4: This section describes the amplification and detection extension primers for the C282Y Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Tables 33 and 34, below.
Assay: FM6-E
Overview:
Reverse reaction:
Wild type template GAGCAGAGATATACGTGCCAGGTGGAGCACCCAGGC (SEQ ID NO:888)
Mutated template GAGCAGAGATATACGTACCAGGTGGAGCACCCAGGC (SEQ ID NO:889) Extension primer CCAGGTGGAGCACCCAGGC (SEQ ID NO: 890)
Amplification by PCR*:
HFE-F4 5'-ACGTTGGATGTGGATAACCTTGGCTGTACC-3'(SEQ ID NO:46)
HFE-R5 5 '-ACGTTGGATGTATCACAATGAGGGGCTGATC-3 '(SEQ ID NO:47)
Amplicon length: 89 bp * amplification primers have the 10-mer tag specific for hME method: acgttggatg.
Extension: Terminator Bases Mix: ACG
Extend Primer (FM6-E): 5' GCCTGGGTGCTCCACCTGG 3' (reverse primer) (SEQ ID NO:48)
Analyte G: 5' GCCTGGGTGCTCCACCTGGC 3' (SEQ ID NO:891) Analyte A: 5' GCCTGGGTGCTCCACCTGGTA 3' (SEQ ID NO:892)
Genotype Calls: G negative (wild type), A homozygous (mutant) GA heterozygous
Table 41. Sequence, length and mass of extension primer, extended primers and pause product for HFE FM6-E assay, mutation C282Y (G845A)
Figure imgf000085_0001
(SEQ ID NOS:893, 894, 895, and 896) Assay: HFE-E6
Overview:
Wild type template TGGGGAAGAGCAGAGATATACGTGCCAGGTGGAGCACCCAGGC (SEQ ID NO:897)
Mutated template TGGGGAAGAGCAGAGATATACGTACCAGGTGGAGCACCCAGGC (SEQ ID NO: 898) Extension primer GGGAAGAGCAGAGATATACGT (SEQ ID NO:51)
Amplification by PCR* :
HFE-F9 5'-ACGTTGGATGTAATGGGGATGGGACCTACC-3' (SEQ ID NO:49) HFE-R10 5'-ACGTTGGATGTGCTCTCATCAGTCACATACC-3' (SEQ ID NO:50) Amplicon length: 137 bp * amplification primers have the 10-mer tag specific for hME method: acgttggatg.
Extension: Terminator Bases Mix: ACT Extend Primer (HFE-E6): 5' GGGAAGAGCAGAGATATACGT 3' (SEQ ID NO:51)
Analyte A: 5' GGGAAGAGCAGAGATATACGTA 3' (SEQ ID NO:899) Analyte G: 5' GGGAAGAGCAGAGATATACGTGC 3' (SEQ ID NO:900)
Genotype Calls: G negative (wild type) A homozygous (mutant) AG heterozygous
Table 42. Sequence, length and mass of extension primer, extended primers and pause product for HFE HFE-E6 assay, mutation C282Y (G845A)
Figure imgf000086_0001
Pause GGGAAGAGCAGAGATATACGTG 22 bp Da
(SEQ ID NOS:901, 902, 903, and 904)
HFE S65C (A193T) mutation in exon 2: This section describes the amplification and detection extension primers for the A193T Assay and provides the sequences of the primers. The sequences of the resulting extended primers are provided in Tables 35 and 36, below.
Assay: HFE S65C_E1
Overview:
Wild type template CAGCTGTTCGTGTTCTATGATCATGAGAGTCGCCGTGTGGAGCCCCGAAC(SEQ ID NO:905) Mutated template CAGCTGTTCGTGTTCTATGATCATGAGTGTCGCCGTGTGGAGCCCCGAAC (SEQ ID NO:906) Extension primer GTCGCCGTGTGGAGCCC (SEQ ID NO:907)
Amplification by PCR*: HFE-F1 5'-ACGTTGGATGATGACCAGCTGTTCGTGTTC-3' (SEQ ID NO:52) HFE-R2 5'-ACGTTGGATGTCTACTGGAAACCCATGGAG-3'(SEQ ID NO:53)
Amplicon length: 74 bp * amplification primers have the 10-mer tag specific for hME method: acgttggatg. Extension: Terminator Bases Mix: CGT
Extend Primer (HFE S65C_E1): 5' GGGCTCCACACGGCGAC 3' (reverse primer) (SEQ ID NO:54)
Analyte A: 5' GGGCTCCACACGGCGACT 3' (reverse primer) (SEQ ID NO:908) Analyte T: 5* GGGCTCCACACGGCGACAC 3' (reverse primer) (SEQ ID NO:909) Genotype Calls: A negative (wild type) T homozygous (mutant) AT heterozygous Table 43. Sequence, length and mass of extension primer, extended primers and pause product for HFE S65C-E1 assay, mutation A193T
Figure imgf000088_0001
(SEQ ID NOS.910, 911, 912, and 913)
Assay: HFE S65CJB5 Overview:
Wild type template CAGCTGTTCGTGTTCTATGATCATGAGAGTCGCCGTGTGGAGCCCCGAAC (SEQ ID NO:914) Mutated template CAGCTGTTCGTGTTCTATGATCATGAGTGTCGCCGTGTGGAGCCCCGAAC (SEQ ID NO:915) Extension primer TTCGTGTTCTATGATCATGAG (SEQ ID NO:57)
Amplification by PCR*:
HFE-F7 5 '-ACGTTGGATGTTCATGGGTGCCTCAGAGC-3 ' (SEQ ID NO:55) HFE-R8 5'-ACGTTGGATGCCACATCTGGCTTGAAATTC-3' (SEQ ID NO:56) Amplicon length: 153 bp * amplification primers have the 10-mer tag specific for hME method:acgttggatg (SEQ ID NO:916)
Extension: Terminator Bases Mix: CGT
Extend Primer (HFE S65C_E5): 5' TTCGTGTTCTATGATCATGAG 3' (6442.2 Da) (SEQ ID NO:57)
Analyte A: 5' TTCGTGTTCTATGATCATGAGAG 3' (7068.6 Da) (SEQ ID NO:917) Analyte T: 5'-TTCGTGTTCTATGATCATGAGT-3' (6730.4 Da) (SEQ ID NO:918) Genotype Calls: A negative (wild type) T homozygous (mutant) AT heterozygous
Table 44. Sequence, length and mass of extension primer, extended primers and pause product for HFE S65C-E5 assay, mutation A193T
Figure imgf000089_0001
(SEQ ID NOS:919, 920, and 921)
Testing Procedure Blood specimens and quality control procedures were performed according to protocols described in Example 1. Table 45, below, provides a list of controls used in the presently described assay.
Table 45. Controls Used in the Assays
HFE H63D NA13591 G HFE H63D homozygous mutant 393547 C HFE H63D negative- wild type GM7798 C HFE H63D negative- wild type GM8810 C HFE H63D negative- wild type GM9729 C HFE H63D negative- wild type NA14646 C HFE H63D negative- wild type NA14702 C HFE H63D negative- wild type NA16028 C HFE H63D negative- wild type GM12783 CG HFE H63D heterozygous NA14641 CG HFE H63D heterozygous NA14650 CG HFE H63D heterozygous NA16000 CG HFE H63D heterozygous
HFE C282Y 393547 A HFE C282Y homozygous mutant NA14646 A HFE C282Y homozygous mutant GM5896 G HFE C282Y negative- wild type GM6023 G HFE C282Y negative- wild type GM7798 G HFE C282Y negative- wild type GM8810 G HFE C282Y negative- wild type NA13591 G HFE C282Y negative- wild type NA14702 G HFE C282Y negative- wild type NA16000 G HFE C282Y negative- wild type NA16028 G HFE C282Y negative- wild type NA14641 AG HFE C282Y heterozygous NA14650 AG HFE C282Y heterozygous HFE S65C 393547 A HFE S65C negative- wild type GM12783 A HFE S65C negative- wild type GM5896 A HFE S65C negative- wild type GM6023 A HFE S65C negative- wild type GM7798 A HFE S65C negative- wild type GM8810 A HFE S65C negative- wild type GM9729 A HFE S65C negative- wild type NA13591 A HFE S65C negative- wild type NA14641 A HFE S65C negative- wild type NA14646 A HFE S65C negative- wild type NA14650 A HFE S65C negative- wild type NA14702 A HFE S65C negative- wild type NA16000 A HFE S65C negative- wild type NA16028 AT HFE S65C heterozygous PCR, dephosphorylation, homogenous MASSEXTEND (HME), and spectroclean resin clean up procedures were carried out as described in Example 1, above.
RESULTS ANALYSIS Results were analyzed as described in Example 1, above. FIG. 7 is a mass spectram of heterozygous "GA" alleles (heterozygous positive) for H63D Histidine to Aspartic acid (C187G) mutation in the FM3-E assay. FIG. 8 is a mass spectram of heterozygous "GC" alleles (heterozygous positive) for H63D Histidine to Aspartic acid (C187G) mutation in the HFE-E3 assay. FIG. 9 is a mass spectrum of heterozygous "GA" alleles (heterozygous positive) for S65C Serine to Cysteine (A193T) mutation in the HFE S65C El assay. FIG. 10 is a mass spectrum of heterozygous "GA" alleles (heterozygous positive) for S65C Serine to Cysteine (A193T) mutation in the HFE S65C E5 assay. FIG. 11 is a mass spectram of heterozygous "GA" alleles (heterozygous positive) for C282Y cysteine to tyrosine (G845A) mutation in the FM6-E assay. FIG. 12 is a mass spectrum of heterozygous "GA" alleles (heterozygous positive) for C282Y cysteine to tyrosine (G845A) mutation in the HFE-E6 assay. Exemplary test results are provided in Tables 46 to 48, below.
Validation Tests Results
Table 46. H63D mutation tested by HFE-E3_FM3-E assays
Figure imgf000091_0001
Distribution of genotypes: GG HOMOZYGOUS N=5 CC NEGATIVE N=68 GC HETEROZYGOUS N=58
Summary: a) HFE assays, FM3-E and HFE-E3, were validated in two runs "DD33" and "Validation HFE-E3_FM3-E" for a total of 131 samples. b) The samples were obtained from ARUP and our results are compared to the results from ARUP. c) The results from 129 samples were in accordance with ARUP results for both assays. d) For two samples, 01hFE_021220 & 101hFE_021220, our results differ from those from ARUP. The sample: 101hFE_021220 is a duplicate (re-extracted and PCRed a second time) of the sample 01hFE_021220. All 4 of our results agreed. We suggest that our results are coπect. e) Thirteen samples which did not give any result in one of the assays were re-run in subsequent runs and results were obtained for all the samples.
Figure imgf000092_0001
Distribution of genotypes: GG HOMOZYGOUS N=32 CC NEGATIVE N=47 GC HETEROZYGOUS N=45 Summary: a) HFE assays, FM6 -E and HFE-E6, were validated in the run "VALIDATION HFE- FM6 HFE-E 041603" a total of 124 samples. b) The samples were obtained from ARUP and our results are compared to the results from ARUP. c) The results from 122 samples agreed with ARUP results for both assays. d) For two samples (04hFE_021220& 104hFE_021220) our results differ from those from ARUP. Sample 104hFE_021220 is a re-extracted second time sample 04hFE_021220, and all 4 of our results agree. Therefore, we suggest that our results are coπect.
Table 48. S65C mutation tested by HFE S65C_E1 and HFE S65CJE5 assays
Figure imgf000093_0001
Distribution of genotypes: TT HOMOZYGOUS N=0 AA NEGATIVE N=98 AT HETEROZYGOUS N=4 Summary: a) HFE assays, HFE S65C_Eland HFE S65CJE5, were at total of 103 samples. b) The samples were obtained from ARUP and our results are compared to the results from ARUP. c) The results from 98 samples agree with ARUP results for both assays. d) For six samples (01hFE_021220 & 101hFE_021220, 04hFE_021220 & 104hFE_021220, 41hFE_021126 & 141hFE_021126) our results differ from those from ARUP. The samples: 101hFE_021220, 104hFE_021220, and 141hFE_021126 are duplicates (re-extracted and PCRed second time) of the samples 01hFE_021220, 04hFE_021220, and 41hFE_021126. All 4 of our results agree for each sample. e) In addition, since samples 01hFE_021220 and 04hFE_021220 had different calls for two mutations suggesting a mixup in the ARUP samples.
OTHER EMBODIMENTS A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims. ? E^i i y. l_
Private Sub btnBrowse_Click()
'open explorer
CommonDialog 1. Action = 1
'display file chosen in the Data File text box
Forml.txtDataFile.text = CommonDialogl.FileName
Forail.txtOutFile.text = Mid$(txtDataFile.text, 1, Len(txtDataFile.text) - 4) &
"outputFile.csv"
End Sub
Private Sub btnCancel_Click() End End Sub
Private Sub btnOutputFileGen_Click() 'automatically clicks this button Modulel .btnOutputFileGen_Click
End Sub
Private Sub Form_Load() Module3.Initialize 'automatically loads this form Modulel .btnOutputFileGen_Click End
End Sub
Modulel OutFileConv
Public Sub btnOutputFileGen_Click()
Dim i, j, k, intDelimiterl, intDelimiter2 As Integer
Dim strPlatenum, strWelmum, strDecider, strLineText As String
Dim strOldplatenum, strPlatenumhst, strSourceposnum As String
Dim strSourcelD, strDNAID As String
Dim intDestlD, intDestWelllD, intSourceWelllD, intDNAID As Integer
Dim strWelllD, strDestID As String
Dim intHitcount, intTipcount,- intWellcount, intPlatecount, intPipetteSteps As Integer
Dim aπVall(20) As String
Dim Fsysl As New FileSystemObject Dim Fsys2 As New FileSystemObject Dim Fsys3 As New FileSystemObject Dim histreaml As TextStream Dim Outstream As TextStream Dim InFile, OutFile As File
'Dim DataFilePath As String 'Dim OutputFilePath As String intPipetteSteps = 0 intTipcount - 0 intWellcount = 0 intHitcount = 0 strSourceposnum = 0 intPlatecount = 1 strPlatenumhst = "" j = l i = l k = l
With For l
Dim fso, f, fl, fc Dim s(10) As String Dim t As Integer Dim name As String Dim Filename 1, Filename2 As String Dim movefilenamel, movefilename2 As String Set fso = CreateObject("Scripting.FileSystemObject") Set f = fso.GetFolder("C:\Program Files\Gemini\Output") Set fc = f.Files For Each fl In fc name = fl .name If InStr(l, name, "Output") = 0 Then s(t) = fl .name t = t + l End If Next Ift = 0 Then End End If
Filenamel = ("C:\Program Files\Gemini\Output\" & s(0)) strDestID = Mid$(s(0), 1, Len(s(0)) - 4) movefilenamel = "C:\Program Files\Gemini\OutputProcessed\" & s(0) Set fristreaml = Fsysl.OpenTextFile(Filenamel) Instreaml .SkipLine Set Outstream = Fsys3.CreateTextFile("C:\Program Files\Gemini\Output\Output" & strDestID & ".csv") Instreaml .SkipLine Outstream. WriteLine ("DNA ID," & "DestWelllD," & "Dest ED," & "SourceWelllD," & "Sourceld") Outsfream.WriteLine
Do While Not Instreaml. AtEndOfStream strLineText = Instreaml. ReadLine For k = 1 To Len(strLineText) intDelimiterl = friStr(j, strLineText, ",") If intDelimiterl = 0 Then arrVall(i) = Mid$(strLineText, j) Else arrVall(i) = Mid$(strLineText, j, intDelimiterl - j) j = intDelimiterl + 1 i = i + l End If Next i = l j = ι intDestWellED - arrVall(l) strDNAID = arrVall(7) sfrSourcelD = (arrVall(lO)) intSourceWelllD = arrVall(6) If strDNAID = "" Then Else Outsfream.WriteLine (strDNAID & "," & intDestWelllD & "," & strDestID & "," & intSourceWelllD & "," & sfrSourcelD) End If Loop
End With
Instreaml. Close
Fsysl.MoveFile Filename 1, movefilenamel
End Sub
Module 3 INIOutfileConv
Public Const strfrii = "OutFile Converter.ini"
Function GetParameter(strTag As String, strFile As String) As String 'Function that used to set the files used in the conversion. Now it scans the 'directory and looks for files and converts them. So this function only sets the 'date.
Dim strPath As String
Dim strTemp As String
Dim Instream As TextStream
Dim Fsys As New FileSystemObject
Dim position As Long
Dim endpos As Long
Dim text As String
Dim strAHText As String strPath = App.Path & "\" & strFile
If Fsys.FileExists(strPath) Then Set Instream = Fsys.OpenTextFile(strPath) strAHText = Instream.ReadAll position = InStr(l, strAHText, strTag) endpos = InStr(position, strAHText, Chr(13)) position = position + Len(strTag) + 2 text = Mid$(strAUText, position, (endpos - position)) GetParameter = text
End If
End Function
Sub Initialize()
Dim OutputFile As String Dim OutputConverted As String Dim OutputFileMoved As String
With Forml 'OutputConverted = GetParameter("Output File", strlni) ' xtOutFile = OutputConverted Dim mydate mydate = Format(Date, "mmddyy") 'OutputFileMoved = GetParameter("Output Moved", strlni) '.txtOutFileMoved = OutputFileMoved & mydate & ".csv"
End With
End Sub
Figure imgf000100_0001
PCR Mix Trans
Private Sub btnBrowse_Click()
'open explorer
CommonDialogl ction = 1
'display file chosen in the Data File text box
PCRMixTrans.txtDataFile.text = CommonDialogl.FileName
PCRMixTrans.txtWklName.text = Mid$(txtDataFile.text, 1, Len(txtDataFile.text) - 4) &
".gwl"
End Sub
Private Sub btnCancel_Click()
End
End Sub
Private Sub btnWklGen_Click() Module4.btnWklGen_Click
End Sub
Private Sub Form_Load() Module3.Initialize Module4.btnWklGen_Click End
End Sub
Modulel
Function WellToNum96(Well As String) As String
'Function that will take a combination letter/number well description and
'changing it to a well number for a 96 well plate. Dim strWelllett As String Dim strWellnum As String Dim strLettnum As String strWelllett = Mid$(Well, 1, 1) IfLen(Well) = 2 Then strWellnum = Mid$(Well, 2, 1) ElseIfLen(Well) = 3 Then strWellnum = Mid$(Well, 2, 2) End If Select Case strWelllett Case "A" strLettnum = 1 WellToNum96 = strLettnum + 8 * (strWellnum - 1) Case "B" strLettnum = 2 WellToNum96 = strLettnum + 8 * (strWellnum - 1) Case "C" strLettnum = 3 WellToNum96 = strLettnum + 8 * (strWellnum - 1 Case "D" strLettnum = 4 WellToNum96 = strLettnum + 8 * (strWellnum - 1 Case "E" strLettnum = 5 WellToNum96 = strLettnum + 8 * (strWellnum - 1 Case "F" strLettnum = 6 WellToNum96 = strLettnum + 8 * (strWellnum - 1 Case "G" strLettnum = 7 WellToNum96 = strLettnum + 8 * (strWellnum - 1 Case "H" strLettnum = 8 WellToNum96 = strLettnum + 8 * (strWellnum - 1 Case Else WellToNum96 = Well
End Select End Function
Module 2
Function WellToNum384(Well As String) As String
'Function that will take a combination letter/number well description and
'changing it to a well number for a 384 well plate. Dim strWelllett As String Dim strWellnum As String Dim strLettnum As String strWelllett = Mid$(Well, 1, 1) IfLen(Well) = 2 Then strWellnum = Mid$(Well, 2, 1) Elself Len(Well) = 3 Then strWellnum = Mid$(Well, 2, 2) End If Select Case strWelllett Case "A" strLettnum = 1 WellToNum384 = strLettnum + 16 * (strWellnum - 1 Case "B" strLettnum = 2 WellToNum384 = strLettnum + 16 * (strWellnum - 1 Case "C" strLettnum = 3 WellToNum384 = strLettnum + 16 * (strWellnum - 1 Case "D" strLettnum = 4 WellToNum384 = strLettnum + 16 * (strWellnum - 1 Case "E" strLettnum = 5 WellToNum384 = strLettnum + 16 * (strWellnum - 1 Case "F" strLettnum = 6 WellToNum384 = strLettnum + 16 * (strWellnum - 1 Case "G" strLettnum = 7 WellToNum384 = strLettnum + 16 * (strWellnum - 1 Case "H" strLettnum = 8 WellToNum384 = strLettnum + 16 * (strWellnum - 1 Case "I" strLettnum = 9 WellToNum384 = strLettnum + 16 * (strWellnum - 1) Case "J" strLettnum = 10 WellToNum384 = strLettnum + 16 * (strWellnum - 1) Case "K" strLettnum = 11 WellToNum384 = strLettnum + 16 * (strWellnum - 1) Case "L" strLettnum = 12 WellToNum384 = strLettnum + 16 * (strWellnum - 1) Case "M" strLettnum = 13 WellToNum384 = strLettnum + 16 * (strWellnum - 1) Case "N" strLettnum = 14 WellToNum384 = strLettnum + 16 * (strWellnum - 1) Case "O" strLettnum = 15 WellToNum384 = strLettnum + 16 * (strWellnum - 1) Case "P" strLettnum = 16 WellToNum384 = strLettnum + 16 * (strWellnum - 1) Case Else WellToNum384 = Well
End Select End Function
PCR Mix Transfer Module 3
Public Const strlni = "PCR Mix Transfer.ini"
Function GetParameter(strTag As String, strFile As String) As String 'Short function to parse the ini file to get information needed
Dim strPath As String
Dim strTemp As String
Dim Instream As TextStream
Dim Fsys As New FileSystemObject
Dim position As Long
Dim endpos As Long
Dim text As String
Dim strAHText As String strPath = App.Path & "\" & strFile
If Fsys.FileExists(strPath) Then Set Instream = Fsys.OpenTextFile(strPath) strAHText = fristream.ReadAll position = InStr(l, strAHText, strTag) endpos = InStr(position, strAUText, Chr(13)) position = position + Len(strTag) + 2 text = Mid$ (strAUText, position, (endpos - position)) GetParameter = text
End If
End Function
Sub Initialize()
Dim InputFile As String Dim Worklist As String Dim WashWorklist As String Dim SourceType As String Dim DestType As String Dim Volume As String
With PCRMixTrans 'With loop for all the parameters that are being retreived from 'parsing function above. Where the parameter names must match the 'bracketed parameters in the ini file (see file list at top). InputFile = GetParameter("Input File", strlni) .txtDataFile = InputFile Worklist = GetParameter("Worklist File", strlni) .txtWklName = Worklist 'Wash Worklist = GetParameter("Wash Default Worklist", strlni) '.txtWashWklName = WashWorklist SourceType = GetParameter("Source Type", strlni) .cmbSourcePlate = SourceType DestType = GetParameter("Dest Plate Type", strlni) .cmbDestPlate = DestType Volume = GetParameter("Volume", strlni) .txtVol = Volume
End With
End Sub
PCRMixTransfer Module 4
Public g_boolEvens_Done As Boolean Public Sub btnWklGen_Click()
Dim i, j, k, intDelimiterl, intDelimiter2 As Integer
Dim strPlatenum, strWellnum, strDecider, strLineTextl, strLineText2 As String
Dim strOldplatenum, strPlatenumhst, strSourceposnum As String
Dim strDestWellld As String
Dim strOldTubeld As String
Dim strSourceWellld As String
Dim intHitcount, intTipcount, intWellcount, intPlatecount, intPipetteSteps As hiteger
Dim DNAId As String
Dim strTubeld As String
Dim arrVall(lO) As String
Dim Fsysl As New FileSystemObject Dim Instreaml As TextStream Dim Outstream 1 As TextStream Dim InFilel, OutFilel As String
Dim app World As Excel. Application Dim wb World As Excel. Workbook intPipetteSteps = 0 intTipcount = 0 intWellcount = -1 intHitcount = 0 intCounter = 0 strSourceposnum = 0 intPlatecount = 1 strPlatenumhst = "" j = l i = l k = l
Dim testskipline As Integer testskipline = 0 g_boolEvens_Done = False With PCRMixTrans 'Next set up code is to open Excel, if not already open. Open the input file, 'which is listed in the ini file, and sort the data according to the customer. On Error Resume Next 'ignore eπors Set appWorld = GetObject(, "Excel.Apphcation") 'look for a miming copy of Excel If Err .Number <> 0 Then 'If Excel is not running then Set appWorld = CreateObject("Excel.Application") 'ran it End If Err. Clear ' Clear Err object in case error occuπed. 'On Error GoTo 0 'Resume normal error processing Set wb World = appWorld. Workbooks. Open(.txtDataFile.text) Columns("E:E").Select Selection.TextToColumns Destination:=Range("El "), DataType:=xlFixedWidth, FieldInfo:=Array(Array(0, 2), Array(l, 2)) Range("El").Select Columns("A:F").Select Selection.Sort Keyl :=Range("F: lGuess, _ OrderCustom:=l, MatchCase:
Figure imgf000108_0001
Selection.Sort Keyl:=Range("Fl"), Orderl :=xlAscending, Header:=xlGuess, _ OrderCustom:=l, MatchCase:=False, Orientation:=xlTopToBottom wb World. Save wb World. Close False Set wb World = app World. Workbooks.Open(.txtDataFile.text) Columns("A:F").Select Columns("A:F").Select Selection.Sort Keyl :=Range("Fl "), Orderl :=xlAscending, Key2:=Range("El ") _ , Order2:=xlAscending, Header:=xlGuess, OrderCustom:=l, MatchCase:= _ False, Orientation:=xlT opToBottom wb World. Save wbWorld.Close False
Start: testskipline = testskipline + 1
'This If loop now opens the sorted Input file and parses it to find out in which 'wells which PCR mixes go into.
If Fsys 1.FileExists(.txtDataFile.text) Then Set Instreaml = Fsysl.OpenTextFile(.txtDataFile.text) 'open file Set Outstreaml = Fsysl.CreateTextFile(.txtWklName.text) 'create worklist file If testskipline < 2 Then 'Customer wants to do odd well, then evens. Therefore, 'we skip another line on the second time through the 'file. Instreaml .SkipLine
End If
Instreaml. SkipLine 'Always skip one line, for headers, or extraneous info.
Do While Not Instream 1. AtEndOfStream strLineTextl = Instream l.ReadLine 'This loop does the parsing of the text in the file. Fork = 1 To Len(strLineTextl) intDelimiterl = InStrfi, strLineTextl, ",") If intDelimiterl = 0 Then aπVall(i) = Mid$(strLineTextl, j) Else arrVall(i) = Mid$ (strLineText 1, j, intDelimiterl - j) j = intDelimiterl + 1 i = i + l End If Next i = l j = l intTipcount = intTipcount + 1 intWellcount = intWellcount + 2 strOldTubeld = strTubeld strDestWellld = aιrVall(5) & aιrVall(6) 'Well number in dest. plate strTubeld = arrVall(3) 'PCR Mix id 'Small loop to find out which conversion method to use, 96 or 384 well pits. If InStr(l, .cmbDestPlate.text, "384") = 0 Then strWellnum = WellToNum96(strDestWellId) If strWellnum > 96 Then MsgBox ("Well number in file greater than 96!") End End If Else strWellnum = WellToNum384(strDestWellId) End If 'The customer only wants to do an extra wash of the tips if the 'PCR Mix id is different. Will waste time otherwise. If strTubeld <> strOldTubeld Then IfstrOldTubeId = "" Then Else Outstreaml .WriteLine ("B;Aspirate(255,Decon,290,290,290,290,290,290,290,290,0,0,0,0,3,0,l,0108~l,0);") Outstreaml .WriteLine ("B;StartTimer(l);") Outstreaml.WriteLine ("B;WaitTimer(l,10);") Outstreaml .WriteLine ("B;Wash(255,l,2,l,0,10,500,10,500,10,70,30,2,0,1000);") Outstreaml .WriteLine ("B;Wash(255,l,2,l,0,5,500,10,500,10,70,30,2,0,1000);") Outstreaml .WriteLine ("B;Wash(255,l,2,l,0,5,500,10,500,10,70,30,2,0,1000);") intPipetteSteps = 0 End If End If 'Worklist contents Outstreaml. WriteLine ("A;" & strTubeld & ";;" & .cmbSourcePlate.text & ";" & intTipcount & ";" & _ DNAId & ";" & .txtVol.text & ";;;") Outstreaml. WriteLine ("D;D" & CStr(intPlatecount) & ";;" & .cmbDestPlate.text & ";" & strWellnum & _ ";;" & .txtVol.text & ";;;") Outstreaml. WriteLine ("W;") intPipetteSteps = intPipetteSteps + 1 strOldplatenum = strPlatenum If intTipcount = 8 Then intTipcount = 0 If InStr(l, .cmbDestPlate.text, "384") = 0 Then If intWellcount = 96 Then intPlatecount = intPlatecount + 1 intWellcount = 0 Else intWellcount = intWellcount + 8 End If Else strWellnum = WellToNum384(strDestWellId) 'Need to go through the file twice, once for odds, 'then once for evens.... If intWellcount = 383 Then intWellcount = 0 Elself intWellcount = 384 Then intWellcount = -1 End If End If End If
Instreaml .SkipLine Loop 'Loop to see if evens where done, if not go back to top If Instream 1. AtEndOfStream = True And g_boolEvens_Done = False Then Instreaml. Close g_boolEvens_Done = True GoTo Start Else Always need to wash at end of worklist If Instreaml. AtEndOfStream = True Then Outstreaml .WriteLine ("B;Aspirate(255,Decon,290,290,290,290,290,290,290,290,0,0,0,0,3,0,l,0108~l,0);") Outstreaml .WriteLine ("B;StartTimer(l);") Outstream 1.WriteLine ("B ; WaitTimer( 1,10);") Outstreaml .WriteLine ("B;Wash(255,l,2,l,0,10,500,10,500,10,70,30,2,0,1000);") Outstreaml .WriteLine ("B; Wash(255, 1 ,2, 1 ,0,5,500, 10,500, 10,70,30,2,0, 1000);") Outstreaml .WriteLine ("B;Wash(255,l,2,l,0,5,500,10,500,10,70,30,2,0,1000);") End If Instreaml. Close 'Close file End If
End If
End With
End Sub Private Sub btnBrowse_Click()
'open explorer
CommonDialogl. Action = 1
CommonDialog2Action = 1
'display file chosen in the Data File text box
DNATrans.txtDataFile.text = CommonDialogl .FileName
DNATrans.txtWklName.text = Mid$(txtDataFile.text, 1, Len(txtDataFile.text) - 4) &
".gwl"
End Sub
Private Sub btnCancel_Click() End End Sub Private Sub btnMoveFile_Click() Module4.btnMoveFile_Click
End Sub
Private Sub Form_Load() Module3.Initialize Module4.btnMoveFile_Click End
End Sub
Module 3 INEvfoveFileProcessed
Public Const strlni = "Move File Processed.ini"
Function GetParameter(strTag As String, strFile As String) As String
Dim strPath As String
Dim strTemp As String
Dim Instream As TextStream
Dim Fsys As New FileSystemObject
Dim position As Long
Dim endpos As Long
Dim text As String
Dim strAUText As String strPath = App.Path & "\" & strFile
If Fsys.FileExists(strPath) Then Set Instream = Fsys.OpenTextFile(strPath) strAUText = Instream.ReadAll position = frιStr(l, strAUText, strTag) endpos = InStr(position, strAUText, Chr(13)) position = position + Len(strTag) + 2 text = Mid$(strAllText, position, (endpos - position)) GetParameter = text
End If
End Function
Sub friitializeO
Dim OutputPath As String Dim MovePath As String
With MoveFile OutputPath = GetParameter("Original Path", strlni) .txtOutputPath = OutputPath MovePath = GetParameter("Move Path", strlni) .txtMovePath = MovePath End With End Sub
APpeMDi 3»
DNA Transfer Module 3
Public Const strlni = "DNA Transfer.ini"
Function GetParameter(strTag As String, strFile As String) As String
'Small function to parse the ini file listed above and get the parameters needed
'for the application.
Dim strPath As String
Dim strTemp As String
Dim Instream As TextStream
Dim Fsys As New FileSystemObject
Dim position As Long
Dim endpos As Long
Dim text As String
Dim strAUText As String strPath = App.Path & "\" & strFile
If Fsys.FileExists(strPath) Then Set Instream = Fsys.OpenTextFile(strPath) strAUText = Instream.ReadAll position = InStr(l, strAUText, strTag) endpos = InStr(position, strAUText, Chr(13)) position = position + Len(strTag) + 2 text = Mid$(strAllText, position, (endpos - position)) GetParameter = text
End If
End Function
Sub Initialize()
Dim DNAlist As String Dim Worklist As String Dim SourceType As String Dim DestType As String Dim Volume As String
With DNATrans
'With loop to go through and get the parameters needed from the parsing function. 'Each parameter listed below, must match the parameters in the brackets in the 'ini file. DNAlist = GetParameter("DataFile", strlni) .txtDataFile = DNAlist Worklist = GetParameter("Worklist File", strlni) .txtWklName = Worklist SourceType = GetParameter("Source Type", strlni) .cmbSourcePlate = SourceType DestType = GetParameter("Dest Plate Type", strlni) .cmbDestPlate = DestType Volume = GetParameter("Volume", strlni) .txtVol = Volume
End With
End Sub
DNA Transfer Module 4
Public g_boolEvens_Done As Boolean
Public Sub btnWklGen_Click()
Dim i, j, k, intDelimiterl, intDelimiter2 As Integer
Dim strPlatenum, strWellnum, strDecider, strLineTextl, strLineText2 As String
Dim strOldplatenum, strPlatenumhst, strSourceposnum As String
Dim strDestWellld As String
Dim strSourceld As String
Dim strSourceWellld As String
Dim intHitcount, intTipcount, intWellcount, intPlatecount, intPipetteSteps As Integer
Dim DNAId As String
Dim searchDNAId As String
Dim oldsearchDNAId As String
Dim aπVal 1 ( 10) As String
Dim aπVal2(10) As String
Dim intCounter As Integer
Dim Fsysl As New FileSystemObject Dim Fsys2 As New FileSystemObject Dim Fsys3 As New FileSystemObject Dim isDNASource As TextStream Dim isDNASearch As TextStream Dim Outstreaml As TextStream Dim Outstream2 As TextStream
Dim appWorld As Excel.Apphcation Dim wbWorld As Excel.Workbook Dim noidcheck As Integer Dim fsό, f, fl, fc, s Dim Filename As String Dim movefilename As String intPipetteSteps = 0 intTipcount = 0 intWellcount = -1 intHitcount = 0 intCounter = 0 strSourceposnum = 0 intPlatecount = 1 strPlatenumhst = "" j = l i = l k = l
Dim testskipline As Integer testskipline = 0 g_boolEvens_Done = False
With DNATrans 'These next set of commands open Excel, if not open already. Then takes 'the file specified in the ini file and sorts it according to customer 'request. On Error Resume Next 'ignore eπors Set appWorld = GetObject(, "Excel.Apphcation") 'look for a running copy of Excel If Eπ.Number <> 0 Then 'If Excel is not running then Set appWorld = CreateObject("Excel.Application") 'ran it End If Err. Clear ' Clear En object in case error oc rrred. 'On Error GoTo 0 'Resume normal error processing 'Set wb World = appWorld. Workbooks.Open("D:\@Work\Customers\BNRI\080702\DNA list.csv") Set wb World = app World. Workbooks. Open(.txtDataFile.text) 'Excel mods Columns("E:E").Select Selection.TextToColumns Destination:=Range("El "), DataType:=xlFixedWidth, FieldInfo:=Array(Array(0, 2), Aπay(l, 2)) Range("El").Select Columns("A:F"). Select Selection.Sort Keyl :=Range("F:F"), Orderl :=xl Ascending, Header:=xlGuess, _ OrderCustom:=l, MatchCase:=False, Orientation:=xlTopToBottom Selection.Sort Keyl:=Range("Fl"), Order l:=xl Ascending, Header:=xlGuess, __ . OrderCustom:=l, MatchCase:=False, Orientation:=xlTopToBottom wb World. Save wbWorld.Close False Set wb World = app World. Workbooks.Open(.txtDataFile.text) Columns("A:F").Select Selection.Sort Keyl :=Range("F:F"), Orderl :=xlAscending, Header.-xlGuess, _ OrderCustom:=l, MatchCase:=False, Orientation:=xlTopToBottom Selection.Sort Keyl :=Range("Fl"), Orderl :=xlAscending, Header:=xlGuess, __ OrderCustom:=l, MatchCase:=False, Orientation:=xlTopToBottom wbWorld.Save wbWorld.Close False Set Outstream2 = Fsys3.CreateTextFile("C:\Gemini\Logfiles\DNAIdLog.txt")
Start: testskipline = testskipline + 1 If Fsysl .FileExists(.txtDataFile.text) Then Set isDNASource = Fsysl. OpenTextFile(.txtDataFile.text) 'open input Set Outstreaml = Fsysl. CreateTextFile(.txtWklName.text) 'creat worklist 'If second time through the file, skip an extra line to go back through 'and do the evens isDNASource.SkipLine Iftestskipline > 1 Then isDNASource . SkipLine End If 'Loop to do the parsing on the input file Do While Not isDNASource.AtEndOfStream strLineTextl = isDNASource.ReadLine For k = 1 To Len(strLineTextl) intDelimiterl = InStr(j, strLineTextl, ",") If intDelimiterl = 0 Then arrVall(i) = Mid$(strLineTextl, j) Else arrVall(i) = Mid$(strLineTextl, j, intDelimiterl - j) j = intDelimiterl + 1 i = i + l End If Next i = l j = l intTipcount = intTipcount + 1 DNAId = arrVall(4) 'DNA Id strDestWellld = arrVall(5) & arrVall(6) 'Dest Well id strWellnum = WellToNum384(strDestWellId) 'Convert to a well number 'Debug.Print strWellnum Set fso = CreateObject("Scripting.FileSystemObject") Set f = fso.GetFolder("C:\Gemini\Output") Set fc = fFiles 'Loop that takes the DNA Id from above and goes through all files 'in the Output directory looking for the match of the id to see 'which well of the source plate to take the sample out of. For Each fl In fc s = fl.Name Filename = "C:\Gemini\Output\" & s movefilename = "C:\Gemini\OutputProcessed\" & s Set isDNASearch = Fsys2.OpenTextFile("C:\Gemini\Output\" & s) isDNASearch.SkipLine Do While Not isDNASearch.AtEndOfStream And searcliDNAId <> DNAId strLineText2 = isDNASearch.ReadLine For k = 1 To Len(strLineText2) intDelimiterl = InStr(j, strLineText2, ",") If intDelimiterl = 0 Then aπVal2(i) = Mid$(strLineText2, j) Else aπVal2(i) = Mid$(strLineText2, j, intDelimiterl - j) j = intDelimiterl + 1 i = i + l End If Next i = l j = l searchDNAId = arrVal2(l) 'Debug.Print searchDNAId, DNAId If searchDNAId = DNAId Then strSourceWellld = arrVal2(2) strSourceld = aπVal2(3) 'isDNASource. SkipLine End If Loop If searchDNAId o DNAId And isDNASearch.AtEndOfStream = Trae Then isDNASearch.Close 'isDNASource.SkipLine Else isDNASearch.Close End If
Next isDNASource. SkipLine
If searchDNAId o DNAId Then Outstreanώ. WriteLine ("DNA Id's Not Found: " & vbCrLf & DNAId) GoTo Skip Else 'Contents of Worklist 'If searchDNAId o DNAId Then 'Set Outstream2 = Fsys3.CreateTextFile("C:\Gemini\Logfiles\DNAIdLog.txt") 'Outstream2.WriteLine ("DNA Id's Not Found: " & vbCrLf & DNAId) 'GoTo Skip 'Else Outstreaml. WriteLine ("A;;" & sfrSourceld & ";" & .cmbSourcePlate.text & ";" & strSourceWellId & _ ";" & DNAId & ";" & .txtVol.text & ";;;") Outstreaml. WriteLine ("D;D" & CStr(intPlatecount) & ";;" & .cmbDestPlate.text & ";" & strWellnum & _ ";;" & .txtVol.text & ";;;") Outstreaml .WriteLine ("A;D" & CStr(intPlatecount) & ";;" & .cmbDestPlate.text & ";" & strWellnum & _ Outstreaml. WriteLine ("D;D" & CStr(intPlatecount) & ";;" & .cmbDestPlate.text & ";" & strWellnum & _ ";;3...") Outstreaml .WriteLine ("A;D" & CStr(intPlatecount) & ";;" & .cmbDestPlate.text & ";" & strWellnum & _ Outstreaml. WriteLine ("D;D" & CStr(intPlatecount) & ";;" & .cmbDestPlate.text & ";" & strWellnum & _ Outstreaml. WriteLine ("A;D" & CStr(intPlatecount) & ";;" & .cmbDestPlate.text & ";" & strWellnum & _ Outstreaml. WriteLine ("D;D" & CStr(intPlatecount) & ";;" & .cmbDestPlate.text & ";" & strWellnum & _ "..3;;;") Outstreaml. WriteLine ("W;") intPipetteSteps = intPipetteSteps + 1 If intPipetteSteps = 8 Or isDNASource. AtEndOfStream Then Outstreaml .WriteLine ("B;Aspirate(255,Decon,290,290,290,290,290,290,290,290,0,0,0,0,3,0,l,0108~l,0);") Outstreaml .WriteLine ("B;StartTimer(l);") Outstreaml .WriteLine ("B;WaitTimer(l , 10);") Outstream 1.WriteLine ("B;Wash(255,l,2,l,0,10,500,10,500,10,70,30,2,0,1000);") Outstream 1 riteLine ("B;Wash(255,l,2,l,0,5,500,10,500,10,70,30,2,0,1000);") Outstream 1.WriteLine ("B;Wash(255,l,2,l,0,5,500,10,500,10,70,30,2,0,1000);") intPipetteSteps = 0 End If If intTipcount = 8 Then intTipcount = 0 End If End If Skip: If searchDNAId <> DNAId Then noidcheck = 1 End If Loop End If 'MsgBox ("Worklist created! The path of the file is: " & .txtWklName.text) 'If evens are done, quit, if not then go back to "Start" and do them. If g_boolEvens_Done = False Then g_boolEvens_Done = Trae 'isDNASource.Close GoTo Start End If End With If noidcheck = 1 Then MsgBox ("Application Terminated!" & vbCrLf & "DNA Ids missing! See DNAIdLog, fix files, and rerun.") End Else End If
'Small loop to move all processed output files Set fso = CreateObject("Scripting.FileSystemObject") Set f = fso.GetFolder("C:\Gemini\Output") Set fc = f. Files For Each fl In fc s = fl .Name Filename = "C:\Gemini\Output\" & s movefilename = "C:\Gemini\OutputProcessed\" & s Fsys2.MoveFile Filename, movefilename Next
End Sub MoveExistFile Form in txt
Private Sub btnBrowse_Click()
'open explorer
CommonDialogl. Action = 1
CommonDialog2 ction = 1
'display file chosen in the Data File text box
DNATrans.txtDataFile.text = CommonDialogl.FileName
DNATrans.txtWklName.text = Mid$(txtDataFile.text, 1, Len(txtDataFile.text) - 4) &
".gwl"
End Sub
Private Sub btnCancel_Click() End End Sub Private Sub btnMoveFile_Click() Module4.btnMoveFile_Click
End Sub
Private Sub FornALoadQ Module3. Initialize Module4.btnMoveFile_Click End
End Sub
Module 3 Move File
Public Const strlni = "Move File.ini"
Function GetParameter(strTag As String, strFile As String) As String
Dim strPath As String
Dim strTemp As String
Dim Instream As TextStream
Dim Fsys As New FileSystemObject
Dim position As Long
Dim endpos As Long
Dim text As String
Dim strAUText As String strPath = App.Path & "\" & strFile
If Fsys.FileExists(strPath) Then Set Instream = Fsys.OpenTextFile(strPath) strAUText = Instream.ReadAll position = InStr(l, strAUText, strTag) endpos = InStr(position, strAUText, Chr(13)) position = position + Len(strTag) + 2 text = Mid$ (strAUText, position, (endpos - position)) GetParameter = text
End If
End Function
Sub frιitialize()
Dim DNAlist As String Dim Worklist As String Dim DefaultWorklist As String Dim SourceType As String Dim DestType As String Dim Volume As String
With MoveFile Worklist = GetParameter("Worklist File", strlni) .txtWklName = Worklist DefaultWorklist = GetParameter("Default Worklist File", strlni) .txtDefaultWklName = DefaultWorklist
End With End Sub
INI Move File Module 4
Public Sub btnMoveFile_Click()
Dim Fsysl As New FileSystemObject Dim Instreaml As TextStream With MoveFile
Set Instreaml = Fsysl . OpenTextFile(.txtDefaultWklName.text) Fsysl. Cop yFile .txtDefaultWklName.text, .txtWklName.text Instreaml. Close
End With
End Sub
Final OutputConverter Form
Private Sub btnBrowse_Click()
'open explorer
CommonDialog 1. Action = 1
'display file chosen in the Data File text box
Forml.txtDataFile.text = CommonDialogl.FileName
Fonnl.txtOutFile.text = Mid$(txtDataFile.text, 1, Len(txtDataFile.text) - 4) &
"outputFile.csv"
End Sub
Private Sub btnCancel_Click() End End Sub
Private Sub btnOutputFileGen_Click() 'automatically clicks this button Modulel .btnOutputFileGen_Click
End Sub
Private Sub FornALoadQ Module3.Initialize 'automatically loads this form Modulel .btnOutputFileGen_Click End
End Sub
Module 3 INIOutfileConv
Public Const strhii = "OutFile Converter.ini"
Function GetParameter(strTag As String, strFile As String) As String 'Function that used to set the files used in the conversion. Now it scans the 'directory and looks for files and converts them. So this function only sets the 'date.
Dim strPath As String
Dim strTemp As String
Dim Instream As TextStream
Dim Fsys As New FileSystemObject
Dim position As Long
Dim endpos As Long
Dim text As String
Dim strAUText As String strPath = App.Path & "\" & strFile
If Fsys.FileExists(strPath) Then Set Instream = Fsys.OpenTextFile(strPath) strAUText = Instream.ReadAll position = InStr(l, strAUText, strTag) endpos = InStr(position, strAUText, Chr(13)) position = position + Len(strTag) + 2 text = Mid$(strAUText, position, (endpos - position)) GetParameter = text
End If
End Function
Sub InitializeO
Dim OutputFile As String Dim OutputConverted As String Dim OutputFileMoved As String
With Forml OutputConverted = GetParameter("Output File", strlni) '.txtOutFile = OutputConverted Dim mydate mydate = Format(Date, "mmddyy") 'OutputFileMoved = GetParameter("Output Moved", strlni) '.txtOutFileMoved = OutputFileMoved & mydate & ".csv"
End With
End Sub
Module2 Conv nt_To_WellID
'Function: Convert_Integer_to_Well
'Puφose: Converts well of type integer (1) to well of type alphanumeric (Al)
'Comments:
Public Function ConvertJ_nteger_to_Well(intWell As Integer, strPlateFormat As String) As String
Dim strRow As String
Dim intCol As Integer If strPlateFormat = "96" Then Select Case intWell Case Is = 0 MsgBox "Invalid well number. Get a real well." Case 1 To 8 intCol = 1 Case 9 To 16 intCol = 2 Case 17 To 24 intCol = 3 Case 25 To 32 intCol = 4 Case 33 To 40 intCol = 5 Case 41 To 48 intCol = 6 Case 49 To 56 intCol = 7 Case 57 To 64 intCol = 8 Case 65 To 72 intCol = 9 Case 73 To 80 intCol = 10 Case 81 To 88 intCol = 11 Case 89 To 96 intCol = 12 End Select
Select Case intWell Case 1, 9, 17, 25, 33, 41, 49, 57, 65, 73, 81, 89 strRow = "A" Case 2, 10, 18, 26, 34, 42, 50, 58, 66, 74, 82, 90 strRow = "B" Case 3, 11, 19, 27, 35, 43, 51, 59, 67, 75, 83, 91 strRow = "C" Case 4, 12, 20, 28, 36, 44, 52, 60, 68, 76, 84, 92 strRow = "D" Case 5, 13, 21, 29, 37, 45, 53, 61, 69, 77, 85, 93 strRow = "E" Case 6, 14, 22, 30, 38, 46, 54, 62, 70, 78, 86, 94 strRow = "F" Case 7, 15, 23, 31, 39, 47, 55, 63, 71, 79, 87, 95 strRow = "G" Case 8, 16, 24, 32, 40, 48, 56, 64, 72, 80, 88, 96 strRow = "H" End Select
Elself strPlateFormat = "384" Then Select Case intWell Case 1 To 16 intCol = 1 Case 17 To 32 intCol = 2 Case 33 To 48 intCol = 3 Case 49 To 64 intCol = 4 Case 65 To 80 intCol = 5 Case 81 To 96 intCol = 6 Case 97 To 112 intCol = 7 Case 113 To 128 intCol = 8 Case 129 To 144 intCol = 9 Case 145 To 160 intCol = 10 Case 161 To 176 intCol = 11 Case 177 To 192 I intCol = 12 Case 193 To 208 intCol = 13 Case 209 To 224 intCol = 14 Case 225 To 240 intCol = 15 Case 241 To 256 intCol = 16 Case 257 To 272 intCol = 17 Case 273 To 288 intCol = 18 Case 289 To 304 intCol = 19 Case 305 To 320 intCol = 20 Case 321 To 336 intCol = 21 Case 337 To 352 intCol = 22 Case 353 To 368 intCol = 23 Case 369 To 384 intCol = 24 End Select
Select Case intWell Case 1, 17, 33, 49, 65, 81, 97, 113, 129, 145, 161, 177, 193, 209, 225, 241, 257,
273, 289, 305, 321, 337, 353, 369 strRow = "A" Case 2, 18, 34, 50, 66, 82, 98, 114, 130, 146, 162, 178, 194, 210, 226, 242, 258,
274, 290, 306, 322, 338, 354, 370 strRow = "B" Case 3, 19, 35, 51, 67, 83, 99, 115, 131, 147, 163, 179, 195, 211, 227, 243, 259,
275, 291, 307, 323, 339, 355, 371 strRow = "C" Case 4, 20, 36, 52, 68, 84, 100, 116, 132, 148, 164, 180, 196, 212, 228, 244, 260,
276, 292, 308, 324, 340, 356, 372 strRow = "D" Case 5, 21, 37, 53, 69, 85, 101, 117, 133, 149, 165, 181, 197, 213, 229, 245, 261,
277, 293, 309, 325, 341, 357, 373 strRow = "E" Case 6, 22, 38, 54, 70, 86, 102, 118, 134, 150, 166, 182, 198, 214, 230, 246, 262,
278, 294, 310, 326, 342, 358, 374 strRow = "F" Case 7, 23, 39, 55, 71, 87, 103, 119, 135, 151, 167, 183, 199, 215, 231, 247, 263,
279, 295, 311, 327, 343, 359, 375 strRow = "G" Case 8, 24, 40, 56, 72, 88, 104, 120, 136, 152, 168, 184, 200, 216, 232, 248, 264,
280, 296, 312, 328, 344, 360, 376 strRow = "H" Case 9, 25, 41, 57, 73, 89, 105, 121, 137, 153, 169, 185, 201, 217, 233, 249, 265,
281, 297, 313, 329, 345, 361, 377 strRow = "I" Case 10, 26, 42, 58, 74, 90, 106, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266,
282, 298, 314, 330, 346, 362, 378 strRow = "J" Case 11, 27, 43, 59, 75, 91, 107, 123, 139, 155, 171, 187, 203, 219, 235, 251, 267,
283, 299, 315, 331, 347, 363, 379 strRow = "K" Case 12, 28, 44, 60, 76, 92, 108, 124, 140, 156, 172, 188, 204, 220, 236, 252, 268, 284, 300, 316, 332, 348, 364, 380 strRow = "L" Case 13, 29, 45, 61, 77, 93, 109, 125, 141, 157, 173, 189, 205, 221, 237, 253, 269, 285, 301, 317, 333, 349, 365, 381 strRow = "M" Case 14, 30, 46, 62, 78, 94, 110, 126, 142, 158, 174, 190, 206, 222, 238, 254, 270,
286, 302, 318, 334, 350, 366, 382 strRow = "N" Case 15, 31, 47, 63, 79, 95, 111, 127, 143, 159, 175, 191, 207, 223, 239, 255, 271,
287, 303, 319, 335, 351, 367, 383 strRow = "O" Case 16, 32, 48, 64, 80, 96, 112, 128, 144, 160, 176, 192, 208, 224, 240, 256, 272,
288, 304, 320, 336, 352, 368, 384 strRow = "P" End Select End If Convert_Integer_to_Well = strRow & intCol End Function
Module 1 (OutFileConverter)
'Module to parse the original output file and put it in a readable format, changing the 'well id to a string
Public Sub btnOutputFileGen_Click()
Dim i, j, k, intDelimiterl, intDelimiter2 As Integer
Dim strPlatenum, strWellnum, strDecider, strLineText As String
Dim sfrSourcelD, strDNAID As String
Dim intDestlD, intDestWellED, intSourceWelllD, intDNAID As Integer
Dim strWelUD, strDestID λs String
Dim aπVall(20) As String
Dim Fsysl As New FileSystemObject Dim Fsys2 As New FileSystemObject Dim Fsys3 As New FileSystemObject Dim Instreaml As TextStream Dim Outstream As TextStream Dim InFile, OutFile As File
j = l i = l k = l
With Foπnl
Dim fso, f, fl, fc Dim s(10) As String Dim t As Integer Dim name As String Dim strTemp As String Dim intWellld As Integer Dim Filename 1, Filename2 As String Dim movefilenamel, movefilename2 As String Set fso = CreateObject("Scripting.FileSystemObject") Set f = fso.GetFolder("C:\Gemini\Output") Set fc = f.Files For Each fl In fc name = fl .name If InStr(l, name, "Output") = 0 Then s(t) = fl .name t = t + l End If Next Ift = 0 Then End End If
Filenamel = ("C:\Gemini\Output\" & s(0)) StrDestID = Mid$(s(0), 1 , Len(s(0)) - 4) ' movefilenamel = "C:\Gemini\OutputProcessed\" & s(0) Set Instreaml = Fsysl. OpenTextFile(Filenamel) Dim newFileName As String newFileName = "C:\Gemini\Output\Output" & strDestID & ".csv" Set Outstream = Fsys3.CreateTextFile(newFileName) Instreaml .SkipLine Outsfream.WriteLine ("DNA ID," & "DestWelllD," & "Dest ID," & "SourceWelllD," & "Sourceld") Outsfream.WriteLine
Do While Not Instreaml. AtEndOfStream As the file is read into the program, it is parsed to get each of the 'source and destination parameters. strLineText = Instream l.ReadLine For k = 1 To Len(strLineText) intDelimiterl = InStr j, strLineText, ",") If intDelimiterl = 0 Then arrVall(i) = Mid$(strLineText, j) Else aπVall(i) = Mid$(strLineText, j, intDelimiterl - j) j = intDelimiterl + 1 i = i + l End If Next i = l j = l 'If/then to make sure there are no extraneous lines in the output file. 'If there is the user needs to open the output and correct it and then ran again. IfaπVall(l) = "" Then MsgBox ("There is a line missing in the output file. Please fix and run this line again!") Outstream.Close Fsys3.DeleteFile newFileName, Trae End Else intWellld = CInt(aπVall(l)) End If 'parameter setting from the parse loop strTemp = Convert_Integer_to_Well(intWellId, "384") intDestWellED = strTemp strDNAID - arτVall(6) sfrSourcelD = (arrVall(9)) intSourceWelllD = aιrVall(5) oop to write to the final output file. If strDNAID = "" Then Else Outsfream.WriteLine (strDNAID & "," & intDestWelllD & "," & strDestID & "," & intSourceWelllD & "," & sfrSourcelD) End If Loop
End With
'Close the file and move to the processed directory.
Instreaml. Close
Fsysl.MoveFile Filename 1, movefilenamel
End Sub Compare Files Module 2
Public Sub btnCheckFiles_Click()
Dim i, j, k, intDelimiterl, intDelimiter2 As Integer
Dim strDecider, strLineTextl, strLineText2 As String
Dim DNAId As String
Dim arrVall(lO) As String
Dim aπVal2(10) As String
Dim intCounter As Integer
Dim Fsysl As New FileSystemObject
Dim Fsys2 As New FileSystemObject
Dim Fsys3 As New FileSystemObject
Dim ishiputFile As TextStream
Dim isOutputFile As TextStream
Dim Outstream As TextStream
Dim appWorld As Excel.Apphcation
Dim wb World As Excel. Workbook
j = l i = l k = l With Forml 'These next set of commands open Excel, if not open already. Then takes 'the file specified in the ini file and sorts it according to customer 'request. On Error Resume Next 'ignore eπors Set appWorld = GetObject(, "Excel.Apphcation") 'look for a running copy of
Excel If Eπ.Number <> 0 Then 'If Excel is not running then Set appWorld = CreateObject("Excel.Application") 'ran it End If Eπ.Clear ' Clear Err object in case eπor occuπed. 'On Error GoTo 0 'Resume normal eπor processing Set wb World = app World. Workbooks.Open(.txtlnputFile.text) 'Excel mods Columns("E:E"). Select Selection.TextToColumns Destination:=Range("El "), DataType:=xlFixedWidth, FieldInfo:=Array(Array(0, 2), Array(l, 2)) Range("El").Select Columns("A:F"). Select Selection.Sort Keyl :=Range("F:F"), Orderl :=xlAscending, Header:=xlGuess, OrderCustom:=l, MatchCase:=False, Orientation:=xlTopToBottom Selection.Sort Keyl:=Range("Fl"), Orderl :=xl Ascending, Header:=xlGuess, OrderCustom:=l, MatchCase:=False, Orientation:=xlTopToBottom wbWorld.Save wbWorld.Close False Set wb World = appWorld.Workbooks.Open(.txtlnputFile.text) Columns("A:F").Select Selection.Sort Keyl :=Range("F:F"), Orderl :=xlAscending, Header:=xlGuess, OrderCustom:=l, MatchCase:=False, Orientation:=xlTopToBottom - Seleetion.Sort Keyl :=Range("Fl"), Orderl :=xlAscending, Header:=xlGuess, _ OrderCustom:=l, MatchCase:=False, Orientation:=xlTopToBottom wbWorld.Save wbWorld.Close False
Start: Set Outstream = Fsys3.CreateTextFile(.txtLogFile.text) If Fsysl .FileExists(.txtlnputFile.text) Then Set isInputFile = Fsysl. OpenTextFile(.txtlnputFile.text) 'open input isInputFile.SkipLine 'Loop to do the parsing on the input file Do While Not isInputFile.AtEndOfStream strLineTextl = isInputFile.ReadLine Fjpr k = 1 To Len(strLineTextl) ϊ intDelimiterl = InStr(j, strLineTextl, ",") - ' If intDelimiterl = 0 Then arrVall(i) = Mid$(strLineTextl, j) Else aπVall(i) = Mid$(strLineTextl, j, intDelimiterl - j) j = intDelimiterl + 1 i = i + l End If Next i = l
DNAId = aπVall(4) 'DNA Id strDestWellld = aπVall(5) & arτVall(6) 'Dest Well id 'set output file Dim fso, f, fl , fc Dim s( 10) As String j = ι searchWellld = arrVal2(2) 'Debug.Print searchDNAId, DNAId If searchWellld = strDestWellld Then strDNAId = aπVal2(l) If strDNAId = DNAId Then Else Outsfream.WriteLine ("Well Number " & strDestWellld & " has a confliction.") Outstream.WriteLine ("Input File records " & strDestWellld & " with DNAId: " & DNAId) Outstream.WriteLine ("Output File records: " & searchWellld & " with DNAId: " & strDNAId) End If End If Loop If searchWellld <> strDestWellld And isOutputFile. AtEndOfStream = True
Then isOutputFile.Close Else isOutputFile.Close End If Loop End If
End With isInputFile. Close isOutputFile.Close End Sub
Compare Files Modulel (IniForFilePaths)
Public Const strlni = "Compare Files.ini"
Function GetParameter(strTag As String, strFile As String) As String
'Small function to parse the ini file listed above and get the parameters needed
'for the application.
Dim strPath As String
Dim strTemp As String
Dim Instream As TextStream
Dim Fsys As New FileSystemObject
Dim position As Long
Dim endpos As Long
Dim text As String
Dim strAUText As String strPath = App.Path & "\" & strFile
If Fsys.FileExists(strPath) Then Set Instream = Fsys.OpenTextFile(strPath) strAUText = Instream.ReadAU position = InStr(l, strAUText, strTag) endpos = InStr(position, strAUText, Chr(13)) position = position + Len(strTag) + 2 text = Mid$(strAUText, position, (endpos - position)) GetParameter = text
End If
End Function
Sub Initialize()
Dim InputFile As String Dim LogFile As String
With Form 1
'With loop to go through and get the parameters needed from the parsing function. 'Each parameter listed below, must match the parameters in the brackets in the 'ini file. InputFile = GetParameter("Input File", strlni) .txtlnputFile = InputFile LogFile = GetParameter("Log File", strlni) .txtLogFile = LogFile
End With
End Sub
Compare Form
Private Sub btnBrowsel_Click()
'open explorer
CommonDialogl. Action = 1
'display file chosen in the Data File text box
Form 1. txtlnputFile. text = CommonDialogl.FileName
End Sub
Private Sub btnBrowse2_Click()
'open explorer
CommonDialog2 Action = 1
'display file chosen in the Data File text box
Forml.txtOutputFile.text = CommonDialog2. FileName
End Sub
Private Sub btnBrowse3_Click()
'open explorer
CommonDialog3. Action = 1
'display file chosen in the Data File text box
Forml.txtLogFile.text = CommonDialog3. FileName
End Sub
Private Sub btnCancel_Click() End End Sub Private Sub btnCheckFiles_Click() Module2.btnCheckFiles _Click
End Sub
Private Sub Form_Load() Modulel. Initialize Module2.btnCheckFiles_Click End
End Sub

Claims

WHAT IS CLAIMED IS:
1. A system for performing an assay on a biological sample, comprising: (a) a central controller programmed to: (i) exchange information about the biological sample with an outside system or database; and (ii) exchange information about the biological sample with one or more modules of the system; (b) a sample transfer module for transferring a portion of the sample to a first container; (c) a nucleic acid extraction module for extracting nucleic acids from cells within the portion and for transferring the portion from the first container to a second container; (d) a nucleic acid measurement module for measuring the concentration of nucleic acids in the portion; (e) a PCR preparation module for adding polymerase chain reaction (PCR) reaction materials to the portion; (f) a thermocyling module for amplifying a target sequence and extending a primer in the portion; (g) a primer extension preparation module for adding primer extension reaction materials to the portion; (h) a mass spectrometry preparation module for removing a sample of the portion from the second container to a support for analysis by mass spectrometry; and (i) a mass spectrometry module for analyzing the sample.
2. The system of claim 1, further comprising linking software that enables the central controller to communicate with at least one other module in the system.
3. The system of claim 1, further comprising a plate editor module that provides sample information to the PCR preparation module.
4. The system of claim 1, further comprising: (j) a transport module comprising one or more robotic arms or tracks to fransport a biological sample, or portion thereof, between at least two module of (a) to (i), and arranged to receive information from and transmit information to the central controller.
5. The system of claim 1, further comprising: (j) a detection module for detecting the presence of a sample and monitoring the progress of the sample through the system, and arranged to receive information from and transmit information to the central controller.
6. The system of claim 1, wherein the PCR preparation system includes a primer set selected from the group consisting of: SEQ ID NOS:l, 2, and 3; SEQ ID NOS:4, 5 and 6; SEQ ID NOS:7, 8, and 9; and SEQ ED NOS:10, 11, and 12; SEQ ID NOS:13, 14, and 15; SEQ ID NOS: 16, 17 and 18; SEQ ED NOS:19, 20, and 21; and SEQ ID NOS:22, 23 and 24; SEQ ID NOS:25, 26, and 27; SEQ ED NOS:28, 29, and 30; SEQ ID NOS:31, 32, and 33; SEQ ID NOS:34, 35 and 36; SEQ ID NOS:37, 38 and 39; SEQ ID NOS:40, 41 and 42; SEQ ID NOS:43, 44 and 45; SEQ ID NOS:46, 47 and 48; SEQ ED NOS:49, 50 and 51; SEQ ID NOS:52, 53 and 54; SEQ ID NOS: 55, 56 and 57; SEQ ID NOS:58, 59 and 60; SEQ ID
NOS: 61, 62, and 63 SEQ ID NOS 64, 65, and 66; SEQ ID NOS: 67, 68, and 69; SEQ ID NOS: 70, 71, and 72 SEQ ID NOS 73, 74, and 75; SEQ ID NOS: 76, 77, and 78; SEQ ID NOS: 79, 80, and 81 SEQ ID NOS 82, 83, and 84; SEQ ID NOS: 85, 86, and 87; SEQ ID NOS: 88, 89, and 90 SEQ ID NOS 91, 92, and 93; SEQ ID NOS: 94, 95, and 96; SEQ ID NOS: 97, 98, and 99 SEQ ID NOS 100, 101, and 102; SEQ ID NOS: 103, 104, and 105; SEQ ED NOS: 106, 107, and 108; SEQ ID NOS: 109, 110, and 111; SEQ ED NOS: 112, 113, and 114; SEQ ID NOS: 115, 116, and 117; SEQ ID NOS: 118, 119, and 120; SEQ ID NOS: 121, 122, and 123; SEQ ID NOS: 124, 125, and 126; SEQ ID NOS: 127, 128, and 129; SEQ ED NOS: 130, 131, and 132; SEQ ED NOS: 133, 134, and 135; SEQ ID NOS: 136, 137, and 138; SEQ ID NOS: 139, 140, and 141; SEQ ID NOS: 142, 143, and 144; SEQ ID NOS: 145, 146, and 147; SEQ ID NOS: 148, 149, and 150; SEQ ID NOS: 151, 152, and 153; SEQ ED NOS: 154, 155, and 156; SEQ ID NOS: 157, 158, and 159; SEQ ED NOS: 160, 161, and 162; SEQ ID NOS: 163, 164, and 165; SEQ ID NOS: 166, 167, and 168; SEQ ID NOS: 169, 170, and 171; SEQ ED NOS: 172, 173, and 174; SEQ ID NOS: 175, 176, and 177; SEQ ID NOS: 178, 179, and 180; SEQ ID NOS: 181, 182, and 183; SEQ ED NOS: 184, 185, and 186; SEQ ED NOS: 187, 188, and 189; SEQ ED NOS: 190, 191, and 192; SEQ ED NOS: 193, 194, and 195; S£Q ID NOS: 196, 197, and 198; SEQ ID NOS: 199, 200, and 201; SEQ ED NOS: 202, 203, and 204; SEQ ID NOS: 205, 206, and 207; SEQ ID NOS: 208, 209, and 210; SEQ ID NOS: 211, 212, and 213; SEQ ID NOS: 214, 215, and 216; SEQ ID NOS: 217, 218, and 219; SEQ ED NOS: 220, 221, and 222; SEQ ED NOS: 223, 224, and 225; SEQ ID NOS: 226, 227, and 228; SEQ ID NOS: 229, 230, and 231; SEQ ED NOS: 232, 233, and 234; SEQ ID NOS: 235, 236, and 237; SEQ ED NOS: 238, 239, and 240; SEQ ED NOS: 241, 242, and 243; SEQ ID NOS: 244, 245, and 246; SEQ ED NOS: 247, 248, and 249; SEQ ID NOS: 250, 251, and 252; SEQ ED NOS: 253, 254, and 255; SEQ ID NOS: 256, 257, and 258; SEQ ID NOS: 259, 260, and 261; SEQ ID NOS: 262, 263, and 264; SEQ ID NOS: 265, 266, and 267; SEQ ID NOS: 268, 269, and 270; SEQ ID NOS: 271, 272, and 273; SEQ ED NOS: 274, 275, and 276; SEQ ED NOS: 277, 278, and 279; SEQ ID NOS: 280, 281, and 282; SEQ DD NOS: 283, 284, and 285; SEQ ID NOS: 286, 287, and 288; SEQ ID NOS: 289, 290, and 291; SEQ ID NOS: 292, 293, and 294; SEQ ID NOS: 295, 296, and 297; SEQ ID NOS: 298, 299, and 300; SEQ ID NOS: 301, 302, and 303; SEQ ID NOS: 304, 305, and 306; SEQ ID NOS: 307, 308, and 309; SEQ ED NOS: 310, 311, and 312; SEQ ID NOS: 313, 314, and 315; SEQ ID NOS: 316, 317, and 318; SEQ ID NOS: 319, 320, and 321; SEQ ID NOS: 322, 323, and 324; SEQ ID NOS: 325, 326, and 327; SEQ ID NOS: 328, 329, and 330; SEQ ED NOS: 331, 332, and 333; SEQ ID NOS: 334, 335, and 336; SEQ ID NOS: 337, 338, and 339; SEQ ED NOS: 340, 341, and 342; SEQ ED NOS: 343, 344, and 345; SEQ ED NOS: 346, 347, and 348; SEQ ID NOS: 349, 350, and 351; SEQ ID NOS: 352, 353, and 354; SEQ ID NOS: 355, 356, and 357; SEQ ID NOS: 358, 359, and 360; SEQ ID NOS: 361, 362, and 363; SEQ ID NOS: 364, 365, and 366; SEQ ID NOS: 367, 368, and 369; SEQ ED NOS: 370, 371, and 372; SEQ ED NOS: 373, 374, and 375; SEQ DD NOS: 376, 377, and 378; SEQ DD NOS: 379, 380, and 381; SEQ DD NOS: 382, 383, and 384; SEQ ED NOS: 385, 386, and 387; SEQ ID NOS: 388, 389, and 390; SEQ ID NOS: 391, 392, and 393; SEQ E) NOS: 394, 395, and 396; SEQ ID NOS: 397, 398, and 399; SEQ DD NOS: 400, 401, and 402; SEQ ED NOS: 403, 404, and 405; SEQ DD NOS: 406, 407, and 408; SEQ ED NOS: 409, 410, and 411; SEQ ED NOS: 412, 413, and 414; SEQ DD NOS: 415, 416, and 417; SEQ DD NOS: 418, 419, and 420; SEQ DD NOS: 421, 422, and 423; SEQ DD NOS: 424, 425, and 426; SEQ DD NOS: 427, 428, and 429; SEQ ED NOS: 430, 431, and 432; SEQ DD NOS: 433, 434, and 435; SEQ ID NOS: 436, 437, and 438; SEQ DO NOS: 439, 440, and 441; SEQ DD NOS: 442, 443, and 444; SEQ ID NOS: 445, 446, and 447; SEQ ED NOS: 448, 449, and 450; SEQ DD NOS: 451, 452, and 453; SEQ ED NOS: 454, 455, and 456; SEQ ID NOS: 457, 458, and 459; SEQ DD NOS: 460, 461, and 462; SEQ DD NOS: 463, 464, and 465; SEQ DD NOS: 466, 467, and 468; SEQ DD NOS: 469, 470, and 471; SEQ DD NOS: 472, 473, and 474; SEQ ED NOS: 475, 476, and 477; SEQ DD NOS: 478, 479, and 480; SEQ DD NOS: 481, 482, and 483; SEQ DD NOS: 484, 485, and 486; SEQ DD NOS: 487, 488, and 489; SEQ DD NOS: 490, 491, and 492; SEQ ID NOS: 493, 494, and 495; SEQ ED NOS: 496, 497, and 498; SEQ ED NOS: 499, 500, and 501; and SEQ ED NOS: 502, 503, and 504, each primer set including two amplification primers and one detection extension primer.
7. The system of claim 1, wherein the central controller is a personal computer system.
8. The system of claim 1, wherein the central controller includes linking software.
9. The system of claim 1, wherein the sample transfer module includes a pipetting robot.
10. The system of claim 1, wherein the nucleic acids measurement module includes an ultraviolet light spectrophotometer or a fluorometer.
11. The system of claim 1 , wherein the PCR preparation module includes a pipetting robot.
12. The system of claim 1, wherein the thermocycling module includes a thermocyler.
13. The system of claim 1, further comprising a computer-readable medium comprising one or more programs for instructing a given module.
14. The system of claim 1, wherein the support is a chip or microwell.
15. A method of performing a diagnostic assay on a biological sample, the method comprising: (a) perfonning on a biological sample an assay using a clinical assay system, wherein the assay comprises mass spectrometry analysis of a target nucleic acid; and (b) automatically reporting information about the assay from a central controller of the clinical assay system to an outside system or database accessible by at least one health care provider or at least one third party payor.
16. The method of claim 15, wherein the clinical assay system includes at least one component selected from the group consisting of: a central controller, a sample transfer module, a nucleic acid extraction module, a nucleic acid measurement module, a PCR preparation module, a thermocyling module, a primer extension preparation module, a mass spectrometry preparation module, and a mass spectrometry module.
17. A method of performing a diagnostic assay on a biological sample, the method comprising: (a) receiving a biological sample, generating information about the biological sample, and transmitting the information to a central controller; (b) transferring a portion of the biological sample to a first container; (c) extracting nucleic acids from cells within the portion and transferring the portion to a second container; (d) measuring the concentration of extracted nucleic acids in the portion; (e) adding polymerase chain reaction (PCR) materials to the portion; (f) amplifying target nucleic acids in the portion; (g) adding primer extension reaction materials to the portion; (h) extending a detection extension primer in the portion; (i) transfeπing a sample of the portion from the second container to a support; (j) analyzing the sample and exporting data to the central controller using a mass spectrometry system; and (k) transmitting the data from the central controller to an output device, external system, or database.
18. The method of claim 17, wherein at steps (a) to (k) are performed automatically by an automated system.
19. The method of claim 18, wherein the automated system includes at least one component selected from the group consisting of: a central controller, a sample transfer module, a nucleic acid extraction module, a nucleic acid measurement module, a PCR preparation module, a thermocyling module, a primer extension preparation module, a mass spectrometry preparation module, and a mass spectrometry module.
20. The method of claim 17, wherein the diagnostic assay is an assay for detecting mutations in a gene.
21. The method of claim 20, wherein the gene is selected from the group consisting of: 5,10-Methylenetetrahydrofolate Reductase (MTFR); Coagulation Factor II; Coagulation Factor V; hemochromatosis (HFE); and a glucocerebrosidase (GC). fibroblast growth factor receptor 3; aspartoacylase; Glucocerebrosidase; Coagulation Factor VII; Fanconi Anemia, Complementation Group C (FANCC); inhibitor of kappa light polypeptide gene enhancer in b cells, kinase complex-associated protein; acid sphingomyelinase; hexosaminidase; angiotensin i-converting enzyme; adenylate cyclase 9; apolipoprotein A-1; apolipoprotein E; endothelial leukocyte adhesion molecule 1; fc fragment of IGG, low affinity Ea, receptor; fibrinogen beta chain;coagulation factor II, factor XIII; guanine nucleotide-binding protein beta-3; integrin, alpha-2, glycoprotein Ia/Iia; glycoprotein lb, platelet, alpha polypeptide; intercellular adhesion molecule 1; glycoprotein Ia IIa (a2), integrin, alpha-2; platelet glycoprotein lib, integrin, alpha-2b; glycoprotein Ilb/IIIa, integrin, beta-3;3-hydroxy-3- methylglutaryl-coa reductase; lymphocyte adhesion molecule 1 ; methylene tetrahydrofolate reductase; plasminogen activator inhibitor 1; platelet alpha-granule membrane protein; transforming growth factor-beta receptor, type III; thrombomodulin; tumor necrosis factor; vascular cell adhesion molecule; coagulation factor II receptor; glycoprotein VI, platelet; purinergic receptor P2Y,g protein-coupled, 1; purinergic receptor P2Y, G protein-coupled, 12; prostaglandin-endoperoxide synthase 1; prostaglandin-endoperoxide synthase 2; thromboxane A2 receptor, platelet; and thrombospondm I.
21. The method of claim 17, wherein the diagnostic assay is an assay for detecting a pathogen in the sample.
22. The method of claim 21, wherein the pathogen is a viras, bacterium, or fungus.
23. The method of claim 22, wherein the viras is a viras of the family Heφesviridae.
24. The method of claim 23, wherein the viras is of the genus cytomegaloviras (CMV).
25. An automated method for detecting mutations in a target gene, the method comprising: a) amplifying a target sequence using PCR and automatically performing a primer extension reaction using a set of three primers, each set of primers including two amplification primers and one detection extension primer; b) automatically transfeπing detection extension primers to a mass spectrometry device; and c) automatically determining the molecular weights of the detection extension primers by mass spectrometry following the primer extension reaction, wherein a change in the molecular weight of the extended primer, as compared to a control, indicates the presence of a mutation in the gene.
26. The method of claim 25, further comprising automatically transmitting information related to the presence of the mutation to a central controller.
27. The method of claim 25, wherein the gene is a 5,10-Methylenetetrahydrofolate Reductase (MTFR) gene, and the set of three primers is selected from the group consisting of: SEQ ED NOS: 1, 2, and 3; SEQ BD NOS: 4, 5 and 6; SEQ BD NOS: 7, 8, and 9; and SEQ ID NOS: 10, 11, and 12; each set of primers including two amplification primers and one detection extension primer.
28. The method of claim 25, wherein the gene is a Coagulation Factor II gene, and the set of three primers is selected from the group consisting of: SEQ DD NOS: 13, 14, and 15 and SEQ DD NOS: 16, 17 and 18; each primer set including two amplification primers and one detection extension primer.
29. The method of claim 25, wherein the gene is a Coagulation Factor Vgene, and the set of three primers is selected from the group consisting of: SEQ ED NOS: 19, 20, and 21 or SEQ DD NOS: 22, 23 and 24; each primer set including two amplification primers and one detection extension primer.
30. The method of claim 25, wherein the gene is a hemochromatosis (HFE) gene, and the set of three primers is selected from the group consisting of: SEQ ED NOS: 40, 41, and 42, SEQ ED NOS: 43, 44 and 45; SEQ ED NOS: 46, 47 and 48; SEQ ED NOS: 49, 50 and 51; SEQ ED NOS: 52, 53 and 54; or SEQ ED NOS: 55, 56 and 57; each set of primers including two amplification primers and one detection extension primer.
31. An automated method for detecting a pathogen in a biological sample, the method comprising: a) amplifying a target sequence using PCR and automatically performing a primer extension reaction using a set of three primers, each set of primers including two amplification primers and one detection extension primer; b) automatically transfeπing detection extension primers to a mass spectrometry device; and c) automatically determining the molecular weights of the detection extension primers by mass spectrometry following the primer extension reaction, wherein a change in the molecular weight of the extended primer, as compared to controls, indicates the presence presence of a pathogen in the sample.
32. The method of claim 31, wherein the confrols include an internal confrol for determining the amount of the pathogen in the sample.
33. The method of claim 31 , wherein the pathogen is cytomegaloviras (CMV), and the three primers are selected from the group consisting of: SEQ ED NOS: 25, 26, and 27; SEQ ED NOS: 28, 29 and 30; SEQ ED NOS: 31, 32, and 33; SEQ ED NOS: 34, 35, and 36; SEQ DD NOS: 37, 38, and 39; and SEQ ED NOS: 58, 59, and 60; each primer set including two amplification primers and one detection extension primer.
34. An isolated DNA selected from the group consisting of SEQ ED NOS.:l to 504.
35. A kit comprising: a primer set selected from the group consisting of: SEQ ED NOS:l, 2, and 3; SEQ ED NOS:4, 5 and 6; SEQ ED NOS:7, 8, and 9; and SEQ ED NOS:10, 11, and 12; SEQ ED NOS:13, 14, and 15; SEQ ED NOS: 16, 17 and 18; SEQ ED NOS:19, 20, and 21; and SEQ ED NOS:22, 23 and 24; SEQ ED NOS:25, 26, and 27; SEQ BD NOS:28, 29, and 30; SEQ ED NOS:31, 32, and 33; SEQ ED NOS:34, 35 and 36; SEQ ED NOS:37, 38 and 39; SEQ BD NOS:40, 41 and 42; SEQ ED NOS:43, 44 and 45; SEQ ED NOS:46, 47 and 48; SEQ ED NOS:49, 50 and 51; SEQ ED NOS:52, 53 and 54; SEQ BD NOS: 55, 56 and 57; SEQ ED NOS:58, 59 and 60; SEQ ED NOS: 61, 62, and 63; SEQ ED NOS: 64, 65, and 66; SEQ ED
NOS: 67, 68, and 69; SEQ ED NOS : 70, 71, and 72; SEQ ED NOS: 73, 74, and 75; SEQ ED NOS: 76, 77, and 78; SEQ DD NOS : 79, 80, and 81; SEQ ED NOS: 82, 83, and 84; SEQ ED NOS: 85, 86, and 87; SEQ ED NOS : 88, 89, and 90; SEQ BD NOS: 91, 92, and 93; SEQ ED NOS: 94, 95, and 96; SEQ ED NOS : 97, 98, and 99; SEQ ED NOS: 100, 101, and 102; SEQ ED NOS: 103, 104, and 105; SEQ ED NOS: 106, 107, and 108; SEQ ED NOS: 109, 110, and 111; SEQ DD NOS: 112, 113, and 114; SEQ DD NOS: 115, 116, and 117; SEQ DD NOS: 118, 119, and 120; SEQ DD NOS: 121, 122, and 123; SEQ DD NOS: 124, 125, and 126; SEQ ED NOS: 127, 128, and 129; SEQ ED NOS: 130, 131, and 132; SEQ ED NOS: 133, 134, and 135; SEQ ED NOS: 136, 137, and 138; SEQ DD NOS: 139, 140, and 141; SEQ BD NOS: 142, 143, and 144; SEQ ED NOS: 145, 146, and 147; SEQ BD NOS: 148, 149, and 150; SEQ ED NOS: 151, 152, and 153; SEQ ED NOS: 154, 155, and 156; SEQ BD NOS: 157, 158, and 159; SEQ ED NOS: 160, 161, and 162; SEQ BD NOS: 163, 164, and 165; SEQ ED NOS: 166, 167, and 168; SEQ ED NOS: 169, 170, and 171; SEQ ED NOS: 172, 173, and 174; SEQ ED NOS: 175, 176, and 177; SEQ ED NOS: 178, 179, and 180; SEQ ED NOS: 181, 182, and 183; SEQ ED NOS: 184, 185, and 186; SEQ BD NOS: 187, 188, and 189; SEQ ED NOS: 190, 191, and 192; SEQ ED NOS: 193, 194, and 195; SEQ ED NOS: 196, 197, and 198; SEQ DD NOS: 199, 200, and 201; SEQ ED NOS: 202, 203, and 204; SEQ BD NOS: 205, 206, and 207; SEQ ED NOS: 208, 209, and 210; SEQ ED NOS: 211, 212, and 213; SEQ ED NOS: 214, 215, and 216; SEQ ED NOS: 217, 218, and 219; SEQ BD NOS: 220, 221, and 222; SEQ ED NOS: 223, 224, and 225; SEQ ED NOS: 226, 227, and 228; SEQ ED NOS: 229, 230, and 231; SEQ BD NOS: 232, 233, and 234; SEQ ED NOS: 235, 236, and 237; SEQ ED NOS: 238, 239, and 240; SEQ ED NOS: 241, 242, and 243; SEQ BD NOS: 244, 245, and 246; SEQ DD NOS: 247, 248, and 249; SEQ DD NOS: 250, 251, and 252; SEQ DD NOS: 253, 254, and 255; SEQ DD NOS: 256, 257, and 258; SEQ ED NOS: 259, 260, and 261; SEQ BD NOS: 262, 263, and 264; SEQ ED NOS: 265, 266, and 267; SEQ ED NOS: 268, 269, and 270; SEQ ED NOS: 271, 272, and 273; SEQ ED NOS: 274, 275, and 276; SEQ ED NOS: 277, 278, and 279; SEQ ED NOS: 280, 281, and 282; SEQ ED NOS: 283, 284, and 285; SEQ ED NOS: 286, 287, and 288; SEQ ED NOS: 289, 290, and 291; SEQ ED NOS: 292, 293, and 294; SEQ ED NOS: 295, 296, and 297; SEQ ED NOS: 298, 299, and 300; SEQ DD NOS: 301, 302, and 303; SEQ DD NOS: 304, 305, and 306; SEQ DD NOS: 307, 308, and 309; SEQ ED NOS: 310, 311, and 312; SEQ DD NOS: 313, 314, and 315; SEQ DD NOS: 316, 317, and 318; SEQ BD NOS: 319, 320, and 321; SEQ ED NOS: 322, 323, and 324; SEQ DD NOS: 325, 326, and 327; SEQ DD NOS: 328, 329, and 330; SEQ ED NOS: 331, 332, and 333; SEQ ED NOS: 334, 335, and 336; SEQ ED NOS: 337, 338, and 339; SEQ ED NOS: 340, 341, and 342; SEQ ED NOS: 343, 344, and 345; SEQ ED NOS: 346, 347, and 348; SEQ ED NOS: 349, 350, and 351; SEQ ED NOS: 352, 353, and 354; SEQ ED NOS: 355, 356, and 357; SEQ BD NOS: 358, 359, and 360; SEQ ED NOS: 361, 362, and 363; SEQ BD NOS: 364, 365, and 366; SEQ BD NOS: 367, 368, and 369; SEQ DD NOS: 370, 371, and 372; SEQ DD NOS: 373, 374, and 375; SEQ ED NOS: 376, 377, and 378; SEQ ED NOS: 379, 380, and 381; SEQ ED NOS: 382, 383, and 384; SEQ ED NOS: 385, 386, and 387; SEQ ED NOS: 388, 389, and 390; SEQ ED NOS: 391, 392, and 393; SEQ ED NOS: 394, 395, and 396; SEQ ED NOS: 397, 398, and 399; SEQ DD NOS: 400, 401, and 402; SEQ ED NOS: 403, 404, and 405; SEQ ED NOS: 406, 407, and 408; SEQ ED NOS: 409, 410, and 411; SEQ ED NOS: 412, 413, and 414; SEQ ED NOS: 415, 416, and 417; SEQ ED NOS: 418, 419, and 420; SEQ ED NOS: 421, 422, and 423; SEQ BD NOS: 424, 425, and 426; SEQ BD NOS: 427, 428, and 429; SEQ ED NOS: 430, 431, and 432; SEQ ED NOS: 433, 434, and 435; SEQ DD NOS: 436, 437, and 438; SEQ ED NOS: 439, 440, and 441; SEQ ED NOS: 442, 443, and 444; SEQ ED NOS: 445, 446, and 447; SEQ ED NOS: 448, 449, and 450; SEQ ED NOS: 451, 452, and 453; SEQ BD NOS: 454, 455, and 456; SEQ ED NOS: 457, 458, and 459; SEQ ED NOS: 460, 461, and 462; SEQ ED NOS: 463, 464, and 465; SEQ ED NOS: 466, 467, and 468; SEQ ED NOS: 469, 470, and 471; SEQ BD NOS: 472, 473, and 474; SEQ ED NOS: 475, 476, and 477; SEQ BD NOS: 478, 479, and 480; SEQ BD NOS: 481, 482, and 483; SEQ ED NOS: 484, 485, and 486; SEQ ED NOS: 487, 488, and 489; SEQ ED NOS: 490, 491, and 492; SEQ ED NOS: 493, 494, and 495; SEQ DD NOS: 496, 497, and 498; SEQ DD NOS: 499, 500, and 501; and SEQ DD NOS: 502, 503, and 504; each primer set including two amplification primers and one detection extension primer; and instructions for using the primer set to detect or analyze a target nucleic acid sequence in a biological sample.
36. A computer readable medium comprising a program for instructing a central controller in an automated system for performing an assay on a biological sample to: (a) receive a biological sample, generate infoπnation about the biological sample, and transmit the information into a central controller; (b) transfer a portion of the biological sample to a first container; (c) extract nucleic acids from cells within the portion and transfer the portion to a second container; (d) measure the concentration of extracted nucleic acids in the portion; (e) add polymerase chain reaction (PCR) materials to the portion; (f) amplify target nucleic acids in the portion; (g) add primer extension reaction materials to the portion; (h) extend a detection extension primer in the portion; (i) transfer a sample of the portion from the second container to a support; (j) analyze the sample and exporting data to the central controller using a mass spectrometry system; and (k) transmit the data from the central controller to an output device, external system,ase.
PCT/US2004/025526 2003-08-06 2004-08-06 Systems and methods for analyzing nucleic acid sequences Ceased WO2005014850A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US49323803P 2003-08-06 2003-08-06
US60/493,238 2003-08-06
US56895804P 2004-05-07 2004-05-07
US60/568,958 2004-05-07

Publications (2)

Publication Number Publication Date
WO2005014850A2 true WO2005014850A2 (en) 2005-02-17
WO2005014850A3 WO2005014850A3 (en) 2006-04-13

Family

ID=34138744

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/025526 Ceased WO2005014850A2 (en) 2003-08-06 2004-08-06 Systems and methods for analyzing nucleic acid sequences

Country Status (2)

Country Link
US (2) US7939310B2 (en)
WO (1) WO2005014850A2 (en)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008147879A1 (en) * 2007-05-22 2008-12-04 Ryan Golhar Automated method and device for dna isolation, sequence determination, and identification
US8101371B2 (en) 2007-10-18 2012-01-24 Musc Foundation For Research Development Methods for the diagnosis of genitourinary cancer
US20130331286A1 (en) * 2012-05-31 2013-12-12 Ibis Biosciences, Inc. Universal random access detection of nucleic acids
CN103907117A (en) * 2011-09-01 2014-07-02 基因组编译器公司 System for polynucleotide construct design, visualization and transactions to manufacture the same
FR3034431A1 (en) * 2015-04-01 2016-10-07 Ad Nucleis AUTOMATED DATA PROCESSING SYSTEM AND METHOD FOR NUCLEIC ACID EXTRACTION ROBOT AND GENE AMPLIFICATION THROUGH THE REAL TIME PCR PROCESS
US10272410B2 (en) 2013-08-05 2019-04-30 Twist Bioscience Corporation De novo synthesized gene libraries
US10669304B2 (en) 2015-02-04 2020-06-02 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
US10696965B2 (en) 2017-06-12 2020-06-30 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US10744477B2 (en) 2015-04-21 2020-08-18 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US10754994B2 (en) 2016-09-21 2020-08-25 Twist Bioscience Corporation Nucleic acid based data storage
US10844373B2 (en) 2015-09-18 2020-11-24 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
US10894959B2 (en) 2017-03-15 2021-01-19 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
US10894242B2 (en) 2017-10-20 2021-01-19 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
US10907274B2 (en) 2016-12-16 2021-02-02 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
US10936953B2 (en) 2018-01-04 2021-03-02 Twist Bioscience Corporation DNA-based digital information storage with sidewall electrodes
US10975372B2 (en) 2016-08-22 2021-04-13 Twist Bioscience Corporation De novo synthesized nucleic acid libraries
US10987648B2 (en) 2015-12-01 2021-04-27 Twist Bioscience Corporation Functionalized surfaces and preparation thereof
US11332738B2 (en) 2019-06-21 2022-05-17 Twist Bioscience Corporation Barcode-based nucleic acid sequence assembly
US11377676B2 (en) 2017-06-12 2022-07-05 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11407837B2 (en) 2017-09-11 2022-08-09 Twist Bioscience Corporation GPCR binding proteins and synthesis thereof
US11492727B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for GLP1 receptor
US11492665B2 (en) 2018-05-18 2022-11-08 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US11492728B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
US11512347B2 (en) 2015-09-22 2022-11-29 Twist Bioscience Corporation Flexible substrates for nucleic acid synthesis
US11550939B2 (en) 2017-02-22 2023-01-10 Twist Bioscience Corporation Nucleic acid based data storage using enzymatic bioencryption
US12091777B2 (en) 2019-09-23 2024-09-17 Twist Bioscience Corporation Variant nucleic acid libraries for CRTH2
US12173282B2 (en) 2019-09-23 2024-12-24 Twist Bioscience, Inc. Antibodies that bind CD3 epsilon
US12357959B2 (en) 2018-12-26 2025-07-15 Twist Bioscience Corporation Highly accurate de novo polynucleotide synthesis
US12570750B2 (en) 2019-12-09 2026-03-10 Twist Bioscience Corporation Antibodies that bind adenosine A2A receptors and methods of use thereof to treat cancer and neurological diseases

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040132008A1 (en) * 2002-04-30 2004-07-08 Doranz Benjamin J Elucidation of gene function
WO2006052952A2 (en) * 2004-11-09 2006-05-18 The Brigham And Women's Hospital, Inc. System and method for determining whether to issue an alert to consider prophylaxis for a risk condition
US8084207B2 (en) * 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US20070112804A1 (en) 2005-11-07 2007-05-17 Desimas Bruce E Systems and methods for generating automated software workflows for biological testing
US9114398B2 (en) 2006-11-29 2015-08-25 Canon U.S. Life Sciences, Inc. Device and method for digital multiplex PCR assays
CN103370627B (en) 2010-10-29 2016-05-11 恩姆菲舍尔科技公司 System layout of automated system for sample preparation and analysis
US10068200B1 (en) * 2011-01-22 2018-09-04 Mass Insight, Inc. Business and data processing system for providing mass spectrometric services
US9460904B1 (en) * 2011-01-22 2016-10-04 Matthew Paul Greving Methods, apparatus, and compositions for mass spectrometry
EP4414990A3 (en) 2013-01-17 2024-11-06 Personalis, Inc. Methods and systems for genetic analysis
US10913977B2 (en) * 2013-07-24 2021-02-09 Dana-Farber Cancer Institute, Inc. Methods and compositions to enable enrichment of minor DNA alleles by limiting denaturation time in PCR or simply enable enrichment of minor DNA alleles by limiting the denaturation time in PCR
WO2015031689A1 (en) 2013-08-30 2015-03-05 Personalis, Inc. Methods and systems for genomic analysis
WO2015051275A1 (en) 2013-10-03 2015-04-09 Personalis, Inc. Methods for analyzing genotypes
GB2522087B (en) * 2013-12-27 2016-02-17 Personalis Inc Methods and systems for genetic analysis
US10125399B2 (en) 2014-10-30 2018-11-13 Personalis, Inc. Methods for using mosaicism in nucleic acids sampled distal to their origin
WO2016160520A1 (en) * 2015-03-30 2016-10-06 Virgin Instruments Corporation Mass spectrometry method and apparatus for clinical diagnostic applications
US11299783B2 (en) 2016-05-27 2022-04-12 Personalis, Inc. Methods and systems for genetic analysis
ES2959865T3 (en) * 2017-06-29 2024-02-28 Seegene Inc Method and device for controlling a detection composition preparation instrument
US10801064B2 (en) 2018-05-31 2020-10-13 Personalis, Inc. Compositions, methods and systems for processing or analyzing multi-species nucleic acid samples
US11814750B2 (en) 2018-05-31 2023-11-14 Personalis, Inc. Compositions, methods and systems for processing or analyzing multi-species nucleic acid samples
CN109439651B (en) * 2018-11-15 2022-07-12 上海派森诺生物科技股份有限公司 Method for extracting blood genome DNA (deoxyribonucleic acid) by using batch plate-type silica gel adsorption columns
CN110157796B (en) * 2019-05-30 2023-04-07 北京和合医学诊断技术股份有限公司 Method for detecting polymorphism of folate metabolism related gene
JP7470787B2 (en) 2019-11-05 2024-04-18 パーソナリス，インコーポレイティド Estimation of tumor purity from a single sample
WO2023059654A1 (en) 2021-10-05 2023-04-13 Personalis, Inc. Customized assays for personalized cancer monitoring

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020009394A1 (en) * 1999-04-02 2002-01-24 Hubert Koster Automated process line
US6326147B1 (en) 1999-05-13 2001-12-04 The Perkin-Elmer Corporation Methods, apparatus, articles of manufacture, and user interfaces for performing automated biological assay preparation and macromolecule purification
US6274321B1 (en) * 1999-12-03 2001-08-14 The Regents Of The University Of California High throughput functional screening of cDNAs
WO2001056753A1 (en) * 2000-02-01 2001-08-09 Incyte Genomics, Inc. Robot mounted barcode reader
ATE526423T1 (en) 2000-04-18 2011-10-15 Virco Bvba METHOD FOR MEASURING DRUG RESISTANCE TO HCV
WO2002007064A2 (en) * 2000-07-17 2002-01-24 Labnetics, Inc. Method and apparatus for the processing of remotely collected electronic information characterizing properties of biological entities
US6783672B2 (en) 2001-01-18 2004-08-31 Kemmons A. Tubbs Integrated high throughput system for the mass spectrometry of biomolecules
US20030129760A1 (en) 2001-11-13 2003-07-10 Aguilera Frank Reinaldo Morales Mass intensity profiling system and uses thereof

Cited By (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008147879A1 (en) * 2007-05-22 2008-12-04 Ryan Golhar Automated method and device for dna isolation, sequence determination, and identification
US8101371B2 (en) 2007-10-18 2012-01-24 Musc Foundation For Research Development Methods for the diagnosis of genitourinary cancer
CN103907117A (en) * 2011-09-01 2014-07-02 基因组编译器公司 System for polynucleotide construct design, visualization and transactions to manufacture the same
CN103907117B (en) * 2011-09-01 2019-03-29 基因组编译器公司 Systems and methods for polynucleotide construct design
US20130331286A1 (en) * 2012-05-31 2013-12-12 Ibis Biosciences, Inc. Universal random access detection of nucleic acids
US10384188B2 (en) 2013-08-05 2019-08-20 Twist Bioscience Corporation De novo synthesized gene libraries
US12569822B2 (en) 2013-08-05 2026-03-10 Twist Bioscience Corporation De novo synthesized gene libraries
US10272410B2 (en) 2013-08-05 2019-04-30 Twist Bioscience Corporation De novo synthesized gene libraries
US10773232B2 (en) 2013-08-05 2020-09-15 Twist Bioscience Corporation De novo synthesized gene libraries
US10583415B2 (en) 2013-08-05 2020-03-10 Twist Bioscience Corporation De novo synthesized gene libraries
US10618024B2 (en) 2013-08-05 2020-04-14 Twist Bioscience Corporation De novo synthesized gene libraries
US10632445B2 (en) 2013-08-05 2020-04-28 Twist Bioscience Corporation De novo synthesized gene libraries
US10639609B2 (en) 2013-08-05 2020-05-05 Twist Bioscience Corporation De novo synthesized gene libraries
US11559778B2 (en) 2013-08-05 2023-01-24 Twist Bioscience Corporation De novo synthesized gene libraries
US11452980B2 (en) 2013-08-05 2022-09-27 Twist Bioscience Corporation De novo synthesized gene libraries
US11185837B2 (en) 2013-08-05 2021-11-30 Twist Bioscience Corporation De novo synthesized gene libraries
US11697668B2 (en) 2015-02-04 2023-07-11 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
US10669304B2 (en) 2015-02-04 2020-06-02 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
FR3034431A1 (en) * 2015-04-01 2016-10-07 Ad Nucleis AUTOMATED DATA PROCESSING SYSTEM AND METHOD FOR NUCLEIC ACID EXTRACTION ROBOT AND GENE AMPLIFICATION THROUGH THE REAL TIME PCR PROCESS
EP3075866A3 (en) * 2015-04-01 2016-11-16 Ad Nucleis System and method for automated processing of data from a robot for extracting nucleic acids and amplifying genes by the real-time pcr method
US11691118B2 (en) 2015-04-21 2023-07-04 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US10744477B2 (en) 2015-04-21 2020-08-18 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US10844373B2 (en) 2015-09-18 2020-11-24 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
US11807956B2 (en) 2015-09-18 2023-11-07 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
US11512347B2 (en) 2015-09-22 2022-11-29 Twist Bioscience Corporation Flexible substrates for nucleic acid synthesis
US10987648B2 (en) 2015-12-01 2021-04-27 Twist Bioscience Corporation Functionalized surfaces and preparation thereof
US10975372B2 (en) 2016-08-22 2021-04-13 Twist Bioscience Corporation De novo synthesized nucleic acid libraries
US11263354B2 (en) 2016-09-21 2022-03-01 Twist Bioscience Corporation Nucleic acid based data storage
US11562103B2 (en) 2016-09-21 2023-01-24 Twist Bioscience Corporation Nucleic acid based data storage
US12056264B2 (en) 2016-09-21 2024-08-06 Twist Bioscience Corporation Nucleic acid based data storage
US10754994B2 (en) 2016-09-21 2020-08-25 Twist Bioscience Corporation Nucleic acid based data storage
US10907274B2 (en) 2016-12-16 2021-02-02 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
US11550939B2 (en) 2017-02-22 2023-01-10 Twist Bioscience Corporation Nucleic acid based data storage using enzymatic bioencryption
US10894959B2 (en) 2017-03-15 2021-01-19 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
US11332740B2 (en) 2017-06-12 2022-05-17 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11377676B2 (en) 2017-06-12 2022-07-05 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US12270028B2 (en) 2017-06-12 2025-04-08 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US10696965B2 (en) 2017-06-12 2020-06-30 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11407837B2 (en) 2017-09-11 2022-08-09 Twist Bioscience Corporation GPCR binding proteins and synthesis thereof
US11745159B2 (en) 2017-10-20 2023-09-05 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
US10894242B2 (en) 2017-10-20 2021-01-19 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
US10936953B2 (en) 2018-01-04 2021-03-02 Twist Bioscience Corporation DNA-based digital information storage with sidewall electrodes
US12086722B2 (en) 2018-01-04 2024-09-10 Twist Bioscience Corporation DNA-based digital information storage with sidewall electrodes
US11732294B2 (en) 2018-05-18 2023-08-22 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US11492665B2 (en) 2018-05-18 2022-11-08 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US12522868B2 (en) 2018-05-18 2026-01-13 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US12357959B2 (en) 2018-12-26 2025-07-15 Twist Bioscience Corporation Highly accurate de novo polynucleotide synthesis
US11492728B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
US12331427B2 (en) 2019-02-26 2025-06-17 Twist Bioscience Corporation Antibodies that bind GLP1R
US12565715B2 (en) 2019-02-26 2026-03-03 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
US11492727B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for GLP1 receptor
US11332738B2 (en) 2019-06-21 2022-05-17 Twist Bioscience Corporation Barcode-based nucleic acid sequence assembly
US12173282B2 (en) 2019-09-23 2024-12-24 Twist Bioscience, Inc. Antibodies that bind CD3 epsilon
US12091777B2 (en) 2019-09-23 2024-09-17 Twist Bioscience Corporation Variant nucleic acid libraries for CRTH2
US12570750B2 (en) 2019-12-09 2026-03-10 Twist Bioscience Corporation Antibodies that bind adenosine A2A receptors and methods of use thereof to treat cancer and neurological diseases

Also Published As

Publication number Publication date
US7939310B2 (en) 2011-05-10
US20120270206A1 (en) 2012-10-25
US20050089894A1 (en) 2005-04-28
WO2005014850A3 (en) 2006-04-13

Similar Documents

Publication Publication Date Title
US7939310B2 (en) Systems and methods for analyzing nucleic acid sequences
Fernandez et al. Comparative study of three diagnostic approaches (FISH, STRs and MLPA) in 30 patients with 22q11. 2 deletion syndrome
Tong et al. Noninvasive prenatal detection of fetal trisomy 18 by epigenetic allelic ratio analysis in maternal plasma: theoretical and empirical considerations
EP1319716B1 (en) Method of analyzing nucleic acid
CN110564837B (en) Genetic metabolic disease gene chip and application thereof
McBean et al. Blood group genotyping: the power and limitations of the Hemo ID Panel and MassARRAY platform
CN106480170A (en) Determine method and the application of donor and receptor difference SNP
CN104928389A (en) Method and kit for detecting human ATP7B gene mutation type
Damour et al. Early noninvasive prenatal paternity testing by targeted fetal DNA analysis
Papasavva et al. A minimal set of SNPs for the noninvasive prenatal diagnosis of β‐thalassaemia
Peyrard Use of genomics for decision‐making in transfusion medicine: laboratory practice
US7919279B2 (en) Methods and compositions for KIR genotyping
Wei et al. Development and validation of a haplotype‐free technique for non‐invasive prenatal diagnosis of spinal muscular atrophy
Emadi et al. Analytic validity of genetic tests to identify factor V Leiden and prothrombin G20210A
Grill et al. High throughput non-invasive determination of foetal Rhesus D status using automated extraction of cell-free foetal DNA in maternal plasma and mass spectrometry
Yan et al. Reliable detection of paternal SNPs within deletion breakpoints for non-invasive prenatal exclusion of homozygous α0-thalassemia in maternal plasma
Chiu et al. Circulating Nucleic Acids in Plasma/Serum III and Serum Proteomics Recent Developments in Fetal DNA in Maternal Plasma
CN105400863A (en) Probe amplification method based on multiplex extending connection, and uses thereof, and kit
Old et al. Molecular diagnostics for haemoglobinopathies
Hansen et al. Robust nonradioactive oligonucleotide ligation assay to detect a common point mutation in the CYP2D6 gene causing abnormal drug metabolism
CN118957105A (en) A liquid phase chip for beef cattle pedigree identification and its design method and application
Thyagarajan et al. New approaches for genotyping paraffin wax embedded breast tissue from patients with cancer: the Iowa women’s health study
CN116640858A (en) Method for identifying human ABO blood type and special KASP primer combination thereof
CN110438217B (en) Single nucleotide polymorphism rs976754 detection device and application of statin-related myopathy
US20250266126A1 (en) Multi-stage single nucleotide polymorphism based identity verification for genetic files

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
122 Ep: pct application non-entry in european phase