WO2005014826A1 - Use of npabc1 transporter and promoter thereof - Google Patents

Use of npabc1 transporter and promoter thereof Download PDF

Info

Publication number
WO2005014826A1
WO2005014826A1 PCT/EP2003/008137 EP0308137W WO2005014826A1 WO 2005014826 A1 WO2005014826 A1 WO 2005014826A1 EP 0308137 W EP0308137 W EP 0308137W WO 2005014826 A1 WO2005014826 A1 WO 2005014826A1
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
seq
sequence
polypeptide
given
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2003/008137
Other languages
French (fr)
Inventor
Marc Boutry
Michal Jasinski
Sébastien GREC
Yvan Stukkens
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universite Catholique de Louvain UCL
Original Assignee
Universite Catholique de Louvain UCL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite Catholique de Louvain UCL filed Critical Universite Catholique de Louvain UCL
Priority to AU2003250163A priority Critical patent/AU2003250163A1/en
Priority to PCT/EP2003/008137 priority patent/WO2005014826A1/en
Publication of WO2005014826A1 publication Critical patent/WO2005014826A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8281Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to the use of Nicotiana NpABCI -transporter. More specifically, the invention relates to the use of Nicotiana NpABCI -transporter to enhance the production and/or secretion of taxane-type diterpene and/or derivative thereof in plants and plant cell cultures. The present invention also relates to the use of NpABCI transporter for protecting plants from damage caused by pathogens. In a third aspect, the present invention relates to the NpABCI promoter.
  • ABC transporters which are found in all organisms, catalyze ATP-dependent transport of endogenous or exogenous substrates across biological membranes (Borst, P., (1997) Seminar in Cancer Biology 8: 131-213) and/or allosterically modify the function of heterologous proteins (Higgins CF, 1995, Cell 82: 693-696).
  • ABC transporters have been associated with clinically relevant phenotypes including the phenomenon of multidrug resistance. ABC transporters are encoded by a large family of genes.
  • NpABCI is a Nicotiana plumbaginifolia PDR-type ABC transporter which is expressed in the leaf epidermis (Jasinski et al., (2001 ) Plant Cell, 13, 1095-1107) and is induced by sclareol a diterpene, as well as by sclareolide a close analogue thereof.
  • Taxanes are diterpene compounds containing a taxane skeleton.
  • Taxol is a naturally occurring compound originally isolated from the stem bark of the Western Yew, Taxus brevifolia. Taxol is an important chemotherapeutic agent for the treatment of human ovarian, breast and lung cancers and is considered as a promising therapeutic agent for the treatment of other human cancers.
  • Taxanes such as taxol are characterized by a highly structurally complex diterpene skeleton that has thus far eluded total chemical synthesis. Therefore, large-scale synthesis from simple available chemicals is not likely to be a feasible option for the next few years. The total chemical synthesis method has not been practically applied in the art, since it requires very expensive chemical reagents and the yield is not so high, which can be expected from the complicated chemical structure of taxol.
  • the semi-synthesis method employing precursors such as 10-deacetylbaccatin III has revealed some drawbacks since it essentially entails complicated and multiple steps of isolating and purifying the taxol precursors from Taxus genus plants and transforming the precursors to taxol.
  • U.S. Pat. No. 5,019,504 discloses a method for producing taxol and its derivative utilizing cultured cells of Taxus brevifolia.
  • the yield of taxol described is insufficient for industrial application.
  • the production of taxol by the cell culture is unstable and even when a primary cell of high productivity can be obtained by selection, it is difficult to keep its content by subculturing.
  • U.S. Pat. No. 5,015,744 teaches a semi-synthetic method from baccatin III, which is a precursor in biosynthesis of taxol.
  • baccatin III a raw material for the semi-synthetic process such as baccatin III can be produced, thus the plant tissue culture can also be utilized for taxol production by the above-mentioned semi-synthetic process.
  • WO 93/17121 offers a method for taxol production by cell culture of Taxus genus plants while changing composition of medium, growth rate, and production rate.
  • the invention aims primarily at enhancing or inducing the production and/or secretion of taxane-type diterpenes and/or derivatives thereof, in plants or plant cell cultures. More in particular, it is an object of the present invention to provide plants or plant cell cultures with induced or enhanced taxol production and/or secretion.
  • Plants are subjected to threats by numerous pathogens, e.g., fungi, bacteria, viruses, nematodes, aphids, insects and other pests.
  • pathogens e.g., fungi, bacteria, viruses, nematodes, aphids, insects and other pests.
  • a strategy to combat fungal disease includes the use of chemical fungicides. However, this involves high expense and environmental cost.
  • Transgenic techniques have become a powerful tool for addressing important biological problems in multicellular organisms, and this is particularly true in the plant field.
  • Many approaches that were impossible to implement by traditional genetics can now be realized by transgenic techniques, including the introduction of homologous or heterologous genes into plants, with modified functions and altered expression patterns.
  • the success of such techniques often depends upon the use of promoters to control the expression of the transgenes. Still the need exists for new promoters from plant origin.
  • terpenes and/or derivatives thereof secretion of terpenes and/or derivatives thereof, in plants and plant cell cultures can be enhanced by the transformation of a polynucleotide corresponding to the NpABCI gene, variants, fragments or functional fragments thereof encoding a polypeptide corresponding to the NpABCI transporter or a functional fragment thereof to the plants or plant cells producing the desired terpene.
  • the present invention provides an isolated polynucleotide that induces or enhances the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells, wherein said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof; (b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1; (d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c), (e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in S
  • the invention provides an isolated polypeptide that induces or enhances the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells, wherein said polypeptide is selected from the group comprising: (a) a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1 ; (b) a polypeptide encoded by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (c) a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (d) a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (e) variants or fragments or functional fragments of such polypeptides in (a) to (d).
  • a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1
  • the slow growth of plant cells producing taxane-type diterpenes is due to the toxicity of said metabolites which are produced inside the plant cells.
  • the present inventors have surprisingly found that the toxicity can largely be increased by preventing the expression of the NpABCI gene encoding the NpABCI transporter in the plant cells producing taxane-type diterpenes.
  • polynucleotide corresponding to the NpABCI gene or a functional fragment thereof or encoding a polypeptide corresponding to the NpABCI protein or a functional fragment thereof for protecting plants from damage caused by pathogens
  • said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO: 1 or the complement thereof; (b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c), (e) a polynucleotide encoding a polypeptide with an amino sequence which is at least
  • said polypeptide is selected from the group comprising: (a) a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1 ; (b) a polypeptide encoded by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1; (c) a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (d) a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (e) variants or fragments or functional fragments of such polypeptides in (a) to (d).
  • the present invention provides isolated non-coding nucleotide sequences upstream of the NpABCI gene useful as promoters for homologous or heterologous gene expression in plants.
  • the present invention provides a promoter having a sequence selected from the group comprising: a) a nucleic acid sequence as given in SEQ ID NO 3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6, SEQ ID NO:7 or a combination thereof; and b) a nucleic acid sequence that is at least about 60% homologous to the coding regions of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6 and SEQ ID NO:7 or a combination thereof.
  • a first aspect of the present invention relates to the use of a polynucleotide corresponding to the NpABCI gene or a functional fragment thereof, or encoding a polypeptide corresponding to the NpABCI protein or a functional fragment thereof for inducing or enhancing the production and/or secretion of taxane type diterpene and/or derivative thereof in plants or plant cells.
  • said polynucleotide for use in the present invention is selected from the group comprising (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof; (b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO: 1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c), (e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (g) fragments and variants of such polyn
  • the polypeptide is selected from the group comprising: (a) a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1 ; (b) a polypeptide encoded by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1; (c) a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (d) a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (e) variants or fragments or functional fragments of such polypeptides in (a) to (d).
  • fragment refers to a polypeptide or polynucleotide corresponding to at least 25% of the polynucleotide or polypeptide sequence, typically at least 50% to 75%, generally at least 90% of the polypeptide or polynucleotide sequence. If desired, the fragment may be fused at either terminus to additional amino acids or base pairs, which may number from 1 to 20, typically 50 to 100, but up to 250 to 500 or more.
  • polypeptide fragment refers to a polypeptide fragment possessing the biological property of inducing or enhancing the production or the secretion of at least one secondary metabolite in plants or plant cells.
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i. e. 65% identity over a specified region), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using sequence comparison algorithms or by manual alignment and visual inspection.
  • the present invention is also directed to the use of a polynucleotide as described above, which comprises or alternately consists of a nucleic acid sequence which is at least 65%, 70%, 75%, 80%, 90%, 95%, 96%, 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identical to the nucleic acid sequence SEQ ID NO:1.
  • the present invention is also directed to the use of a polypeptide as described above, which comprises or alternately consists of an amino sequence which is at least 65%, 70%, 75%, 80%, 90%, 95%, 96%, 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identical to the amino acid sequence as given in SEQ ID NO:2.
  • polypeptide having an amino acid sequence of at least for example 95% to the amino acid sequence as given in SEQ ID NO:2 it is intended that the amino acid sequence of the polypeptide is identical to said sequence except that the amino acid sequence may include up to five amino acid alteration per each 100 amino acids of said SEQ ID N:2.
  • amino acid sequence may include up to five amino acid alteration per each 100 amino acids of said SEQ ID N:2.
  • nucleotide sequence of the polynucleotide is identical to SEQ ID NO:1 except that the nucleotide sequence may include up to five nucleic acid alterations per each 100 nucleic acid of said SEQ ID NO:1.
  • the present invention also relates to the use of an expression cassette comprising a polynucleotide as described above to induce or to enhance the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells.
  • Said polynucleotide encodes the NpABCI transporter or a functional fragment thereof.
  • expression cassettes refers to DNA constructs preferably including (5' to 3' in the direction of transcription): a promoter region, a polynucleotide as described above operatively linked with the transcription initiation region, and a termination sequence including a stop signal for RNA polymerase and a polyadenylation signal. It is understood that all of these regions should be capable of operating in the cells to be transformed.
  • the promoter region comprising the transcription initiation region, which preferably includes the RNA polymerase binding site, and the polyadenylation signal may be native to the biological cell to be transformed or may be derived from an alternative source, where the region is functional in the cell.
  • the term "enhanced production” means that the level of taxane type diterpene may be enhanced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or at least 100% relative to the untransformed plant cell which was used to transform with an expression vector comprising an expression cassette further comprising the gene coding for NpABCI transporter or variants or fragments or functional fragments thereof.
  • An enhanced production of taxane type diterpene can result in a detection of a higher level of taxane type diterpene in the extracellular medium of the plant cell culture.
  • a higher level of taxane type diterpene can be detected inside the plant cells, for example in the vacuole.
  • an "enhanced secretion of at least one taxane type diterpene and/or derivatives thereof means that there exists already a detectable secretion of the taxane type diterpene in the extracellular medium of the plant cell culture and that an increase of said taxane type diterpene can be measured by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% compared to basal secretion by the untransformed plant cell culture.
  • An “enhanced secretion” does not necessarily mean that there is a higher production, it can also mean that there exists the same level of production but that the secretion is enhanced.
  • An "induced secretion of at least one taxane type diterpene” means that there is no detectable secretion of the taxane type diterpene in the extracellular medium of the untransformed plant cell culture or plant but that the detection becomes possible upon carrying out the transformation according to the invention.
  • secretion means secretion of a taxane type diterpene across the plasma membrane or secretion across both the plasma membrane and the cell wall of a plant cell.
  • the present invention further encompasses the use of an expression cassette as described above to induce or to enhance the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, wherein said expression cassette further comprises a promoter operably linked to said polynucleotide encoding NpABCI - transporter.
  • the NpABCI gene may be expressed in for example a plant cell under the control of a promoter that directs constitutive expression or regulated expression.
  • operably linked refers to linkage of a DNA segment to another DNA segment in such a way as to allow the segments to function in their intended manners.
  • a DNA sequence encoding a gene product is operably linked to a regulatory sequence when it is ligated to the regulatory sequence, such as, for example a promoter, in a manner which allows modulation of transcription of the DNA sequence, directly or indirectly.
  • a DNA sequence is operably linked to a promoter when it is ligated to the promoter downstream with respect to the transcription initiation site of the promoter and allows transcription elongation to proceed through the DNA sequence.
  • a DNA for a signal sequence is operably linked to DNA coding for a polypeptide if it is expressed as a pre-protein that participates in the transport of the polypeptide.
  • Linkage of DNA sequences to regulatory sequences is typically accomplished by ligation at suitable restriction sites or adapters or linkers inserted in lieu thereof using restriction endonucleases known to one of skill in the art.
  • Regulated expression comprises temporally or spatially regulated expression and overexpression and any other form of inducible or repressible expression.
  • Temporally means that the expression is induced at a certain time point, for instance, when a certain growth rate of the plant cell culture is obtained (e. g. the promoter is induced only in the stationary phase or at a certain stage of development).
  • Spatially means that the promoter is only active in specific organs, tissues, or cells (e.g. only in roots, leaves, epidermis, guard cells or the like).
  • Other examples of regulated expression comprise promoters whose activity is induced or repressed by adding chemical or physical stimuli to the plant cell.
  • said promoter corresponds to the intrinsic promoter of the NpABCI gene or a functional derivative thereof, and has a sequence selected from the group comprising: a) a nucleic acid sequence as given in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6, SEQ ID NO:7 or a combination thereof; and b) a nucleic acid sequence that is at least about 60% homologous to the coding regions of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6 and SEQ ID NO:7 or a combination thereof.
  • the NpABCI transporter or functional fragment thereof can be placed under the control of a constitutive promoter.
  • a constitutive promoter directs expression in a wide range of cells under a wide range of conditions.
  • constitutive plant promoters useful for expressing heterologous polypeptides in plant cells include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, or the figwort mosaic virus 35S promoter which confer constitutive, high-level expression in most plant tissues including monocots.
  • Other constitutive promoters contemplated for use in the present invention include, but are not limited to: T-DNA mannopine synthetase, opaline synthase, nopaline synthase (NOS) and octopine synthase (OCS) promoters.
  • said promoter is cauliflower mosaic virus (CaMV) 35S promoter.
  • the expression cassette is usually provided in a DNA or RNA construct which is typically called an "expression vector" which is any genetic element, e. g., a plasmid, a chromosome, a virus, behaving either as an autonomous unit of polynucleotide replication within a cell (i. e. capable of replication under its own control) or being rendered capable of replication by insertion into a host cell chromosome, having attached to it another polynucleotide segment, so as to bring about the replication and/or expression of the attached segment.
  • Suitable vectors include, but are not limited to, plasmids, bacteriophages, cosmids, plant viruses and artificial chromosomes.
  • the expression cassette may be provided in a DNA construct which also has at least one replication system.
  • there will frequently be at least one marker present which may be useful in one or more hosts, or different markers for individual hosts.
  • the markers may a) code for protection against a biocide, such as antibiotics, toxins, heavy metals, certain sugars or the like; b) provide complementation, by imparting prototrophy to an auxotrophic host: or c) provide a visible phenotype through the production of a novel compound in the plant.
  • NPTII neomycin phosphotransferase
  • HPT hygromycin phosphotransferase
  • CAT chloramphenicol acetyltransferase
  • gentamicin resistance gene neomycin phosphotransferase
  • suitable markers are ?-glucuronidase, providing indigo production, luciferase, providing visible light production, Green Fluorescent Protein and variants thereof, and the mutated aroA gene, providing glyphosate resistance.
  • the present invention relates to the use of an expression cassette as described above to induce or enhance the production or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells, comprising: transforming said plants or plant cell with an expression vector comprising said expression cassette, selecting transformed plants or plant cells with an enhanced production, and propagating such selected transformed plants or plant cells.
  • DNA sequences encoding NpABCI transporter are used to enhance the production and/or the production of at least one taxane-type diterpene and/or derivative thereof, in plants comprising the transformation of said plants with an expression vector comprising an expression cassette further comprising a gene coding for the NpABCI transporter or a functional fragment thereof.
  • taxane- type diterpene and/or derivative thereof may be enhanced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or at least 100% relative to the untransformed plant which was used to transform with an expression vector comprising an expression cassette further comprising a gene coding for NpABCI -transporter.
  • An enhanced production of a taxane-type diterpene and/or derivative thereof can result in a detection of a higher level of taxane-type diterpene in the plant, for example in the vacuole.
  • the enhanced production of at least one taxane-type diterpene and/or derivative thereof leads to an enhanced secretion.
  • the same production of at least one taxane-type diterpene and/or derivative thereof occurs in the transformed plant but an enhanced secretion of at least one taxane- type diterpene and/or derivative thereof, occurs by said transformed plant.
  • Non-limiting examples of the plant or plant cells to be used in the present invention which produces the taxane-type diterpene comprise those belonging to genus Taxus, in which taxol and taxol-like compounds, or taxanes, can be produced in very high yield from all known Taxus species, i.e., brevifolia, canadensis, cuspidata, baccata, globosa, fioridana, wallichiana, media and chinensis.
  • the invention can even be practiced in plant species that are presently not amenable for transformation, as the amenability of such species is just a matter of time and because transformation as such is of no relevance for the principles underlying the invention.
  • the taxane-type diterpenes are not particularly limited to any diterpene as far as it has a taxane skeleton, and the illustrative examples include, taxol, 7-epitaxol, baccatin III, 7-epibaccatin III, cephalomannine, 7-epicephalomannine, 10-deacetylbaccatin III, 10-deacetylcephalomannine, 10-deacetyltaxol, 7-xylosyltaxol, 7- xylosylcephalomannine, 7-xylosylbaccatin III, taxagifine, an analogue thereof, taxane la, an analogue thereof and the like.
  • said taxane type diterpene is taxol.
  • the present invention is not limited to the taxane-type diterpenes, but encompasses the production and/or the section of any terpene, including terpenoid indole alkaloid, terpenoids compounds (monoterpenoids, iridoids, sesquiterpenoids, triterpenoids and diterpenoids such as sclareol- and sclareolide-like compounds).
  • terpenoid indole alkaloid terpenoids compounds (monoterpenoids, iridoids, sesquiterpenoids, triterpenoids and diterpenoids such as sclareol- and sclareolide-like compounds).
  • Non-limiting examples include myrcene, geraniol, ⁇ -terpinene, cineole, menthone, menthol, carvone, thujone, farnesol, eudesmol, bulgarene, atractylone, caryophyllene, aromadendrene, linderene, germacrone, limonene, camphor, ⁇ -pinene, guaiol, ⁇ -selinene, valerane, ⁇ - vetivone, eremophilone and the like.
  • Sclareol-like compounds are diterpene compounds, and include but are not limited to sclareol, 13-episclareol, ferruginol, salvipisone, aethopisome, neoclerodane, sagequinone, romulgarzone, ortho-benzoquinone, para- benzoquinone, clariol, and the like.
  • sclareol-like compounds include but are not limited to abietane diterpenoids, icetaxane diterpenoids, languidulane diterpenes, paryin diterpenes, pimarine diterpenes, methylene quinine diterpenoids, manyol norditerpenoids, multicaulin, salvipimarone and primane diterpenoid. See, for example, the types of compounds set forth in Gonzalez et al., Can. J. Chem. 67(2), 208-212(1989); Banthorpe et al., Phytochem. 29, 2145-2148 (1990); Kouzi et al., Helv. Chim. Acta.
  • Sclareolide-like compounds are fused-ring diterpene compounds and include, for example, sclareolide, ambrox, and wiedenol. See, for example, the types of compounds set forth in Hanson, Nat. Prod. Rep.
  • Non-limiting examples of the plants or plant cells to be used in the present invention which produce terpenoids include but are not limited to Asteraceae, Labiateae, Cistaceae, Pinaceae, Cupressaceae, Taxodiaceae, Acanthaceae, Annonaceae, Caprifoliaceae, Solanaceae, Apocynaceae, Verbenaceae and Zingiberaceae.
  • the invention provides a method for producing a plant or a plant cell having enhanced production and/or secretion of at least one taxane-type diterpene and/or derivative thereof by plants or plant cells by transformation of said plant or plant cell with an expression cassette as described above.
  • transgenic plants the cells, seeds, plant cell culture, and progeny thereof with an enhanced production and/or secretion of at least one taxane-type diterpene and/or derivative thereof, transformed with an expression vector comprising an expression cassette as described above.
  • transgenic plants; cells, seeds, plant cell culture, and progeny thereof according to the invention is further characterized in (1) having an increased vacuolar localization of said taxane-type diterpene and/or derivative thereof, or (2) having a secretion or an increased secretion of said taxane-type diterpene and/or derivative thereof.
  • culture of the above-mentioned plant can be carried out by the previously known method except that the tissue or the cell of the plant which produces the taxane-type diterpene is transformed with an expression cassette of the current invention and for which transformed cells can be cultured in vitro.
  • Suspension culture, callus culture, hairy root culture, shoot culture or other conventional plant cell culture methods may be used (as described in: Drugs of Natural Origin, G. Samuelsson, 1999, ISBN 9186274813).
  • plant cells it is understood any cell which is derived from a plant and can be subsequently propagated as callus, plant cells in suspension, organized tissue and organs (e.g. hairy roots). Tissue cultures derived from the plant tissue of interest can be established.
  • the current invention can be combined with other known methods to enhance the production and/or the secretion of taxane type diterpene and/or derivative thereof in plant cell cultures such as (1) by improvement of the plant cell culture conditions, (2) by the transformation of the plant cells with a transcription factor capable of upregulating genes involved in the pathway of taxane type diterpene formation, (3) by the addition of specific elicitors to the plant cell culture, (4) by the induction of organogenesis and (5) by improving the expression of the enzyme involved in the biosynthetic pathway.
  • the present invention encompasses the use of a polynucleotide corresponding to the NpABCI gene or a functional fragment thereof, or encoding a polypeptide corresponding to the NpABCI protein or a functional fragment thereof for inducing or enhancing the production and/or secretion of terpene and/or derivative thereof in plants or plant cells for providing increased fragrance in said plant.
  • Non-limiting examples of such terpenes include myrcene, geraniol, ⁇ -terpinene, cineole, menthone, menthol, carvone, thujone, famesol, eudesmol, bulgarene, atractylone, caryophyllene, aromadendrene, linderene, germacrone, limonene, camphor, ⁇ -pinene, guaiol, ⁇ -selinene, valerane, ⁇ -vetivone, eremophilone and the like.
  • the expression cassette of the present invention may be useful in home gardening such as in ornamental plants and flowers, as well as cut flowers.
  • the plants within the scope of the present invention include and are not limited to the Families Rosaceae including roses, Ericaceae including rhododendrons and azaleas, Euphorbiaceai including poinsettias and croton, Caryophyllaceae including carnations, Solanaceae including petunias, Gesneriaceae including african violets, Balsaminaceae including impatiens, Orchidaceae including orchids, Iridaceae including Gladiolas, Irises, Freesia, and Crocus, Compositae including marigolds, Geraniaceae including geraniums, and the like.
  • the increased production of volatiles by the transformed plants is also encompassed by the present invention.
  • the transformed plants can further be used for the attraction of the insect and the like.
  • the polynucleotide corresponding to the NpABCI gene or a functional fragment thereof, or encoding a polypeptide corresponding to the NpABCI protein or a functional fragment thereof is used for protecting plants from damage caused by pathogens. It was surprisingly found that NpABCI gene, protein, or functional fragment thereof could be used to increase the resistance of the plant to pathogens such as plants, animals and microorganisms (including resistance to both fungal and bacterial pathogens).
  • the present invention therefore also provides an isolated polynucleotide that protects plants from damage caused by pathogens, wherein said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof; (b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c), (e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as
  • the invention relates to the use of an isolated polypeptide for protecting plants from damage caused by pathogens, wherein said polypeptide is selected from the group comprising: (a) a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1 ; (b) a polypeptide encoded by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (c) a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (d) a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (e) variants or fragments or functional fragments of such polypeptides in (a) to (d).
  • the present invention also encompasses the use of an expression cassette comprising a polynucleotide as described above for protecting plants from damage caused by pathogen.
  • the present invention further encompasses the use of an expression cassette as described above for protecting plants from damage caused by pathogens, wherein said expression cassette further comprises a promoter operably linked to said polynucleotide. Examples of suitable promoters to be used in the present invention are the same as that described above.
  • the invention further provides transgenic plants protected from pathogens, comprising of a host plant transformed with an expression vector comprising an expression cassette comprising a polynucleotide wherein said polynucleotide is as described above.
  • the genetically modified plants have an enhanced resistance to pathogens following transformation of the plant with a vector as described above.
  • the present invention provides plants protected from pathogens, such as microorganisms, plants, animals including insects and the like.
  • the invention can even be practiced in plant species that are presently not amenable for transformation, as the amenability of such species is just a matter of time and because transformation as such is of no relevance for the principles underlying the invention.
  • the present invention can be practiced with any plant variety for which cells of the plant can be transformed with an expression cassette of the current invention and for which transformed cells can be cultured in vitro. Suspension culture, callus culture, hairy root culture, shoot culture or other conventional plant cell culture methods may be used (as described in: Drugs of Natural Origin, G. Samuelsson, 1999, ISBN 9186274813).
  • the invention thus, encompasses transgenic plants that express at least one NpABCI and/or at least one NpABCI -related peptide, and methods for producing such plants.
  • the present invention also provides a method for protecting plants from damage caused by pathogens, comprising the step of transforming with an expression vector comprising an expression cassette comprising a polynucleotide wherein said polynucleotide is as described above.
  • plants refers to vascular plants (e.g. gymnosperms and angiosperms).
  • plants for the purpose of this description shall include angiosperms as well as gymnosperms, monocotyledonous as well as dicotyledonous plants, be they for feed, food or industrial processing purposes; included are plants used for any agricultural or horticultural purpose including forestry and flower culture, as well as home gardening or indoor gardening, or other decorative purposes.
  • the method comprises transforming a plant cell with an expression cassette of the present invention and regenerating such plant cell into a transgenic plant.
  • Such plants can be propagated vegetatively or reproductively.
  • the transforming step may be carried out by any suitable means, including by Agrobacterium-mediated transformation and non- Agrobacterium-mediated transformation, as discussed in detail below.
  • Plants can be regenerated from the transformed cell (or cells) by techniques known to those skilled in the art. Where chimeric plants are produced by the process, plants in which all cells are transformed may be regenerated from chimeric plants having transformed germ cells, as is known in the art.
  • Methods that can be used to transform plant cells or tissue with expression vectors of the present invention include both Agrobacterium and non- Agrobacterium vectors.
  • a second group of transformation methods is the non- Agrobacterium mediated transformation and these methods are known as direct gene transfer methods.
  • Organogenesis' means a process by which shoots and roots are developed sequentially from meristematic centers; the term “embryogenesis” means a process by which shoots and roots develop together in a concerted fashion (not sequentially), whether from somatic cells or gametes.
  • tissue targets include protoplasts, leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissues (e. g. apical meristems, axillary buds, and root meristems), and induced meristem tissues (e. g., cotyledon meristem and hypocotyls meristem).
  • the present invention may be used for producing resistance in any of various plant types.
  • the invention may be applied to both monocotyledonous, dicotyledonous, and gymnospermous plants, including, but not limited to, maize, wheat, rice, barley, soybean, cotton, legumes, rape/canola, alfalfa, flax, sunflower, safflower, brassica, cotton, flax, peanut, and clover; vegetables such as lettuce, tomato, cucurbits, cassava, potato, carrot, radish, pea, lentil, cabbage, cauliflower, broccoli, Brussels sprouts, and peppers; tree fruits such as citrus, apples, pears, peaches, apricots, and walnuts; and flowers such as orchids, carnations, and roses; coffee; cacao; conifers such as Douglas fir, spruce, and pine; and woody deciduous trees such as poplar and elms.
  • said transforming step includes providing an inducible promoter operably linked to said polynucleotide which promotes localized expression of said polynucleotide in the area of invasion of said pathogen.
  • inducible promoter operably linked to said polynucleotide which promotes localized expression of said polynucleotide in the area of invasion of said pathogen.
  • the present invention provides a method of preventing or reducing damage in a host plant, which may be attacked by a pathogen, comprising the step of harboring in said host plant a polynucleotide as described above.
  • putatively transformed plants may be evaluated, for instance using Southern analysis. After the initial analysis, which is optional, transformed plants showing the desired copy number and expression level of the polynucleotide according to the invention may be tested for resistance levels against a pathogen.
  • the transformed plants may be grown directly, but usually they may be used as parental lines in the breeding of new varieties or in the creation of hybrids and the like.
  • Plants or edible parts thereof may be used for animal feed or human consumption, or may be processed for food, feed or other purposes in any form of agriculture or industry.
  • Agriculture shall mean to include horticulture, arboriculture, flower culture, and the like.
  • Industries which may benefit from plant material according to the invention include but are not limited to the pharmaceutical industry, the paper and pulp manufacturing industry, sugar manufacturing industry, feed and food industry, enzyme manufacturers and the like.
  • the advantages of the plants, or parts thereof, according to the invention are the decreased need for pesticide treatment, thus lowering costs of material, labor, and environmental pollution, or prolonging shelf-life of products (e.g. fruit, seed, and the like) of such plants.
  • the present invention is also directed to isolated non-coding nucleotide sequences upstream of the NpABCI gene useful as promoters for homologous or heterologous gene expression in plants.
  • the present invention is also directed to vectors and plant cells comprising the isolated nucleotide sequences.
  • heterologous DNA or “heterologous RNA” refers to DNA or RNA that does not occur naturally as part of the genome or DNA or RNA sequence in which it is present, or that is found in a cell or location in the genome or DNA or RNA sequence that differs from that which is found in nature.
  • Heterologous DNA and RNA are not endogenous to the cell into which it is introduced, but has been obtained from another cell or synthetically or recombinantly produced.
  • An example is a human gene, encoding a human protein, operably linked to a non-human promoter.
  • Another example is a gene isolated from one plant species operably linked to a promoter isolated from another plant species.
  • heterologous DNA or RNA may also refer to as foreign DNA or RNA. Any DNA or RNA that one of skill in the art would recognize as heterologous or foreign to the cell in which it is expressed is herein encompassed by the term heterologous DNA or heterologous RNA.
  • heterologous DNA examples include, but are not limited to, DNA that encodes proteins, polypeptides, receptors, reporter genes, transcriptional and translational regulatory sequences, selectable or traceable marker proteins, such as a protein that confers drug resistance, RNA including mRNA and antisense RNA and ribozymes.
  • NpABCI promoter from Nicotiana plumbaginifolia, is used to express introduced genes at high levels and in various plant tissues.
  • a genomic fragment including the 1 ,282 bp region upstream of the NpABCI transcription start (SEQ ID NO:3) was cloned and sequenced and fused to the reporter ⁇ -glucuronidase (gus) gene and introduced into N. tabacum BY2 cells for stable transformation.
  • the transcription promoter was isolated and a search was performed for regulatory elements, using a combination of in vivo and in vitro approaches. Three putative DNA regulatory elements were identified. A 25-fold increase in gus expression was observed when cells were treated with sclareolide and some other terpenes.
  • the combined use of 5' deletion promoter analysis, gel mobility shift assays, DNase I footprinting and site directed mutagenesis permitted to identify three cis-elements SB1 (SEQ ID:5), SB2 (SEQ ID:6) and SB3 (SEQ ID:7) located, respectively, within nucleotides -827 to -802, - 278 to - 243 and -216 to -190 upstream of the NpABCI transcription start.
  • the present invention therefore provides a promoter having a sequence selected from the group comprising: a) a nucleic acid sequence as given in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6, SEQ ID NO:7 or a combination thereof; and b) a nucleic acid sequence that is at least about 60% homologous to the coding regions of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6 and SEQ ID NO:7 or a combination thereof.
  • combination thereof encompasses promoters having a sequence selected from the group comprising the combination of SEQ ID NO:3 with SEQ ID NO:4 and/or with SEQ ID NO:5 and/or with SEQ ID NO:6 and/or with SEQ ID NO:7, or in a different order; the combination of SEQ ID NO:4 with SEQ ID NO:5 and/or with SEQ ID NO:6 and/or with SEQ ID NO:7, or in a different order, combination of SEQ ID NO:5 with SEQ ID NO:6 and/or with SEQ ID NO:7 or in a different order; and/or combinations thereof.
  • said promoter comprises two or more copies of the nucleotide sequence selected from the group comprising SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6 and SEQ ID NO:7or a combination thereof.
  • the present invention also provides chimeric gene, and vector characterized in that they comprise the promoter according to the present invention.
  • the vector is characterized in that it has a cloning site and a terminator functional in a host cell, which is positioned 3' downstream of said promoter.
  • Said vector may further comprise the chimeric gene.
  • the present invention further provides transformant characterized in that it contains the promoters, the chimeric gene or the vector according to the invention.
  • said transformant is a microorganism such as fungi. In another embodiment of the present invention, said transformant is a plant cell.
  • the present invention further encompasses a method for expressing a gene, which is characterized by comprising a step of expressing the desired gene in a host cell under the control of the promoter according to the invention. Accordingly, said promoter can be used for controlling the expression of a desired gene in a host cell.
  • the present invention further provides a method of expressing heterologous genes in plants comprising the steps of (a) recombinantly transforming a portion of the plant in which it is desired to express said heterologous gene with said heterologous gene, in operative association with the promoter according to the invention (b) allowing the plant material so transformed to express such heterologous gene.
  • Such a plant may be a dicotyledonous plant or a monocotyledonous plant.
  • parts of said plants selected from seeds, flowers, tubers, roots, leaves, fruits, pollen and wood, form part of the invention.
  • Figure 1 is a schematic representation of the 593 bp probe obtained by PCR using the primers P235 and ABCS1.
  • S1 nuclease protection assays were carried out, using 50 ⁇ g of mRNA isolated from cultured N. plumbaginifolia cells with (+) or without (-) treatment with 200 ⁇ M sclareolide for 2 h.
  • the DNA fragment, S1ABC, shown in A was labeled by phosphorylation with T4 DNA kinase.
  • the product of a sequencing reaction was simultaneously run on the polyacrylamide gel as a ladder (TCGA). The 5' ends of the protected fragment (in bold) and the surrounding DNA sequence and their distance from the translation start are shown on the right of the Figure. An amount of probe equal to 25% of that used in the assays was run in the right lane (P).
  • C represents the sequence upstream of the translation start site (bold characters) is displayed.
  • the first transcription start site is indicated by the arrow and +1 , the corresponding nucleotide being shown in bold and italics.
  • Putative TATA and CAAT boxes are indicated by the boxes.
  • Figure 2 is a schematic representation of the P1282-GUS construct.
  • LB and RB left and right borders of T-DNA; nos Pro : nopaline synthase promoter; nos Ter : nopaline synthase terminator; nptll : neomycin phosphotransferase. Fusion nucleotides are displayed and translational NpABCI and Gus initiation codon are italicized.
  • FIG. B shows a graph representing the GUS activity of transgenic lines containing the P1282- GUS construct after 16 h treatment with 200 ⁇ M sclareolide or DMSO (solvent control). The data represent the mean of three measurements on each of 12 independent transgenic lines.
  • C is a graph wherein the induction ratio represents the GUS activity in cells treated for 16 h with the indicated sclareolide concentration divided by that of cells treated with solvent. The data represent the means of three measurements on each of 6 independent transgenic lines. The 95% confidence intervals are indicated on the graph.
  • a microsomal fraction (20 ⁇ g) was prepared from the treated cells and subjected to Western blotting using anti-NpABC1 antibodies (NpABCI) or anti-H +- ATPase antibodies (H +- ATPase).
  • Figure 3 is a schematic representation of the 5' deleted regions obtained by PCR, which were fused to the gus reporter gene in the pBi-101.1 transformation vector.
  • the size (bp) of the fragment is indicated following «P», the transcription start site being +1.
  • induction ratio represents the GUS activity of extracts from cells treated with 200 ⁇ M sclareolide for 16 h relative to that untreated cells.
  • the bars represent the 95% confidence interval.
  • the induction ratio (followed by «X») and the number of independent transgenic lines (followed by «L») are indicated to the right of each bar.
  • Figure 4. is a schematic representation of the B3 and B6 DNA fragments used in the mobility shift reactions and their position relative to the transcription start.
  • Lane B is a photograph of a gel retardation analysis using the B3 fragment. Lanes 1-4 and lanes 5-8 correspond to binding reactions using 5 ⁇ g of nuclear proteins from untreated and sclareolide-treated cells, respectively. The unlabeled B3 fragment was used as competitor at molar excesses of 10-fold (lanes 2 and 6), 25-fold (lanes 3 and 7), and 50- fold (lanes 4 and 8). In lane 9, 5 ⁇ g of BSA was used instead of nuclear proteins. The free probe (FP B3) and complex (Cp) are indicated.
  • C is a photograph of a gel retardation analysis using the B6 fragment.
  • Five micrograms of nuclear proteins were used from untreated cells (lanes 1 , 2, 5, and 6) or cells treated with 200 mM sclareolide for 90 min (lanes 3, 4, 7, and 8).
  • a 50-fold molar excess of unlabeled B6 probe (lanes 6 and 8) or 1 ⁇ g of sonicated herring sperm DNA (lanes 2 and 4) was used as competitor DNA.
  • 5 ⁇ g of BSA was used instead of nuclear proteins.
  • the free probe (FP B6) and the two complexes (Cpl and Cpll) are indicated.
  • Figure 5 is a schematic representation of the positions of the B3, B6, and B61 probes used in DNase I footprinting experiments relative to the transcription start (+1). The stars indicate the labeled end for the probes used in B.
  • B shows photographs of sequencing gels wherein the labeled probes were incubated with 30 ⁇ g of nuclear proteins from cells treated (lanes 1 and 4) or not treated (lane 2 and 5) with 200 ⁇ M sclareolide for 90 min or with 30 ⁇ g of BSA (lanes 3 and 6) prior to digestion with DNase I at concentrations of 5 x 10 -3 (denoted as «1 » in lanes 1 , 2, and 3) or 2.5 x 10 -3 unit/ ⁇ l (denoted as «2» in lanes 4, 5 and 6).
  • the resulting samples and the products of a sequencing reaction used as a ladder were separated on a 6% polyacrylamide sequencing gel. The protected regions are shown by the thick vertical gray line and their positions relative to the transcription start are indicated.
  • C represents the nucleotide sequences of the three protected regions found in B.
  • Figure 6 represents the upper strand nucleotide sequences of wild-type NpABCI promoter (SB1-A and SB3- A) and of the mutants (SB1-1 to SB1-7 and SB3-1 to SB3-6). The mutated bases are italicized and boxed.
  • B and C show photographs of gel retardation analysis performed using the indicated double-stranded wild-type or mutated SB1 (B) or SB3 (C) probe.
  • the even and odd lanes contain 5 ⁇ g of nuclear proteins from control cells or cells treated 90 min with 200 ⁇ M sclareolide, respectively.
  • the free probe (FP) and the complex (Cp) are indicated.
  • Figure 7. shows photographs of gel retardation analysis, which was performed using the
  • Figure 8. A shows the mutations within the three identified boxes of the NpABCI promoter were obtained by two-step PCR (Experimental procedures). The mutated nucleotides are italicized and the replaced nucleotides are displayed above. The dark gray boxes show the mutated regions.
  • B is a graph wherein the induction ratio of the different mutants was measured as the GUS activity of extracts from cells treated with 200 ⁇ M sclareolide for 16 h relative to that of control cells. The bars represent 95% confidence intervals. The induction ratio (followed by «X») and the number of independent transgenic lines (followed by «L») are indicated to the right of each bar.
  • Figure 9. A shows the molecular representation of the compounds used in B.
  • B is a graph wherein the GUS activity induction ratio was measured on extracts from two transgenic lines (each 3 measurements) with or without 16 h treatment with the indicated concentration ( ⁇ M) of the different compounds. The bars indicate the 95% confidence intervals.
  • C is a graph wherein the GUS activity induction ratio was measured on extracts from two transgenic lines (each 2 measurements) with or without treatment with the indicated concentrations of salicylic acid (SA) (36 h), methyl jasmonate (MejA) (16 h), or sclareolide (16 h). The bars indicate the 95% confidence intervals.
  • D shows photographs of western blots.
  • the crude soluble protein fractions (15 ⁇ g) used in C were analyzed by Western blotting using antibodies against PR-N (detection of PR-O, PR-N, and PR-2) or PMT (putrescine N-methyl transferase).
  • SEQ ID NO:1 is the polynucleotide encoding the NpABCI protein.
  • SEQ ID NO:2 is the polypeptide sequence of the NpABCI protein.
  • SEQ ID NO:3 is the polynucleotide sequence 1 ,394 bp upstream of the translated region of the NpABCI gene from N. plumbaginifolia genomic DNA.
  • SEQ ID NO:4 is the polynucleotide sequence from position 454 to 1315 of the 1 ,394 bp sequence upstream of the translated region of the NpABCI gene from N. plumbaginifolia genomic DNA.
  • SEQ ID NO:5 is the polynucleotide sequence of the SB1 box
  • SEQ ID NO:6 is the polynucleotide sequence of the SB2 box
  • SEQ ID NO:7 is the polynucleotide sequence of the SB3 box
  • Tobacco BY-2 cells (Nicotiana tabacum cv. Bright Yellow; Nagata et al., (1981) Mol Gen Genet, 184, 161-165) were maintained in MS medium (Murashige, T. and Skoog, F. (1962) Physiol. Plantarum, 15, 473-497) containing 0.2 mg/l 2,4-D, 0.2 g/l KH 2 P0 4 , 50 mg/l of myo-inositol, and 5 mg/l thiamine HCI.
  • DMSO sclareol, sclareolide, abietic acid, and larixol, methyl jasmonate
  • water salicylic acid, pH 5.7 with KOH
  • the Agrobacterium tumefaciens strain GV3101 ::pMP90 C58 was used to perform the genetic transformation of BY2 cells (Koncz, C. and Schell, J. (1986) Mol Gen Genet, 204, 383-396), following the procedure of An (An, G. (1985) Plant Physiol 79, 568-570).
  • Transgenic calli were selected on MS medium containing 0.2 mg/l 2,4-D, 0.2 g/l KH 2 P0 , 50 mg/l myo-inositol, 5 mg/l thiamine HCI, 0.8% agar, 100 mg/l kanamycin, and 400 mg/l carbenecillin and subcultured every two weeks. Liquid cell cultures (same medium) were initiated from the callus. Nicotiana plumbaginifolia DOBA cells were maintained as described in Barfield et al., (1985) Plant Cell Reports, 4, 104-107.
  • Genomic cloning of the 1.4 kb promoter region of NpABCI was used to obtain a 1 ,394 bp sequence upstream of the translated region of the NpABCI gene from N. plumbaginifolia genomic DNA.
  • the promoter region used in this work was then obtained by direct genomic PCR using two primers, PROABC5' (5'- CGCGGATCCTCCTTCTCTTCAACAGTAGAATTGG-3' - SEQ ID:8) and PROABC3' (5'- ATCCCC CGGGGCCATTTTGAGCAATAATTAAGAAGTTCGAC-3' - SEQ ID:9), and was cloned into pGEM-T easy (PromegaTM) and sequenced in both orientations. Three clones from independent PCR reactions were obtained and their sequences checked.
  • the S1ABC DNA probe was obtained by PCR using the primers P388 (5'- CGGATCCGCTATGCTGACTTGGCATGTTTC-3' - SEQ ID: 10) and ABCS1 (5'- CAGCAGCAGCA CCTTGTGATCC-3' - SEQ ID:11 ) and a genomic clone from -611 to 4929 bp as the template. About 100 ng of probe was labeled with 3 units of T4 polynucleotide kinase (RocheTM) and 100 ⁇ Ci of [ ⁇ 32 P]ATP (AmershamTM) in a final volume of 25 ⁇ l.
  • RNA (50 ⁇ g) from treated or untreated cells was mixed with 2 ⁇ l of 5 X hybridization buffer (2 M NaCl, 200 mM Pipes, pH 6.4, 5 mM EDTA), then the mixture was vacuum dried and dissolved in 2 ⁇ l of S1ABC probe (80,000 cpm) and 8 ⁇ l of formamide.
  • the sample was incubated at 85°C for 10 min and at 42°C for 16 h, then diluted with 100 ⁇ l of 0.2 M NaCl, 50 mM sodium acetate, pH 4.6, 1 mM ZnS0 4 , 0.5% glycerol, 20 mg/ml of single-stranded herring sperm DNA, 300 units of nuclease S1 , and incubated for 1 h at 25°C. Nucleic acids were ethanol precipitated and electrophoresed in a denaturing 6% polyacrylamide gel.
  • NpABCI -GUS chimeric gene and modified forms A 1 ,394 bp DNA fragment containing the NpABCI promoter region was released from pGEM-T easy by BamHUSmal restriction, and introduced into the pBi-101.1 binary vector (Jefferson et al., (1987) EMBO J, 6, 3901-3907) to give the construct P1282.
  • Deleted forms of the promoter region were obtained by PCR using the primers P1046 (5'-CGGATCCCATCATCATTCTC CACTTGCCG-3' - SEQ ID: 12), P840 (5'-CGGATCCCCTAAAGAACTCTTCACTA ACAC- 3' - SEQ ID: 13), P641 (5'-CGGATCCTAGGCTCACATTAATGGGGTG-3' - SEQ ID: 14), P496 (5'-CGGATCCGCTAAGATCCCA AGTCC AATG-3' - SEQ ID:15), P388 (5'- CGGATCCGCTATGCTGACTTGGCATGTTTC-3' SEQ ID: 16), P235 (5'- CGGATCCCTCATTTGGTCACATATGCTCC-3' - SEQ ID:17), and P77 (5'- CGGATCCAAACAATG CTATAGCCGCCCC-3' - SEQ ID: 18) at the 5' end and the PROABC3' primer at the 3' end.
  • Each fragment was
  • MutSBI was obtained with primers (5'-TCTCTGCAGGTCCCACACCGACA AAGAGTTCTTTAGGAAATTTTCATTCTC-3' - SEQ ID:19) and (5'- GGTGTGGGACCTGCAGATGAGG CTCGAAAGAATTTAATCAAGAATTATTTTGAC-3' SEQ ID:20), MutSB2 was obtained using primers (5'-
  • GUS assay Cells (day 4 subcultures) were treated for 16 h with 200 ⁇ M sclareolide or an equivalent volume of solvent. Cells (1.5 ml) were collected by centrifugation for 3 min at 2,700 g, suspended in 300 ⁇ l of grinding buffer (50 mM NaHP0 4l pH 7.0, 10 mM EDTA, 0.1% sodium laurylsarcosine, 0.1% Triton X-100, 10 mM ⁇ -mercaptoethanol), and homogenized for 40 s using glass beads (0.2 mm diameter) in a Mini bead-beater homogenizer (BiospecTM). GUS activity was determined fluorometrically as described by Jefferson et al (1987). Protein content was measured as described by Bradford (Bradford, M.M. (1976). Anal Biochem, 72, 248-254), using BSA as a standard.
  • BY2 cells (day 4 subcultures) were treated for 90 min with 200 ⁇ M sclareolide or the same volume of solvent. Cells were harvested by vacuum filtration and nuclear proteins extracted and stored at -80°C as described by Shen and Gigot, (Shen, W.H. and Gigot, C. (1997) Plant Mol Biol, 33, 367- 379). Nuclear extracts used for footprinting were concentrated to 3 mg/ml of proteins under N2 pressure (3.5 kPa), using an AMICONTM (MCOW 3000) filter.
  • DNA probes for gel retardation and footprinting DNA fragments were generated either by PCR or by the annealing of synthetic oligonucleotides (sequences shown in Figure 6). Annealing of double strands was performed by mixing two complementary DNA oligonucleotides at 90°C for 5 min, then allowing the temperature to fall to 20°C. Probes B3 and B6 were generated by PCR using the primers P840 and P593 (5'- CTCATCTTGCAAGCATCTTAACTAC-3' - SEQ ID:25) or P388 and P190 (5'- CTTCTATAATTACTGTT CATAAGGAGTC-3' - SEQ ID:26).
  • DNA 100 ng was labeled with 3 units of T4 polynucleotide kinase (RocheTM) and 100 ⁇ Ci of [ ⁇ 32 P]ATP (AmershamTM) (50 ⁇ l). Free nucleotides were removed using the PCR purification kit (RocheTM) for probes B3 and B6 or Sephadex Microspin G-25 columns (PharmaciaTM) for smaller probes. The DNA fragments were then phenol extracted, ethanol precipitated, and dissolved in water.
  • Labeled fragment B61 was obtained by PCR using the labeled P61 primer (5'-CTTTGTC TGCTTTGACTGCTGCCTCTCC- 3' - SEQ ID:29) and P7 (5'- GCAGCAAAGAGGAAGGGGCGGC- 3' - SEQ ID:30), and purified as described above.
  • Protein-DNA binding for gel retardation assays was carried out in a final volume of 20 ⁇ l of 25 M HEPES (pH 8.0, KOH), 5 mM MgCI 2 , 50 mM KCI, 0.1 mM Na 2 EDTA, 10% [v/v] glycerol, 1 ⁇ g/ ⁇ l of poly (dl-dC), 1 ⁇ g of BSA, containing 5 ⁇ g of nuclear proteins and 5,000 cpm of labeled probe.
  • the running buffer was 6.5 mM Tris-HCI, 0.1 mM Na 2 EDTA, 3.3 mM sodium acetate, 0.5 mM MgCI 2 , pH 8.0. After electrophoresis at 200 V and 4°C, the gels were dried on Whatman 3MM paper and autoradiographed.
  • Protein-DNA binding for footprinting was carried out as above, but using 30 ⁇ g of nuclear proteins and 5,000 cpm of 5'-end labeled probe. Following this incubation, 40 ⁇ l of 25 mM Hepes (pH 8.0 KOH), 5 mM MgCI 2 , 50 mM KCI, 0.1 mM Na 2 EDTA, containing 5 x 10 -5 or 2.5 x 10 -5 U of DNase I (RocheTM) was added.
  • the reaction was stopped by the addition of 240 ⁇ l of 0.3 M NaCl, 0.5% SDS, and 5 mM Na 2 EDTA pH 8.0 HCI, then the mixture was extracted twice with phenol/chloroform incubated at 80°C for 5 min, and the nucleic acids precipitated with ethanol.
  • the pellets were washed twice with 70% ethanol, allowed to dry at room temperature, and solubilized in sequencing loading dye (85% formamide, 1 X TBE, 0.05 % xylene cyanol, 0.05% bromophenol blue).
  • sequencing loading dye 85% formamide, 1 X TBE, 0.05 % xylene cyanol, 0.05% bromophenol blue.
  • the samples were then denaturated at 95°C for 5 min and electrophoresed on a 5% polyacrylamide-urea sequencing gel, then the gel was dried on Whatman 3MM paper and autoradiographed.
  • Microsomal fractions were prepared from day 4 subcultures of BY2 cells following the procedure described by Jasinski et al., (2001).
  • the membrane was sequentially incubated with rabbit antibodies specific for NpABCI (Jasinski et al., 2001), H + -ATPase (Morsomme et al., (1998) J Biol Chem, 273, 34837-34842), PR-N (Niki et al., 1998), or putrescine N-methyl transferase (Shoji et al., 2000), and alkaline phosphatase- conjugated anti-rabbit IgG antibodies (RocheTM), binding of which was detected by chemiluminescence.
  • NpABCI transports out of the cell sclareol and other metabolites that accumulate at the leaf surface and protect the plant against pathogens.
  • NpABCI When a plant was infected by a pathogen (Pseudomonas syringae) or an insect (Trialeurodes vaporarium), NpABCI was induced in the whole leaf, showing that this transporter is also involved in an induced defense mechanism. NpABCI thus participates in a constitutive defense system.
  • N. plumbaginifolia genomic fragment was obtained including the 1 ,394 bp region upstream of the NpABCI translation initiation codon (SEQ ID NO:3).
  • a subclone ( Figure 1A) was used to map the transcription start site in an S1 nuclease protection experiment. RNA extracted from cultured N. plumbaginifolia cells which show high expression of NpABCI upon addition of sclareol or sclareolide to the culture medium (Jasinski et al., 2001).
  • P1282-GUS construct were designed in which the reporter gene, ⁇ -glucuronidase (gus), was fused in frame to a 1 ,394 bp DNA fragment ending at the NpABCI translation start ( Figure 2A).
  • This construct was introduced into a binary vector and transferred, through Agrobacterium tumefaciens- mediated transformation, into the genome of N. tabacum BY2 cultured cells.
  • the gus gene expression driven by the NpABCI promoter region was increased 25-fold after treatment with sclareolide ( Figure 2B).
  • deletion to -641 significantly decreased inducibility from an average of 25-fold to 12-fold. While further deletion down to -388 (see P496 and P388) did not have any significant effect, deletion to -235 (P235) reduced the inducibility to 2.1 -fold. The last deletion (P77) resulted in an almost inactive promoter.
  • B3 and B6 probes were each divided into three overlapping probes (-840 to -743, -770 to -651 , -680 to -593 and -388 to -310, -338 to - 241 , -263 to -190, respectively. Binding activities were shown to be restricted within two regions: from -840 to -743 bp and from -263 to -190 bp (data not shown).
  • SB1-A, SB2-A, and SB3-A were designed to cover the three identified boxes SB1 , SB2, and SB3, respectively; the sequences for SB1-A and SB3-A are shown in Figure 6A.
  • SB1-A and SB3-A formed specific retarded complexes ( Figures 6B and C), whereas SB2-A did not (data not shown), indicating that this short fragment was unable to stably bind a protein factor.
  • SB1-A and SB3-A The regions in SB1-A and SB3-A that were critical for factor binding were determined using the mobility shift assay and several probes, each bearing 3-4 adjacent mutated nucleotides ( Figure 6A).
  • the first SB1-A-derived mutant (SB1-1) showed a dramatically reduced ability to bind nuclear factors, while mutants SB1-2, SB1-3, and SB1-4 completely failed to bind; in contrast, mutants SB1-5, SB1-6, and SB1-7 were as effective as SB1-A.
  • This analysis restricted to 16 the number of nucleotides involved in this in vitro DNA-protein association, i.e. 'CACTAACACAAAGTAA'.
  • Similar experiments on SB3 showed that the 15-nucleotide sequence TTATGAACAGTAATT - SEQ ID:33 was essential for nuclear factor recruitment.
  • GT-like sequences could also be recruited by 3AF1 factors, since 3AF1 could contact AT- rich sequences (Ouwerkerk et al., (1999) Mol Gen Genet, 261 , 610-22).
  • a dimer of box VI from the Rbcs3A promoter (Lam et al., (1990) Plant Cell 2, 857-866) (5 ⁇ AATAGATAAATAAAAACATT-3' - SEQ ID:35) was used alternatively as a 3AF1 probe or competitor. This sequence was able to compete with the SB1-A probe ( Figure 7A). Addition of SB1-A partly decreased the amount of the complex formed with the 3AF1 probe, suggesting that SB1 might be recruited by factors related to 3AF1.
  • SB1 CACTAACACAAAGTAA
  • SB2 TAATAA ATAATTACCCTCGAAGTTTCTTTCAAG - SEQ ID:36
  • SB3 TAATAA ATAATTACCCTCGAAGTTTCTTTCAAG - SEQ ID:36
  • the SB2 sequence alone was unable to recruit a transcription factor. Moreover, it appeared as non-essential for sclareolide-mediated NpABC1-gus induction in vivo.
  • the sequence might be an accessory element, the activity of which could be supplied by other elements, such as SB1.
  • SB2 might contribute to the response to other stresses or, in planta, to the tissue-specific regulation of NpABCI expression.
  • SB3 box fits with the GT-1 or 3AF1 consensus (Zhou, 1999; Ouwerkerk et al., 1999), no competition was found between SB3 and GT-1 or 3AF1.
  • the SB3 sequence did not show any clear similarity to other already identified motifs except for a degenerated C-box (TGACGTCA). This motif was first described in the cauliflower mosaic virus and has been shown to mediate wound, salicylic acid and auxin transcriptional activation (Katagiri et al., (1989) Nature, 340, 727-730; Niggeweg et al., (2000a) J Biol Chem, 275, 19897-19905).
  • SB3 thus represents a major element of the NpABCI promoter. Whether it is sufficient or not for sclareolide induction requires gain-of- function experiments involving the association of SB3 and possibly other NpABCI promoter sequences with a minimal promoter.
  • sclareolide treatment might result in post-translational modification of a protein in the complex, thereby facilitating its interaction with the transcription machinery leading to NpABCI induction.
  • Post-translational activation of DNA-binding proteins or co-activators by, for example, kinases and phosphatases or acetylases is well documented in the plant kingdom and other eukaryotic systems. Transcription activation might also occur indirectly through modification of the chromatin structure (reviewed in Schwechheimer C, Bevan M. (1998) Trends Plant Sci 3, 378-383; Martinez, E. (2002) Plant Mol. Biol. 50, 925-947).
  • sclareolide is a very convenient means of inducing expression of NpABCI and the gus reporter gene fused to the NpABCI transcriptional promoter, it is not a major diterpene produced in Nicotiana spp., whereas sclareol is (see Figure 9A for their respective structure).
  • the effect of sclareol treatment on NpABCI -gus expression was examined and it was found that, at a concentration of 100 ⁇ M, it caused a 68- fold induction of GUS activity (Figure 9B), a result even greater than that seen with sclareolide ( Figure 2). Higher sclareol concentrations resulted in less gus induction, probably because of cell toxicity (data not shown).
  • NpABCI is upregulated by its own substrate, a physiological compound synthesized by plant cells (Jasinski et al., 2001). It was shown that induction of NpABCI expression was not restricted to sclareol or sclareolide, but could also be caused by other molecules, such as abietic acid or larixol, two diterpenoids chemically related to sclareol and found in plants.
  • NpABCI -gus expression is increased by methyl jasmonate, but not by salicylic acid or ethylene Because high sclareolide concentrations seem to be toxic for cells, induction of NpABCI - gus expression might be considered as a stress response.
  • the response of the plant to abiotic or biotic stress generally involves cross talk among at least three different signaling pathways involving mediator molecules, such as salicylic acid, methyl jasmonate, and ethylene (Reymond, P. and Farmer, E.E. (1998) Curr Opin Plant Biol, 1 , 404-411).
  • Salicylic acid has been implicated as a key signal molecule in the establishment of systemic acquired resistance (SAR) (Hunt et al., (1996) Gene, 179, 89-95.).
  • SAR systemic acquired resistance
  • PR proteins used as marker of the salicylic acid response (Niki et al., (1998) Plant Cell Physiol, 39, 500- 507; Yamakawa et al., (1998) Plant Physiol, 118, 1213-1222), were strongly induced at 200 ⁇ M, although higher concentrations had less effect (Figure 9D).
  • Methyl jasmonate a lipoxygenase product of linolenic acid, also a signal molecule that is released by plants in response to various stimuli, was also tested. Methyl jasmonate treatment resulted in increased GUS activity (Figure 9C). This effect involves SB3 since mutation of the latter (MutSB3) abolished NpABC1-gus expression upon methyl jasmonate treatment (data not shown).
  • Methyl jasmonate also increased the level of putrescine N-methyl transferase (Figure 9D), used as a marker (Shoji et al., (2000) Plant Cell Physiol, 41 , 1072-1076; Imanishi et al., (1998) Plant Mol Biol, 38, 1101-1111). This could suggest that sclareolide induces a stress response involving methyl jasmonate; however, it was found that the expression of putrescine N-methyl transferase was not increased by sclareolide ( Figure 9D), suggesting that the signaling pathway leading from sclareolide to NpABCI induction does not use the methyl jasmonate pathway. Finally, the ethylene pathway was stimulated by treating cells with the ethylene generator, ethephon. No modification of GUS activity was found (data not shown).
  • Methyl jasmonate has been shown to promote the production of defense molecules, such as diterpenes (Ketchum et al., (1999) Biotechnol Bioeng, 62, 97-105; Martin et al., (2002) Plant Physiol, 129, 1003- 1018). It is believed that methyl jasmonate might stimulate diterpene biosynthesis and, as a consequence, NpABCI expression.
  • SEQ ID NO:2 translation product of SEQ ID NO 1
  • SEQ ID NO:5 SB1 box CACTAACACA AAGTAA

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Insects & Arthropods (AREA)
  • Pest Control & Pesticides (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The present invention relates to the use of an isolated polynucleotide to induce or enhance the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells, wherein said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO: 1 or the complement thereof; (b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO : 1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65 % identical to SEQ ID NO: 1; (d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c); (e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO: 2; (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO: 2; and(g) fragments and variants of such polynucleotides in (a) to (f).

Description

Use of NpABCI transporter and promoter thereof
Field of the invention
The present invention relates to the use of Nicotiana NpABCI -transporter. More specifically, the invention relates to the use of Nicotiana NpABCI -transporter to enhance the production and/or secretion of taxane-type diterpene and/or derivative thereof in plants and plant cell cultures. The present invention also relates to the use of NpABCI transporter for protecting plants from damage caused by pathogens. In a third aspect, the present invention relates to the NpABCI promoter.
Background to the invention
ATP binding cassette (ABC) transporters, which are found in all organisms, catalyze ATP- dependent transport of endogenous or exogenous substrates across biological membranes (Borst, P., (1997) Seminar in Cancer Biology 8: 131-213) and/or allosterically modify the function of heterologous proteins (Higgins CF, 1995, Cell 82: 693-696). Several ABC transporters have been associated with clinically relevant phenotypes including the phenomenon of multidrug resistance. ABC transporters are encoded by a large family of genes. For instance, in Arabidopsis, 105 putative intrinsic membrane ABC genes have been predicted from the genome (Sanchez-Fernandez et al., (2001a) J Biol Chem, 276, 30231-30244.; Martinoia et al., (2002). Planta, 214, 345-355). NpABCI , is a Nicotiana plumbaginifolia PDR-type ABC transporter which is expressed in the leaf epidermis (Jasinski et al., (2001 ) Plant Cell, 13, 1095-1107) and is induced by sclareol a diterpene, as well as by sclareolide a close analogue thereof.
Taxanes are diterpene compounds containing a taxane skeleton. For example, Taxol is a naturally occurring compound originally isolated from the stem bark of the Western Yew, Taxus brevifolia. Taxol is an important chemotherapeutic agent for the treatment of human ovarian, breast and lung cancers and is considered as a promising therapeutic agent for the treatment of other human cancers. Taxanes such as taxol are characterized by a highly structurally complex diterpene skeleton that has thus far eluded total chemical synthesis. Therefore, large-scale synthesis from simple available chemicals is not likely to be a feasible option for the next few years. The total chemical synthesis method has not been practically applied in the art, since it requires very expensive chemical reagents and the yield is not so high, which can be expected from the complicated chemical structure of taxol.
The semi-synthesis method employing precursors such as 10-deacetylbaccatin III, has revealed some drawbacks since it essentially entails complicated and multiple steps of isolating and purifying the taxol precursors from Taxus genus plants and transforming the precursors to taxol.
In this regard, the extraction method by which taxol can be isolated from Taxus genus plants in a direct manner, has prevailed in the art, since it has the advantage of economy. However, the said method has proven to be less satisfactory in the sense that it essentially requires a large amount of yew trees to purify taxol, which finally gives rise to the serious environmental disruption.
The problems of obtaining useful metabolites from natural sources may potentially be circumvented by cell culture. Although plant cell cultures might be somewhat sensitive for shear forces, many cultures can be grown in large bioreactors without difficulty.
U.S. Pat. No. 5,019,504 discloses a method for producing taxol and its derivative utilizing cultured cells of Taxus brevifolia. However, the yield of taxol described is insufficient for industrial application. Besides, the production of taxol by the cell culture is unstable and even when a primary cell of high productivity can be obtained by selection, it is difficult to keep its content by subculturing.
U.S. Pat. No. 5,015,744 teaches a semi-synthetic method from baccatin III, which is a precursor in biosynthesis of taxol. By the use of the plant tissue culture, a raw material for the semi-synthetic process such as baccatin III can be produced, thus the plant tissue culture can also be utilized for taxol production by the above-mentioned semi-synthetic process.
WO 93/17121 offers a method for taxol production by cell culture of Taxus genus plants while changing composition of medium, growth rate, and production rate.
Despite the promising features and developments, the production of plant-derived pharmaceuticals by plant cell cultures has not been fully commercially exploited. The main reasons for this reluctance shown by industry to produce taxane-type diterpenes by means of cell cultures, compared to the conventional extraction of whole plant material, are economical ones based on the slow growth and the low production levels of said compounds by such plant cell cultures. An important cause is the toxicity of such compounds to the plant cell. Another important problem is that said compounds are mostly retained intracellularly complicating the downstream processing and purification.
The invention aims primarily at enhancing or inducing the production and/or secretion of taxane-type diterpenes and/or derivatives thereof, in plants or plant cell cultures. More in particular, it is an object of the present invention to provide plants or plant cell cultures with induced or enhanced taxol production and/or secretion.
Plants play a critical role as nutrients for animals, including humans, and for the production of substances useful as pharmaceuticals, cosmetics and the like. The steady growth in the world's population results in increasing needs for plant crops. This increased need must be satisfied with reduced soil resources available to agriculture. Increased crop yield can be provided with existing soil resources by engineering plant species that grow better and that are more resistant to plant pathogens.
Plants are subjected to threats by numerous pathogens, e.g., fungi, bacteria, viruses, nematodes, aphids, insects and other pests. A strategy to combat fungal disease includes the use of chemical fungicides. However, this involves high expense and environmental cost.
The effect of a pathogen on a plant and on the economics of crop production can be very serious. Especially in the case of agronomically important crops such as tomato, potato, rice and corn, this effect can be enormous if not disastrous. Accordingly, there is a need for plants that are less vulnerable to pathogens and/or to plants that are more capable of defending themselves against invading pathogens.
It is therefore a further object of the present invention, to enhance pathogen resistance in plants or plant cell cultures. More in particular it is an object of the present invention to provide plants or plant cell cultures protected from damage caused by pathogens. It is also a goal of the present invention to provide for methods for enhancing resistance of plants or plant cell cultures against pathogens.
Transgenic techniques have become a powerful tool for addressing important biological problems in multicellular organisms, and this is particularly true in the plant field. Many approaches that were impossible to implement by traditional genetics can now be realized by transgenic techniques, including the introduction of homologous or heterologous genes into plants, with modified functions and altered expression patterns. The success of such techniques often depends upon the use of promoters to control the expression of the transgenes. Still the need exists for new promoters from plant origin.
It is therefore an aim of the present invention to provide a new plant-derived promoter. It is a further aim of the present invention to provide fragments of DNA comprising the promoter according to the present invention. It is a further aim of the present invention to provide transgenic plants or plant cell cultures (parts and/or seeds thereof) comprising the promoter according to the present invention, including plants or plant cell cultures (or parts of plants) and seeds derived from said transgenic plants.
Summary of the invention
In the present invention it was surprisingly found that secretion of terpenes and/or derivatives thereof, in plants and plant cell cultures can be enhanced by the transformation of a polynucleotide corresponding to the NpABCI gene, variants, fragments or functional fragments thereof encoding a polypeptide corresponding to the NpABCI transporter or a functional fragment thereof to the plants or plant cells producing the desired terpene.
According to a first embodiment, the present invention provides an isolated polynucleotide that induces or enhances the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells, wherein said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof; (b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1; (d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c), (e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (g) fragments and variants of such polynucleotides in (a) to (f).
In another embodiment, the invention provides an isolated polypeptide that induces or enhances the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells, wherein said polypeptide is selected from the group comprising: (a) a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1 ; (b) a polypeptide encoded by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (c) a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (d) a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (e) variants or fragments or functional fragments of such polypeptides in (a) to (d).
Sometimes the slow growth of plant cells producing taxane-type diterpenes is due to the toxicity of said metabolites which are produced inside the plant cells. The present inventors have surprisingly found that the toxicity can largely be increased by preventing the expression of the NpABCI gene encoding the NpABCI transporter in the plant cells producing taxane-type diterpenes.
Another aspect of the invention is drawn to the use of a polynucleotide corresponding to the NpABCI gene or a functional fragment thereof, or encoding a polypeptide corresponding to the NpABCI protein or a functional fragment thereof for protecting plants from damage caused by pathogens, wherein said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO: 1 or the complement thereof; (b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c), (e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (g) fragments and variants of such polynucleotides in (a) to (f).
In another embodiment, said polypeptide is selected from the group comprising: (a) a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1 ; (b) a polypeptide encoded by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1; (c) a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (d) a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (e) variants or fragments or functional fragments of such polypeptides in (a) to (d). In a third aspect, the present invention provides isolated non-coding nucleotide sequences upstream of the NpABCI gene useful as promoters for homologous or heterologous gene expression in plants.
More in particular, the present invention provides a promoter having a sequence selected from the group comprising: a) a nucleic acid sequence as given in SEQ ID NO 3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6, SEQ ID NO:7 or a combination thereof; and b) a nucleic acid sequence that is at least about 60% homologous to the coding regions of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6 and SEQ ID NO:7 or a combination thereof.
These and other features and advantages of the present invention will be described in detail in the description and examples set forth below.
Detailed description
A first aspect of the present invention relates to the use of a polynucleotide corresponding to the NpABCI gene or a functional fragment thereof, or encoding a polypeptide corresponding to the NpABCI protein or a functional fragment thereof for inducing or enhancing the production and/or secretion of taxane type diterpene and/or derivative thereof in plants or plant cells.
According to the invention said polynucleotide for use in the present invention is selected from the group comprising (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof; (b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO: 1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c), (e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (g) fragments and variants of such polynucleotides in (a) to (f).
In another embodiment, the polypeptide is selected from the group comprising: (a) a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1 ; (b) a polypeptide encoded by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1; (c) a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (d) a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (e) variants or fragments or functional fragments of such polypeptides in (a) to (d).
As used herein, "fragment" refers to a polypeptide or polynucleotide corresponding to at least 25% of the polynucleotide or polypeptide sequence, typically at least 50% to 75%, generally at least 90% of the polypeptide or polynucleotide sequence. If desired, the fragment may be fused at either terminus to additional amino acids or base pairs, which may number from 1 to 20, typically 50 to 100, but up to 250 to 500 or more.
As used herein "functional fragment" refers to a polypeptide fragment possessing the biological property of inducing or enhancing the production or the secretion of at least one secondary metabolite in plants or plant cells.
As used herein the terms "identical" or percent "identity" in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i. e. 65% identity over a specified region), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using sequence comparison algorithms or by manual alignment and visual inspection. The present invention is also directed to the use of a polynucleotide as described above, which comprises or alternately consists of a nucleic acid sequence which is at least 65%, 70%, 75%, 80%, 90%, 95%, 96%, 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identical to the nucleic acid sequence SEQ ID NO:1. The present invention is also directed to the use of a polypeptide as described above, which comprises or alternately consists of an amino sequence which is at least 65%, 70%, 75%, 80%, 90%, 95%, 96%, 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identical to the amino acid sequence as given in SEQ ID NO:2.
By a polypeptide having an amino acid sequence of at least for example 95% to the amino acid sequence as given in SEQ ID NO:2, it is intended that the amino acid sequence of the polypeptide is identical to said sequence except that the amino acid sequence may include up to five amino acid alteration per each 100 amino acids of said SEQ ID N:2. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to SEQ ID NO:2 up to 5% of the amino acids in said sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acids in said sequence may be inserted into said sequence. Similarly, by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 , it is intended that the nucleotide sequence of the polynucleotide is identical to SEQ ID NO:1 except that the nucleotide sequence may include up to five nucleic acid alterations per each 100 nucleic acid of said SEQ ID NO:1.
The present invention also relates to the use of an expression cassette comprising a polynucleotide as described above to induce or to enhance the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells. Said polynucleotide encodes the NpABCI transporter or a functional fragment thereof.
As used herein the term "expression cassettes", refers to DNA constructs preferably including (5' to 3' in the direction of transcription): a promoter region, a polynucleotide as described above operatively linked with the transcription initiation region, and a termination sequence including a stop signal for RNA polymerase and a polyadenylation signal. It is understood that all of these regions should be capable of operating in the cells to be transformed. The promoter region comprising the transcription initiation region, which preferably includes the RNA polymerase binding site, and the polyadenylation signal may be native to the biological cell to be transformed or may be derived from an alternative source, where the region is functional in the cell.
As used herein the term "enhanced production" means that the level of taxane type diterpene may be enhanced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or at least 100% relative to the untransformed plant cell which was used to transform with an expression vector comprising an expression cassette further comprising the gene coding for NpABCI transporter or variants or fragments or functional fragments thereof. An enhanced production of taxane type diterpene can result in a detection of a higher level of taxane type diterpene in the extracellular medium of the plant cell culture. Alternatively, a higher level of taxane type diterpene can be detected inside the plant cells, for example in the vacuole.
As use herein an "enhanced secretion of at least one taxane type diterpene and/or derivatives thereof means that there exists already a detectable secretion of the taxane type diterpene in the extracellular medium of the plant cell culture and that an increase of said taxane type diterpene can be measured by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% compared to basal secretion by the untransformed plant cell culture. An "enhanced secretion" does not necessarily mean that there is a higher production, it can also mean that there exists the same level of production but that the secretion is enhanced. An "induced secretion of at least one taxane type diterpene" means that there is no detectable secretion of the taxane type diterpene in the extracellular medium of the untransformed plant cell culture or plant but that the detection becomes possible upon carrying out the transformation according to the invention.
As used herein the term "secretion" means secretion of a taxane type diterpene across the plasma membrane or secretion across both the plasma membrane and the cell wall of a plant cell.
The present invention further encompasses the use of an expression cassette as described above to induce or to enhance the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, wherein said expression cassette further comprises a promoter operably linked to said polynucleotide encoding NpABCI - transporter. The NpABCI gene may be expressed in for example a plant cell under the control of a promoter that directs constitutive expression or regulated expression.
As used herein, the term "operably linked" refers to linkage of a DNA segment to another DNA segment in such a way as to allow the segments to function in their intended manners. A DNA sequence encoding a gene product is operably linked to a regulatory sequence when it is ligated to the regulatory sequence, such as, for example a promoter, in a manner which allows modulation of transcription of the DNA sequence, directly or indirectly. For example, a DNA sequence is operably linked to a promoter when it is ligated to the promoter downstream with respect to the transcription initiation site of the promoter and allows transcription elongation to proceed through the DNA sequence. A DNA for a signal sequence is operably linked to DNA coding for a polypeptide if it is expressed as a pre-protein that participates in the transport of the polypeptide. Linkage of DNA sequences to regulatory sequences is typically accomplished by ligation at suitable restriction sites or adapters or linkers inserted in lieu thereof using restriction endonucleases known to one of skill in the art.
Regulated expression comprises temporally or spatially regulated expression and overexpression and any other form of inducible or repressible expression. Temporally means that the expression is induced at a certain time point, for instance, when a certain growth rate of the plant cell culture is obtained (e. g. the promoter is induced only in the stationary phase or at a certain stage of development). Spatially means that the promoter is only active in specific organs, tissues, or cells (e.g. only in roots, leaves, epidermis, guard cells or the like). Other examples of regulated expression comprise promoters whose activity is induced or repressed by adding chemical or physical stimuli to the plant cell.
In another embodiment, said promoter corresponds to the intrinsic promoter of the NpABCI gene or a functional derivative thereof, and has a sequence selected from the group comprising: a) a nucleic acid sequence as given in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6, SEQ ID NO:7 or a combination thereof; and b) a nucleic acid sequence that is at least about 60% homologous to the coding regions of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6 and SEQ ID NO:7 or a combination thereof.
Alternatively, the NpABCI transporter or functional fragment thereof can be placed under the control of a constitutive promoter. A constitutive promoter directs expression in a wide range of cells under a wide range of conditions.
Examples of constitutive plant promoters useful for expressing heterologous polypeptides in plant cells include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, or the figwort mosaic virus 35S promoter which confer constitutive, high-level expression in most plant tissues including monocots. Other constitutive promoters contemplated for use in the present invention include, but are not limited to: T-DNA mannopine synthetase, opaline synthase, nopaline synthase (NOS) and octopine synthase (OCS) promoters. In an embodiment of said invention, said promoter is cauliflower mosaic virus (CaMV) 35S promoter.
The expression cassette is usually provided in a DNA or RNA construct which is typically called an "expression vector" which is any genetic element, e. g., a plasmid, a chromosome, a virus, behaving either as an autonomous unit of polynucleotide replication within a cell (i. e. capable of replication under its own control) or being rendered capable of replication by insertion into a host cell chromosome, having attached to it another polynucleotide segment, so as to bring about the replication and/or expression of the attached segment. Suitable vectors include, but are not limited to, plasmids, bacteriophages, cosmids, plant viruses and artificial chromosomes. The expression cassette may be provided in a DNA construct which also has at least one replication system. In addition to the replication system, there will frequently be at least one marker present, which may be useful in one or more hosts, or different markers for individual hosts. The markers may a) code for protection against a biocide, such as antibiotics, toxins, heavy metals, certain sugars or the like; b) provide complementation, by imparting prototrophy to an auxotrophic host: or c) provide a visible phenotype through the production of a novel compound in the plant.
Exemplary genes that may be employed include neomycin phosphotransferase (NPTII), hygromycin phosphotransferase (HPT), chloramphenicol acetyltransferase (CAT), nitrilase, and the gentamicin resistance gene. For plant host selection, non limiting examples of suitable markers are ?-glucuronidase, providing indigo production, luciferase, providing visible light production, Green Fluorescent Protein and variants thereof, and the mutated aroA gene, providing glyphosate resistance.
The present invention relates to the use of an expression cassette as described above to induce or enhance the production or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells, comprising: transforming said plants or plant cell with an expression vector comprising said expression cassette, selecting transformed plants or plant cells with an enhanced production, and propagating such selected transformed plants or plant cells.
In another embodiment of the invention, DNA sequences encoding NpABCI transporter are used to enhance the production and/or the production of at least one taxane-type diterpene and/or derivative thereof, in plants comprising the transformation of said plants with an expression vector comprising an expression cassette further comprising a gene coding for the NpABCI transporter or a functional fragment thereof.
By the term "to enhance the production" it is meant that the level of one or more taxane- type diterpene and/or derivative thereof, may be enhanced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or at least 100% relative to the untransformed plant which was used to transform with an expression vector comprising an expression cassette further comprising a gene coding for NpABCI -transporter.
An enhanced production of a taxane-type diterpene and/or derivative thereof can result in a detection of a higher level of taxane-type diterpene in the plant, for example in the vacuole. In another embodiment, the enhanced production of at least one taxane-type diterpene and/or derivative thereof leads to an enhanced secretion. In yet another embodiment, the same production of at least one taxane-type diterpene and/or derivative thereof, occurs in the transformed plant but an enhanced secretion of at least one taxane- type diterpene and/or derivative thereof, occurs by said transformed plant. Non-limiting examples of the plant or plant cells to be used in the present invention which produces the taxane-type diterpene comprise those belonging to genus Taxus, in which taxol and taxol-like compounds, or taxanes, can be produced in very high yield from all known Taxus species, i.e., brevifolia, canadensis, cuspidata, baccata, globosa, fioridana, wallichiana, media and chinensis.
The invention can even be practiced in plant species that are presently not amenable for transformation, as the amenability of such species is just a matter of time and because transformation as such is of no relevance for the principles underlying the invention.
According to the present invention, the taxane-type diterpenes are not particularly limited to any diterpene as far as it has a taxane skeleton, and the illustrative examples include, taxol, 7-epitaxol, baccatin III, 7-epibaccatin III, cephalomannine, 7-epicephalomannine, 10-deacetylbaccatin III, 10-deacetylcephalomannine, 10-deacetyltaxol, 7-xylosyltaxol, 7- xylosylcephalomannine, 7-xylosylbaccatin III, taxagifine, an analogue thereof, taxane la, an analogue thereof and the like. In a preferred embodiment said taxane type diterpene is taxol.
Furthermore, the present invention is not limited to the taxane-type diterpenes, but encompasses the production and/or the section of any terpene, including terpenoid indole alkaloid, terpenoids compounds (monoterpenoids, iridoids, sesquiterpenoids, triterpenoids and diterpenoids such as sclareol- and sclareolide-like compounds). Non-limiting examples include myrcene, geraniol, α-terpinene, cineole, menthone, menthol, carvone, thujone, farnesol, eudesmol, bulgarene, atractylone, caryophyllene, aromadendrene, linderene, germacrone, limonene, camphor, α-pinene, guaiol, β-selinene, valerane, β- vetivone, eremophilone and the like. Sclareol-like compounds are diterpene compounds, and include but are not limited to sclareol, 13-episclareol, ferruginol, salvipisone, aethopisome, neoclerodane, sagequinone, romulgarzone, ortho-benzoquinone, para- benzoquinone, clariol, and the like. Other sclareol-like compounds include but are not limited to abietane diterpenoids, icetaxane diterpenoids, languidulane diterpenes, paryin diterpenes, pimarine diterpenes, methylene quinine diterpenoids, manyol norditerpenoids, multicaulin, salvipimarone and primane diterpenoid. See, for example, the types of compounds set forth in Gonzalez et al., Can. J. Chem. 67(2), 208-212(1989); Banthorpe et al., Phytochem. 29, 2145-2148 (1990); Kouzi et al., Helv. Chim. Acta. 73(8), 2157-2164 1990); Abraham, Phytochem. 36(6) 1421-1424 (1994); Ulubelen et al. Phytochem. 36(4), 971-974 (1994); Hanson, Nat. Prod. Rep., 13, 59-71 (1996) and Topcu et al., J. Nat. Prod. 59, 734-737 (1996). Sclareolide-like compounds are fused-ring diterpene compounds and include, for example, sclareolide, ambrox, and wiedenol. See, for example, the types of compounds set forth in Hanson, Nat. Prod. Rep. 13, 59-71 (1996); Chackalamanni et al., Tetrahedron Letters 36, 5315-5318 (1995); Barrero et al., Tetrahedron Letters 35, 2945- 2948 (1994); Martres et al. Tetrahedron Letters 34, 801-8084 (1993) and Barrero et al., Tetrahedron 49(5), 10405-10412 (1993).
Non-limiting examples of the plants or plant cells to be used in the present invention which produce terpenoids include but are not limited to Asteraceae, Labiateae, Cistaceae, Pinaceae, Cupressaceae, Taxodiaceae, Acanthaceae, Annonaceae, Caprifoliaceae, Solanaceae, Apocynaceae, Verbenaceae and Zingiberaceae.
In another embodiment, the invention provides a method for producing a plant or a plant cell having enhanced production and/or secretion of at least one taxane-type diterpene and/or derivative thereof by plants or plant cells by transformation of said plant or plant cell with an expression cassette as described above.
Also provided are transgenic plants, the cells, seeds, plant cell culture, and progeny thereof with an enhanced production and/or secretion of at least one taxane-type diterpene and/or derivative thereof, transformed with an expression vector comprising an expression cassette as described above.
In an embodiment of the present invention said transgenic plants; cells, seeds, plant cell culture, and progeny thereof according to the invention is further characterized in (1) having an increased vacuolar localization of said taxane-type diterpene and/or derivative thereof, or (2) having a secretion or an increased secretion of said taxane-type diterpene and/or derivative thereof.
According to the present invention, culture of the above-mentioned plant can be carried out by the previously known method except that the tissue or the cell of the plant which produces the taxane-type diterpene is transformed with an expression cassette of the current invention and for which transformed cells can be cultured in vitro. Suspension culture, callus culture, hairy root culture, shoot culture or other conventional plant cell culture methods may be used (as described in: Drugs of Natural Origin, G. Samuelsson, 1999, ISBN 9186274813). By "plant cells", it is understood any cell which is derived from a plant and can be subsequently propagated as callus, plant cells in suspension, organized tissue and organs (e.g. hairy roots). Tissue cultures derived from the plant tissue of interest can be established. Methods for establishing and maintaining plant tissue cultures are well known in the art (see, e. g. Trigiano R. N. and Gray D. J. (1999),"Plant Tissue Culture Concepts and Laboratory Exercises", ISBN : 0-8493-2029-1; Herman E. B. (2000),"Regeneration and Micropropagation: Techniques, Systems and Media 1997-1999", Agricell Report).
In another embodiment the current invention can be combined with other known methods to enhance the production and/or the secretion of taxane type diterpene and/or derivative thereof in plant cell cultures such as (1) by improvement of the plant cell culture conditions, (2) by the transformation of the plant cells with a transcription factor capable of upregulating genes involved in the pathway of taxane type diterpene formation, (3) by the addition of specific elicitors to the plant cell culture, (4) by the induction of organogenesis and (5) by improving the expression of the enzyme involved in the biosynthetic pathway.
The present invention encompasses the use of a polynucleotide corresponding to the NpABCI gene or a functional fragment thereof, or encoding a polypeptide corresponding to the NpABCI protein or a functional fragment thereof for inducing or enhancing the production and/or secretion of terpene and/or derivative thereof in plants or plant cells for providing increased fragrance in said plant.
Non-limiting examples of such terpenes include myrcene, geraniol, α-terpinene, cineole, menthone, menthol, carvone, thujone, famesol, eudesmol, bulgarene, atractylone, caryophyllene, aromadendrene, linderene, germacrone, limonene, camphor, α-pinene, guaiol, β-selinene, valerane, β-vetivone, eremophilone and the like.
The expression cassette of the present invention, and accordingly the vector comprising it, may be useful in home gardening such as in ornamental plants and flowers, as well as cut flowers. The plants within the scope of the present invention include and are not limited to the Families Rosaceae including roses, Ericaceae including rhododendrons and azaleas, Euphorbiaceai including poinsettias and croton, Caryophyllaceae including carnations, Solanaceae including petunias, Gesneriaceae including african violets, Balsaminaceae including impatiens, Orchidaceae including orchids, Iridaceae including Gladiolas, Irises, Freesia, and Crocus, Compositae including marigolds, Geraniaceae including geraniums, and the like. The increased production of volatiles by the transformed plants is also encompassed by the present invention. The transformed plants can further be used for the attraction of the insect and the like.
In another aspect of the present invention the polynucleotide corresponding to the NpABCI gene or a functional fragment thereof, or encoding a polypeptide corresponding to the NpABCI protein or a functional fragment thereof is used for protecting plants from damage caused by pathogens. It was surprisingly found that NpABCI gene, protein, or functional fragment thereof could be used to increase the resistance of the plant to pathogens such as plants, animals and microorganisms (including resistance to both fungal and bacterial pathogens).
The present invention therefore also provides an isolated polynucleotide that protects plants from damage caused by pathogens, wherein said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof; (b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c), (e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (g) fragments and variants of such polynucleotides in (a) to (f).
In another embodiment, the invention relates to the use of an isolated polypeptide for protecting plants from damage caused by pathogens, wherein said polypeptide is selected from the group comprising: (a) a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1 ; (b) a polypeptide encoded by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (c) a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (d) a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (e) variants or fragments or functional fragments of such polypeptides in (a) to (d).
The present invention also encompasses the use of an expression cassette comprising a polynucleotide as described above for protecting plants from damage caused by pathogen. The present invention further encompasses the use of an expression cassette as described above for protecting plants from damage caused by pathogens, wherein said expression cassette further comprises a promoter operably linked to said polynucleotide. Examples of suitable promoters to be used in the present invention are the same as that described above.
The invention further provides transgenic plants protected from pathogens, comprising of a host plant transformed with an expression vector comprising an expression cassette comprising a polynucleotide wherein said polynucleotide is as described above. The genetically modified plants have an enhanced resistance to pathogens following transformation of the plant with a vector as described above.
The present invention provides plants protected from pathogens, such as microorganisms, plants, animals including insects and the like.
Any plant species that is subject to some form of pathogen attack, especially from fungi or bacteria, may be transformed with an expression vector according to the invention. The invention can even be practiced in plant species that are presently not amenable for transformation, as the amenability of such species is just a matter of time and because transformation as such is of no relevance for the principles underlying the invention. Furthermore, the present invention can be practiced with any plant variety for which cells of the plant can be transformed with an expression cassette of the current invention and for which transformed cells can be cultured in vitro. Suspension culture, callus culture, hairy root culture, shoot culture or other conventional plant cell culture methods may be used (as described in: Drugs of Natural Origin, G. Samuelsson, 1999, ISBN 9186274813).
The invention, thus, encompasses transgenic plants that express at least one NpABCI and/or at least one NpABCI -related peptide, and methods for producing such plants.
The present invention also provides a method for protecting plants from damage caused by pathogens, comprising the step of transforming with an expression vector comprising an expression cassette comprising a polynucleotide wherein said polynucleotide is as described above.
The term "plant" as used herein refers to vascular plants (e.g. gymnosperms and angiosperms). Hence, plants for the purpose of this description shall include angiosperms as well as gymnosperms, monocotyledonous as well as dicotyledonous plants, be they for feed, food or industrial processing purposes; included are plants used for any agricultural or horticultural purpose including forestry and flower culture, as well as home gardening or indoor gardening, or other decorative purposes.
The method comprises transforming a plant cell with an expression cassette of the present invention and regenerating such plant cell into a transgenic plant. Such plants can be propagated vegetatively or reproductively. The transforming step may be carried out by any suitable means, including by Agrobacterium-mediated transformation and non- Agrobacterium-mediated transformation, as discussed in detail below. Plants can be regenerated from the transformed cell (or cells) by techniques known to those skilled in the art. Where chimeric plants are produced by the process, plants in which all cells are transformed may be regenerated from chimeric plants having transformed germ cells, as is known in the art. Methods that can be used to transform plant cells or tissue with expression vectors of the present invention include both Agrobacterium and non- Agrobacterium vectors. A second group of transformation methods is the non- Agrobacterium mediated transformation and these methods are known as direct gene transfer methods.
Any plant tissue or plant cells capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with an expression vector of the present invention. The term Organogenesis' means a process by which shoots and roots are developed sequentially from meristematic centers; the term "embryogenesis" means a process by which shoots and roots develop together in a concerted fashion (not sequentially), whether from somatic cells or gametes. The particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular species being transformed. Exemplary tissue targets include protoplasts, leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissues (e. g. apical meristems, axillary buds, and root meristems), and induced meristem tissues (e. g., cotyledon meristem and hypocotyls meristem).
Because all plant types are susceptible to one or more plant pathogens, the present invention may be used for producing resistance in any of various plant types. Thus, the invention may be applied to both monocotyledonous, dicotyledonous, and gymnospermous plants, including, but not limited to, maize, wheat, rice, barley, soybean, cotton, legumes, rape/canola, alfalfa, flax, sunflower, safflower, brassica, cotton, flax, peanut, and clover; vegetables such as lettuce, tomato, cucurbits, cassava, potato, carrot, radish, pea, lentil, cabbage, cauliflower, broccoli, Brussels sprouts, and peppers; tree fruits such as citrus, apples, pears, peaches, apricots, and walnuts; and flowers such as orchids, carnations, and roses; coffee; cacao; conifers such as Douglas fir, spruce, and pine; and woody deciduous trees such as poplar and elms. In an embodiment of the present invention, said transforming step includes providing an inducible promoter operably linked to said polynucleotide which promotes localized expression of said polynucleotide in the area of invasion of said pathogen. Examples of suitable promoters are the same as that described above.
The present invention provides a method of preventing or reducing damage in a host plant, which may be attacked by a pathogen, comprising the step of harboring in said host plant a polynucleotide as described above.
For following DNA transfer and regeneration, putatively transformed plants may be evaluated, for instance using Southern analysis. After the initial analysis, which is optional, transformed plants showing the desired copy number and expression level of the polynucleotide according to the invention may be tested for resistance levels against a pathogen.
Other evaluations may include the testing of pathogen resistance under field conditions, checking fertility, yield, and other characteristics. Such testing is now routinely performed by persons having ordinary skill in the art.
Following such evaluations, the transformed plants may be grown directly, but usually they may be used as parental lines in the breeding of new varieties or in the creation of hybrids and the like.
These plants, including plant varieties, with improved resistance against pathogens may be grown in the field, in the greenhouse, or at home or elsewhere. Plants or edible parts thereof may be used for animal feed or human consumption, or may be processed for food, feed or other purposes in any form of agriculture or industry. Agriculture shall mean to include horticulture, arboriculture, flower culture, and the like. Industries which may benefit from plant material according to the invention include but are not limited to the pharmaceutical industry, the paper and pulp manufacturing industry, sugar manufacturing industry, feed and food industry, enzyme manufacturers and the like.
The advantages of the plants, or parts thereof, according to the invention are the decreased need for pesticide treatment, thus lowering costs of material, labor, and environmental pollution, or prolonging shelf-life of products (e.g. fruit, seed, and the like) of such plants.
In a third aspect, the present invention is also directed to isolated non-coding nucleotide sequences upstream of the NpABCI gene useful as promoters for homologous or heterologous gene expression in plants. The present invention is also directed to vectors and plant cells comprising the isolated nucleotide sequences.
The term "heterologous DNA" or "heterologous RNA" refers to DNA or RNA that does not occur naturally as part of the genome or DNA or RNA sequence in which it is present, or that is found in a cell or location in the genome or DNA or RNA sequence that differs from that which is found in nature. Heterologous DNA and RNA (in contrast to homologous DNA and RNA) are not endogenous to the cell into which it is introduced, but has been obtained from another cell or synthetically or recombinantly produced. An example is a human gene, encoding a human protein, operably linked to a non-human promoter. Another example is a gene isolated from one plant species operably linked to a promoter isolated from another plant species. Generally, though not necessarily, such DNA encodes RNA and proteins that are not normally produced by the cell in which the DNA is transcribed or expressed. Similarly exogenous RNA encodes for proteins not normally expressed in the cell in which the exogenous RNA is present. Heterologous DNA or RNA may also refer to as foreign DNA or RNA. Any DNA or RNA that one of skill in the art would recognize as heterologous or foreign to the cell in which it is expressed is herein encompassed by the term heterologous DNA or heterologous RNA. Examples of heterologous DNA include, but are not limited to, DNA that encodes proteins, polypeptides, receptors, reporter genes, transcriptional and translational regulatory sequences, selectable or traceable marker proteins, such as a protein that confers drug resistance, RNA including mRNA and antisense RNA and ribozymes.
NpABCI promoter from Nicotiana plumbaginifolia, is used to express introduced genes at high levels and in various plant tissues. A genomic fragment including the 1 ,282 bp region upstream of the NpABCI transcription start (SEQ ID NO:3) was cloned and sequenced and fused to the reporter β-glucuronidase (gus) gene and introduced into N. tabacum BY2 cells for stable transformation.
The transcription promoter was isolated and a search was performed for regulatory elements, using a combination of in vivo and in vitro approaches. Three putative DNA regulatory elements were identified. A 25-fold increase in gus expression was observed when cells were treated with sclareolide and some other terpenes. The combined use of 5' deletion promoter analysis, gel mobility shift assays, DNase I footprinting and site directed mutagenesis permitted to identify three cis-elements SB1 (SEQ ID:5), SB2 (SEQ ID:6) and SB3 (SEQ ID:7) located, respectively, within nucleotides -827 to -802, - 278 to - 243 and -216 to -190 upstream of the NpABCI transcription start. In vivo evaluation of these elements on sclareolide- induced expression showed that mutation of SB1 reduced expression by two-fold, while that of SB2 had no effect. On the other hand, SB3 had a marked effect since it completely abolished sclareolide-mediated expression. NpABC1-gus expression was not induced by the stress signals, salicylic acid and ethylene, but was mediated to some extent by methyl jasmonate, known to promote diterpene synthesis.
The present invention therefore provides a promoter having a sequence selected from the group comprising: a) a nucleic acid sequence as given in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6, SEQ ID NO:7 or a combination thereof; and b) a nucleic acid sequence that is at least about 60% homologous to the coding regions of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6 and SEQ ID NO:7 or a combination thereof.
As used herein "combination thereof encompasses promoters having a sequence selected from the group comprising the combination of SEQ ID NO:3 with SEQ ID NO:4 and/or with SEQ ID NO:5 and/or with SEQ ID NO:6 and/or with SEQ ID NO:7, or in a different order; the combination of SEQ ID NO:4 with SEQ ID NO:5 and/or with SEQ ID NO:6 and/or with SEQ ID NO:7, or in a different order, combination of SEQ ID NO:5 with SEQ ID NO:6 and/or with SEQ ID NO:7 or in a different order; and/or combinations thereof.
In an embodiment of the present invention said promoter comprises two or more copies of the nucleotide sequence selected from the group comprising SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6 and SEQ ID NO:7or a combination thereof.
The present invention also provides chimeric gene, and vector characterized in that they comprise the promoter according to the present invention.
In an embodiment of the present invention, the vector is characterized in that it has a cloning site and a terminator functional in a host cell, which is positioned 3' downstream of said promoter. Said vector may further comprise the chimeric gene. The present invention further provides transformant characterized in that it contains the promoters, the chimeric gene or the vector according to the invention.
In an embodiment of the present invention, said transformant is a microorganism such as fungi. In another embodiment of the present invention, said transformant is a plant cell.
The present invention further encompasses a method for expressing a gene, which is characterized by comprising a step of expressing the desired gene in a host cell under the control of the promoter according to the invention. Accordingly, said promoter can be used for controlling the expression of a desired gene in a host cell.
The present invention further provides a method of expressing heterologous genes in plants comprising the steps of (a) recombinantly transforming a portion of the plant in which it is desired to express said heterologous gene with said heterologous gene, in operative association with the promoter according to the invention (b) allowing the plant material so transformed to express such heterologous gene.
Such a plant may be a dicotyledonous plant or a monocotyledonous plant. In addition, parts of said plants selected from seeds, flowers, tubers, roots, leaves, fruits, pollen and wood, form part of the invention.
Examples and figures are provided below as illustrating aspects of the invention. They should be regarded as illustrating rather than limiting the invention, which is defined by the appended claims.
Brief description of the drawings
Figure 1. A: is a schematic representation of the 593 bp probe obtained by PCR using the primers P235 and ABCS1.
B: represents a photograph of a sequencing gel. S1 nuclease protection assays were carried out, using 50 μg of mRNA isolated from cultured N. plumbaginifolia cells with (+) or without (-) treatment with 200 μM sclareolide for 2 h. The DNA fragment, S1ABC, shown in A, was labeled by phosphorylation with T4 DNA kinase. The product of a sequencing reaction was simultaneously run on the polyacrylamide gel as a ladder (TCGA). The 5' ends of the protected fragment (in bold) and the surrounding DNA sequence and their distance from the translation start are shown on the right of the Figure. An amount of probe equal to 25% of that used in the assays was run in the right lane (P). C: represents the sequence upstream of the translation start site (bold characters) is displayed. The first transcription start site is indicated by the arrow and +1 , the corresponding nucleotide being shown in bold and italics. Putative TATA and CAAT boxes are indicated by the boxes.
Figure 2. A : is a schematic representation of the P1282-GUS construct. LB and RB: left and right borders of T-DNA; nos Pro : nopaline synthase promoter; nos Ter : nopaline synthase terminator; nptll : neomycin phosphotransferase. Fusion nucleotides are displayed and translational NpABCI and Gus initiation codon are italicized.
B : shows a graph representing the GUS activity of transgenic lines containing the P1282- GUS construct after 16 h treatment with 200 μM sclareolide or DMSO (solvent control). The data represent the mean of three measurements on each of 12 independent transgenic lines.
C : is a graph wherein the induction ratio represents the GUS activity in cells treated for 16 h with the indicated sclareolide concentration divided by that of cells treated with solvent. The data represent the means of three measurements on each of 6 independent transgenic lines. The 95% confidence intervals are indicated on the graph. A microsomal fraction (20 μg) was prepared from the treated cells and subjected to Western blotting using anti-NpABC1 antibodies (NpABCI) or anti-H +- ATPase antibodies (H +- ATPase).
Figure 3. A: is a schematic representation of the 5' deleted regions obtained by PCR, which were fused to the gus reporter gene in the pBi-101.1 transformation vector. The size (bp) of the fragment is indicated following «P», the transcription start site being +1.
B: is a graph wherein the induction ratio represents the GUS activity of extracts from cells treated with 200 μM sclareolide for 16 h relative to that untreated cells. The bars represent the 95% confidence interval. The induction ratio (followed by «X») and the number of independent transgenic lines (followed by «L») are indicated to the right of each bar.
Figure 4. A: is a schematic representation of the B3 and B6 DNA fragments used in the mobility shift reactions and their position relative to the transcription start.
B: is a photograph of a gel retardation analysis using the B3 fragment. Lanes 1-4 and lanes 5-8 correspond to binding reactions using 5 μg of nuclear proteins from untreated and sclareolide-treated cells, respectively. The unlabeled B3 fragment was used as competitor at molar excesses of 10-fold (lanes 2 and 6), 25-fold (lanes 3 and 7), and 50- fold (lanes 4 and 8). In lane 9, 5 μg of BSA was used instead of nuclear proteins. The free probe (FP B3) and complex (Cp) are indicated.
C: is a photograph of a gel retardation analysis using the B6 fragment. Five micrograms of nuclear proteins were used from untreated cells (lanes 1 , 2, 5, and 6) or cells treated with 200 mM sclareolide for 90 min (lanes 3, 4, 7, and 8). A 50-fold molar excess of unlabeled B6 probe (lanes 6 and 8) or 1 μg of sonicated herring sperm DNA (lanes 2 and 4) was used as competitor DNA. In lane 9, 5 μg of BSA was used instead of nuclear proteins. The free probe (FP B6) and the two complexes (Cpl and Cpll) are indicated.
Figure 5. A: is a schematic representation of the positions of the B3, B6, and B61 probes used in DNase I footprinting experiments relative to the transcription start (+1). The stars indicate the labeled end for the probes used in B.
B: shows photographs of sequencing gels wherein the labeled probes were incubated with 30 μg of nuclear proteins from cells treated (lanes 1 and 4) or not treated (lane 2 and 5) with 200 μM sclareolide for 90 min or with 30 μg of BSA (lanes 3 and 6) prior to digestion with DNase I at concentrations of 5 x 10 -3 (denoted as «1 » in lanes 1 , 2, and 3) or 2.5 x 10 -3 unit/μl (denoted as «2» in lanes 4, 5 and 6). The resulting samples and the products of a sequencing reaction used as a ladder were separated on a 6% polyacrylamide sequencing gel. The protected regions are shown by the thick vertical gray line and their positions relative to the transcription start are indicated.
C: represents the nucleotide sequences of the three protected regions found in B.
Figure 6. A: represents the upper strand nucleotide sequences of wild-type NpABCI promoter (SB1-A and SB3- A) and of the mutants (SB1-1 to SB1-7 and SB3-1 to SB3-6). The mutated bases are italicized and boxed.
B and C: show photographs of gel retardation analysis performed using the indicated double-stranded wild-type or mutated SB1 (B) or SB3 (C) probe. The even and odd lanes contain 5 μg of nuclear proteins from control cells or cells treated 90 min with 200 μM sclareolide, respectively. The free probe (FP) and the complex (Cp) are indicated.
Figure 7. shows photographs of gel retardation analysis, which was performed using the
SB1-A (A ), SB3-A (D) (see Fig 6), GT-1 (B and E) or 3AF1 (C and F) probes. Competitors were added to 25- or 50- fold molar excess as indicated. When indicated (Nuclear Extract) the probe was mixed with 5 μg of nuclear proteins from cells treated for 90 min with 200 μM sclareolide. The free probe (FP) and the complex (Cp) are indicated. The retardation analysis has been reproduced combining different probes within the same gel. The different complex mobilities seen for SB1-A, SB3-A, GT-1 and 3AF1 were reproducible.
Figure 8. A: shows the mutations within the three identified boxes of the NpABCI promoter were obtained by two-step PCR (Experimental procedures). The mutated nucleotides are italicized and the replaced nucleotides are displayed above. The dark gray boxes show the mutated regions.
B: is a graph wherein the induction ratio of the different mutants was measured as the GUS activity of extracts from cells treated with 200 μM sclareolide for 16 h relative to that of control cells. The bars represent 95% confidence intervals. The induction ratio (followed by «X») and the number of independent transgenic lines (followed by «L») are indicated to the right of each bar.
Figure 9. A: shows the molecular representation of the compounds used in B.
B: is a graph wherein the GUS activity induction ratio was measured on extracts from two transgenic lines (each 3 measurements) with or without 16 h treatment with the indicated concentration (μM) of the different compounds. The bars indicate the 95% confidence intervals.
C: is a graph wherein the GUS activity induction ratio was measured on extracts from two transgenic lines (each 2 measurements) with or without treatment with the indicated concentrations of salicylic acid (SA) (36 h), methyl jasmonate (MejA) (16 h), or sclareolide (16 h). The bars indicate the 95% confidence intervals.
D: shows photographs of western blots. The crude soluble protein fractions (15 μg) used in C were analyzed by Western blotting using antibodies against PR-N (detection of PR-O, PR-N, and PR-2) or PMT (putrescine N-methyl transferase).
Brief description of the sequences
The nucleic and amino acid sequences listed hereunder are shown using standard letter abbreviations for nucleotide bases, and one-letter code for amino acids. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. SEQ ID NO:1 is the polynucleotide encoding the NpABCI protein.
SEQ ID NO:2 is the polypeptide sequence of the NpABCI protein.
SEQ ID NO:3 is the polynucleotide sequence 1 ,394 bp upstream of the translated region of the NpABCI gene from N. plumbaginifolia genomic DNA.
SEQ ID NO:4 is the polynucleotide sequence from position 454 to 1315 of the 1 ,394 bp sequence upstream of the translated region of the NpABCI gene from N. plumbaginifolia genomic DNA.
SEQ ID NO:5 is the polynucleotide sequence of the SB1 box
SEQ ID NO:6 is the polynucleotide sequence of the SB2 box
SEQ ID NO:7 is the polynucleotide sequence of the SB3 box
Examples
Experimental procedures
Plant material and genetic transformations: Tobacco BY-2 cells (Nicotiana tabacum cv. Bright Yellow; Nagata et al., (1981) Mol Gen Genet, 184, 161-165) were maintained in MS medium (Murashige, T. and Skoog, F. (1962) Physiol. Plantarum, 15, 473-497) containing 0.2 mg/l 2,4-D, 0.2 g/l KH2P04, 50 mg/l of myo-inositol, and 5 mg/l thiamine HCI. Cell cultures were subcultured at weekly intervals by 25-fold dilution in fresh medium and treatments were applied to day 4 subcultured cells, the metabolites being dissolved in DMSO (sclareol, sclareolide, abietic acid, and larixol, methyl jasmonate), or water (salicylic acid, pH 5.7 with KOH).
The Agrobacterium tumefaciens strain GV3101 ::pMP90 C58 was used to perform the genetic transformation of BY2 cells (Koncz, C. and Schell, J. (1986) Mol Gen Genet, 204, 383-396), following the procedure of An (An, G. (1985) Plant Physiol 79, 568-570). Transgenic calli were selected on MS medium containing 0.2 mg/l 2,4-D, 0.2 g/l KH2P0 , 50 mg/l myo-inositol, 5 mg/l thiamine HCI, 0.8% agar, 100 mg/l kanamycin, and 400 mg/l carbenecillin and subcultured every two weeks. Liquid cell cultures (same medium) were initiated from the callus. Nicotiana plumbaginifolia DOBA cells were maintained as described in Barfield et al., (1985) Plant Cell Reports, 4, 104-107.
Genomic cloning of the 1.4 kb promoter region of NpABCI : Inverse PCR was used to obtain a 1 ,394 bp sequence upstream of the translated region of the NpABCI gene from N. plumbaginifolia genomic DNA. The promoter region used in this work (see Figure 2A) was then obtained by direct genomic PCR using two primers, PROABC5' (5'- CGCGGATCCTCCTTCTCTTCAACAGTAGAATTGG-3' - SEQ ID:8) and PROABC3' (5'- ATCCCC CGGGGCCATTTTGAGCAATAATTAAGAAGTTCGAC-3' - SEQ ID:9), and was cloned into pGEM-T easy (Promega™) and sequenced in both orientations. Three clones from independent PCR reactions were obtained and their sequences checked.
5' end transcript mapping: A N. plumbaginifolia cell suspension (day 12 subculture) was treated with 200 μM sclareolide for 2 h, then the cells were collected and ground in liquid nitrogen. RNA was extracted with two volumes of 5 M guanidine thiocyanate, 25 mM sodium citrate, pH 7.0 (HCI), 0.5% sarkosyl, and 5% b-mercaptoethanol, and purified by a combination of phenol/chloroform extraction and ethanol precipitation (Aurubel et al., (1994) Current Protocols in Molecular Biology, Massachusetts General Hospital Harvard Medical School, John Wiley&Sons, Inc).
The S1ABC DNA probe was obtained by PCR using the primers P388 (5'- CGGATCCGCTATGCTGACTTGGCATGTTTC-3' - SEQ ID: 10) and ABCS1 (5'- CAGCAGCAGCA CCTTGTGATCC-3' - SEQ ID:11 ) and a genomic clone from -611 to 4929 bp as the template. About 100 ng of probe was labeled with 3 units of T4 polynucleotide kinase (Roche™) and 100 μCi of [γ32P]ATP (Amersham™) in a final volume of 25 μl. Total RNA (50 μg) from treated or untreated cells was mixed with 2 μl of 5 X hybridization buffer (2 M NaCl, 200 mM Pipes, pH 6.4, 5 mM EDTA), then the mixture was vacuum dried and dissolved in 2 μl of S1ABC probe (80,000 cpm) and 8 μl of formamide. The sample was incubated at 85°C for 10 min and at 42°C for 16 h, then diluted with 100 μl of 0.2 M NaCl, 50 mM sodium acetate, pH 4.6, 1 mM ZnS04, 0.5% glycerol, 20 mg/ml of single-stranded herring sperm DNA, 300 units of nuclease S1 , and incubated for 1 h at 25°C. Nucleic acids were ethanol precipitated and electrophoresed in a denaturing 6% polyacrylamide gel.
Construction of the NpABCI -GUS chimeric gene and modified forms: A 1 ,394 bp DNA fragment containing the NpABCI promoter region was released from pGEM-T easy by BamHUSmal restriction, and introduced into the pBi-101.1 binary vector (Jefferson et al., (1987) EMBO J, 6, 3901-3907) to give the construct P1282. Deleted forms of the promoter region were obtained by PCR using the primers P1046 (5'-CGGATCCCATCATCATTCTC CACTTGCCG-3' - SEQ ID: 12), P840 (5'-CGGATCCCCTAAAGAACTCTTCACTA ACAC- 3' - SEQ ID: 13), P641 (5'-CGGATCCTAGGCTCACATTAATGGGGTG-3' - SEQ ID: 14), P496 (5'-CGGATCCGCTAAGATCCCA AGTCC AATG-3' - SEQ ID:15), P388 (5'- CGGATCCGCTATGCTGACTTGGCATGTTTC-3' SEQ ID: 16), P235 (5'- CGGATCCCTCATTTGGTCACATATGCTCC-3' - SEQ ID:17), and P77 (5'- CGGATCCAAACAATG CTATAGCCGCCCC-3' - SEQ ID: 18) at the 5' end and the PROABC3' primer at the 3' end. Each fragment was cloned into pGEM-T easy, and, after sequencing, introduced into pBi-101.1.
Site directed mutations within the promoter region were introduced by a two-step PCR using primers MutSBI was obtained with primers (5'-TCTCTGCAGGTCCCACACCGACA AAGAGTTCTTTAGGAAATTTTCATTCTC-3' - SEQ ID:19) and (5'- GGTGTGGGACCTGCAGATGAGG CTCGAAAGAATTTAATCAAGAATTATTTTGAC-3' SEQ ID:20), MutSB2 was obtained using primers (5'-
GGGACGGTCCTAGCTGCAGCCGCTTATTAACGTGTGAATTATTAGCA- 3' - SEQ ID:21 ) and (5'-GCTGCAGCTAGGACCCTCCCTGGATCTTTTTCTCATTTGGTCACATAT- 3' SEQ ID:22) and MutSB3 was obtained with primers (5'- CTCGCGCGGCCGCCCTGCGGAAGACCATATG TGACCAAATGAGAAAAAGAC-3' - SEQ ID:23) and (5'-CCGCAGGGCGGCCGCGCGAGGATTTCCT
CTACAACTACTGTATAC- 3' - SEQ ID:24).
All mutated forms of the promoter region were checked by sequencing, then introduced into pB101.1 within the SamHI and Smal restriction sites.
GUS assay: Cells (day 4 subcultures) were treated for 16 h with 200 μM sclareolide or an equivalent volume of solvent. Cells (1.5 ml) were collected by centrifugation for 3 min at 2,700 g, suspended in 300 μl of grinding buffer (50 mM NaHP04l pH 7.0, 10 mM EDTA, 0.1% sodium laurylsarcosine, 0.1% Triton X-100, 10 mM β-mercaptoethanol), and homogenized for 40 s using glass beads (0.2 mm diameter) in a Mini bead-beater homogenizer (Biospec™). GUS activity was determined fluorometrically as described by Jefferson et al (1987). Protein content was measured as described by Bradford (Bradford, M.M. (1976). Anal Biochem, 72, 248-254), using BSA as a standard.
Preparation of tobacco BY2 cell nuclear extracts: BY2 cells (day 4 subcultures) were treated for 90 min with 200 μM sclareolide or the same volume of solvent. Cells were harvested by vacuum filtration and nuclear proteins extracted and stored at -80°C as described by Shen and Gigot, (Shen, W.H. and Gigot, C. (1997) Plant Mol Biol, 33, 367- 379). Nuclear extracts used for footprinting were concentrated to 3 mg/ml of proteins under N2 pressure (3.5 kPa), using an AMICON™ (MCOW 3000) filter.
DNA probes for gel retardation and footprinting: DNA fragments were generated either by PCR or by the annealing of synthetic oligonucleotides (sequences shown in Figure 6). Annealing of double strands was performed by mixing two complementary DNA oligonucleotides at 90°C for 5 min, then allowing the temperature to fall to 20°C. Probes B3 and B6 were generated by PCR using the primers P840 and P593 (5'- CTCATCTTGCAAGCATCTTAACTAC-3' - SEQ ID:25) or P388 and P190 (5'- CTTCTATAATTACTGTT CATAAGGAGTC-3' - SEQ ID:26).
DNA (100 ng) was labeled with 3 units of T4 polynucleotide kinase (Roche™) and 100 μCi of [γ32P]ATP (Amersham™) (50 μl). Free nucleotides were removed using the PCR purification kit (Roche™) for probes B3 and B6 or Sephadex Microspin G-25 columns (Pharmacia™) for smaller probes. The DNA fragments were then phenol extracted, ethanol precipitated, and dissolved in water.
Fragments B3 and B6 were cloned into pGEM-T easy to obtain DNA probes for DNase I footprinting. The U primer (5'-GTAAAACGACGGCCAGT-3' - SEQ ID:27) was labeled using T4 polynucleotide kinase, purified through a Sephadex Microspin G-25 column, and used with the R primer (5'-GGTCGACCTGCAGGCGG-3' - SEQ ID:28) to PCR amplify the B3 or B6 fragments, which were purified using a PCR purification kit (Roche™), phenol extracted, ethanol precipitated, and dissolved in water.
Labeled fragment B61 was obtained by PCR using the labeled P61 primer (5'-CTTTGTC TGCTTTGACTGCTGCCTCTCC- 3' - SEQ ID:29) and P7 (5'- GCAGCAAAGAGGAAGGGGCGGC- 3' - SEQ ID:30), and purified as described above.
Gel retardation and footprinting: Protein-DNA binding for gel retardation assays was carried out in a final volume of 20 μl of 25 M HEPES (pH 8.0, KOH), 5 mM MgCI2, 50 mM KCI, 0.1 mM Na2EDTA, 10% [v/v] glycerol, 1 μg/μl of poly (dl-dC), 1 μg of BSA, containing 5 μg of nuclear proteins and 5,000 cpm of labeled probe. The samples were incubated for 30 min at 20°C, then loaded onto a native gel of either 4% acrylamide/bis- acrylamide (29 :1), 0.7% agarose, 6.5 mM Tris-HCI, 0.1 mM Na2EDTA, 0.5 mM MgCI2, 3.3 mM sodium acetate, pH 8.0, 2.5% glycerol, 2.10 -3 0 /0 TEMED, 3.10 -3 0 /0 ammonium persulfate (Figure 4) or 5% acrylamide/bis-acrylamide gel without agarose (Figures 6,7). The running buffer was 6.5 mM Tris-HCI, 0.1 mM Na2EDTA, 3.3 mM sodium acetate, 0.5 mM MgCI2, pH 8.0. After electrophoresis at 200 V and 4°C, the gels were dried on Whatman 3MM paper and autoradiographed.
Protein-DNA binding for footprinting was carried out as above, but using 30 μg of nuclear proteins and 5,000 cpm of 5'-end labeled probe. Following this incubation, 40 μl of 25 mM Hepes (pH 8.0 KOH), 5 mM MgCI2, 50 mM KCI, 0.1 mM Na2EDTA, containing 5 x 10 -5 or 2.5 x 10 -5 U of DNase I (Roche™) was added. After 2 min at 20°C, the reaction was stopped by the addition of 240 μl of 0.3 M NaCl, 0.5% SDS, and 5 mM Na2EDTA pH 8.0 HCI, then the mixture was extracted twice with phenol/chloroform incubated at 80°C for 5 min, and the nucleic acids precipitated with ethanol. The pellets were washed twice with 70% ethanol, allowed to dry at room temperature, and solubilized in sequencing loading dye (85% formamide, 1 X TBE, 0.05 % xylene cyanol, 0.05% bromophenol blue). The samples were then denaturated at 95°C for 5 min and electrophoresed on a 5% polyacrylamide-urea sequencing gel, then the gel was dried on Whatman 3MM paper and autoradiographed.
Preparation of microsomal fractions: Microsomal fractions were prepared from day 4 subcultures of BY2 cells following the procedure described by Jasinski et al., (2001).
Western blotting : Proteins (microsomal fractions or whole cell soluble extracts) were and subjected to SDS-PAGE, then transferred electrophoretically to a polyvinyldifluoride membrane (Millipore™ , Bedford, MA), which was then blocked with 3% non-fat milk powder in 20 mM Tris-HCI, 137 mM NaCl, 0.5% Tween 80, pH 7.6. The membrane was sequentially incubated with rabbit antibodies specific for NpABCI (Jasinski et al., 2001), H + -ATPase (Morsomme et al., (1998) J Biol Chem, 273, 34837-34842), PR-N (Niki et al., 1998), or putrescine N-methyl transferase (Shoji et al., 2000), and alkaline phosphatase- conjugated anti-rabbit IgG antibodies (Roche™), binding of which was detected by chemiluminescence.
Example 1
After characterization of the NpABCI gene, we obtained antibodies that recognized a synthetic peptide corresponding to a sequence of NpABCI. These antibodies were used to follow the induction of NpABCI expression by various diterpenes not tested so far. Among these, Taxol, tested in the range of 5 to 45 μM, was found to induce the expression of NpABCI as detected by immunodetection.
Showing that Taxol induces NpABCI expression, the next point was to show that it was transported out of the cell by NpABCI . To prove this point, we have obtained transgenic plants in which NpABCI expression was prevented by the RNA interference technique. Consequently, NpABCI could not be detected in these plants when treated with sclareol. Moreover, these plants became more sensitive to sclareol added in the medium. This was demonstrated by two methods: i) absence of regeneration of shoots when leaf disks were put in a regenerating growth medium in the presence of sclareol; ii) increased mortality of leaf protoplasts when they were incubated in the presence of sclareol.
Example 2
NpABCI transports out of the cell sclareol and other metabolites that accumulate at the leaf surface and protect the plant against pathogens.
When a plant was infected by a pathogen (Pseudomonas syringae) or an insect (Trialeurodes vaporarium), NpABCI was induced in the whole leaf, showing that this transporter is also involved in an induced defense mechanism. NpABCI thus participates in a constitutive defense system.
Transgenic plants in which NpABCI expression was prevented by the RNA interference technique were obtained. These plants were further challenged with pathogens to determine if these plants became more sensitive to these pathogens. These plants became sensitive to these pathogens, and showed reduced resistance.
Example 3 Identification of the sclareolide activated NpABCI promoter region
An N. plumbaginifolia genomic fragment was obtained including the 1 ,394 bp region upstream of the NpABCI translation initiation codon (SEQ ID NO:3). A subclone (Figure 1A) was used to map the transcription start site in an S1 nuclease protection experiment. RNA extracted from cultured N. plumbaginifolia cells which show high expression of NpABCI upon addition of sclareol or sclareolide to the culture medium (Jasinski et al., 2001). Two protected fragments of equal intensity were seen (Figure 1 B), a larger one corresponding to a 5' position 112 bp upstream of the translation initiation codon, and a smaller one 5 bp further downstream, which could be considered as a second initiation start or as an artifact due to breathing of the RNA/DNA hybrid in this AT-rich region. In addition, on comparing RNA isolated from control and sclareolide-treated cells, it was found that the same protected fragments were present in both, although much stronger in the latter. Putative TATA (TATATAATA - SEQ ID:31) and CAAT (ACAATG - SEQ ID:32) boxes were found at -44 and -75 bp, respectively, from the first transcriptional start site (Figure 1C).
To further characterize the putative transcription promoter region, P1282-GUS construct were designed in which the reporter gene, β-glucuronidase (gus), was fused in frame to a 1 ,394 bp DNA fragment ending at the NpABCI translation start (Figure 2A). This construct was introduced into a binary vector and transferred, through Agrobacterium tumefaciens- mediated transformation, into the genome of N. tabacum BY2 cultured cells. In these transgenic cells, the gus gene expression driven by the NpABCI promoter region was increased 25-fold after treatment with sclareolide (Figure 2B). To validate the reporter system, sclareolide induction of GUS expression and of NpABCI expression were compared, the latter being monitored by Western blotting. In both cases, 25 μM sclareolide was sufficient to induce expression, while the maximal effect was seen at concentrations of 100-200 μM (or higher) (Figure 2C). No increase in GUS activity was seen using transgenic lines containing gus without any promoter region (data not shown).
Fusion of gus to the NpABCI promoter region conferred inducibility by sclareolide to the reporter gene, thus validating the reporter system.
Example 4 Promoter deletions and DNA-protein interactions detected by mobility shift assays
Once the reporter system had been validated, 5' deletions in the NpABCI upstream region (Figure 3A) were prepared to delimit the smallest NpABCI promoter region still capable of directing expression following sclareolide treatment. At least 12 independent transgenic lines were analyzed for each construct. GUS levels varied within the transgenic lines, a result which is consistent with those of other studies and can be attributed to the positional effect (Peach, C. and Velten, J. (1991) Plant Mol Biol, 17, 49-60). However, only statistically significant data were considered here. As shown in Figure 3B, shortening the sequence down to -840 from the first transcription start had little effect on induction by sclareolide (compare P1282, P1046, and P840). However, further deletion to -641 significantly decreased inducibility from an average of 25-fold to 12-fold. While further deletion down to -388 (see P496 and P388) did not have any significant effect, deletion to -235 (P235) reduced the inducibility to 2.1 -fold. The last deletion (P77) resulted in an almost inactive promoter.
The above study showed that two regions, -840 to -641 bp and -388 to -77 bp, of the NpABCI promoter were involved in sclareolide-mediated regulation. Gel retardation analysis was then performed to identify sequences that bind nuclear protein factors using nuclear proteins extracted from tobacco BY2 cells 90 min after treatment with 200 μM sclareolide. Within this time period, the NpABCI transcript level is already increased, but is not yet maximal (about 3 h) (Jasinski et al., 2001 and data not shown), so transcription is still proceeding. The DNA probes used were B3 (-840 to -593 bp) and B6 (-388 to - 190) (Figure 4A). Using probe B3, one retarded complex was seen (Figure 4B), while two were seen using probe B6, these being a fast migrating complex (complex I) and a slow migrating complex (complex II) (Figure 4C). Comparison of protein extracts from sclareolide-treated and non-treated cells did not show any difference in their ability to bind the B3 or B6 probes (compare lanes 1-4 with lanes 5-8 (Figure 4B) or lanes 1-2 with lanes 3-4 (Figure 4C)). Different nuclear extracts were tested, with the same results. Moreover, no difference was observed between nuclear extracts prepared at different times after induction by sclareolide (data not shown). Nevertheless, the binding of the nuclear factors to the DNA probe was specific, since it was prevented by a 50-fold molar excess of the respective unlabeled probes (Figure 4B and 4C), but not by non-specific DNA (shown for probe B6 in Figure 4C, lanes 2 and 4). B3 and B6 probes were each divided into three overlapping probes (-840 to -743, -770 to -651 , -680 to -593 and -388 to -310, -338 to - 241 , -263 to -190, respectively. Binding activities were shown to be restricted within two regions: from -840 to -743 bp and from -263 to -190 bp (data not shown).
Example 5 DNA-protein interactions detected by DNase I footprint analysis and mutational analysis of the binding sites.
To further delimit the regions that possibly interact with nuclear proteins, DNase I protection analysis was performed using probes B3 and B6 (Figure 5A). As shown in Figure 5B, using probe B3, one protected region, named sclareol box 1 (SB1 ), was found approximately between positions -827 and -802, while, using probe B6, two protected regions were identified, sclareol box 2 (SB2 : -270 to -243) and sclareol box 3 (SB3 : -216 to -190). These three regions were also identified when the complementary strand was labeled (data not shown). Since SB3 is localized at the probe B6 boundary, the probe was extended down to -40 bp (probe B61 , Figure 5A) and revealed SB2 and SB3, but no more protected region (Figure 5B). As in the mobility shift assays previously displayed, no difference was observed in the footprint pattern between nuclear extracts from sclareolide- treated and non-treated cells (compare lanes 1 and 2 on Figure 5B). The sequences of regions SB1 , SB2, and SB3 are shown in Figure 5C.
Based on the DNase I footprint results, three synthetic probes, SB1-A, SB2-A, and SB3-A, were designed to cover the three identified boxes SB1 , SB2, and SB3, respectively; the sequences for SB1-A and SB3-A are shown in Figure 6A. SB1-A and SB3-A formed specific retarded complexes (Figures 6B and C), whereas SB2-A did not (data not shown), indicating that this short fragment was unable to stably bind a protein factor.
The regions in SB1-A and SB3-A that were critical for factor binding were determined using the mobility shift assay and several probes, each bearing 3-4 adjacent mutated nucleotides (Figure 6A). The first SB1-A-derived mutant (SB1-1) showed a dramatically reduced ability to bind nuclear factors, while mutants SB1-2, SB1-3, and SB1-4 completely failed to bind; in contrast, mutants SB1-5, SB1-6, and SB1-7 were as effective as SB1-A. This analysis restricted to 16 the number of nucleotides involved in this in vitro DNA-protein association, i.e. 'CACTAACACAAAGTAA'. Similar experiments on SB3 showed that the 15-nucleotide sequence TTATGAACAGTAATT - SEQ ID:33 was essential for nuclear factor recruitment.
Since SB1 and SB3 boxes are AT-rich, the possibility was considered that they correspond to the GT-like motif found in several genes (Zhou DX (1999) Trends Plant Sci, 4, 210-214). Because of the high degeneracy of this motif, an experimental approach was necessary to evaluate this possibility. Therefore, whether a tetramer of the original GT-1 sequence (TGTGTGGTTAATATG - SEQ ID:34) found in the pea RbcS-3A gene (Green et al., 1987) was able to compete with SB1 or SB3 was tested by mobility shift assays. The GT-1 probe was able to partly compete with SB1 (Figure 7A). In the reciprocal experiment, the complex formed with GT-1 was displaced by SB1 , but to a lesser extent than by GT-1 itself (Figure 7B).
GT-like sequences could also be recruited by 3AF1 factors, since 3AF1 could contact AT- rich sequences (Ouwerkerk et al., (1999) Mol Gen Genet, 261 , 610-22). A dimer of box VI from the Rbcs3A promoter (Lam et al., (1990) Plant Cell 2, 857-866) (5ΑAATAGATAAATAAAAACATT-3' - SEQ ID:35) was used alternatively as a 3AF1 probe or competitor. This sequence was able to compete with the SB1-A probe (Figure 7A). Addition of SB1-A partly decreased the amount of the complex formed with the 3AF1 probe, suggesting that SB1 might be recruited by factors related to 3AF1.
On the other hand, no competition was found between SB3-A and GT1 or 3AF1 sequences (Figure 7C to F), indicating that no GT- or 3AF1-like factor is recruited by this sequence.
In conclusion, three sequence elements, SB1 (CACTAACACAAAGTAA), SB2 (TAATAA ATAATTACCCTCGAAGTTTCTTTCAAG - SEQ ID:36), and SB3
(TTATGAACAGTAATTA), were identified by the use of DNase I footprinting and gel mobility shift assays. In vivo evaluation of these boxes showed that SB1 was moderately and SB3, strongly, involved in NpABCI -gus expression, while no in vivo effect was found for SB2.
Example 6 In vivo mutagenesis analysis of the three SB boxes
To evaluate the role of the three SB boxes in vivo, these were mutated by nucleotide substitution within the entire promoter region linked to the gus reporter (MutSB1-3 in Figure 8A) and the constructs used to generate transgenic cell lines, which were then tested for GUS activity. Mutation of SB1 decreased sclareolide induction (Figure 8B) to the level obtained using deletion P641 (Figure 3B), suggesting that SB1 is required for maximal induction and might act as an enhancer. While mutation of SB2 had no significant effect, mutation of SB3 reduced induction to less than 2-fold, resulting in an almost inactive promoter (Figure 8B). It can be therefore concluded that SB1 and SB3 have, respectively, moderate and marked effects on the sclareolide-induced expression of NpABC1-gus, while SB2 mutation did not reveal any effect.
Deletion of SB1 (Figure 8) had the same effect as deletion of the entire upstream region down to - 641 , namely, a two-fold reduction in inducing ability. This demonstrates that no important regulatory sequence involved in sclareolide induction is localized upstream of SB1. A GT-1 binding motif could be identified on the SB1 sequence and the latter was able to compete to some extent with a GT-1 probe for the binding of a nuclear factor. This motif, first identified in the pea Rbcs-3A promoter (Green et al, (1987) Embo J, 6, 2543- 2549), has been found in the promoter of many other genes with diverse regulatory properties (Zhou, 1999, Buchel et al., (1999) Plant Mol Biol, 40, 387-396, Ouwerkerk et al., 1999). The observation that the SB1 binding activity was not fully displaced by the GT- 1 sequence suggests that the nuclear factors that bind to each of them are homologous but not identical. As a matter of fact, several GT factors have been identified and various GT sequences can recruit different GT proteins (Zhou, 1999). Although SB1 participates in NpABCI promoter activity, it is clearly not the main determinant of sclareolide induction and might possibly act as an enhancer to reinforce the action of other elements.
The SB2 sequence alone was unable to recruit a transcription factor. Moreover, it appeared as non-essential for sclareolide-mediated NpABC1-gus induction in vivo. The sequence might be an accessory element, the activity of which could be supplied by other elements, such as SB1. Alternatively, SB2 might contribute to the response to other stresses or, in planta, to the tissue-specific regulation of NpABCI expression.
Although the SB3 box fits with the GT-1 or 3AF1 consensus (Zhou, 1999; Ouwerkerk et al., 1999), no competition was found between SB3 and GT-1 or 3AF1. The SB3 sequence did not show any clear similarity to other already identified motifs except for a degenerated C-box (TGACGTCA). This motif was first described in the cauliflower mosaic virus and has been shown to mediate wound, salicylic acid and auxin transcriptional activation (Katagiri et al., (1989) Nature, 340, 727-730; Niggeweg et al., (2000a) J Biol Chem, 275, 19897-19905). Moreover, this motif is also found in the promoter region of a glutathione S-transferase gene, where it acts as a chemical stress, jasmonic acid, salicylic acid, and auxin responsive element (Klinedinst et al., (2000) Plant Mol Biol, 42, 679-688). Contrary to SB1 or SB2, SB3 mutation had a strong in vivo effect, resulting in a low active promoter without any sclareolide induction. SB3 thus represents a major element of the NpABCI promoter. Whether it is sufficient or not for sclareolide induction requires gain-of- function experiments involving the association of SB3 and possibly other NpABCI promoter sequences with a minimal promoter.
On gels, we did not detect any difference in the intensity of retarded complexes or protected regions using nuclear extracts from sclareolide-treated or untreated BY2 cells. This might be explained in several ways. In sclareolide-treated cells, a differentially expressed or regulated protein might interact with the constitutively expressed proteins present in the retarded complexes to regulate NpABCI transcription. Interaction between transcription factors and associated proteins has already been reported, e.g. for the regulation driven by TGA factors (Niggeweg et al., (2000b) Plant Mol Biol, 42, 775-788; Subramaniam et al., (2001) Nat. Biotechnol. 19, 769-772) Alternatively, sclareolide treatment might result in post-translational modification of a protein in the complex, thereby facilitating its interaction with the transcription machinery leading to NpABCI induction. Post-translational activation of DNA-binding proteins or co-activators by, for example, kinases and phosphatases or acetylases is well documented in the plant kingdom and other eukaryotic systems. Transcription activation might also occur indirectly through modification of the chromatin structure (reviewed in Schwechheimer C, Bevan M. (1998) Trends Plant Sci 3, 378-383; Martinez, E. (2002) Plant Mol. Biol. 50, 925-947).
Example 7 NpABC1-gus expression is increased by other terpenes.-
Although sclareolide is a very convenient means of inducing expression of NpABCI and the gus reporter gene fused to the NpABCI transcriptional promoter, it is not a major diterpene produced in Nicotiana spp., whereas sclareol is (see Figure 9A for their respective structure). The effect of sclareol treatment on NpABCI -gus expression was examined and it was found that, at a concentration of 100 μM, it caused a 68- fold induction of GUS activity (Figure 9B), a result even greater than that seen with sclareolide (Figure 2). Higher sclareol concentrations resulted in less gus induction, probably because of cell toxicity (data not shown).
The analysis was extended to other biological molecules structurally related to sclareol (Figure 9A). Two diterpenoids, abietic acid and larixol, components of the resin secreted by Abies grandis (Trapp, S. and Croteau, R. (2001) Annu Rev. Plant Physiol Plant Mol Biol, 52, 689-724.) and Larix sibilica (Tanaka et al., (1997) Phytochem, 46, 1051-1057), respectively, were effective activators of NpABC1-gus expression (Figure 9B). These compounds are important defensive agents, which are toxic to scavengers and pathogenic fungi (Vogel et al., (1996) J Biol Chem, 271 , 23262-23268). Gibberellic acid, a plant hormone belonging to the terpenoid family, did not cause induction of NpABC1-gus expression (data not shown).
One particular trait of NpABCI is that it is upregulated by its own substrate, a physiological compound synthesized by plant cells (Jasinski et al., 2001). It was shown that induction of NpABCI expression was not restricted to sclareol or sclareolide, but could also be caused by other molecules, such as abietic acid or larixol, two diterpenoids chemically related to sclareol and found in plants.
Example 8 NpABCI -gus expression is increased by methyl jasmonate, but not by salicylic acid or ethylene Because high sclareolide concentrations seem to be toxic for cells, induction of NpABCI - gus expression might be considered as a stress response. The response of the plant to abiotic or biotic stress generally involves cross talk among at least three different signaling pathways involving mediator molecules, such as salicylic acid, methyl jasmonate, and ethylene (Reymond, P. and Farmer, E.E. (1998) Curr Opin Plant Biol, 1 , 404-411). Salicylic acid has been implicated as a key signal molecule in the establishment of systemic acquired resistance (SAR) (Hunt et al., (1996) Gene, 179, 89-95.). However, when tested on cells expressing NpABC1-gus, no increase in GUS activity was seen at concentrations up to 1 mM (Figure 9C) whereas PR proteins, used as marker of the salicylic acid response (Niki et al., (1998) Plant Cell Physiol, 39, 500- 507; Yamakawa et al., (1998) Plant Physiol, 118, 1213-1222), were strongly induced at 200 μM, although higher concentrations had less effect (Figure 9D). Methyl jasmonate, a lipoxygenase product of linolenic acid, also a signal molecule that is released by plants in response to various stimuli, was also tested. Methyl jasmonate treatment resulted in increased GUS activity (Figure 9C). This effect involves SB3 since mutation of the latter (MutSB3) abolished NpABC1-gus expression upon methyl jasmonate treatment (data not shown). Methyl jasmonate also increased the level of putrescine N-methyl transferase (Figure 9D), used as a marker (Shoji et al., (2000) Plant Cell Physiol, 41 , 1072-1076; Imanishi et al., (1998) Plant Mol Biol, 38, 1101-1111). This could suggest that sclareolide induces a stress response involving methyl jasmonate; however, it was found that the expression of putrescine N-methyl transferase was not increased by sclareolide (Figure 9D), suggesting that the signaling pathway leading from sclareolide to NpABCI induction does not use the methyl jasmonate pathway. Finally, the ethylene pathway was stimulated by treating cells with the ethylene generator, ethephon. No modification of GUS activity was found (data not shown).
Treatment of cells with methyl jasmonate led to NpABC1-gus induction, while treatment with salicylic acid or ethylene did not. It was found that induction of NpABC1-gus by methyl jasmonate, like by sclareolide, required SB3, since the MutSB3 mutant did not respond any more to methyl jasmonate treatment. Although a high sclareol concentration impaired cell growth, the possibility that diterpenes act on NpABCI by a general stress effect through methyl jasmonate was ruled out for three reasons: 1/ sclareol did not induce the synthesis of putrescine N-methyl transferase, a typical marker of methyl jasmonate- induced proteins; 2/ 100 μM methyl jasmonate resulted in maximal putrescine N-methyl transferase expression, while 250 μM jasmonate was required for NpABC1-gus induction, suggesting that the latter effect was indirect; 3/ NpABC1-gus was also induced by abietic acid, a diterpene that showed no toxicity for BY2 cells. Methyl jasmonate has been shown to promote the production of defense molecules, such as diterpenes (Ketchum et al., (1999) Biotechnol Bioeng, 62, 97-105; Martin et al., (2002) Plant Physiol, 129, 1003- 1018). It is believed that methyl jasmonate might stimulate diterpene biosynthesis and, as a consequence, NpABCI expression.
Sequences
SEQ ID NO:1
CTAATTTCAC ATTTTCAGTT CATTTGATCA AATTATAAAA TATTTTGAAA GTCGAACTTC TTAATTATTG CTCAAAATGG AGCCAGCAGA TTTAAGTAAT TTGCGGGGCC GAAGTTTAAG AGCAAGTATA AGGGGAAGCA TGAGAGGAAG TATAAGAGAA AATAGCAATT CAATATGGAG AAATAATGGT GCTGAGGTAT TTTCGCGTTC AGCGAGGGAT GAAGATGATG AAGAAGCACT TAAATGGGCT GCACTTGAAA AATTACCAAC TTATGATAGA TTAAGAAAAG GTATATTGTT TGGATCACAA GGTGCTGCTG CTGAAGTTGA TGTAGATGAT TCAGGTGTTT TAGAAAGAAA GAATTTGCTT GAAAGACTTG TTAAAGTTGC TGATGAAGAT AATGAGAAGT TTTTGCTGAA ACTCAAGAAT AGAATTGACA GGGTTGGGAT TGATTTTCCA TCAATAGAGG TGAGATTTGA GCATCTGAAT ATTGATGCAG ATGCATATGT AGGAAGCAGA GCTTTGCCTA CATTTACCAA CTTCATTTCT AACTTCGTTG AGGGCCTATT GGATTCAATT CACATACTTC CATCAAAGAA AAGGCAAGTT ACAATTCTCA AGGATGTTAG TGGCATAGTT AAGCCCTGTA GAATGACTCT TCTTTTGGGA CCTCCTGGTT CTGGAAAAAC TACTTTGTTA CTTGCTTTGG CTGGTAAACT TGACTCTGCT CTAAAGGTTA CTGGAAAGGT GACATATAAT GGACATGAAT TACATGAGTT TGTGCCACAA AGAACTGCCG CTTATATTAG CCAGCATGAT TTGCATATTG GAGAAATGAC TGTTAGAGAA ACTTTGGAGT TCTCTGCAAG ATGCCAAGGC GTTGGCTCTC GTTATGAGAT GCTGGCTGAA CTATCAAGAA GAGAGAAAGC AGCTAATATT AAACCAGATG CTGATATTGA CATGTTCATG AAGGCTGCAT CAACAGAAGG ACAAGAGGCC AAAGTGGTTA CAGATTACAT TCTTAAGATA CTGGGACTGG ATATTTGTGC AGATACTATG GTGGGAGATC AAATGATAAG GGGTATTTCA GGAGGACAGA AGAAGCGTGT GACGACTGGT GAAATGATTG TTGGACCCTC TAAAGCACTT TTCATGGATG AAATATCAAC TGGATTGGAC AGTTCCACTA CTTACTCCAT TGTGAATTCC TTAAAGCAAT CTGTTCGAAT CATGAAGGGA ACAGCTCTGA TTTCTCTCTT GCAACCTGCC CCCGAGACCT ACAACCTGTT CGACGATATT ATTCTGTTAT CCGATGGGTA TATTGTTTAT GAGGGTCCGC GAGAGGAAGT GCTCGAGTTC TTTGAATCCA TGGGATTCAA ATGCCCTGAG AGAAAAGGCG CTGCTGACTT CTTGCAAGAA GTGACATCTA AGAAGGATCA ACAGCAATAT TGGATTAGGA GAGATGAGCC TTATCGGTTC ATCACATCAA AAGAATTTGC TGAAGCTTAT CAGTCTTTTC ATGTTGGAAG AAAAGTAAGC GATGAGCTCA AAACCACATT TGACAAGAGT AAAAGCCACC CTGCTGCTTT GACTACTCAA AAGTATGGTA TAGGGAAGAG ACAACTTTTG AAGGTTTGCA CCGAAAGAGA ACTATTGCTA ATGCAAAGAA ACTCATTTGT TTACCTCTTC AAGTTCTTTC AGCTCCTGAT AATCGCACTT ATGACAATGA CCATATTTTT CCGAACTAAG ATGCCTCGGG ATAGTGCAGA AGATGGAGGA ATATATTCTG GTGCTCTCTT TTTTGTGGTT ATTATGATTA TGTTTAATGG TTTGTCCGAG CTCCCTATGA CACTTTACAA ACTTCCGGTC TTCTACAAGC AAAGGGACTT TCTCTTCTAT CCTTCGTGGG CTTACGCCAT TCCCTCATGG ATCCTCAAAA TCCCTGTAAC TTTTGCTGAA GTCGGGATGT GGGTGTTCCT CACGTATTAT GTTATGGGAT TTGATCCCAA TGTTGGAAGG TTTTTCAAAC AATTTTTGCT ACTGTTACTA GTAAACCAGA TGGCATCAGC ATTGTTCAGA TTTATCGCGG CAGTAGGAAG GACCATGGGA GTTGCTAGCA CATTTGGAGC ATTTGCTCTT CTTTTACAAT TTGCATTGGG AGGTTTTATT CTTGCGCGAA ATGATGTGAA GGATTGGTGG ATTTGGGGAT ACTGGACGTC ACCGTTGATG TATTCTGTGA ATGCAATTCT TGTGAATGAA TTTGATGGGC AAAAGTGGAA ACATATTGTA GCCGGTGGAA CTGAGCCGCT TGGAGCTGCA GTGGTAAGAG CTCGAGGGTT CTTCCCAGAT GCATATTGGT ACTGGATAGG TGTAGGGGCA CTTGCTGGAT TCATAGTTAT GTTTAACATC GCCTACAGTG TTGCTCTCGC TTATCTTAAC CCATTTGATA AGCCACAAGC TACGATTTCA GACGAGAGTG AGAATAACGA AAGTGAATCA TCACCCCAGA TAACTAGCAC ACAAGAAGGA GATTCTGCCA GTGAGAATAA GAAGAAGGGA ATGGTTCTTC CATTTGATCC CCATTCCATC ACCTTTGATG AAGTTGTATA CTCCGTTGAT ATGCCTCGGG AAATGAGAGA GTCAGGTACC AGTGACAATA GATTGGTACT TTTGAAGAGT GTGAGCGGAG CTTTCAGGCC AGGTGTTCTC ACAGCTTTGA TGGGTGTTAG TGGTGCTGGT AAAACAACAT TAATGGATGT CTTGGCTGGA AGGAAAACCG GAGGTTACAT TGACGGGAGC ATCAAGATTT CTGGATACCC CAAGAAGCAA GATACATTTG CACGTATTTC CGGATACTGT GAACAGAATG ACATCCATTC ACCGTATGTA ACAGTTTTTG AGTCATTGGT TTACTCAGCT TGGCTGCGTT TACCTCAAGA CGTCAATGAA GAAAAAAGGA TGATGTTTGT TGAGGAAGTT ATGGATCTTG TGGAGCTTAC ACCATTAAGA TCAGCCTTAG TCGGGTTGCC AGGAGTTAAC GGTCTGTCAA CTGAGCAACG TAAAAGGTTG ACGATTGCAG TTGAACTAGT GGCAAATCCC TCTATCATTT TTATGGACGA ACCAACTTCA GGGTTAGATG CAAGAGCTGC TGCCATTGTG ATGAGAGCTG TTAGGAACAC TGTCGATACA GGAAGAACAG TTGTTTGTAC CATTCATCAG CCTAGCATTG ACATTTTTGA GGCTTTCGAC GAGTTGTTTC TAATGAAACG AGGAGGACAA GAGATATACG TTGGTCCATT AGGCCGCCAA TCATGCCATT TGATAAAATA TTTTGAGTCG ATACCTGGAG TAAGCAAAAT AGTGGAAGGT TACAATCCAG CAACTTGGAT GTTAGAAGTC ACAGCCTCAT CTCAAGAAAT GGCATTAGGG GTTGATTTTA CTGACTTGTA CAAGAAGTCA GATCTCTACA GGAGAAACAA AGCCTTGATT GATGAACTAA GCGTGCCGCG ACCTGGTACA AGTGACCTGC ATTTTGATTC TGAATTCTCA CAGCCATTTT GGACCCAATG TATGGCTTGC CTATGGAAAC AACACTGGTC ATATTGGCGT AATCCGGCTT ACACTGCAGT CAGACTTATC TTCACAACCT TTATAGCACT CATTTTCGGG ACAATGTTCT GGGATATTGG TACCAAAGTG AGTAGGAACC AAGATCTGGT TAATGCTATG GGATCTATGT ATGCTGCTGT TCTCTTCCTT GGCGTACAAA ATTCATCGTC
AGTTCAGCCT GTTGTATCCG TTGAGCGTAC TGTATTTTAC AGAGAAAAAG CTGCTGGAAT
GTACTCTGCT ATACCATATG CCTTTGCACA AGTTCTCATT GAAATACCTT ATATATTTGT
TCAAGCTACT GTCTATGGTC TCATTGTCTA TTCTATGATT GGATTTGAAT GGACTGTTGC AAAATTCTTT TGGGACTTCT TCTTCATGTT CTTCACTTTC CTGTACTTCA CCTTCTTTGG
TATGATGACC GTGGCTGTGA CCCCGAATCA AAACGTTGCT TCAATCGTCG CTGGATTCTT CTATACAGTA TGGAATCTCT TCTCAGGTTT CATCGTTCCA CGACCTCGTA TTCCGATATG
GTGGAGATGG TACTACTGGG GTTGCCCTAT TGCATGGACC TTGTATGGTT TGGTTGCATC
TCAATTCGGA GACCTTCAAG ATCCACTTAC TGATCAGAAT CAAACTGTGG AACAATTCCT GAGAAGTAAC TTTGGATTTA AGCATGATTT TCTTGGAGTT GTTGCAGCTG TGATCGTTGC
GTTTGCTGTT GTTTTCGCCT TCACATTTGC TTTGGGTATT AAGGCATTCA ACTTCCAGAG
AAGATAAAAA GAGTGTCTAT TTGTGTTTAA TTTGCTGTTG TTAATTCTTG AATAAGCTTT
CTATATGCAT TACTTTCTAG ATTACTGAAT ATGTCTTATG TTTTATTAAT CTTTTTGAAT
TCCCAGTTTT GTGTAACATG TAGTAATTGT TACTCATAAT TTTTTTTTAA TGGAAATATG TCTTCATTCT CC
SEQ ID NO:2: translation product of SEQ ID NO 1
MEPADLSNLR GRSLRASIRG SMRGSIRENS NSI RN GAE VFSRSARDED DEEALKAAL EKLPTYDRLR KGILFGSQGA AAEVDVDDSG VLERKNLLER LVKVADEDNE KFLLKLKNRI DRVGIDFPSI EVRFEHLNID ADAYVGSRAL PTFTNFISNF VEGLLDSIHI LPSKKRQVTI LKDVSGIVKP CRMTLLLGPP GSGKTTLLLA LAGKLDSALK VTGKVTYNGH ELHEFVPQRT AAYISQHDLH IGEMTVRETL EFSARCQGVG SRYEMLAELS RREKAANIKP DADIDMFMKA ASTEGQEAKV VTDYILKILG LDICADTMVG DQMIRGISGG QKKRVTTGEM IVGPSKALFM DEISTGLDSS TTYSIVNSLK QSVRIMKGTA LISLLQPAPE TYNLFDDIIL LSDGYIVYEG PREEVLEFFE SMGFKCPERK GAADFLQEVT SKKDQQQY I RRDEPYRFIT SKEFAEAYQS FHVGRKVSDE LKTTFDKSKS HPAALTTQKY GIGKRQLLKV CTERELLLMQ RNSFVYLFKF FQLLIIALMT MTIFFRTKMP RDSAEDGGIY SGALFFWIM IMFNGLSELP MTLYKLPVFY KQRDFLFYPS WAYAIPS IL KIPVTFAEVG MVFLTYYVM GFDPNVGRFF KQFLLLLLVN QMASALFRFI AAVGRTMGVA STFGAFALLL QFALGGFILA RNDVKD WI GY TSPLMYS VNAILVNEFD GQK KHIVAG GTEPLGAAW RARGFFPDAY Y IGVGALA GFIVMFNIAY SVALAYLNPF DKPQATISDE SENNESESSP QITSTQEGDS ASENKKKGMV LPFDPHSITF DEWYSVDMP PEMRESGTSD NRLVLLKSVS GAFRPGVLTA LMGVSGAGKT TLMDVLAGRK TGGYIDGSIK ISGYPKKQDT FARISGYCEQ NDIHSPYVTV FESLVYSA L RLPQDVNEEK RMMFVEEVMD LVELTPLRSA LVGLPGVNGL STEQRKRLTI AVELVANPSI IFMDEPTSGL DARAAAIVMR AVRNTVDTGR TWCTIHQPS IDIFEAFDEL FLMKRGGQEI YVGPLGRQSC HLIKYFESIP GVSKIVEGYN PAT MLEVTA SSQEMALGVD FTDLYKKSDL YRRNKALIDE LSVPRPGTSD LHFDSEFSQP F TQCMACL KQH SY RNP AYTAVRLIFT TFIALIFGTM FWDIGTKVSR NQDLVNAMGS MYAAVLFLGV QNSSSVQPW SVERTVFYRE KAAGMYSAIP YAFAQVLIEI PYIFVQATVY GLIVYSMIGF EWTVAKFFWD FFFMFFTFLY FTFFGMMTVA VTPNQNVASI VAGFFYTVWN LFSGFIVPRP RIPI R YY WGCPIA TLY GLVASQFGDL QDPLTDQNQT VEQFLRSNFG FKHDFLGWA AVIVAFAWF AFTFALGIKA FNFQRR
SEQ ID NO:3
TCCTCCTTCT CTTCAACAGT AGAATTGGTA ATTAAGACAA CTAATCAACT GATTGCACAT TGATTAGTAT CATGATATGA TATATTAATC TCGTGGACCC TATATATATT CGTCGTTCAT TATATTATAT TATATTAAGC AACTTCTTGT AAGAAGAAAA ATCTCAGCTC AGCTAGCTTC TTTCTAGATA TTTGAAGAGT CAAGCTAAAA AGGCATTTCA TAATTCTTAA TTTCATCATC ATTCTCCACT TGCCGTAAAA AAAGAAAAAA AGGAAAGAAA AAGGAAAATA GAAACTAGTA TTGCGAGAAT TACAAAGCCC AGAATTTGGA AATGTACAAG ATCAATATAA TGTCGTTACT AGCAAATATT AGGGTGATCT CACAGGTTTG GTTTTTAAAA AGTATAAAAT TGATAATTTA ACTCAGAGAA TGAAAATTTC CTAAAGAACT CTTCACTAAC ACAAAGTAAA AAAGCAGAAT CTGAAAGAAT TTAATCAAGA ATTATTTTGA CATTCTACTA GGGGATAAAA TTTGAGATCA TCAGACAATG ATTATTTTAA AAAAAAACCG TAAGATCAAC TTTAAACTTC TTTTAAAATG TTGCTTAAAT CTTTGTGAGA TCAATGACCT GATATGAGTA GGCTCACATT AATGGGGTGA GTAGTTAAGA TGCTTGCAAG ATGAGTTCTC AATATTAGGA TATTCCGAGC TTACTTATAT GAGAACTAAA CTAGTTGATT CTCTTTGTCC AGTCACCTTG TTGCAATATT TGCATTTCTT CCGGCTAAGA TCCCAAGTCC AATGTTATTA AATCAATACA AGCATATATA AATTCTGTTA AATTAATTAT GAATAAAAAT TTAAAATATA AATAAAATAA TATTTAATTT GCTATGCTGA CTTGGCATGT TTCTAGACGC TGGTGGCTGG CGGCTATTTT TCTTTGTCTG CTTTGACTGC TGCCTCTCCA AATTATAAGA TCCTATGCTA ATAATTCACA CGTTAATAAA TAATTACCCT CGAAGTTTCT TTCAAGTCTT TTTCTCATTT GGTCACATAT GACTCCTTAT GAACAGTAAT TATAGAAGTT TCCTCTACAA CTACTGTATA CGTCAAATAA TTCAAATTAA ATTCGTCAAA ATATTAGGTC AATAATTCCA AAGACCAAAG TACTATGCAT GTATACGACC AATTAAAAAT TAAAACAATG CTATAGCCGC CCCTTCCTCT TTGCTGCTAT ATAATACCTT CTCCTTAGAC AACTAACCTT AACTTCTCCT TCTATTCTTT TGTTCTTGTA ATAAAGAAGA TTACACTAAT TTCACATTTT CAGTTCATTT GATCAAATTA TAAAATATTT TGAAAGTCGA ACTTCTTAAT TATTGCTCAA AATG
SEQ ID NO:4
CACTAACACA AAGTAAAAAA GCAGAATCTG AAAGAATTTA ATCAAGAATT ATTTTGACAT TCTACTAGGG GATAAAATTT GAGATCATCA GACAATGATT ATTTTAAAAA AAAACCGTAA GATCAACTTT AAACTTCTTT TAAAATGTTG CTTAAATCTT TGTGAGATCA ATGACCTGAT ATGAGTAGGC TCACATTAAT GGGGTGAGTA GTTAAGATGC TTGCAAGATG AGTTCTCAAT ATTAGGATAT TCCGAGCTTA CTTATATGAG AACTAAACTA GTTGATTCTC TTTGTCCAGT CACCTTGTTG CAATATTTGC ATTTCTTCCG GCTAAGATCC CAAGTCCAAT GTTATTAAAT CAATACAAGC ATATATAAAT TCTGTTAAAT TAATTATGAA TAAAAATTTA AAATATAAAT AAAATAATAT TTAATTTGCT ATGCTGACTT GGCATGTTTC TAGACGCTGG TGGCTGGCGG CTATTTTTCT TTGTCTGCTT TGACTGCTGC CTCTCCAAAT TATAAGATCC TATGCTAATA ATTCACACGT TAATAAATAA TTACCCTCGA AGTTTCTTTC AAGTCTTTTT CTCATTTGGT CACATATGAC TCCTTATGAA CAGTAATTAT AGAAGTTTCC TCTACAACTA CTGTATACGT CAAATAATTC AAATTAAATT CGTCAAAATA TTAGGTCAAT AATTCCAAAG ACCAAAGTAC TATGCATGTA TACGACCAAT TAAAAATTAA AACAATGCTA TAGCCGCCCC TTCCTCTTTG CTGCTATATA ATACCTTCTC CTTAGACAAC TAACCTTAAC TTCTCCTTCT ATTCTTTTGT TCTTGTAATA AAGAAGATTA CA
SEQ ID NO:5: SB1 box CACTAACACA AAGTAA
SEQ ID NO:6: SB2 box
CGTTAATAAA TAATTACCCT CGAAGTTTCT TTCAAGTCTT TTTCTCA
SEQ ID NO:7: SB3 box
TTATGAACAG TAATTA

Claims

1. Use of an isolated polynucleotide to induce or enhance the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells, wherein said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof;
(b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO :1 or the complement thereof;
(c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO: 1 ;
(d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c),
(e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and
(g) fragments and variants of such polynucleotides in (a) to (f).
2. Use of an isolated polypeptide to induce or enhance the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells, wherein said polypeptide is selected from the group comprising:
(a) a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1;
(b) a polypeptide encoded by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (c) a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2,
(d) a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and (e) variants or fragments or functional fragments of such polypeptides in (a) to (d).
3. Use of an expression cassette comprising a polynucleotide wherein said polynucleotide is selected from the group comprising:
(a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof;
(b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof;
(c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO: 1 ; (d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c),
(e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2,
(f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and
(g) fragments and variants of such polynucleotides in (a) to (f); to induce or to enhance the production and/or the secretion of at least one taxane- type diterpene and/or derivative thereof, in plants or plant cells.
4. Use according to claim 3, wherein said expression cassette further comprises a promoter operably linked to said polynucleotide encoding NpABCI -transporter.
5. Use of an expression cassette according to claim 3 to 4 to induce or enhance the production and/or the secretion of at least one taxane-type diterpene and/or derivative thereof, in plants or plant cells, comprising: transforming said plants or plant cells with an expression vector comprising said expression cassette, selecting transformed plants or plant cells with an enhanced production, and propagating such selected transformed plants or plant cells.
6. Use according to any of claims 1 to 5, wherein the taxane-type diterpene is at least one compound selected from the group comprising taxol, 7-epitaxol, baccatin III, 7- epibaccatin III, cephalomannine, 7-epicephalomannine, 10-deacetylbaccatin III, 10-deacetylcephalomannine, 10-deacetyltaxol, 7-xylosyltaxol, 7- xylosylcephalomannine, 7-xylosylbaccatin III, taxagifine, an analogue thereof, taxane la, an analogue thereof and the like.
7. Use according to claim 6, wherein said taxane-type diterpene is taxol.
8. Method for producing a plant or a plant cell having enhanced production and/or secretion of at least one taxane-type diterpene and/or derivative thereof by plants or plant cells by transforming said plant or plant cell with an expression cassette according to any of claims 3 to 7.
9. Transgenic plants, the cells, seeds, plant cell culture, and progeny thereof with an enhanced production and/or secretion of at least one taxane-type diterpene and/or derivative thereof, transformed with an expression vector comprising an expression cassette according to any of claims 3 to 8.
10. Transgenic plant cell culture according to claim 9 further characterized in (1 ) having an increased vacuolar localization of said taxane-type diterpene and/or derivative thereof, or (2) having a secretion or an increased secretion of said taxane-type diterpene and/or derivative thereof.
11. Use of an isolated polynucleotide for protecting plants from damage caused by pathogens, wherein said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof;
(b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof;
(c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO: 1;
(d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c),
(e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and
(g) fragments and variants of such polynucleotides in (a) to (f).
12. Use of an isolated polypeptide for protecting plants from damage caused by pathogens, wherein said polypeptide is selected from the group comprising:
(a) a polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO:1 ;
(b) a polypeptide encoded by a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO:1 ; (c) a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2,
(d) a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and
(e) variants or fragments or functional fragments of such polypeptides in (a) to (d).
13. Use of an expression cassette comprising a polynucleotide wherein said polynucleotide is selected from the group comprising:
(a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof;
(b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO: 1 ;
(d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c),
(e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and
(g) fragments and variants of such polynucleotides in (a) to (f); for protecting plants from damage caused by pathogens.
14. Use according to claim 13, wherein said expression cassette further comprises a promoter operably linked to said polynucleotide encoding NpABCI -transporter.
15. Use of an expression cassette according to claims 13 or 14 for protecting plants from damage caused by pathogens, comprising: transforming said plants with an expression vector comprising said expression cassette, selecting transformed plants, and propagating such selected transformed plants .
16. Transgenic plants protected from pathogens, comprised of a host plant transformed with an expression vector comprising an expression cassette comprising a polynucleotide wherein said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof;
(b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof;
(c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO: 1 ;
(d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c),
(e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and
(g) fragments and variants of such polynucleotides in (a) to (f).
17. Method for protecting plants from damage caused by pathogens, comprising the step of transforming with an expression vector comprising an expression cassette comprising a polynucleotide wherein said polynucleotide is selected from the group comprising: (a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof;
(b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof;
(c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO: 1 ;
(d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c),
(e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2, (f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and
(g) fragments and variants of such polynucleotides in (a) to (f).
18. Method according to claim 17 wherein said transforming step includes providing an inducible promoter operably linked to said polynucleotide which promotes localized expression of said polynucleotide in the area of invasion of said pathogen.
19. Method of preventing or reducing damage in a host plant which may be attacked by a pathogen, comprising the step of harboring in said host plant a polynucleotide selected from the group comprising:
(a) a polynucleotide comprising an RNA sequence as given in SEQ ID NO:1 or the complement thereof;
(b) a polynucleotide comprising a DNA sequence corresponding to SEQ ID NO:1 or the complement thereof; (c) a polynucleotide having a polynucleotide sequence which is at least 65% identical to SEQ ID NO: 1;
(d) a polynucleotide specifically hybridizing to the polynucleotide sequence as defined in (a) to (c), (e) a polynucleotide encoding a polypeptide with an amino sequence which is at least 65% identical to the amino acid sequence as given in SEQ ID NO:2,
(f) a polynucleotide encoding a polypeptide comprising the amino sequence as given in SEQ ID NO:2, and
(g) fragments and variants of such polynucleotides in (a) to (f).
20. Promoter having a sequence selected from the group comprising: a) a nucleic acid sequence as given in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6, SEQ ID NO:7 or a combination thereof; and b) a nucleic acid sequence that is at least about 60% homologous to the coding regions of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6 and SEQ ID NO:7 or a combination thereof.
21. Promoter according to claim 20, characterized in that it comprises two or more copies of the nucleotide sequence selected from the group comprising SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5; SEQ ID NO:6 and SEQ ID NO:7 or a combination thereof;.
22. Chimeric gene characterized in that it comprises the promoter according to claims 20 or 21 and a desired gene.
23. Vector characterized in that it comprises the promoter according to claims 20 or 21.
24. Vector according to claim 23, characterized in that it has a cloning site and a terminator functional in a host cell, which is positioned 3' downstream of said promoter.
25. Vector characterized in that it comprises the chimeric gene of claim 22.
26. Transformant characterized in that it contains the promoter according to claims 20 or 21 , the chimeric gene of claim 22 or the vector according to any of claims 23 to 25.
27. Transformant of claim 26, which is a plant cell.
28. Method for expressing a gene, which is characterized by comprising a step of expressing the desired gene in a host cell under the control of the promoter according to claims 20 or 21.
29. Use of the promoter according to claims 20 or 21 for controlling the expression of a desired gene in a host cell.
30. Method of expressing heterologous genes in plants comprising the steps of
(a) recombinantly transforming a portion of the plant in which it is desired to express said heterologous gene with said heterologous gene, in operative association with the promoter according to claim 20 or 21 ;
(b) allowing the plant material so transformed to express such heterologous gene.
PCT/EP2003/008137 2003-07-24 2003-07-24 Use of npabc1 transporter and promoter thereof Ceased WO2005014826A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU2003250163A AU2003250163A1 (en) 2003-07-24 2003-07-24 Use of npabc1 transporter and promoter thereof
PCT/EP2003/008137 WO2005014826A1 (en) 2003-07-24 2003-07-24 Use of npabc1 transporter and promoter thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2003/008137 WO2005014826A1 (en) 2003-07-24 2003-07-24 Use of npabc1 transporter and promoter thereof

Publications (1)

Publication Number Publication Date
WO2005014826A1 true WO2005014826A1 (en) 2005-02-17

Family

ID=34129884

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/008137 Ceased WO2005014826A1 (en) 2003-07-24 2003-07-24 Use of npabc1 transporter and promoter thereof

Country Status (2)

Country Link
AU (1) AU2003250163A1 (en)
WO (1) WO2005014826A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002083888A2 (en) * 2001-04-18 2002-10-24 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw The use of genes encoding abc transporters to stimulate the production of secondary metabolites in biological cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002083888A2 (en) * 2001-04-18 2002-10-24 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw The use of genes encoding abc transporters to stimulate the production of secondary metabolites in biological cells

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [online] 7 May 2003 (2003-05-07), XP002275319, retrieved from EBI Database accession no. AY267899 *
GREC SEBASTIEN ET AL: "Identification of a transcription promoter region that regulates the expression of a plasma membrane ABC transporter involved in the secretion of antifungal diterpenes.", PLANT BIOLOGY (ROCKVILLE), vol. 2001, 2001, Joint Annual Meetings of the American Society of Plant Biologists and the Canadian Society of Plant;Providence, Rhode Island, USA; July 21-25, 2001, pages 155, XP002274709 *
GREC SEBASTIEN ET AL: "Identification of regulatory sequence elements within the transcription promoter region of NpABC1, a gene encoding a plant ABC transporter induced by diterpenes.", PLANT JOURNAL, vol. 35, no. 2, July 2003 (2003-07-01), pages 237 - 250, XP002274708, ISSN: 0960-7412 *
JASINSKI MICHAL ET AL: "A plant plasma membrane ATP binding cassette-type transporter is involved in antifungal terpenoid secretion", PLANT CELL, vol. 13, no. 5, May 2001 (2001-05-01), pages 1095 - 1107, XP002274707, ISSN: 1040-4651 *
JASINSKI MICHAL ET AL: "The ATP-binding cassette transporters: Structure, function, and gene family comparison between rice and Arabidopsis.", PLANT PHYSIOLOGY (ROCKVILLE), vol. 131, no. 3, March 2003 (2003-03-01), pages 1169 - 1177, XP002274712, ISSN: 0032-0889 (ISSN print) *
KIKUCHI SHOSHI ET AL: "Collection, mapping, and annotation of over 28,000 cDNA clones from japonica rice.", SCIENCE (WASHINGTON D C), vol. 301, no. 5631, 18 July 2003 (2003-07-18), pages 376 - 379, XP002274713, ISSN: 0036-8075 (ISSN print) *
SASABE M ET AL: "cDNA cloning and characterization of tobacco ABC transporter: NtPDR1 is a novel elicitor-responsive gene", FEBS LETTERS, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 518, no. 1-3, 8 May 2002 (2002-05-08), pages 164 - 168, XP004353661, ISSN: 0014-5793 *
SMART C C ET AL: "HORMONAL AND ENVIRONMENTAL REGULATION OF A PLANT PDR5-LIKE ABC TRANSPORTER", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, US, vol. 271, no. 32, 9 August 1996 (1996-08-09), pages 19351 - 19357, XP002951325, ISSN: 0021-9258 *
VAN DEN BRULE SYBILLE ET AL: "The plant PDR family of ABC transporters.", PLANTA (BERLIN), vol. 216, no. 1, November 2002 (2002-11-01), pages 95 - 106, XP002274710, ISSN: 0032-0935 *

Also Published As

Publication number Publication date
AU2003250163A1 (en) 2005-02-25

Similar Documents

Publication Publication Date Title
JP2002535993A (en) Methods for modulating biosynthesis of metabolites in recombinant cells
WO1992012249A1 (en) Control of fruit ripening and senescence in plants
JP2002051654A (en) Genetic engineering of novel plant expression type
Koyama et al. Promoter of Arabidopsis thaliana phosphate transporter gene drives root-specific expression of transgene in rice
EP3318638A1 (en) Nucleotide sequence for improving resistance against plant pathogens
Serrazina et al. Expression of Castanea crenata allene oxide synthase in Arabidopsis improves the defense to Phytophthora cinnamomi
JP2003048897A (en) Method for producing antibacterial protein
US20100016565A1 (en) Identification and characterization of an anthocyanin mutant (ant1) in tomato
US7855319B2 (en) High level antioxidant-containing foods
CN109136233B (en) Overexpression of transcription factor SlBBX20 increases tomato anthocyanin content
WO2009061215A1 (en) Compositions and methods for altering pigment production in plants
CN110408649A (en) Application of NOR gene and its encoded protein in regulating the synthesis of flavonoids in tomato fruit
KR20020064352A (en) Rice-Origin Gibberellin 3β-HydroxylaseGenes and Utilization Thereof
Pulla et al. Expression and functional characterization of pathogenesis-related protein family 10 gene, PgPR10-2, from Panax ginseng CA Meyer
CN100422321C (en) Disease-resistant plants and breeding methods thereof
WO2010004070A1 (en) Plant having resistance to low-temperature stress and method of production thereof
US7304207B2 (en) Identification and characterization of an Anthocyanin mutant (ANT1) in tomato
US5723746A (en) Reduced ethylene synthesis and delayed fruit ripening in transgenic tomatoes expressing S-adenosylmethionine hydrolase
US6025544A (en) Processes for modifying plant flowering behavior
JP5804420B2 (en) Genes involved in promotion of plant growth and increase in biomass and methods for using the same
WO2005014826A1 (en) Use of npabc1 transporter and promoter thereof
US20060075525A1 (en) Transgenic Echinacea plants
CN111154772B (en) Pear sugar transport gene PbSWEET4 and application thereof
KR101166715B1 (en) Recombinant vector comprising polynucleotide related with tocotrienol biosynthesis and transformants transformed thereby
JP3527585B2 (en) Promoter of gene induced by disease resistance inducer

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP