WO2005014110A1 - Cpg-packaged liposomes - Google Patents
Cpg-packaged liposomes Download PDFInfo
- Publication number
- WO2005014110A1 WO2005014110A1 PCT/EP2004/008190 EP2004008190W WO2005014110A1 WO 2005014110 A1 WO2005014110 A1 WO 2005014110A1 EP 2004008190 W EP2004008190 W EP 2004008190W WO 2005014110 A1 WO2005014110 A1 WO 2005014110A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- composition
- cpg
- nucleotides
- animal
- liposome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention is related to the fields of vaccinology, immunology and medicine.
- the invention provides compositions and methods for enhancing production of IFN ⁇ in an animal by binding or enclosing and packaging, respectively, of at least one A- type CpG, preferably oligonucleotides containing at least one non-methylated CpG sequence.
- Preferred liposomes are cationic liposomes.
- the invention can be used to induce IFN ⁇ in vivo, particularly useful for the treatment of chronic viral diseases, cancer and short-term prophylaxis from pathogen-infection.
- lymphocytes are the key players of the adaptive immune system. Each lymphocyte expresses antigen-receptors of unique specificity. Upon recognizing an antigen via the receptor, lymphocytes proliferate and develop effector function. Few lymphocytes exhibit specificity for a given antigen or pathogen, and massive proliferation is usually required before an effector response can be measured - hence, the slow kinetics of the adaptive immune system.
- the adaptive immune system reacts faster when encountering the antigen a second time. This is the basis of its ability to remember.
- the cells and molecules of the innate immune system are usually present in massive numbers and recognize a limited number of invariant features associated with pathogens (Medzhitov, R. and Janeway, C.A., Jr., Cell 91:295-298 (1997)). Examples of such patterns include lipopolysaccharides (LPS).
- CpG non-methylated CG-rich DNA
- RNA double stranded RNA
- CpG motifs may differ.
- CpG motifs that stimulate mouse immune cells may not necessarily stimulate human immune cells and vice versa.
- two types of CpGs exist, those that activate B cells and trigger the production of IL-12 (B-type, also known as K-type) and those that activate plasmocytoid DCs and induce the production of IFN ⁇ (A-type, also known as D-type).
- B-type CpGs exhibit maximal activity only if the natural phosphodiester bond of the DNA is replaced by non-natural phosphothioester bond. This modification not only stabilizes the CpGs and protects them from degradation by nucleases but also leads to enhanced recognition by TLR9.
- A-type CpGs which are optimally recognized by TLR9 in their natural phosphodiester form
- phosphothioester stabilized A-type CpGs are poorly recognized
- the usefulness of A-type CpGs is often limited in vivo, since they are rather unstable in vivo. Thus, they exhibit unfavourable pharmacokinetics.
- A-type CpG-oligonucleotides In order to render A-type CpG-oligonucleotides more potent, it would be essential to apply them in a protected form.
- One possibility to stabilize A-type CpGs is to package them into viruslike particles (NLPs), which protect them from degradation (WO03/024481).
- liposomes were reported not to enhance the potency of A-type CpGs (WO 03/040308). We now found surprisingly, that liposomes strongly enhance the in vivo efficacy of A-type CpGs.
- the invention provides a composition for inducing the production of IFN ⁇ in an animal comprising a liposome and an A-type unmethylated CpG-containing oligonucleotide, where the oligonucleotide is bound to or enclosed by the liposome.
- the at least one A-type CpG comprises at least one
- the at least one A-type CpG comprises poly G motifs at the 5' and 3' ends, and wherein preferably all of the G nucleotides are phosphodiester nucleotides.
- the A-type (also called D-type) CpG comprises or alternatively consists of a phosphodiester oligonucleotide, preferably comprising a palindromic sequence, wherein preferably the palindromic sequence is GACGATCGTC (SEQ ID NO: 16).
- the A-type CpG has the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 3) or is a shorter version thereof.
- the liposome is neutral, anionic, cationic, stealth or cationic stealth.
- the liposome is a cationic liposome.
- the liposome is smaller than 200 nm.
- the present invention provides a method for enhancing the production of IFN ⁇ in an animal comprising introducing into the animal a composition of the invention.
- a vaccine comprising an immunologically effective amount of the composition of the invention together with a pharmaceutically acceptable diluent, carrier or excipient.
- the route of injection is preferably subcutaneous or intramuscular, but it would also be possible to apply the A-type CpG-containing liposomes intradermally, intranasally, intravenously or directly into the lymph node.
- the A-type CpG-containing liposomes mixed with antigen are applied locally, near a tumor or local viral reservoir.
- PBMC Peripheral blood mononuclear cells
- FCS RPMI 10% FCS RPMI
- 96-U-bottom well plate 0.3x10 6 cells/well.
- Cells were treated with the indicated concentrations of oligonucleotides or left untreated for 24h, at 37°C.
- PBMC peripheral blood mononuclear cells
- PBMC Peripheral blood mononuclear cells
- PBMC peripheral blood mononuclear cells
- PBMC peripheral blood mononuclear cells
- PBMC peripheral blood mononuclear cells
- IFN alpha released in the supematants was measured by ELISA using an antibody set (Cat. # 71100-1) from PBL Biomedical Laboratories, USA.
- Fig. 4 shows that phosphothioester (type B) oligonucleotides induce IL-12 secretion from human PBMC.
- PBMC Peripheral blood mononuclear cells were (PBMC) obtained from heparinized blood of healthy volunteers by ficoll (Amersham Biosciences, Sweden) density centrifugation. PBMC were resuspended in 10% FCS RPMI and plated in 96-U-bottom well plate at 0.3xl0 6 cells/well. Cells were treated with the indicated concentrations of oligonucleotides or left untreated for 24h, at 37°C. IL-12, released in the supematants was measured by ELISA using an antibody pair provided from Becton Dickinson (C8.3 and C8.6 clones). Fig.
- pDC human plasmacytoid DC
- pDC phosphodiester (type A) oligonucleotides induce IFN alpha secretion from human plasmacytoid DC
- pDC were isolated from human PBMC by magnetic activated cell sorting (MACS).
- PBMC from buffy coats were labeled with anti-BDCA-2 mAb coupled to magnetic beads (Milteniy, Germany) according to manufacturer's protocol.
- Labeled cells were positively selected by passing PBMC through a LS column.
- the purity of pDC was controlled by staining them with anti- BDCA-4-APC mAb (Milteniy).
- pDC were plated at 0.04x10 6 /well and treated with G10, 2006 or left untreated.
- PBMC Peripheral blood mononuclear cells
- Fig. 7 shows that 1668pt but not 1668po or G6 is able to enhance CTL responses in vivo.
- Fig. 7A Mice were immunized with 100 ug of p33-NLPs (HBcAg with genetically fused the p33 epitope) alone or mixed with 1668pt or 1668po CpGs (20 nmol).
- mice were challenged ip with recombinant vaccinia viras expressing LCMN GP (1 x 106 pfu) and viral titers were determined in ovaries 5 days later.
- Fig. 7B The bacteriophage Q ⁇ capsid was used as VLP, to which the p33 peptide was chemically coupled, and co-delivered with the G6 CpG. Mice were left untreated or immunized with 90 ug of Q ⁇ p33-VLPs mixed with G6 CpGs (20 nmol).
- Fig. 8 shows that G6 in liposomes is able to enhance p33-specif ⁇ c immunity.
- Fig. 8A Liposomes containing 1 mg/ml p33 peptide (KAVY ⁇ FATM) (SEQ ID NO: 13) alone or with 100 nmol/ml CpGs (1668 or G6) were produced.
- Fig. 8B At day 12, liposome-treated mice were challenged ip with recombinant vaccinia viras expressing LCMV-GP (4 x 10 pfu) and viral titers were determined in ovaries 5 days later.
- Animal As used herein, the term “animal” is meant to include, for example, humans, sheep, horses, cattle, pigs, dogs, cats, rats, mice, birds, reptiles, fish, insects and arachnids.
- Antibody As used herein, the term “antibody” refers to molecules which are capable of binding an epitope or antigenic determinant.
- the term is meant to include whole antibodies and antigen-binding fragments thereof, including single-chain antibodies.
- the antibodies are human antigen binding antibody fragments and include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or N ⁇ domain.
- the antibodies can be from any animal origin including birds and mammals.
- the antibodies are human, murine, rabbit, goat, guinea pig, camel, horse or chicken.
- human antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulins and that do not express endogenous immunoglobulins, as described, for example, in U.S. Patent No. 5,939,598 by Kucherlapati et al.
- the compositions and methods of the invention are also useful for treating cancer by stimulating non-specific immunity against cancer which may enhance specific immunity against tumor antigens.
- a "tumor antigen” as used herein is a compound, such as a peptide, associated with a tumor or cancer and which is capable of provoking an immune response.
- Tumor antigens can be prepared from cancer cells either by preparing cmde extracts of cancer cells, for example, as described in Cohen, et al., Cancer Research, 54:1055 (1994), by partially purifying the antigens, by recombinant technology or by de novo synthesis of known antigens.
- Tumor antigens include antigens that are antigenic portions of or are a whole tumor or cancer polypeptide. Such antigens can be isolated or prepared recombinantly or by any other means known in the art.
- Cancers or tumors include, but are not limited to, biliary tract cancer; brain cancer; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver cancer; lung cancer (e.g. small cell and non-small cell); melanoma; neuroblastomas; oral cancer; ovarian cancer; pancreas cancer; prostate cancer; rectal cancer; sarcomas; skin cancer; testicular cancer; thyroid cancer; and renal cancer, as well as other carcinomas and sarcomas. Allergens also serve as antigens in vertebrate animals.
- allergen also encompasses "allergen extracts” and "allergenic epitopes.”
- allergens include, but are not limited to: pollens (e.g. grass, ragweed, birch and mountain cedar); house dust and dust mites; mammalian epidermal allergens and animal danders; mold and fungus; insect bodies and insect venom; feathers; food; and drags (e.g., penicillin).
- allergen determinant As used herein, the term “antigenic determinant” is meant to refer to that portion of an antigen that is specifically recognized by either B- or T- lymphocytes.
- Antigen presenting cell As used herein, the term "antigen presenting cell” is meant to refer to a heterogeneous population of leucocytes or bone marrow derived cells which possess an immunostimulatory capacity. For example, these cells are capable of generating peptides bound to MHC molecules that can be recognized by T cells.
- the term is synonymous with the term "accessory cell” and includes, for example, Langerhans' cells, interdigitating cells, dendritic cells, B cells and macrophages.
- epithelial cells, endothelial cells and other, non-bone marrow derived cells may also serve as antigen presenting cells.
- bound refers to binding that may be covalent, e.g., by chemically coupling the unmethylated CpG-containing oligonucleotide to a liposome, or non-covalent, e.g., ionic interactions, hydrophobic interactions, hydrogen bonds, etc.
- Covalent bonds can be, for example, ester, ether, phosphoester, amide, peptide, imide, carbon-sulfur bonds, carbon-phosphoms bonds, and the like.
- the term also includes the enclosement, or partial enclosement, of a substance.
- bound is broader than and includes terms such as “coupled,” “fused,” “enclosed” and “attached.” Moreover, with respect to the CpG being bound to the liposome, the term “bound” also includes the enclosement, or partial enclosement, of the CpG.
- CpG refers to an oligonucleotide which contains at least one unmethylated cytosine, guanine dinucleotide sequence (e.g. "CpG- oligonucleotides” or DNA containing a cytosine followed by guanosine and linked by a
- a CpG oligonucleotide is an oligonucleotide that is at least about ten nucleotides in length and includes at least one unmethylated CpG dinucleotide. The entire CpG oligodeoxynucleotide can be unmethylated or portions may be unmethylated.
- CpGs can be useful in activating B cells, NK cells and antigen-presenting cells, such as dendritic cells, monocytes and macrophages.
- the CpGs can include nucleotide analogs such as analogs containing phosphorothioester bonds and can be double-stranded or single-stranded.
- phosphothioester stabilized CpGs are B-type CpGs while phosphodiester CpGs are A-type CpGs as indicated below.
- CpG motif refers to a pattern of nucleotides that include an unmethylated central CpG, i.e.
- the unmethylated CpG dinucleotide in which the C is unmethylated, surrounded by at least one base, preferably one or two nucleotides, flanking (on the 3' and the 5' side of) the central CpG.
- the CpG motif as used herein comprises or alternatively consists of the unmethylated CpG dinucleotide and two nucleotides on its 5' and 3' ends.
- the bases flanking the CpG confer a significant part of the activity to the CpG oligonucleotide.
- A-type CpGs As used herein, the term "A-type CpG” or “D-type CpG” refers to an oligodeoxynucleotide (ODN) comprising at least one CpG motif.
- ODN oligodeoxynucleotide
- the nucleotides of the at least one CpG motif are linked by at least one, typically and preferably exclusively phosphodiester (PO) bonds.
- PO phosphodiester
- the CpG motif, and hereby preferably the CpG dinucleotide and its immediate flanking regions comprising at least one, preferably two nucleotides are composed of phosphodiester nucleotides.
- the term "A-type CpG” or “D-type CpG” as used within this specification refers to an oligodeoxynucleotide (ODN) comprising at least one CpG motif and having poly G motifs at the 5' and/or 3' ends.
- the poly G motif comprises or alternatively consists of at least one, preferably at least three, at least four, at least five, at least six, at least seven, at least 8, at least 9, and more preferably at least 10 Gs (glycins).
- the 5' and/or 3' ends are phoshorothioate modified.
- all Gs of the poly G motif are linked by phosphodiester bonds.
- A- type CpGs preferentially stimulate activation of T cells and the maturation of dendritic cells and induce the release of IFN ⁇ .
- the A-type CpG of the invention comprises or alternatively consists of a palindromic sequence.
- the CpG motif is part of a palindromic sequence.
- all nucleotides are composed of phosphodiester nucleotides.
- the palindromic sequence is GACGATCGTC (SEQ ID NO: 16).
- Immune response refers to the systemic or local production of cytokines/chemokines/interferons. In some instances, however, the immune responses may be of low intensity and become detectable only when using at least one substance in accordance with the invention. "Immunogenic” refers to an agent used to stimulate the immune system of a living organism, so that one or more functions of the immune system are increased and directed towards the immunogenic agent.
- Immunization refers to conferring the ability to mount a substantial immune response (including non-specific production of cytokines, chemokines, interferons and alike). These terms do not require that complete immunity be created, but rather that an immune response be produced which is substantially greater than baseline. For example, a mammal may be considered to be immunized if systemic or local cytokine/chemokine/interferon production can be measured.
- liposome refers to phospholipid vesicles comprising one or more, preferably one, two, or three phospholipid bilayer membranes.
- Liposomes vary in charge and in size depending on the method of preparation and the lipids used.
- the liposome of the present invention may be neutral, cationic, anionic, stealth, or cationic stealth.
- the liposome of the invention is a cationic liposome.
- the liposome may have a diameter between 100 and 800 nm, preferably between 100 and 400 nm, more preferably between 100 and 300 nm, even more preferably between 100 and 200 nm, most preferably less than 200 nm.
- liposome shall also encompass modified liposomes, preferably modified liposomes, wherein the surface of the liposomes may be specifically modified to optimize binding to DC, for example, via specific sugar moieties (Fukasawa et al, (1998), FEBS, 441, 353-356) or antibodies (Serre et al. (1998), J. Immunol., 161, 6059- 6067).
- Oligonucleotide refers to a nucleic acid sequence comprising 2 or more nucleotides, generally at least about 6 nucleotides to about 100,000 nucleotides, preferably about 6 to about 2000 nucleotides, and more preferably about 6 to about 300 nucleotides, even more preferably about 20 to about 300 nucleotides, and even more preferably about 20 to about 100 nucleotides.
- oligonucleotide or “oligomer” also refer to a nucleic acid sequence comprising more than 100 to about 2000 nucleotides, preferably more than 100 to about 1000 nucleotides, and more preferably more than 100 to about 500 nucleotides.
- Oligonucleotide also generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. The modification may comprise the backbone or nucleotide analogues.
- Oligonucleotide includes, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double- stranded or a mixture of single- and double-stranded regions.
- oligonucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
- an oligonucleotide can be synthetic, genomic or recombinant, e.g., ⁇ - DNA, cosmid DNA, artificial bacterial chromosome, yeast artificial chromosome and filamentous phage such as Ml 3.
- oligonucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
- nucleotide modifications/analogs include peptide nucleic acid, inosin, tritylated bases, phosphorothioates, alkylphosphorothioates, 5-nitroindole deoxyribofuranosyl, 5-methyldeoxycytosine and 5,6-dihydro-5,6- dihydroxydeoxythymidine.
- oligonucleotide embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells.
- Other nucleotide analogs/modifications will be evident to those skilled in the art.
- Effective Amount refers to an amount necessary or sufficient to realize a desired biologic effect.
- An effective amount of the composition would be the amount that achieves this selected result, and such an amount could be determined as a matter of routine by a person skilled in the art.
- an effective amount for treating an immune system deficiency could be that amount necessary to cause activation of the immune system, resulting in the production of cytokines and alike.
- the term is also synonymous with "sufficient amount.”
- the effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular composition being administered, the size of the subject, and/or the severity of the disease or condition.
- compositions of the invention can be combined, optionally, with a pharmaceutically-acceptable carrier.
- pharmaceutically-acceptable carrier means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human or other animal.
- carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. Treatment: As used herein, the terms “treatment”, “treat”, “treated” or “treating” refer to prophylaxis and or therapy.
- the term refers to a prophylactic treatment which increases the resistance of a subject to infection with a pathogen or, in other words, decreases the likelihood that the subject will become infected with the pathogen or will show signs of illness attributable to the infection, as well as a treatment after the subject has become infected in order to fight the infection, e.g., reduce or eliminate the infection or prevent it from becoming worse.
- Vaccine refers to a formulation which contains the composition of the present invention and which is in a form that is capable of being administered to an animal.
- the vaccine comprises a conventional saline or buffered aqueous solution medium in which the composition of the present invention is suspended or dissolved.
- the composition of the present invention can be used conveniently to prevent, ameliorate, or otherwise treat a condition.
- the vaccine Upon introduction into a host, the vaccine is able to provoke an immune response including, but not limited to, the production of antibodies and/or cytokines and/or the activation of cytotoxic T cells, antigen presenting cells, helper T cells, dendritic cells and/or other cellular responses.
- the vaccine of the present invention additionally includes an adjuvant which can be present in either a minor or major proportion relative to the compound of the present invention.
- adjuvant refers to non-specific stimulators of the immune response or substances that allow generation of a depot in the host which when combined with the vaccine of the present invention provide for an even more enhanced immune response.
- adjuvants can be used. Examples include incomplete Freund's adjuvant, aluminum hydroxide and modified muramyldipeptide.
- One, a, or an When the terms “one,” “a,” or “an” are used in this disclosure, they mean “at least one” or "one or more,” unless otherwise indicated.
- certain embodiments of the invention involve the use of recombinant nucleic acid technologies such as cloning, polymerase chain reaction, the purification of DNA and RNA, the expression of recombinant proteins in prokaryotic and eukaryotic cells, etc.
- recombinant nucleic acid technologies such as cloning, polymerase chain reaction, the purification of DNA and RNA, the expression of recombinant proteins in prokaryotic and eukaryotic cells, etc.
- Such methodologies are well known to those skilled in the art and can be conveniently found in published laboratory methods manuals (e.g., Sambrook, J. et al., eds., Molecular Cloning, A Laboratory Manual, 2nd. edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (1989). 2.
- compositions and Methods for Enhancing of CpG-induced INF ⁇ - production by liposomes The disclosed invention provides compositions and methods for enhancing the production of IFN ⁇ by CpGs in an animal.
- Compositions of the invention comprise, or alternatively consist of, (a) a liposome and (b) at least one A-type CpG, wherein said A- type CpG (b) is bound to or enclosed by the liposome (a).
- the A-type CpG of the invention is G10 (SEQ ID NO: 3).
- the invention provides a method for enhancing the production of IFN ⁇ in an animal comprising introducing into said animal a composition of the invention.
- the invention provides a method of immunizing or treating an animal comprising administering to the animal an immunologically effective amount of a vaccine of the invention.
- the invention conveniently enables the practitioner to constmct such a composition for various treatment and/or prevention purposes, which include the prevention and/or treatment of infectious diseases, as well as chronic infectious diseases, the prevention and/or treatment of cancers .
- the A-type CpG comprises or consists of a CpG motif with bases linked by phosphodiester bonds.
- the at least one A-type CpG of the invention comprises poly G motifs at the 5' and 3' ends, preferably wherein the G bases are phosphodiester bases.
- the 5' and 3' ends are phoshorothioate modified.
- the CpG motif is part of a palindromic sequence.
- the A-type CpG oligonucleotide comprises or consists of an unmethylated CpG motif that has a sequence represented by the formula: 5' RiYi-CG- R 2 Y 2 3', wherein the central CpG motif is unmethylated, and R ⁇ ; R 2; Yi, and Y 2 are any nucleotide.
- the unmethylated CpG motif has a sequence represented by the formula: 5' R,Y,CG R 2 Y 2 3', 5' RiN.CG Y 2 R 2 3', 5' R,R 2 CG R 3 Y,.3', R 3 Y,CG Y 2 Y 3 3' or preferably 5' R ⁇ R 2 CG R 3 Y ⁇ CG Y 2 Y 3 3', wherein the CpG motif is unmethylated, and wherein Ri, R 2; or R 3 is A or G (a purine), and Y 1; Y 2 , or Y 3 is C or T (a pyrimidine).
- an A-type CpG is at least about 16 nucleotides in length and comprises or contains a sequence represented by formula: 5'-(G) K (X) L RYCGYR(W) M (G)N-3' wherein the central CpG motif is unmethylated, R is a purine nucleotide, Y is a pyrimidine nucleotide, X and W are any nucleotide, K is any integer from 3 to 10, L is any integer from 0 to 10, M is any integer from 0 to 10, and N is any integer from 4 to 10.
- the oligonucleotide can comprise about 6 to about 100,000 nucleotides, preferably about 6 to about 2000 nucleotides, more preferably about 20 to about 2000 nucleotides, more preferably about 20 to about 300 nucleotides, more preferably about 20 to about 100 nucleotides, and even more preferably about 20 to about 40 nucleotides.
- the oligonucleotide can comprise more than 100 to about 2000 nucleotides, preferably more than 100 to about 1000 nucleotides, and more preferably more than 100 to about 500 nucleotides.
- the A-type CpG-containing oligonucleotide contains one or more phosphothioester modifications of the phosphate backbone.
- an A-type CpG-containing oligonucleotide having one or more phosphate backbone modifications or preferably, having the phosphate backbone of the poly G motif modified, wherein one, some or all of the nucleotide phosphate backbone modifications are phosphorothioate modifications are included within the scope of the present invention.
- the poly G motif at the 5' and 3' ends of the A-type CpG oligonucleotide contains phosphorohioate modifications
- the CpG motif contains phosphodiester nucleotides.
- all nucleotides of the A-type CpG oligonucleotide are phosphodiester nucleotides.
- the at least one unmethylated A-type CpG-containing oligonucleotide can also be recombinant, genomic, synthetic, cDNA, plasmid-derived and single or double stranded.
- the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art, for example, the b-cyanoethyl phosphoramidite method (Beaucage, S. L., and Carathers, M. H., Tet. Let. 22:1859 (1981); nucleoside H-phosphonate method (Garegg et al, Tet. Let. 27:4051-4054 (1986); Froehler et al, Nucl. Acid.
- Oligonucleotides can be prepared from existing nucleic acid sequences (e.g., genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
- the CpG motif of said at least one unmethylated A-type CpG-containing oligonucleotide is part of a palindromic sequence.
- said palindromic sequence is GACGATCGTC (SEQ ID NO: 16).
- the palindromic sequence is flanked at its 3 '-terminus and at its 5 '-terminus by 10 guanosine entities, wherein preferably said palindromic sequence is GACGATCGTC (SEQ ID NO: 16). In another embodiment, said palindromic sequence is GACGATCGTC (SEQ ID NO: 16), and wherein said palindromic sequence is flanked at its 3 '-terminus and at its 5 '-terminus by more than two and less than 11 guanosine entities or, more preferably by 8-10 guanosine entities, or, most preferably by 10 guanosine entities. In a preferred embodiment of the present invention, the palindromic sequence comprises, or alternatively consist essentially of, or alternatively consists of or is
- the palindromic sequence is flanked at its 5'- terminus by at least 3 and at most 10 guanosine entities and wherein said palindromic sequence is flanked at its 3 '-terminus by at least 6 and at most 10 guanosine entities.
- the palindromic sequence is flanked at its 5 '-terminus by at least 3 and at most 10 guanosine entities and wherein said palindromic sequence is flanked at its 3 '-terminus by at least 6 and at most 10 guanosine entities.
- the at least one unmethylated A-type CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of a palindromic sequence, wherein at least one unmethylated A-type CpG-containing oligonucleotide comprises or consists of a nucleic acid sequence selected from the group consisting of (a) GGGGACGATCGTCGGGGGG ((SEQ ID NO: 6); and typically abbreviated herein as G3-6), (b)
- GGGGGACGATCGTCGGGGGG ((SEQ ID NO: 7); and typically abbreviated herein as G4-6), (c) GGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 8); and typically abbreviated herein as G5-6), (d) GGGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 9); and typically abbreviated herein as G6-6), (e) GGGGGGGGGGACGATCGTCGGGGGGG ((SEQ ID NO: 10); and typically abbreviated herein as G7-7), (f) GGGGGGGGGACGATCGTCGGGGGGGG ((SEQ ID NO: 11); and typically abbreviated herein as G8-8), (g) GGGGGGGGGGACGATCGTCGGGGGGGGG ((SEQ ID NO: 12); and typically abbreviated herein as G9-9), (h)
- GGGGGGCGACGACGATCGTCGTCGGGGGGG ((SEQ ID NO: 5); and typically abbreviated herein as G6), and (i) GGGGGGGGGG GACGATCGTCGGGGGGGGGG ((SEQ ID NO: 3) and typically abbreviated herein as G10).
- the CpG motif of the at least one unmethylated A-type CpG-containing oligonucleotide is part of a palindromic sequence, wherein said palindromic sequence is GACGATCGTC (SEQ ID NO: 16), and wherein said palindromic sequence is flanked at its 5 '-terminus of at least 4 and at most 9 guanosine entities and wherein said palindromic sequence is flanked at its 3 '-terminus of at least 6 and at most 9 guanosine entities.
- the CpG motif of the at least one unmethylated A-type CpG-containing oligonucleotide is part of a palindromic sequence, wherein said palindromic sequence is GACGATCGTC (SEQ ID NO: 16), and wherein said palindromic sequence is flanked at its 5 '-terminus of at least 5 and at most 8 guanosine entities and wherein said palindromic sequence is flanked at its 3 '-terminus of at least 6 and at most 8 guanosine entities.
- Liposomes in the context of the present application refer to lipid vesicles consisting of a lipid bilayer that can be used to entrap or bind various drags including CpGs.
- the liposome of the present invention may be selected from the group consisting of neutral liposome, anionic liposome, cationic liposome, stealth, or cationic stealth.
- the liposome is a cationic liposome.
- the liposome may have a diameter between 100 and 800 nm, preferably between 100 and 400 nm, more preferably between 100 and 300 nm, even more preferably between 100 and 200 nm, most preferably 200 nm.
- the liposome exhibits positive charges in order to facilitate interaction of T cells with target cells.
- the liposome comprises a cationic lipid, a colipid, and a stabilizing additive.
- the liposome comprises dimethylaminoethane-carbamol-cholisterol, and/or dioleoylphosphatidylethanolamine, and/or polyethylene glycol derivatized phosphatidylethanolamine.
- the liposome comprises phosphatidylcholine, and/or cholesterol, and/or DL- ⁇ -tocopherol, preferably phosphatidylcholine, cholesterol, and DL- ⁇ -tocopherol. Generation of such liposomes is well established e.g.
- the A-type CpGs in liposomes are used to induce systemically increased levels of IFN ⁇ .
- IFNa is known to be therapeutically active during hepatitis B and hepatitis C viras infection and also during infection with HIV.
- the invention provides a method for enhancing the production of IFN ⁇ in an animal comprising introducing into said animal a composition of the invention.
- the invention also provides vaccine compositions which can be used for preventing and/or attenuating diseases or conditions.
- Vaccine compositions of the invention comprise, or alternatively consist of, an immunologically effective amount of the inventive immune enhancing composition together with a pharmaceutically acceptable diluent, carrier or excipient.
- the vaccine can also optionally comprise an adjuvant.
- the vaccine does not comprise an antigen.
- the invention provides a method of immunizing an animal or treating a disease or condition in an animal, the method comprising administering to the animal an immunologically effective amount of a composition or vaccine of the invention, wherein the disease or condition is selected from the group consisting of infectious disease (e.g. virus or parasitic infections) and cancer.
- infectious disease e.g. virus or parasitic infections
- the invention further provides vaccination methods for preventing and/or attenuating diseases or conditions in animals.
- the invention provides vaccines for the prevention of infectious diseases in a wide range of animal species, particularly mammalian species such as human, monkey, cow, dog, cat, horse, pig, etc.
- Vaccines can be designed to treat infections of viral etiology such as HIV, influenza, Herpes, viral hepatitis, Epstein Barr, polio, viral encephalitis, measles, chicken pox, etc.; or infections of bacterial etiology such as pneumonia, tuberculosis, syphilis, etc.; or infections of parasitic etiology such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis, amoebiasis, etc.
- viral etiology such as HIV, influenza, Herpes, viral hepatitis, Epstein Barr, polio, viral encephalitis, measles, chicken pox, etc.
- infections of bacterial etiology such as pneumonia, tuberculosis,
- the invention provides vaccines for the prevention of cancer in a wide range of species, particularly mammalian species such as human, monkey, cow, dog, cat, horse, pig, etc.
- Vaccines can be designed to treat all types of cancer including, but not limited to, lymphomas, carcinomas, sarcomas and melanomas.
- the present invention provides the use of a composition or a vaccine of the invention in the manufacture of a pharmaceutical for the treatment of a disorder or disease, wherein the disease or disorder is typically and preferably selected from the group consisting of cancer and infectious diseases.
- compositions of the invention when administered to an animal, they can be in a composition which contains salts, buffers, adjuvants or other substances which are desirable for improving the efficacy of the composition.
- materials suitable for use in preparing pharmaceutical compositions are provided in numerous sources including Remington's Pharmaceutical Sciences (Osol, A, ed., Mack Publishing Co., (1990)).
- the compositions of the present invention can be administered by various methods known in the art. The particular mode selected will depend of course, upon the particular composition selected, the severity of the condition being treated and the dosage required for therapeutic efficacy.
- the methods of the invention can be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects.
- modes of administration include oral, rectal, parenteral, intracistemal, intravaginal, intraperitoneal, topical (as by powders, ointments, drops or transdermal patch), bucal, or as an oral or nasal spray.
- parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
- the composition of the invention can also be injected directly in a lymph node.
- Dosage levels depend on the mode of administration, the nature of the subject, and the quality of the carrier/adjuvant formulation. Typical amounts are in the range of about 0.1 ⁇ g to about 100 mg CpG per subject. Preferred amounts are at least about 10 ⁇ g to about 1000 ⁇ g per subject. Multiple administration to immunize the subject is preferred, and protocols are those standard in the art adapted to the subject in question.
- the compositions can conveniently be presented in unit dosage form and can be prepared by any of the methods well-known in the art of pharmacy. Methods include the step of bringing the compositions of the invention into association with a carrier which constitutes one or more accessory ingredients.
- compositions suitable for oral administration can be presented as discrete units, such as capsules, tablets or lozenges, each containing a predetermined amount of the compositions of the invention.
- Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, an elixir or an emulsion.
- Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compositions of the invention described above, increasing convenience to the subject and the physician.
- CpG 2006 Human peripheral blood mononuclear cells (PBMC) were isolated and stimulated with various concentrations of CpG G10, G9-9, G8-8, G7-7 or the thioester stabilized CpG 2006. The next day, cells were stained for the expression of CD8 and CD69 in order to test for T cell activation. G10, G9-9, G8-8, G7-7 all efficiently activated CD8+ T cells, with G10 and G9-9 being most effective while G7-7 was least effective. In contrast, 2006 was barely able to activate human T cells (Fig 1). This characterizes G10, G9-9, G8-8, G7-7 as A type CpGs while 2006 is characterized as a B type CpG.
- PBMC peripheral blood mononuclear cells
- G10 and analogues but not CpG 2006 induce production of IFN ⁇ in human PBMC
- Human PBMC were isolated and stimulated with various concentrations of CpG G10, G9-9, G8-8, G7-7, G3, G6, G4-6 and G6-6 or the thioester stabilized CpG 2006. 24h later, supematants were assessed for the presence of IFN ⁇ by ELISA.
- G10, G9-9, G8-8, G7-7, G3, G6, G4-6 and G6-6 all efficiently induced the production of IFN ⁇ , with G10 being most effective while G4-6 least effective.
- 2006 was not able to induce IFN alpha release from human PBMC (Fig 3). This characterizes G10, G9-9, G8- 8, G7-7 as A type CpGs while 2006 is characterized as a B type CpG.
- EXAMPLE 4 EXAMPLE 4
- EXAMPLE 5 G10 but not 2006 induces production of IFN ⁇ in human plasmocytoid DCs
- Human plasmocytoid dendritic cells (pDCs) were isolated from PBMC by labeling them with anti-BDCA-2 mAb attached to magnetic beads (Miltenyi Biotec, Germany). pDCs were subsequently stimulated with the CpGs G10 or the phosphothioester stabilized CpG 2006 (20 nM) and release of IFN ⁇ into the supernatant was monitored subsequently by ELISA. Only G10 but not 2006 was able to efficiently trigger release of IFN ⁇ (Fig 5).
- G10-PS Phosphothioester stabilized G10
- 1668pt but not 1668po or G6 is able to enhance CTL responses in vivo CpGs are able to non-specifically activate antigen-presenting cells. However, in vivo, usually only thioester-stabilized oligonucleotides may be active. We have previously observed that thioester stabilized CpGs are able to enhance CTL responses in vivo if mixed together with VLPs (Stomi et al. (2002), J Immunol. 168: 2880). We now compared the ability of 1668pt (B type, phosphorothioate stabilized 1668) CpGs with 1668po (A-type) CpGs to enhance CTL responses upon mixing with VLPs.
- 1668pt B type, phosphorothioate stabilized 1668
- hepatitis B core Ag fused to peptide p33 derived from LCMV was used (see WO 03/024481, Example 1).
- the p33-VLPs were generated as follows: Hepatitis B clone pEco63 containing the complete viral genome of Hepatitis B virus was purchased from ATCC. The gene encoding HBcAg was introduced into the EcoRI/Hindlll restriction sites of expression vector pKK223.3 (Amersham Pharmacia Biotech Inc., NJ) under the control of a tac promotor.
- E. coli K802d were transfected with the plasmid and grown in 2 liter cultures until an optical density of 1 (at 600 nm wavelength). Cells were induced by adding IPTG (Sigma, Division of Fluka AG, Switzerland) to a final concentration of ImM for 4 hours.
- Bacteria were then collected by centrifugation and resuspended in 5 ml lysis buffer (10 mM ⁇ a 2 HPO 4 , 30 mM NaCl, 10 mM EDTA, 0.25 % Tween-20, pH 7.0). 200 ⁇ l of lysozyme solution (20 mg/ml) was added. After sonication 4 ⁇ l benzonase (Merck, Darmstadt, Germany) and 10 mM MgCl 2 were supplemented to the cell lysate. The suspension was then incubated for 30 minutes at RT and centrifuged for 15 minutes at 27000 x g. The retained supernatant was complemented with 20 % (w/v) ammonium sulfate.
- mice were challenged ip (intraperitoneal) with recombinant vaccinia viras expressing LCMN GP (1 x 10 6 pfu, plaque forming unit) and viral titers were determined in ovaries 5 days later (Storni et al., 2002, J Immunol. 168: 2880) (Fig 7 A). Only 1668pt but not 1668po was able to enhance protective p33- specific CTL responses. Alternatively, the bacteriophage Q ⁇ capsid was used as NLP and co-delivered with the G6 CpG (Fig 7 B). Production and purification of Q ⁇ is performed with the same protocol as for HBcAg NLPs.
- the p33 peptide was chemically coupled to the Q ⁇ NLP via a bifunctional linker as follows: purified Q ⁇ VLPs (1.5 mg/ml in 20 mM HEPES, 150 mM ⁇ aCl pH 7.2) were derivatized by a 30 min incubation at RT with a 10-fold molar excess of succinimidyl-6-( ⁇ -maleimidopropionamido)hexanoate (Pierce Biotechnology, Rockford, IL, USA). Free cross-linker was removed by extensive dialysis against 20 mM HEPES pH 7.2.
- Peptide p33 was produced in a modified version with three additional amino acids (GGC) added to the C-terminus (p33-GGC) (EMC microcollections GmbH, Tubingen, Germany) to allow coupling to VLPs. Derivatized Q ⁇ VLPs and p33-GGC (peptide at 5-fold molar excess) were then incubated for 2 h at RT to allow cross-linking. Free p33-GGC was removed by dialysis against 20 mM HEPES pH 7.2 using DispoDialyser membranes with a molecular weight cut-off of 300 kD (Spectrum Medical Industries Inc., Collinso Dominguez, CA).
- G6 in liposomes is able to enhance p33 -specific immunity
- liposomes containing p33 and either G6 or 1668 were generated.
- Liposomes were produced as previously described (Ludewig et al, 2000, Vaccine 19, 23-32). Briefly, small unilamellar liposomes were generated by freeze-thawing followed by sequential filter extrusion.
- the liposomal composition was 200 mg/ml soy phosphatidylcholine, 25 mg/ml cholesterol and 1.2 mg/ml DL- ⁇ -tocopherol.
- the dried lipid mixture was solubilized with 1 mg/ml ⁇ 33 peptide (KAVYNFATM, SEQ ID NO: 13) alone or with 100 nmol/ml CpGs (G6 or 1668), subjected to 3-5 freeze-thaw cycles and repeatedly extruded through Nucleopore filters of 0.8, 0.4 and 0.2 ⁇ m pore size (Sterico AG, Dietikon, Switzerland). Unencapsulated peptide and CpGs were removed by dialysis. Liposome size was determined by laser light scattering (Submicron Particle Sizer Model 370, Nicomp, Santa Barbara, USA).
- mice were vaccinated subsequently with the liposomes and p33-specific T cell responses were assessed by tetramer-staining 8 days later (Fig 8A).
- mice were challenged ip with recombinant vaccinia virus expressing LCMV-GP (4 x 10 pfu) and viral titers were determined in ovaries 5 days later (Stomi et al, 2002, J Immunol. 168: 2880) (Fig 8B).
- LCMV-GP x 10 pfu
- Liposomes containing p33 and either G10 or 2006 are generated.
- Liposomes are produced as previously described (Ludewig et al, 2000, Vaccine 19, 23-32). Briefly, small unilamellar liposomes are generated by freeze-thawing followed by sequential filter extrusion.
- the liposomal composition is 200 mg/ml soy phosphatidylcholine, 25 mg/ml cholesterol and 1.2 mg/ml DL- ⁇ -tocopherol.
- the dried lipid mixture is solubilized with 1 mg/ml or 50 ⁇ g/ml p33 peptide (KAVYNFATM, SEQ ID NO: 13) alone or with 100 nmol/ml CpGs (G10 or 2006), subjected to 3-5 freeze-thaw cycles and repeatedly extruded through Nucleopore filters of 0.8, 0.4 and 0.2 ⁇ m pore size (Sterico AG, Dietikon, Switzerland). Unencapsulated peptide and CpGs are removed by dialysis. Liposome size is determined by laser light scattering (Submicron Particle Sizer Model 370, Nicomp, Santa Barbara, USA). Mice are vaccinated subsequently with the liposomes and production of IFN ⁇ is analyzed 6, 12, 18 and 24 hours later in the blood of vaccinated mice.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Dispersion Chemistry (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Medicinal Preparation (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/565,264 US20060182793A1 (en) | 2003-07-22 | 2004-07-22 | Cpg-packaged liposomes |
| CA002544240A CA2544240A1 (en) | 2003-07-22 | 2004-07-22 | Cpg-packaged liposomes |
| EP04741216A EP1646427A1 (en) | 2003-07-22 | 2004-07-22 | Cpg-packaged liposomes |
| US12/171,876 US20090074851A1 (en) | 2003-07-22 | 2008-07-11 | Cpg-packaged liposomes |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US48879903P | 2003-07-22 | 2003-07-22 | |
| US60/488,799 | 2003-07-22 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/171,876 Continuation US20090074851A1 (en) | 2003-07-22 | 2008-07-11 | Cpg-packaged liposomes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2005014110A1 true WO2005014110A1 (en) | 2005-02-17 |
Family
ID=34135092
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2004/008190 Ceased WO2005014110A1 (en) | 2003-07-22 | 2004-07-22 | Cpg-packaged liposomes |
Country Status (4)
| Country | Link |
|---|---|
| US (2) | US20060182793A1 (en) |
| EP (1) | EP1646427A1 (en) |
| CA (1) | CA2544240A1 (en) |
| WO (1) | WO2005014110A1 (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007068747A1 (en) * | 2005-12-14 | 2007-06-21 | Cytos Biotechnology Ag | Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity |
| WO2008073960A3 (en) * | 2006-12-12 | 2008-08-07 | Integrated Dna Tech Inc | Oligonucleotides containing high concentrations of guanine monomers |
| WO2008109686A3 (en) * | 2007-03-05 | 2009-03-12 | Neurok Pharma Llc | Non- infectious recombinant virus-like particles and their pharmaceutical applications |
| US7517520B2 (en) | 2003-03-26 | 2009-04-14 | Cytos Biotechnology Ag | Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use |
| US7537767B2 (en) | 2003-03-26 | 2009-05-26 | Cytis Biotechnology Ag | Melan-A- carrier conjugates |
| US8592566B2 (en) | 2006-05-31 | 2013-11-26 | Toray Industries, Inc. | Immunostimulatory oligonucleotides and use thereof in pharmaceuticals |
| US8629151B2 (en) | 2009-05-27 | 2014-01-14 | Selecta Biosciences, Inc. | Immunomodulatory agent-polymeric compounds |
| TWI425091B (en) * | 2011-01-10 | 2014-02-01 | Univ Nat Pingtung Sci & Tech | Dna adjuvant for waterfowl and livestock vaccines |
| TWI425088B (en) * | 2011-10-27 | 2014-02-01 | Univ Nat Pingtung Sci & Tech | Dna vaccine for waterfowl parvovirus |
| US9066978B2 (en) | 2010-05-26 | 2015-06-30 | Selecta Biosciences, Inc. | Dose selection of adjuvanted synthetic nanocarriers |
| US9404126B2 (en) | 2006-06-12 | 2016-08-02 | Kuros Biosciences Ag | Processes for packaging aggregated oligonucleotides into virus-like particles of RNA bacteriophages |
| WO2020017590A1 (en) * | 2018-07-19 | 2020-01-23 | 一般財団法人阪大微生物病研究会 | LIPID PARTICLE CONTAINING A-TYPE CpG OLIGODEOXYNUCLEOTIDE |
| US10933129B2 (en) | 2011-07-29 | 2021-03-02 | Selecta Biosciences, Inc. | Methods for administering synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte responses |
Families Citing this family (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6207646B1 (en) * | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| CA2371994C (en) * | 1999-02-26 | 2010-09-28 | Guido Grandi | Enhancement of bactericidal activity of neisseria antigens with oligonucleotides containing cg motifs |
| US7585847B2 (en) * | 2000-02-03 | 2009-09-08 | Coley Pharmaceutical Group, Inc. | Immunostimulatory nucleic acids for the treatment of asthma and allergy |
| KR101092043B1 (en) * | 2002-04-22 | 2011-12-12 | 바이오니취 라이프 사이언시즈 인코포레이티드 | Oligonucleotide compositions and their use for the modulation of immune responses |
| US7569553B2 (en) * | 2002-07-03 | 2009-08-04 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
| US20040053880A1 (en) * | 2002-07-03 | 2004-03-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
| US7807803B2 (en) * | 2002-07-03 | 2010-10-05 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
| CA2502015A1 (en) * | 2002-12-11 | 2004-06-24 | Coley Pharmaceutical Group, Inc. | 5' cpg nucleic acids and methods of use |
| US7303881B2 (en) * | 2004-04-30 | 2007-12-04 | Pds Biotechnology Corporation | Antigen delivery compositions and methods of use |
| US8877206B2 (en) | 2007-03-22 | 2014-11-04 | Pds Biotechnology Corporation | Stimulation of an immune response by cationic lipids |
| JP2011500569A (en) | 2007-10-12 | 2011-01-06 | マサチューセッツ インスティテュート オブ テクノロジー | Vaccine nanotechnology |
| EP2276495B1 (en) | 2008-04-17 | 2018-11-21 | PDS Biotechnology Corporation | Stimulation of an immune response by enantiomers of cationic lipids |
| CA2876656C (en) | 2012-06-15 | 2023-09-26 | Pds Biotechnology Corporation | Cationic lipid vaccine compositions and methods of use |
| CN113144188A (en) | 2012-09-21 | 2021-07-23 | Pds生物科技公司 | Improved vaccine compositions and methods of use |
| US10449212B2 (en) * | 2015-07-09 | 2019-10-22 | National Institute For Materials Science | Immunostimulating oligonucleotide complex |
| CA3005251A1 (en) | 2015-11-13 | 2017-05-18 | Pds Biotechnology Corporation | Lipids as synthetic vectors to enhance antigen processing and presentation ex-vivo in dendritic cell therapy |
| WO2019113200A1 (en) | 2017-12-05 | 2019-06-13 | Pds Biotechnology Corporation | Methods and compositions comprising cationic lipids for stimulating type 1 interferon genes |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030050268A1 (en) * | 2001-03-29 | 2003-03-13 | Krieg Arthur M. | Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases |
| US20030060440A1 (en) * | 1999-04-12 | 2003-03-27 | Dennis Klinman | Oligodeoxynucleotide and its use to induce an immune response |
| WO2003024481A2 (en) * | 2001-09-14 | 2003-03-27 | Cytos Biotechnology Ag | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use |
| WO2003030656A2 (en) * | 2001-10-06 | 2003-04-17 | Merial Limited | Methods and compositions for promoting growth and innate immunity in young animals |
| US20030087848A1 (en) * | 2000-02-03 | 2003-05-08 | Bratzler Robert L. | Immunostimulatory nucleic acids for the treatment of asthma and allergy |
| WO2003040308A2 (en) * | 2001-07-27 | 2003-05-15 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Use of sterically stabilized cationic liposomes to efficiently deliver cpg oligonucleotides in vivo |
| WO2003045431A2 (en) * | 2001-11-27 | 2003-06-05 | Schering Corporation | Methods for treating cancer using a combination of a tumor-derived dendritic cell inhibitory factor antagonist and a toll-like receptor agonist |
| WO2004000351A1 (en) * | 2002-06-20 | 2003-12-31 | Cytos Biotechnology Ag | Packaged virus-like particles for use as adjuvants: method of preparation and use |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6126965A (en) * | 1997-03-21 | 2000-10-03 | Georgetown University School Of Medicine | Liposomes containing oligonucleotides |
-
2004
- 2004-07-22 US US10/565,264 patent/US20060182793A1/en not_active Abandoned
- 2004-07-22 CA CA002544240A patent/CA2544240A1/en not_active Abandoned
- 2004-07-22 EP EP04741216A patent/EP1646427A1/en not_active Withdrawn
- 2004-07-22 WO PCT/EP2004/008190 patent/WO2005014110A1/en not_active Ceased
-
2008
- 2008-07-11 US US12/171,876 patent/US20090074851A1/en not_active Abandoned
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030060440A1 (en) * | 1999-04-12 | 2003-03-27 | Dennis Klinman | Oligodeoxynucleotide and its use to induce an immune response |
| US20030087848A1 (en) * | 2000-02-03 | 2003-05-08 | Bratzler Robert L. | Immunostimulatory nucleic acids for the treatment of asthma and allergy |
| US20030050268A1 (en) * | 2001-03-29 | 2003-03-13 | Krieg Arthur M. | Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases |
| WO2003040308A2 (en) * | 2001-07-27 | 2003-05-15 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Use of sterically stabilized cationic liposomes to efficiently deliver cpg oligonucleotides in vivo |
| WO2003024481A2 (en) * | 2001-09-14 | 2003-03-27 | Cytos Biotechnology Ag | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use |
| WO2003030656A2 (en) * | 2001-10-06 | 2003-04-17 | Merial Limited | Methods and compositions for promoting growth and innate immunity in young animals |
| WO2003045431A2 (en) * | 2001-11-27 | 2003-06-05 | Schering Corporation | Methods for treating cancer using a combination of a tumor-derived dendritic cell inhibitory factor antagonist and a toll-like receptor agonist |
| WO2004000351A1 (en) * | 2002-06-20 | 2003-12-31 | Cytos Biotechnology Ag | Packaged virus-like particles for use as adjuvants: method of preparation and use |
Non-Patent Citations (5)
| Title |
|---|
| BLACKWELL SUE E ET AL: "CpG-A-induced monocyte IFN-gamma-inducible protein-10 production is regulated by plasmacytoid dendritic cell-derived IFN-alpha.", JOURNAL OF IMMUNOLOGY, vol. 170, no. 8, 15 April 2003 (2003-04-15), pages 4061 - 4068, XP002303133, ISSN: 0022-1767 * |
| GURSEL I ET AL: "Sterically stabilized cationic liposomes improve the uptake and immunostimulatory activity of CpG oligonucleotides", JOURNAL OF IMMUNOLOGY, THE WILLIAMS AND WILKINS CO. BALTIMORE, US, vol. 167, no. 6, 15 September 2001 (2001-09-15), pages 3324 - 3328, XP002228991, ISSN: 0022-1767 * |
| KERKMANN MIREN ET AL: "Activation with CpG-A and CpG-B oligonucleotides reveals two distinct regulatory pathways of type I IFN synthesis in human plasmacytoid dendritic cells.", JOURNAL OF IMMUNOLOGY, vol. 170, no. 9, 1 May 2003 (2003-05-01), pages 4465 - 4474, XP002303134, ISSN: 0022-1767 * |
| KRUG A ET AL: "Identification of CpG oligonucleotide sequences with high induction of IFN-alpha/beta in plasmacytoid dendritic cells", EUROPEAN JOURNAL OF IMMUNOLOGY, WEINHEIM, DE, vol. 31, no. 7, July 2001 (2001-07-01), pages 2154 - 2163, XP002292085, ISSN: 0014-2980 * |
| KRUG ANNE ET AL: "CpG-A oligonucleotides induce a monocyte-derived dendritic cell-like phenotype that preferentially activates CD8 T cells.", JOURNAL OF IMMUNOLOGY, vol. 170, no. 7, 1 April 2003 (2003-04-01), pages 3468 - 3477, XP002303132, ISSN: 0022-1767 * |
Cited By (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7517520B2 (en) | 2003-03-26 | 2009-04-14 | Cytos Biotechnology Ag | Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use |
| US7537767B2 (en) | 2003-03-26 | 2009-05-26 | Cytis Biotechnology Ag | Melan-A- carrier conjugates |
| AU2006325225B2 (en) * | 2005-12-14 | 2013-07-04 | Cytos Biotechnology Ag | Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity |
| WO2007068747A1 (en) * | 2005-12-14 | 2007-06-21 | Cytos Biotechnology Ag | Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity |
| US8574564B2 (en) | 2005-12-14 | 2013-11-05 | Cytos Biotechnology Ag | Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity |
| US8592566B2 (en) | 2006-05-31 | 2013-11-26 | Toray Industries, Inc. | Immunostimulatory oligonucleotides and use thereof in pharmaceuticals |
| US9902972B2 (en) | 2006-06-12 | 2018-02-27 | Kuros Biosciences Ag | Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages |
| US9404126B2 (en) | 2006-06-12 | 2016-08-02 | Kuros Biosciences Ag | Processes for packaging aggregated oligonucleotides into virus-like particles of RNA bacteriophages |
| US10358656B2 (en) | 2006-06-12 | 2019-07-23 | Kuros Biosciences Ag | Oligonucleotides packaged into virus-like particles of RNA bacteriophages |
| US9914746B2 (en) | 2006-12-12 | 2018-03-13 | Kuros Biosciences Ag | Oligonucleotides containing high concentrations of guanine monomers |
| JP2010512169A (en) * | 2006-12-12 | 2010-04-22 | インテグレイテッド ディーエヌエー テクノロジーズ, インク. | Oligonucleotides containing high concentrations of guanine monomer |
| US8586728B2 (en) | 2006-12-12 | 2013-11-19 | Cytos Biotechnology Ag | Oligonucleotides containing high concentrations of guanine monomers |
| AU2007333147B2 (en) * | 2006-12-12 | 2013-12-19 | Kuros Us Llc | Oligonucleotides containing high concentrations of guanine monomers |
| WO2008073960A3 (en) * | 2006-12-12 | 2008-08-07 | Integrated Dna Tech Inc | Oligonucleotides containing high concentrations of guanine monomers |
| US20140200338A1 (en) * | 2006-12-12 | 2014-07-17 | Cytos Biotechnology Ag | Oligonucleotides containing high concentrations of guanine monomers |
| US20160145293A1 (en) * | 2006-12-12 | 2016-05-26 | Cytos Biotechnology Ag | Oligonucleotides containing high concentrations of guanine monomers |
| WO2008109686A3 (en) * | 2007-03-05 | 2009-03-12 | Neurok Pharma Llc | Non- infectious recombinant virus-like particles and their pharmaceutical applications |
| US9006254B2 (en) | 2009-05-27 | 2015-04-14 | Selecta Biosciences, Inc. | Immunomodulatory agent-polymeric compounds |
| US9884112B2 (en) | 2009-05-27 | 2018-02-06 | Selecta Biosciences, Inc. | Immunomodulatory agent-polymeric compounds |
| US8629151B2 (en) | 2009-05-27 | 2014-01-14 | Selecta Biosciences, Inc. | Immunomodulatory agent-polymeric compounds |
| US9066978B2 (en) | 2010-05-26 | 2015-06-30 | Selecta Biosciences, Inc. | Dose selection of adjuvanted synthetic nanocarriers |
| US9764031B2 (en) | 2010-05-26 | 2017-09-19 | Selecta Biosciences, Inc. | Dose selection of adjuvanted synthetic nanocarriers |
| TWI425091B (en) * | 2011-01-10 | 2014-02-01 | Univ Nat Pingtung Sci & Tech | Dna adjuvant for waterfowl and livestock vaccines |
| US10933129B2 (en) | 2011-07-29 | 2021-03-02 | Selecta Biosciences, Inc. | Methods for administering synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte responses |
| TWI425088B (en) * | 2011-10-27 | 2014-02-01 | Univ Nat Pingtung Sci & Tech | Dna vaccine for waterfowl parvovirus |
| WO2020017590A1 (en) * | 2018-07-19 | 2020-01-23 | 一般財団法人阪大微生物病研究会 | LIPID PARTICLE CONTAINING A-TYPE CpG OLIGODEOXYNUCLEOTIDE |
| JPWO2020017590A1 (en) * | 2018-07-19 | 2021-08-02 | 一般財団法人阪大微生物病研究会 | A type CpG oligodeoxynucleotide-containing lipid particles |
| JP7520321B2 (en) | 2018-07-19 | 2024-07-23 | 国立大学法人大阪大学 | Lipid particles containing A-type CpG oligodeoxynucleotides |
Also Published As
| Publication number | Publication date |
|---|---|
| US20060182793A1 (en) | 2006-08-17 |
| EP1646427A1 (en) | 2006-04-19 |
| CA2544240A1 (en) | 2005-02-17 |
| US20090074851A1 (en) | 2009-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20090074851A1 (en) | Cpg-packaged liposomes | |
| Kayraklioglu et al. | CpG oligonucleotides as vaccine adjuvants | |
| EP1513552B1 (en) | Packaged virus-like particles in combination with cpg for use as adjuvants with allergens : method of preparation and use | |
| JP6993649B2 (en) | Oligonucleotide-containing complexes with immunostimulatory activity and their uses | |
| Klinman | CpG DNA as a vaccine adjuvant | |
| JP5022028B2 (en) | Melan-A peptide analog-virus-like particle conjugate | |
| EP1644034B1 (en) | Composition for enhancing an immune response comprising packaged virus-like particles | |
| Bode et al. | CpG DNA as a vaccine adjuvant | |
| ES2335979T3 (en) | IMMUNOSTIMULATOR CPG PACKAGING IN VIRUS SIMILAR PARTICLES: PREPARATION METHOD AND ITS USE. | |
| JP2003520824A (en) | Pharmaceutical composition for immunomodulation and preparation of a vaccine comprising an antigen and an immunogenic oligodeoxynucleotide and a polycationic polymer as an adjuvant | |
| EA030863B1 (en) | COMPOSITIONS FOR STRENGTHENING IMMUNE RESPONSE TO ANTIGEN CONTAINING SYNTHETIC NANOSATORS, AND THEIR APPLICATIONS | |
| EP0855184A1 (en) | Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination | |
| WO2006035939A1 (en) | Immune stimulating oligonucleotide and use thereof in pharmaceutical | |
| WO2005083076A1 (en) | Immune stimulant oligonucleotide inducing interferon alpha | |
| US6887464B1 (en) | Advanced antigen presentation platform | |
| JP2006521321A (en) | Use of alum and Th1 immune response inducing adjuvants to promote immune responses | |
| MXPA04011127A (en) | IMMUNE OLIGONUCLEOTIDES METHODED STIMULATORS AND METHODS TO USE THE SAME. | |
| KR20210003695A (en) | Universal vaccine platform based on nano composite comprising novel nucleic acid and epitope | |
| JP2003520568A (en) | Advanced antigen presentation platform | |
| JP5685646B2 (en) | Sticolicin-based vaccine composition encapsulated in liposomes | |
| Verthelyi | Adjuvant properties of CpG oligonucleotides in primates | |
| JP2005525414A (en) | Pathogen vaccine and method of use | |
| Ohta | Cholesteryl Pullulan Nanoparticles-Encapsulated TNF-a: An Effective Mucosal Vaccine Adjuvant Against | |
| WO2025240477A1 (en) | Methods and materials for enhancing delivery of nucleic acid to cells | |
| Tam | Liposomal encapsulation enhances the activity of immunostimulatory oligonucleotides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2004741216 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006182793 Country of ref document: US Ref document number: 10565264 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004741216 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2544240 Country of ref document: CA |
|
| WWP | Wipo information: published in national office |
Ref document number: 10565264 Country of ref document: US |
