WO2004102199A2 - Method for selecting and producing vaccine components and vaccines based thereon - Google Patents
Method for selecting and producing vaccine components and vaccines based thereon Download PDFInfo
- Publication number
- WO2004102199A2 WO2004102199A2 PCT/NL2004/000338 NL2004000338W WO2004102199A2 WO 2004102199 A2 WO2004102199 A2 WO 2004102199A2 NL 2004000338 W NL2004000338 W NL 2004000338W WO 2004102199 A2 WO2004102199 A2 WO 2004102199A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- vaccine
- antibody
- antibodies
- microorganism
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/09—Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
- A61K39/092—Streptococcus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1267—Gram-positive bacteria
- C07K16/1275—Streptococcus (G)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the invention relates to the field of biology, more specifically to the field of immunology and microbiology.
- the invention further relates to the field of vaccines against microbial infections and more in particular bacterial vaccines such as pneumococcal vaccines. More in particular, the invention relates to means and methods to identify, select and isolate a vaccine component to produce a vaccine for passive and/or active immunization against a microorganism that can be recognized and preferably taken up and more preferably killed by opsonophagocytic cells.
- Streptococcus pneumoniae is the leading etiological agent of severe infections such as pneumonia, septicemia, meningitis and otitis media, and causes over three million deaths per year worldwide, of which a million are children.
- the problem of antimicrobial resistance in Streptococcus pneumoniae has been enhanced by the successful spread of a limited number of internationally recognized multi-resistant strains. These strains have complicated the treatment of pneumococcal disease, and this has further emphasized the need for vaccination as an alternative means of preventing the large-scale morbidity and mortality associated with pneumococcal infection.
- this vaccine covers only 7 out of 90 of the known pneumococcal capsule serotypes, and clinical data from phase three trials conducted in the USA, Israel, and South Africa have shown that the use of this vaccine causes a shift in colonization by non-vaccine serotypes in place of vaccine serotypes (1, 2, 3, 4, 5).
- This apparent weakness associated with narrow spectrum polysaccharide based antigens attention has been focused on the non- polys accharide capsule related pneumococcal proteins, many of which are involved in the pathogenesis of infections. These proteins are considered to be interesting components for future vaccines, since they cover all serotypes of pneumococci.
- the protein loci are less variable than those encoding the genes for capsular polysaccharide production, and they are more likely to be able to elicit an immune response in children (6, 7, 8, 9).
- vaccines that have been developed thus far are systemic vaccines, i.e. vaccines that have to be injected.
- a mucosal vaccine that could e.g. be administered intranasally would be preferred for ease of administration, especially in children.
- Opsonization is the process of making a microorganism more susceptible for the uptake by a phagocyte. In said process, opsonizing antibodies and/or proteins bind to said microorganism, thereby facilitating the uptake of said microorganism by said phagocyte.
- Opsonophagocytosis is measured in living phagocytic cells and comprises measuring the uptake by phagocytic cells of microorganisms pretreated with opsonizing antibodies.
- surface antigens i.e. antigens naturally or artificially associated with the surface of a microorganism that specifically induce opsonophagocytosis.
- surface antigens with opsonophagocytosis inducing ability can be selected from a collection of surface proteins. This typically implies that said surface proteins are isolated from microorganisms and subsequently are purified and tested.
- mice active and passive immunization procedures with said recombinant protein or with antibodies against said protein are performed to test the opsonizing potential of said recombinant protein.
- Protective ability of the selected protein or part thereof may be measured in a vaccination challenge experiment.
- three proteins have been identified as possible phagocytosis inducing vaccine components and are disclosed herein.
- One of said proteins is a protein called pneumococcal IgAl protease (IgAl proteinase), a protease that can convert human dimer IgA molecules into monomers.
- Another protein is a peptidyl prolyl isomerase, which we named streptococcal lipoprotein rotamase A (SlrA).
- Yet another protein is pneumococcal surface adhesion protein A (PsaA)
- PpmA protein has been classified as an isomerase enzyme.
- SlrA protein with a peptidyl prolyl isomerase activity
- SlrA although belonging to another family of proteins than PpmA also appeared to be an opsonophagocytosis-inducing antigen.
- abovementioned proteins have not been identified by any other method as being opsonophagocytosis enhancing proteins.
- antibodjr titers against SlrA, or IgAlproteinase and the first episode of acute otitis media (middle ear infection) in children in a large serological survey in Finland as is described in example one. In the absence of such a correlation, these proteins were not considered to be important for the defense against streptococcal infection.
- a method to identify an opsonophagocytosis inducing antigen as a vaccine component for immunization against a microorganism comprising selecting (in silico) via a molecule associated with the surface of a microorganism such as a membrane anchoring motif and/or a cell wall binding domain, a nucleotide sequence encoding at least part of a bacterial protein, and producing at least part of said protein, and contacting a collection of antibodies to said protein and testing for binding between at least one antibody and at least one antigen, and measuring the opsonizing ability of said binding antibody for a microorganism having such an antigen.
- motifs which can be used for the in silico selection comprise, for example, a lipobox (anchoring to membrane via a lipid group), a peptidoglycan binding domain(PBD), a choline binding domain (CBD) or a LPxTG motief (cell wall binding domain).
- a lipobox anchoring to membrane via a lipid group
- PBD peptidoglycan binding domain
- CBD choline binding domain
- LPxTG motief cell wall binding domain
- said collection of antibodies can be produced by raising antibodies in an animal, by immunizing for example a rabbit or a mouse or a rat or another animal with at least part of said selected protein of said microorganism. Therefore, this application also teaches a method to identify an opsonophagocytosis inducing antigen as a vaccine component for immunisation against a microorganism as described above wherein said collection of antibodies is raised by immunizing an animal with at least one antigen of said microorganism.
- Antibodies against said proteins may also be selected from pre-existing collections of antibodies or functional parts, derivatives or analogues thereof. This method can be applied to any microorganism for which the defence by the immune system depends on opsonophagocytosis.
- the application teaches a method to identify an opsonophagocytosis inducing antigen as a vaccine component for immunisation against a microorganism as described, wherein said microorganism is for example a member of the genus Streptococcus, for example a member of the species of Streptococcus pneumoniae, or Streptococcus viridans, or Streptococcus canis, or Streptococcus suis, or a member of the genus Staphylococcus, for example a member of the species Staphylococcus aureus, or Staphylococcus epidermidis, or a coagulase negative Staphylococcus, or a member of the species Moraxella catarrhalis, or Neisseria meningitidis, or Neisseria ghonorrhoeae, or Helicobacter pylori, or Haemophilus influenzae or Campylobacter jejuni, or
- said partially homologous protein or a part thereof is recombinantly produced and tested for its capability to induce opsonophagocytosis. Therefore, this application also teaches a nucleotide sequence at least encoding for a functional part of a protein, said protein inducing opsonophagocytosis of a microorganism having such a protein, wherein said protein is partially homologous with a protein selected by the method as described above. Said nucleotide sequence can be incorporated into a recombinant vector and herewith, recombinant cells can be provided.
- Said recombinant cell produces protein based on said nucleotide sequence
- this application teaches a recombinant vector comprising a nucleotide sequence at least encoding for a functional part of a protein, said protein inducing opsonophagocytosis of a microorganism having such a protein, wherein said protein is partially homologous with a protein selected by the method as described above.
- the application also teaches a recombinant cell expressing at least part of a nucleotide, and a purified protein, produced by said recombinant cell.
- Said antigen or protein or a part thereof can be used as a vaccine component for immunisation against a microorganism, therefore this application teaches a vaccine component for immunisation against a micro organism which can be killed by opsonophagocytic cells, said vaccine component comprising said protein, and/or an antigenic part thereof.
- said vaccine component may comprise at least a functional part of streptococcal lipoprotein rotamase A (SlrA) of Streptococcus pneumoniae. Therefore, this patent application discloses said vaccine component, comprising at least a functional part of streptococcal lipoprotein rotamase A (SlrA) of Streptococcus pneumoniae.
- said vaccine component may comprise at least a functional part of pneumococcal IgAl protease (IgAl) of Streptococcus pneumoniae. Therefore, this patent application discloses said vaccine component, comprising at least a functional part of pneumococcal IgAl protease (IgAl) of Streptococcus pneumoniae.
- said vaccine component may comprise at least a functional part of pneumococcal surface adhesion protein A (PsaA) of Streptococcus pneumoniae. Therefore, this patent application discloses said vaccine component, comprising at least a functional part of pneumococcal surface adhesion protein A (PsaA) of Streptococcus pneumoniae.
- PsaA pneumococcal surface adhesion protein A
- a functional part of a protein it is meant that the minimal amount of amino acid is taken which is still able to raise an immune response in the vaccinate subject.
- antigenic part is used in this specification to identify such a functional part of a protein. Generally, such parts will at least be more than 10 amino acids, and preferably about 50-100 amino acids.
- said vaccine component may also comprise at least an antigenic part of pneumococcal maturation protein A (PpmA) of Streptococcus pneumoniae or another protein.
- PpmA pneumococcal maturation protein A
- a vaccine may be produced for the treatment of an infection by a microorganism, which can be killed by opsonophagocytic cells.
- this application teaches a vaccine comprising at least one of said vaccine components and/or a homologous and/or functionally homologous protein or protein fragment thereof for the treatment of an infection by a microorganism that can be killed by opsonophagocytic cells.
- a pharmaceutically acceptable carrier and/or adjuvant comprises cell wall material of Gram positive bacteria, more preferable it comprises co-called ghosts (empty bacterial cells, which still have an intact cell wall structure). It is further preferable to couple the antigens to such ghosts, for example by using protein anchors, such as the AcmA protein anchor.
- Other adjuvants may be chosen from adjuvant preparations known in the art, such as emulsions with vitamin E. Therefore, this application also teaches said vaccine, also comprising a pharmaceutically acceptable carrier and/or adjuvant.
- antibody refers to monoclonal antibodies, multispecific antibodies (e.g., bi-specific), human antibodies, humanized antibodies, camelised antibodies, chimeric antibodies, single-chain Fvs (scFv), single chain antibodies, synthetic antibodies, single domain antibodies, Fab fragments, F(ab) fragments, disulfide -linked Fvs (sdFv), and anti-idiotypic (anti-Id) antibodies, and epitope -binding fragments of any of the above.
- antibodies include immunoglobulin molecules and imniunologically active fragments of immunoglobulin molecules, i.e., molecules that contain an antigen binding site.
- Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass.
- Antibodies of the invention include, but are not limited to, monoclonal antibodies, multispecific antibodies, synthetic antibodies, human antibodies, humanized antibodies, chimeric antibodies, single-chain Fvs (scFv), single chain antibodies, Fab fragments, F(ab') fragments, disulfide-linked Fvs (sdFv), and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope-binding fragments of any of the above.
- antibodies of the present invention include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds to a vaccine component according to the invention.
- the immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule.
- the antibodies of the invention may be from any animal origin including birds and mammals (e.g., human, murine, donkey, sheep, rabbit, goat, guinea pig, camel, horse, or chicken).
- the antibodies of the invention are human or humanized monoclonal antibodies.
- human antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries (including, but not limited to, synthetic libraries of immunoglobulin sequences homologous to human immunoglobulin sequences) or from mice that express antibodies from human genes.
- high potency antibodies can be used in the methods of the invention.
- high potency antibodies can be produced by genetically engineering appropriate antibody gene sequences and expressing the antibody sequences in a suitable host. The antibodies produced can be screened to identify antibodies with, e.g., high kon values in a BIAcore assay (see below).
- an antibody to be used with the methods of the present invention or fragment thereof has an affinity constant or Ka (kon/koff) of at least 102 M-1, at least 5 X 102 M-1, at least 103 M-1, at least 5 X 103 M-1, at least 104 M-1, at least 5 X 104 M-1, at least 105 M-1, at least 5 X 105 M-1, at least 106 M-1, at least 5 X 106 M-1, at least 107 M-1, at least 5 X 107 M-1, at least 108 M-1, at least 5 X 108 M-1, at least 109 M-1, at least 5 X 109 M-1, at least 1010 M-1, at least 5 X 1010 M-1, at least 1011 M-1, at least 5 X 1011 M-1, at least 1012 M-1, at least 5 X 1012 M-1, at least 1013 M-1, at least 5 X 1013 M-1, at least 1014 M-1, at least 5 X 1014 M-1, at least 5 X
- an antibody to be used with the methods of the invention or fragment thereof has a dissociation constant or Kd (koff/kon) of less than 10-2 M, less than 5 X 10-2 M, less than 10-3 M, less than 5 X 10-3 M, less than 10-4 M, less than 5 X 10-4 M, less than 10-5 M, less than 5 X 10-5 M, less than 10-6 M, less than 5 X 10-6 M, less than 10-7 M, less than 5 X 10-7 M, less than 10-8 M, less than 5 X 10-8 M, less than 10-9 M, less than 5 X 10-9 M, less than 10-10 M, less than 5 X 10-10 M, less than 10-11 M, less than 5 X 10-11 M, less than 10-12 M, less than 5 X 10-12 M, less than 10-13 M, less than 5 X 10-13 M, less than 10-14 M, less than 5 X 10-14 M, less than 10-15 M, or less than 5 X 10-15 M.
- Kd dissociation constant or Kd
- an antibody to be used with the methods of the invention or fragment thereof that has a median effective concentration (EC50) of less than 0.01 nM, less than 0.025 nM, less than 0.05 nM, less than 0.1 nM, less than 0.25 nM, less than 0.5 nM, less than 0.75 nM, less than 1 nM, less than 1.25 nM, less than 1.5 nM, less than 1.75 nM, or less than 2 nM, in an in vitro microneutralization assay.
- the median effective concentration is the concentration of antibody or antibody fragments that neutralizes 50% of the infective micro-organism in an in vitro microneutralization assay.
- an antibody to be used with the methods of the invention or fragment thereof has an EC50 of less than 0.01 nM, less than 0.025 nM, less than 0.05 nM, less than 0.1 nM, less than 0.25 nM, less than 0.5 nM, less than 0.75 nM, less than 1 nM, less than 1.25 nM, less than 1.5 nM, less than 1.75 nM, or less than 2 nM, in an in vitro microneutralization assay.
- the antibodies to be used with the methods of the invention include derivatives that are modified, i.e, by the covalent attachment of any type of molecule to the antibody.
- the antibody derivatives include antibodies that have been modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Any of numerous chemical modifications may be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, synthesis in the presence of tunicamycin, etc. Additionally, the derivative may contain one or more non-classical amino acids.
- the present invention also provides antibodies of the invention or fragments thereof that comprise a framework region known to those of skill in the art.
- one or more framework regions, preferably, all of the framework regions, of an antibody to be used in the methods of the invention or fragment thereof are human.
- the fragment region of an antibody of the invention or fragment thereof is humanized.
- the antibody to be used with the methods of the invention is a synthetic antibody, a monoclonal antibody, an intrabody, a chimeric antibody, a human antibody, a humanized chimeric antibody, a humanized antibody, a glycosylated antibody, a multispecific antibody, a human antibody, a single-chain antibody, or a bispecific antibody.
- the antibodies to be used with the invention have half-lives in a mammal, preferably a human, of greater than 12 hours, greater than 1 day, greater than 3 days, greater than 6 days, greater than 10 days, greater than 15 days, greater than 20 days, greater than 25 days, greater than 30 days, greater than 35 days, greater than 40 days, greater than 45 days, greater than 2 months, greater than 3 months, greater than 4 months, or greater than 5 months.
- Antibodies or antigen-binding fragments thereof having increased in vivo half-lives can be generated by techniques known to those of skill in the art.
- antibodies or antigen-binding fragments thereof with increased in vivo half-lives can be generated by modifying (e.g., substituting, deleting or adding) amino acid residues identified as involved in the interaction between the Fc domain and the FcRn receptor (see, e.g., PCT Publication No. WO 97/34631 and U.S.
- Patent Application No.: 10/020,354 entitled “Molecules with Extended Half- Lives, Compositions and Uses Thereof, filed December 12, 2001, by Johnson et al., which are incorporated herein by reference).
- Such antibodies or antigen- binding fragments thereof can be tested for binding activity to the vaccine components of the invention as well as for in vivo efficacy using methods known to those skilled in the art, for example, by immunoassays described herein.
- antibodies or antigen-binding fragments thereof with increased in vivo half-lives can be generated by attaching to said antibodies or antibody fragments polymer molecules such as high molecular weight polyethyleneglycol (PEG).
- PEG polymer molecules
- PEG can be attached to said antibodies or antibody fragments with or without a multifunctional linker either through site-specific conjugation of the PEG to the N— or C- terminus of said antibodies or antibody fragments or via epsilon-amino groups present on lysine residues.
- Linear or branched polymer derivatization that results in minimal loss of biological activity will be used.
- the degree of conjugation will be closely monitored by SDS-PAGE and mass spectrometry to ensure proper conjugation of PEG molecules to the antibodies.
- Unreacted PEG can be separated from antibody- PEG conjugates by, e.g., size exclusion or ion-exchange chromatography.
- PEG- derivatizated antibodies or antigen-binding fragments thereof can be tested for binding activity to the vaccine components of the invention as well as for in vivo efficacy using methods known to those skilled in the art, for example, by immunoassays described herein.
- the antibodies to be used with the methods of the invention are fusion proteins comprising an antibody or fragment thereof that immunospecifically binds to a vaccine component of the invention and a heterologous polypeptide.
- the heterologous polypeptide that the antibody or antibody fragment is fused to is useful for targeting the antibody to cells which are prone to infection.
- antibodies to be used with the methods of the invention or fragments thereof disrupt or prevent the interaction between an microbial antigen and its host cell receptor.
- antibodies to be used with the methods of the invention are single-chain antibodies.
- the design and construction of a single- chain antibody is described in Marasco et al, 1993, Proc Natl Acad Sci 90:7889- 7893, which is incorporated herein by reference.
- the antibodies to be used with the invention bind to an intracellular epitope, i.e., are intrabodies.
- An intrabody comprises at least a portion of an antibody that is capable of immunospecifically binding an antigen and preferably does not contain sequences coding for its secretion. Such antibodies will bind its antigen intracellularly.
- the intrabody comprises a single -chain Fv ("sFv").
- sFv are antibody fragments comprising the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain.
- the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form the desired structure for antigen binding.
- the intrabody preferably does not encode an operable secretory sequence and thus remains within the cell (see generally Marasco, WA, 1998, "Intrabodies: Basic Research and Clinical Gene Therapy Applications” Springe :New York).
- intrabodies are well-known to the skilled artisan and is described for example in U.S. Patent Nos. 6,004,940; 6,072,036; 5,965,371, which are incorporated by reference. Further, the construction of intrabodies is discussed in Ohage and Steipe, 1999, J. Mol. Biol. 291:1119-1128; Ohage et al., 1999, J. Mol. Biol. 291:1129-1134; and Wirtz and Steipe, 1999, Protein Science 8:2245-2250. Recombinant molecular biological techniques such as those described for recombinant production of antibodies (see below) may also be used in the generation of intrabodies.
- intrabodies of the invention retain at least about 75% of the binding effectiveness of the complete antibody (i.e., having constant as well as variable regions) to the antigen. More preferably, the intrabody retains at least 85% of the binding effectiveness of the complete antibody. Still more preferably, the intrabody retains at least 90% of the binding effectiveness of the complete antibody. Even more preferably, the intrabody retains at least 95% of the binding effectiveness of the complete antibody.
- polynucleotides encoding the variable region for both the VH and VL chains of interest can be cloned by using, for example, hybridoma mRNA or splenic mRNA as a template for PCR amplification of such domains (Huse et al., 1989, Science 246:1276).
- the polynucleotides encoding the VH and VL domains are joined by a polynucleotide sequence encoding a linker to make a single chain antibody (sFv).
- the sFv typically comprises a single peptide with the sequence VH -linker-VL or VL-linker-VH.
- the linker is chosen to permit the heavy chain and light chain to bind together in their proper conformational orientation (see for example, Huston, et al., 1991, Methods in Enzym. 203:46-121).
- the linker can span the distance between its points of fusion to each of the variable domains (e.g., 3.5 nm) to minimize distortion of the native Fv conformation.
- the linker is a polypeptide of at least 5 amino acid residues, at least 10 amino acid residues, at least 15 amino acid residues, or greater.
- the linker should not cause a steric interference with the VH and VL domains of the combining site.
- the linker is 35 amino acids or less, 30 amino acids or less, or 25 amino acids or less.
- the linker is between 15-25 amino acid residues in length.
- the linker is hydrophilic and sufficiently flexible such that the VH and VL domains can adopt the conformation necessary to detect antigen. Intrabodies can be generated with different linker sequences inserted between identical VH and VL domains. A linker with the appropriate properties for a particular pair of VH and VL domains can be determined empirically by assess the degree of antigen binding for each. Examples of linkers include, but are not limited to, those sequences disclosed in Table IA. Table IA Sequence
- intrabodies are expressed in the cytoplasm.
- the intrabodies are localized to various intracellular locations.
- specific localization sequences can be attached to the intranucleotide polypepetide to direct the intrabody to a specific location.
- Intrabodies can be localized, for example, to the following intracellular locations: endoplasmic reticulum (Munro et al., 1987, Cell 48:899-907; Hangejorden et al., 1991, J. Biol. Chem. 266:6015); nucleus (Lanford et al., 1986, Cell 46:575; Stanton et al.,1986, PNAS 83:1772; Harlow et al., 1985, Mol. Cell Biol.
- nucleolar region (Seomi et al., 1990, J. Virology 64:1803; Kubota et al., 1989, Biochem. Biophys. Res. Comm. 162:963; Siomi et al., 1998, Cell 55:197); endosomal compartment (Bakke et al., 1990, Cell 63:707-716); mitochondrial matrix (Pugsley, A. P., 1989, "Protein Targeting", Academic Press, Inc.); Golgi apparatus (Tang et al., 1992, J. Bio. Chem.
- VH and VL domains are made up of the immunoglobulin domains that generally have a conserved structural disulfide bond.
- the intrabodies are expressed in a reducing environment (e.g., the cytoplasm), such a structural feature cannot exist. Mutations can be made to the intrabody polypeptide sequence to compensate for the decreased stability of the immunoglobulin structure resulting from the absence of disulfide bond formation.
- the VH and/or VL domains of the intrabodies contain one or more point mutations such that their expression is stabilized in reducing environments (see Steipe et al., 1994, J. Mol. Biol.
- the antibodies to be used with the methods of the invention or fragments thereof can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques.
- Polyclonal antibodies to vaccine component of the invention can be produced by various procedures well known in the art.
- an antigen according to the invention can be administered to various host animals including, but not limited to, rabbits, mice, rats, etc. to induce the production of sera containing polyclonal antibodies specific for the antigen.
- adjuvants may be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, bacterial ghosts, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvurn.
- BCG Bacille Calmette-Guerin
- corynebacterium parvurn Such adjuvants are also well known in the art.
- the antigens are preferably coupled to the ghost, for instance through protein anchors, of which the AcmA protein anchor is especially preferred.
- Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof.
- monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981).
- the term “monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology.
- the term “monoclonal antibody” refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.
- a method of generating monoclonal antibodies comprises culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse immunized with an antigen with myeloma cells and then screening the hybridomas resulting from the fusion for hybridoma clones that secrete an antibody able to bind said antigen.
- Antibody fragments which recognize the specific antigens of the invention may be generated by any technique known to those of skill in the art.
- Fab and F(ab')2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
- F(ab')2 fragments contain the variable region, the light chain constant region and the CHI domain of the heavy chain.
- the antibodies to be used with the present invention can also be generated using various phage display methods known in the art.
- phage display methods functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them.
- DNA sequences encoding VH and VL domains are amplified from animal cDNA libraries (e.g., human or murine cDNA libraries of lymphoid tissues).
- the DNA encoding the VH and VL domains are recombined together with an scFv linker by PCR and cloned into a phagemid vector (e.g., p CANTAB 6 or pComb 3 HSS).
- the vector is electroporated in E. coli and the E. coli is infected with helper phage.
- Phage used in these methods are typically filamentous phage including fd and M13 and the VH and VL domains are usually recombinantly fused to either the phage gene III or gene VIII.
- Phage expressing an antigen binding domain that binds to an antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al., 1995, J. Immunol. Methods 182:41-50; Ames et al., 1995, J. Immunol.
- the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described below.
- Techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in PCT publication No.
- PCR primers including VH or VL nucleotide sequences, a restriction site, and a flanking sequence to protect the restriction site can be used to amplify the VH or VL sequences in scFv clones.
- VH constant region e.g., the human gamma 4 constant region
- VL constant region e.g., human kappa or lamb a constant regions.
- the vectors for expressing the VH or VL domains comprise an EF-l ⁇ promoter, a secretion signal, a cloning site for the variable domain, constant domains, and a selection marker such as neomycin.
- the VH and VL domains may also cloned into one vector expressing the necessary constant regions.
- the heavy chain conversion vectors and light chain conversion vectors are then co-transfected into cell lines to generate stable or transient cell lines that express full-length antibodies, e.g., IgG, using techniques known to those of skill in the art.
- human or chimeric antibodies For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use human or chimeric antibodies. Completely human antibodies are particularly desirable for therapeutic treatment of human subjects.
- Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences or synthetic sequences homologous to human immunoglobulin sequences. See also U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO98/16654, WO 96/34096, WO 96/33735, and WO 91/10741.
- Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes.
- the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells.
- the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes.
- the mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination.
- homozygous deletion of the JH region prevents endogenous antibody production.
- the modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice.
- the chimeric mice are then be bred to produce homozygous offspring which express human antibodies.
- the transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide of the invention.
- Monoclonal antibodies directed against the antigen can be obtained from the immunized, transgenic mice using conventional hybridoma technology.
- the human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation.
- Lonberg and Huszar (1995, Int. Rev. Immunol. 13:65-93).
- this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies see, e.g., PCT publication Nos.
- companies such as Medarex, Inc. (Princeton, NJ), Abgenix, Inc. (Freemont, CA) and Genpharm (San Jose, CA) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.
- a chimeric antibody is a molecule in which different portions of the antibody are derived from different immunoglobulin molecules such as antibodies having a variable region derived from a non-human (e.g., murine) antibody and a human immunoglobulin constant region.
- Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, 1985, Science 229:1202; Oi et al., 1986, BioTechniques 4:214; Gillies et al., 1989, J. Immunol. Methods 125:191-202; and U.S. Patent Nos. 5,807,715, 4,816,567, and 4,816,397.
- Chimeric antibodies comprising one or more CDRs from human species and framework regions from a non-human immunoglobulin molecule can be produced using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication No. WO 91/09967; and U.S. Patent Nos. 5,225,539, 5,530,101, and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, 1991, Molecular Immunology 28(4/5):489-498; Studnicka et al., 1994, Protein Engineering 7(6):805-814; and Roguska et al., 1994, PNAS 91:969-973), and chain shuffling (U.S.
- antibodies comprise one or more CDRs and human framework regions.
- framework residues in the framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding.
- These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions.
- Polynucleotides encoding antibodies to be used with the invention may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art.
- Such a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242)..
- a polynucleotide encoding an antibody may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be
- the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY), to generate antibodies having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions.
- methods well known in the art for the manipulation of nucleotide sequences e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory
- one or more of the CDRs is inserted within framework regions using routine recombinant DNA techniques.
- the framework regions may be naturally occurring or consensus framework regions, and preferably human framework regions (see, e.g., Chothia et al., 1998, J. Mol. Biol. 278: 457-479 for a listing of human framework regions).
- the polynucleotide generated by the combination of the framework regions and CDRs encodes an antibodjr that specifically binds to a vaccine component of the invention.
- one or more amino acid substitutions may be made within the framework regions, and, preferably, the amino acid substitutions improve binding of the antibody to its antigen.
- Such methods may be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds.
- Other alterations to the polynucleotide are encompassed by the present invention and within the skill of the art.
- Recombinant expression of an antibody to be used with the methods of the invention, derivative or analog thereof, requires construction of an expression vector containing a polynucleotide that encodes the antibody.
- the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art.
- the expression vector is transferred to a host cell by conventional techniques and the fransfected cells are then cultured by conventional techniques to produce an antibody of the invention.
- Antibodies according to the invention can not only be used for passive vaccination, but can also be used for diagnostic purposes and in assay systems to detect presence of bacteria and/or the antigens to which they are directed. Such a diagnosis is useful (for instance) to test material (such as food, pharmaceutical compositions or air filters) for the presence of bacteria. It is also possible to develop a test system which can detect the antibodies themselves to check for the presence or to calculate the titer of antibodies in the blood of subjects that have been immunized with a vaccine according to the invention.
- a person skilled in the art is well able to generate analogous compounds of the opsonophagocytosis inducing proteins of the invention. This can for instance be done through screening of a peptide library and testing to binding to one or more of the antibodies described above. Such an analogue has essentially the same biological properties of said protein in kind, i.e. it is able to generate a similar immunological response, not necessarily in amount. It will also be possible genetically engineer analogous compounds starting from the sequences provided in this specification. Such analogous compounds will have a sequence identity of more than 50% compared to the sequences given in the specification. Sequence identity may be defined and determined by the TBLASTN or TBLASTP program for nucleic acid or amino acid sequences, respectively, of Altschul et al.
- Sequence identity may be at the nucleotide sequence and/or encoded amino acid sequence level.
- the nucleic acid and/or amino acid sequence shares at least 50%, or 60% sequence identity, most preferably at least about 70%, or 80% or 90% sequence identity with the sequences of the specification as provided hereunder.
- orthologous proteins i.e. proteins from other organisms, be it closely related or not to Streptococcus pneumoniae D39 and/or Streptococcus pneumoniae TIGR4, such as other Streptococcus pneumoniae strains, or other Streptococcus species, or even Staphylococcus, Moraxella, Neisseria and other bacteria, or even non-bacterial organisms.
- Orthologous proteins in this regard means proteins from other species which proteins have the same common ancestry, but are different in sequence as a result of (spontaneous) mutations. These sequences can easily been found, for instance by comparing the sequences of the invention to other sequences available in sequence databases such as GenBank or by isolating orthologous proteins from other organisms by PCR mediated amplification methods in which (degenerated) primers are designed based on the sequences of the specification. Such methods are known to the person skilled in the art.
- proteins obtained by the above described methods should further be tested with respect to their opsonophagocytosis inducing properties. Any protein obtained through the above discussed methods which appears to be opsonophagocytosis inducing is considered to be a protein of the invention and is considered to be suitable for inclusion into the vaccines of the invention. Also parts of these proteins which have retained the functional characteristic of being able to induce opsonophagocytosis are considered to be comprised in the present invention.
- Opsonophagocytosis inducing proteins as vaccine components can also be combined with other opsonophagocytosis inducing proteins and/or other proteins to result in a better vaccine.
- This patent application discloses the use of SlrA, IgAl proteinase and PsaA and the combination of PpmA and/or other proteins with said proteins.
- a vaccine according to the invention comprises two of more opsonophagocytosis inducing proteins, wherein the combination of PpmA and SlrA, whether or not in the presence of further antigens, is most preferred.
- the invention is further explained in the examples.
- Example 1 Correlation of antibody titers against Streptococcus pneumoniae surface proteins with occurrence of first acute otitis media. A cross sectional population survey in Finland.
- the IgG titers against PpmA, SlrA, and IgAl proteinase are all lower than the titers against alpha-enolase of Streptococcus pneumoniae. Because of the absence of this correlation of antibody titer and protection, SlrA and IgAl proteinase were considered to have no added value for protective immunity, and hence would not be selected for use as a vaccine component.
- mice CMl outbred female mice, purchased from Harlan Olac, Bicester, UK All mice were barrier reared and specified pathogen free.
- the active immunisation protocol started with 6 week old mice (25-30g) and passive immunisation with 9 week old mice (30-35g).
- Bacterial strains
- Streptococcus pneumoniae D39, serotype 2 has been obtained from the National Collection of Type Cultures (NCTC 7466; Central Public Health Laboratory, London). Streptococcus pneumoniae TIGR4, serotype 4, has been obtained from The Institute for Genome Research. Bacteria are grown on Blood Agar Base Number 2 (Oxoid, Basingstoke, UK) plus 5% (vol/vol) defibrinated horse blood (BAB). Stock cultures are prepared by inoculating a sweep of 4-5 colonies into 25ml Brain-Heart Infusion broth (BHI, Oxoid). Cultures are grown statically at 37°C overnight before 1ml aliquots containing 15% sterile glycerol are frozen at -70°C until use.
- BHI Brain-Heart Infusion broth
- Strain validation is carried out by confirming sensitivity to the antibiotic Optochin (Difco, Detroit, USA). Serotype verification is performed by checking for the presence of type specific polysaccharide capsule using anti-type 2 or 4 capsule antiserum (Statens Seruminstitut, Copenhagen, Denmark).
- Bacteria were harvested by centrifugation at 3,000 rpm for lOmin (Heraeus medifuge), resuspended in fresh BHI containing 20% v/v FCS and then incubated at 37°C until they reached mid-log phase (as judged by optical density). 1ml aliquots of the suspension were stored at -70°C, until required. After 24h at -70°C viability of the suspension was measured by viable counting and optochin sensitivity was confirmed. Viability was unaffected by storage at -70°C for at least 3 months.
- mice were held with the nose held upright, and pneumococci were introduced intranasally by adding a series of small droplets of the 50 ⁇ L inoculum in to the nostril for the mice to involuntarily inhale. After inoculation the mice were laid on their backs until recovery and the viable count of the inoculum was re-determined. Mice were monitored frequently (at least 3 times a day) during the following 14 days for signs of infection. On reaching the pre-determined endpoint (moribund) mice were killed by cervical dislocation and the survival time noted.
- Serum was complement inactivated by incubation at 56°C for 30 min and was used at a pre-determined dilution. 24h and Ih prior to infection, mice were vaccinated by intraperitoneal injection of 200 ⁇ l serum. Mice were then infected as previously described. Bacteria were opsonized by incubation in the diluted serum at 37°C for lhr prior to infection. Mice were monitored frequently (at least 3 times a day) during the following 14 days for signs of infection. On reaching the pre-determined endpoint (moribund) mice were sacrificed by cervical dislocation and the survival time noted.
- mice were randomly arranged in groups of 6 and a blood sample was removed from the tail vein prior 24h prior to initial vaccination.
- Vaccines were prepared in a 1:1 ratio in either Freunds complete adjuvant or incomplete adjuvant (Sigma) or Hunter's TiterMax (CytRx Corp., Norcross, GA) or Quill A (Accurate Chemical Scientific Corporation, Westbury, NY 11590) as per manufacturers instructions.
- lOO ⁇ l of vaccine was injected subcutaneously per mouse. Nine days later a blood sample was removed from half of the mice fro a tail vein.
- mice By staggering this bleed and the next we could bleed all mice prior to vaccination and prior to infection but still monitor immune response during vaccination protocol: this kept us in line with the restrictions on the total number of bleeds/ mouse (3) and the minimum time interval between bleeds (14 days).
- 24h after sampling blood vaccination was repeated as previously but if using Freunds, FIA (Freunds incomplete adjuvant) was used. 9 days after boost, a blood sample was removed from those mice not bled before last boost. 24h later vaccination was repeated as previously. 28 days later a blood sample was removed from the tail vein of all mice. 24h later mice were infected as previously described with approximately 10 G CFU Streptococcus pneumoniae D39 or TIGR4. Mice were monitored at least 3 times daily for signs of infection. On reaching the pre-determined endpoint (moribund) mice were sacrificed by cervical dislocation. Preparation of mouse virulent inoculum
- mice were used for the production of mouse virulent inocula.
- the number of times that inocula must be prepared/passaged depended on the virulence and viability of the organisms after prolonged freezing at -80°C.
- mice per group; challenged with wild virulent strain of Streptococcus pneumoniae and with a strain D39 deleted for PpmA.
- mice IgAl proteinase elicited a good protective immune response in the mice, as is shown in table 5 and fig. 7
- PsaA elicited a good protective immune response in the mice, as is shown in hg. 8.
- Vaccinating with two antigenic proteins resulted in a better survival time in mice after challenge with virulent Streptococcus pneumoniae D39 as is shown in table 6, and in fig. 9.
- mice were vaccinated (2x200 ⁇ l) with rabbit-pre immune serum
- the nucleotide sequence of PpmA was determined to search databases for partial homology.
- the gene for PpmA was amplified by PCR from Streptococcus pneumoniae D39 with the primers
- the recombinant protein was purified by Ni + affinity chromatography with the HisTrap Kit (Amersham Pharmacia) according to the manufacturers recommendations.
- the purified recombinant protein was dialysed against 10mM HEPES buffer, pH7.5, freeze dried, and stored at -20°C.
- the gene for the active peptide of SlrA was amplified by PCR from Streptococcus pneumoniae D39 with the primers
- the amplified DNA was cloned into a pETlla expression vector (Stratagene, LaJolla, CA) and electrotransformed into E. coli BL21(DE3).
- the recombinant protein was purified by Ni + affinity chromatography with the HisTrap Kit (Amersham Pharmacia) according to the manufacturers recommendations.
- the purified recombinant protein was dialysed against lO M HEPES buffer, pH7.5, freeze dried, and stored at -20°C.
- a 3948bp gene fragment which encodes amino acids 671-1987 of the IgAl proteinase was amplified by PCR from Streptococcus pneumoniae TIGR4 with the primers 5'CAACATCACATATGGGACAAACAGAACCAGAG3'and 5 CTTAGATCTTAATGATGGTGGTGATGATGGGCTTTAAAGATTGCTC3 ' which incorporate flanking Nde ⁇ and Bgl ⁇ l restriction sites, and a C-terminal His 6 tag.
- the amplified DNA was cloned into a pETlla expression vector (Stratagene, LaJolla, CA) and electrotransformed into E. coli BL21(DE3).
- the cells are lysed by sonication 3x 30seconds on ice (1 min intervals to allow cooling). Place lysate on a rotating shaker at 4°C for 20min (to dissolve inclusion bodies).
- the crude lysate is cleared by centrifugation (15,000rpm for 30min in a JA20 rotor).
- wash buffer (20mM sodium phosphate buffer pH7.4, 0.5M
- the second fraction should contain the IgAl proteinase.
- the 2 nd fraction is then dialyzed overnight against 2L lOmM Hepes buffer pH7.4.
- the protein will re-precipitate. Recover the protein by centrifugation, Freeze dry and store at -20°C.
- Protein can be resolubilized in 8M urea and then diluted in PBS etc. It will remain soluble at high concentrations in 4M urea.
- Immunoglobulin Al protease (iga) nucleotide sequence [Streptococcus pneumoniae TIGR4]
- the gene for PsaA was amplified by PCR from Streptococcus pneumoniae D39 with the primers 5'CCATGGCTAGCCACCATCACCATCACCATgctacaaactcaatcatcgc 3' and 5'TTTCGGATCCTTATTTTGCCAATCCTTCAGC 3' which incorporate flanking Nhel and BamHI restriction sites, and a N-terminal His6 tag.
- the amplified DNA was cloned into a pETlla expression vector (Stratagene, LaJolla, CA) and electrotransformed into E. coli BL21(DE3).
- the recombinant protein was purified by Ni + affinity chromatography with the HisTrap Kit (Amersham Pharmacia) according to the manufacturers recommendations. To prevent the formation of inclusion bodies, 8M urea was added to all buffers throughout the purification process.
- the purified recombinant protein was dialysed against lOmM HEPES buffer, pH7.5, free dried, and
- IgG antibodies to Eno, Iga, PpmA and SlrA in serum of humans suffering from pneumococcus infection were measured by EIA.
- Microtiter plates (Maxisorp; Nunc, Roskilde, Denmark) were coated with lOO ⁇ l/well, with a coating concentration of 5 ⁇ g/ml of antigen in PBS and incubated overnight at 37°C.
- the plates were blocked with 1% bovine serum albumin (BSA) and 0.05% Tween 20 in PBS at 37°C for 1 h.
- the samples were serially diluted (starting at 1:100) in the dilution buffer (1% BSA, 0.05% Tween 20 in PBS).
- the serum endpoint antibody titer was interpolated from the intersection of the absorbance-versus-serum dilution curve at the background fluorescence plus four times the standard deviation. The end-point titer was then converted into antibody concentration (EIA units of immunoglobulin per milliliter) by comparison with a standard serum consisting of pooled healthy adult volunteers, and was considered to contain 100 U/mL of anti-a-enolase, Iga, PpmA or SlrA.
- a logistic regression was used to evaluate the effects of the acute phase antibody concentration, age and the nature of pneumococcal contact on the antibody response and to evaluate antibody concentrations (logarithm base e of antibody concentration) as a risk factor for the involvement of pneumococci as a risk factor for the development of AOM.
- Children were grouped into eight 3- month groups according to the age at which the acute serum was sampled. To determine whether there were any significant differences in relation to age, groups were analyzed by 1-way ANOVA followed by a Tukey's HSD test
- Lactococcus lactis ghosts in combination with the AcmA cell-wall- binding domain can be used as a carrier/adjuvant system for mucosal and systemic delivery of antigens (WO 99/25836 and WO 02/101026).
- immunogenicity and protective activity of a tri- valent ghost-protein vaccine (SlrA, Igalprt, PpmA) was tested as well as that of each of the monovalent ghost-protein vaccines after nasal administration of the vaccines and nasal challenge with virulent S. pneumoniae.
- the aim of the experiments was: • To evaluate protective activity of an intranasal administered L.
- SlrA ghost-protein anchor tri-valent
- PpmA ghost- protein anchor mono-valent
- Igalprt ghost-protein anchor mono-valent
- Plasmid pPA32 specifying a fusion between the S. pneumoniae PpmA protein and the protein anchor ( Figure 12), was constructed by ligating an Ncol- and EcoRI-cleaved PCR-amplified fragment of CbpA into the Ncol and EcoRI sites of pPA3 (Steen et al. 2003. J. Biol. Chem. 278:23874- 23881).
- the PpmA-specific fragment was amplified with the primers PpmA.l (cggtctcacatgtcgaaagggtcagaaggtgcagacc) and PpmA.2 (cggtctcgaattgcttcgtttgatgtactactgcttgag) with S. pneumoniae strain D39 chromosomal DNA as template.
- the ligation mix was cut with EcoRI and Nhel before it was used for electroporation of . lactis PAlOOl (Kuipers et al. J. Biol. Chem. 2004 Mar 24 [Epub ahead of print]).
- the final construct was designated pPA32.
- Plasmid pPAl52 specifying a fusion between a fragment of the S. pneumoniae Igalprt protein (residues 672 to 1330) and the protein anchor ( Figure 13). Plasmid pPAl52 was constructed by ligating an Ncol- and EcoRI-cleaved PCR-amplified fragment of Igalprt into the corresponding sites of pPA3.
- the Igalprt-specific fragment was amplified with the primers Igal.fw2 (cgtctcccatgggacaaacagaaccagagccatcaaacgg) and Igaltrunc2.rev (ccgtctcgaattctagccagtccagcatc) with ⁇ S. pneumoniae strain TIGR4 chromosomal DNA as template.
- the ligation mix was cut with Nhel before it was used for electroporation of L. lactis PAlOOl.
- the final construct was designated pPAl52.
- Plasmid pPAl62 specifying a fusion between the 5. pneumoniae SlrA protein and the protein anchor ( Figure 14), was constructed by ligating an Esp3l-cleaved PCR-amplified fragment of SlrA into the Ncol and EcoRI sites of plasmid pPA3.
- the SlrA-specific fragment was amplified with the primers SlrA.fw (ccgtctcccatggtccaacgcagtctgcgt) and SlrA.rev (ccgtctcgaattccagatttaaaatcgtagtctttcacca) with S.
- L. lactis ghosts were produced as described in WO 02/101026. Each dosis representing the amount used for one nasal administration in mice, contained approximately 2.5x109 ghosts.
- the yeast-based GLS mediu was used for production of the vaccine.
- GLS contains 2% gistex (Gistex® LS Ferm Powder AGGL - 1027180, Strik Special Additives, The Netherlands), 3% ⁇ - glycerophosphate and 2% glucose. Glucose was sterilized as a separate solution and added to the broth when the strain was inoculated.
- L. lactis PAlOOl containing plasmids pPAl52, pPA32 or pPA162 were grown in GLS supplemented with 5 ⁇ g/ml chloramphenicol.
- the cultures were induced by adding 1 ml of the cell- free supernatant of a nisin producing L. lactis culture per litre of medium (1:1000; Kuipers et al. 1997. Tibtech. 15: 135-140).
- the culture was left at 30°C overnight, after which the culture supernatants were concentrated with a VivaFlow tangential flow module (Vivascience VivaFlow 200; 10,000 Da cutoff).
- the concentrate was sterilised through a 0.45 ⁇ m filter and stored at +4° C until binding.
- the vaccines were produced as follows: ghost-SlrA::PA monovalent vaccine: 27.5 ml of a lOx concentrated supernatant of a SlrA::PA producing L. lactis culture was bound to 4.6 ml Ghost (46 units) on a blood suspension mixer for 30 minutes at room temperature. After washing, the pellet was resuspended in 920 ⁇ l PBS and 880 ⁇ l was divided in 4 vials (220 ⁇ l each). 3 vials for the monovalent vaccine and 1 vial for the trivalent vaccine.
- One dosis (20 ⁇ l) of a nasal vaccine contains 2.5xl0 9 Ghost cells.
- mice Female outbred CD-I mice were purchased from Harlan France. Mice were 6 week-old at the time of starting the study.
- S. pneumoniae D39, serotype 2 was obtained from the National Collection of Type Cultures (NCTC 7466; Central Public Health Laboratory, London).
- mice were immunized intranasally under light inhalation anaesthesia (isoflurane/O2/N2O) by pipeting 20 ⁇ l of the vaccine or control onto the nostrils. Complete immunization consisted of 3 doses given at 10 day-intervals.
- mice (10 per group) received PBS as control.
- the vaccines consisted of 2.5 x 10 9 ghosts and contained 5 ⁇ g Igalprt, 10 Dg PpmA and 50 ⁇ g SlrA per dose for the mono-valent vaccines, 2.5 x 10 9 ghosts with a third of the monovalent doses of each antigen for the tri-valent vaccine.
- the following groups were used: 1. 20 ⁇ l PBS.
- Scoring of health status Each animal was scored 44 h after infection according to the criteria given in Table 11. The maximum score per group of 10 animals is 40 (all animals dead). All animals healthy results in a score of 0. The disease index is the percentage of the maximum score.
- Igalprotease was coated at 10 ⁇ g/ml in coating buffer.
- rat anti-mouse kappa chain (BD Biosciences 559749, 0.5 mg/ml) was coated at 1/500 dilution in coating buffer. After incubation overnight at 4 °C, the plates were rinsed 3 times with wash buffer (0.02% Tween 20 in PBS). The plates were blocked by adding 100 ⁇ l blocking buffer (1% BSA, 0.02% Tween 20 in PBS) in each well. The plates were incubated for 1 hour at room temperature. All blood samples were diluted 1/100 with blocking buffer, and serial dilutions (1/3) of these samples were performed in 100 ⁇ l blocking buffer.
- the trivalent vaccine was composed by mixing the monovalent vaccines in a ratio of 1:1:1 with the total number of ghost the same as in the monovalent vaccines (2.5 x 109) resulting in the following amounts of antigen: ghost-SlrA::PA: 17 ⁇ g/dose
- Serum IgG response were determined by ELISA after 3 immunizations in pre-challenge blood.
- Figure 19 shows the serum IgG antigen specific responses generated in the different vaccine groups.
- the responses against SlrA, PpmA and Igalprt in the monovalent vaccines are similar to the responses to these antigens in the tri-valent vaccines, indicating that the amounts of antigen in the tri-valent vaccine are sufficient to elicit serum antibody' responses of this magnitude for these antigens.
- the combined response to the three antigens in the tri-valent vaccine is needed to obtain the protective effect, since each of the individual responses in the monovalent vaccine groups did not provide sufficient protection.
- Igalprt vaccine provided increased protection of the mice after challenge with S. pneumoniae.
- McCool TL Gate TR, Moy G, Weiser JN.
- Fig. 1 Titres of anti-pneumococcal IgG against PpmA in children and adults.
- Fig. 2. Titres of anti-pneumococcal IgG against pneumolysin in children and adults.
- Fig. 4. Titres of anti-pneumococcal IgG against alpha-enolase in children and adults.
- Fig. 5. Titres of anti-pneumococcal IgG against SlrA in children and adults.
- Fig. 9 Survival time of SlrA- and PpmA-vaccinated CD-I mice infected intranasally with Streptococcus pneumoniae D39.
- Fig 10 Passive immunization of CD-I mice with pre-immune serum (PIS), anti-PpmA serum (APS) and challenged intranasally with Streptococcus pneumoniae D39 or a PpmA-negative knockout strain of Streptococcus pneumoniae.
- PIS pre-immune serum
- APS anti-PpmA serum
- Fig 11. Survival of MF-1 mice passively vaccinated with anti-PpmA antiserum and intranasally infected with Streptococcus pneumoniae D39.
- Fig 12.. Sequence of the secreted PpmA::PA fusion protein. Underlined are the aminoacids of Igalprt. Protein anchor (PA) amino acids are in italics.
- Fig 13 Sequence of the secreted Igalprt::PA fusion protein. Underlined are the aminoacids of Igalprt. Protein anchor (PA) amino acids are in italics.
- Fig 14. Sequence of the secreted SlrA::PA fusion protein. Underlined are the aminoacids of Igalprt. Protein anchor (PA) amino acids are in italics.
- Fig 15. A CBB stained SDS-PAGE gel with the ghost-antigen vaccines and a BSA reference. SlrA, PpmA and Igal are samples from the vaccine groups. Each sample represents one dose (20 ⁇ l). In the five lanes on the right, the number represents the amount of BSA in micrograms. An estimate of the amount of bound antigen is made and shown in the lower right part of the Figure.
- Fig 16. Health status of the mice at the time of ending experiment (t 44-h after infection). A score ranging from 0-4 was attributed to each mouse according to the parameters described in material and methods. The disease index was calculated as percentage of maximal score and presented as average + SEM for each group. A high score indicates that most animals are diseased. A low score indicates that most animals are healthy.
- Fig 18. Bacterial counts 44-h post-challenge in the lungs (A), nose (B) and blood (C). Graphs show individual data (0) and the average (— ) for each group. High bacterial counts are an indication that animals are not protected. Fig 19. Antigen specific IgG in the serum after 3 immunizations but prior to challenge. The values are presented as average + SEM for each group.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Biochemistry (AREA)
- Urology & Nephrology (AREA)
- Microbiology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Physics & Mathematics (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Mycology (AREA)
- Pathology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AT04733500T ATE484744T1 (en) | 2003-05-16 | 2004-05-17 | VACCINES THAT PROTECT AGAINST STREPTOCOCCUS PNEUMONIA INFECTIONS. |
| DE602004029565T DE602004029565D1 (en) | 2003-05-16 | 2004-05-17 | Vaccines that protect against Streptococcus pneumonia infections. |
| NZ543662A NZ543662A (en) | 2003-05-16 | 2004-05-17 | Streptococcus pneumoniae vaccine comprising pneumococcal maturation protein A (PpmA) |
| EP04733500A EP1625393B1 (en) | 2003-05-16 | 2004-05-17 | Vaccines conferring protection to infection by Streptococcus pneumonia. |
| US10/556,733 US8142789B2 (en) | 2003-05-16 | 2004-05-17 | Method for selecting and producing vaccine components and vaccines based thereon |
| AU2004239596A AU2004239596B2 (en) | 2003-05-16 | 2004-05-17 | Method for selecting and producing vaccine components and vaccines based thereon |
| CA2525766A CA2525766C (en) | 2003-05-16 | 2004-05-17 | Method for selecting and producing vaccine components and vaccines based thereon |
| DK04733500.5T DK1625393T3 (en) | 2003-05-16 | 2004-05-17 | Vaccines that provide protection against infection of Streptococcus pneumonia |
| US13/397,354 US9549974B2 (en) | 2003-05-16 | 2012-02-15 | Method for selecting and producing vaccine components and vaccines based thereon |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP03076492.2 | 2003-05-16 | ||
| EP03076492A EP1477802A1 (en) | 2003-05-16 | 2003-05-16 | Method for selecting and producing vaccine components and vaccines based thereon |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/556,733 A-371-Of-International US8142789B2 (en) | 2003-05-16 | 2004-05-17 | Method for selecting and producing vaccine components and vaccines based thereon |
| US13/397,354 Division US9549974B2 (en) | 2003-05-16 | 2012-02-15 | Method for selecting and producing vaccine components and vaccines based thereon |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2004102199A2 true WO2004102199A2 (en) | 2004-11-25 |
| WO2004102199A3 WO2004102199A3 (en) | 2005-02-24 |
Family
ID=33016944
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/NL2004/000338 Ceased WO2004102199A2 (en) | 2003-05-16 | 2004-05-17 | Method for selecting and producing vaccine components and vaccines based thereon |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US8142789B2 (en) |
| EP (2) | EP1477802A1 (en) |
| CN (1) | CN100523809C (en) |
| AT (1) | ATE484744T1 (en) |
| AU (1) | AU2004239596B2 (en) |
| CA (1) | CA2525766C (en) |
| DE (1) | DE602004029565D1 (en) |
| DK (1) | DK1625393T3 (en) |
| NZ (1) | NZ543662A (en) |
| WO (1) | WO2004102199A2 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1746103A1 (en) | 2005-07-20 | 2007-01-24 | Applied NanoSystems B.V. | Bifunctional protein anchors |
| EP2298342A3 (en) * | 2006-11-20 | 2011-04-20 | Intercell AG | Peptides protective against s. pneumoniae and compositions, methods and uses relating thereto |
| WO2013191591A1 (en) | 2012-06-22 | 2013-12-27 | Epitope Limited (Epitope Ltd) | Chimeric protein vaccine against pneumonia caused by streptococcus pneumoniae |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2371843B1 (en) * | 2005-05-19 | 2014-09-17 | THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by the Secretary, Department of Health and Human Services | Functional epitopes of streptococcus pneumoniae psaA antigen and uses thereof |
| AU2012201107B2 (en) * | 2005-05-19 | 2012-11-29 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services, Centers For Disease Control And Prevention | Functional epitopes of Streptococcus pneumoniae PsaA antigen and uses thereof |
| EP2343319A1 (en) | 2010-01-07 | 2011-07-13 | University of Ljubljana | Genetically modified food grade microorganism for treatment of inflammatory bowel disease |
| EP2915543B1 (en) | 2014-03-04 | 2018-05-09 | Albert-Ludwigs-Universität Freiburg | Polypeptides derived from Enterococcus and their use for vaccination and the generation of therapeutic antibodies |
| CN105101456B (en) * | 2014-04-24 | 2019-05-07 | 阿尔卡特朗讯 | A kind of method, equipment and system for internet of things equipment triggering |
| CN105968213A (en) * | 2016-06-14 | 2016-09-28 | 长春百克生物科技股份公司 | Streptococcus pneumonia fusion protein and vaccine thereof |
| US12616745B2 (en) * | 2019-06-07 | 2026-05-05 | Flugen, Inc. | Influenza virus backbone |
| CN110551703A (en) * | 2019-09-10 | 2019-12-10 | 天津大学 | Preparation and application methods of novel material BEM |
| WO2024108137A2 (en) | 2022-11-18 | 2024-05-23 | Seismic Therapeutic, Inc. | Fc fusion molecules and uses thereof |
| JP2026501731A (en) | 2023-01-06 | 2026-01-16 | サイズミック セラピューティク インコーポレイテッド | Protease variants and uses thereof |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5976542A (en) * | 1996-09-23 | 1999-11-02 | New England Medical Center | Compositions and methods for treatment of streptococcus pneumoniae infection |
| JP2003519089A (en) * | 1999-06-10 | 2003-06-17 | ユーエイビー リサーチ ファウンデーション | Pneumococcal surface protein-containing vaccine |
| EP1075841A1 (en) * | 1999-08-13 | 2001-02-14 | Erasmus Universiteit Rotterdam | Pneumococcal vaccines |
| GB0022742D0 (en) * | 2000-09-15 | 2000-11-01 | Smithkline Beecham Biolog | Vaccine |
| GB0107658D0 (en) * | 2001-03-27 | 2001-05-16 | Chiron Spa | Streptococcus pneumoniae |
| DK1395648T3 (en) * | 2001-06-11 | 2009-08-03 | Applied Nanosystems Bv | Methods for binding AcmA-type protein anchor fusions to cell wall material of microorganisms |
-
2003
- 2003-05-16 EP EP03076492A patent/EP1477802A1/en not_active Withdrawn
-
2004
- 2004-05-17 NZ NZ543662A patent/NZ543662A/en not_active IP Right Cessation
- 2004-05-17 US US10/556,733 patent/US8142789B2/en not_active Expired - Fee Related
- 2004-05-17 DE DE602004029565T patent/DE602004029565D1/en not_active Expired - Lifetime
- 2004-05-17 EP EP04733500A patent/EP1625393B1/en not_active Expired - Lifetime
- 2004-05-17 AT AT04733500T patent/ATE484744T1/en active
- 2004-05-17 CA CA2525766A patent/CA2525766C/en not_active Expired - Fee Related
- 2004-05-17 CN CNB2004800168399A patent/CN100523809C/en not_active Expired - Fee Related
- 2004-05-17 WO PCT/NL2004/000338 patent/WO2004102199A2/en not_active Ceased
- 2004-05-17 DK DK04733500.5T patent/DK1625393T3/en active
- 2004-05-17 AU AU2004239596A patent/AU2004239596B2/en not_active Ceased
-
2012
- 2012-02-15 US US13/397,354 patent/US9549974B2/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| OVERWEG ET AL., INFECTION AND IMMUNITY, vol. 68, no. 7, 2000, pages 4180 - 4188 |
| ZVSK ET AL., INFECTION AND IMMUNITY, vol. 68, no. 6, 2000, pages 3740 - 3743 |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1746103A1 (en) | 2005-07-20 | 2007-01-24 | Applied NanoSystems B.V. | Bifunctional protein anchors |
| US9011870B2 (en) | 2005-07-20 | 2015-04-21 | Applied Nanosystems B.V. | Bifunctional protein anchors |
| EP2298342A3 (en) * | 2006-11-20 | 2011-04-20 | Intercell AG | Peptides protective against s. pneumoniae and compositions, methods and uses relating thereto |
| WO2013191591A1 (en) | 2012-06-22 | 2013-12-27 | Epitope Limited (Epitope Ltd) | Chimeric protein vaccine against pneumonia caused by streptococcus pneumoniae |
| US9345757B2 (en) | 2012-06-22 | 2016-05-24 | Epitope Limited | Chimeric protein vaccine against pneumonia caused by Streptococcus pneumoniae |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2004239596A1 (en) | 2004-11-25 |
| US9549974B2 (en) | 2017-01-24 |
| CN100523809C (en) | 2009-08-05 |
| CA2525766A1 (en) | 2004-11-25 |
| ATE484744T1 (en) | 2010-10-15 |
| AU2004239596B2 (en) | 2011-03-03 |
| DE602004029565D1 (en) | 2010-11-25 |
| EP1625393A2 (en) | 2006-02-15 |
| DK1625393T3 (en) | 2011-01-31 |
| US20070082003A1 (en) | 2007-04-12 |
| NZ543662A (en) | 2009-03-31 |
| US8142789B2 (en) | 2012-03-27 |
| EP1625393B1 (en) | 2010-10-13 |
| US20120301501A1 (en) | 2012-11-29 |
| EP1477802A1 (en) | 2004-11-17 |
| CA2525766C (en) | 2016-06-28 |
| WO2004102199A3 (en) | 2005-02-24 |
| CN1806172A (en) | 2006-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9549974B2 (en) | Method for selecting and producing vaccine components and vaccines based thereon | |
| Hamel et al. | Prevention of pneumococcal disease in mice immunized with conserved surface-accessible proteins | |
| Alexander et al. | Immunization of mice with pneumolysin toxoid confers a significant degree of protection against at least nine serotypes of Streptococcus pneumoniae | |
| US20100278740A1 (en) | Streptococcus pneumoniae proteins and nucleic acid molecules | |
| JP2008263970A (en) | S. pneumoniae proteins and nucleic acid molecules | |
| Cole et al. | Human pathogenic streptococcal proteomics and vaccine development | |
| US8795690B2 (en) | Protective proteins of S. agalactiae, combinations thereof and methods of using the same | |
| EP1075841A1 (en) | Pneumococcal vaccines | |
| US7098182B2 (en) | Nucleic acids and proteins from group B streptococcus | |
| JP2017088612A (en) | Group A Streptococcus multivalent vaccine | |
| EP3946444A1 (en) | Compositions and methods for eliciting an immune response against clostridium difficile | |
| US20180140693A1 (en) | Group A Streptococcus Pharmaceutical Compositions and Methods Thereof | |
| US7501132B2 (en) | Multiple antigenic peptides immunogenic against Streptococcus pneumonia | |
| US20130243779A1 (en) | Peptides protective against e. faecalis, methods and uses relating thereto | |
| Meinke et al. | Immunological fingerprinting of group B streptococci: from circulating human antibodies to protective antigens | |
| US9650425B2 (en) | Group A streptococcal M-related proteins and methods of use | |
| Lebogo | Pre-Clinical Evaluation of Pneumococcal Vaccine Candidate Molecules in a Mouse Pneumococcal Pneumonia Model | |
| WO2008127102A1 (en) | S. pnuemoniae transcytosis protein | |
| Henningham | Characterisation of anchorless cell-surface proteins: novel candidates for a safe and universal group a streptococcal vaccine | |
| McCabe | B anes | |
| JP2004321010A (en) | Novel streptococcal protein antigen | |
| JP2004504056A (en) | protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2525766 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004239596 Country of ref document: AU Ref document number: 543662 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004733500 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2004239596 Country of ref document: AU Date of ref document: 20040517 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004239596 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 20048168399 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004733500 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007082003 Country of ref document: US Ref document number: 10556733 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 10556733 Country of ref document: US |














