WO2004076615A2 - Immunomodulating probiotic compounds - Google Patents

Abstract

The present invention relates to methods for modulating i) an immune response and/or ii) the amount and/or composition of mucosal mucins, by contacting a cell forming part of mucosal­associated lymphoid tissue (MALT), or an epithelial cell, with a microbial cell surface polypeptide. The modulation of the immune response preferably involves the induction of one or more cytokines. The microbial cell surface polypeptide is preferably a polypeptide obtained from probiotic species of Lactobacillus or Bifidobacterium. It has surprisingly been found that intracellular enzymes acting in metabolic pathways in Lactobacillus and Bifidobacterium, or polypeptides substantially identical with such intracellular enzymes, are transported to the surface of the cell where they may become at least partially exposed to the extracellular medium. Accordingly, preferred cell surface polypeptides have intracellular (i.e. cytoplasm associated) equivalents acting in metabolic pathways, such as e.g. glycolysis, in probiotic species of Lactobacillus and/or Bifidobacterium. The surface associated polypeptides and their intracellular equivalents share an extended stretch of consecutive amino acid residues, but are located in different parts of a cell.

Description

Immunomodulating Probiotic Compounds

This application is a non-provisional of U.S. provisional application Serial No. 60/449,840 filed February 27, 2003 and of U.S. provisional application Serial No. 60/482,156 filed June 25, 2003, which are hereby incorporated by reference in their entirety.

All patent and non-patent references are hereby incorporated by reference in their entirety.

Field of Invention

The present invention relates to methods for modulating i) an immune response and/or ii) the amount and/or composition of mucosal mucins, by contacting a cell forming part of mucosal-associated lymphoid tissue (MALT), or an epithelial cell, with a microbial cell surface polypeptide. The modulation of the immune response preferably involves the induction of one or more cytokines.

The microbial cell surface polypeptide is preferably a polypeptide obtained from probiotic species of Lactobacillus or Bifidobacterium. It has surprisingly been found that intracellular enzymes acting in metabolic pathways in Lactobacillus and Bifidobacterium, or polypeptides substantially identical with such intracellular enzymes, are transported lo the surface of the cell where they may become at least partially exposed to the extracellular medium.

Accordingly, preferred cell surface polypeptides have intracellular (i.e. cytoplasm associated) equivalents acting in metabolic pathways, such as e.g. glycolysis, in probiotic species of Lactobacillus and/or Bifidobacterium. The surface associated polypeptides and their intracellular equivalents share an extended stretch of consecutive amino acid residues, but are located in different parts of a cell.

The cell surface polypeptide can be administered in isolated form, or associated covalently or non-covalently with the surface of the cell having produced the polypeptide. When associated with the cell surface the polypeptide can furthermore be modified, e.g. by post-translational modification, as compared to its intracellular equivalent.

The invention also relates to species of Lactobacillus and Bifidobacterium having an altered expression of at least one cell surface polypeptide. The altered expression can be generated by mutagenising an expression signal directing the expression of a gene encoding a cell surface polypeptide. Alternatively, the altered expression can be generated by fusing a gene encoding a cell surface polypeptide to a heterologous expression signal not natively associated with said gene. The altered expression can be an increased expression or a decreased expression. Preferably, the altered expression is an increased expression.

The invention is useful in the treatment of clinical conditions in an individual which responds to modulation of the mucosal immune system, including modulations involving one or more of e.g. the synthesis and/or secretion of cytokines, the stimulation of IgA antibodies, the inhibition of IgE antibodies, the regulation of the Th1/Th2 response, the stimulation of macrophage function, the stimulation of natural killer cell synthesis, and the general activation of the mucosa-associated lymphoreticular tissue system.

The invention further relates to methods for probiotic strain development and methods for performing a quality control procedure ensuring that a strain have desired probiotic qualities.

Background of Invention

Probiotic microorganisms

Probiotic microorganisms are defined as microorganisms that are beneficial to ani- mal or human health. This invention pertains to the field of immunomodulatory and mucin modulatory compounds produced by probiotic microorganisms.

The Nobel Prize winner Metchnikoff claimed in the beginning of the last century that the consumption of certain microorganisms was beneficial to the health i.e. resulting in a prolonged lifetime. In the following years, research on these so-called "probiotic microorganisms" has been scattered into several different areas including "improvement of general health", atherosclerosis, infections, gastrointestinal diseases and cancer. Although the majority of these studies have been performed as clinical trials, many results are difficult to interpret for the reason that non-standardized or non-optimal procedures have been employed regarding the handling, storage, cultivation and formulation of the probiotic microorganisms. This has led to much speculation, but few clinical results backed by hard experimental facts. Accordingly, scientific data describing the molecular mechanisms behind the alleged positive effects of probiotics is still lacking.

An increasing activity in the research on probiotic microorganisms has emerged in the past five years. For instance, a number of results show that certain probiotic bacterial strains have a positive influence on inflammatory bowel diseases (Hart et al.; 2003). Also, it has been shown that inactivated probiotic strains cause different cytokines to be produced when the strains are brought into contact with epithelial or immuno-competent mammal cells (Maassen et al.; 2000, Christensen et al.; 2002). The strains Lactobacillus plantarum 299v (Johansson et al.; 1993), Lb. rhamnosus 271 (Johansson et al.; 1993), Lb. paracasei 8700:2 and Lb. paracasei 02A (Ahrne et al.; 1998, Molin et al.; 1993, Hessle et al.; 1999, and Antonsson M.; 2001) can be used as standard indicators for probiotic potential as they have been shown to have probiotic properties such as e.g. survival in the gastrointestinal tract, adherence to intestinal mucosa, and induction/modification of cytokine release. Children congeni- tally exposed to human immunodeficiency virus (HIV) have received Lb. plantarum 299v in a fermented oatmeal gruel (freeze-dried) in a pilot study. The results sug- gested that Lb. plantarum 299v elicits specific systemic immune responses after oral supplementation (Cunningham-Rundles et al.; 2000 and Cunningham-Rundles et al.; 2002. However, no results have been published concerning the compounds, produced by the probiotic cells, which are responsible for the induction of the cytokine production.

A few patents and patent applications speculate that each of a large variety of different compounds in or on probiotic strains could be responsible for the immuno- modulatory response in the mammalian cells (a. Glenn et al.; 2002, b. Glenn et al.; 2002). Genome sequencing and proteome projects have revealed the genetic and protein make-up of selected Lactobacillus strains (Kleerebezem et al.; 2003, a.Glenn et al.; 2002) but the identification and characterisation of one or more compounds responsible for the immuno-modulatory effect has not been reported.

Mucosal immune system

Mucosal surfaces of the lungs and the Gl tract have several tasks that include absorption, macromolecule transport, barrier and secretory functions. However, the large mucosal surfaces are continuously exposed to millions of more or less harmful antigens from the environment, food and microorganisms. To meet these chal- lenges, the mucosa possesses an immune system that tightly controls the balance between responsiveness and tolerance.

The immune system of the mucosa is part of the entire immune system and, consequently, immune responses in the mucosa are reflected in the entire body. It con- sists of an integrated network of tissues, lymphoid and non-lymphoid cells and effector molecules such as antibodies and cytokines. The interaction between antigen-presenting cells (APCs), T lymphocytes and cytokines is the key for providing the correct specific immune response.

An incorrect or uncontrolled mucosal T-cell response may lead to immunological diseases such as allergy, inflammation and a number of autoimmune diseases. Means to control T-cell differentiation and cytokine signaling will be essential for the prevention of or the development of therapeutics against such diseases.

The cytokines tumor necrosis factor-alpha (TNFα) and interleukin (IL)1 β have been shown to be essential mediators in stimulating inflammatory responses and the production of these cytokines characterize a pro-inflammatory response. Conversely, the cytokine IL10 and TGFβ are mediators of an anti-inflammatory response (for review see Neurath et al.; 2002).

The first interaction between microorganisms and the host cells takes place at the so-called mucosa-associated lymphoreticular tissue (MALT), which contains APC, T-lymphocytes and IgA-committed B-cells. In the MALT, specialized epithelial M cells transport antigens and microorganisms to the dome underlying the epithelial layer, where they encounter antigen presenting cells (APCs) such as dendritic cells (DCs).

Two major outcomes can in principle result from the above-mentioned transport of antigens to the dome underlying the epithelial layer. One outcome results in the development of B-cells capable of producing antigen-specific antibodies. The B-cells can reach the mucosal tissues where they differentiate into plasma cells.

A second outcome of the entry of antigen and antigen presentation by DCs is the activation and differentiation of T cells that subsequently can migrate out of the

MALT and reach mucosal or peripheral non-mucosal tissues. The T cells can secrete cytokines, such as IL10 and TGFβ, which are essential for the induction of suppressive T cell responses i.e. an anti-inflammatory response.

Alternatively, mucosal T helper cells, Th1 or Th2, can produce pro-inflammatory cytokines such as TNFα and IL1β. After the differentiation and migration, CD4+ T cells are termed naive T precursor cells, which are functionally immature.

The activation and further differentiation of naive T precursor cells requires at least two separate signals provided by APCs. The first signal is delivered by the T cell receptor/CD3 complex after the T cell's interaction with antigen/major histocompati- bility complex on APCs. The second signal is produced by a number of co- stimulatory or accessory molecules on the APC that interact with their ligands on T cells.

Cytokines play the most critical role in this so-called Th1/Th2 polarization. IL12 and IL4 are essential in the control of the differentiation of precursor T cells into Th1 and Th2, respectively. Cytokines induce the generation of their own T-helper subset and, simultaneously, inhibit the generation of the other subset.

Besides cytokines such as IL12 and IL4, the cytokine IL18 also favors Th1 development. Although IL18 alone cannot induce Th1 cell differentiation it strongly enhances IL12-dependent Th1 cell development. Th1 cells secrete the cytokines interferon-γ (INFγ), and TNF. The cytokine IL13 plays an important role in the Th2 development and its function is partly overlapping that of IL4. The cytokine signaling in T cells as carried out by INFγ, IL12 and IL4 occurs through the binding to the membrane-located cytokine receptors IFN-γ R, IL12R and IL4R, respectively. The binding conducts activation of the transcription factors STAT1 , STAT4 and STAT6, respectively. STAT1 activates the master transcription factor T- bet for Th1 cells. T-bet induces Th1 cytokine production and IL12R β2 chain expression while it simultaneously suppresses Th2 cytokine production. In contrast, the activation of STAT6 leads to the activation of the master transcription factor GATA-3 for Th2 cells. This activation directs Th2 cytokines production through activation of a number of other activators.

Th1 development eventually leads to a cell mediated immunological response while a Th2 development leads to a humoral response. Some infections require Th1 response while others require Th2. However, uncontrolled responses can result in significant tissue and organ damage, which eventually may result in the death of the host. Examples of diseases resulting from uncontrolled responses include inflammatory bowel disease, rheumatoid arthritis, multiple sclerosis, arteriosclerosis, allergy and diabetes. The inflammatory responses also have an essential role in the protection against growth and development of tumors.

Cytokine modulation

In recent years there has been a growing interest in cytokine therapies and cytokine signaling-directed therapies for T cell mediated diseases using either recombinant cytokines or anti-cytokines strategies.

An attractive approach to prevent and control such diseases would be the therapeutic use of compounds that are capable of changing specific cytokine concentrations although knowledge is presently lacking on the characterization on accurate immune responses. For instance, compounds that lower the IL4 levels would be useful for the treatment of allergy and lowering the TNF levels would be useful against Crohn's disease.

The bacterial cell surface is the immediate object for interaction with or binding to eukaryotic host cells. It has been shown that, in general, Gram-negative bacteria induce a pro-inflammatory response while certain Gram-positive induce an anti- inflammatory response (Maasen et al.; 2000, Christensen et al.; 2002). It is speculated that Gram-negative bacteria contains surface located compounds, such as specific lipopolysaccharides or flagellin, which induce the pro-inflammatory response (Liaudet et al.; 2003). Gram-positive bacteria are generally believed to harbour anti- inflammatory inducing compounds although exceptions have been described (Han- age & Cohen; 2002). Various Gram-positive bacteria have been shown to be associated with the induction in DCs of different cytokines in different amounts, but no link have been established between specific cell surface polypeptides and a particular induction profile (Maasen et al.; 2000, Christensen et al.; 2002).

Modulation of mucin production

It has been shown that specific bacteria can modulate the expression of genes encoding mucins (Mack et al., 1999, Mattar et al.; 2002). The ability to approach and adhere to the epithelial cells in the intestine changes with differences in the mucin composition. Using a transfection strategy, some strains of E. coli is capable of changing the mucin composition in order to favor its affinity to adhere to the epithelia of the intestinal tract. Some Lactobacillus strains have been shown to remodulate the mucin composition resulting in a disfavorable structure to E. coli adherence (Mack et al.; 1999).

Mucosal colonization

Candida albicans (Gil-Navarro et al.; 1997) and group A streptococci (Pancholi & Fischetti 1992) contain surface located glyceraldehydephosphate dehydrogenase (GAPDH), which is key enzymes of the intracellularly operating glycolysis.

The surface located GAPDH of group A streptococci also functions as an ADP- ribosylating enzyme, which in the presence of NAD is auto-ADP-ribosylated (Pancholi & Fischetti 1993). Since ADP-ribosylation is involved in signal transduction events, this activity of GAPDH may be involved in the communication between the bacterium and a eukaryotic host cell. This is supported by the finding that the

GAPDH of group A streptococci is involved in the activation of protein tyrosine kinase and protein kinase C of human pharyngeal cells (Pancholi & Fischetti 1997).

In addition, another key glycolytic enzyme, -enolase, has been found on the sur- face of pathogenic streptococci (Pancholi & Fischetti 1997; Pancholi & Fischetti 1998; Bergmann et al.; 2001 ) and Candida albicans (Barea et al.; 1999). Strepto- coccal surface enolase (SEN) displays strong plasmin and plasminogen binding, which could be a virulence factor. Group A streptococci may thus bind to plasminogen) via SEN and subvert the fibrinolytic activity of human plasmin(ogen) to their own advantage for tissue invasion. The presence of enolase on the surface of streptococci and also on a variety of mammalian tissues including the brain provides new insight in the role of SEN-specific antibodies in post-streptococcal autoimmune diseases. Additionally, SEN has been shown to bind to the extracellular matrix, which makes it tempting to speculate if enolase is involved in bacterial signal trig- gering or transduction in eukaryotic host cells.

Most probiotic strains belong to the genera of Lactobacillus and Bifidobacterium. Several publications, patents and patent applications have described clinical effects related to the ingestion of such strains (Sen et al.; 2002, for review see Sanders 1999). GAPDH has recently been described on the surface of Lactobacillus rham- nosus (a. Glenn et al.; 2002).

Only a few publications describe compounds that could be related to the probiotic effects (Adlerberth et al.; 1996, Grenato et al.; 1999, Vidal et al.; 2002,) and specific mechanisms at the molecular level are not described.

Summary of Invention

Identification of Lactobacillus and Bifidobacterium compounds capable of either modulating an immune response and/or modulating the amount and/or composition of mucosal mucins would be of great interest in the prevention and treatment of e.g. immuno-dependent diseases and infectious diseases.

It has surprisingly been found that intracellular Lactobacillus enzymes acting in metabolic pathways, or polypeptides being substantially identical with such intracellular enzymes as described herein below, are transported to the cell surface and optionally becomes at least partially exposed to the extracellular medium.

In one aspect of the present invention, methods for modulating an immune response and/or modulating the amount and/or composition of mucosal mucins exploit Lactobacillus and/or Bifidobacterium cell surface polypeptides having substantially identical intracellular equivalents acting in metabolic pathways, such as e.g. the glycolytic pathway, in Lactobacillus and/or Bifidobacterium. The cell surface polypeptides are capable of contacting an animal or human cell forming part of the mucosa-associated lymphoid tissue (MALT) system and/or an animal or human epithelial cell, including MALT cells and epithelial cells of the gastro-intestinal (Gl) tract.

This invention in one aspect relates to methods for i) induction of gene expression in an animal or human host cell and, subsequently, ii) increased or decreased production of compounds such as e.g. cytokines and/or mucins, wherein the production of e.g. cytokines and/or mucins result from the contacting of a microbial cell surface polypeptide and the animal or human host cell.

The increased or decreased production of compounds such as e.g. cytokines and/or mucins is according to one presently preferred hypothesis believed to be the result of the binding of a Lactobacillus or Bifidobacterium surface polypeptide to an epithelial cell, or a cell forming part of mucosa-associated lymphoid tissue (MALT).

The binding of the surface polypeptide can be direct or indirect, i.e. additional binding factors can be involved in order for the Lactobacillus or Bifibobacterium cell surface polypeptide to bind an epithelial cell and/or a cell of the MALT system.

The binding of the Lactobacillus or Bifibobacterium cell surface polypeptide alone can mediate signal transduction, or signal transduction (ultimately resulting in cytokine modulation and/or modulation of the amount and/or composition of mucosal mucins) can require additional factors which may also need to bind the epithelial cell and/or the MALT and/or the surface polypeptide.

Signal transduction can also occur because the binding of a Lactobacillus or

Bifidobacterium surface polypeptide to an epithelial cell, or a cell forming part of MALT can prevent a pathogen microbial cell from gaining access to the site of binding of the Lactobacillus or Bifidobacterium surface polypeptide. According to another presently preferred hypothesis, self-antibodies present in e.g. auto-immune diseases can be titrated by binding to a Lactobacillus or Bifidobacterium surface polypeptide according to the invention, thereby at least alleviating the auto-immune disease.

The present invention in a particularly preferred aspect relates to methods for modulating an immune response, such as a cytokine response, in an animal or human host cell, such as an epithelial cell or a cell of the MALT-system in an animal or human individual, by contacting said cell with a microbial cell surface polypeptide preferably obtained from a probiotic strain of Lactobacillus or Bifidobacterium. The cell surface polypeptide can be in isolated form or associated with the surface of the cell having produced the polypeptide.

The cell surface polypeptide can be modified as compared to a substantially identical intracellular/cytoplasmatically located equivalent/homolog of the cell surface polypeptide. The intracellular equivalent acts in a metabolic pathway and comprises an enzymatic activity. The cell surface polypeptide can comprise an enzymatic activity, but need not have any enzymatic activity. The modification of the cell surface polypeptide can be any post-translational modification, including ribosylation, phosphorylation, methylation acetylation, alkylation, glycosylation, sulfation, amidation, proteolytic processing, and the cell surface polypeptide can form oligomeric or mullimeric complexes with itself or other polypeptides, and attain a different tertiary structure as a result of the cell surface association or the association with e.g. molecular chaperones.

Cell surface polypeptides and their substantially identical cytoplasmic equivalents/homologs share an extensive stretch of consecutive amino acid residues, such as e.g. at least 20 amino acid residues, for example at least 40 amino acid residues, such as e.g. at least 50 amino acid residues, for example at least 60 amino acid residues, such as e.g. at least 70 amino acid residues, for example at least 80 amino acid residues, such as e.g. at least 90 amino acid residues, for example at least 100 amino acid residues, such as e.g. at least 120 amino acid residues, for example at least 140 amino acid residues, such as e.g. at least 160 amino acid residues, for example at least 180 amino acid residues, such as at least 200 amino acid residues. Cell surface polypeptides and their substantially identical equivalents/homologs preferably comprise amino acid sequences which are e.g. at least 80% identical, such as at least 85% identical, for example at least 90% identical, such as at least 95% identical, for example at least 98% identical, such as completely (100%) identical amino acid sequences. As cell surface polypeptides and their equivalents share extensive stretches of amino acids they are likely also to share some secondary and/or tertiary structure and they can in some embodiments be identified by the same antibody, such as a polyclonal antibody or a monoclonal antibody.

"Substantially identical" can be determined e.g. on the basis of the above characteristics. "Substantially identical" as used herein does not exclude differences between cell surface polypeptides and their intracellular/ cytoplasmatically located equivalents/homologs such as e.g. that one of the aforementioned having an enzymatic activity while the other does not (preferably the intracellular equivalent/homolog exerts an enzymatic activity), as well as differences resulting from post-translational modifications, and differences in secondary and/or tertiary structure resulting from different folding reactions or folding pathways.

Accordingly, equivalents/homologs can share homologous enzymatic activities, but do not need to do so as the cell surface polypeptides of the invention do not always (need to) have the activity of its intracellular equivalent in order to bind an epithelial cell or a cell of the MAST. Equivalents/homologs can furthermore be encoded by the same or different gene(s) and/or regulated by the same or different regulator(s).

It is believed according to one presently preferred hypothesis that at least transient colonisation of the gastro-intestinal (Gl) tract is a prerequisite for a probiotic microbial cell to exert its probiotic potential. The attachment of the probiotic microbial cell, optionally in combination with the attachment of additional compounds, such as e.g. one or more of mannose binding polypeptides, S-layer proteins, carbohydrates, lipotachoic acid as well as lipids, is believed to be responsible for signal triggering and/or signal transduction in the host cell. It is therefore also believed that signal triggering and/or signal transduction can be performed by the presence and/or binding to an animal or human cell of one or more additional compounds following the initial binding of the probiotic microbial cell to the host cell. The invention in presently preferred embodiments relates to methods employing species of Lactobacillus and/or Bifidobacterium, as well as to species of Lactobacillus and/or Bifidobacterium having an altered expression of at least one cell surface polypeptide capable of exerting an immunomodulating effect when binding an epithelial cell or a cell of the mucosa-associated lymphoid tissue (MALT).

In additionally preferred embodiments of the present invention the methods and microbial cells are directed to Lactobacillus species and/or Bifidobacterium species harbouring on their cell surface an enzyme also capable of acting in the glycolytic pathway, i.e. an enzyme the activity of which catalyses a reaction in the glycolytic pathway. Particularly preferred examples are the surface located polypeptides Enolase and GAPDH from Lactobacillus plantarum. A surface localisation of an Enolase enzyme in a Lactic Acid Bacteria has not previously been described.

The invention further relates to isolated polynucleotides and isolated cell surface located polypeptides. Such polynucleotides and polypeptides have been isolated by cloning and characterisation of e.g. genes encoding Enolase, GAPDH, phospho- glycerate kinase (PGK) and triose phosphate isomerase (TPI) from Lb plantarum.

PGK and TPI are also believed to be located on the surface of Lb plantarum. Accordingly, Enolase, GAPDH, PGK and TPI are all candidate compounds for acting on epithelial cells, or cells of the mucosa-associated lymphoid tissue, and thereby modulating mucosa-associated cytokine production and/or cytokine secretion, and/or modulating the amount and/or composition of mucosal mucins in an animal or human individual.

The observed effect is possibly exerted through M cells and/or dendritic cells (DCs), and/or antigen presenting cells (APCs), and/or T cells, and/or B cells, and/or natural killer (NK) cells, and/or macrophages, and/or further mucosal associated cells. The above candidate compounds in another preferred embodiment also act as a signal transducer of the animal or human cell being contacted by the compound. Also described herein below is the cloning and characterisation of a gene encoding a regulator protein (GRE) that might regulate the transcription of the operon containing the genes encoding Enolase, GAPDH, PGK and TPI.

The cell surface location of e.g. Enolase, GAPDH, PGK, TPI and GRE of Lactobacillus and Bifidobacterium cells, or their modified equivalents, or genes encoding such proteins, or polypeptides involved in production, secretion and/or modification thereof, is believed to be important markers for probiotic activity and would, therefore, serve as an indicator for optimisation of the probiotic strains. The optimisation could be carried out using classical screening methods, by using recombinant DNA techniques, or by using and optimising growth conditions, storage conditions and formulation techniques.

Moreover, the isolated and/or purified Enolase, GAPDH, PGK and TPI could be provided alone or in combination with the probiotic microorganisms producing the compounds in methods for modulating immune responses and/or for modulating the mucin composition of the mucosa. As demonstrated herein, the markers can also serve as important probiotic indicators during production processes and/or concomitant or subsequent quality control.

In another preferred embodiment there is provided methods for the construction of probiotic strains and methods for the production of the above-mentioned candidate compounds for use in an analysis of immuno-modulatory and/or mucin modulating effects. The analyses comprise e.g. using one or more of 0-mutants (null-mutants, i.e. a probiotic strain not expressing one or more candidate compounds), or mutants defective in secretion and/or post-translational modification, the isolated compounds, and combinations thereof. The wild type strain Lb plantarum 299v can be used as a standard indicator for probiotic potential.

The analysis can e.g. be carried out in in vitro models using cell cultures and in animals using colitis models. The ultimate goal is to demonstrate the immuno- modulatory and mucin modulating effects in human trials.

The present invention relates to the following aspects: A microbial cell comprising at least one microbial cell surface polypeptide and a substantially identical intracellular equivalent thereof,

wherein the microbial cell is selected from the group consisting of Lactobacillus species and Bifidobacterium species, and

wherein the microbial cell comprises an altered polynucleotide sequence as compared to a reference microbial cell comprising a reference polynucleotide sequence without said alteration,

wherein the activity of the intracellular equivalent is capable of converting a substrate in a Lactobacillus metabolic pathway and/or a Bifidobacterium metabolic pathway, and

wherein the altered polynucleotide sequence results in an altered, preferably increased, production and/or secretion and/or post-translational modification in the microbial cell of the at least one microbial cell surface polypeptide as compared to the production and/or secretion and/or post-translational modification of the cell surface polypeptide in a reference microbial cell comprising said reference polynucleotide sequence without said alteration.

A method for determining the probiotic potential of a candidate microbial cell, preferably selected from the group consisting of Lactobacillus species and Bifidobacterium species, such as, but not limited to, a microbial cell described herein, said cell comprising a microbial cell surface polypeptide and a substantially identical intracellular equivalent capable of converting a substrate in a metabolic pathway of the candidate microbial cell, said method comprising the steps of i) providing a candidate microbial cell for which the probiotic potential is to be determined, ii) performing a qualitative and/or quantitative determination of the production and/or secretion and/or post-translational modification in the candidate microbial cell of said microbial cell surface polypeptide, or determining another characteristic of said candidate microbial cell, wherein said other characteristic is related to or correlates with the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, iii) comparing the result of the determination performed in step ii) with a reference value indicative of the probiotic potential of a reference microbial cell, and iv) determining the probiotic potential of said candidate microbial cell based on the comparison performed in step iii).

A method for determining the probiotic potential of a starter culture, said starter culture comprising a plurality of microbial cells, preferably selected from the group consisting of Lactobacillus species and Bifidobacterium species, such as, but not limited to, a plurality of microbial cells as described herein, said cells each comprising a microbial cell surface polypeptide and a substantially identical intracellular equivalent capable of converting a substrate in a metabolic pathway of the microbial cell, said method comprising the steps of i) providing a sample from a candidate starter culture for which the probiotic potential is to be determined, ii) performing on said sample a qualitative and/or quantitative determination of the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, or determining another characteristic on said sample, wherein said other characteristic is related to or correlates with the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, iii) comparing the result of the determination performed in step ii) with a reference value indicative of the probiotic potential of a reference starter culture, and iv) determining the probiotic potential of said candidate starter culture based on the comparison performed in step iii).

A method for determining the probiotic potential of an end-user product, preferably selected from the group consisting of Lactobacillus species and Bifidobacterium species, said end-user product comprising a plurality of microbial cells, such as, but not limited to, a plurality of microbial cells as described herein, said cells each comprising a microbial cell surface polypeptide and a substantially identical intracellular equivalent capable of converting a substrate in a metabolic pathway of the microbial cell, said method comprising the steps of i) providing a sample from a candidate end-user product for which the probiotic potential is to be determined, ii) performing on said sample a qualitative and/or quantitative determination of the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, or determining another characteristic on said sample, wherein said other characteristic is related to or correlates with the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, iii) comparing the result of the determination performed in step ii) with a reference value indicative of the probiotic potential of a reference end- user product, and iv) determining the probiotic potential of said candidate end-user product based on the comparison performed in step iii).

A method for identifying a microbial cell with altered probiotic potential, comprising the steps of i) providing a plurality of cells of a Lactobacillus species or a plurality of cells of a Bifidobacterium species ii) subjecting said plurality of cells to a selection and/or mutagenesis procedure, and iii) identifying a microbial cell with altered probiotic potential as compared to the cells provided in step i), by identifying a cell with an altered production and/or secretion and/or post-translational modification of cell surface polypeptide, said cell surface polypeptide having a substantially identical intracellular equivalent, wherein the activity of the intracellular equivalent is capable of converting a substrate in a metabolic pathway of the cell.

A microbial cell having an altered probiotic potential obtainable by the above method for identifying. A method for improving the probiotic potential of a microbial cell, preferably selected from the group consisting of Lactobacillus species and Bifidobacterium species, said cell comprising a cell surface polypeptide having a substantially identical intracellular equivalent, wherein the activity of the intracellular equivalent is capable of converting a substrate in a metabolic pathway of the cell, said method comprising the steps of

i) providing a microbial cell the probiotic potential of which is to be optimised,

ii) cultivating the microbial cell in a growth medium under conditions allowing the microbial cell to undergo at least one cell division,

wherein the probiotic potential of the microbial cell is improved by controlling, during the cultivation of the microbial cell, the presence or amount of one or more of the following components:

a) reducing agents, such as glutathione and/or cysteine, preferably increasing the amount thereof, b) gasses, such oxygen or carbon dioxide, c) yeast extract, or components thereof, d) organic acids, e) the carbon source, preferably carbohydrates, f) the nitrogen source, preferably proteins, peptides (like casaminoacids), amino acids, including any composition of naturally occurring amino acids, and precursors and/or derivatives thereof, as well as inorganic salts (like ammonium sulfate, acetamide, nitrates or nitrites), g) the oxygen content, h) the ionic strength of the growth medium, such as the NaCl content, i) the pH, j) low molecular weight compounds, preferably salts (sulfate, phosphate, nitrate), and/or metals (e.g., copper), and/or organic acids, k) cAMP level in the microbial cell, and I) a cell constituent, or a precursor thereof, preferably a co-factor, a vitamin, a lipid, and the like

thereby controlling the production and/or secretion and/or post-translational modification of said cell surface polypeptide.

A method for modulating an immune response and/or the amount and/or composition of mucosal mucins in an individual, said method comprising the steps of

i) providing a microbial cell selected from a Lactobacillus cell and a

Bifidobacterium cell,

wherein said cell comprises at least one microbial cell surface polypeptide and a substantially identical intracellular equivalent thereof,

wherein the activity of the intracellular equivalent is capable of converting a substrate in a metabolic pathway of the cell,

ii) contacting an epithelial cell or a cell of the mucosa-associated lymphoid tissue (MALT) of the individual with at least one microbial cell surface polypeptide, and

iii) modulating an immune response and/or the amount and/or composition of mucosal mucins in an individual.

An isolated polynucleotide comprising a nucleic acid sequence which is at least 90% identical to at least one of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5; and SEQ ID NO:7, wherein the percentage of identical nucleotides is determined by aligning the sequence and the compare sequences using the BLASTN algorithm version 2.04 set at default parameters described herein above, identifying the number of identical nucleotides over aligned portions of the sequence and the compare sequences, dividing the number of identical nucleotides by the total number of nucleic acids of the compare sequence, and multiplying by 100 to determine the percentage identical nucleotides. A vector comprising a polynucleotide as described herein.

A host cell comprising a polynucleotide as described herein.

A method for producing a microbial cell surface polypeptide capable of modulating an immune response, or a fragment thereof, comprising the step of culturing a host cell as described herein under conditions suitable for the production of said immu- nomodulating polypeptide, or fragment thereof.

A method for producing a microbial cell surface polypeptide capable of modulating the amount and/or composition of mucosal mucins, or a fragment thereof, comprising the step of culturing a host cell as described herein under conditions suitable for the production of said immunomodulating polypeptide, or fragment thereof.

A method for producing an epithelial adhesive polypeptide, or a fragment thereof, comprising the step of culturing the host cell as described herein under conditions suitable for the production of said epithelial adhesive polypeptide, or fragment thereof.

A polypeptide comprising an amino acid sequence which is at least 90% identical to at least one of SEQ ID NO:2; SEQ ID NO: 4; SEQ ID NO:6; and SEQ ID NO:8, including variants and functional equivalents thereof.

An antibody against a polypeptide as described herein.

An antagonist capable of inhibiting the activity or expression of a polypeptide as described herein.

An agonist capable of enhancing the activity or expression of a polypeptide as de- scribed herein.

A method for the treatment of an individual comprising the step of administering to the individual a therapeutically effective amount of a polypeptide as described herein. A method for the treatment of an individual comprising the step of administering to the individual a therapeutically effective amount of a host cell as described herein.

A method for identifying compounds which interact with and inhibit or activate an activity of a polypeptide as described herein comprising the steps of

i) contacting a composition comprising the polypeptide with the compound to be screened under conditions to permit interaction between the compound and the polypeptide to assess the interaction of a compound, such interaction being associated with a second component capable of providing a detectable signal in response to the interaction of the polypeptide with the compound; and

ii) determining whether the compound interacts with and activates or in- hibits an activity of the polypeptide by detecting the presence or absence of a signal generated from the interaction of the compound with the polypeptide.

A method for treating an auto-immune disease in an individual comprising the step of administering to the individual a pharmaceutically effective amount of a polypeptide as described herein, or a host cell as described herein.

A polypeptide and variants and functional equivalents thereof as described herein or a host cell as described herein, for use as a medicament.

Use of a polypeptide and variants and functional equivalents thereof as described herein or a host cell as described herein, for the manufacture of a medicament for treatment of a disease, wherein said treat- ment benefits from modulation of the immune response.

A pharmaceutical composition comprising a therapeutically effective amount of at least one polypeptide and variants and functional equivalents thereof as described herein or a host cell as described herein, and at least one excipient. A nutritional supplement comprising at least a host cell as described herein and/or at least a polypeptide and variants and functional equivalents thereof as described herein.

Use of a polypeptide and variants and functional equivalents thereof as described herein and/or at least a host cell as described herein for the manufacture of a nutritional supplement for treatment of a disease which benefit from modulation of the immune response.

A food comprising at least a host cell as describee herein, and/or at least a polypeptide and variants and functional equivalents thereof as described herein.

Use of a polypeptide and variants and functional equivalents thereof as described herein and/or at least a host cell as described herein for the manufacture of a food for treatment of a disease which benefit from modulation of the immune response.

In a preferred embodiment, an increased probiotic potential is generated by an increased production and/or an increased secretion and/or an increased or decrea- sed post-translational modification of said microbial cell surface polypeptide,

such as an increased production and an increased secretion and an increased or decreased post-translational modification of said microbial cell surface polypeptide,

for example an increased production and an increased secretion and an increased post-translational modification of said microbial cell surface polypeptide,

such as an increased production and an increased secretion and a decreased post- translational modification of said microbial cell surface polypeptide,

for example an increased production and/or an increased or decreased post- translational modification of said microbial cell surface polypeptide,

such as an increased production and an increased post-translational modification of said microbial cell surface polypeptide, for example an increased production and a decreased post-translational modification of said microbial cell surface polypeptide,

such as an increased secretion and an increased or decreased post-translational modification of said microbial cell surface polypeptide,

for example an increased secretion and an increased post-translational modification of said microbial cell surface polypeptide,

such as an increased secretion and an decreased post-translational modification of said microbial cell surface polypeptide,

for example an increased production of said microbial cell surface polypeptide,

such as an increased secretion of said microbial cell surface polypeptide,

for example an increased or decreased post-translational modification of said microbial cell surface polypeptide,

such as an increased post-translational modification of said microbial cell surface polypeptide,

for example a decreased post-translational modification of said microbial cell surface polypeptide.

Description of Drawings

Fig. 1 illustrates SDS-PAGE analysis of surface located proteins from L. plantarum

299v.

Fig. 2 illustrates data obtained from mass spectrometric analysis of the tryptic digest from band at MW 38.5 kDa (Fig. 1). Fig. 3 illustrates a nucleotide sequence of L. plantarum 299v encoding the regulator and the genes encoding gapdh-pgk-tpi-eno.

Fig. 4 illustrates the amino acid sequence of L. plantarum Gapdh.

Fig. 5 illustrates the amino acid sequence of L. plantarum Pgk.

Fig. 6 illustrates the amino acid sequence of L. plantarum Tpi.

Fig. 7 illustrates the amino acid sequence of L. plantarum Eno.

Fig. 8 illustrates the amino acid sequence of the regulator of expression of gapdh- pgk-tpi-eno in L. plantarum.

Fig. 9 illustrates the difference between extracellular/surface-located GAPDH activity in MRS broth (black bars) and in the modified sMRS medium (white bars). Each result is the mean of two parallel cultures of Lactobacillus plantarum 299v.

Fig. 10 illustrates the development of extracellular/surface-located GAPDH in cultures of Lactobacillus plantarum strains 299v (diamonds) and WCFS1 (triangles) during incubation for three days at 30°C.

Fig. 11 shows GAPDH activity in culture supernatant, in ESP (the fraction eluted from harvested cells by washing with PBS), and in the suspension of washed cells.

Fig. 12 shows the distribution of GAPDH (white bars) and LDH activity (black bars) between the extracellular (culture supernatant, ESP, and washed cells) and intracellular (cell lysate) fractions from a stationary phase culture of Lactobacillus plantarum 299v.

Fig. 13 shows a western blot illustrating the cross reaction between anti-GAPDH and GAPDH-GST fusion protein or GAPDH wild type protein.

Fig. 14 illustrates the extracellular/surface-located GAPDH and LDH activities in cultures of 23 different Lactococcus strains. Fig. 15 shows western blots of ESP-fractions from 23 different Lactococcus strains. anti-GAPDH and anti-ENO, respectively, were used as primary antibodies.

Fig. 16 illustrates the binding of GAPDH to fibronectin.

Fig. 17 illustrates the binding of enolase to fibronectin.

Fig. 18 illustrates the binding of GAPDH to plasminogen.

Fig. 19 illustrates the binding of enolase to plasminogen.

Fig. 20 illustrates the binding of GAPDH to mucin.

Fig. 21 illustrates the binding of enolase to mucin.

Fig. 22 illustrates the IL-10 stimulation assay.

Fig. 23 illustrates screening of 192 mutants of 299v. A) Photograph of plate 53 (top) and plate 52 (bottom). B) OD₅₉₅ readings from plate 53 (top) and plate 52 (bottom).

Fig. 24 illustrates LDH and GAPDH activities found in culture supernatants and ESP-fractions of L. plantarum strains 299v, WCFS1 , 149-D7, 147-D7/129 and UP102.

Fig. 25 shows immunoblots (western blots) of proteins from lysed cells, ESP- fractions (surface attached proteins), and culture supernatants of Lb. plantarum strains 299v, WCFS1, and 149-D7. A Coomassie stained SDS-PAGE gel is also shown.

Fig. 26 shows immunoblots of proteins from culture supernatants and ESP-fractions (surface attached proteins) of Lb. plantarum strains 299v, WCFS1 , 149-D7, 149- D7/129, and UP102. Anti-GAPDH, anti-ENO, and anti-PGK, respectively, are used as primary antibodies. Fig. 27 illustrates plasmid constructs used to complement L. plantarum WCFS1.

Fig. 28 shows a silver stained 2D-PAGE loaded with ESP from L. plantarum 299v.

Fig. 29 illustrates part of the result from analysis of the GAPDH tryptic digest.

Fig. 30 illustrates Nano-ESI analysis of the ions at m/z 612.87.

Fig. 31 illustrates Nano-ESI analysis of the ions at m/z 827.38.

Fig. 32 illustrates the inactivation of hom2-thrB in L. plantarum 299v.

Fig. 33 illustrates Southern blot analysis of L. plantarum 299v and L. plantarum PSM2012 (hybridised with hom2-thrB DNA).

Definitions

Contacting: The binding, transient or longer lasting, of e.g. a polypeptide to a cell.

Cytokine response: The induction or repression of one or more cytokines.

Degenerated polynucleotide: Different polynucleotides can encode the same polypeptide as the genetic code is degenerated.

Enzyme: Polypeptide comprising an activity allowing the polypeptide to convert a substrate into a product resulting from the enzymatic reaction.

Epithelial cell: Cell of the gastro-intestinal (Gl) tract.

Food: Where used herein, the term 'food' can be any type of food, incl. an edible product. In some embodiments, the edible product is a food for special medical purposes, or a functional food or a novel food. Microbial cell surface polypeptide: Polypeptide located on the cell surface or attached thereto or associated therewith. The attachment can be covalent or non- covalent. The polypeptide can be exposed to the extracellular medium or act in the cell membrane to present other polypeptides to the extracellular medium.

Modulating: Changing the expression or production of one or more compounds. Modulating can be inducing or repressive leading to increased expression/production and reduced expression/production, respectively.

Probiotic marker: Surface located polypeptide acting as a determinant for the probiotic potential of a cell.

Probiotic potential: the potential for immunomodulation and/or mucin production and/or the adhesion to intestinal epithelium.

Detailed Description of the Invention

Preferred embodiments of the present invention is described herein below.

Methods for modulating an immune response in an individual

In one embodiment there is provided a method for modulating an immune response and/or the amount and/or composition of mucosal mucins in an individual, said method comprising the steps of

i) providing a microbial cell selected from a Lactobacillus cell and a

Bifidobacterium cell,

wherein said cell comprises at least one microbial cell surface polypeptide and a substantially identical intracellular equivalent thereof,

wherein the activity of the intracellular equivalent is capable of converting a substrate in a metabolic pathway of the cell, ii) contacting an epithelial cell or a cell of the mucosa-associated lymphoid tissue (MALT) of the individual with at least one microbial cell surface polypeptide, and

iii) modulating an immune response and/or the amount and/or composition of mucosal mucins in an individual.

The modulation of the immune response preferably comprises a cytokine response, such as a modulation of the synthesis and/or secretion of at least one cytokine selected from the group consisting of IL-1 , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9,

IL-10, IL-11 , IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18 and IL-19, TNF-alpha, TNF-beta, LT-beta, CD40 ligand, Fas ligand, CD27 ligand, CD30 ligand, 4-1 BBL, TGF-beta, and interferons, including IFN-alpha, IFN-beta, and IFN-gamma.

The modulation of the immune response can further comprise one or more of i) an increased or decreased IgA production, ii) an increased or decreased IgE production, iii) a stimulation or repression of macrophage function, iv) a stimulation or repression of natural killer cell activity, and v) an activation or repression of the MALT system.

The epithelial cell is preferably selected from the group consisting of epithelial cells from an animal or human individual. The cell of the mucosa-associated lymphoid tissue (MALT) is selected from the group consisting of M-cells, antigen presenting cells (APCs), dendritic cells (DCs), T-lymphocytes, including Th1 , Th2, and CTL cells, IgA-committed B cells, macrophages, and natural killer (NK) cells.

The substantially identical intracellular equivalent of the cell surface polypeptide is preferably selected from the group consisting of Lactobacillus enzymes acting in a metabolic pathway and Bifidobacterium enzymes acting in a metabolic pathway. The metabolic pathway is preferably the glycolytic pathway or the pathway for uptake of carbohydrates (phosphotransferase uptake system).

The enzyme acting in a metabolic pathway in Lactobacillus and/or Bifidobacterium is preferably selected from the group consisting of hexokinase; glucose 6-phosphate isomerase; phosphofructokinase; aldolase; triose phosphate isomerase (TPI); glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase (PGK); phosphoglycerate mutase; enolase; and pyruvate kinase.

More preferably, the enzyme is selected from the group consisting of enolase; glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase

(PGK); and triose phosphate isomerase (TPI). In one presently most preferred embodiment, the enzyme is selected from the group consisting of enolase and glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

The microbial cell surface polypeptide can be covalently or non-covalently bound to the surface of a microbial cell, such as a Lactobacillus cell or a Bifidobacterium cell. The microbial cell can natively produce the .cell surface polypeptide, or the microbial cell is can be a cell not natively producing the cell surface polypeptide.

The cell surface polypeptide can modified as compared to the polypeptide or its substantially identical equivalent/homolog when it is located intracellularly. The modification can be a covalent modification, such as a covalent modification selected from the group consisting of ribosylation, phosphorylation, methylation acetylation, alkylation, glycosylation, sulfation, amidation, proteolytic processing.

Microbial cells capable of producing a microbial cell surface polypeptide

In another embodiment there is provided a microbial cell comprising at least one microbial cell surface polypeptide and a substantially identical intracellular equivalent thereof,

wherein the microbial cell is selected from the group consisting of Lactobacillus species and Bifidobacterium species, and

wherein the activity of the intracellular equivalent is capable of converting a substrate in a Lactobacillus metabolic pathway and/or a Bifidobacterium metabolic pathway, and wherein the at least one microbial cell surface polypeptide is encoded by a first polynucleotide operably linked to a second polynucleotide capable of directing the expression of said first polynucleotide, and

wherein the first and second polynucleotides are not natively associated, and

wherein the production and/or secretion and/or modification of the at least one microbial cell surface polypeptide is altered as compared to the production thereof when the first polynucleotide is operably linked to its native expression signal.

First and second polynucleotides not natively associated shall comprise the introduction of a heterologous expression signal operably linked to the gene encoding the cell surface polynucleotide as well as a mutagenised expression signal which differs from the native expression signal by at least one nucleotide deletion, addition or substitution.

An altered expression of the cell surface polypeptide can be determined by e.g. enzymatic assays and/or immunological assays.

The intracellular equivalent of the microbial cell surface polypeptide is preferably selected from the group consisting of Lactobacillus enzymes and Bifidobacterium enzymes acting in a metabolic pathway.

The metabolic pathway is preferably selected from the glycolytic pathway and the phosphotransferase system, and the enzyme is preferably selected from the group consisting of hexokinase; glucose 6-phosphate isomerase; phosphofructokinase; aldolase; triose phosphate isomerase (TPI); glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase (PGK); phosphoglycerate mutase; enolase; and pyruvate kinase.

More preferably, the enzyme is selected from the group consisting of enolase; glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase (PGK); and triose phosphate isomerase (TPI). The enzyme in a presently most preferred embodiment is selected from the group consisting of enolase and glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

The microbial cell surface polypeptide can be covalently or non-covalently bound to the surface of the microbial cell, and the microbial cell can natively produce the cell surface polypeptide or be a cell which does not natively produce the cell surface polypeptide.

The cell surface polypeptide can be modified as compared to the substantially identical intracellularly equivalent/homolog thereof, and the modification can be a covalent or non-covalent modification. The covalent modification is preferably selected from the group consisting of ribosylation, phosphorylation, methylation acetylation, alkylation, glycosylation, sulfation, amidation, and proteolytic processing.

Polynucleotides, vectors and host cells transformed therewith

There is also provided polynucleotides and vectors encoding cell surface polynucleotides, as well as host cells transformed therewith.

In one embodiment the host cell is the microbial cell described herein above, i.e. a microbial cell comprising at least one microbial cell surface polypeptide and a substantially identical intracellular equivalent thereof,

wherein the microbial cell is selected from the group consisting of Lactobacillus species and Bifidobacterium species, and

wherein the activity of the intracellular equivalent is capable of converting a substrate in a Lactobacillus metabolic pathway and/or a Bifidobacterium metabolic pathway, and

wherein the at least one microbial cell surface polypeptide is encoded by a first polynucleotide operably linked to a second polynucleotide capable of directing the expression of said first polynucleotide, and wherein the first and second polynucleotides are not natively associated, and

wherein the production and/or secretion and/or modification of the at least one microbial cell surface polypeptide is altered as compared to the production thereof when the first polynucleotide is operably linked to its native expression signal.

The host cell transformed with the below polynucleotides can also be a cell where the expression of the gene encoding the cell surface polynucleotide is directed by a native expression signal, and wherein the secretion and/or modification of the cell surface polynucleotide is altered as a result of mutagenesis, or altered expression of one or more chaperones or one or more components of the secretion machinery or one or more enzymes involved in performing post-translational modifications of polypeptides. An increased secretion and/or modification can be determined by suitable enzymatic assays and/or immunological assays.

Preferred host cells are selected from the group consisting of Gram-positive, non- pathogenic bacteria, such as from the group consisting of the genus of Lactobacillus and the genus of Bifidobacterium.

Presently preferred host cells comprise Lactobacillus acetotolerans, Lactobacillus acidipiscis, Lactobacillus acidophilus, Lactobacillus agilis, Lactobacillus algidus, Lactobacillus alimentarius, Lactobacillus amylolyticus, Lactobacillus amylophilus, Lactobacillus amylovorus, Lactobacillus animalis, Lactobacillus arizonensis, Lacto- bacillus aviarius, Lactobacillus bifermentans, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus coelohominis, Lactobacillus collinoides, Lactobacillus coryniformis subsp. coryniformis, Lactobacillus coryniformis subsp. torquens, Lactobacillus crispatus, Lactobacillus curvatus, Lactobacillus cypricasei, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus delbrueckii subsp del- brueckii, Lactobacillus delbrueckii subsp. lactis, Lactobacillus durianus, Lactobacillus equi, Lactobacillus farciminis, Lactobacillus ferintoshensis, Lactobacillus fer- mentum, Lactobacillus fornicalis, Lactobacillus fructivorans, Lactobacillus frumenti, Lactobacillus fuchuensis, Lactobacillus gallinarum, Lactobacillus gasseri, Lactobacillus graminis, Lactobacillus hamsteri, Lactobacillus helveticus, Lactobacillus helveticus subsp. jugurti, Lactobacillus heterohiochii, Lactobacillus hilgardii, Lacto- bacillus homohiochii, Lactobacillus intestinalis, Lactobacillus japonicus, Lactobacillus jensenii, Lactobacillus johnsonii, Lactobacillus kefiri, Lactobacillus kimchii, Lactobacillus kunkeei, Lactobacillus leichmannii, Lactobacillus letivazi, Lactobacillus lindneri, Lactobacillus malefermentans, Lactobacillus mali, Lactobacillus maltaromi- cus, Lactobacillus manihotivorans, Lactobacillus mindensis, Lactobacillus mucosae,

Lactobacillus murinus, Lactobacillus nagelii, Lactobacillus oris, Lactobacillus panis, Lactobacillus pantheri, Lactobacillus parabuchneri, Lactobacillus paracasei subsp. paracasei, Lactobacillus paracasei subsp. pseudoplantarum,, Lactobacillus paracasei subsp. tolerans, Lactobacillus parakefiri, Lactobacillus paralimentarius, Lactoba- cillus paraplantarum, Lactobacillus pentosus, Lactobacillus perolens, Lactobacillus plantarum, Lactobacillus pontis, Lactobacillus psittaci, Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus ruminis, Lactobacillus sakei, Lactobacillus salivarius, Lactobacillus salivarius subsp. salicinius, Lactobacillus salivarius subsp. salivarius, Lactobacillus sanfranciscensis, Lactobacillus sharpeae, Lactobacillus suebicus, Lactobacillus thermophilus, Lactobacillus thermotolerans, Lactobacillus vaccinostercus, Lactobacillus vaginalis, Lactobacillus versmoldensis, Lactobacillus vitulinus, Lactobacillus vermiforme, Lactobacillus zeae

Additional preferred host cells comprise Bifidobacterium adolescentis, Bifidobacte- rium aerophilum, Bifidobacterium angulatum, Bifidobacterium animalis, Bifidobacterium asteroides, Bifidobacterium bifidum, Bifidobacterium bourn, B dobacterium breve, Bifidobacterium catenulatum, Bifidobacterium choerinum, B dobacterium coryneforme, Bifidobacterium cuniculi, Bifidobacterium dentium, B dobacterium gallicum, Bifidobacterium gallinarum, Bifidobacterium indicum, B dobacterium longum, Bifidobacterium longum bv Longum, Bifidobacterium longum bv. Infantis,

Bifidobacterium longum bv. Suis, Bifidobacterium magnum, Bifidobacterium mery- cicum, Bifidobacterium minimum, Bifidobacterium pseudocatenulatum, Bifidobacterium pseudolongum, Bifidobacterium pseudolongum subsp. globosum, Bifidobacterium pseudolongum subsp. pseudolongum, Bifidobacterium psychroaerophilum, Bifidobacterium pullorum, Bifidobacterium ruminantium, Bifidobacterium saeculare,

Bifidobacterium scardovii, Bifidobacterium subtile, Bifidobacterium thermoacidophi- lum, Bifidobacterium thermoacidophilum subsp. suis, Bifidobacterium thermophilum, Bifidobacterium urinalis. Preferred examples of first polynucleotides encoding a cell surface polynucleotide is provided herein below and includes SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7 and fragments thereof encoding a polypeptide capable of acting as a cell surface polypeptide and capable of binding an epithelial cell and/or a cell of the mucosa-associated lymphoid tissue (MALT).

Polynucleotides encoding glyceraldehyde phosphate dehydrogenase (gapdh)

In one preferred embodiment there is provided a polynucleotide selected from the group consisting of

i) SEQ ID NO:1 or a polynucleotide comprising nucleotides 1285 to 2307 of

SEQ ID NO:11 , and

ii) a polynucleotide comprising or essentially consisting of the coding sequence of gap encoding a glyceraldehyde 3-phosphate dehydrogenase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843; and

iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO:2; and

iv) a polynucleotide encoding a fragment of a polypeptide encoded by polynucleotides (i), (ii) or (iii), wherein said fragment

a) has glyceraldehyde 3-phosphate dehydrogenase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:2; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:2 for binding to at least one predetermined binding partner; and v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that

a) has glyceraldehyde 3-phosphate dehydrogenase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:2; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:2 for binding to at least one predetermined binding partner,

vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v),

and the complementary strand of such a polynucleotide.

Polynucleotides encoding phospho glycerate kinase (pgk)

In one preferred embodiment there is provided a polynucleotide selected from the group consisting of

i) SEQ ID NO:3, or a polynucleotide comprising nucleotides 2428 to 2630 of SEQ ID NO:11 , and

ii) a polynucleotide comprising or essentially consisting of the coding sequence of pgk encoding a phosphoglycerate kinase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM

9843; and

iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO:4; and iv) a polynucleotide encoding a fragment of a polypeptide encoded by polynucleotides (i), (ii) or (iii), wherein said fragment

a) has phosphoglycerate kinase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:4; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:4 for binding to at least one predetermined binding partner; and

v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that

a) has phosphoglycerate kinase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:4; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:4 for binding to at least one predetermined binding partner,

vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v),

and the complementary strand of such a polynucleotide.

Polynucleotides encoding triose phosphate isomerase (tpi)

In one preferred embodiment there is provided a polynucleotide selected from the group consisting of i) SEQ ID NO:5, or a polynucleotide comprising nucleotides 3657 to 4415 of SEQ ID NO:11 , and

ii) a polynucleotide comprising or essentially consisting of the coding sequence of tpi encoding a triose phosphate isomerase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843; and

iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO:6; and

iv) a polynucleotide encoding a fragment of a polypeptide encoded by polynucleotides (i), (ii) or (iii), wherein said fragment

a) has triose phosphate isomerase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:6; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:6 for binding to at least one predetermined binding partner; and

v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that

a) has triose phosphate isomerase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:6; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:6 for binding to at least one predetermined binding partner,

vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v),

and the complementary strand of such a polynucleotide.

Polynucleotides encoding enolase (eno)

In one preferred embodiment there is provided a polynucleotide selected from the group consisting of

i) SEQ ID NO:7, a polynucleotide comprising nucleotides 4497 to 5825 of

SEQ ID NO:11 , and

ii) a polynucleotide comprising or essentially consisting of the coding se- quence of eno encoding an enolase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843; and

iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO:8; and

iv) a polynucleotide encoding a fragment of a polypeptide encoded by polynucleotides (i), (ii) or (iii), wherein said fragment

a) has enolase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:8; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:8 for binding to at least one predetermined binding partner; and

v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that

a) has enolase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:8; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:8 for binding to at least one predetermined binding partner,

vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v),

and the complementary strand of such a polynucleotide.

Polypeptides

The present invention is also directed to polypeptides encoded by the above polynucleotides as well as variants and functional equivalents of such polypeptides.

Accordingly, there is provided a polypeptide selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8, including fragments, variants and functional equivalents thereof as described below in more detail.

Functional equivalents and variants are used interchangeably herein. When being polypeptides, variants are determined on the basis of their degree of identity or their degree of homology with any predetermined sequence of consecutive amino acid sequences of a fragment of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8.

One therefore initially define a sequence of consecutive SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 amino acid residues and then define variants and functional equivalents in relation thereto.

Accordingly, variants preferably have at least 75% sequence identity, for example at least 80% sequence identity, such as at least 85 % sequence identity, for example at least 90 % sequence identity, such as at least 91 % sequence identity, for example at least 91% sequence identity, such as at least 92 % sequence identity, for example at least 93 % sequence identity, such as at least 94 % sequence identity, for example at least 95 % sequence identity, such as at least 96 % sequence identity, for example at least 97% sequence identity, such as at least 98 % sequence identity, for example 99% sequence identity with the predetermined SEQ ID NO:2,

SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 sequence of consecutive amino acid residues.

Sequence identity is determined in one embodiment by using the algorithm GAP, BESTFIT, or FASTA in the Wisconsin Genetics Software Package Release 7.0, using default gap weights.

The following terms are used to describe the sequence relationships between two or more polynucleotides: "predetermined sequence", "comparison window", "sequence identity", "percentage of sequence identity", and "substantial identity". A "predetermined sequence" is a defined sequence used as a basis for a sequence comparison; a predetermined sequence may be a subset of a larger sequence.

Optimal alignment of sequences for aligning a comparison window may be con- ducted by the local homology algorithm of Smith and Waterman (1981 ) Adv. Appl.

Math. 2: 482, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48: 443, by the search for similarity method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444, by computerised implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wis- consin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection, and the best alignment (i.e., resulting in the highest percentage of homology over the comparison window) generated by the various methods is selected.

The term "sequence identity" means that two amino acid sequences are identical over the window of comparison.

The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which identical amino acid residues occur in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.

As applied to polypeptides, a degree of identity of amino acid sequences is a function of the number of identical amino acids at positions shared by the amino acid sequences. A degree of homology or similarity of amino acid sequences is a function of the number of amino acids, i.e. structurally related, at positions shared by the amino acid sequences.

The term "substantial identity" means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 75 percent sequence identity, such as at least 80 percent sequence identity, for example at least 85 percent sequence identity, such as e.g. at least 90 percent sequence identity, for example at least 95 percent sequence identity, such as at least 98 percent sequence identity, or even at least 99 percent sequence identity, compared to a predetermined sequence over a comparison window of at least 9 amino acid residues, such as 10 amino acid residues, for example 11 amino acid residues, such as 12 amino acid residues, for example 13 amino acid residues, such as 14 amino acid residues, for example 15 amino acid residues, such as 20 amino acid residues, for example 30 amino acid residues, such as 40 amino acid residues, for example 50 amino acid residues, such as 60 amino acid residues, for example 70 amino acid residues, such as 80 amino acid residues, for example 90 amino acid residues, such as 100 amino acid residues, for example 110 amino acid residues, such as 120 amino acid residues, for example 130 amino acid residues, such as 140 amino acid residues, for example 150 amino acid residues, such as 175 amino acid residues, for example 200 amino acid residues, such as 225 amino acid residues, for example 250 amino acid residues, such as 275 amino acid residues, for example 297 amino acid residues. Preferably, residue positions which are not iden- tical differ by conservative amino acid substitutions.

Conservative amino acid substitutions refer in one embodiment to the interchange- ability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine, a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine- valine, and asparagine-glutamine.

Additionally, variants are also determined based on a predetermined number of conservative amino acid substitutions as defined herein below. Conservative amino acid substitution as used herein relates to the substitution of one amino acid (within a predetermined group of amino acids) for another amino acid (within the same group), wherein the amino acids exhibit similar or substantially similar characteristics.

Within the meaning of the term "conservative amino acid substitution" as applied herein, one amino acid may be substituted for another within the groups of amino acids indicated herein below:

Amino acids having polar side chains (Asp, Glu, Lys, Arg, His, Asn, Gin, Ser, Thr,

Tyr, and Cys,)

Amino acids having non-polar side chains (Gly, Ala, Val, Leu, lie, Phe, Trp, Pro, and Met) Amino acids having aliphatic side chains (Gly, Ala Val, Leu, lie)

Amino acids having cyclic side chains (Phe, Tyr, Trp, His, Pro)

Amino acids having aromatic side chains (Phe, Tyr, Trp)

Amino acids having acidic side chains (Asp, Glu)

Amino acids having basic side chains (Lys, Arg, His)

Amino acids having amide side chains (Asn, Gin)

Amino acids having hydroxy side chains (Ser, Thr)

Amino acids having sulphor-containing side chains (Cys, Met),

Neutral, weakly hydrophobic amino acids (Pro, Ala, Gly, Ser, Thr)

Hydrophilic, acidic amino acids (Gin, Asn, Glu, Asp), and

Hydrophobic amino acids (Leu, lie, Val)

Accordingly, a variant or a fragment thereof according to the invention may comprise at least one substitution, such as a plurality of substitutions introduced independ- ently of one another. It is clear from the above outline that the same variant or fragment thereof may comprise more than one conservative amino acid substitution from more than one group of conservative amino acids as defined herein above.

The addition or deletion of at least one amino acid may be an addition or deletion of from preferably 2 to 250 amino acids, such as from 10 to 20 amino acids, for example from 20 to 30 amino acids, such as from 40 to 50 amino acids. However, additions or deletions of more than 50 amino acids, such as additions from 50 to 100 amino acids, addition of 100 to 150 amino acids, addition of 150-250 amino acids, are also comprised within the present invention. The deletion and/or the addition may - independently of one another - be a deletion and/or an addition within a sequence and/or at the end of a sequence.

The polypeptide fragments according to the present invention, including any func- tional equivalents thereof, may in one embodiment comprise a sequence of consecutive SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 amino acid residues of less than 250 amino acid residues, such as less than 240 amino acid residues, for example less than 225 amino acid residues, such as less than 200 amino acid residues, for example less than 180 amino acid residues, such as less than 160 amino acid residues, for example less than 150 amino acid residues, such as less than 140 amino acid residues, for example less than 130 amino acid residues, such as less than 120 amino acid residues, for example less than 110 amino acid residues, such as less than 100 amino acid residues, for example less than 90 amino acid residues, such as less than 85 amino acid residues, for example less than 80 amino acid residues, such as less than 75 amino acid residues, for example less than 70 amino acid residues, such as less than 65 amino acid residues, for example less than 60 amino acid residues, such as less than 55 amino acid residues, for example less than 50 amino acid residues, such as less than 45 amino acid residues, for example less than 30 amino acid residues, such as less than 25 amino acid residues, for example less than 20 amino acid residues, for example 10 consecutive amino acid residues of any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8.

"Functional equivalency" as used in the present invention is according to one pre- ferred embodiment established by means of reference to the corresponding functionality of a predetermined fragment of the sequence.

Functional equivalents or variants or fragments of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 as described herein will be understood to exhibit amino acid sequences gradually differing from preferred, predetermined sequences, as the number and scope of insertions, deletions and substitutions including conservative substitutions, increases. This difference is measured as a reduction in homology between a preferred, predetermined sequence and the SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 fragment or SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 variant or functional equivalent. All SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID N0:8 fragments comprising or consisting of consecutive SEQ ID N0:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 amino acid residues as well as variants and functional equivalents thereof are included within the scope of this invention, regardless of the degree of homology they show to a predetermined sequence. The reason for this is that some regions of the SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 fragments are most likely readily mutatable, or capable of being completely deleted, without any significant effect on e.g. the binding activity of the resulting fragment.

A functional variant obtained by substitution may well exhibit some form or degree of native binding activity, and yet be less homologous, if residues containing functionally similar amino acid side chains are substituted. Functionally similar in this respect refers to dominant characteristics of the side chains such as hydrophobic, basic, neutral or acidic, or the presence or absence of steric bulk. Accordingly, in one embodiment of the invention, the degree of identity is not a principal measure of a fragment being a variant or functional equivalent of a preferred predetermined fragment according to the present invention.

The homology between amino acid sequences may be calculated using well known algorithms such as any one of BLOSUM 30, BLOSUM 40, BLOSUM 45, BLOSUM 50, BLOSUM 55, BLOSUM 60, BLOSUM 62, BLOSUM 65, BLOSUM 70, BLOSUM 75, BLOSUM 80, BLOSUM 85, and BLOSUM 90.

Fragments sharing homology with fragments comprising or consisting of consecutive SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 amino acid residues are to be considered as falling within the scope of the present invention when they are preferably at least about 90 percent homologous, for example at least 92 percent homologous, such as at least 94 percent homologous, for example at least 95 percent homologous, such as at least 96 percent homologous, for example at least 97 percent homologous, such as at least 98 percent homologous, for example at least 99 percent homologous with a predetermined SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 fragment. According to one embodiment of the invention the homology percentages indicated above are identity percentages. Additional factors that may be taken into consideration when determining functional equivalence according to the meaning used herein are i) the ability of antisera to detect a SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 fragment according to the present invention, or ii) the ability of a functionally equivalent SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 fragment to compete with a predetermined SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 fragment in an assay. One method for determining a sequence of immunogenically active amino acids within a known amino acid sequence has been described by Geysen in US 5,595,915 and is incorporated herein by reference.

A further suitably adaptable method for determining structure and function relationships of peptide fragments is described by US 6,013,478, which is herein incorporated by reference.

In addition to conservative substitutions introduced into any position of a preferred

SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 fragments, it may also be desirable to introduce non-conservative substitutions in any one or more positions of such a fragment. A non-conservative substitution leading to the formation of a functionally equivalent fragment would for example i) differ substantially in polarity, for example a residue with a non-polar side chain (Ala, Leu, Pro, Trp, Val, lie, Leu, Phe or Met) substituted for a residue with a polar side chain such as Gly, Ser, Thr, Cys, Tyr, Asn, or Gin or a charged amino acid such as Asp, Glu, Arg, or Lys, or substituting a charged or a polar residue for a non-polar one; and/or ii) differ substantially in its effect on polypeptide backbone orientation such as substitution of or for Pro or Gly by another residue; and/or iii) differ substantially in electric charge, for example substitution of a negatively charged residue such as Glu or Asp for a positively charged residue such as Lys, His or Arg (and vice versa); and/or iv) differ substantially in steric bulk, for example substitution of a bulky residue such as His, Trp, Phe or Tyr for one having a minor side chain, e.g. Ala, Gly or Ser (and vice versa).

Variants obtained by substitution of amino acids may in one preferred embodiment be made based upon the hydrophobicity and hydrophilicity values and the relative similarity of the amino acid side-chain substituents, including charge, size, and the like. Exemplary amino acid substitutions which take various of the foregoing char- acteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.

In a further embodiment the present invention relates to functional variants comprising substituted amino acids having hydrophilic values or hydropathic indices that are within +/-4.9, for example within +/-4.7, such as within +/-4.5, for example within +A-4.3, such as within +/-4.1 , for example within +/-3.9, such as within +/-3.7, for example within +/- 3.5, such as within +/-3.3, for example within +/- 3.1 , such as within +/- 2.9, for example within +/- 2.7, such as within +/-2.5, for example within +/-

2.3, such as within +/- 2.1 , for example within +/- 2.0, such as within +/- 1.8, for example within +/- 1.6, such as within +/- 1.5, for example within +/- 1.4, such as within +/- 1.3 for example within +/- 1.2, such as within +/- 1.1 , for example within +/- 1.0, such as within +/- 0.9, for example within +/- 0.8, such as within +/- 0.7, for example within +/- 0.6, such as within +/- 0.5, for example within +/- 0.4, such as within +/- 0.3, for example within +/- 0.25, such as within +/- 0.2 of the value of the amino acid it has substituted.

The importance of the hydrophilic and hydropathic amino acid indices in conferring interactive biologic function on a protein is well understood in the art (Kyte & Doolit- tle, 1982 and Hopp, U.S. Pat. No. 4,554,101 , each incorporated herein by reference).

The amino acid hydropathic index values as used herein are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4 ); threonine (-0.7 ); serine (-0.8 ); tryptophan (-0.9); tyrosine (-1.3); praline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (- 3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5) (Kyte & Doolittle, 1982).

The amino acid hydrophilicity values are: arginine (+3.0); lysine (+3.0); aspartate (+3.0.+-.1 ); glutamate (+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); praline (-0.5.+-.1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4) (U.S. 4,554,101). In addition to the peptidyl compounds described herein, sterically similar compounds may be formulated to mimic the key portions of the peptide structure and that such compounds may also be used in the same manner as the peptides of the invention. This may be achieved by techniques of modelling and chemical designing known to those of skill in the art. For example, esterification and other alkylations may be employed to modify the amino terminus of, e.g., a di-arginine peptide backbone, to mimic a tetra peptide structure. It will be understood that all such sterically similar constructs fall within the scope of the present invention.

Variants and functional equivalents of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 also includes derivatives of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 or fragments thereof, for example fragments substituted with one or more chemical moieties.

Peptides with N-terminal alkylations and C-terminal esterifications are also encompassed within the present invention. Functional equivalents also comprise glycosyl- ated and covalent or aggregative conjugates formed with the same or other polypeptide selected from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8, or a fragment thereof, including dimers and unrelated chemical moieties.

Such functional equivalents are prepared by linkage of functionalities to groups which are found in fragment including at any one or both of the N- and C-termini, by means known in the art.

Functional equivalents may thus comprise SEQ ID NO:2, SEQ ID NO:4, SEQ ID

NO:6, AND SEQ ID NO:8, or fragments thereof conjugated to aliphatic or acyl esters or amides of the carboxyl terminus, alkylamines or residues containing carboxyl side chains, e.g., conjugates to alkylamines at aspartic acid residues; O-acyl derivatives of hydroxyl group-containing residues and N-acyl derivatives of the amino terminal amino acid or amino-group containing residues, e.g. conjugates with fMet-Leu-Phe or immunogenic proteins. Derivatives of the acyl groups are selected from the group of alkyl-moieties (including C3 to C10 normal alkyl), thereby forming alkanoyl species, and carbocyclic or heterocyclic compounds, thereby forming aroyl species. The reactive groups preferably are difunctional compounds known per se for use in cross-linking proteins to insoluble matrices through reactive side groups. Covalent or aggregative functional equivalents and derivatives thereof are useful as reagents in immunoassays or for affinity purification procedures. For example, a SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 or fragments thereof according to the present invention may be insolubilized by covalent bonding to cyanogen bromide-activated Sepharose by methods known per se or adsorbed to polyolefin surfaces, either with or without glutaraldehyde cross-linking, for use in an assay or purification of anti-SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 antibodies or cell surface receptors. Fragments may also be labelled with a detectable group, e.g., radioiodinated by the chloramine T procedure, covalently bound to rare earth chelates or conjugated to another fluorescent moiety for use in e.g. diagnostic assays.

SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 or fragments thereof according to the invention may be synthesised both in vitro and in vivo. In one embodiment the SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 fragments of the invention are synthesised by automated synthesis. Any of the commercially available solid-phase techniques may be employed, such as the Merrifield solid phase synthesis method, in which amino acids are sequentially added to a growing amino acid chain. (See Merrifield, J. Am. Chem. Soc. 85:2149-2146, 1963).

Equipment for automated synthesis of polypeptides is commercially available from suppliers such as Applied Biosystems, Inc. of Foster City, Calif., and may generally be operated according to the manufacturer's instructions. Solid phase synthesis will enable the incorporation of desirable amino acid substitutions into any of SEQ ID

NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8, or a fragment thereof, according to the present invention. It will be understood that substitutions, deletions, insertions or any subcombination thereof may be combined to arrive at a final sequence of a functional equivalent. Insertions shall be understood to include amino- terminal and/or carboxyl-terminal fusions, e.g. with a hydrophobic or immunogenic protein or a carrier such as any polypeptide or scaffold structure capable as serving as a carrier.

Oligomers including dimers including homodimers and heterodimers of any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 or fragments thereof fragments according to the invention are also provided and fall under the scope of the invention. Functional equivalents and variants of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8, or fragments thereof, can be produced as homodimers or heterodimers with other amino acid sequences or with native SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 sequences. Heterodimers include dimers containing immunoreactive SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 variants and fragments as well as SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8 variants and fragments that need not have or exert any biological activity.

Method for producing microbial cell surface polypeptide

In another embodiment there is provided a method for producing a microbial cell surface polypeptide, or a fragment thereof capable of modulating an immune re- sponse in an individual or modulating the amount and/or composition of mucosal mucins, comprising the step of culturing a host cell as described herein under conditions suitable for the production of said polypeptide, or fragment thereof. The cell surface polypeptide is preferably selected from any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8, including functional equivalents and variants and fragments thereof.

Method for producing epithelial adhesive polypeptide

In another embodiment there is provided a method for producing an epithelial adhe- sive polypeptide or a MALT cell adhesive polypeptide, or a fragment thereof, comprising the step of culturing a host cell as described herein under conditions suitable for the production of said epithelial adhesive polypeptide, or fragment thereof. The adhesive polypeptide is preferably selected from any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8, including functional equivalents and vari- ants and fragments thereof.

Antibodies There is also provided a polyclonal antibody or a monoclonal antibody specific for any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8, including functional equivalents and variants and fragments thereof.

Antagonists and agonists

The invention also provided antagonists and agonists for any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8, including functional equivalents and variants and fragments thereof.

Pharmaceutical compositions and methods for treatment of an individual

The is provided a pharmaceutical composition comprising a polypeptide selected from any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, AND SEQ ID NO:8, includ- ing functional equivalents and variants and fragments thereof. The polypeptide can be provided in purified or isolated form or the polypeptide can be provided as part of a Lactobacillus cell and/or Bifidobacterium cell in a composition comprising such cells.

Accordingly, the invention in preferred embodiments relates to pharmaceutical compositions which comprise the above-mentioned polypeptides as well as variants or fragments of these molecules as defined herein above for the treatment of disorders of the immune system.

Pharmaceutically and/or veterinary useful therapeutic compositions according to the invention can be formulated according to known methods such as by the admixture of one or more pharmaceutically or veterinary acceptable excipients or carriers. Examples of such excipients, carriers and methods of formulation may be found e.g. in Remington's Pharmaceutical Sciences (Maack Publishing Co, Easton, PA). To form a pharmaceutically or veterinary acceptable composition suitable for effective administration, such compositions will contain an effective amount of a polypeptide, nucleic acid, antibody or compound modulator.

Therapeutic or diagnostic compositions of the invention are administered to an individual (mammal-human or animal) or used in amounts sufficient to treat or diagnose apoptosis-related disorders. The effective amount may vary according to a variety of factors such as the individual's condition, weight, sex and age. Other factors include the mode of administration.

The term functional derivative includes a molecule that contains additional chemical moieties which are not normally a part of the base molecule. Such moieties may improve the solubility, half-life, absorption, etc. of the base molecule. Alternatively the moieties may attenuate undesirable side effects of the base molecule or de- crease the toxicity of the base molecule. Examples of such moieties are described in a variety of texts, such as Remington's Pharmaceutical Sciences.

Pharmaceutical and veterinary compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose. The determination of an effective dose is well within the capability of those skilled in the art. The therapeutically effective dose can be estimated initially either in cell culture assays, e.g., of neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs. The animal model is also used to achieve a desirable concentration range and route of administration. Such infor- mation can then be used to determine useful doses and routes for administration in humans and other animals. A therapeutically effective dose refers to that amount of compound, peptide, antibody or nucleic acid which ameliorate or prevent a dysfunctional apoptotic condition. The exact dosage is chosen by the individual physician in view of the patient to be treated.

Compounds identified according to the methods disclosed herein as well as, therapeutic antibodies, therapeutic nucleic acids and peptides contemplated herein may be used alone at appropriate dosages defined by routine testing in order to obtain optimal modulation of living activity. In addition, co-administration or sequential administration of these and other agents may be desirable.

The pharmaceutical or veterinary compositions may be provided to the individual by a variety of routes such as subcutaneous, topical, oral and intramuscular. Administration of pharmaceutical compositions is accomplished orally or parenterally. Methods of parenteral delivery include topical, intra-arterial (directly to the tissue), intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, intraperitoneal, or intranasal administration. The present invention also has the objective of providing suitable topical, oral, systemic and parenteral pharmaceutical formulations for use in the novel methods of treatment of the present invention. The compositions containing compounds identified according to this invention as the active ingredient for use in the modulation of a protein which mediates apoptosis can be administered in a wide variety of therapeutic dosage forms in conventional vehicles for administration. For example, the compounds can be administered in such oral dosage forms as tablets, capsules (each including timed release and sustained release formulations), pills, powders, granules, elixirs, tinctures, solutions, suspensions, syrups and emulsions, or by injection. Likewise, they may also be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, topical with or without occlusion, or intramuscular form, all using forms well known to those of ordinary skill in the pharmaceutical arts. An effective but non-toxic amount of the compound, nucleic acid, or peptide desired can be employed as an apoptosis modulating agent.

The daily dosage of the products may be varied over a wide range such as e.g. from about 1 to 10,000 mg per adult human/per day. For oral administration, the compo- sitions are preferably provided in the form of scored or unscored tablets containing

1.0, 25, 50, 100, 150, 250, 500, 1000, 5000, and 10000 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated. An effective amount of the drug is ordinarily supplied at a dosage level of from about 0.0001 mg/kg to about 100 mg/kg of body weight per day. The range is more par- ticularly from about 0.001 mg/kg to preferably less than 100 mg/kg of body weight per day.

Of course the dosage level will vary depending upon the potency of the particular compound. Certain compounds will be more potent than others. In addition, the dosage level will vary depending upon the bioavailability of the compound. The more bioavailable and potent the compound, the less compound will need to be administered through any delivery route, including but not limited to oral delivery.

The dosages of living modulators are adjusted when combined to achieve desired effects. On the other hand, dosages of these various agents may be independently optimised and combined to achieve a synergistic result wherein the pathology is reduced more than it would be if either agent were used alone. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors.

There is also provided combination therapies comprising the step of administering the vaccine compositions according to the invention in combination with a chemotherapeutic agent and/or an immunotherapeutic agent and/or a cancer vaccine.

There is also provided a method of treating an individual with the above methods in order to alleliorate, cure or prophylactically treat an individual suffering from a condition affecting the immune system of the individual.

Conditions capable of being treated include, but is not limited to auto-immune dis- eases. Autoimmune diseases may be loosely grouped into those primarily restricted to specific organs or tissues and those that affect the entire body. Examples of organ-specific disorders (with the organ affected) include multiple sclerosis (myelin coating on nerve processes), type I diabetes mellitus (pancreas), Hashimotos thy- roiditis (thyroid gland), pernicious anemia (stomach), Addison's disease (adrenal glands), myasthenia gravis (acetylcholine receptors at neuromuscular junction), rheumatoid arthritis (joint lining), uveitis (eye), psoriasis (skin), Guillain-Barre Syndrome (nerve cells) and Grave's disease (thyroid). Systemic autoimmune diseases include systemic lupus erythematosus and dermatomyositis.

Other examples of hypersensitivity disorders capable of being treated in accordance with the present invention include asthma, eczema, atopical dermatitis, contact dermatitis, other eczematous dermatitides, seborrheic dermatitis, rhinitis, Lichen planus, Pemplugus, bullous Pemphigoid, Epidermolysis bullosa, uritcaris, an- gioedemas, vasculitides, erythemas, cutaneous eosinophilias, Alopecia areata, atherosclerosis, primary biliary cirrhosis and nephrotic syndrome. Related diseases include intestinal inflammations, such as Coeliac disease, proctitis, eosinophilia gastroenteritis, mastocytosis, inflammatory bowel disease, Crohn's disease and ulcerative colitis, as well as food-related allergies. Methods for performing Quality control and strain development

In yet further embodiments there is provided a method for determining the probiotic potential of a microorganism, said method comprising the steps of

i) determining the relative production and/or amount in the microorganism of a microbial cell surface polypeptide the intracellular equivalent of which is selected from glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof, and

ii) comparing the relative production of the microbial cell surface polypeptide to the production in L. plantarum 299v of a cell surface polypeptide having the same activity under substantially identical growth conditions.

There is also provided a method for optimising the probiotic potential of a microbial cell, said method comprising the steps of

i) obtaining a microbial cell the probiotic potential of which is to be optimised, and

iii) optimising the production and/or secretion and/or modification in the microbial cell of a polypeptide selected from the group consisting of glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof, and

thereby optimising the probiotic potential of the cell.

Examples

Example 1 : Isolation of major surface located proteins from Lactobacillus plantarum strain 299v Lactobacillus plantarum strain 299v was pre-cultivated on Man-Rogosa-Sharpe

(MRS) (Oxoid, Basingstoke, Hampshire, England) agar plates for 48 hours at 37° C. Glass tubes containing 15 mL MRS medium was subsequently inoculated with pre- cultured cells of L. plantarum 299v and left overnight at 37° C without aeration.

The L. plantarum 299v culture (OD₆₀o of 6.5) was harvested by centrifugation (4000 x g/4°C) and washed once in PBS buffer (136.9 mM sodium chloride, 2.68 mM potassium chloride, 8.1 mM disodium hydrogen phosphate, 1.47 mM potassium dihydrogen phosphate). The pellet was resuspended in PBS to a final optical density at 600 nm of 65. The suspension was incubated statically at 37° C for 3 hours, and proteins released from the outer cell surface of L. plantarum 299v into the PBS buffer was analysed by SDS-PAGE.

Samples were analysed by SDS-PAGE using 12 % Invitrogen NuPage^™ BIS-TRIS gels (Invitrogen, San Diego, Calif.), gelmatrix: acrylamide/bis-acrylamide, size: 8x8 cm², 1 mm gel thickness. The running buffer used was a 2-(N- morpholino)ethanesulfonic acid (MES) SDS buffer. Samples for SDS-PAGE analysis were prepared by mixing 22.5 μl sample, 12.5 μl NuPage^™ lithium dodecyl sulphate (LDS) sample buffer (Invitrogen) and 5 μl NuPage^™ sample reducing agent (Invitrogen). The mixture was incubated at 56°C for 20 min prior to analysis. 20 μL of the sample was analysed in parallel with 10 μL of a Precision Plus Protein^M stan- dards, All Blue molecular weight standard (Bio-Rad Laboratories, CA, USA). Gels were run for 40 min at 200 V. Protein-bands were visualised by Coomassie blue staining (Bio-Safe™ Coomassie, Bio-Rad Laboratories). SDS-PAGE analysis of outer surface associated proteins revealed one distinct band of approximately MW 38.5 kDa and two faint bands of approximately MW 51 kDA and 100 kDA (Fig. 1).

Example 2: Analysis of released surface proteins by mass spectrometry Bands visualised by Coomassie blue staining were excised from the gel and in-gel digested with trypsin. The excised gel bands were transferred to 1.5 mL eppendorf microcentrifuge tubes and incubated with 200 μl ultra pure water. After 10 min of incubation the gel pieces were transferred to a clean glass plate, cut into small pieces (approximately 1 mm³) and rinsed with 200 μl ultra pure water in eppendorf microcentrifuge tubes. The gel pieces were rinsed, shrunk by adding 30 μl 100% acetonitrile, and subsequently dried in a vacuum centrifuge. Then the gel pieces were swollen in a digestion buffer, 50 mM NH₄C0₃, 12.5 ng/μl trypsin (Promega, Madison, Wl, USA, modified, sequencing grade) in an ice-cold water-bath. After 45 min the supernatant was removed and replaced with 30 μL 50 mM (NH₄)₂C0₃ buffer. Enzymatic cleavage was performed overnight at 37° C. The protein digests were loaded on POROS R2 (Applied Biosystems, Calif., USA) reverse phase col- umn material prepared in GELoader tips (Eppendorf, Hamburg, Germany) prepared as described (Kussmann et al.; 1997). The column was washed with 50 μL formic acid and the bound peptides were eluted directly into a nanospray needle (Protana, Odense, Denmark) with 2 μL of a 50% MeOH-1 % formic acid solution. The digestion mixtures were analysed by nanoelectrospray mass spectrometry (nano ESI MS) using a Q-Tof mass spectrometer (Micromass, Manchester, United Kingdom). Selected peptides were sequenced by nanoelectrospray tandem mass spectrometry (nano ESI MS/MS). The resulting peptide sequences were used to search for short nearly exact matches in the non-redundant Blast protein-protein (www.ncbi.nlm.nih/gov/BLAST/) sequence database, enabling identification of the proteins.

Example 3: Identification of surface proteins from 1. plantarum

SDS-PAGE analysis of outer surface associated proteins revealed one distinct band of approximately MW 38.5 kDa and two faint bands of approximately MW 51 kDA and 100 kDA (Fig. 1). The three protein bands were excised and in-gel digested with trypsin. The resulting tryptic digests were analysed using nano ESI MS and peptides of interest were selected and sequenced by nano ESI MS/MS analysis. This is shown in Fig. 2 with the tryptic digest of the band at MW 38.5 kDa as an example. Fig. 2a shows the ESI MS analysis of the tryptic digest. The double charged peptide at m/z 918.96 Da (Fig. 2b) was sequenced by ESI MS/MS analysis (Fig. 2c). The peptides selected for nano ESI MS/MS analysis, the resulting sequences and protein protein identities from the MS analysis of the tryptic digest of the protein bands at MW 38.5 and 51.0 kDa are summarised in Table 1.

Table 1. Peptide sequences and protein identifications/assignments from proteins derived from one-dimensional SDS-PAGE separation of cell surface associated proteins. The bands were in-gel digested with trypsin and selected peptides sequenced by ESI MS/MS analysis. Proteins were identified using the non-redundant Blast protein-protein (www.ncbi.nlm.nih/oov/BLAST/) sequence database.

Example 4: Cloning of the gene encoding glyceraldehyde 3 phosphate dehydrogenase (GAPDH) from Lactobacillus plantarum 299v

The result of the blastp analysis described in example 3 clearly identified the analyzed surface protein as GAPDH from L. plantarum 299v.

Two degenerate primers

GPD-Nterm (INGFGRIG (SEQ ID NO:21)) (5' ATHAAYGGNTTYGGNMGNATHGGN

3¹ (SEQ ID NO:22)) and

GPD-mid REV (TGAAKAVGK (SEQ ID NO:23)) (5' YTTNCCNACNGCYTTNGC

NGCNCCNGT 3' (SEQ ID NO:24))

which have been used for PCR amplification of the gapdh gene from Mucor circi- nelloides (Wolff & Arnau; 2002) were used to amplify an internal 0.7 kb fragment of the gapdh gene from L. plantarum 299v. The following PCR profile was used to amplify the 0.7 kb gapdh fragment: 94 °C 2 min

30 cycles

72 °C 7 min

Total DNA from L. plantarum 299v was used as template. A standard PCR reaction condition with the Taq DNA polymerase (Invitrogen, Carlsbad, Calif.), expect that the concentration of each primer was 5 μM, was used to amplify the gapdh gene. A PCR product of the expected size was purified from an agarose gel using the GFX™ PCR DNA and gel band purification kit (Amersham Biosciences Corp., Pis- cataway, NJ) and inserted into the pCR^®2.1-TOPO vector (Invitrogen, Carlsbad, Calif.). The DNA sequence of the insert was determined using an ALFexpress DNA sequencer and universal M13 forward and reverse primers. The remaining part of the gapdh gene and the adjacent DNA regions were amplified by consecutive rounds of inverse PCR (Ochman et al.; 1988). In short, total DNA of L. plantarum 299v was digested with either EcoRI or Hindlll and religated in a large volume. PCR amplifications were carried out using DNA primers based on DNA sequences that were obtained during the successive rounds of inverse PCR. The polynucleotide sequence and the polypeptide sequence of gapdh are shown in Figs. 3 and 4. The gapdh gene of 299v encodes a 340 aa protein. A blastp similarity search showed that gapdh protein of L. plantarum is 96% (low complexity filter on) identical to the gapdh gene from L. plantarum WCFS1 (Ace. No. CAD63377) and 81% (low complexity filter on) identical to a hypothetical protein from Lb. gasseri (Ace. No. ZP_00047412.1).

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH; EC 1.2.1.12) is an enzyme of the glycolytic pathway, in which it catalyzes the oxidative conversion of D- glyceraldehyde 3-phosphate and phosphate to 3-phospho-D-glyceroyl phosphate using NAD⁺ as an acceptor.

Example 5: Cloning of the gene encoding phosphoglycerate kinase (PGK) from Lactobacillus plantarum 299v During the course of cloning and sequencing of the gapdh gene we identified the 5' end of the gene encoding phosphoglycerate kinase (PGK; EC. 2. 7. 2. 3.). In the glycolytic pathway, PGK catalyses the phosphotransferase reaction between 3- phospho-D-glyceroyl phosphate and ADP to produce ATP and 3-phospho-D- glycerate. The pgk gene is located immediately downstream of the gapdh gene of L. plantarum 299v. The remaining part of the pgk gene was cloned by consecutive rounds of inverse PCR as described above. The polynucleotide sequence and the polypeptide sequence of pgk are shown in Figs. 3 and 5. The pgk gene encodes a 400 aa protein. A blastp similarity search showed that the pgk protein from L. plan- tarum is 99% (low complexity filter on) identical to the pgk gene from L. plantarum

WCFS1 (Ace. No. CAD63378) and 74% (low complexity filter on) identical to the pgk gene from Lb. delbrueckii (Ace. No. CAD56495).

Example 6: Cloning of the gene encoding triosephosphate isomerase (TPI) from Lactobacillus plantarum 299v

During the course of cloning and sequencing of the pgk gene we identified the 5' end of the gene encoding triosephosphate isomerase (TPI; EC. 5. 3. 1. 1.). The tpi gene is located immediately downstream of the pgk gene in L. plantarum 299v. The remaining part of the tpi gene was cloned by consecutive rounds of inverse PCR as described above. The polynucleotide sequence and the polypeptide sequence of tpi are shown in Figs. 3 and 6. Tpi encodes a 252 aa protein. A blastp similarity search showed that the tpi protein from L. plantarum is 99% (low complexity filter on) identical to the tpi gene from Lactobacillus plantarum WCFS1 (Ace No. CAD63379) and 71% (low complexity filter on) identical to the tpi gene from L. delbrueckii (Ace. No. 032757).

TPI catalyzes the isomerisation of D-glyceraldehyde 3-phosphate to glycerone phosphate and vice versa in the glycolytic pathway.

Example 7: Cloning of the gene encoding enolase (eno) (phosphoenolpyru- vate hydratase) from Lactobacillus plantarum 299v

The result of the blastp analysis described in example 3 obviously identified the analysed surface protein as enolase from L. plantarum 299v. Enolase (2-phospho- D-glycerate hydrolyase; EC 4.2.1.11) catalyses the dehydration of 2- phosphoglycerate to phosphoenolpyruvate. Based on the amino acid sequences described in example 3 we designed two degenerate primers Eno-Deg1 (5' GTNGARGTNGARYTNTAYACNGA 3' (SEQ ID NO:25)) and Eno-Deg2 (5' RTTNGTNACRAANARRTCRTCNCC 3' (SEQ ID NO:26)). Eno-Deg1 corresponds to the peptide sequence VEVELYTES (SEQ ID NO:27), which, is found in the amino terminal of the enolase whereas Eno-Deg2 corresponds to the peptide sequence GDDLFVTN (SEQ ID NO:28) located approximately 300 amino acids downstream of the start codon of the enolase. The following PCR profile was used to amplify an internal 0.9 kb enolase fragment: 94 °C 2 min

10 cycles

10 cycles

10 cycles

94 °C 30 sec

15 cycles

Total DNA from L. plantarum 299v was used as template. A standard PCR reaction condition with the Taq DNA polymerase, expect that the concentration of each primer was 5 μM, was used to amplify the internal fragment of the enolase gene. A PCR product of approximately 0.9 kb was purified from an agarose gel using the GFX™ PCR DNA and gel band purification kit (Amersham Biosciences Corp., Pis- cataway, NJ) and inserted into the pCR^®2.1-TOPO vector. The DNA sequence of the insert was determined using the ALFexpress DNA sequencer and universal M13 forward and reverse primers. The remaining part of the enolase gene and the adjacent DNA regions were amplified by consecutive rounds of inverse PCR as described above. Using this strategy we identified the 3' end of triosephosphate isomerase gene upstream of the 5' end of the enolase gene, which consequently re- vealed that the four genes are placed in the order gapdh-pgk-tpi-eno and suggests that the genes are clustered in an operon.

The polynucleotide sequence and the polypeptide sequence of enolase are shown in Figs. 3 and 7. Enolase of 299v encodes a 442 aa protein. A blastp similarity search showed that enolase protein of L. plantarum 299v is 98% (low complexity filter on) identical to the phosphopyruvate hydratase from L. plantarum WCFS1 (Ace No. CAD63380) and 77% identical to a hypothetical protein from Lb. gasseri (Ace. No. ZP_00047409).

Example 8: Cloning of the gene encoding a putative regulator of the gapdh- pgk-tpi-eno operon from Lactobacillus plantarum 299v

During the course of cloning and sequencing of the gapdh gene we identified the 3' end of the gene encoding a putative glycolytic regulator. The regulatory gene is located upstream of the gapdh gene of L. plantarum 299v. The remaining part of the regulator gene was cloned by consecutive rounds of inverse PCR as described above. The polynucleotide sequence and the polypeptide sequence of the regulator are shown in Figs. 3 and 8. The glycolytic regulator encodes a 343 aa protein. A blastp similarity search showed that the glycolytic regulator from L. plantarum 299v is 93% (low complexity filter on) identical to the central glycolytic regulator from L. plantarum WCFS1 (Ace. No. CAD63376) and 45% (low complexity filter on) identical to a hypothetical transcriptional regulator from Listeria innocua (Ace. No. NP_471884).

Localization of genes:

Glycolytic Regulator (SEQ ID NO:9):

Start position: 187

Stop position: 1218 (stop codon)

Gapdh (SEQ ID NO:1 ):

Start position: 1285

Stop position: 2307 (stop codon)

Pgk (SEQ ID NO:3): Start position: 2428 (Leucine) Stop position: 3630 (stop codon)

Tpi (SEQ ID NO:5): Start position: 3657 (Valine)

Stop position: 4415 (stop codon)

Eno (SEQ ID NO:7): Start position: 4497 Stop position: 5825 (stop codon)

Example 9: GAPDH activity on the surface of L. plantarum 299v

Detection of GAPDH activity in untreated culture samples As described in Example 3, GAPDH appeared as a major band when proteins released from the cells in PBS were analyzed by SDS-PAGE. To test whether the surface-located GAPDH protein was enzymatically active, we performed activity assays on untreated culture samples. NAD and NADH, which take part in the GAPDH reaction, are not taken up by intact cells. Therefore, the intracellular GAPDH will not be detected without prior lysis or permeabilization of the cells. We refer to the activity measured in untreated culture samples as "extracellular/surface located".

GAPDH assay was performed with a modification of the procedure described by Gil- Navarro et al. (1997). 16 μL sample was mixed in a 1 cm light path cuvette with reaction mixture to a final volume of 0.8 mL. The reaction mixture contained 1 mM

NAD and 2 mM glyceraldehyde 3-phosphate in 0,1 mM dithiothreitol, 5 mM EDTA,

50 mM sodium phosphate and 40 mM triethanolamine, adjusted to pH 8.6 with HCI.

A mixture without glyceraldehyde 3-phosphate was used for control reactions. Activ- ity of GAPDH causes an increase in absorbance at 340 nm (A₃₄₀) as NADH is formed during the reaction. The reaction took place at room temperature (25°+/-

3°C). A₃₄₀ was measured at intervals throughout a total incubation time of 5-180 min, depending on the activity of the sample. For each sample, the slope of A₃₄₀ versus time was calculated, and the slope of the control reaction without glyceralde- hyde 3-phosphate was subtracted. Further correction was made for A₃₄₀ decrease in reaction mixture with buffer added instead of sample. To obtain the activity in units/mL, the corrected slope was multiplied by the reaction volume and divided by the sample volume and the millimolar extinction coefficient of NADH, 6.3 (mM-cm)^"1. 1 unit of GAPDH will catalyse production of 1 μmole 1 ,3-diphosphoglyceric acid per minute.

L. plantarum 299v was grown without shaking or aeration at 30°C in MRS broth (De Man et al.; 1960) prepared from dehydrated medium (OXOID Ltd., Basingstoke, Hampshire, England). The extracellular/surface-located GAPDH activity was found to be low during active growth of the cultures, but increased in stationary phase to above 0.05 u/mL. Thus, the extracellular/surface-located GAPDH appears to be growth phase dependent.

Development of the sMRS medium In further experiments we obtained low and variable results, which appeared to be related to the use of different batches of MRS broth. This indicates that the dehydrated MRS broth contains varying amounts of components that directly or indirectly influence the amount of surface-located GAPDH.

To improve the reproducibility of surface-located GAPDH activity, we composed a medium designated sMRS. In composition this medium (shown in Table 9-1) is similar to MRS, but the concentrations of hydrated salts (like sodium acetate tri- hydrate) have been increased to correct for the weight of water, and the yeast extract concentration has been increased 25%. Furthermore, the procedures for preparation differ. The dehydrated MRS broth contains all the final components, which are dissolved in water and autoclaved together. For preparation of sMRS, some components are sterilised separately to avoid breakdown or precipitation of important nutrient factors:

• A basal medium consisting of peptones and meat extract are autoclaved with Tween 80, salts, acetate and citrate.

• Glucose and phosphate buffer are autoclaved as separate stock solutions.

• Yeast extract is filter-sterilised (0.22 μm pore size filter).

• The final medium is mixed aseptically, when the autoclaved stock solutions have cooled down. Both media were stored at 2-8°C. Fig. 9 shows the results from parallel cultures in sMRS and in a low-yielding batch of MRS. GAPDH assays were performed in untreated culture samples taken in late growth phase (OD₆₀o 7.5-8.6) and again 22 hours later in stationary phase (OD₆₀o 12-12.5). Even after such prolonged incubation, the GAPDH activity in the MRS cultures was below 0.03 u/mL. In the sMRS cultures, GAPDH activity followed the pattern observed earlier for some other batches of MRS, i.e. increasing activity in stationary phase. Using sMRS, we consistently obtained high activities in untreated samples from stationary phase cultures. Therefore, sMRS was used in all subsequent experiments on the surface-located GAPDH, unless otherwise stated.

Table 9-1

Influence of growth conditions and incubation time Cultivation of L. plantarum 299 at 30°C and 37°C resulted in comparable activities of extracellular/surface-located GAPDH, e.g. 0.34 u/mL at 30°C and 0.30 u/mL at 37°C for parallel stationary phase cultures. Unless another temperature is specified, cultivation temperature was 30°C.

The ratio between the culture surface and the volume of the cultivation medium was found to influence the amount of GAPDH activity located extracellulariy and/or on the cell surface. This was demonstrated by growing L. plantarum 299v in two screw- capped 15 mL tubes containing 5 mL sMRS medium. Incubating one tube horizontally and the other in an upright position resulted in a remarkable difference in extra- cellular/surface-located GAPDH activity, as shown in Table 9-2. The difference is probably connected to the exchange of oxygen, carbon dioxide and/or volatile metabolites between headspace and culture liquid. If nothing else is stated, the Lactobacillus strains were cultivated in closed tubes or flasks in upright position and with a medium to headspace ratio of at least 0.25.

Table 9-2. GAPDH activity (u/mL) in untreated culture samples of L. plantarum 299v

In sMRS-cultures, extracellular/surface-located GAPDH of L. plantarum 299v in- creased with incubation time up to 3 days as shown in Fig. 10. In contrast, Lactobacillus plantarum WCFS1 (Kleerebeezem et al.; 2003) showed no or very low activity (<0.03 u/mL) during the entire incubation period.

Elution of GAPDH from the cell surface As expected from the analysis of surface proteins by SDS-PAGE the major part of the extracellular/surface-located GAPDH activity remained attached to the cells during harvest but was easily released by washing the cells as follows: Culture samples were harvested by centrifugation at 4°C for 5-7 min at 14,000 x g. The cells were resuspended in an equal volume of PBS buffer at room temperature and har- vested again. The washed cells were resuspended in the same volume of PBS and kept on ice. GAPDH activity was determined in culture supernatant, in supernatant from washing in PBS and in the suspension of washed cells. Fig. 11 shows the results from washing cells from a stationary phase culture of L. plantarum 299v. 89% of the activity was found in the supernatant from washing in PBS; this fraction will in the following text be referred to as ESP (Eluted Surface Proteins).

Elution of GAPDH was dependent on pH; adhesion of GAPDH to the cells was not affected by washing in a pH 4.5 buffer of a composition similar to PBS (0.14 M sodium chloride and 0.01 M potassium dihydrogen phosphate), (data not shown). Thus, adhesion of GAPDH to the cell surface is allowed at low pH, which is the natural environment of Lactobacillus. Specific surface-location of GAPDH

In order to investigate whether the surface-located GAPDH activity was a result of cell lysis, the intracellular enzymes L- and D-lactate dehydrogenase (LDH) were used as indicators of cell lysis. The assay, which measures the sum of the L-LDH and D-LDH activities, was performed by a procedure that is analogous to the GAPDH assay. In the case of LDH, the reduction of pyruvate at the expense of NADH was measured as a decrease of A_{3 0} with time. The reaction mixture consisted of 10 mM sodium pyruvate and 0.2 mM NADH in 63.2 mM potassium dihydrogen phosphate and 3.5 disodium hydrogen phosphate (Bernard et al.; 1994).

To be able to compare extracellular and intracellular activities, washed cells were lysed by ultrasound treatment with glass beads: 500 μL of cell suspension in PBS was mixed with an equal volume of glass beads (Sigma G 9143, 212-300 μm) and subjected to ultrasound at maximum effect in an ultrasound bath (Elma Transsonic Digital S) with ice for a total of 15 min. Cells and glass beads were mixed at 1-2 minute intervals by inversion of the tubes. The resulting lysate represent the intracellular fraction plus the proteins still attached to the cell surface after washing. The latter can be measured in the suspension of washed cells, and in the case of GAPDH and LDH, the activities were low (see below). For simplicity, we will refer to the GAPDH and LDH activities measured in the lysate as "intracellular".

LDH and GAPDH assays were performed on the lysate, culture supernatant, ESP fraction, and washed cells suspension of a stationary phase L. plantarum 299v culture. The results are shown in Fig. 12. The culture supernatant and the suspen- sion of washed cells contained only negligible amounts of LDH and GAPDH activities. In the lysate, both activities were high (3 u/mL of LDH and 1 u/mL of GAPDH). The ESP fraction contained a high activity of GAPDH (0.37 u/mL) and, surprisingly, also a significant amount of LDH activity (0.09 u/mL). This could indicate that LDH, like GAPDH, was presented on the cell surface in the stationary phase culture. However, there is a clear difference between the distribution ratios of the two activities between the ESP fraction and intracellular fraction (Table 9-3). If both LDH and GAPDH had been released by lysis, the ratios would be expected to be more equal. This indicates that GAPDH in the ESP fraction is transported to the cell surface by an alternative, specific mechanism, resulting in the presence of stable GAPDH as a major protein species on the surface of Lactobacillus. Table 9-3

Development of a procedure for cultivation and GAPDH-testing in microtiter plates To be able to screen a larger number of strains for the presence or absence of extracellular/surface-located GAPDH, we developed a procedure for growing and assaying in microtiter plates. Growing the microtiter cultures in an oxygen-depleted, carbon dioxide-enriched atmosphere allowed display of extracellular/surface-located GAPDH activity in spite of the low volume to surface ratio in the wells.

The Lactobacillus strains were inoculated in 150 or 200 μL sMRS in 300 μL wells in sterile microtiter plates (96 well polystyrene plates with round-bottom wells, Nunc a/s, Roskilde, Denmark). The microtiter plates were incubated at 30°C with Anaerocult A or Anaerocult IS (Merck, Darmstadt, Germany) in anaerobic jars or sealed polyethylene bags or in an atmosphere of 10% H₂, 10% C0₂, 80% N₂ in a MK3 Anaerobic Work Station (DW Scientific, Shipley, West Yorkshire, UK). After 40- 48 hours at 30°C, the culture in each well was mixed with a pipette and a sample of 5 μL was transferred to the corresponding well in another microtiter plate where it was mixed with 120 or 150 μL reaction mixture. The reaction mixture contained 1 mM NAD and 2 mM glyceraldehyde 3-phosphate in 0.1 mM dithiothreitol, 5 mM EDTA, 50 mM sodium phosphate, and 40 mM triethanolamine, adjusted to pH 8.6 with HCI. After incubation at ambient temperature for 30-120 min, the plates were photographed on a UV trans-illuminator. Wells with GAPDH activity were identified by their yellow fluorescence (450 nm). The microtiter plate-based GAPDH assay was used for screening purposes as described in example 14 and 15.

Example 10: Expression and purification of recombinant PGK, GAPDH and ENO and generation of antibodies.

The coding regions of the PGK, GAPDH and ENO encoding genes were amplified from the genome of Lactobacillus plantarum 299v by PCR. The PCR was performed on the three individual genes using total DNA from L. plantarum 299v and three sets of primers containing engineered BamHI (GGATCC) and Xhol (C7^"CG>4G) recognition sites:

The resulting PCR products were 1225 bp comprising the pgk gene, 1351 bp comprising the eno gene and 1022 bp comprising the gapdh gene and contained the translation start site (ATG) and the stop codon (TAA) of the each gene. The DNA fragments were BamHI/Xhol-digested and cloned into the same sites of the pGEX- 4T-3 (Pharmacia) expression vector. The ligation mixtures were transformed into E. coli DH10 (Invitrogen, Carlsbad, CA, USA) according to standard procedures. In the pGEX-4T-3 system the recombinant PGK, GAPDH and ENO are produced as a fusion protein with the 26 kDa glutathione-S-transferase (GST) polypeptide. Following IPTG induced expression the PGK, GAPDH and ENO fusion proteins were purified from the E. coli extracts. However, to avoid the direction of recombinant fusion proteins into insoluble inclusion bodies, the procedure for induction and expression were optimised as follows. Overnight E. coli cultures were diluted 50 times in 100 mL fresh LB medium containing 100 μg/mL ampicillin and were incubated for 2 h at 37°C in large 1000 mL flasks at 200 RPM. The temperature was lowered to 25°C and after 0.5 h IPTG was added to a final concentration of 0.1 mM. Expression was allowed overnight at 25°C and 200 RPM. Harvested cells were washed in 5 mL

PBS and sonicated. Lysates containing the GST fusion protein were added to the Glutathione Sepharose 4B Redipack column and eluted with glutathione according to the manual of the supplier (Amersham Biosciences). Antibodies were raised against the PGK, GAPDH and ENO fusion proteins respectively, by immunising rabbits three times with 100 μL 1 mg/mL of recombinant protein. The antisera were evaluated by western blot analysis using the following protocol. Pre-cast 14% Tris- glycine gels from Invitrogen were used for SDS-PAGE, and proteins were blotted to Invitrogen type 2 nitrocellulose membranes using an Xcell II blot module from Invitrogen. Membranes were blocked with a solution of 3% skim milk powder. As pri- mary antibody either anti-GAPDH, anti-PGK or anti-ENO raised in rabbits was used.

As secondary antibody alkaline phosphatase-conjugated goat anti-rabbit antibody from Dakocytomation (Glostrup, Denmark) was used. Blots were developed using NBT/BCIP tablets from Roche Diagnostics (Penzberg, Germany). Fig. 13 shows the cross reaction against the GAPDH fusion protein and the wild type GAPDH protein from L. plantarum 299v.

Example 11 : Extracellular/surface-located activity of Lactobacillus spp.

To assess how frequently GAPDH surface display occurs among Lactobacillus species, we screened the extracellular/surface-located activity of 23 strains from the

Lactobacillus species L. plantarum, rhamnosus, gasseri, casei and paracasei. Each strain was inoculated with a small amount of material (< 50 μL) from a frozen cryo- culture into 5 mL of sMRS medium and incubated in a 15 mL screw-capped tube at 30°C for at least 45 hours. Strains that had not developed a dense culture in 2 days were incubated for one additional day. OD₆₀o was measured and GAPDH and LDH activity was determined in untreated culture samples. For detection of GAPDH and ENO by Western Blotting, ESP-fractions were prepared from the cultures and frozen for later analysis.

Each strain was tested twice in independent cultures on different days. Fig. 14 shows the extracellular/surface-located activities as a mean of the result from the two tests. Six of the nine L plantarum strains, 299v, ATCC14917, B, 299, P, and Q, showed similar activities of GAPDH (average above 0.2 u/mL) and LDH (average below 0.02 u/mL). L. plantarum ATCC8014 differs by a higher LDH activity. L. plantarum C had a lower GAPDH activity (0.15 u/mL) and an LDH activity below

0.02 u/mL. As observed earlier, strain WCFS1 diverges by showing low activities of both enzymes. L. rhamnosus strains ATCC7469, E, R, GG, and T varied considerably with respect to extracellular/surface-located GAPDH activity. Only two of the strains, E and T, showed activities that were comparable with those of L. plantarum 299v. LDH was low in all tested strains of the L. rhamnosus species. Only the L gasseri AA and Z showed high GAPDH/LDH ratios indicating that GAPDH is not directed to the surface by means of lysis. The other L. gasseri tested showed low GAPDH/LDH activity ratios indicating that the extracellular GAPDH activity is due to lysis. Both activities were low in the cultures of the tested L. casei strain. For L. paracasei the extracellular/surface-located GAPDH activity is lower than that of L. plantarum 299v. However, their GAPDH/LDH activity ratios show specific transport of GAPDH to the cell-surface of L paracasei. The data of the GAPDH/LDH activity ratios (Fig. 14) correlates with the Western blot of the ESP fractions of the cultures (Fig. 15). Furthermore, high activities and amounts of surface located GAPDH correlates with high amounts of ENO at the surface (Fig. 15). This suggests a similar mechanism of transport of GAPDH and ENO to the cell-surface of Lactobacillus species. In conclusion, the surface display of GAPDH and ENO is a widespread phenomenon among Lactobacillus species.

Example 12: Immobilized binding assay.

The role of GAPDH and ENO proteins as an adhesin was evaluated by immobilised binding assay using components of the epithelial lining. GAPDH and ENO were eluted from the surface of L. plantarum 299v using the procedure described in example 9. Subsequently, the eluted surface proteins (ESP) were concentrated 20 times using 4 mL spin columns with cut-off at MW 10 kDA (Millipore, MA, USA). Maxisorb microtiter wells (Nunc, Roskilde, DK) were coated with 20 μg/mL human plasma fibronectin (Sigma-Aldrich, St. Louis, MO), 20 μg/mL porcine mucin (Sigma- Aldrich) or 20 μg/mL human plasminogen (American Diagnostica, CT, USA). Wells coated with 0.5% bovine serum albumin (BSA) alone served as negative control. Immobilisation was allowed for 3 h at 37°C with lid on. Unbound components were removed by rinsing the wells five times with PBS-0.2% Tween 20. Free sites in the wells were blocked with 0.1% BSA containing 0.2% Tween 20 for 30 min at 500 RPM. Excess BSA was removed by a PBS-0.2% Tween 20 wash. A 2-fold dilution series of the 20 times concentrated ESP were titrated onto the wells followed by incubation for 1 h at 37°C. Plates were washed in PBS-0.2% Tween 20 and bound protein were detected after overnight incubation at 4° C and 500 RPM with a 1 :1000 dilution of rabbit anti-GAPDH or anti-ENO serum diluted in PBS containing 0.1% BSA and 0.2% Tween 20. After five further washes with PBS-0.2% Tween 20, a 1 :4000 dilution of goat anti-rabbit AP-conjugated antiserum in PBS with 0.1 % BSA and 0.2% Tween 20 were added to the wells and incubated at room temperature for

1.5 h and 500 RPM. After five further washes in PBS containing 0.1% BSA and 0.2% Tween 20, wells were washed in H₂0. Finally, bound AP-conjugated antibodies were detected by addition of p-nitrophenyl phosphate (Sigma-Aldrich) in 1 M diethanolamine, 0.5 mM MgCI₂ for 15 min at room temperature. Plates were read in an ELISA plate reader. As shown in Fig. 16 GAPDH binds to immobilised fibronectin in a concentration dependent matter. Also, ENO binds specifically to fibronectin and as showed using GAPDH it has low nonspecifically binding to the control protein BSA (Fig. 17). The specific affinity of GAPDH and ENO towards plasminogen is significant and the binding curves display saturation at lower GAPDH and ENO concentrations than that towards fibronectin (Fig. 18 and Fig. 19). Thus GAPDH and ENO binds more strongly to plasminogen than to fibronectin. Furthermore ENO shows a higher affinity to plasminogen than that of GAPDH. The adhesion properties of GAPDH and ENO to mucin were also investigated. These results show that GAPDH specifically binds to immobilised mucin (Fig. 20). However, the affinity of ENO to mucin is low and not significant (Fig. 21).

The conducted binding studies suggest a role of extracellular located GADPH and ENO as adhesion-components during adherence and colonization of L. plantarum

299v.

Example 13: Role of surface proteins in dendritic cell stimulation

Dendritic cells play an essential immunoregulatory role in the Th1 , Th2, and Th3 cell balance and are present throughout the gastrointestinal tract. Thus, dendritic cells may be targets for modulation by gut microbes, including ingested probiotics. It has been shown that incubation of dendritic cells with killed Lactobacillus induces a strain dependent cytokine production. In this example the eluted surface proteins from the surface of L. plantarum 299v were tested for immunomodulating potential. Bone marrow cells were isolated from the femora and tibiae from two female

C57BL/6 mice, 8-12 weeks old (Biocentrum-DTU, DK), which were removed and stripped of muscles and tendons. After soaking the bones in 70% ethanol for 2 min and rinsing in PBS, both ends were cut with scissors and the marrow was flushed with PBS using a 27-gauge needle. Cell clusters were dissociated by repeated pipetting using a 10 mL serological pipette. The resulting cell suspension was cen- trifuged for 10 min at 300 x g and washed once in PBS.

Cells were resuspended in RPMI 1640 (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 4 mM L-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, 50 μM 2-Mercaptoethanol, 10% (v/v) heat-inactivated FBS (Atlanta Biologicals, Nor- cross, GA, USA), and 15 ng/mL murine GM-CSF. GM-CSF was added as 5-10% (v/v) culture supernatant harvested from a GM-CSF-producing cell line (GM-CSF transfected Ag8.653 myeloma cell line) and GM-CSF was quantified using a specific ELISA kit (BD PharMingen, San Diego, CA).

To enrich for dendritic cells, 10 mL of cell suspension containing 3x10⁶ leukocytes was seeded in bacteriological petri dish (day 0) and incubated for 8 days at 37°C in 5% C0₂. An additional 10 mL of freshly prepared medium was added to each plate on day 3. On day 6, 9 mL from each plate was centrifuged for 5 min at 300 x g, resultant cell pellet was resuspended in 10 mL of fresh medium, and the suspension was returned to the dish. On day 8, cells were used to evaluate effects of the ESP from L. plantarum 299v on cytokine release.

Nonadherent cells were gently pipetted from the petri dishes containing 8-day old dendritic cell-enriched cultures. The collected cells were centrifuged for 5 min at 300 x g and resuspended in medium supplemented with only 10 ng/mL GM-CSF. Cells were seeded in 48-well tissue culture plates at 1.4 x 10⁶/500 μL/well. The 20x concentrated ESP from L. plantarum 299v was then added at 100 μL/well in a series of 2 fold dilutions. The PBS alone was used as negative control. Furthermore, wells containing 100 μl supernatants of the L. plantarum 299v cultures were included. After a stimulation period of 15 h at 37°C in 5% C0₂, culture supernatants were collected and stored at -80°C until cytokine analysis. IL-10 were analyzed using commercially available ELISA kits (BD PharMingen) according to manufacturer's instructions.

As shown in Fig. 22 the ESP from L. plantarum 299v induces IL-10 production in dendritic cells in a concentration dependent matter. The lack of IL-10 induction from PBS alone (Fig. 22) or from the culture supernatants (data not shown) of L. plantarum 299v shows that a component in the ESP is responsible for the induction of IL-10. These results demonstrate that part of the immunomodulating component(s) of L. plantarum 299v is present at and non-covalently bound to the cell surface.

Example 14: High throughput screening of L. plantarum 299v mutant strains for low extracellular amounts of GAPDH

A library of random mutants of Lactobacillus plantarum 299v was generated by a modified version of the method of Ibrahim and O'Sullivan, 2000. Strain 299v was grown in MRS broth (Oxoid, Basingstoke, Hampshire, England) at 30°C for 24h. The optical density of the culture (at 600 nm) was 8.0. The culture was harvested (5000 RPM, 20°C, 10 min) and resuspended in 10 mL of 100 mM K₂HP0₄/KH₂P0₄ buffer, pH 7.5. 100 μL of the cell suspension was withdrawn, and the remaining cell sus- pension was mixed with 1 ,2 mL ethyl methanesulfonate (EMS) (Sigma Co., St.

Louis, MD, USA). Samples of the cell suspension (1 mL) was withdrawn after 15 min, 30 min, 1h, 1 h 30 min, 2h, 2h 30 min, 3h, 4h, 5h, 7h 30 min and 10h. Cells were harvested (10,000 g, 4°C, 30 sec) and washed twice in 1 mL 100 mM K₂HP0₄/KH₂P0₄ buffer, resuspended in 40 mL of pre-warmed MRS and allowed to grow at 30°C for two hours. To determine kill rates, dilutions of cultures were plated on MRS agar (Oxoid) and grown for two days at 30°C and the number of colonies was counted. Cells withdrawn before addition of EMS were not allowed to grow before plating. Ten mL 75% (v/v) Glycerol was added to cultures, and 12 aliquots (1 mL) from each culture were frozen and stored at -80°C.

If it is assumed that EMS treated cells were dividing once before plating, kill rates are:

Oh 15 min EMS treatment: (490-14.6/2)/490χ 100% = 98.5%

Oh 30 min EMS treatment: (490-1 ,28/2)/490x 100% = 99,87% 1 h EMS treatment (490-0,073/2)/490x100% = 99,993%. Mutant libraries generated by 15 min EMS treatment and 30 min EMS treatment were used in the screening for strains with lower extracellular amounts of GAPDH.

Identification of isolates with lower amounts of extracellular GAPDH Dilutions of a thawed aliquot of 299v mutants generated by 15 min EMS treatment were plated on Genetix Qtrays (Genetix, New Milton, Hampshire, UK) containing 200 mL MRS agar (Oxoid) in order to obtain 2000-3000 colonies per tray. Clones were transferred to 150 μL of sMRS in Nunc 96 microwell plates (Nunc, Roskilde, Denmark) using a Qpix colony-picking robot (Genetix). Microwell plates were incu- bated 21-27h at 30°C in a gas mixture containing 10% H₂, 10% C0₂, and 80% N₂ in a MK3 Anaerobic work station from DW scientific (Shipley, West Yorkshire, UK).

The assay for extracellular GAPDH activity was modified for microwell plates (example 9). Cultures were mixed using a multi channel pipette to resuspend precipi- tated cells, and 5 μL of the cultures were transferred to new microwell plates. The assay reactions were initiated by the addition of 150 μL reaction mixture. Plates were incubated 45 min at room temperature and photographed on an UV transil- luminator to record fluorescence of NADH at 450 nm. During incubation, the optical densities at 595 nm (OD₅₉ ) were determined using a microwell plate reader.

Photographs from plates were visually inspected and cultures resulting in lower fluorescence, indicating lower levels of extracellular GAPDH, were selected. For selected isolates, OD₅g₅ readings were examined to estimate, whether low fluores- cence was a result of poor growth or low levels of extracellular GAPDH. If low fluorescence was estimated to be due to low levels of extracellular GAPDH, then isolates were selected for further analysis. An example, showing photographs and OD₅₉₅ readings from two assay plates, is shown in Fig. 23. Based on photographs, the cultures in plate 53, well H12 and in plate 52, well D4 were selected. However, OD₅₉₅ readings revealed that the low GAPDH activity in plate 52, well H12 was due to poor growth. The culture in plate 52, well D4 grew normally, and this clone was therefore selected for further analysis.

A total of 161 microwell plates containing more than 15,000 mutants were screened. All screened microwell plates were stored at -80°C after addition of 50 μL 75% (v/v) glycerol (to each well) until the analysis of isolates were completed. Initially, 47 clones were selected. For selected clones, new assays for extracellular/surface- located GAPDH were performed as described in example 9. Nine clones displayed lower GAPDH activity in these assays and were further characterised (example 15).

In conclusion example 14 demonstrates generation of random mutants by EMS mutagenesis of L. plantarum 299v. Furthermore, 15000 mutant strains could be investigated for the presence of extracellular/surface-located GAPDH by use of a high-through-put screening method. Of the 15000 screened clones the high-through- put screening produced nine final candidates with apparent low amounts of extracellular/surface-located GAPDH.

Example 15: GAPDH and LDH activities in culture supernatants and ESP- fraction of selected isolates Overnight cultures of L plantarum 299v, L. plantarum WCFS1 , and nine selected mutants of L. plantarum 299v, were assayed for GAPDH and LDH activity in the ESP-fraction and in culture supernatants as described in example 9. The result is shown in the table below.

GAPDH and LDH activities (U/mL) in culture supernatants (SN) and ESP-fraction

Isolate 8-C8 was deselected. This mutant showed very slow growth and had no LDH activity in a cell lysate prepared as in example 9 (not shown). It was assumed to be an LDH mutant. Several of the other clones showed a high extracellular LDH activity indicating a high degree of lysis.

Isolate 149-D7 was selected for further work because this strain showed normal growth, and reproducible low GAPDH activity in culture supernatants and in ESP- fractions. Lactobacillus plantarum strain 149-D7 was deposited at the DSMZ (Deut- sche Sammlung von Mikroorganismen und Zellkulturen GmbH), and has been registered under number DSM 16241.

New activity assays were made to confirm the low GAPDH activity in culture supernatants and ESP-fractions of strain 149-D7, and to study the activity levels for other strains.

Fig. 24 shows a comparison of GAPDH and LDH activities in the culture supernatants and ESP-fractions of L. plantarum strains 299v, WCFS1 , and 149-D7. The GAPDH activity in the ESP fraction of 149-D7 is significantly lower than in equivalent fraction from the wild type 299v, indicating that the mutation in 149-D7 has affected genes involved in surface display of GAPDH.

Also shown in Fig. 24 is assay results from strains 149-D7/129 and UP102. Strain UP102 was isolated from a library of WCFS1 containing DNA fragments from L. plantarum 299v during screening for clones that displayed higher levels of extracellular/surface-associated GAPDH than the host strain WCFS1 (see example 17). Lactobacillus plantarum strain UP-102 was deposited at the DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH), and has been registered under number DSM 16240.The plasmid in strain UP102, pUP102 was transformed into strain 149-D7 to obtain the strain 149-D7/129.

The GAPDH activities of culture supernatants and ESP-fractions of strain UP102 were higher than the corresponding activities for the host strain, WCFS1 , but lower than for 299v. In contrast to 299v, approximately half the extracellular GAPDH activity was found in the culture supernatant. This shows that although pUP102 was able to increase the levels of GAPDH outside cells of WCFS1 , it did not give the host the same phenotype as 299v with respect to binding GAPDH to the cells.

The question was whether the pUP102 plasmid could also increase extracellular/surface-located GAPDH in the 299v-mutant 149-D7. As seen in Fig. 24, strain 149-D7/129 had higher GAPDH activities than 149-D7 in both culture supernatants and ESP-fractions. Although the activities did not reach the levels of strain 299v, the presence of pUP102 partially complement the mutation in 149-D7 with respect to surface display of GAPDH. A high proportion of the extracellular activity was found in the ESP fraction, indicating that the complemented 149-D7 mutant has retained the 299v wild type phenotype of binding GAPDH to the surface.

LDH activity was high in the culture supernatant of UP102, but low in culture supernatants from other strains. This indicated a higher degree of lysis in this strain. Strain 149-D7/129 also had higher LDH activity outside cells (compared to 1 9-D7), but in this case LDH adhered to cells. It is therefore possible, that some of the higher GAPDH activities seen outside cells of strain UP102 and strain 149-D7/129 were due to higher lysis. Similarly, the level of LDH outside strain 149-D7 cells was lower than the levels seen for strain 299v.

In conclusion, we have obtained a mutant of L. plantarum 299v that shows a signifi- cantly lower surface-located activity of GAPDH. Obviously, the mutation may also affect the surface-location of other proteins that are not synthesised with secretion signals, like ENO and PGK. This was investigated by immunoblotting (see example 16). The mutant will be useful in investigation of the role of GAPDH in the strains adhesive properties and its ability to colonise and stimulate the host immune sys- tem. Furthermore, complementation studies with the mutant as described above can be used to isolate the genes involved in surface display of GAPDH.

Example 16: Immuno-detection of GAPDH, ENO and PGK from selected mu- tants of 299v.

In order to confirm the results obtained in activity assays, SDS-PAGE and immunoblotting was also used to evaluate levels GAPDH in cell extracts, ESP (eluted surface proteins) and culture supernatants. ESP and culture supernatants were prepared as described (Example 9). Cell ex- tracts were prepared as follows: Equal amounts of cells, glass beads (from Sigma,

106 μm and finer) and PBS buffer were mixed. The cells were disrupted using a Fastprep FP120 from Qbiogene (Carlsbad, CA, USA) in three cycles at maximum speed for 25 seconds followed by cooling on ice. Western blot of cell extracts, ESP- fractions, and culture supernatants from strains 299v, WCFS1 , and the selected mutant, 149-D7 were prepared as described in example 10. The volume loaded on gels corresponds to 10 μL culture for the cell extracts, 1 μL culture for the ESP- fraction and 15 μL culture for supernatants. The western blots are shown in Fig. 25. The lower amounts of GAPDH in the ESP-fraction and culture supernatant of strain 149-D7, compared to strain 299v, are clearly seen. A Coomassie stained gel loaded with ESP-fractions did also demonstrate a reduced amount of GAPDH on the surface of strain 149-D7.

Proteins in culture supernatants and ESP-fractions (surface proteins) from the L. plantarum strains 299v, WCFS1 , 149-D7, 149-D7/129 and UP102 were separated by SDS-PAGE and blotted onto nitrocellulose membranes as described above.

Loaded sample volumes corresponding to 150 μL for culture supernatants and 10 μL for ESP-fractions. Three blots were prepared, and as primary antibodies were used anti-GAPDH, anti-ENO, and anti-PGK, respectively. Alkaline phosphatase- conjugated goat anti-rabbit antibodies from Dako Cytomation were used as secon- dary antibodies. Blots were developed using NBT/BCIP tablets from Roche Diagnostics. The results are shown in Fig. 26. The amounts of GAPDH, ENO and PGK were lower in culture supernatants and in ESP-fractions of strain 149-D7 compared to strain 299v. However, the levels of all three proteins were even lower for strain WCFS1. Strain UP102, described in example 18 had higher levels of all three pro- teins in both culture supernatants and at cell surfaces compared to the host strain WCFS1. The levels of GAPDH, ENO and PGK were also higher for strain 149- D7/129 than for strain 149-D7. This confirms the results from activity assays for GAPDH in culture supernatants and in ESP-fractions from these strains (example 16). Estimated from immunoblots in Fig. 26, levels of ENO and PGK correlate to the levels of GAPDH in these strains.

To summarise the observations, activities of GAPDH, ENO and PGK in ESP fractions decreased in concert in the 149-D7 mutant. Likewise they increased simultaneously in the complemented strain 149-D7/102. This indicates that a common mechanism is responsible for the surface display of these glycolytic enzymes.

Example 17: Screening for genes involved in surface display of GAPDH

L. plantarum 299v is able to display the normally intracellular located enzyme glyc- eraldehyde-3-phosphate dehydrogenase (GAPDH) on the cell surface. In contrast, GAPDH levels were close to or below the detection limit on the surface of L. plantarum WCFS1. With the aim of identifying genes involved in GAPDH surface display, a 299v genomic DNA library was screened in strain WCFS1.

Genomic DNA was isolated from L. plantarum 299v and partially digested with Sau3AI. The partially digested DNA fragments were separated on agarose gel and fragments with a minimum size of 5 kb were isolated. These fragments were ligated with the vector pTRKL2 (O'Sullivan and Klaenhammer), which had been digested with BamHI. The ligation mixture was transformed into E. coli and transformants selected on LB agar plates containing erythromycin (200 μg/mL). Pools of transfor- mant colonies were washed off the selective agar plates and plasmid DNA was isolated from these transformant pools. The obtained plasmid DNA pools were used for transformation of L. plantarum WCFS1 and transformants were selected on MRS agar in Qtrays (Genetix) containing erythromycin (5 μg/mL). Individual transformants were picked from the Qtrays using a Qpix colony-picking robot and inoculated into the wells of microtiter plates containing 150 μL MRS with erythromycin. After overnight incubation at 37°C, glycerol was added to a final concentration of 20%, and the cultures were stored at -80°C. Later, transformants were inoculated into new microtiter plates containing 150 μL or 200 μL sMRS with erythromycin. These microtiter plates were incubated and assayed for GAPDH activity as described in example 9. Three clones with extracellular/surface-associated GAPDH activity were identified. Plasmid DNA was isolated from these clones and restriction enzyme analysis using EcoRI indicated that the three plasmids contained the same insert. One of the plas- mids, pUPO102, has been further characterised. The plasmid contains an insert of

6.2 kb (Fig. 27) and sequence analysis indicate the presence of the 3' end of a regulatory gene, the entire rpoB gene including the promoter region and the 5' end of the rpoC gene. Deletions in the rpoB sequence were made by digestion with Fspl (pUP0164), Nrul (pUP0165) or Bglll (pUP0163) (Fig. 27). The resulting plasmids were transformed into L. plantarum WCFS1 and the transformants analysed for surface-associated GAPDH activity. None of these transformants displayed extracellular/surface-associated GAPDH activity (Fig. 27).

In summary, these results indicate that the rpoB gene from L. plantarum 299v is able to mediate surface display of GAPDH when transformed into L. plantarum

WCFS1. The rpoB gene encodes the β subunit present in the core enzyme ( ₂ββ') of the RNA polymerase complex. The β subunit is implicated in the binding of nucleotides needed for RNA polymerisation.

Example 18: Analysis of eluted surface proteins by 2D-PAGE

In order to determine the identity of the most abundant proteins displayed on the cell surface of L .plantarum eluted surface proteins (ESP) were analysed by D PAGE. ESP from L. plantarum 299v were prepared as described in example 9. The ESP were precipitated from the solution by adding 4 volumes of ice-cold acetone and incubation for 2 hours at -21 °C. The resulting pellet was collected by centrifugation

(15,000 x g, 10 min) at 4°C. The pellet containing the cell surface-associated proteins were resuspended in a solution containing 8 M urea, 2% Chaps, 0.002% bro- mophenol blue, 50 mM dithiothreitol (DTT), 0.2% w/v carrier ampholyte, pH 3-10 (Bio-Rad, Laboratories Ltd., Hemel Hempstead, Hertfordshire, UK) to give a final protein concentration of approximately 0.1 μg/μl and used to rehydrate 11-cm pH 4 to 7 linear immobilised pharmalyte gradient (IPG) strips. Strips were rehydrated over-night under passive conditions and focused for 30,000 Volt-hours according to manufactures instructions. Prior to loading on the second dimension, focused IPG strips were equilibrated sequentially in a buffer (Tris-HCI buffer containing 6 M urea, 30% [vol/vol] glycerol, 2% sodium dodecyl sulphate [SDS]) containing 2% DTT or 2.5% iodoacetamide for 15 min each and applied to 10% polyacrylamide Tris-HCI gels. SDS-PAGE was carried out with a Protean II cell (Bio-Rad), and proteins were resolved at a constant voltage of 200 V for 1 hour. Proteins were visualised by silver staining (Shevchenko et al.; 1996). The 2-D PAGE of L. plantarum 299v analysis is shown in Fig. 28. The most abundant gel spots were excised from the gel, "in-gel" digested with trypsin, and analysed by nano-ESI-MS/MS as described in example 3. The box below summarises the sequences and protein identities obtained from the MS analysis of the tryptic digests of proteins isolated by 2D-PAGE.

In summary all the identified ESP are homologous to proteins normally considered as being located intracellular. Nine of the ten identified are enzymes of the metabolic pathways of the cell.

Peptide sequences and protein identities/assignments from outer cell surface associated proteins separated by 2D-PAGE and analysed by MS. Protein spots were in-gel digested with trypsin, and the resulting peptides were extracted and sequenced by nano ESI-MS/MS analyses. Proteins were identi- fied by searching the non-redundant Blast-protein-protein sequence database.

Example 19: Identification of different isoforms of GAPDH

The 2-D PAGE analysis revealed three distinct protein spots all identified as GAPDH (Fig. 28). This indicated the presence of different isoforms of GADPH. A theoretical tryptic digest of the polypeptide sequence of GAPDH showed two putative peptides (ALGLVIPELNGK (SEQ ID NO:48); MW 1223.74 Da) corresponding to residue 221-

232, and (YDSTHGTLNADVSATDDSIWNGK (SEQ ID NO:49); MW 2478.16 Da), corresponding to residue 51-74 that could not be assigned by ESI-MS analysis of a tryptic digest of GAPDH isolated by gel electrophoresis.

Two peptides, a doubly charged peptide at m/z 612.87 and a triply charged peptide at m/z 827.38 (Fig. 29) with MWs of one dalton higher than the corresponding peptides from the theoretical digest (MW 1223.74 and 2479.14 Da for the analysed peptides versus 1222.73 and 2478.16 Da obtained from the theoretical digest) were identified in the GAPDH tryptic digest. Nano-ESI MS/MS analysis of the ions at m/z 612.87 (Fig. 30) and m/z 827.38 (Fig. 31 ) revealed sequences identical with the sequences obtained from the theoretical digest of GAPDH except from the asparagine residues N⁷² and N²³⁰ that were deamidated to aspartate residues, D⁷² and D²³⁰. These results account for the three isoforms of GAPDH corresponding to non- modified GAPDH, a single deamidated form of either residues of N⁷² or N²³⁰ and the third isoform where both residues N⁷² and N²³⁰ are deamidated. This post- translational modification of GAPDH may be unique to the extracellular GAPDH and may be essential for the non-glycolytic function e.g. adhesion or signaling of GAPDH on the cell surface.

Example 20. Gene inactivation in L. plantarum 299v.

Construction of integration plasmid and transformation into L. plantarum.

Plasmid pTN1 was recently developed and successfully used for gene inactivation in

L. gasseri (Nue and Henrich, 2003). The pTN1 vector replicates at 35°C whereas replication is efficiently shut down at 42°C, allowing the use of the vector for single copy integrations in L. gasseri. The present example describes the use of pTN1 for construction of a threonine auxotroph mutant in L. plantarum 299v. Inactivation of genes needed for threonine biosynthesis serves as an example of inactivation of specific genes. A similar approach can be used for inactivation of genes that are expected to be essential for probiotic activity. The complete genome sequence of L. plantarum WCFS1 revealed the presence of a threonine biosynthetic pathway. Based on the threonine biosynthetic genes identified in L. plantarum strain WCFS1 we assumed that the same genes are present in strain 299v. Furthermore we assumed that the gene sequences between the two subspecies are almost identical allowing primer design that is based on the published WCFS1 genome sequence (Kleerebezem et al.; 2003). We attempted to construct a threonine auxotrophic strain by deletion of the C-terminus of the gene encoding Hom2 (homoserine dehydrogenase) and the N-terminus of the gene en- coding ThrB (homoserine kinase). A 500 bp PCR fragment covering an internal region of the hom2 gene was obtained using the primers hom2-thrB-1 (5' GAGGA- TATTGCGGAAGCTC 3' (SEQ ID NO:50)) and hom2-thrB-2 (5' GCGCCGGTCAAT- CATTCATGGCATGGGTAATG 3' (SEQ ID NO:51 )) and genomic L plantarum 299v DNA as template. Similarly, a 500 bp PCR fragment covering an internal region of the thrB gene was obtained using the primers hom2-thrB-3 (5' CATGAATGATT-

GACCGGCGCAACG CGCTCTTC 3' (SEQ ID NO:52)) and hom2-thrB-4 (5' CTTGGCTCAATTGTGC CTGC 3' (SEQ ID NO:53)) and genomic L plantarum 299v DNA as template.

The following PCR profile was used to amplify both 500 bp fragments:

94 °C 5 min 94 °C 30 sec ^~

52 °C 30 sec 25 cycles 72 °C 45 sec

72 °C 2 min

The two primers hom2-thrB 2 and hom2-thrB 3 contain 5^'ends that are complementary to each other. The two synthesised PCR fragments containing overlapping regions were allowed to anneal to each other before extension and amplification using the outer primers hom2-thrB 1 and hom2-thrB 4.

The following extension profile was used:

94 °C 5 min 60 °C 30 sec 72 °C 10 min

The following PCR profile was used to amplify the extended 1000 bp fragment:

94 °C 5 min 94 °C 30 sec ^"

52 °C 30 sec > 25 cycles

72 °C 45 sec 72 °C 2 min

The extended PCR product was purified using the GFX™ PCR DNA and gel band purification kit (Amersham Biosciences) and inserted into the pCR2.1^®-TOPO vector (Invitrogen) resulting in plasmid pPSM1081. The polylinker region of pCR2.1^®- TOPO contains two EcoRI restriction sites that flank the hom2-thrB insert in pPSM1081. Plasmid pPSM1081 was digested with EcoRI, the 1000 bp fragment was purified and inserted into plasmid pTN1 (integration vector), which was pre- digested with EcoRI and treated with bacterial alkaline phosphatase.

The replicon present in pTN1 is unable to replicate in E. coli whereas replication in

L. lactis is efficient. The ligation mixture was therefore transformed into L. lactis MG1363 and selected on M17 agar (Oxoid) with 5 g/L glucose and 5 μg/mL of erythromycin. The resulting plasmid was named pPSM652.

Plasmid pPSM652 was isolated from L. lactis and electroporated into L. plantarum

299v using cells that have been made electrocompetent using a modified protocol developed by Wei et al (1995). Briefly, one mL of an overnight culture was diluted in fresh MRS broth (Oxoid) and grown until OD600 = 0.35. The culture was treated with 10 μg/mL ampicillin for 114 hours and washed twice in 40 mL ice-cold 5mM NaP-1 mM MgCI₂ buffer, pH 7.4. The cells were re-suspended in 500 μl 0.9 M su- crose-3mM MgCI₂ buffer. 100 μl electrocompetent cells and 1 μg plasmid DNA were mixed in a 0.2 cm cuvette, left on ice for 2 min and electroporated using the following settings: 2.0 kV, 25 mF, 200 ohm. 900 μl liquid MRS medium was added and the transformation mixture was incubated at 30°C for 2V hours. Transformed cells were plated on MRS agar plates containing 3 μg/mL of erythromycin and incubated for 48 hours at 30°C. Transformation of pPSM652 into L. plantarum 299v resulted in strain PSM2009.

Integration of pPSM652 into the chromosome of L. plantarum 299v.

To select for plasmid-carrying cells, strain PSM2009 was grown overnight in selective medium at the permissive temperature (30°C). The overnight culture was diluted 1000 fold in fresh MRS medium and incubated overnight at 41 °C. The overnight culture was diluted 10^"4 and plated on MRS agar plates with antibiotic at the non- permissive temperature (41 °C) for 48 hours to obtain single copy integrations of pPSM652 into the chromosome of L. plantarum 299v. Fig.. 32 shows the strategy for pPSM652 integration. Erythromycin resistant clones were isolated and integration of plasmid pPSM652 was verified using the following primers hom2-thrB-5 (5' CGCGACCCTGCTTGATCCGTCC 3') (SEQ ID NO:54) and pTN1-frw (5' GGAA- CAGAACATTTTTTTGTTAAGA 3'). The primer sequence of hom2-thrB-5 is not included in the fragment that was inserted in pPSM652, but located in a position on the chromosome of 299v, which is further upstream of the sequence in pPSM652. Consequently, only erythromycin resistant clones that contain an integrated plasmid pPSM652 will give rise to a PCR product. One such clone containing pPSM652 on the chromosome was named PSM2011.

Excision of plasmid pPSM652 in PSM2011 by a second single-crossover event is allowed by growth in non-selective MRS broth at the permissive temperature (30°C). PSM2011 was incubated in MRS broth at 30°C overnight and diluted to 10^~3 in fresh medium. The overnight incubation and dilution was repeated three times and cells were spread on MRS agar plates and incubated at 30°C for two days. By replica- plating to MRS agar plates containing erythromycin, clones that were unable to grow in the presence of erythromycin were identified. These clones were expected to have excised the integrated pPSM652 plasmid. The single-crossover event will result either in a mutant strain or a wild-type strain depending on how the recombination takes place. The two types of events can be distinguished using the primers hom2-thrB-5 and hom2-thrB-4. Wild type clones will result in a 1908 bp PCR fragment, whereas mutant clones will result in a 1509 bp PCR fragment. A mutant clone was isolated and named PSM2012. The presence of an internal 399 bp deletion in the hom2-thrB genes of strain PSM2012 was verified by Southern blot analysis. Genomic DNA was prepared from strains PSM2012 and L plantarum 299v. Isolated genomic DNA from both strains was digested with either Hindi or Accl and separated on a 1% agarose gel. The agarose gel was treated for hybridisation as described previously (Arnau et al.;

1996) followed by transfer of the DNA to a Hybond-N+ membrane (Amersham Bio- sciences). The membrane was hybridised using a -1000 bp hom2-thrB fragment, amplified from genomic DNA by using the primers hom2-thrB-5 and hom2-thrB-2, as probe. Probe labeling was performed using Ready-To-Go DNA labeling beads (Amersham Biosciences). Unincorporated nucleotides were removed using a NICK column (Amersham Biosciences). The Southern blot analysis is shown in Fig. 33.

The Southern blot analysis revealed two bands of approximately 1.1 kb and 1.8 kb, respectively, when L. plantarum 299v genomic DNA was digested with Accl and hybridised with the hom2-thrB probe. In contrast, genomic DNA isolated from

PSM2012 digested with Accl and hybridised with the same probe resulted in bands of approximately 0.7 kb and 1.8 kb, respectively. Based on available genome sequence from L. plantarum WCFS1 , the wild type strain (299v) was expected to give rise to fragments of 1038 and >730 bp, respectively, whereas the deletion strain (PSM2012) was expected to give rise to fragments of 639 and >730 bp, respectively, when digested with Accl. Thus, the sizes of the fragments revealed by Southern hybridisation correspond to the expected sizes of the smallest fragment for both the wild type and the deletion strain and further indicate the presence of an Accl site 1.8 kb upstream of the Accl site located in the probe sequence.

The Southern blot analysis revealed two bands of approximately 0.9 kb and 1.5 kb, respectively, when L. plantarum 299v genomic DNA was digested with Hindi and hybridised with the hom2-thrB probe. In contrast, genomic DNA isolated from PSM2012 digested with Hindi and hybridised with the same probe resulted in a band of approximately 1.3 kb. Based on available genome sequence from L. plantarum WCFS1 , the wild type strain (299v) was expected to give rise to fragments of 826 and >747 bp, respectively, whereas the deletion strain (PSM2012) was expected to give rise to fragments of 1204 bp and >747 bp, respectively, when digested with Hindi. Thus, the smallest fragments revealed by Southern hybridisation when wild type DNA was digested with Hindi correspond to the expected 826 bp fragment and the largest band indicate the presence of an Hindi site approximately 1.3 kb upstream of the Hindi site located in the probe sequence. For the deletion strain, a band of 1206 bp was expected predicted from the genome sequence and a band of 1.3 kb was expected from the hybridisation pattern observed for the wild type strain. Thus, we assume that the observed band of approximately 1.3 kb represents a double band. In summary, the Southern blot analysis of chromosomal DNA from PSM2012 resulted in the hybridisation pattern expected for a deletion strain.

L. plantarum strains 299v and PSM2012 were inoculated in defined medium with out threonine and as a control in the same medium supplemented with threonine (Lbp-

V24-G10). The medium components are listed in the box below.

The wild type strain (299v) was able to grow in both media. In contrast, the deletion strain (PSM2012) was unable to grow in the threonine deficient medium, but able to grow in the same medium supplemented with threonine indicating a block in the threonine biosynthetic pathway.

In summary, this example shows that specific gene inactivation can be achieved in L. plantarum by use of plasmid pT 1.

The chemically defined medium Lbp-V24-G10 for L plantarum contains: Carbohydrate: 10 g/L D-Glucose;

Buffers:, 3.6 g/L sodium acetate, 3 g/L potassium dihydrogen phosphate, 3 g/L dipoiassium hydrogen phosphate; Fatty acid ester: 1 mL/L Tween 80;

Amino acids: 1.2 g/L L-alanine, 0.8 g/L L-arginine, 0.4 g/L L-asparagine, 0.2 g/L L-cysteine, 1.2 g/L glutamic acid, 0.4 g/L glutamine, 0.8 g/L glycine, 0.2 g/L L-histidine, 0.4 g/L L- isoleucine, 0.4 g/L L-leucine, 1.0 g/L L-lysine-HCI, 0.4 g/L L-methionine, 0.8 g/L L- phenylalanine, 1.2 g/L L-proline, 1.2 g/L L-serine, 0.8 g/L L-threonine, 0.1 g/L L-tryptophane, 0.2 g/L L-tyrosine, and 0.4 g/L L-valine;

Nucleotide bases and vitamins: 0.05 g/L adenine, 0.05 g/L guanine, 0.05 g/L xanthine, 0.05 g/L uracil, 0.2 mg/L potassium p-aminobenzoate, 0.05 mg/L biotin, 0.05 mg/L cyanocobala- min, 1 mg/L riboflavin, 1 mg/L nicotinic acid, 1 mg/L niacinamid, 0.05 mg/L folic acid, 2 mg/L pyridoxal-HCI, 2 mg/L pyridoxin-HCI, 1 mg/L thiamin-HCI, 0.1 mg/L lipoic acid, 5 mg/L inos- ine, 3.7 mg/L thymidine, and 5 mg/L potassium orotate;

Mineral salts with complexinq agent: 0.5 g/L magnesium sulphate heptahydrate, 0.05 g/L manganese sulphate hydrate, 0.02 g/L iron(ll) sulphate heptahydrate;3 μM ammonium molybdate tetrahydrate, 0.4 mM boric acid, 30 μM cobalt chloride hexahydrate, 10 μM cupric sulphate pentahydrate, 80 μM manganese chloride tetrahydrate, 10 μM zinc sulfate heptahydrate, 1 g/L diammonium hydrogen citrate, and 19 mg/L citric acid. Example 21 : Immunomodulatory effects

The present example illustrates various methods for analysing the immunomodulatory effects of pure polypeptides with or without the parallel use of probiotic strains, which are e.g. wild type optimised for selected probiotics properties, null-mutants, secretion deficient mutants, or modification deficient mutants.

The identified genes encoding Enolase, GAPDH, PGK and TPI (in the following termed GENE PRODUCTS) will each be inserted into expression vectors for lactic acid bacteria but also into expression vectors for other bacteria such as E. coli (as in example 10). The resulting vectors will be introduced into appropriate strains, which then will be grown under controlled conditions in fermentors (Bredmose et al.; 2001). A pure preparation of GENE PRODUCTS can be obtained using the above techniques followed by standard purification techniques. It should be noted that the secretion, localisation on the cell surface, and/or possibly chemical modifications could be imperative for the GENE PRODUCTS to be capable of exerting immunomodulation, or changing the amount and/or composition of the mucins in animals or humans. This analysis will be carried out according to the description below where the application of a probiotic strain includes the use of a null-mutant with respect to the gene or genes encoding the relevant GENE PRODUCT(S), or a mutant that is deficient in the ability to secrete the GENE PRODUCT(S), such as the 299v mutant

149-D7 described in examples 14-15, or a mutant deficient in the ability to perform a chemical or structural modification critical for the function of the GENE PRODUCES).

Pure preparations of one or more GENE PRODUCTS can be used alone or in combination with probiotic strains in the developed in vitro assays (example 13) aiming at testing and establishing the immunomodulatory properties of GENE PRODUCTS alone or in combination with probiotic strains and derivatives thereof, such as e.g. the mutagenised strain 149-D7. The probiotic strains could be wild type, naturally improved or improved using recombinant gene technology techniques as described in the following example. Immunomodulatory effects means that the production increases or decreases of one or more of either the cytokines IL1 , IL2 etc. to IL15, TNF-alpha, TGF-beta, interferons and mucins compared to neutral control- compounds and strains. These effects can be studied in the developed dendrite cell assay described in example 13. If one or more of the GENE PRODUCTS alone or in any combination with or without probiotic strains or derivatives thereof show immunomodulatory effects in the in vitro assay, they can be used in animal models or in human trials.

The animal models could include a colitis model where the intestines of animals are treated with dextran sulfate sodium (Okayasu et al.; 1990) to induce colitis symptoms. Following induction, the animals are nourished with feed containing the compound^) and or the strains to be tested. Also, a control with no compound(s) or strains is included. The animals are killed after an appropriate time of treatment and their intestines will be examined. In addition, an analysis of the levels of selected markers such as cytokines could be carried out. Moreover, an analysis of the mucin production and composition before and after the treatment could be performed. Subsequently, human trials will be carried out if the examination and/or the levels of markers show that the compounds and/or the bacterial strains demonstrate the expected beneficial effects.

The human trials will be carried out in patients with e.g. autoimmune diseases, including, but not limited to, Inflammatory Bowel Disease or rheumatoid arthritis. The compound(s) with or without probiotic strain(s) and/or supporting compounds could be encapsulated using an appropriated substance that releases the contents at desired locations in the intestine. Examination of symptoms and analysis of relevant marker such as TNF-alpha and other cytokines will be performed. Also, an analysis of the mucin production and composition before and after the treatment is relevant.

Novel drugs will result from the above program. The drugs can either be used alone or in combination with existing drugs to treat or prevent several diseases including autoimmune diseases, cancers and microbial infections.

Example 22: Selected applications of the present invention The present invention in preferred embodiments is directed to e.g. methods for developing or constructing probiotic strains with impaired or improved probiotic properties, methods for setting up a quality control in the manufacturing process of probiotic starter cultures and end-user products, and methods for screening for new probiotic strains, as described in more detail herein below. Improved probiotic strains can be developed when the GENE PRODUCTS alone or on the surface of a probiotic microorganism have been demonstrated to exert immunomodulatory effects or alterations in the mucin production in in vitro assays and/or in animals and/or in humans. Two approaches can be used namely i) tradi- tional mutagenesis followed by screening procedures and ii) the use of recombinant gene technology to enhance or reduce the levels of the GENE PRODUCTS.

The first approach uses EMS (ethyl-methane-sulfonate), as described in example 14, or UV irradiation for the mutagenesis of a known probiotic strain such as L. plantarum 299v. A large number, preferably but not restricted to more than 10⁴, of mutagenised bacteria will subsequently be analysed using a high throughput screening (HTS) technology, as described in example 14. The HTS is based on growth of the lactic acid bacterium mutants in microtiter wells followed by the monitoring of the levels of one or more GENE PRODUCTS. Preferred mutants could overproduce one or more GENE PRODUCTS and/or have a lower production of one or more other GENE PRODUCTS and/or a have a higher or lower production of any other metabolic products produced by the bacterium. However, mutants that do not contain one or more GENE PRODUCTS on the surface will be useful for analysing the importance of the GENE PRODUCTS on the surface of Lactobacillus and/or the role of a possible modification of the GENE PRODUCTS. Enzyme activity assays or specific antibodies could be used for the quantification of the production levels of the GENE PRODUCTS or any other metabolic product produced by the bacterium.

The preferred mutants will be analysed in in vitro assays (as in example 13) and animal models as described in the former example. The GENE PRODUCTS or any other supporting compounds could be included together with the mutants in the analysis. Mutants that show the expected effects alone or in any combination with GENE PRODUCTS or any other supporting compounds will be used in human trials also as described in the former example.

In the second approach, one or more genes encoding the GENE PRODUCTS will be inserted into an appropriate expression vector such as pVS2 (von Wright et al.; 1987) containing expression signals that ensure the desired production levels of the GENE PRODUCTS. Expression signals include promoters, Shine Dalgarno se- quences (RBS-sequences), secretion signals and the modulation of the distances between these units themselves and the distances to the start codon of the gene(s). Also, one or more genes encoding the GENE PRODUCTS together with the appropriate expression signals could be inserted into the chromosome of the bacterium using the described techniques (Madsen et al.; 1996). Moreover, null-mutants con- taining a deletion in one or more genes encoding the GENE PRODUCTS can be constructed using for instance gene replacement techniques (Madsen et al.; 1996), as described in example 20. Also, it will be possible to construct strains that are deficient in the secretion of one or more of the GENE PRODUCTS. This will be done using an approach that allows the generation of randomly located and tagged inser- tions into the genome of Lactobacillus followed by screenings according to the description above. The construction of null-mutants requires the use of growth media containing compounds that replace the metabolic products produced in the reactions catalysed by the GENE PRODUCTS in the wild type. The use of the null- mutants or the secretion deficient mutants in the analysis will provide evidence whether secretion, surface localisation and/or possibly chemical modifications are imperative for the GENE PRODUCTS to be capable of exerting immunomodulations or changing the levels and the composition of the mucins in animals or humans.

The resulting recombinant strains will be analysed for the expected over-production and/or lowered production of the GENE PRODUCTS and possibly also other metabolic compounds produced by the bacterium. Analyses of increased or decreased secretion of GENE PRODUCTS as well as analyses of the modification of the GENE PRODUCTS can also be performed.

The analysis could be carried out using the same methods as described above for the HTS technique. The recombinant strains will be analysed in in vitro assays and in animal models as described above for the preferred mutant. Also as described for the preferred mutants, the recombinant strains could also be tested in humans.

Quality control (QC) in the manufacturing process of probiotic starter cultures and probiotic end-user products can be established when the GENE PRODUCTS have been demonstrated to exert immunomodulatory effects or alterations in the mucin production in in vitro assays and/or in animals and/or in humans. Starter culture companies can perform QC on probiotic cultures in the laboratory and in the manufacturing process using methods that take advantage of the GENE PRODUCTS as probiotic markers. Analysing for appropriate levels of the GENE PRODUCTS in the probiotic starter can be performed during inoculation, propaga- tion and the manufacturing of the cultures. The analysis can include monitoring of the levels of one or more GENE PRODUCTS, the presence of the genes encoding one or more GENE PRODUCTS and/or the levels of mRNA related to the genes encoding one or more GENE PRODUCTS. The companies that produce end-user probiotic products can perform the same QC by using the same techniques. Also, these techniques can be used for process optimisations in the production of probiotic starter cultures and/or end-user probiotic products, c.f. the different GAPDH activities at different growth stages and conditions as shown e.g. in Example 9. Moreover, these techniques are useful for the identification of and screening for new probiotic strains that could be found anywhere in the environment such as in the Gl- tract of humans or animals, in dairy products and in cereals. The screening could be performed using the HTS technology described above.

References

1. a: Glenn, M., Havukkala, I. J., Bloksberg, Lubbers M. W., Dekker, J., Chris- tensson, A. C, Holland, R., OToole, P. W., Reid, J. R., and Coolbear, T. Lac- tobacillus Rhamnosus Polynucleotides, Polypeptides and Methods for Using

Them. United States Patent Publication . 31-10-2002. Ref Type: Patent

2. Adlerberth, I., S. Ahrne, M. L. Johansson, G. Molin, L. A. Hanson, and A. E. Wold. 1996. A mannose-specific adherence mechanism in Lactobacillus plantarum conferring binding to the human colonic cell line HT-29. Appl. Environ. Microbiol. 62:2244-2251.

3. Arnau, J., K.l. Sørensen, K.F. Appel, F.K. Vogensen, and K. Hammer. 1996. Analysis of heat shock gene expression in Lactococcus lactis MG1363. Microbiology 142:1685-1691. 4. b: Glenn, M., Lubbers, M., and Dekker, J. Polynucleotides, Materials Incorporating Them, and Methods for Using Them. [US 6,476,209]. 5-11-2002. Ref Type: Patent

5. Barea, P. L., E. Calvo, J. A. Rodriguez, A. Rementeria, R. Calcedo, M. J. Sevilla, J. Ponton, and F. L. Hernando. 1999. Characterization of Candida al- bicans antigenic determinants by two- dimensional polyacrylamide gel electrophoresis and enhanced chemiluminescence. FEMS Immunol. Med. Microbiol. 23:343-354.

6. Bergmann, S., M. Rohde, G. S. Chhatwal, and S. Hammerschmidt. 2001. al- pha-Enolase of Streptococcus pneumoniae is a plasmin(ogen)-binding protein displayed on the bacterial cell surface. Mol. Microbiol. 40:1273-1287.

7. Bernard, N., K. Johnsen, T. Ferain, D. Garmyn, P. Hols, J. J. Holbrook, and J. Delcour. 1994. NAD(+)-dependent D-2-hydroxyisocaproate dehydrogenase of Lactobacillus delbrueckii subsp. bulgaricus. Gene cloning and enzyme char- acterization. Eur. J. Biochem. 224:439-446.

8. Bredmose L., M. SM. V. A. R. P. J. MG. G. J. &.. I. H. 2001. Development of a heterologous gene expression system for use in Lactococcus lactis. A novel gram-positive expression system. Recombinant Protein Production with Pro- karyotic and Eukaryotic Cells - A Comparative View on Host Physiology.

9. Christensen, H. R., H. Frokiaer, and J. J. Pestka. 2002. Lactobacilli differentially modulate expression of cytokines and maturation surface markers in murine dendritic cells. J. Immunol. 168:171-178.

10. Collins, J. K. and O'Mahoney, L. In Vitro Model For Gastrointestinal Inflammation. WO 00/42429. 20-7-2000.

11. De Man, J.C,. M. Rogosa, and. M. E. Sharpe. 1960. A medium for the cultivation of Lactobacilli. J. Appl. Bact 23:130-135.

12. Gil-Navarro, I., M. L. Gil, M. Casanova, J. E. O'Connor, J. P. Martinez, and D. Gozalbo. 1997. The glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase of Candida albicans is a surface antigen. J. Bacteriol. 179:4992-4999. 13. Granato, D., F. Perotti, I. Masserey, M. Rouvet, M. Golliard, A. Servin, and D. Brassart. 1999. Cell surface-associated lipoteichoic acid acts as an adhesion factor for attachment of Lactobacillus johnsonii La1 to human enterocyte-like Caco-2 cells. Appl. Environ. Microbiol. 65:1071-1077.

14. Grifantini, R., E. Bartolini, A. Muzzi, M. Draghi, E. Frigimelica, J. Berger, F.

Randazzo, and G. Grandi. 2002. Gene Expression Profile in Neisseria menin- gitidis and Neisseria lactamica upon Host-Cell Contact: From Basic Research to Vaccine Development. Ann. N. Y. Acad. Sci. 975:202-216.

15. Hanage, W. P. and J. Cohen. 2002. Stimulation of cytokine release and adhe- sion molecule expression by products of Viridans streptococci. J. Infect. Dis.

185:357-367.

16. Hart, A. L., A. J. Stagg, and M. A. Kamm. 2003. Use of probiotics in the treatment of inflammatory bowel disease. J. Clin. Gastroenterol. 36:111-119.

17. Huther, F. J., N. Psarros, and H. Duschner. 1990. Isolation, characterization, and inhibition kinetics of enolase from Streptococcus rattus FA-1. Infect. Im- mun. 58:1043-1047.

18. Ibrahim, S.A., and D.J. O'Sullivan. 2000. Use of chemical mutagenesis for the isolation of food grade beta-galactosidase overproducing mutants of bifido- bacteria, lactobacilli and Streptococcus thermophilus. J. Dairy Sci. 83:923-930.

19. Kazmi, S. U., R. Kansal, R. K. Aziz, M. Hooshdaran, A. Norrby-Teglund, D. E.

Low, A. B. Halim, and M. Kotb. 2001. Reciprocal, temporal expression of SpeA and SpeB by invasive M1T1 group a streptococcal isolates in vivo. Infect. Im- mun. 69:4988-4995.

20. Kleerebezem, M., J. Boekhorst, R. Van Kranenburg, D. Molenaar, O. P. Kuipers, R. Leer, R. Tarchini, S. A. Peters, H. M. Sandbrink, M. W. Fiers, W.

Stiekema, R. M. Lankhorst, P. A. Bran, S. M. Hoffer, M. N. Groot, R. Kerkho- ven, M. De Vries, B. Ursing, W. M. De Vos, and R. J. Siezen. 2003. Complete genome sequence of Lactobacillus plantarum WCFS1. Proc. Natl. Acad. Sci. U. S. A 100:1990-1995. 21. Kussmann, M., U. Lassing, C. A. Sturmer, M. Przybylski, and P. Roepstorff. 1997. Matrix-assisted laser desorption/ionization mass spectrometric peptide mapping of the neural cell adhesion protein neurolin purified by sodium dodecyl sulfate polyacrylamide gel electrophoresis or acidic precipitation. J. Mass Spectrom. 32:483-493.

22. Liaudet, L, C. Szabo, O. V. Evgenov, K. G. Murthy, P. Pacher, L. Virag, J. G. Mabley, A. Marton, F. G. Soriano, M. Y. Kirov, L. J. Bjertnaes, and A. L. Salzman. 2003. Flagellin from Gram-negative bacteria is a potent mediator of acute pulmonary inflammation in sepsis. Shock 19:131-137.

23. Maassen, C. B., C. Holten-Neelen, F. Balk, M. J. Bak-Glashouwer, R. J. Leer,

J. D. Laman, W. J. Boersma, and E. Claassen. 2000. Strain-dependent induction of cytokine profiles in the gut by orally administered Lactobacillus strains. Vaccine 18:2613-2623.

24. Mack, D. R., S. Michail, S. Wei, L. McDougall, and M. A. Hollingsworth. 1999. Probiotics inhibit enteropathogenic E. coli adherence in vitro by inducing intestinal mucin gene expression. Am. J. Physiol 276:G9 1-G950.

25. Madsen, S. M., B. Albrechtsen, E. B. Hansen, and H. Israelsen. 1996. Cloning and transcriptional analysis of two threonine biosynthetic genes from Lactococcus lactis MG1614. J. Bacteriol. 178:3689-3694.

26. Mattar, A. F., D. H. Teitelbaum, R. A. Drongowski, F. Yongyi, C. M. Harmon, and A. G. Coran. 2002. Probiotics up-regulate MUC-2 mucin gene expression in a Caco-2 cell- culture model. Pediatr. Surg. Int. 18:586-590.

27. Neu T., and B. Henrich. 2003. New thermosensitive delivery vector and its use to enable nisin-controlled gene expression in Lactobacillus gasseri. Appl. Environ. Microbiol. 69:i377-i382.

28. Neurath, M. F., S. Finotto, and L. H. Glimcher. 2002. The role of Th1/Th2 polarization in mucosal immunity. Nat. Med. 8:567-573.

29. Ochman, H., A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120:621-623. 30. Ochman, H., A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120:621-623.

31. Okayasu, I., S. Hatakeyama, M. Yamada, T. Ohkusa, Y. Inagaki, and R. Na- kaya. 1990. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 98:694-702.

32. O'Sullivan, D.J., and T.R. Klaenhammer. 1993. High- and low-copy-number Lactococcus shuttle cloning vectors with features for clone screening. Gene 137: 227-231.

33. Pancholi, V. and V. A. Fischetti. 1992. A major surface protein on group A streptococci is a glyceraldehyde-3- phosphate-dehydrogenase with multiple binding activity. J. Exp. Med. 176:415-426.

34. Pancholi, V. and V. A. Fischetti. 1993. Glyceraldehyde-3-phosphate dehydrogenase on the surface of group A streptococci is also an ADP-ribosylating enzyme. Proc. Natl. Acad. Sci. U. S. A 90:8154-8158.

35. Pancholi, V. and V. A. Fischetti. 1997. Regulation of the phosphorylation of human pharyngeal cell proteins by group A streptococcal surface dehydrogenase: signal transduction between streptococci and pharyngeal cells. J. Exp. Med. 186:1633-1643.

36. Pancholi, V. and V. A. Fischetti. 1997. A novel plasminogen/plasmin binding protein on the surface of group A streptococci. Adv. Exp. Med. Biol. 418:597-

37. Pancholi, V. and V. A. Fischetti. 1998. alpha-enolase, a novel strong plasminogen) binding protein on the surface of pathogenic streptococci. J. Biol. Chem. 273 :14503-14515.

38. Sanders, M. E. 2003. Probiotics. Food Technology 53:67-77.

39. Sen, S., M. M. Mullan, T. J. Parker, J. T. Woolner, S. A. Tarry, and J. O. Hunter. 2002. Effect of Lactobacillus plantarum 299v on colonic fermentation and symptoms of irritable bowel syndrome. Dig. Dis. Sci. 47:2615-2620. 40. Shevchenko, A., M. Wilm, O. Worm, and M. Mann. 1996. Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels. Anal Chem. 68:850-858.

41. Vidal, K., A. Donnet-Hughes, and D. Granato. 2002. Lipoteichoic acids from Lactobacillus johnsonii strain La1 and Lactobacillus acidophilus strain La10 antagonize the responsiveness of human intestinal epithelial HT29 cells to lipopolysaccharide and gram- negative bacteria. Infect. Immun. 70:2057-2064.

42. Von Wright, A., S. Tynkynnen, and M. Suominen. 1987. Cloning of a Streptococcus lactis subsp. lactis chromosomal fragment associated with the ability to grow in milk. Appl. Environ. Microbiol. 53:1584-1588.

43. Wei. M.Q., CM. Rush, J.M. Norman, L.M. Hafner, R.J Epping, and P. Timms. 1995. An improved method for the transformation of Lactobacillus strains using electroporation. J. Microbiol. Methods. 21 :97-109.

44. Wolff, A. M. and J. Arnau. 2002. Cloning of glyceraldehyde-3-phosphate dehy- drogenase-encoding genes in Mucor circinelloides (Syn. racemosus) and use of the gpdl promoter for recombinant protein production. Fungal. Genet. Biol. 35:21-29.

45. Zhang, J. P. and S. Normark. 1996. Induction of gene expression in Escher- ichia coli after pilus-mediated adherence. Science 273:1234-1236.

46. Johansson M.-L., G. molin, B. Jeppson, S. Nobaek, S. Ahrne and S. Beng- mark. 1993. Administration of different Lactobacillus strains in fermented oatmeal soup: in vivo colonization of human intestinal mucosa and effect on indigenous flora. Appl. Environmental. Micobiol. 59:15-20.

47. Ahrne S., S. Nobaek, B. Jeppson, I. Adlerbreth, A. Wold and G. Molin. 1998. The normal Lactobacillus flora of healthy human rectal and oral mucosa. J.

Appl. Microbiol. 85:88-94.

48. Molin G., B. Jeppson, S. Ahrne, M.-L. Johansson, S. Nobaek, M. Stahl and S. Bengmark. 1993. Numerical taxonomy of Lactobacillus spp. associated with healthy and diseased mucosa of the human intestines. J. Appl. Microbiol. 74:314-323. 49. Hessle, C, L.A. Hansson, and A.E.Wold. 1999. Lactobacilli from human gastrointestinal mucosa are strong stimulators of IL-12 production. Clin Exp Immunol. 116:276-282.

50. Antonsson M. 2001. Lactobacillus in semi-hard cheese and their use as ad- junct cultures. Doctoral Thesis. Lund University. ISBN: 91-7874-139-4.

51. Cunningham-Rundles, S., S. Ahrne, and S. Bengmark. 2000. Probiotics and immune respons. Am. J. Gastroenterol. 95:S22-S25.

52. Cunningham-Rundles, S., S. Ahrne, B.S. Abuav-Nissbaum, and A. Dnistrian. Development of immunocompetence: role of micronutrients and micoorgan- isms. Nutr. Rev. 60:S68-S72.

Claims

Patent Claims

1. A microbial cell comprising at least one microbial cell surface polypeptide and a substantially identical intracellular equivalent thereof,

wherein the microbial cell is selected from the group consisting of Lactobacillus species and Bifidobacterium species, and

wherein the microbial cell comprises an altered polynucleotide sequence as compared to a reference microbial cell comprising a reference polynucleotide sequence without said alteration,

wherein the activity of the intracellular equivalent is capable of converting a substrate in a Lactobacillus metabolic pathway and/or a Bifidobacterium metabolic pathway, and

wherein the altered polynucleotide sequence results in an altered, preferably increased, production and/or secretion and/or post-translational modification in the microbial cell of the at least one microbial cell surface polypeptide as compared to the production and/or secretion and/or post-translational modification of the cell surface polypeptide in a reference microbial cell comprising said reference polynucleotide sequence without said alteration.

2. The microbial cell of claim 1 , wherein the alteration in the polynucleotide sequence is a change in a gene encoding a trans-acting factor or in a region capable of controlling the expression of said gene, wherein said trans-acting factor is a polypeptide that alters, preferably increases, the production and/or secretion and/or post-translational modification of the at least one microbial cell surface polypeptide.

The microbial cell of claim 2, wherein the trans-acting factor is a regulator, such as a repressor or transcriptional activator of the gene encoding the at least one microbial cell surface polypeptide.

4. The microbial cell of claim 2, wherein the trans-acting factor is a polypeptide required for cell surface localisation of the at least one microbial cell surface polypeptide.

5. The microbial cell of claim 2, wherein the trans-acting factor is a polypeptide required for post-translational modification of the at least one microbial cell surface polypeptide.

6. The microbial cell of claim 5, wherein said post-translational modification is a deamidation.

7. The microbial cell of claim 1 , wherein the at least one microbial cell surface polypeptide is encoded by a first polynucleotide operably linked to a second polynucleotide capable of directing the expression of said first polynucleotide, and wherein the alteration in the polynucleotide sequence results in the first and second polynucleotides not being natively associated, and wherein said reference microbial cell polypeptide comprises the first polynucleotide operably linked to its native expression signal.

8. The microbial cell of claim 7, wherein the second polynucleotide has more than

90% sequence identity to the reference second polynucleotide that is natively associated with the first polynucleotide.

9. The microbial cell of claim 7, wherein the second polynucleotide has less than 90% sequence identity, such as less than 75%, e.g. less than 50%, such as less than 30% sequence identity to the reference second polynucleotide that is natively associated with the first polynucleotide.

10. The microbial cell of any of claims 7 to 9, wherein said reference second polynucleotide consists of the 1000 contiguous nucleotides preceding the translation start in the operon encoding the at least one microbial cell surface polypeptide.

11. The microbial cell of any of the preceding claims, wherein said reference microbial cell is Lactobacillus plantarum 299v.

12. The microbial cell of any of the preceding claims, wherein the genetic material of said microbial cell and that of said reference microbial cell differ only in said alteration.

13. The microbial cell of any of claims 1 to 11 , wherein the genetic material of said microbial cell and that of said reference microbial cell differ in less than 10000, such as less than 1000, e.g. less than 100, such as less than 10, such as less than 2 nucleotides in addition to said alteration.

14. The microbial cell of any of the preceding claims, wherein said alteration is a deletion, substitution or insertion of a single nucleotide.

15. The microbial cell of any of claims 1 to 13, wherein said alteration is an insertion, substitution or insertion of more than one nucleotide, such as more than 2, e.g. more than 5, such as more than 10, e.g. more than 50, such as more than 100 nucleotides.

16. The microbial cell of any of the preceding claims, wherein the intracellular equivalent of the microbial cell surface polypeptide is selected from the group consisting of Lactobacillus enzymes acting in a metabolic pathway.

17. The microbial cell of any of claims 1 to 10 or any of claims 12 to 15, wherein the intracellular equivalent of the microbial cell surface polypeptide is selected from the group consisting of Bifidobacterium enzymes acting in a metabolic pathway.

18. The microbial cell according to claim 16 or 17, wherein the metabolic pathway is selected from the glycolytic pathway and the phosphotransferase system.

19. The microbial cell according to claim 16 or 17, wherein the enzyme is selected from the group consisting of hexokinase; glucose 6-phosphate isomerase; phosphofructokinase; aldolase; triose phosphate isomerase (TPI); glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase (PGK); phosphoglycerate mutase; enolase; and pyruvate kinase.

20. The microbial cell according to any of claims 2 to 19, wherein the enzyme is selected from the group consisting of enolase; glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase (PGK); and triose phosphate isomerase (TPI).

21. The microbial cell according to any of claims 2 to 19, wherein the enzyme is selected from the group consisting of enolase and glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

22. The microbial cell according to claim 21 , wherein the enzyme is enolase.

23. The microbial cell according to claim 21 , wherein the enzyme is glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

24. The microbial cell according to any of the preceding claims, wherein the microbial cell surface polypeptide is covalently or non-covalently bound to the surface of the microbial cell.

25. The microbial cell according to any of the preceding claims, wherein the microbial cell is natively producing the cell surface polypeptide.

26. The microbial cell according to any of claims 1 to 24, wherein the microbial cell is not natively producing the cell surface polypeptide.

27. The microbial cell according to any of claims 1 to 24, wherein the cell surface polypeptide is modified as compared to the intracellular equivalent.

28. The microbial cell according to claim 27, wherein the modification is a covalent or non-covalent modification.

29. The microbial cell according to claim 28, wherein the covalent modification is selected from the group consisting of deamidation, ribosylation, phosphorylation, methylation acetylation, alkylation, glycosylation, sulfation, amidation, and proteolytic processing.

30. The microbial cell according to any of the preceding claims, wherein the alteration is a change in the rpoB gene or in a polynucleotide capable of directing the expression of the rpoB gene.

31. A method for determining the probiotic potential of a candidate microbial cell, such as, but not limited to, a microbial cell according to any of claims 1-30, said cell comprising a microbial cell surface polypeptide and a substantially identical intracellular equivalent capable of converting a substrate in a metabolic pathway of the candidate microbial cell, said method comprising the steps of i) providing a candidate microbial cell for which the probiotic potential is to be determined, ii) performing a qualitative and/or quantitative determination of the production and/or secretion and/or post-translational modification in the candidate microbial cell of said microbial cell surface polypeptide, or determining another characteristic of said candidate microbial cell, wherein said other characteristic is related to or correlates with the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, iii) comparing the result of the determination performed in step ii) with a reference value indicative of the probiotic potential of a reference microbial cell, and iv) determining the probiotic potential of said candidate microbial cell based on the comparison performed in step iii).

32. The method of claim 31 , wherein the reference value has been determined by performing step i) and ii) of claim 31 on a reference microbial cell, said reference microbial cell preferably having a probiotic potential.

33. The method of claim 31 or 32, wherein the reference microbial cell is a cell of the same species or subspecies, preferably of the same strain.

34. The method of claim any of claims 31 to 33, wherein the determination in step ii) is performed by comparing the relative production and/or secretion and/or post- translational modification of the microbial cell surface polypeptide to the production and/or secretion and/or post-translational modification in L. plantarum 299v of said cell surface polypeptide under substantially identical growth conditions.

35. The method of any of claims 31 to 34, wherein the intracellular equivalent is selected from glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof.

36. A method for determining the probiotic potential of a starter culture, said starter culture comprising a plurality of microbial cells, such as, but not limited to, a plurality of microbial cells according to any of claims 1-30, said cells each comprising a microbial cell surface polypeptide and a substantially identical intracellular equivalent capable of converting a substrate in a metabolic pathway of the microbial cell, said method comprising the steps of i) providing a sample from a candidate starter culture for which the probiotic potential is to be determined, ii) performing on said sample a qualitative and/or quantitative determination of the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, or determining another characteristic on said sample, wherein said other characteristic is related to or correlates with the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, iii) comparing the result of the determination performed in step ii) with a reference value indicative of the probiotic potential of a reference starter culture, and iv) determining the probiotic potential of said candidate starter culture based on the comparison performed in step iii).

37. The method of claim 36, wherein the comparison in step iii) is performed by comparing the relative production and/or secretion and/or post-translational modification of the microbial cell surface polypeptide to the production in L. plantarum 299v of said cell surface polypeptide under substantially identical growth conditions.

38. The method of claim 36 or 37, wherein the intracellular equivalent is selected from glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof.

39. A method for determining the probiotic potential of an end-user product, said end-user product comprising a plurality of microbial cells, such as, but not limited to, a plurality of microbial cells according to any of claims 1-30, said cells each comprising a microbial cell surface polypeptide and a substantially identical intracellular equivalent capable of converting a substrate in a metabolic pathway of the microbial cell, said method comprising the steps of i) providing a sample from a candidate end-user product for which the probiotic potential is to be determined, ii) performing on said sample a qualitative and/or quantitative determination of the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, or determining another characteristic on said sample, wherein said other characteristic is related to or correlates with the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, iii) comparing the result of the determination performed in step ii) with a reference value indicative of the probiotic potential of a reference end- user product, and iv) determining the probiotic potential of said candidate end-user product based on the comparison performed in step iii).

40. The method of claim 39, wherein the comparison in step iii) is performed by comparing the relative production and/or secretion and/or post-translational modification of the microbial cell surface polypeptide to the production in L. plantarum 299v of said cell surface polypeptide under substantially identical growth conditions.

41. The method of claim 39 or 40, wherein the intracellular equivalent is selected from glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof.

42. A method for identifying a microbial cell with altered probiotic potential, comprising the steps of i) providing a plurality of cells of a Lactobacillus species or a plurality of cells of a Bifidobacterium species, ii) subjecting said plurality of cells to a selection and/or mutagenesis procedure, and iii) identifying a microbial cell with altered probiotic potential as compared to the cells provided in step i), by identifying a cell with an altered production and/or secretion and/or post-translational modification of cell surface polypeptide, said cell surface polypeptide having a substantially identical intracellular equivalent, wherein the activity of the intracellular equivalent is capable of converting a substrate in a metabolic pathway of the cell.

43. The method of claim 42, wherein said cell surface polypeptide is selected from the group consisting of glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof.

44. The method of claim 43, wherein said cell surface polypeptide is glyceraldehyde phosphate dehydrogenase and said identification step comprises growing the cultures in a microtiter plate in an oxygen-depleted carbon dioxide-enriched atmosphere.

45. The method of any of claims 42 to 44, wherein the mutagenesis is performed in such way that on average fewer than 10000, such as fewer than 1000, e.g. fewer than 100, such as fewer than 10 mutations are introduced per cell.

46. The method of any of claims 42 to 45, wherein said steps are repeated once or several times, in each next round providing in step i) a plurality of cells derived from a cell identified in step iii) of the previous round.

47. The method of any of claims 42 to 46, further comprising the step of identifying the one or more genetic change(s) responsible for said altered probiotic potential.

48. The method of any of claims 42 to 47, further comprising the step of introducing the one or more genetic change(s) or a functionally equivalent genetic change into another microbial strain, preferably a into suitable production strain.

49. A microbial cell having an altered probiotic potential obtainable by any of the methods of claim 42 to 48.

50. A method for improving the probiotic potential of a microbial cell comprising a cell surface polypeptide having a substantially identical intracellular equivalent, wherein the activity of the intracellular equivalent is capable of converting a substrate in a metabolic pathway of the cell, said method comprising the steps of

i) providing a microbial cell the probiotic potential of which is to be optimised,

ii) cultivating the microbial cell in a growth medium under conditions allowing the microbial cell to undergo at least one cell division,

wherein the probiotic potential of the microbial cell is improved by controlling, during the cultivation of the microbial cell, the presence or amount of one or more of the following components:

a) reducing agents, such as glutathione and/or cysteine, preferably increasing the amount thereof, b) gasses, such oxygen or carbon dioxide, c) yeast extract, or components thereof, d) organic acids, e) the carbon source, preferably carbohydrates, f) the nitrogen source, preferably proteins, peptides (like casaminoacids), amino acids, including any composition of naturally occurring amino acids, and precursors and/or derivatives thereof, as well as inorganic salts (like ammonium sulfate, acetamide, nitrates or nitrites), g) the oxygen content, h) the ionic strength of the growth medium, such as the NaCl content, i) the pH, j) low molecular weight compounds, preferably salts (sulfate, phosphate, ni- trate), and/or metals (e.g., copper), and/or organic acids, k) cAMP level in the microbial cell, and

I) a cell constituent, or a precursor thereof, preferably a co-factor, a vitamin, a lipid, and the like

thereby controlling the production and/or secretion and/or post-translational modification of said cell surface polypeptide.

51. The method of claim 50, wherein the intracellular equivalent is selected from glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof.

52. A method for modulating an immune response and/or the amount and/or composition of mucosal mucins in an individual, said method comprising the steps of

i) providing a microbial cell selected from a Lactobacillus cell and a

Bifidobacterium cell, such as, but not limited to, a microbial cell of any of claims 1 to 30,

wherein said cell comprises at least one microbial cell surface polypeptide and a substantially identical intracellular equivalent thereof,

wherein the activity of the intracellular equivalent is capable of converting a substrate in a metabolic pathway of the cell, ii) contacting an epithelial cell or a cell of the mucosa-associated lymphoid tissue (MALT) of the individual with at least one microbial cell surface polypeptide, and

iii) modulating an immune response and/or the amount and/or composition of mucosal mucins in an individual.

53. The method of claim 52, wherein the modulation of the immune response comprises a cytokine response.

54. The method of claim 53, wherein the cytokine response comprises a modulation of the synthesis and/or secretion of at least one cytokine selected from the group consisting of IL-1 , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 , IL-12, IL-13, IL-14, IL-15, 1L-16, IL-17, IL-18 and IL-19, TNF-alpha, TNF-beta, LT-beta,

CD40 ligand, Fas ligand, CD27 ligand, CD30 ligand, 4-1 BBL, TGF-beta, and interferons, including IFN-alpha, IFN-beta, and IFN-gamma.

55. The method of any of claims 53 to 54, wherein the modulation of the immune response further comprises an increased or decreased IgA production.

53. The method of any of claims 53 to 55, wherein the modulation of the immune response further comprises an increased or decreased IgE production.

54. The method of any of claims 53 to 53, wherein the modulation of the immune response further comprises a stimulation or repression of macrophage function.

55. The method of any of claims 53 to 54, wherein the modulation of the immune response further comprises a stimulation or repression of natural killer cell activity.

56. The method of any of claims 53 to 55, wherein the modulation of the immune response further comprises an activation or repression of the MALT system.

57. The method of any of claims 52 to 56, wherein the epithelial cell is selected from the group consisting of epithelial cells from an animal or human individual.

58. The method of any of claims 52 to 56, wherein the cell of the mucosa-associated lymphoid tissue (MALT) is selected from the group consisting of M-cells, antigen presenting cells (APCs), dendritic cells (DCs), T-lymphocytes, including Th1 , Th2, and CTL cells, IgA-committed B cells, macrophages, and natural killer (NK) cells.

59. The method of any of claims 52 to 58, wherein the substantially identical intracellular equivalent of the cell surface polypeptide is selected from the group consisting of Lactobacillus enzymes acting in a metabolic pathway and Bifidobacterium enzymes acting in a metabolic pathway.

60. The method of claim 59, wherein the metabolic pathway is the glycolytic pathway or the pathway for uptake of carbohydrates (phosphotransferase uptake system).

61. The method of claim 59, wherein the enzyme is selected from the group consisting of hexokinase; glucose 6-phosphate isomerase; phosphofructokinase; aldolase; triose phosphate isomerase (TPI); glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase (PGK); phosphoglycerate mutase; enolase; and pyruvate kinase.

62. The method of claim 61 , wherein the enzyme is selected from the group consisting of enolase; glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase (PGK); and triose phosphate isomerase (TPI).

63. The method of claim 61 , wherein the enzyme is selected from the group consisting of enolase and glyceraldehyde 3-phosphate dehydrogenase

(GAPDH).

64. The method of claim 61 , wherein the enzyme is enolase.

65. The method of claim 61 , wherein the enzyme is glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

66. The method of any of claims 52 and 65, wherein the microbial cell surface polypeptide is covalently or non-covalently bound to the surface of a microbial cell.

67. The method of claim 66, wherein the microbial cell is a Lactobacillus cell.

68. The method of claim 66, wherein the microbial cell is a Bifidobacterium cell.

69. The method of claim 66, wherein the microbial cell is natively producing the cell surface polypeptide.

70. The method of claim 66, wherein the microbial cell is not natively producing the cell surface polypeptide.

71. The method of any of claims 52 to 70, wherein the cell surface polypeptide is modified as compared to the polypeptide when it is located intracellularly.

72. The method of claim 71 , wherein the modification is a covalent modification.

73. The method of claim 72, wherein the covalent modification is selected from the group consisting of ribosylation, phosphorylation, methylation acetylation, alkylation, glycosylation, sulfation, amidation, proteolytic processing.

74. An isolated polynucleotide comprising a nucleic acid sequence which is at least 90% identical to at least one of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5; and SEQ ID NO:7, wherein the percentage of identical nucleotides is determined by aligning the sequence and the compare sequences using the BLASTN algorithm version 2.04 set at default parameters described herein above, identifying the number of identical nucleotides over aligned portions of the sequence and the compare sequences, dividing the number of identical nucleotides by the total number of nucleic acids of the compare sequence, and multiplying by 100 to determine the percentage identical nucleotides.

75. The polynucleotide according to claim 74, wherein the polynucleotide comprises a nucleic acid sequence which is at least 94% identical to at least one of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5; and SEQ ID NO:7.

76. The polynucleotide according to claim 74, wherein the polynucleotide comprises a nucleic acid sequence which is at least 96% identical to at least one of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5, and SEQ ID NO:7.

77. The polynucleotide according to claim 74, wherein the polynucleotide comprises a nucleic acid sequence which is at least 98% identical to at least one of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5; and SEQ ID NO:7.

78. The polynucleotide according to any of claims 74 to 77, wherein the polynucleotide comprises:

i) a nucleic acid sequence selected from the group consisting of SEQ ID

NO:1; SEQ ID NO:3; SEQ ID NO:5; and SEQ ID NO:7, or

ii) a nucleic acid sequence selected from the group consisting of the coding sequence part of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5; and SEQ ID NO:7, or

iii) a nucleic acid sequence selected from the group consisting of (a) the coding sequence of gap encoding a glyceraldehyde 3-phosphate dehydrogenase (Gap) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843); (b) the coding sequence of pgk encoding a phosphoglycerate kinase (Pgk) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843) (c) the coding sequence of tpi encoding a triosephosphate isomerase (Tpi) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843), and (d) the coding sequence of eno encoding an enolase (Eno) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843), or iv) a nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NO:2; SEQ ID NO:4; SEQ ID NO:6; and SEQ ID NO:8, or

v) a nucleic acid sequence hybridising under stringent hybridisation conditions to a nucleic acid sequence listed in any of i), ii) iii), and iv), or

vi) a nucleic acid sequence selected from the group consisting of (a) a complement of a nucleic acid sequence listed in any of i), ii), iii), and iv); (b) a reverse complement of a nucleic acid sequence listed in i), ii), iii), and iv); and (c) a reverse sequence of a nucleic acid sequence listed in i), ii), iii), and iv), or

vii) a nucleic acid sequence selected from the group consisting of: (a) a sequence comprising more than 200 consecutive nucleotides of a nucleic acid sequence listed in any of i), ii), iii), and iv); (b) a sequence comprising more than 100 consecutive nucleotides of a nucleic acid sequence listed in any of i), ii), iii), and iv); (c) a sequence comprising more than 50 consecutive nucleotides of a nucleic acid sequence listed in any of i), ii), iii), and iv); and (d) a sequence comprising more than 25 consecutive nucleotides of a nucleic acid sequence listed in any of i), ii), iii), and iv).

79. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 ;

SEQ ID NO:3; SEQ ID NO:5; and SEQ ID NO:7.

80. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence selected from the group consisting of the coding sequence part of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5; and SEQ ID NO:7.

81. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence selected from the group consisting of (a) the coding sequence of gap encoding a glyceraldehyde 3-phosphate dehydrogenase (Gap) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843); (b) the coding sequence of pgk encoding a phosphoglycerate kinase (Pgk) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843) (c) the coding sequence of tpi encoding a triosephosphate isomerase (Tpi) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843), and (d) the coding sequence of eno encoding an enolase (Eno) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843).

82. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NO:2; SEQ ID NO:4; SEQ ID NO:6; and SEQ ID NO:8.

83. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence hybridising under stringent hybridisation conditions to a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5 and SEQ ID NO:7.

84. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence selected from the group consisting of (a) a complement of a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5 and SEQ ID NO:7; (b) a reverse complement of a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5 and SEQ ID NO:7; and (c) a reverse sequence of a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5 and SEQ ID NO:7.

85. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence selected from the group consisting of: (a) a sequence comprising more than 200 consecutive nucleotides of a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5 and SEQ ID NO:7; (b) a sequence comprising more than 100 consecutive nucleotides of a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5 and SEQ ID NO:7; (c) a sequence comprising more than 50 consecutive nucleotides of a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5 and SEQ ID NO:7; and (d) a sequence comprising more than 25 consecutive nucleotides of a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 ; SEQ ID NO:3; SEQ ID NO:5 and SEQ ID NO:7.

86. The polynucleotide according to any of claims 74 to 78, wherein the polynucleotide is selected from the group consisting of

i) a polynucleotide comprising nucleotides 1285 to 2307 of SEQ ID NO:11 , and

ii) a polynucleotide comprising or essentially consisting of the coding sequence of gap encoding a glyceraldehyde 3-phosphate dehydrogenase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843; and

iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO:2; and

iv) a polynucleotide encoding a fragment of a polypeptide encoded by polynucleotides (i), (ii) or (iii), wherein said fragment

a) has glyceraldehyde 3-phosphate dehydrogenase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:2; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:2 for binding to at least one predetermined binding partner; and

v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that

a) has glyceraldehyde 3-phosphate dehydrogenase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:2; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:2 for binding to at least one predetermined binding partner,

vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v),

and the complementary strand of such a polynucleotide.

87. The polynucleotide according to claim 86, wherein the polynucleotide comprises nucleotides 1285 to 2307 of SEQ ID NO:11.

88. The polynucleotide according to claim 86, wherein the polynucleotide comprises or essentially consists of the coding sequence of gap encoding a glyceraldehyde 3-phosphate dehydrogenase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843.

89. The polynucleotide according to claim 86, wherein the polynucleotide encodes a polypeptide having the amino acid sequence as shown in SEQ ID NO:2.

90. The polynucleotide according to claim 86, wherein the polynucleotide encodes a fragment of the polypeptide having the amino acid sequence as shown in SEQ ID NO:2, wherein said fragment

a) has glyceraldehyde 3-phosphate dehydrogenase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:2; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:2 for binding to at least one predetermined binding partner.

91. The polynucleotide according to claim 86, wherein the complementary strand of said polynucleotide hybridises under stringent conditions with a polynucleotide that

a) has glyceraldehyde 3-phosphate dehydrogenase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:2; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:2 for binding to at least one predetermined binding partner.

92. The polynucleotide according to any of claims 90 and 91 , wherein the polynucleotide is degenerated.

93. The polynucleotide according to any of claims 74 to 78, wherein the polynucleotide is selected from the group consisting of

i) a polynucleotide comprising nucleotides 2428 to 2630 of SEQ ID NO:11 , and

ii) a polynucleotide comprising or essentially consisting of the coding sequence of pgk encoding a phosphoglycerate kinase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843; and

iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO:4; and iv) a polynucleotide encoding a fragment of a polypeptide encoded by polynucleotides (i), (ii) or (iii), wherein said fragment

a) has phosphoglycerate kinase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:4; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:4 for binding to at least one predetermined binding partner; and

v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that

a) has phosphoglycerate kinase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:4; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:4 for binding to at least one predetermined binding partner,

vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v),

and the complementary strand of such a polynucleotide.

94. The polynucleotide according to claim 93, wherein the polynucleotide comprises nucleotides 2428 to 3630 of SEQ ID NO:11.

95. The polynucleotide according to claim 93, wherein the polynucleotide comprises or essentially consists of the coding sequence of pgk encoding a phosphoglyc- erate kinase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843.

96. The polynucleotide according to claim 93, wherein the polynucleotide encodes a polypeptide having the amino acid sequence as shown in SEQ ID NO:4.

97. The polynucleotide according to claim 93, wherein the polynucleotide encodes a fragment of the polypeptide having the amino acid sequence as shown in SEQ ID NO:4, wherein said fragment

a) has phosphoglycerate kinase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:4; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:4 for binding to at least one predetermined binding partner.

98. The polynucleotide according to claim 93, wherein the complementary strand of said polynucleotide hybridises under stringent conditions with a polynucleotide that

a) has phosphoglycerate kinase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:4; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:4 for binding to at least one predetermined binding partner.

99. The polynucleotide according to any of claims 97 and 98, wherein the polynucleotide is degenerated.

. The polynucleotide according to any of claims 74 to 78, wherein the polynucleotide is selected from the group consisting of

i) a polynucleotide comprising nucleotides 3657 to 4415 of SEQ ID NO:11 , and

ii) a polynucleotide comprising or essentially consisting of the coding sequence of tpi encoding a triose phosphate isomerase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843; and

iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO:6; and

iv) a polynucleotide encoding a fragment of a polypeptide encoded by polynucleotides (i), (ii) or (iii), wherein said fragment

a) has triose phosphate isomerase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:6; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:6 for binding to at least one predetermined binding partner; and

v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that

a) has triose phosphate isomerase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:6; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:6 for binding to at least one predetermined binding partner,

vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v),

and the complementary strand of such a polynucleotide.

101. The polynucleotide according to claim 100, wherein the polynucleotide comprises nucleotides 3657 to 4415 of SEQ ID NO:11.

102. The polynucleotide according to claim 100, wherein the polynucleotide comprises or essentially consists of the coding sequence of tpi encoding a triose phosphate isomerase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843.

103. The polynucleotide according to claim 100, wherein the polynucleotide encodes a polypeptide having the amino acid sequence as shown in SEQ ID

NO:6.

104. The polynucleotide according to claim 100, wherein the polynucleotide encodes a fragment of the polypeptide having the amino acid sequence as shown in SEQ ID NO:6, wherein said fragment

a) has triosephosphate isomerase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:6; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:6 for binding to at least one predetermined binding partner.

105. The polynucleotide according to claim 100, wherein the complementary strand of said polynucleotide hybridises under stringent conditions with a polynucleotide that

a) has triose phosphate isomerase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:6; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:6 for binding to at least one predetermined binding partner.

106. The polynucleotide according to any of claims 104 and 105, wherein the polynucleotide is degenerated.

107. The polynucleotide according to any of claims 74 to 78, wherein the polynucleotide is selected from the group consisting of

i) a polynucleotide comprising nucleotides 4497 to 5825 of SEQ ID NO:11 , and

ii) a polynucleotide comprising or essentially consisting of the coding sequence of eno encoding an enolase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843; and

iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO:8; and

iv) a polynucleotide encoding a fragment of a polypeptide encoded by polynucleotides (i), (ii) or (iii), wherein said fragment

a) has enolase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:8; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:8 for binding to at least one predetermined binding partner; and

v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that

a) has enolase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:8; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:8 for binding to at least one predetermined binding partner,

vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v),

and the complementary strand of such a polynucleotide.

108. The polynucleotide according to claim 107, wherein the polynucleotide comprises nucleotides 4497 to 5825 of SEQ ID NO:11.

109. The polynucleotide according to claim 107, wherein the polynucleotide comprises or essentially consists of the coding sequence of eno encoding an enolase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843.

110. The polynucleotide according to claim 107, wherein the polynucleotide encodes a polypeptide having the amino acid sequence as shown in SEQ ID NO:8.

111. The polynucleotide according to claim 107, wherein the polynucleotide encodes a fragment of the polypeptide having the amino acid sequence as shown in SEQ ID NO:8, wherein said fragment

a) has enolase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO:8; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:8 for binding to at least one predetermined binding partner.

112. The polynucleotide according to claim 107, wherein the complementary strand of said polynucleotide hybridises under stringent conditions with a polynucleotide that

a) has enolase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is ca- pable of recognising SEQ ID NO:8; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO:8 for binding to at least one predetermined binding partner.

113. The polynucleotide according to any of claims 111 and 112, wherein the polynucleotide is degenerated.

114. A vector comprising the polynucleotide according to any of claims 74 to 113.

115. A host cell comprising the polynucleotide according to any of claims 74 to 113, or the vector according to claim 114.

116. The host cell according to claim 115 selected from the group consisting of Gram-positive, non-pathogenic bacteria.

117. The host cell according to claim 116 selected from the group consisting of the genus of Lactobacillus.

118. The microbial cell of any of claims 1 to 30 or the host cell according to claim 117 selected from Lactobacillus acetotolerans, Lactobacillus acidipiscis, Lactobacillus acidophilus, Lactobacillus agilis, Lactobacillus algidus, Lactobacillus alimentarius, Lactobacillus amylolyticus, Lactobacillus amylophilus, Lactoba- cillus amylovorus, Lactobacillus animalis, Lactobacillus arizonensis, Lactobacillus aviarius, Lactobacillus bifermentans, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus coelohominis, Lactobacillus collinoi- des, Lactobacillus coryniformis subsp. coryniformis, Lactobacillus coryniformis subsp. torquens, Lactobacillus crispatus, Lactobacillus curvatus, Lactobacillus cypricasei, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus delbrueckii subsp delbrueckii, Lactobacillus delbrueckii subsp. lactis, Lactobacillus durianus, Lactobacillus equi, Lactobacillus farciminis, Lactobacillus ferintoshensis, Lactobacillus fermentum, Lactobacillus fomicalis, Lactobacillus fructivorans, Lactobacillus frumenti, Lactobacillus fuchuensis, Lactobacillus gallinarum, Lactobacillus gasseri, Lactobacillus graminis, Lactobacillus hamsteri, Lactobacillus helveticus,

Lactobacillus helveticus subsp. jugurti, Lactobacillus heterohiochii, Lactobacillus hilgardii, Lactobacillus homohiochii, Lactobacillus intestinalis, Lactobacillus japonicus, Lactobacillus jensenii, Lactobacillus johnsonii, Lactobacillus kefiri, Lactobacillus kimchii, Lactobacillus kunkeei, Lactobacillus leichmannii, Lactoba- cillus letivazi, Lactobacillus lindneri, Lactobacillus malefermentans, Lactobacillus mali, Lactobacillus maltaromicus, Lactobacillus manihotivorans, Lactobacillus mindensis, Lactobacillus mucosae, Lactobacillus murinus, Lactobacillus nagelii, Lactobacillus oris, Lactobacillus panis, Lactobacillus pantheri, Lactobacillus parabuchneri, Lactobacillus paracasei subsp. paracasei, Lactobacillus paracasei subsp. pseudoplantarum,, Lactobacillus paracasei subsp. tolerans, Lactobacillus parakefiri, Lactobacillus paralimentarius, Lactobacillus paraplantarum, Lactobacillus pentosus, Lactobacillus perolens, Lactobacillus plantarum, Lactobacillus pontis, Lactobacillus psittaci, Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus ruminis, Lactobacillus sakei, Lactobacillus salivarius, Lactobacillus salivarius subsp. salicinius, Lactobacillus salivarius subsp. salivarius, Lactobacillus sanfranciscensis, Lactobacillus sharpeae, Lactobacillus suebicus, Lactobacillus thermophilus, Lactobacillus thermotolerans, Lactobacillus vaccinostercus, Lactobacillus vaginalis, Lactobacillus versmoldensis, Lactobacillus vitulinus, Lactobacillus vermiforme, Lactobacillus zeae

119. The host cell according to claim 118, wherein said host cell is Lactobacillus plantarum.

120. The host cell according to claim 116 selected from the group consist- ing of the genus of Bifidobacterium.

121. The microbial cell of any of claims 1 to 30 or the host cell according to claim 120 selected from the group consisting of Bifidobacterium adolescentis, Bifidobacterium aerophilum, Bifidobacterium angulatum, Bifidobacterium ani- malis, Bifidobacterium asteroides, Bifidobacterium bifidum, Bifidobacterium bourn, Bifidobacterium breve, Bifidobacterium catenulatum, Bifidobacterium choerinum, Bifidobacterium coryneforme, Bifidobacterium cuniculi, Bifidobacterium dentium, Bifidobacterium gallicum, Bifidobacterium gallinarum, , Bifidobacterium indicum, Bifidobacterium longum, Bifidobacterium longum bv Longum, Bi- fidobacterium longum bv. Infantis, Bifidobacterium longum bv. Suis, Bifidobacterium magnum, Bifidobacterium merycicum, Bifidobacterium minimum, Bifidobacterium pseudocatenulatum, Bifidobacterium pseudolongum, Bifidobacterium pseudolongum subsp. globosum, Bifidobacterium pseudolongum subsp. pseudolongum, Bifidobacterium psychroaerophilum, Bifidobacterium pullorum, Bifi- dobacterium ruminantium, Bifidobacterium saeculare, Bifidobacterium scardovii,

Bifidobacterium subtile, Bifidobacterium thermoacidophilum, Bifidobacterium thermoacidophilum subsp. suis, Bifidobacterium thermophilum, Bifidobacterium urinalis.

122. The host cell according to claim 115, wherein said host cell is Lactobacillus plantarum.

123. The host cell according to claim 115, wherein said host cell is Lactoba- cillus plantarum 299v or a variant thereof.

124. The host cell according to claim 115, wherein said host cell is Lactobacillus rhamnosus.

125. The host cell according to claim 115, wherein said host cell is Lactobacillus rhamnosus 271 (DSM 6594) or a variant thereof.

126. The host cell according to claim 115, wherein said host cell is Lactobacillus paracasei.

127. The host cell according to claim 115, wherein said host cell is Lactobacillus paracasei 8700:2 (DSM 13434) or a variant thereof.

128. The host cell according to claim 115, wherein said host cell is Lactoba- cillus paracasei 02A (DSM 13432) or a variant thereof.

129. A method for producing a microbial cell surface polypeptide capable of modulating an immune response, or a fragment thereof, comprising the step of culturing the microbial cell of any of claims 1 to 30 or the host cell according to any of claims 115 to 128 under conditions suitable for the production of said immunomodulating polypeptide, or fragment thereof.

130. A method for producing a microbial cell surface polypeptide capable of modulating the amount and/or composition of mucosal mucins, or a fragment thereof, comprising the step of culturing the microbial cell of any of claims 1 to

30 or the host cell according to any of claims 115 to 128 under conditions suitable for the production of said immunomodulating polypeptide, or fragment thereof.

131. A method for producing an epithelial adhesive polypeptide, or a fragment thereof, comprising the step of culturing the microbial cell of any of claims 1 to 30 or the host cell according to any of claims 115 to 128 under conditions suitable for the production of said epithelial adhesive polypeptide, or fragment thereof.

132. A polypeptide comprising an amino acid sequence which is at least 90% identical to at least one of SEQ ID NO:2; SEQ ID NO: 4; SEQ ID NO:6; and SEQ ID NO:8, including variants and functional equivalents thereof.

133. The polypeptide according to claim 132 comprising SEQ ID NO:2.

134. The polypeptide according to claim 132 comprising SEQ ID NO:4.

135. The polypeptide according to claim 132 comprising SEQ ID NO:6.

136. The polypeptide according to claim 132 comprising SEQ ID NO:8.

137. An antibody against the polypeptide of any of claims 132 to 136.

138. The antibody according to claim 137 selected from monoclonal antibodies and polyclonal antibodies.

139. An antagonist capable of inhibiting the activity or expression of the polypeptide according to any of claims 132 to 136.

140. An agonist capable of enhancing the activity or expression of the polypeptide according to any of claims 132 to 136.

141. A complex comprising the polypeptide according to any of claims 132 to 136 and the antagonist of claim 139 or the agonist of claim 140.

142. A method for the treatment of an individual comprising the step of administering to the individual a therapeutically effective amount of the polypep- tide of any of claims 132 to 136.

143. A method for the treatment of an individual comprising the step of administering to the individual a therapeutically effective amount of the microbial cell of any of claims 1 to 30 or the host cell of any of claims 115 to 128.

144. A method for the treatment of an individual comprising the steps of administering to the individual a therapeutically effective amount of the antagonist of claim 139 or the agonist of claim 140.

145. A method for identifying compounds which interact with and inhibit or activate an activity of the polypeptide of any of claims 132 to 136 comprising the steps of

i) contacting a composition comprising the polypeptide with the compound to be screened under conditions to permit interaction between the compound and the polypeptide to assess the interaction of a compound, such interaction being associated with a second component capable of providing a detectable signal in response to the interaction of the polypeptide with the compound; and

ii) determining whether the compound interacts with and activates or inhibits an activity of the polypeptide by detecting the presence or absence of a signal generated from the interaction of the compound with the polypeptide.

146. A method for treating an auto-immune disease in an individual comprising the step of administering to the individual a pharmaceutically effective amount of the polypeptide according to any of claims 132 to 136, or the microbial cell of any of claims 1 to 30 or the host cell according to any of claims to 115 to 128.

147. A polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136 or the microbial cell of any of claims 1 to 30 or the host cell according to any of claims 115 to 128, for use as a medicament.

148. Use of a polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136 or the microbial cell of any of claims 1 to 30 or the host cell according to any of claims 115 to 128, for the manufacture of a medicament for treatment of a disease, wherein said treatment benefits from modulation of the immune response.

149. Use according to claim 148 for treatment of inflammatory bowel disease, rheumatoid arthritis, multiple sclerosis, arteriosclerosis, allergy and dia- betes (type I), multiple sclerosis, Hashimotos thyroiditis, pernicious anemia,

Addison's disease, myasthenia gravis, rheumatoid arthritis, uveitis, psoriasis, Guillain-Barre Syndrome, Grave's disease, Systemic autoimmune diseases including systemic lupus erythematosus and dermatomyositis, asthma, eczema, atopical dermatitis, contact dermatitis, other eczematous dermatitides, sebor- rheic dermatitis, rhinitis, Lichen planus, Pemplugus, bullous Pemphigoid, Epi- dermolysis bullosa, uritcaris, angioedemas, vasculitides, erythemas, cutaneous eosinophilias, Alopecia areata, atherosclerosis, primary biliary cirrhosis and ne- phrotic syndrome. Related diseases include intestinal inflammations, such as Coeliac disease, proctitis, eosinophilia gastroenteritis, mastocytosis, inflamma- tory bowel disease, Crohn's disease and ulcerative colitis, as well as food- related allergies.

150. A pharmaceutical composition comprising a therapeutically effective amount of at least one polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136 or the microbial cell of any of claims 1 to 30 or the host cell according to claims 115 to 128, and at least one excipient.

151. A nutritional supplement comprising at least the microbial cell of any of claims 1 to 30, or at least the host cell according to any one of claims 115 to 128 and/or at least a polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136.

152. Use of a polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136 and/or at least the microbial cell of any of claims 1 to 30 or at least a host cell according to any one of claims 115 to 128 for the manufacture of a nutritional supplement for treatment of a disease which benefit from modulation of the immune response.

153. Use according to claim 152 for treatment of inflammatory bowel disease, rheumatoid arthritis, multiple sclerosis, arteriosclerosis, allergy and diabetes (type I), multiple sclerosis, Hashimotos thyroiditis, pernicious anemia, Addison's disease, myasthenia gravis, rheumatoid arthritis, uveitis, psoriasis, Guillain-Barre Syndrome, Grave's disease, Systemic autoimmune diseases in- eluding systemic lupus erythematosus and dermatomyositis, asthma, eczema, atopical dermatitis, contact dermatitis, other eczematous dermatitides, sebor- rheic dermatitis, rhinitis, Lichen planus, Pemplugus, bullous Pemphigoid, Epi- dermolysis bullosa, uritcaris, angioedemas, vasculitides, erythemas, cutaneous eosinophilias, Alopecia areata, atherosclerosis, primary biliary cirrhosis and ne- phrotic syndrome. Related diseases include intestinal inflammations, such as

Coeliac disease, proctitis, eosinophilia gastroenteritis, mastocytosis, inflammatory bowel disease, Crohn's disease and ulcerative colitis, as well as food- related allergies.

154. A food, preferably a dairy food, comprising at least the microbial cell of any of claims 1 to 30 or the host cell according to any one of claims 115 to 128, and/or at least a polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136.

155. Use of a polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136 and/or a microbial cell according to any of claims 1 to 30 and/or at least a host cell according to any one of claims 115 to 128 for the manufacture of a food for treatment of a disease which benefit from modulation of the immune response.

156. Use according to claim 155 for treatment of inflammatory bowel disease, rheumatoid arthritis, multiple sclerosis, arteriosclerosis, allergy and diabetes (type I), multiple sclerosis, Hashimotos thyroiditis, pernicious anemia, Addison's disease, myasthenia gravis, rheumatoid arthritis, uveitis, psoriasis, Guillain-Barre Syndrome, Grave's disease, Systemic autoimmune diseases including systemic lupus erythe- matosus and dermatomyositis, asthma, eczema, atopical dermatitis, contact dermatitis, other eczematous dermatitides, seborrheic dermatitis, rhinitis, Lichen planus, Pemplugus, bullous Pemphigoid, Epidermolysis bullosa, uritcaris, angioedemas, vasculitides, erythemas, cutaneous eosinophilias, Alopecia areata, atherosclerosis, primary biliary cirrhosis and nephrotic syndrome. Related diseases include intestinal inflammations, such as Coeliac disease, proctitis, eosinophilia gastroenteritis, mas- tocytosis, inflammatory bowel disease, Crohn's disease and ulcerative colitis, as well as food-related allergies.