WO2004067726A2

WO2004067726A2 - Isothermal reactions for the amplification of oligonucleotides

Info

Publication number: WO2004067726A2
Application number: PCT/US2004/002718
Authority: WO
Inventors: Jeffrey Van Ness; David J. Galas; Lori K. Van Ness; Jeffrey B. Graybill
Original assignee: Keck Graduate Institute; Ionian Technologies Inc.
Priority date: 2003-01-29
Filing date: 2004-01-29
Publication date: 2004-08-12
Also published as: WO2004067726A3

Abstract

Described is a new class of isothermal reactions for amplifying DNA. These homogeneous reactions rapidly synthesize short oligonucleotides (e.g., 8-16 bases) specified by the sequence of an amplification template. Versions of the reactions can proceed in either a linear or an exponential amplification mode. Both of these reactions utilize simple, stable conditions. The rate of amplification depends entirely on the molecular parameters governing the interactions of the molecules in the reaction. The exponential version of the method is a molecular chain reaction that uses the oligonucleotide products of each linear reaction to create a producer of more of the same oligonucleotide. It is a highly sensitive chain reaction that can be triggered by specific DNA sequences and can achieve amplifications of more than 106 fold. Several similar reactions in this class are described here. The robustness, speed and sensitivity of the exponential reaction render it useful in rapidly detecting the presence of small amounts of a specific DNA sequence in a sample, and a range of other applications including many currently making use of the polymerase chain reaction (PCR).

Description

ISOTHERMAL REACTIONS FOR THE AMPLIFICATION OF OLIGONUCLEOTIDES

BACKGROUND OF THE INVENTION

Field of the Invention Oligonucleotide amplification reactions and compositions related thereto.

Description of the Related Art

The invention of the polymerase chain reaction (PCR) changed the practice of molecular biology. It has become a mainstay of biological research and diagnostics in providing a method for the rapid detection and isolation of DNA sequences through their specific amplification. It has also been used to measure the amount of a specific sequence in a sample. There are currently two widely used methods for amplifying specific DNA sequences, PCR (see, e.g., Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., Erlich, H. (1986) Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51 Pt 1 , 263-273; and Saiki, R.K., Scharf, S.J., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A., Arnheim N. (1985) Enzymatic Amplification of beta-Globin Sequences and Restriction Site Analysis for Diagnosis of Sickle Cell Anemia. Science 230, 1250-1354) and the rolling circle amplification method (see, e.g., Fire, A., Xu, S.Q. (1995) Rolling replication of short DNA circles. Proc. Natl. Acad. Sci. USA 92(10), 4641-4645; Liu, D., Daubendiek, S.L., Zillman, M.A., Ryan, K., Kool, E.T. (1996) Rolling circle DNA synthesis: Small circular oligonucleotides as efficient templates for DNA polymerases. J. Am. Chem. Soc. t18, 1587-1594; and Lizardi, P.M., Huang, X., Zhu, Z., Bray-Ward, P., Thomas, D.C. and Ward, D.C. (1998) Mutation detection and single-molecule counting using isothermal rolling-circle amplification. Nature Genet. 19, 225-232). The PCR method is the simpler and more flexible of these and has the added advantage of being geometric rather than linear in character so that amplification levels of 10⁶ or more can be achieved. It is by far the most widely used amplification method in biology. It has the disadvantage relative to the isothermal rolling-circle amplification method, however, of needing a temperature cycling protocol to achieve amplification. This imposes instrumentation constraints on the PCR method that make it more complex and limits the rate .of the amplification to the temperature cycling schedule. Another limitation on the rate of PCR derives from the nature of the reaction itself in that a maximum two-fold amplification can be achieved in each cycle. It is apparent that the speed, accuracy and sensitivity of any amplification method, in addition to its simplicity, are all very important for many applications in biology and medicine, and advances in these areas would be most welcome.

The present invention addresses this long-felt need in the art for an improved nucleic acid amplification method.

BRIEF SUMMARY OF THE INVENTION

The present invention is directed to a new class of isothermal reactions for amplifying DNA. These homogeneous reactions rapidly synthesize short oligonucleotides (e.g., 8-16 bases) specified by the sequence of an amplification template. Versions of the reactions can proceed in either a linear or an exponential amplification mode. Both of these reactions utilize simple, stable {i.e., non-cycling) conditions. The rate of amplification depends entirely on the molecular parameters governing the interactions of the molecules in the reaction. The exponential version of the method is a molecular chain reaction that may use the oligonucleotide products of each linear reaction to create a producer of more of the same oligonucleotide. It is a highly sensitive chain reaction that can be triggered by specific DNA sequences and can achieve amplifications of more than 10⁶ fold. Several similar reactions in this class are described here. The robustness, speed and sensitivity of the exponential reaction render it useful in rapidly detecting the presence of small amounts of a specific DNA sequence in a sample, and a range of other applications including many currently making use of the polymerase chain reaction (PCR). In one aspect, the present invention provides a methods that comprises the steps of (A) forming a reaction mixture that comprises (1) a primer, (2) a first template that comprises from 5' to 3': (a) a first region of nucleotides; (b) a nucleotide sequence of a sense strand of a first nicking agent recognition sequence; and (c) a second region of nucleotides that is at least substantially complementary to the primer; (3) a second template that comprises from 5' to 3': (a) a first region of nucleotides; (b) a nucleotide sequence of a sense strand of a second nicking agent recognition sequence; and (c) a second region of nucleotides that is at least substantially identical to the primer; (4) a DNA polymerase; (5) a first nicking agent that recognizes the first nicking agent recognition sequence; and (6) a second nicking agent that recognizes the second nicking agent recognition sequence; and (B) incubating the reaction mixture under conditions that amplifies an oligonucleotide that is at least substantially identical or complementary to the primer.

In certain embodiments, the amplified oligonucleotide may be 4-20 (including all integer value therebetween) nucleotides in length.

In certain embodiments, the second region of the first template is completely complementary to the primer. In some other embodiments, the second region of the first template is completely identical to the primer.

In certain embodiments, the first nicking agent recognition sequence may be identical to the second nicking agent recognition sequence. In some embodiments, both the first and second nicking agent recognition sequences are recognizable by a nicking endonuclease. In certain embodiments, both the first and second nicking agent recognition sequences are recognizable by a restriction endonuclease. In certain embodiments, the DNA polymerase is exo^" Vent polymerase or 9°Nm™ polymerase.

In certain embodiments, the 3' terminus of the first template, the 3' terminus of the second template, or both 3' termini may be blocked. In certain embodiments, the first template, the second template, or both are immobilized.

In some embodiments, the first region of the first template, the first region of the second template, or both may be at least about 6, 7, 8, 9, 10, 11 , 12, 13, 14, or 15 nucleotides in length. In certain embodiments, the amplified oligonucleotide may be further characterized. For instance, the amplified oligonucleotide may be characterized luminescence spectroscopy or spectrometry, fluorescence spectroscopy or spectrometry, mass spectrometry, liquid chromatography, fluorescence polarization, electrophoresis, or the combination of the above technologies. In some embodiments, the reaction mixture further comprises a third template that comprises from 5' to 3': (A) a first region that is at least substantially identical or complementary to the primer; (B) the sequence of the antisense strand of a third nicking agent recognition sequence; and (C) a second region that is not substantially identical or complementary to the primer. Optionally, the first, second and third nicking agent recognition sequences are identical to each other.

In certain embodiments, the amplification reaction is performed under isothermal conditions, such as at about 50°C, 55°C, or 60°C.

In some embodiments, the primer is produced by (A) annealing an oligonucleotide that comprises the sequence of the sense strand of a third nicking agent recogntion sequence to a target nucleic acid that comprises a sequence that is completely complementary to the primer; and (B) amplifying the primer in the presence of the DNA polymerase and a third nicking agent that recognizes the third nicking agent recognition sequence. In certain embodiments, one, two, three, four or five nucleotides in the sense strand of the third NARS do not form base pairs with the nucleotides at their corresponding position in the target nucleic acid. In certain embodiments, the first, second and third nicking agent recognition sequences are identical to each other.

In another aspect, the present invention provides a composition comprising first and second templates wherein each template comprises a nucleotide sequence of a sense strand of a nicking agent recognition sequence, and wherein a 3' portion of the first template is at least substantially complementary to a 3' portion of the second template.

In certain embodiments, the 3' portion of the first template is completely complementary to the 3' portion of the second template.

In certain embodiments, the 3' terminus of the first template, the 3' terminus of the second template, or both are blocked.

Optionally, the composition may further comprise a DNA polymerase, an oligonucleotide primer that comprises a sequence that is at least substantially complementary to a region of the first template 3' to the sense strand of the nicking agent recognition sequence, or both.

In another aspect, the present invention provide a method for amplifying a signal nucleotide (As) and another nucleic acid (A2) comprising (a) providing (i) a first template nucleic acid (T1) that comprises a nucleotide sequence of one strand of a nicking agent recognition sequence (NARS) and is at least substantially complementary to a trigger oligonucleotide primer (trigger ODNP); and (ii) a signal template nucleic acid (Ts) that comprises a nucleotide sequence of one strand of the NARS; and is at least substantially complementary to the trigger ODNP; (b) hybridizing the trigger ODNP to T1 and Ts; (c) extending the trigger ODNP to form (i) a hybrid (H1 ) comprising extended trigger ODNP hybridized to T1 , where H1 comprises both strands of the NARS; and (ii) a hybrid (Hs) comprising extending trigger ODNP hybridized to Ts, where Hs comprises both strands of the NARS; (d) nicking (i) H1 at a nicking site with a nicking agent (NA) that recognizes the NARS, the fragment having a 5' terminus at the nicking site being named A1 ; and (ii) Hs at a nicking site with the NA, the fragment having a 5' terminus at the nicking site being named As, wherein As is not substantially identical to A1; (e) repeating steps (c) and (d) to amplify A1 and As; (f) providing a second template nucleic acid (T2) that comprises the sequence of one strand of the NARS and ύ at least substantially complementary to A1 , but not to As; (g) hybridizing A1 to T2; (h) extending A1 to form a hybrid (H2) comprising extended A1 hybridized to T2, where H2 comprises both strands of the NARS; (i) nicking H2 with the NA, the fragment having a 5' terminus at the nicking site being named A2; (j) extending the 3' terminus at the nicking site in H2 to re-form H2; and (k) repeating steps (i) and (j) to thereby amplify A2.

In certain embodiments, steps (j)-(k) are performed in a single vessel.

In some embodiments, A1, A2 or both may be from 8 to 24 (including all the integer values therebetween) in length. In some embodiments, As is 4-30 nucleotides (including all the integer values therebetween) in length.

Optionally, the above method may further comprise the step of detecting As.

In another aspect, the present invention provides a method for amplifying a nucleic acid molecule, comprising (A) forming a mixture comprising (i) an oligonucleotide primer having a sequence (S1); (ii) a first template nucleic acid having the sequence of the antisense strand of a nicking agent recognition sequence (NARS), wherein a sequence substantially complementary to S1 <is present both 3' and 5' to the sequence of the antisense strand of the NARS; (iii) a second template nucleic acid comprising from 5' to 3': (a) a first region that is ai least substantially complementary to S1; (b) the sequence of the antisense strand of the NARS; and (c) a second region that is not substantially complementary to S1 ; and (iv) a nicking agent (NA) that recognizes the NARS; a DNA polymerase; and one or more deoxynucleoside triphosphate(s); and(B) maintaining said mixture at conditions that amplify (i) a first single-stranded nucleic acid molecule (A1 ) using the first template nucleic acid as a template; and (ii) a second single-stranded nucleic acid molecule (As) using the second template nucleic acid as a template. Optionally, the sequence in the first template nucleic acid that is at least substantially complementary to S1 is exactly complementary to S1.

Optionally, the amplified nucleic acid molecule A1 has a sequence that is exactly identical to S1.

Optionally, the above method may further comprise the step of detecting the amplified nucleic acid molecule As. In another aspect, the present invention provides an isolated single- stranded nucleic acid useful in detecting the presence or absence of a first target nucleic acid and a second target nucleic acid, wherein the first target nucleic acid is not adjacent to the second target nucleic acid in a naturally occurring nucleic acid molecule, comprising, from 5' to 3' (A) a first sequence that is at least substantially complementary to the first target nucleic acid; (B) a second sequence that is at least substantially complementary to the second target nucleic acid; (C) the sequence of the antisense strand of a nicking agent recognition sequence; and (D) a third sequence.

Optionally, the first sequence is completely complementary to the first target nucleic acid. Optionally, the second sequence is completely complementary to the second target nucleic acid.

Optionally, the above isolated single-stranded nucleic acid may further comprises a sequence 3' to the sequence of the antisense strand of the nicking agent recognition sequence that is at least substantially complementary to a third target nucleic acid.

Optionally, the sequence of the antisense strand of the nicking agent recognition sequence is 5'-GACTC-3' or 5'-GATCC-3'.

In another aspect, the present application provides a composition comprising (A) a first template nucleic acid that comprises, from 5' to 3': (i) a first nucleotide sequence that is at least substantially complementary to a nucleotide sequence present in a first target nucleic acid; (ii) a nucleotide sequence which is an antisense strand of a nicking agent recognition sequence; and (iii) a second nucleotide sequence; and (B) a second template nucleic acid that comprises, from 5' to 3': (i) a first sequence that is at least substantially complementary to a second target nucleic acid; (ii) the sequence of the antisense strand of the nicking agent recognition sequence; and (iii) a second sequence that is exactly identical to the second sequence of the first template nucleic acid.

Optionally, the first sequence of the first template nucleic acid is completely complementary to the first target nucleic acid. Optionally, the first sequence of the second template nucleic acid is completely complementary to the second target nucleic acid.

Optionally, the above composition further comprises a third template nucleic acid that comprises, from 5' to 3': (i) a first sequence that is at least substantially complementary to a third target nucleic acid; (ii) the sequence of the antisense strand of the nicking agent recognition sequence; and (iii) a second sequence that is exactly identical to the second sequence of the first template.

In another aspect, the present application provides an oligonucleotide template conjugate comprising a first oligonucleotide template and a second oligonucleotide template linked with each other, wherein (i) the first template comprises the sequence of one strand of a first nicking agent recognition sequence; and (ii) the second template comprises the sequence of one strand of a second nicking agent recognition sequence.

Optionally, the first and second oligonucleotide templates are linked with each other via a linker. In some embodiments, the 3' terminus of the first oligonucleotide template is linked to the 5' terminus of the second oligonucleotide template via the linker. In other embodiments, the 3' terminus of the first oligonucleotide template is linked to the 3' terminus of the second oligonucleotide template via the linker. In yet other embodiments, the 5' terminus of the first oligonucleotide template is linked to the 5' terminus of the second oligonucleotide template via the (inker. In certain other embodiments, the 5' terminus of the first oligonucleotide template is linked to the 3' terminus of the second oligonucleotide template via the linker. Optionally, the first oligonucleotide template is identical to the second oligonucleotide template.

Optionally, the first nicking agent recognition sequence is identical to the second nicking agent recognition sequence.

Optionally, the above oligonucleotide template conjugate may further comprise a third oligonucleotide template that comprises one strand of a third nicking agent recognition sequence.

In another aspect, the present invention provides a single-stranded template nucleic acid comprising, from 5' to 3' (A) a first sequence; (B) the sequence of the sense strand of a nicking agent recognition sequence; and (C) a second sequence that is at least substantially complementary to a target nucleic acid; wherein the 5' terminus of the template nucleic acid is immobilized to a solid support, and the 3' terminus of the template nucleic acid is labeled with a detectable group.

Optionally, the nicking agent recognition sequence is recognizable by a nicking endonuclease. Optionally, the detectable group is a fluorescent moiety. In another aspect, the present Invention provides a method of amplifying an oligonucleotide in the presence of a template nucleic acid and a nicking agent, wherein (A) the oligonucleotide is 6-18 nucleotides in length; (B) the template comprises the sequence of one strand of a nicking agent recognition sequence; (C) the nicking agent recognizes the nicking agent recognition sequence; and (D) the amplification has the kinetic that fits the equation where σ₀is an initial concentration of the oligonucleotide, and σ is the concentration of the oligonucleotide after the reaction is performed for a period of t, and β is a constant.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1a. The cycle of the synthesis and release of the amplified oligonucleotide is shown schematically. On the upper strand is indicated the recognition site for the enzyme N.BstNB I (5'-GAGTC-3') and the specific nicking site four bases downstream on this strand. The oligonucleotide produced is indicated in blue, the primer in green and the template in red. The lengths of the exemplary template and amplified oligonucleotides are shown in the upper left drawing.

Figure 1b. The results of a linear amplification reaction where the primer-template duplex produces a 12mer as the full-length product are shown as a function of time. The primer (ITAtop, which is 16 nucleotides long) and the template (NBbt12, which is 28 nucleotides long) for the linear amplification were each present at 0.1 uM in a 50ul reaction (see Example 1).

Figure 2a. The relative yields, of 12mer in a 30-minute reaction are shown as a function of different enzyme concentrations. Yield of a 12-mer from a primer-template duplex as a function of polymerase concentration at 5 different nicking enzyme concentrations. The yield increases as nicking enzyme amounts increase, the optimum polymerase concentration is about 0.05 units per microliter. The nicking enzyme was N.BstNB I and the polymerase was Vent exo^", both from NEB. The sequences of the template and primer oligonucleotides were NBbt12 and ITAtop (as described in detail below), respectively. Figure 2b. The yield of various products is shown as a function of time at a higher concentration of nicking enzyme (0.8 units/ μl) and a DNA polymerase concentration of 0.02 units/ul. The dotted lines represent linear, least squares fits to the data. All possible fragments were produced, albeit at low abundances compared to the full-length product (a 16-mer oligonucleotide) (see Example 1 ). The high concentration of nicking enzyme allowed linearity over about a 60-minute period. The sequences of the template and primer oligonucleotides were NBbt16 and ITAtop (as described in detail below), respectively.

Figure 3a. Diagram of the reaction scheme for the exponential amplification of oligonucleotides is shown. The segments in red represent the sequence complement of the oligonucleotide sequence to be amplified, the signal sequence (shown in blue). The amplification template, τ, consists of two copies of the signal complement flanking the nicking enzyme recognition site shown as a light blue box, and a spacer sequence, shown as a green segment. The signal oligonucleotide (labeled σ) is produced in the linear amplification cycle for each amplification template created. The labels on each structure in the figure correspond to the symbols used for their concentrations in the equations. Figure 3b. Mass spectrometry measurements of the signal oligonucleotide in the reaction scheme of Figure 3a as a function of time is shown. The concentration (M) of the signal oligonucleotide (σ in the equations described below) was measured as described in Example 1. The initial point is not measurable in the mass spectrometer and is the initial concentration introduced into the reaction. The template oligonucleotide and signal (also referred to as "trigger") oligonucleotide are shown in Example 1.

Figure 3c. Solution of the differential equations in the text describing the mass-action kinetics of the reaction scheme of Figure 3a is shown. The kinetic parameters used for this solution were: r = 0.4 sec^"1; a = 2x10^"5; c = 2. The parameter c was chosen to give a reasonable fit to the data, though the curve is not very sensitive to this parameter. The other parameters are determined as described below. The initial concentrations of the trigger oligonucleotide were chosen to match the curves in Figure 3b. The curves of variables {i.e., χ and π) other than σ correspond to the curves below the curve of σ. Figure 3d. Amplification levels are shown as a function of the initial concentrations of the signal oligonucleotide (σ) as described in Example 1. A series of reactions, identical except for the initial concentration of σ, were carried out and the final concentrations of σ measured after 30 minutes. The ratios of these concentrations to the starting concentrations are plotted.

Figure 3e. "Real-time" fluorescence monitoring of the EXPAR reaction was shown. The reaction was carried out under the conditions as described in Example 1. The trigger oligonucleotide, σ, was present at 10^"5 μM at time 0. The fluorescence of SYBR^® green was monitored every 30 seconds in 6 independent, identical reactions. The error bars indicate the standard deviations of these reactions at each time point.

Figure 4a. Schematic representation of a mechanism for amplifying an initial oligonucleotide from naturally occurring nicking sites in targeted DNA is shown. The initial oligonucleotide is also referred to as an "A1" because it is the amplified product of a first amplification reaction. The template (green) (T1 ) is made up of sequences matching the target DNA (orange). The nicking enzyme recognition sequence is shown in yellow (s₀, s-i, the nicking site and the 4 base spacer.) A tilda over a sequence symbol indicates the complement of the sequence. Figure 4b. The sequences of the target sites in the cDNA (N.BstNB I recognition sites are in bold), the template oligonucleotides (also referred to as "probes"), and the signal sequences amplified and measured in the mass spectrometer are shown.

Figure 4c. A table is shown to present the results of experiments designed to detect using triggered EXPAR reactions in the presence of specific cDNA sequences {i.e., SIVA, SOST, and OXY as shown in Figure 4b). The table shows the concentrations of signal sequences in reactions as measured at the signal masses (10λ injection per measurement - see Example 1 ). Figures 5a and 5b. Two alternative EXPAR schemes that can be used for different applications are shown. "Direct EXPAR" (Figure 5a) is the scheme described in Figure 3a in short hand form, in which the trigger sequence (blue) is exponentially amplified using the template (red). The "copy EXPAR" scheme (Figure 5b) consists of two parts. The upper bracket represents a template (T1) with a nicking site in the reverse orientation, relative to those in Figure 3a and the left panel of this figure. This template amplifies the complement of the triggering sequence (including the 5' overhang). The lower bracket represents the exponential amplification of that complement, now containing a copy of the 5' overhang on its 3' end (described in the text). The bases represented by the yellow and purple circles in the copy EXPAR section indicate complementary bases. The base represented by the green circle in the template T2b indicates another base variant.

Figure 6. A schematic representation of a template oligonucleotide used in a replicator type of amplification reactions as described in detailed below. Figure 7. Real time fluorescence detection of the oligonucleotide amplification by an M J Opticon I is shown. The time of amplification is plotted on the X axis versus accumulated fluorescence on the Y axis. Each curve from left to right represents a serial dilution of 3-fold. The starting concentration of the trigger was 0.01 picomoles/microliter and the last dilution (far right curve (bottom curve on figure)) was 1.9 x 10^"7 picomoles/microliter. This represents a dilution range of about 20,000-fold (3⁹).

Figure 8. Real time fluorescence detection of the oligonucleotide amplification by a Roche Light Cycler is shown. The time of amplification is plotted on the X axis versus accumulated fluorescence on the Y axis. Each curve from left to right represents a serial dilution of 3-fold. The starting concentration of the trigger was 0.01 picomoles/microliter.

Figure 9. A plot of relative fluorescence units (fluorescence intensity) on the Y-axis vs. the time of measurement (in seconds, x10, so that 14 represents 140 seconds) for the procedure described in Example 8. Series 1 is 30,000,000 triggers, series 2 is 3,000,000, series 3 is 300,000, series 4 is 30,000, series 5 is 3,000 and series 6 is 300 triggers. Series 7 uses the wrong trigger as a control.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides a new class of isothermal reactions for amplifying DNA that overcomes the disadvantages inherent in PCR. This class includes a linear amplification method and several versions of an exponential amplification scheme. These reactions are simple, flexible, and require no special cycling of conditions. They depend entirely for their rate of amplification on the molecular parameters governing the interactions of the molecules in the reaction. Because of the balance between the thermal properties of the DNA oligonucleotides and the enzymes used, the optimum temperature of the reaction with these enzymes, in certain embodiment, may be about 60°C. The exponential version of the method, designated the exponential amplification reaction (EXPAR), is an isothermal, molecular chain reaction in that the products of one reaction catalyze further reactions that create the same products. The linear version of the method is the basic reaction upon which EXPAR is based.

Conventions/Definitions

Prior to providing a more detailed description of the present invention, it may be helpful to an understanding thereof to define conventions and provide definitions as used herein, as follows. Additional definitions are also provided throughout the description of the present invention.

The terms "3"' and "5"' are used herein to describe the location of a particular site within a single strand of nucleic acid. When a location in a nucleic acid is "3' to" or "3' of a reference nucleotide or a reference nucleotide sequence, this means that the location is between the 3' terminus of the reference nucleotide or the reference nucleotide sequence and the 3' hydroxyl of that strand of the nucleic acid. Likewise, when a location in a nucleic acid is "5' to" or "5' of a reference nucleotide or a reference nucleotide sequence, this means that it is between the 5' terminus of the reference nucleotide or the reference nucleotide sequence and the 5' phosphate of that strand of the nucleic acid. Further, when a nucleotide sequence is "directly 3' to" or "directly 3' of a reference nucleotide or a reference nucleotide sequence, this means that the nucleotide sequence is immediately next to the 3' terminus of the reference nucleotide or the reference nucleotide sequence. Similarly, when a nucleotide sequence is "directly 5' to" or "directly 5' of a reference nucleotide or a reference nucleotide sequence, this means that the nucleotide sequence is immediately next to the 5' terminus of the reference nucleotide or the reference nucleotide sequence.

A "naturally occurring nucleic acid" refers to a nucleic acid molecule that occurs in nature, such as a full-length genomic DNA molecule or an mRNA molecule.

An "isolated nucleic acid molecule" refers to a nucleic acid molecule that is not identical to any naturally occurring nucleic acid or to that of any fragment of a naturally occurring genomic nucleic acid spanning more than three separate genes.

As used herein, a nucleotide sequence ("first sequence"), which is a portion of another nucleotide sequence ("second sequence") located at the 5' terminus of the other nucleotide sequence refers to a 5' terminal sequence of the other nucleotide sequence. In other word, the 5' terminus of the first sequence is identical to that of the second sequence.

As used herein, a nucleotide sequence ("first sequence"), which is a portion of another nucleotide sequence ("second sequence") located at the 3' terminus of the other nucleotide sequence refers to a 3' terminal sequence of the other nucleotide sequence. In other word, the 3' terminus of the first sequence is identical to that of the second sequence.

As used herein, "nicking" refers to the cleavage of only one strand of a fully double-stranded nucleic acid molecule or a double-stranded portion of a partially double-stranded nucleic acid molecule at a specific position relative to a nucleotide sequence that is recognized by the enzyme that performs the nicking. The specific position where the nucleic acid is nicked is referred to as the "nicking site" (NS).

A "nicking agent" (NA) is an enzyme that recognizes a particular nucleotide sequence of a completely or partially double-stranded nucleic acid molecule and cleaves only one strand of the nucleic acid molecule at a specific position relative to the recognition sequence. Nicking agents include, but are not limited to, a nicking endonuclease (e.g., N.BstNB 1) and a restriction endonuclease (e.g., Hinc 11) when a completely or partially double-stranded nucleic acid molecule contains a hemimodified recognition/cleavage sequence in which one strand contains at least one derivatized nucleotide(s) that prevents cleavage of that strand {i.e., the strand that contains the derivatized nucleotide(s)) by the restriction endonuclease.

A "nicking endonuclease" (NE), as used herein, refers to an endonuclease that recognizes a nucleotide sequence of a completely or partially double-stranded nucleic acid molecule and cleaves only one strand of the nucleic acid molecule at a specific location relative to the recognition sequence. Unlike a restriction endonuclease (RE), which requires its recognition sequence to be modified by containing at least one derivatized nucleotide to prevent cleavage of the derivatized nucleotide-containing strand of a fully or partially double-stranded nucleic acid molecule, a NE typically recognizes a nucleotide sequence composed of only native nucleotides and cleaves only one strand of a fully or partially double- stranded nucleic acid molecule that contains the nucleotide sequence.

As used herein, "native nucleotide" refers to adenylic acid, guanylic acid, cytidylic acid, thymidylic acid or uridylic acid. A "derivatized nucleotide" is a nucleotide other than a native nucleotide.

The nucleotide sequence of a completely or partially double-stranded nucleic acid molecule that a NA recognizes is referred to as the "nicking agent recognition sequence" (NARS). Likewise, the nucleotide sequence of a completely or partially double-stranded nucleic acid molecule that a NE recognizes is referred to as the "nicking endonuclease recognition sequence" (NERS). The specific sequence that a RE recognizes is referred to as the "restriction endonuclease recognition sequence" (RERS). A "hemimodified RERS," as used herein, refers to a double-stranded RERS in which one strand of the recognition sequence contains at least one derivatized nucleotide (e.g., α-thio deoxynucleotide) that prevents cleavage of that strand (λe., the strand that contains the derivatized nucleotide within the recognition sequence) by a RE that recognizes the RERS.

In certain embodiments, a NARS is a double-stranded nucleotide sequence where each nucleotide in one strand of the nucleotide is complementary to the nucleotide at its corresponding position in the other strand. In such embodiments, the nucleotide of a NARS in the strand containing a NS nickable by a NA that recognizes the NARS is referred to as a "sequence of the sense strand of the NARS" or a "sequence of the sense strand of the double-stranded NARS," while the nucleotide of the NARS in the strand that does not contain the NS is referred to as a "sequence of the antisense strand of the NARS" or a "sequence of the antisense strand of the double-stranded NARS."

Likewise, in the embodiments where a NERS is a double-stranded nucleotide sequence of which one strand is exactly complementary to the other strand, the nucleotide of a NERS located in the strand containing a NS nickable by a NE that recognizes the NERS is referred to as a "sequence of a sense strand of the NERS" or a "sequence of the sense strand of the double-stranded NERS," while the nucleotide of the NERS located in the strand that does not contain the NS is referred to a "sequence of the antisense strand of the NERS" or a "sequence of the antisense strand of the double-stranded NERS." For example, the recognition sequence and the nicking site of an exemplary nicking endonuclease, N.BstNB t, are shown below with V to indicate the cleavage site and N to indicate any nucleotide: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5'

The sequence of the sense strand of the N.BstNB I recognition sequence is 5'- GAGTC-3', whereas that of the antisense strand is 5'-GACTC-3'.

Similarly, the sequence of a hemimodified RERS in the strand containing a NS nickable by a RE that recognizes the hemimodified RERS (λe., the strand that does not contain any derivatized nucleotides) is referred to as "the sequence of the sense strand of the hemimodified RERS" and is located in "the sense strand of the hemimodified RERS" of a hemimodified RERS-containing nucleic acid, while the sequence of the hemimodified RERS in the strand that does not contain the NS {i.e., the strand that contains derivatized nucleotide(s)) is referred to as "the sequence of the antisense strand of the hemimodified RERS" and is located in "the antisense strand of the hemimodified RERS" of a hemimodified RERS-containing nucleic acid.

In certain other embodiments, a NARS is an at most partially double- stranded nucleotide sequence that has one or more nucleotide mismatches, but contains an intact sense strand of a double-stranded NARS as described above. According to the convention used herein, in the context of describing a NARS, when two nucleic acid molecules anneal to one another so as to form a hybridized product, and the hybridized product includes a NARS, and there is at least one mismatched base pair within the NARS of the hybridized product, then this NARS is considered to be only partially double-stranded. Such NARSs may be recognized by certain nicking agents (e.g., N.BstNB I) that require only one strand of double-stranded recognition sequences for their nicking activities. For instance, the NARS of N.BstNB I may contain, in certain embodiments, an intact sense strand, as follows,

5'-GAGTC-3' 3'-NNNNN-5' where N indicates any nucleotide, and N at one position may or may not be identical to N at another position, however there is at least one mismatched base pair within this recognition sequence. In this situation, the NARS will be characterized as having at least one mismatched nucleotide. In certain other embodiments, a NARS is a partially or completely single-stranded nucleotide sequence that has one or more unmatched nucleotides, but contains an intact sense strand of a double-stranded NARS as described above. According to the convention used herein, in the context of describing a NARS, when two nucleic acid molecules {i.e., a first and a second strand) anneal to one another so as to form a hybridized product, and the hybridized product includes a nucleotide sequence in the first strand that is recognized by a NA, i.e., the hybridized product contains a NARS, and at least one nucleotide in the sequence recognized by the NA does not correspond to, i.e., is not across from, a nucleotide in the second strand when the hybridized product is formed, then there is at least one unmatched nucleotide within the NARS of the hybridized product, and this NARS is considered to be partially or completely single-stranded. Such NARSs may be recognized by certain nicking agents (e.g., N.BstNB I) that require only one strand of double-stranded recognition sequences for their nicking activities. For instance, the NARS of N.BstNB l may contain, in certain embodiments, an intact sense strand, as follows,

5'-GAGTC-3' 3'-No^-5'

(where "N" indicates any nucleotide, 0-4 indicates the number of the nucleotides "N," a "N" at one position may or may not be identical to a "N" at another position), which contains the nucleotide of the sense strand of the double-stranded recognition sequence of N.BstNB I. In this instance, at least one of G, A, G, T or C is unmatched, in that there is no corresponding nucleotide in the complementary strand. This situation arises, e.g., when there is a "loop" in the hybridized product, and particularly when the sense sequence is present, completely or in. part, within a loop.

As used herein, the phrase "amplifying a nucleic acid molecule" or "amplification of a nucleic acid molecule" refers to the making of two or more copies of the particular nucleic acid molecule.

A "tandem amplification system" is a system that comprises two or more nucleic acid amplification reactions in which the amplification product from the first amplification reaction functions as an amplification oligonucleotide or an initial oligonucleotide for the second nucleic acid amplification reaction. The term "nucleic acid amplification reaction" refers to the process of making more than one copy of a nucleic acid molecule (A) using a nucleic acid molecule (T) that comprises a sequence complementary to the nucleotide of nucleic acid molecule A as a template.

An "amplification oligonucleotide," as used herein, is an oligonucleotide that anneals to a template nucleic acid comprising a sequence of an antisense strand of a NARS and provides a 3' hydroxyl group for an initial oligonucleotide extension. The resulting extension product from the initial oligonucleotide extension, that is, the strand containing the nucleotide of the amplification oligonucleotide, is then nicked and the fragment in the same strand containing the 3' terminus at the nicking site then provides 3' hydroxyl group for subsequent oligonucleotide extensions.

An "initial oligonucleotide," as used herein, is an oligonucleotide that anneals to a template nucleic acid and initiates a nucleic acid amplification reaction. An initial oligonucleotide must provide a 3' hydroxyl group for an initial oligonucleotide extension, but need not provide a 3' hydroxyl group for any subsequent oligonucleotide extensions. For instance, assume that a primer P1 anneals to a portion of a template nucleic acid T1 that comprises the sequence of a sense strand of a NARS at a location 3' to the sense strand of the NARS. In the presence of a DNA polymerase, the 3' terminus of P1 is extended using T1 as a template to produce a double-stranded or partially double-stranded nucleic acid molecule (H1 ) that contains the double-stranded NARS. In the presence of a NA that recognizes the NARS, H1 is nicked in the strand complementary to the initial primer P1. The strand that contains the 3' terminus at the nicking site, not the initial primer P1 , may function as a primer for subsequent primer extensions in the presence of the NA and the DNA polymerase. P1 is regarded as an initial oligonucleotide because it functions as a primer only for the first primer extension, but not the subsequent primer extensions.

A "trigger oligonucleotide" is an oligonucleotide that functions as a primer in the first nucleic acid amplification reaction of a tandem nucleic acid amplification system. It triggers nucleic acid amplification in the tandem amplification system in the presence of the other required components of the system (e.g., DNA polymerase, NA, deoxynucleoside triphosphates, the template for the first amplification reaction (T1 ), and the template for the second amplification reaction (T2)). In certain embodiments, when the template for the first amplification reaction (T1 ) comprises the sequence of one strand of a NARS, the trigger ODNP may comprise the sequence of the other strand of the NARS. A trigger ODNP may be derived from a target nucleic acid or may be chemically synthesized. A nucleic acid molecule ("first nucleic acid") is "derived from" or

"originates from" another nucleic acid molecule ("second nucleic acid") if the first nucleic acid is either a digestion product of the second nucleic acid, or an amplification product using a portion of the second nucleic acid molecule or the complement thereof as a template. The first nucleic acid molecule must comprise a sequence that is exactly identical to, or exactly complementary to, at least a portion of the second nucleic acid.

A first nucleic acid sequence is "at least substantially identical" to a second nucleic acid sequence when the complement of the first sequence is able to anneal to the second sequence to form at least a transient duplex under certain reaction conditions (e.g., conditions for amplifying nucleic acids). In certain preferred embodiments, the first sequence is exactly identical to the second sequence, that is, the nucleotide of the first sequence at each position is identical to the nucleotide of the second sequence at the same position, and the first sequence is of the same length as the second sequence.

A first nucleic acid sequence is "at least substantially complementary" to a second nucleic acid sequence when the first sequence is able to anneal to the second sequence to form at least a transient duplex under certain reaction conditions (e.g., conditions for amplifying nucleic acids). In certain preferred embodiments, the first sequence is exactly or completely complementary to the second sequence, that is, each nucleotide of the first sequence is complementary to the nucleotide of the second sequence at its corresponding position, and the first sequence is of the same length as the second sequence. A transient duplex between a first nucleic acid sequence and a second nucleic acid sequence is formed when under given reaction conditions, the 3' terminal group of the first nucleic acid sequence (if unblocked) may be extended by a DNA polymerase using the second nucleic acid sequence as a template; or the 3' terminal group of the second nucleic acid sequence (if unblocked) may be extended by a DNA polymerase using the first nucleic acid sequence as a template. In certain embodiments, at least 80% of the nucleotides of the first nucleic acid in a region of at least 8 nucleotides are complementary to the nucleotides of the second nucleic acid at their corresponding positions. In other embodiments, at least 85%, 90%, 95%, 97%, 98%, or 99% of the nucleotides of the first nucleic acid in a region of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides are complementary to the nucleotides of the second nucleic acid at their corresponding positions.

As used herein, a nucleotide in one strand (referred to as the "first strand") of a double-stranded nucleic acid located at a position "corresponding to" another position (e.g., a defined position) in the other strand (referred to as the "second strand") of a double-stranded nucleic acid refers to the nucleotide in the first strand that is complementary to the nucleotide at the corresponding position in the second strand. Likewise, a position in one strand (referred to as the "first strand") of a double-stranded nucleic acid corresponding to a nicking site within the other strand (referred to as the "second strand") of a double-stranded nucleic acid refers to the position between the two nucleotides in the first strand complementary to those in the second strand between which nicking occurs.

The term "isothermal conditions" refers to a set of reaction conditions where the temperature of the reaction is kept essentially constant {i.e., at the same temperature or within the same narrow temperature range wherein the difference between an upper temperature and a lower temperature is no more than about 20°C) during the course of the amplification. In certain embodiments, a reaction is carried out under conditions where the difference between an upper temperature and a lower temperature is no more than 15°C, 10°C, 5°C, 3°C, 2°C or 1°C. Exemplary temperatures for isothermal amplification include, but are not limited to, any temperature between 50°C to 70°C or the temperature range between 5,0°C to 70°C, 55°C to 70°C, 60°C to 70°C, 65°C to 70°C, 50°C to 55°C, 50°C to 60°C, or 50°C to 65°C.

Linear amplification: An amplification reaction has been devised according to the present invention whereby a cyclic chain of reactions restores the reactants to their initial state after each synthesis of the molecule to be amplified. The linear amplification reaction described herein provides such a cycle whose sequence specificity derives from template-dependent synthesis of the oligonucleotide to be amplified. The reaction synthesizes short oligonucleotides whose cycle of reactions depends on the idea that, at the reaction temperature, oligonucleotides above a certain length form stable duplexes, while those below this length form unstable duplexes that dissociate readily. By arranging a specific, single-strand nicking site and nicking enzyme and a compatible DNA polymerase (see Morgan, R.D., Calvet, C, Demeter, M., Agra, R., Kong, H. (2000) Characterization of the specific DNA nicking activity of restriction endonuclease N.BstNBI. Biol. Chem. 381(11), 1123- 1125; and Kong, H., Kucera, R.B., Jack, W.E. (1993) Characterization of a DNA polymerase from the hyperthermophile archaea Thermococcus litoraiis. Vent DNA polymerase, steady state kinetics, thermal stability, processivity, strand displacement, and exonuclease activities. J. Biol. Chem. 268(3), 1965-1967) as described in Figure 1a, a cycle of polymerization and subsequent oligonucleotide release can be set up. The cycle shown in Figure 1a depends on the nicking reaction cleaving a phosphodiester bond to create an oligonucleotide that is below the threshold of stability, and is thereby released from the duplex regenerating the initial primer template. The synthesized oligonucleotide is fully stable at 60°C when it is covalently joined to the rest of the upper strand, as it is immediately after its synthesis, but is only transiently stable as a short oligonucleotide which it becomes after the nicking reaction. Therefore, when the bond is cleaved at the nicking site the oligonucleotide soon dissociates recreating a primer template ready for elongation. This cycle thus creates oligonucleotides that are complementary to the template beyond the nicking site. When the nicking enzyme is also present with a compatible polymerase the reaction proceeds around the cycle shown in Figure 1a, and amplification of the product oligonucleotide occurs. In Figure 1 b we show the results of one of these reactions. The experiment was devised to produce a I2mer as its amplified product. The products of the reaction were analyzed on an LC-MS system after the indicated incubation times at 60°C. Since the exact masses of all of the relevant molecules are known, the relative concentrations of all the components, including the amplified oligonucleotide, can be directly measured. The yield of oligonucleotide is perhaps best characterized in this case as the number of molecules produced per primer-template, per second. For the experiment shown in Figure 1b, this initial rate is about one molecule (12rner) per primer-template every 2.5 seconds, or a rate of ~0.4 molecules/ primer-template • sec. Note that the reaction slows down noticeably after 10 minutes or so. This effect is consistent with the reaction rate declining exponentially, as if an essential component of the reaction is being inactivated. We expect that inactivation of the nicking enzyme is responsible, as the optimum temperature (~55°C) of the enzyme is lower than the 60°C of the reaction, and preliminary experiments show a clear difference in the rate decline between different starting nicking enzyme (NE) concentrations - more enzyme makes the reaction stay linear longer. An extensive set of experiments (data not shown) show that the absolute initial rate of the reaction is proportional to the primer-template concentration, as expected, over a wide range of concentrations. The balance between the nicking enzyme and the DNA polymerase is more complex.

To investigate this relationship we examined the dependence of the reaction yield (12mer product) on- the amounts of the two enzymes. It is clear that the reaction is completely dependent on the presence of both enzymes, the template, and the primer oligonucleotide, but the yield is a complex function of the amounts of both enzymes. What we see from Figure 2a is that for small amounts of nicking enzyme (NE) there is a broad range of similar, albeit low, reaction yields. At higher NE concentrations there is a sharper maximum as a function of polymerase concentration. What is particularly striking is that the DNA polymerase sharply decreases the yield when present at higher concentrations, while the yield ^ι plateaus with nicking enzyme increases, but does not decrease except at rather extreme concentrations (not shown). In addition, it is clear from the data that we can modulate, to some extent, the yield of partial products by changing the ratio of the enzymes. It is also clear that there are optimal concentration ranges of both enzymes for full size product yield under the conditions used here. These optimal concentrations can be readily determined as described herein. If we amplify an oligonucleotide of length 16 bases, and examine the yield of full and partial products at the elevated NE concentrations we see that the extension leads to some partial products (see for example the 12mer yield in Figure 2b). These products are seen by their masses to be the result of incomplete elongation of the primer to the full length of the template. It happens that the reaction favors 12mers as partial products for reasons not well understood, but may have to do with the structural details of the distributive nature of the polymerase (Kong, H., Kucera, R.B., Jack, W.E. (1993) Characterization of a DNA polymerase from the hyperthermophile archaea Thermococcus litoraiis. Vent DNA polymerase, steady state kinetics, thermal stability, processivity, strand displacement, and exonuclease activities. J. Biol. Chem. 268(3), 1965-1967). This phenomenon has been seen with several different template sequences. Tuning the reaction conditions, including the enzyme concentrations, thus appears to be important for maximizing the yield of any particular product. In the present experiments full-length product is optimal.

Exponential Amplification:

We have devised a simple way to use the above-described linear amplification to create an exponential amplification reaction. It has several variants that can be adapted for different uses. The key idea is to arrange it so that the oligonucleotide product of the linear reaction serves to create a new primer that in turn anneals to a target template and creates a new primer-template, which in turn produces more of the same oligonucleotide product, creating a chain reaction. A simple scheme for doing this is depicted in Figure 3a. The scheme is based on our observation that even though the product oligonucleotide is unstable as a duplex it will form a transient duplex molecule with its complement and this transient duplex can act as a primer for extension by the DNA polymerase. Once extension of the oligonucleotide has occurred the duplex is stabilized by the additional complementary duplex section and will not readily dissociate. Extending the primer thus creates a stable primer-template that will produce oligonucleotide products in a linear fashion.

To create these new duplexes we need only provide a ready supply of complementary oligonucleotides that we call amplification templates. The key feature of these single-stranded oligonucleotides is that they contain two copies in tandem of the complement of the oligonucleotide product to be amplified, separated by the complement of the nicking enzyme recognition site (3'-CTCAG- 5') and a four base spacer (on the 5' side). When the transient duplex is extended a stable new primer-template is created. This primed template will then continue to produce oligonucleotide product via the linear amplification cycle as described above (nicking after the four base spacer, dissociating the oligonucleotide and re- elongating the primer) as long as the enzymes remain active and dNTPs are available.

We have considered what happens when a transient duplex is formed with the second copy of the complementary sequence (right-most copy in Figure 3a). The thermodynamics of the situation are essentially the same as after the extended product has been nicked. The big difference is that there can be no extension to stabilize the duplex by elongating it as it provides no primer template structure for the polymerase, and it rapidly dissociates. If the amplification templates are present at a high concentration (experiments reported here use 0.01- 0.1 μM) we can rapidly create primer-template structures that will produce product oligonucleotide at an accelerating rate. In our reactions we take the precaution of blocking the 3' ends of the template oligonucleotides (with 3' PO (phosphate) groups) to prevent spurious self-priming by pairs of template molecules. We have seen no such spontaneous priming in any of our experiments to date (data not shown). Finally, it is clear that when all of the template molecules have been converted into primer-template duplex, the exponential reaction must change over to a linear amplification. While it is intuitively clear that there will be an approximately exponential increase in the product oligonucleotide in a reaction that proceeds as just described, it is informative to look carefully at the mass action reaction equations. If we write out these equations making the simplest assumptions we can show that indeed the kinetics of product generation are predicted to be exponential in character while the template lasts. The solution of the mass action equations using parameters estimated from our experimental results is shown in Figure 3c.

The simplified mass action equations use the following variables: a - annealing rate between the product oligonucleotide concentration, σ, and the amplification template concentration, r, χ - the concentration of the transient complex between σ and τ ; π - the concentration of the primer-template formed by extension of the complex; c - the rate of conversion of χ to π ; r- the rate of oligonucleotide production (σ) by each primer-template. The equations, using the simplifying assumptions that annealing is a single step, bimolecular reaction and that the conversion of χ into π can be represented as a simple, effective rate, are then

dσ dχ dπ dτ

^■ = rπ~aτσ —^ - aτσ -cχ , — = cχ , — -aστ dt dt dt dt

σ can easily be shown from these equations to exhibit exponential behavior. The exponential phase occurs before the template becomes depleted, but after π reaches a steady ratio with χ. In this regime the equation for σ has the approximate solution

σ* σ_σe ^{β t}, where β = (τ(0) a r/2)^1/2- aτ(0) Note that the exponent does not depend on c which is useful in checking the consistency of the model parameters. A more direct method is simply to solve the above equations computationally using a direct, finite difference method. The results of a finite difference solution of the equations clearly show clearly the regime to which the exponential solution applies (see Figure 3b). To examine the kinetics of amplification we carried out the full exponential reaction in the presence of differing initial amounts of amplifying oligonucleotide (σ in Figure 3a) and measured the amounts of σ at a number of time points with the mass spectrometer. We find that the oligonucleotide amplifies approximately exponentially for the first two minutes or so, as shown in Figure 3b. Note that this amplification proceeds exponentially until the concentration of σ approaches the concentration of the template pool. After this point it proceeds in an approximately linear fashion, as expected. The total amplification is approximately 10⁶-10⁷ in the figure shown. In Figure 3d, we show the results of end-point measurements in the same reaction for a range of starting concentrations, in these reactions we see that the amplification levels are all in the range of 10⁶.

Since the EXPAR reaction is rapid and simple it is potentially appealing as a "real time" reaction in which the amplification is monitored in the reaction volume during the reaction itself. To test this possibility we carried out the reaction as described above with the addition of a "double-strand specific" dye, SYBR^® Green, to the reaction, and the reaction was carried out on a temperature- controlled fluorescence reader which was used to make measurements of fluorescence at regular time intervals. The fluorescence in this case is generated during the amplification reaction, not by the presence of the amplified oligonucleotide itself, but rather from the double-stranded primer-templates produced during the reaction (π in Figure 3a). The results of this experiment are shown in Figure 3e. Mass spectrometry measurements show that the amplification in this case was approximately 10^δ- 10⁷fold. To optimally use the amplification reactions described here, the reactions require agitation or some type of mixing. In order to sustain an exponential reaction, the primer oligonucleotides need to diffuse to the template oligonucleotide where a priming and elongation event occurs. Under isothermal conditions {i.e., 5 to 30 minutes at 60°C), there is little mixing or convection in a solution sitting in a reaction vessel of some type. Typical reaction volumes are 1 to 50 microliters in containers like wells of a microwell plate, strips of microtubes, or glass capillaries. Even though the primer oligonucleotides are typically relatively small (6 nucleotides to 16 oligonucleotides), we have discovered that the reaction solutions require some type of mixing in order to maximize the rate of duplex or trigger formation. The solutions can be mixed as by thermocycling below the maximum reaction temperature (as an example, if the reaction temperature condition was 60°C, a thermocycle step of 30°C would be introduced (60°C to 30°C, 1 second hold, the ramp from 30°C to 60°C). This cycle is repeated as necessary, for example every minute. The magnitude of the cycle can be 5°C, 10°C, 15°C, 20°C, 30°C, up to 50°C. The minimum temperature is about 5°C. The upper limit depends on the thermal stability of the nicking enzyme and or polymerase. Alternatively, the reaction can be mixed sonically or mechanically, by application of a potential or electrical field, by the use of microfluidics or nanotechnology or nano-motors, by changing pressure over the solution, or by the use of entropic effects, gas generation or gas consumption, or enzymatic reactions, etc.

Triggering mechanisms

To initiate the exponential reaction we need to produce from the sample the first few oligonucleotide molecules to form the first primer-templates, which then will start generating the amplified signal oligonucleotides. These first produced oligonucleotides must be accurate representations of the sample sequence to be amplified. The mechanism by which these first few oligonucleotides are produced is called the triggering mechanism for EXPAR. There are several ways to do this, each of which requires that we provide a 3'OH group-terminated strand of DNA that can anneal with a complementary template to form a primer-template with the proper configuration and sequence. One of these triggering schemes, and probably the simplest, relies on the natural occurrence of nicking enzyme recognition sites (5'-GAGTC-3') in the DNA of interest. For example, as is shown in Figure 4a, a linear amplifier of a genomic sequence can be created by providing an oligonucleotide template (T1, shown as the green line) that is complementary to the genomic DNA flanking a specific nicking site. When the template (T1 ) is annealed to the genomic DNA this creates a structure that the nicking enzyme can convert to a primer template structure, similar to the linear amplification structure shown in Figure 1a. This structure will then produce an oligonucleotide (A1 ) corresponding to the sequence to the right of the nicking site. This sequence (A1 ) can either be identical to the genomic sequence, as shown in the figure, or be another specified sequence if the template (T1 ) is complementary to the genomic DNA only at the 3' portion of the template. In either case it is this oligonucleotide (A1 ) that is used as an initial primer for a subsequent exponential amplification reaction. Since the nicking enzyme recognition sequence occurs naturally in both bacterial and human DNA at the expected frequency for a 5 base sequence (about 1 in 1000), potential trigger sites abound for amplifying oligonucleotides to be used as primers in exponential amplification reactions.

To demonstrate the triggering from a naturally occurring nick site we specifically amplified certain oligonucleotides contained in cDNA (Figure 4b). In Figure 4c the results of EXPAR reactions triggered from 3 different cDNAs are shown. A different cDNA sequence was present in each of three of the reactions and no cDNA sequence at all in the fourth. All the template oligonucleotides were present in the same concentrations in all the reactions. The cDNAs, if present in the reaction, were at 0.2 picomolar concentrations. This experiment demonstrates the power of the chain reaction to detect the presence of very small amounts of the cDNAs, and the strict dependence on the triggering reaction to do so.

In certain naturally occurring target nucleic acids, two nicking endonuclease recognition sequences may be near to one another. Thus, in the presence of a nicking agent that recognizes the recognition sequences in the target nucleic acids, relatively short single-stranded nucleic acids may be amplified. Such amplification can be performed even in the absence of the template (T1 ) shown in Figure 4a.

We can also easily construct variant forms of the above triggering reaction using any technique that creates a discrete 3' end in the target DNA - by using a restriction site, for example. This fragment is then annealed to a template (T1 ), just as shown in Figure 4a except that the formed duplex only contains the antisense strand of the nicking enzyme recognition sequence in T1 and does not contain the sense strand of the nicking enzyme recognition sequence in the fragment generated from a restriction digestion. Polymerase-based extension of this primed template can then create a duplex nicking site and complete the amplifying structure. The key to creating an oligonucleotide to be used as a primer in the exponential reaction is simply to make a structure strictly dependent on the target DNA that will linearly amplify a target oligonucleotide. Alternatively, oligonucleotides (A1 ) used as primers in a subsequent amplification reaction may be generated or amplified by the following procedure: A target nucleic acid is made single-stranded (if necessary) by denaturation. The resulting single-stranded target nucleic acid is then annealed to a first oligonucleotide, where the first oligonucleotide contains the sense strand of a nicking enzyme recognition sequence. The resulting duplex may be extended from the 3' terminus of the first oligonucleotide by a DNA polymerase. The extension product may then be nicked in the presence of a nicking enzyme. The extension-nicking cycle is repeated to amplify a second single-stranded oligonucleotide (A1 ) that may be used as a primer in another amplification reaction. In some embodiments, the first oligonucleotide is 18 to 50 nucleotides in length, preferably 24 to 35 nucleotides in length. In addition, the oligonucleotide contains the sequence 5'-GAGTC-3', which may be 4 to 16 (including all the integer values therebetween) nucleotides apart from the 3' terminus of the first oligonucleotide. The oligonucleotide needs to be at least substantially complementary to a portion of a single-stranded (or single strand) target nucleic acid so that it anneals to that portion of the target nucleic acid. The sequence GAGTC may or may not form complete base pairs with its corresponding portion of the target nucleic acid. That is, the GAGTC in the triggering oligonucleotide can be entirely mismatched, or partially mismatched, or fully matched. We have discovered that certain nicking enzymes (e.g., N.BstNB I) will bind to and nick a duplex containing only the sense strands of their recognition sequences (e.g., GAGTC). The region consisting of the four bases directly 3' to the 3' terminus of the sense strands of the recognition sequences is generally required to be base paired with (i.e., fully complementary to) the corresponding region in the target nucleic acid.

In certain embodiments, a double-stranded target nucleic acid is placed in 0.5x N.BstNB I buffer and 1x Thermopol buffer (both from New England Biolabs, MA). The denaturation can be achieved by heating to 95°C for 1 to 5 minutes. The triggering oligonucleotide is added to the mixture prior to the denaturation step. The temperature is lowered to 55 to 65°C using a slow ramp period of 1-10 minutes. During this process the triggering oligonucleotide hybridizes to the target oligonucleotide. The following reagents are then added to the above reaction mixture: N.BstNB I nicking enzyme (NEB, MA), Vent exo^' DNA polymerase and dNTPs (all from NEB, MA). The reaction is allowed to proceed at 60°C in a closed container, tube, microwell plate well, or slide. During the reaction, the triggering oligonucleotide is elongated by the polymerase, the nicking enzyme then nicks the elongated strand to release a short oligonucleotide (A1). The remaining portion of the duplex is again elongated, nicked and the cycle continues. During the reaction, the short oligonucleotide (A1) may be amplified 10 to 1000 fold depending on the length of the reaction.

Variant Amplification Schemes

The present invention provides several variant forms of the exponential amplification scheme shown in Figure 3a. One, in particular, has been devised to provide an accurate copy of a polymorphic site that can subsequently be amplified. This latter scheme, illustrated in Figure 5b in a shorthand form, is contrasted with the "direct" EXPAR scheme described above, and is called "copy EXPAR". The "copy EXPAR" scheme, shown on the right of the figure, is slightly more complex than "direct EXPAR", shown on the left, in that there is a second template, whose amplification reaction is driven by the products from the first template. The first reaction (upper bracket in Figure 5b) is essentially a linear amplification of the oligonucleotide trigger with the polymorphic base on its 5' end. Since the nicking sequence is reversed relative to the orientation shown in Figure 3a, and the template (T1 ) does not include this 5' base, the reaction shown in the upper bracket of Figure 5b amplifies an oligonucleotide with a 3' terminal base in the template that matches the polymorphic base {i.e., the red fragment with a purple disc at its 3' terminus). The amplification reaction then produces the complement of this oligonucleotide with an accurate copy of the polymorphism at its 3' end. The second bracket indicates the exponential amplification of the product of this first reaction, shown in the same short-hand as for the left side of the figure.

The effect of the two reactions as shown is to amplify the complement of the triggering oligonucleotide (shown in blue). The scheme enables the creation of a template that carries an extra base, which can be interrogated for polymorphic variation by the mass of the resulting amplified oligonucleotide. This polymorphic variation (or its complement) is shown as the yellow (or purple) disc in the figure. There are two (or more) second templates (T2a, T2b, etc.) available, each cognate to a different extra base. The figure shows the amplification of a sequence with the purple variant (triggered by its complement). Thus, the scheme can be used to detect, and measure polymorphisms in the target DNA. Such detection may be facilitated by immobilizing the second templates on different areas (elements) of a solid support. Oligonucleotide amplification on different areas of the solid support may be monitored by the use of a fluorescence dye specific for double-strand nucleic acids.

Another variation (referred to as "the replicator type") uses three oligonucleotides: one for triggering the reaction, and the other two as amplification templates. The method will amplify as little as 1 molecule to a level of 10¹² molecules in 1 to 10 minutes. In this variation, a trigger of sequence S primes a first template oligonucleotide T1 (S is about 8 to 16 nucleotides in length) to form the following partially double-stranded nucleic acid molecule. The 3' terminus of T1 may be blocked by a phosphate group.

5' s 3'

3' s' NNNNCTGAG 5' (T1 ) In the presence of a DNA polymerase, the upper strand of the above partially double-stranded nucleic acid molecule is elongated to form the following fully double-stranded nucleic acid molecule:

5' s NNNNGACTC 3' 3' S' NNNNCTGAG 5' (T1)

In the presence of a nicking enzyme (e.g., N.BstNB I), the lower strand is nicked to generate a 3' hydroxyl group and release an oligonucleotide blocked at the 3' terminus (un-productive oligonucleotide). The resulting nicked structure is shown below:

5' s NNNNGACTC 3'

3'-NNNNCTGAG 5' (T1) The DNA polymerase uses S as a template and fills in the recessed

3' hydroxyl group of the lower strand to produce the following double-stranded nucleic acid.

5' s NNNNGACTC 3'

3' s' NNNNCTGAG 5' (T1 )

The nicking enzyme cleaves the lower strand, releasing an oligonucleotide having the sequence S' (which is completely complementary to the sequence S) as shown below:

5' s NNNNGACTC 3'

3'-NNNNCTGAG 5' (T1) +

5' s' 3'

The lower strand of the above partially double-stranded nucleic acid may be extended again to produce a fully double-stranded nucleic acid molecule. The lower strand of the fully double-stranded nucleic acid may be nicked again to release another oligonucleotide having the sequence S'. The above extension and nicking cycle may be repeated multiple times, resulting in the amplification of the oligonucleotide having the sequence S'. This oligonucleotide (S') is capable of priming the oligonucleotide template T2 to follow a partially double-stranded nucleic acid molecule as shown below:

5- S' 3'

3' s NNNNCTGAG 5' (12) In the presence of a DNA polymerase, the upper strand of the above partially double-stranded nucleic acid molecule is elongated to form the following fully double-stranded nucleic acid molecule:

5' S' NNNNGACTC 3' 3' S NNNNCTGAG 5' (T2) In the presence of a nicking enzyme (e.g., N.BstNB I), the lower strand is nicked to generate a 3' hydroxyl group and release an oligonucleotide blocked at the 3' terminus (un-productive oligonucleotide). The resulting nicked structure is shown below:

5' S' NNNNGACTC 3'

3'-NNNNCTGAG 5' (T2)

The DNA polymerase uses S' as a template and fills in the recessed 3' hydroxyl group of the lower strand to produce the following double-stranded nucleic acid:

5' S' NNNNGACTC 3'

3' s NNNNCTGAG 5' (T2)

5' S' NNNNCTGAG 3' 3'-NNNNGACTC 5' (T2)

+ 5' s 3'

The lower strand of the above partially double-stranded nucleic acid may be extended again to produce a fully double-stranded nucleic acid molecule. The lower strand of the fully double-stranded nucleic acid may be nicked again to release another oligonucleotide having the sequence S. The above extension and nicking cycle may be repeated multiple times, resulting in the amplification of the oligonucleotide having the sequence S. The two oligonucleotides having the sequences of S and S' are now capable of priming T1 and T2, respectively, and the exponential amplification is started. It should be noted that S and S' are sufficiently short (e.g., 8-16 nucleotides in length) which prevents the triggers from forming a stable duplex in a reaction mixture under conditions for exponential amplification {e.g., 60°C). This variation of exponential amplification has a substantial advantage of requiring a very high level of stringency of an oligonucleotide priming its template. We have discovered that the oligonucleotide (e.g., an oligonucleotide having the sequence S or S') has to be nearly perfectly based paired with its template for an exponential amplification reaction to start. In many cases, even a single mismatch in the oligonucleotide will inhibit the reaction.

To carry out the exponential reaction, some or all of the following components may be used in certain embodiments.

1 ) The first template oligonucleotide (T1 ). A schematic representation of T1 is shown in Figure 6. T1 may be 24 to 60 nucleotides

(including all the integer values therebetween), preferably 32-36 nucleotides in length. The 3'-end of T1 may be blocked with, for example, a phosphate, an amine, a biotin, a dideoxy group or a fluorophore (that is, there is no free 3'- hydroxyl in T1) to prevent extension by a polymerase. The region from the 3' terminus of T1 to the fifth nucleotide directly 3' to the 3' terminus of the sense strand of a nicking endonuclease recognition sequence (e.g., GAGTC) (i.e., Region I in Figure 6) may be 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides in length and is completely (or at least substantially) complementary to the sequence S. To the 5' side of the above region are 4 nucleotides of any sequence (Region II in Figure 6) over which a nicking endonuclease (e.g., N.BstNB I) reaches to nick. Next in the 5' direction is the sequence 3'-CTGAG-5' which is the sense strand of the recognition sequence for a nicking enzyme (e.g., N.BstNBI). Further in the 5' direction is about 10 to 20 nucleotides of any sequence (Region 111 in Figure 6). The sequence at the 5' end should not be complementary to any of the sequence at the 3'-end. The concentration of T1 is 0.001 to 1 micromolar if in solution. T1 can also be tethered to a solid support or covalently attached to any type of solid support.

2) The second template oligonucleotide (T2). Similar to T1 , T2 may be 24 to 60 nucleotides (including all the integer values therebetween), preferably 32-36 nucleotides, in length. The 3'-end of T2 may be blocked with, for example, a phosphate, an amine, a biotin, a dideoxy group or a fluorophore (that is, there is no free 3'-hydroxyl in T2) to prevent extension by a polymerase. The region from the 3' terminus of T2 to the fifth nucleotide directly 3' to the 3' terminus of the sense strand of a nicking endonuclease recognition sequence (e.g., GAGTC) may be 8, 9, 10, 11 , 12, 13, 14, 15 or 16 nucleotides in length and is at least substantially complementary to the sequence S'. To the 5' side of the above region are 4 nucleotides of any sequence over which a nicking endonuclease (e.g., N.BstNB I) reaches to nick. Next in the 5' direction is the sequence "CTGAG" which is the sense strand of the recognition sequence for a nicking enzyme (e.g., N.BstNBI). Further in the 5' direction is about 10 to 20 nucleotides of any sequence. The sequence at the 5' end should not be complementary to any of the sequence at the 3'-end. The concentration of T2 is 0.001 to 1 micromolar if in solution. T2 can also be tethered to a solid support or covalently attached to any type of solid support. 3) A DNA polymerase such as exo^" Vent, 9°N_m™, Taq, or Bst at a concentration of 0.002 to 20 units per microliter. Preferably the concentration of the polymerase is 0.02 to 0.5 units per microliter. The enzyme is typically available commercially in 100 mM KCI, 0.1 mM EDTA, 10 mMTris-HCI (pH 7.4), 1 mM DDT, and 50% glycerol. 4) A nicking enzyme such as N.BstNB I (from New England

Biolabs, (NEB), MA) at a concentration of 0.002 to 20 units per microliter. Preferably the concentration of the nicking enzyme is 0.02 to 0.5 units per microliter. The enzyme is supplied in 50 mM KCI, 10 mMTris-HCI (pH 7.5), 0.1 mM EDTA, 1 mM DTT, 200 ug/ml BSA and 50% glycerol. 5) A salt (e.g., MgCI₂ or MgSO₄) at 0.5 to 10 mM in concentration. Preferably the concentration is 2 to 6 mM.

6) A salt (e.g., (NH₄)₂SO₄) in the 5 to 50 mM range, preferably 10 mM.

7) A salt (e.g., KCI) at 20 to 200 mM. 8) A buffer (e.g., Tris-HCl), pH 7-8, preferably 7.5 in the 10-50 mM range of concentrations, preferably 0 mM.

9) A reducing agent (e.g., dithiothreitol (DTT)) in the 0.5 to 5 M range, preferably 1 M. 10) A detergent (e.g., Triton X-100), in the 0.01% to 1% range

(V/V), preferably 0.01% final concentration (V/V).

Because T1 and T2 contain the sequences S' and S, respectively, and these two sequences are complementary to each other, T1 and T2 may anneal to each other to form the following partially double-stranded nucleic acid:

(T1 ) 5' GAGTCNNNN S^f 3'

3' s NNNNCTGAG 5' (12)

To prevent the extension of the above partially double-stranded nucleic acid from the 3' terminus of the upper and lower strands, the 3'-termini of T1 and T2 may be blocked so that no free 3'-hydroxyl groups are available for extension. Alternatively, T1 and T2 molecules may be immobilized in different regions of a solid substrate or different solid substrates (e.g., microbeads).

A further variation is to include an additional template (referred to as "bleed-out template") in an exponential amplification reaction. The exponential amplification reaction may be any one as described above (e.g., replicator or EXPAR). The bleed-out template is used to produce a short oligonucleotide that does not participate in the exponential reaction. However, this short oligonucleotide may function as a signal sequence for mass spectrometry to detect the presence of a trigger oligonucleotide or a template oligonucleotide. An exemplary bleed-out template is shown below.

3- S' CTCAGNNNN -T 5'

In this variation, a triggering sequence (e.g., an oligonucleotide having the sequence S) made in the exponential reaction can prime the bleed-out template and amplifies an oligonucleotide having the sequence T (which complements with the sequence T in the bleed-out template). The sequence T can be sensitively detected by mass spectrometry. The signal sequence T is not complementary to any other sequences used in the amplification process to be used as a primer. In certain embodiments, this signal sequence is generally 6 to 9 nucleotides in length. The bleed-out sequence is used at concentration about equal to, or greater than the other template(s) in the amplification reaction.

Another variation of exponential amplification is to amplify an oligonucleotide having a specific sequence in the presence of any one of several target nucleic acids. This variation may use a template nucleic acid that contains multiple sequences that are complementary to several target nucleic acids linked with each other.

An example of such template nucleic acids is shown below:

5'— A'-B'-C'-D'-E'-F' CTCAGNNNN -Z' 3' where A', B', C, D', E', F\ etc. are all sequences of 8-16 nucleotides in length and are complementary to target nucleic acid having the sequences A, B, C, D, E, F, etc. The length of such a template can be 30 to about 5000 nucleotides in length, with no real upper value the length. .

Alternatively, multiple template nucleic acids may be used. An example of a set of multiple template nucleic acids is shown below:

5' A' CTCAGNNNN Z -3' 5' B' CTCAGNNNN Z -3'

5' C' CTCAGNNNN 71 -3'

5^< D' CTCAGNNNN Z -3'

5' E' CTCAGNNNN Z -3'

5' F' CTCAGNNNN Z -3'

where A', B', C, etc. are all sequences of 8-16 nucleotides in length and are complementary to target nucleic acid having the sequences A, B, C, etc. The length of such templates can be 30 to 50 nucleotides in length, but all the templates are generally contained in a single well, tube or reaction vessel.

In order for the reactions to amplify exponentially, the oligonucleotide having the sequence Z (which is complementary to the sequence Z' in the templates) in the presence of one or more target nucleic acids must be used as a primer in another amplification reaction. In other words, either the single template nucleic acid containing sequences (e.g., A', B', C, etc) complementary to multiple target nucleic acids linked together or multiple template nucleic acids each having a sequence (e.g., A', B', C, etc) complementary to a target nucleic acid need be used in combination of the amplification reactions described above (e.g., replicator or EXPAR) so that the sequence Z may be used as a primer to initiate an additional amplification reaction.

Another variation on the amplification reaction is to covalently join template oligonucleotides to one another or to a polymer. The template oligonucleotides can be bound to each other using simple cross-linking chemistries such as 3'-amines or 5' amines (or both) and a crosslinker like cyanuric chloride. The template oligonucleotides can be linked, for example, as follows:

1 ) 5' A 3'-linker-3' B 5'

2) 5' A 3'-linker-3' A 5'

3) 5' B 3'-linker-3' A 5'

4) 3' A 5'-linker-5' B 3'

5) 3' A 5'-linker-5' A 3'

6) 3' B 5'-linker-5' A 3'

7) 3' A 5'-linker-3' B 5'

8) 3' A 5'-linker-3' A 5'

9) 3' B 5'-linker-3' A 5' where A and B represent individual template oligonucleotides as described above. Alternatively, a template may be a multimer formed by linking multiple molecules of a single template nucleic acid (e.g., A-linker-A-linker-A-linker-A-linker-A-linker-A) or by linking multiple molecules of different template nucleic acids (e.g., A-linker-B- linker-A-linker-B-linker-A-linker-B). The multimers can be linear or circular. The minimum number of individual template nucleic acid molecules to be cross-linked are 2, the maximum number is 1 billion. Preferably, 2 to 400 individual template molecules are to linked together. Also preferably, the template nucleic acids are linked together at the 3' end of their individual components to prevent self- or mis- priming reactions. Linking individual template oligonucleotides together may also increase the rates of reactions. The above multimers (also referred to as "oligonucleotide conjugates") can be easily prepared and purified by size exclusion chromatography or HPLC.

Template oligonucleotides can also be cross-linked onto dendrimer polymers, or polymers like polylysine, poly(ethyleneimine). The template oligonucleotides can be bound to the polymers using simple cross-linking chemistries such as 3'-amines or 5' amines (or both) and a crosslinker like cyanuric chloride. Oligonucleotides-polymer conjugates can be easily prepared and purified by size exclusion chromatography. The variations described above may be combined with each other or with the linear amplification or exponential amplification schemes. For instance, an oligonucleotide conjugate may be used as a template to amplify a primer that may be used in an EXPAR amplification reaction.

Nicking agents: It should be understood that in the above description of linear and exponential application reactions (including variations thereof), the sequence 5'- GAGTC-3' (or the sequence 5'-GATCT-3') in trigger oligonucleotides or template oligonucleotides is only an example of the sequence of the sense strand (or the antisense strand) of a nicking enzyme recognition sequence, and other sense strand (or antisense strand) sequences may also be used. In addition, as described in detail below, certain restriction endonucleases may also be used to nick nucleic acids and function as a nicking agent, thus one strand of the recognition sequences of these restriction endonucleases may also be used to substitute 5'-GAGTC-3' (or the sequence 5'-GATCT-3') in trigger oligonucleotides or template oligonucleofides.

A nicking endonuclease (NE) useful in the present invention may or may not have a nicking site that overlaps with its recognition sequence. An exemplary NE that nicks outside its recognition sequence is N.BstNB I, which recognizes a unique nucleic acid sequence composed of 5'-GAGTC-3', but nicks four nucleotides beyond the 3' terminus of the recognition sequence. The recognition sequence and the nicking site of N.BstNB I are shown below with "▼" to indicate the cleavage site where the letter N denotes any nucleotide:

T

5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5'

N.BstNB I may be prepared and isolated as described in U.S. Pat. No. 6,191 ,267, incorporated herein by reference in its entirety. Buffers and conditions for using this nicking endonuclease are also described in the '267 patent. An additional exemplary NE that nicks outside its recognition sequence is N.AIwl, which recognizes the following double-stranded recognition sequence:

T

5'-GGATCNNNNN-3' 3'-CCTAGNNNNN-5'

The nicking site of N.AIwl is also indicated by the symbol "▼"• Both NEs are available from New England Biolabs (NEB). N.AIwl may also be prepared by mutating a type Hs RE Alwl as described in Xu et al. (Proc. Natl. Acad. Sci. USA 98:12990-5, 2001 ). Exemplary NEs that nick within their NERSs include N.BbvCI-a and N.BbvCI-b. The recognition sequences for the two NEs and the NSs (indicated by the symbol V) are shown as follows:

N.BbvCI-a

T

5'-CCTCAGC-3^* 3'-GGAGTCG-5^*

N.BbvCI-b

5'-GCTGAGG-3' 3'-CGACTCC-5'

Both NEs are available from NEB.

Additional exemplary nicking endonucleases include, without limitation, N.BstSE I (Abdurashitov et al., Mol. Biol. (Mosk) 30: 1261-7, 1996), an engineered EcoR V (Stahl et al., Proc. Natl. Acad. Sci. USA 93: 6175-80, 1996), an engineered Fok I (Kim ef al., Gene 203: 43-49, 1997), endonuclease V from Thermotoga maritime (Huang et al., Biochem. 40: 8738-48, 2001), Cvi Nickases (e.g., CviNY2A, CviNYSI, Megabase Research Products, Lincoln, Nebraska) (Zhang et al., Virology 240: 366-75, 1998; Nelson et al., Biol. Chem. 379: 423-8, 1998; Xia et al., Nucleic Acids Res. 16: 9477-87, 1988), and an engineered Mly I (t^'.e., N.MIy !) (Besnier and Kong, EMBO Reports 2: 782-6, 2001). Additional NEs may be obtained by engineering other restriction endonuclease, especially type Hs restriction endonucleases, using methods similar to those for engineering EcoR V, Alwl, Fok I and/or Mly I. A restriction endonuclease useful as a nicking agent can be any restriction endonuclease (RE) that nicks a double-stranded nucleic acid at its hemimodified recognition sequences. Exemplary REs that nick their double- stranded hemimodified recognition sequences include, but are not limited to Ava I, Bsl 1, BsmA I, BsoB I, Bsr I, BstN I, BstO I, Fnu4H I, Hinc II, Hind II and Nci I. Additional REs that nick a hemimodified recognition sequence may be screened by the strand protection assays described in U.S. Pat. No. 5,631,147.

In certain embodiments, a nicking agent may recognize a nucleotide sequence in a DNA-RNA duplex and nicks in one strand of the duplex. In certain other embodiments, a nicking agent may recognize a nucleotide sequence in a double-stranded RNA and nicks in on strand of the RNA.

Certain nicking agents require only the presence of the sense strand of a double-stranded recognition sequence in an at least partially double-stranded substrate nucleic acid for their nicking activities. For instance, N.BstNB I is active in nicking a substrate nucleic acid that comprises, in one strand, the sequence of the sense strand of its recognition sequence "5'-GAGTC-3"' of which one or more nucleotides do not form conventional base pairs (e.g., G:C, A:T, or A:U) with nucleotides in the other strand of the substrate nucleic acid. The nicking activity of N.BstNB I decreases with the increase of the number of the nucleotides in the sense strand of its recognition sequence that do not form conventional base pairs with any nucleotides in the other strand of the substrate nucleic acid. However, even if none of the nucleotides of "5'-GAGTC-3"' form conventional base pairs with the nucleotides in the other strand, N.BstNB I may still retain 10-20% of its optimum activity.

DNA polymerases:

In addition to a nicking agent, the present application also requires a DNA polymerase. Various types of DNA polymerase may be used. For instance, DNA polymerases useful in the present invention may be any DNA polymerase that is 5'- 3' exonuclease deficient but has a strand displacement activity. Such DNA polymerases include, but are not limited to, exo^" Deep Vent, exo^" Bst, exo^" Pfu, and exo^" Bca. Additional DNA polymerase useful in the present invention may be screened for or created by the methods described in U.S. Pat. No. 5,631,147, incorporated herein by reference in its entirety. The strand displacement activity may be further enhanced by the presence of a strand displacement facilitator as described below.

Alternatively, in certain embodiments, a DNA polymerase that does not have a strand displacement activity may be used. Such DNA polymerases include, but are not limited to, exo^" Vent, Taq, the Klenow fragment of DNA polymerase I, T5 DNA polymerase, and Phi29 DNA polymerase. In certain embodiments, the use of these DNA polymerases requires the presence of a strand displacement facilitator. A "strand displacement facilitator" is any compound or composition that facilitates strand displacement during nucleic acid extensions from a 3' terminus at a nicking site catalyzed by a DNA polymerase. Exemplary strand displacement facilitators useful in the present invention include, but are not limited to, BMRF1 polymerase accessory subunit (Tsurumi et al., J. Virology 67: 7648-53, 1993), adenovirus DNA-binding protein (Zijderveld and van der Vliet, J. Virology 68: 1158-64, 1994), herpes simplex viral protein ICP8

(Boehmer and Lehman, J. Virology 67: 711-5, 1993; Skaliter and Lehman, Proc. Natl. Acad. Sci. USA 91: 10665-9, 1994), single-stranded DNA binding protein (Rigler and Romano, J. Biol. Chem. 270: 8910-9, 1995), phage T4 gene 32 protein (Villemain and Giedroc, Biochemistry 35: 14395-4404, 1996), calf thymus helicase (Siegel et al., J. Biol. Chem. 267: 13629-35, 1992) and trehalose. In one embodiment, trehalose is present in the amplification reaction mixture.

Additional exemplary DNA polymerases useful in the present invention include, but are not limited to, phage M2 DNA polymerase (Matsumoto et al., Gene 84: 247, 1989), phage PhiPRDI DNA polymerase (Jung et al., Proc. Natl. Acad. Sci. USA 84: 8287, 1987), T5 DNA polymerase (Chatterjee era/., Gene 97: 13-19, 1991), Sequenase (U.S. Biochemicals), PRD1 DNA polymerase (Zhu and Ito, Biochim. Biophys. Acta. 1219: 267-76, 1994), 9°N_m™ DNA polymerase (New England Biolabs) (Southworth et al., Proc. Natl. Acad. Sci. 93: 5281-5, 1996; Rodriquez etal., J. Mol. Biol. 302: 447-62, 2000), and T4 DNA polymerase holoenzyme (Kaboord and Benkovic, Curr. Biol. 5: 149-57, 1995).

Alternatively, a DNA polymerase that has a 5'->3' exonuclease activity may be used. For instance, such a DNA polymerase may be useful for amplifying short nucleic acid fragments that automatically dissociate from the template nucleic acid after nicking.

In certain embodiments where a nicking agent nicks in the DNA strand of a RNA-DNA duplex, a RNA-dependent DNA polymerase may be used. In other embodiments where a nicking agent nicks in the RNA strand of a RNA- DNA duplex, a DNA-dependent DNA polymerase that extends from a DNA primer, such as Avian Myeloblastosis virus reverse transcriptase (Promega) may be used. In both instances, a target mRNA need not be reverse transcribed into cDNA and may be directly mixed with a template nucleic acid molecule that is at least substantially complementary to the target mRNA.

Implementation formats

The nucleic acid amplification reactions described above may be carried out in various formats. For instance, the reactions may be performed in a mixture where all the components are soluble. Alternatively, one or all of the template(s) can be covalently attached at the 3' end or the 5' end to a solid phase with the use of cross-linkers or spacers. The solid phase includes (without limitation) nylon tip beads, opie tips, microbeads, microplate wells, membranes, slides, arrays, and the materials of which the solid phase is made include glass, nylon 6/6, silica, plastics like polystyrene, polymers like poly(ethyleneimine), etc. For example, a replicator type of exponential amplification reaction may be performed using immobilized templates. More specifically, the first template (T1) molecules may be linked to beads, while the second template (T2) molecules are linked to different beads. The beads linked with T1 molecules may be mixed with the beads linked with T2 molecules in a reaction mixture to amplify two oligonucleotides (i.e., S and S' as described above in the context of the replicator type of amplification reaction). In addition, such a reaction may be carried out to amplify multiple oligonucleotide sequences. Beads linked with template molecules other than T1 and T2 molecules may be included in the reaction mixture so that oligonucleotides other than S and S' may also be amplified.

It is also possible and advantageous to perform amplification reactions (e.g., direct EXPAR as described above) on arrays of immobilized oligonucleotides. The arrays can be composed of elements separated spatially on a 2-dimensional solid support. Suitable solid supports include, but are not limited to, glass slides, wafers, beads, microbeads, rods, ribbons, nylon6/6, nylon parts, polymer-coated solid supports, wells, etc. The arrays can be further assembled on a 3-dimensional solid support.

In such a reaction, the amplification template (e.g., r in Figure 3a) is immobilized to a solid support at its 5' end or its 3' end, preferably at its 3'-end. There may or may not be any spacer between the template oligonucleotide and the solid support. The immobilized template, when annealing to a trigger oligonucleotide, may be used as a template to amplify an oligonucleotide having a sequence identical to the trigger oligonucleotide. The newly synthesized oligonucleotide then primes an adjacent template oligonucleotide in the element on (or in) the array and an exponential amplification reaction takes place. Oligonucleotide amplification is detected by employing a DNA binding dye that preferentially binds to double strand DNA (e.g., SYBR^® green).

The assay described here has the advantage of not requiring a washing step. This is different from known assays performed on arrays that contain a hybridization step using a labeled probe (usually labeled with a fluorescent moiety). In such assays, the arrays need to be washed before the elements on the arrays are interrogated for fluorescence. Each element in the array can represent an individual or unique sequence. In a 2- or 3-dimensional array, the spatial distribution of different elements permits multiple levels of multiplexing. That is, multiple different sequences can be detected using a single array. Trigger (or primer) oligonucleotides may be obtained from a single source or multiple sources to initiate amplifications on one or more elements of an array.

Immobilized templates may also be used to perform a replicator type reaction in the presence of a bleed-out template. Such a reaction may be conducted under multiplexing conditions to amplify multiple oligonucleotides (or nucleic acids). Multiplexing may be accomplished by the use of a multimer template nucleic acid or a set of multiple templates that amplify oligonucleotides with identical or different sequences as described in detail above. The use of immobilized template oligonucleotides prevents annealing between template molecules, and increases reaction rates. In addition, the bleed-off template allows detection by mass spectrometry of a signal oligonucleotide, and a high level of multiplexing can be achieved by the use of relatively large solid phases (like 3/32^nd inch nylon beads).

Signal readout formats

Methods and devices known in the art for detecting oligonucleotides may be used for detecting or characterizing the amplified oligonucleotides prepared as described herein. Such methods and devices include liquid chromatography, electrophoresis and automated clinical analyzers. Other exemplary methods and devices are described below.

Labeling amplified nucleic acids The present amplification reaction may be carried out in the presence of a labeled deoxynucleoside triphosphate so that the label is incorporated into the amplified nucleic acid molecules. Labels suitable for incorporating into a nucleic acid fragment, and methods for the subsequent detection of the fragment are known in the art, and exemplary labels include, but are not limited to, a radiolabel such as ³²P, ³³P, ¹²⁵l or ³⁵S, an enzyme capable of producing a colored reaction product such as alkaline phosphatase, fluorescent labels such as fluorescein isothiocyanate (FITC), biotin, avidin, digoxigenin, antigens, haptens, or fluorochromes.

Use of labeled detector oligonucleotides

Alternatively, amplified nucleic acid molecules may be detected by the use of a labeled detector oligonucleotide that is substantially, preferably completely, complementary to the amplified nucleic acid molecules. Similar to a labeled deoxynucleoside triphosphate, the detector oligonucleotide may also be labeled with a radioactive, chemiluminescent, or fluorescent tag (including those suitable for detection using fluorescence polarization or fluorescence resonance energy transfer), or the like. See, for example, Spargo et al., Mol. Cell. Probes 7: 395-404, 1993; Hellyer et al., J. Infectious Diseases 173: 934-41, 1996; Walker et al., Nucl. Acids Res. 24: 348-53, 1996; Walker et al., Clin. Chem. 42: 9-13, 1996; Spears et al., Anal. Biochem. 247: 130-7, 1997; Mehrpouyan et al., Mol. Cell. Probes 11: 337-47, 1997; and Nadeau et al., Anal. Biochem. 276: 177-87, 1999.

Mass spectrometry The various amplification reactions described above may be readout by mass spectrometry. All types of HPLC or LC methods can be coupled to either ESI-based mass spectrometry or APCI-based mass spectrometry. Mass spectrometer detectors include Time-of-Flight instruments, such as the LCT from Micromass (Manchester UK) and quadrupole-based instruments (Waters, Milford, MA). MALDI mass spectrometers are also useful for mass spectrometry-based readouts. MALDI instruments are available from Micromass (Manchester, UK). Real-time Fluorescence

The various amplification reactions described above may also be readout by detectors that measure real-time fluorescence, such as the MJ Opticon from MJ Research (Boston, MA), the ABI Prism 7000 instrument (Foster City, CA), and endpoint plate readers, such as the Ultramark from Biorad (Hercules, CA). Real time monitoring is a very useful method as it enables parameters such as initial rates to be determined with accuracy and ease. The use of double-strand specific fluorescent dyes such as SYBR^® green from Molecular Probes (Eugene OR) is especially useful when used during the amplification reactions described above. Dyes that bind to single strand nucleic acids can also be used, perhaps at times with slightly less efficacy than double-strand specific dyes. Currently, there are four types of detection chemistries that can be used for real time fluorescence readout: intercalating dyes such as SYBR^®, dual labeled probes, FRET (fluorescent energy transfer) probes and Molecular Beacons. Exemplary fluorescent intercalating agents include, without limitation, those disclosed in U.S. Pat. Nos. 4,119,521 ; 5,599,932, 5,658,735; 5,734,058; 5,763,162; 5,808,077; 6,015,902; 6,255,048 and 6,280,933, those discussed in Glazer and Rye, Nature 359: 859-61 , 1992, PicoGreen dye, and SYBR^® dyes such as SYBR^® Gold, SYBR^® Green I and SYBR^® Green II (Molecular Probes, Eugene WA). Fluorescence produced by fluorescent intercalating agents may be detected by various detectors, including PMTs, CCD cameras, fluorescent-based microscopes, fluorescent-based scanners, fluorescent-based microplate readers, fluorescent- based capillary readers.

In certain embodiments, a signal template oligonucleotide is labeled with a fluorophore at its 3' terminus and immobilized at its 5' terminus. The oligonucleotide contains the sense strand of a nicking endonuclease recognition sequence (e.g., the sequence 5'-GAGTC-3'), which is at least 5 nucleotides distal to the 3' end of the template oligonucleotide {i.e., there are at least 5 bases between the "C" in the sequence GAGTC and the 3' fluorescent moiety). The oligonucleotide may be about 16 to 50 bases in length, preferably about 36 bases in length.

An exemplary template is shown below:

Solid phase-5' GAGTCNNNN 3'-fluorescent moiety

An oligonucleotide generated from an amplification reaction as described above primes the signal template oligonucleotide to produce a partially double strand nucleic acid as shown below:

3' 5'

Solid phase-5' GAGTCNNNN 3'-fluorescent moiety

In the presence of a DNA polymerase, the upper strand of the above nucleic acid is extended to produce the following nucleic acid:

3' CTCAGNNNN 5'

Solid phase-5' GAGTCNNNN 3'-fluorescent moiety

A nicking enzyme (e.g., N.BstNB I) binds to the above nucleic acid and cleaves the lower strand between the fourth and fifth nucleotides 3' to the "C" of the sequence 5'-GAGTC-3' in the lower strand as shown below. The fluorescent moiety is released into solution and can be readily measured:

3' CTCAGNNNN 5'

Solid phase-5' GAGTCNNNN-3'

+ 3'-fluorescent moiety The fluorescent moiety can be composed of a single fluorochrome (e.g., fluorescein, Texas Red, Rodamine, Cy5, etc.) or a mixture of different fluorophores or fiuorochromes that generate complex patterns of emissions (e.g., a fluorescent microbead, a fluorescent polymer labeled with multiple identical or different fiuorochromes, etc.).

The background of such a signal system can be made to be extremely low. This is due to the fact that the solid support can be placed some distance from the fluorescence detector. There can be in essence, no intrinsic fluorescent background. The solid support having the tethered (i.e., immobilized) signal oligonucleotide can be placed in the vicinity of another solid support containing different tethered oligonucleotides. The solid support having the tethered signal oligonucleotides can be placed in a microfluidic device, or the solid support itself can be a microfluidic device.

Applications The amplification scheme(s) described herein has several major advantages for many research and diagnostic applications. These include the isothermal conditions required, the relative speed of the reaction and the flexibility with which it can be elaborated into multiple, coupled reactions. We have shown clearly that the linear amplification reaction can be turned into a rather simple exponential amplification scheme (EXPAR). In contrast to the strand displacement amplification scheme (Walker, G.T., Little, M.C., Nadeau, J.G., Shank, D.D. (1992) Isothermal in vitro amplification of DNA by a restriction enzyme/DNA polymerase system. Proc. Natl. Acad. Sci. USA, 89(1), 392-396), the amplification method of the present invention depends fundamentally on the transformation of duplex thermal stability into instability by the cleavage of a phosphodiester bond in the nicking reaction. We have demonstrated this distinction by experiments that physically separate the polymerization step from the nicking and release steps by using the enzymes separately (data not shown). Since the reaction is a true molecular chain reaction, once the reaction is triggered it will proceed without change of the conditions or further stimulus. There is a concern therefore that the reaction may spontaneously, or spuriously trigger. We have taken the precaution of blocking the 3' ends of all templates present to prevent them acting as primers through mis-pairing with each other, and have never seen any spurious priming at the concentrations of template used in these reactions (up to 0.1 μM). This potential source of spurious priming is present only because of the high concentrations of the templates. The full range of possible amplification levels of triggering DNA sequences is not yet fully known. We routinely get 10⁶-10⁷fold amplification within a few minutes, but have observed amplification levels as high as 10⁸-fold.

The variant forms of the amplification reaction attest to a flexibility of the method. One of the major variants, we called "copy" EXPAR, results in the amplification of the complement of the initiating oligonucleotide, and can actually copy variant forms of that sequence by amplifying the result of a copied mismatched primer. This reaction can thus be used to amplify and characterize polymorphic sites in genomic DNA. The "copy EXPAR" reaction diagrammed in Figure 5b depends for its specificity (that is, giving only the appropriate product) on a phenomenon that appears to be particular to the transient annealing and priming process that creates the primer templates. That process, in which an oligonucleotide transiently anneals to the template and is extended by the polymerase, is sharply inhibited by mis-pairing near the 3' end - much more so than inhibition by mispairing of a more stable priming duplex (data not shown). It is sufficiently inhibited that we get no detectable amplification when we attempt to prime with such a mis-paired oligonucleotide (data not shown).

The amplification reactions described here have a wide variety of uses. In addition to the application in genotyping as described above, these reactions may be used to monitor or detect pathogens, algae, and microorganisms (including those that can be used for bio-terrorism) in water, food (or food containers), ecosystem, livestock, and agricultural products, and to characterize gene expression.

The following examples are provided by way of illustration and not limitation.

EXAMPLES

EXAMPLE 1 LINEAR AND EXPONENTIAL AMPLIFICATION OF SHORT OLIGONUCLEOTIDES

This example provides exemplary conditions under which linear and exponential amplification of short oligonucleotides may be performed.

Oligonucleotides and enzymes:

The following oligonucleotides were used in the linear reaction as described in Figures 1b, 2a and 2b.

Primer oligonucleotides

ITAtop: 5'-CCGATCTAGTGAGTCGCTC-3'

Template oligonucleotide

NBbt12 : 5'-ACGACTGGAACTGAGCGACTCACTAGATCGG-3' NBbt16 : 5'-ACCTACGACTGGAACTGAGCGACTCACTAGATCGG-3'

The following oligonucleotides were used in the exponential reaction described in figures 3b-3c. Template oligonucleotide

ceap : 5' CCTACGACTGGAACAGACTCACCTACGACTGGAP- 3'

Primer oligonucleotide

seqS : 5'- aCCAGTCGTAGG -3'

(P indicates phosphate group, the sense and antisense strands of the N.BstNB I recognition sequence are indicated by an underline in all above sequences) Note that the primer oligonucleotide above (i.e., seqS) is one base longer than the oligonucleotide {i.e., 5'-CCAGTCGTAGG-3') amplified from the primer-template duplex. This makes it simple for us to distinguish the primer oligonucleotide (i.e., seqS) from the amplified sequence. In addition, the above design of the primer oligonucleotide does not affect its ability to prime the template effectively.

The above oligonucleotides were synthesized by Midland Certified Reagent Company, Inc. (Midland, TX), MWG Biotech, Inc. (High Point NC), or Sigma-Genosys (The Woodlands, TX). The oligonucleotides were routinely checked by time-of-flight mass spectrometry (using LCT from Micromass, see below).

All enzymes were all purchased from New England Biolabs. The DNA polymerase used was Exo^" Vent (Kong, H., Kucera, R.B., Jack, W.E. (1993) Characterization of a DNA polymerase from the hyperthermophile archaea Thermococcus litoraiis. Vent DNA polymerase, steady state kinetics, thermal stability, processivity, strand displacement, and exonuclease activities. J. Biol. Chem. 268(3), 1965-1967). The nicking enzyme (N.BstNBI) has a specific activity of approximately 10⁶ units/mg (H.-M. Kong, unpublished). All HPLC components (water and acetonitrile) were purchased from Fisher Scientific (Pittsburgh, PA). The dimethy-butylamine was purchased from Sigma-Aldrich Corp. (St. Louis, MO) and a salt was made by the addition of acetic acid (Sigma Aldrich) to pH 8.4. The 2 molar stock solution was filtered using a 0.2 micron nylon filter.

Linear Amplification Reaction:

The conditions for the linear reaction were: 85 mM KCI, 25 mM Tris- HCI (pH 8.8 at 25°C), 2.0 mM MgSO₄, 5 mM MgCI₂, 10 mM (NH₄)₂SO₄, 0.1% (vol/vol) Triton X-100, 0.5 mM DTT, 0.4 U/ul N.BstNB I nicking enzyme, 0.05 U/ul Exo^" Vent polymerase, 400uM dNTPs (Ambion, Austin, TX), 10 ug/ml BSA, 1.0 uM template and primer oligonucleotides (ITAtop and NBbt12) (equimolar) in ultra- pure water that is nuclease-free (Ambion)). These conditions correspond to 1 part of Thermopol buffer and 0.5 parts of N.BstNB I buffer as supplied by New England Biolabs. Reactions were assembled at 4°C, initiated by transferring to a preheated thermocycler at 60°C, and stopped by incubation at 4°C. No further manipulations were performed prior to placement on the auto-injector that is held at 4°C.

Exponential Amplification Reaction:

The exponential reactions were also carried out at 60°C, temperature controlled to be within 0.1° C. The exponential reaction conditions were the same as described above for the linear reaction except with 0.1 uM template oligonucleotide only (unless otherwise noted). Primer oligonucleotides were added as described for each experiment. In the case of fluorescence monitoring, SYBR^® green (Molecular Probes) was added to 5x concentration (SYBR^® green is supplied by the manufacturer at a concentration of 10,000X). Chromatography and Mass Spectrometry

The chromatography system was an Agilent 1100 Series HPLC composed of a binary pump, degasser, a column oven, a diode array detector, and thermostatted microwell plate autoinjector (Agilent Technologies, Palo Alto, CA). The column is a Waters Xterra MS C18, incorporating C18 packing with 3.5 uM particle size, with 125 Angstrom pore size, 2.1 mm x 20 mm (Waters Inc. Milford, MA). The column was run at 30°C with a gradient of acetonitrile in 5mM dimethyl- butylamine acetate (DMBAA). As a check on the complete release of an amplified oligonucleotide during the chromatography and injection we ran the column at 50° after incubating the sample briefly at 95°C. We saw no increase in the oligonucleotide yield over our standard conditions. Buffer A is 5mM DMBAA, buffer B is 5mM DMBAA and 50% (V/V) acetonitrile. The gradient begins at 10%B and ramps to 15%B over 0.3 minute, to 30%B over 2 minutes, to 90%B over 0.5 minute, to 10%B over 0.25 minute, then holds at 10%B for 1.25 minutes. The column temperature was held constant at 30°C. The flow rate was 0.25 ml/minute. The injection volume was 10 ul. Flow rate into the mass spectrometer was also 0.25 ml/min. The mass spectrometer is a Micromass LCT Time-of-Flight with an electrospray inlet (Micromass Inc. Manchester UK). The samples were run in electrospray negative mode with a range from 800 to 2000 amu using a 1 second scan time. Source parameters: Desolvation gas 450 L/hr, Capillary 2225V, Sample cone 30V, RF lens 400V, extraction cone 7V, desolvation temperature 275°C, Source temperature 120°C. Analysis of the LC-mass spectrometry data made use of the software supplied by the manufacturer.

Oligonucleotides are known to exhibit different ionization efficiencies, which in our measurements would be translated into sequence-specific differences in measured oligonucleotide concentration. A survey of a range of more than 80 different 12mers indicated that the variation between sequences attributable to this difference is less than 30%. Almost all relevant quantitative comparisons are with the same oligonucleotide sequence. It is necessary, however, to calibrate for quantitative comparisons between different sequences.

EXAMPLE 2 REPLICATOR TYPE OF OLIGONUCLEOTIDE AMPLIFICATION

The oligonucleotide sequences used in this example are as follows (with the sense strand of the N.BstNB I recognition sequence underlined and a phosphate group at 3' terminus indicated by "P"):

The first template (T1 )

IBceapSP = 5'- ATGCATGCATGAGTCACAACCTACGACTGG P-3'

Trigger oligonucleotide

seqS = 5'- aCCAGTCGTAGG -3'

The second template oligonucleotide (T2)

IBceapS = 5'- ATGCATGCATGAGTCACAACCAGTCGTAGG P-3'

Alternative trigger oligonucleotide

seqSP = 5'- aCCTACGACTGG -3' Alternative first template (T1') when mass spectrometry is used to detect amplified oligonucleotide

I BceapSPm = 5'- ATGCATGCATGAGTCACAACCTACGACTGGAAAA P-3'

The trigger seqS may start the reaction by binding to the first template oligonucleotide T1 (t^'.e., IBceapSP). Alternatively, the alternative trigger seqSP may start the reaction by binding to the second template oligonucleotide T2 (i.e., IBceapS). If seqS is present in the initial reaction mixture, the amplification cycle is initiated by the annealing of seqS to T1 followed by extension of seqS using T1 as a template by a DNA polymerase. The T1 strand is cleaved in the presence of N.BstNB I, releasing the oligonucleotide 5'-CCTACGACTGGP-3'. The remaining portion of the T1 strand is extended using seqS as a template and, then cleaved to release the oligonucleofide 5'-CCTACGACTGGt-3'. The extension- cleaving cycle is repeated multiple times, resulting the amplification of the above oligonucleotide {i.e., 5'-CCTACGACTGGt-3'). This amplified oligonucleotide then anneals to T2 and is extended by a DNA polymerase. The T2 strand is cleaved by N.BstNB I, releasing the oligonucleotide 5'-CCAGTCGTAGGP-3'. The remaining portion of the T2 strand is extended using the above amplified oligonucleotide {i.e., 5'-CCTACGACTGGt-3') as a template and then cleaved to release the oligonucleotide 5'-CCAGTCGTAGG-3'. The extension-cleaving cycle is repeated multiple times, resulting the amplification of the above oligonucleotide {i.e., 5'- CCAGTCGTAGG-3'). This amplified oligonucleotide {i.e., 5'-CCAGTCGTAGG-3') then primes T1 and the cycle is repeated and the exponential amplification reaction is started.

If the alternative trigger (seqSP) is present in the initial reaction mixture, the amplification cycle is initiated by the annealing of seqSP to T2 followed by extension of seqSP using T2 as a template by a DNA polymerase. The T2 strand is cleaved in the presence of N.BstNB I, releasing the oligonucleotide 5'-CCAGTCGTAGGP-3'. The remaining portion of the T2 strand is extended using seqSP as a template and then cleaved to release the oligonucleotide 5'-CCAGTCGTAGGt-3'. The extension-cleaving cycle is repeated multiple times, resulting the amplification of the above oligonucleotide (i.e., 5'- CCAGTCGTAGGt-3'). This amplified oligonucleotide then anneals to T1 and is extended by a DNA polymerase. The T1 strand is cleaved by N.BstNB I, releasing the oligonucleotide 5'-CCTACGACTGGP-3'. The remaining portion of the T1 strand is extended using the above amplified oligonucleotide (i.e., 5'- CCAGTCGTAGGt-3') as a template and then cleaved to release the oligonucleotide 5'-CCTACGACTGG-3'. The extension-cleaving cycle is repeated multiple times, resulting the amplification of the above oligonucleotide {i.e., 5'- CCTACGACTGG-3'). This amplified oligonucleotide (i.e., 5'-CCTACGACTGG-3') then primes T2 and the cycle is repeated and the exponential amplification reaction is started.

The reaction conditions are: 85 mM KCI, 25 mM Tris-HCI (pH 8.8 at 25°C), 2.0 mM MgSO₄, 5 mM MgCI₂, 10 mM (NH₄)₂SO₄, 0.1% Triton X-100, 0.5 mM DTT, 0.4 units N.BstNB I nicking enzyme (NEB), 0.05 units 9°N_m™ DNA polymerase (NEB), 0.2 M Trehalose, 600 micromolar dNTPs, 10 micrograms/ml BSA (NEB), 0.1 micromolar template oligonucleotide in ultra-pure water that is nuclease free (Ambion). In the case of fluorescence monitoring, SYBR^® green (Molecular Probes) was added to 5x concentration (SYBR^® green is supplied by the manufacturer at a concentration of 10,000X).

The following reaction mixture was assembled in a 5 ml polypropylene tube on ice (4°C).

100 ul lOx Thermopol Reaction buffer

50 ul 10x N.BstNB I buffer

1 ul template oligonucleotide T1 at 100 uM stock

1 ul template oligonucleotide T2 at 100 uM stock 24 ul 25 mM dNTPs

1 ul 10 mg/ml BSA

40 ul N.BstNB I nicking enzyme at 10 units/ul

24 ul 9°N_m™ DNA polymerase 760 ul ultra-pure water

The reaction was mixed to homogeneity with a 1 ml pipetor. In a set of 12 microtubes, 120 ul was added to the first tube, then 80 ul was aliquoted over the remaining 11 tubes. The trigger oligonucleotide(s) was diluted 1-1000 from the stock concentration of 100 uM, to a final concentrafion of 0.1 uM. One microliter of the 0.1 uM solution was added to the first tube, then eleven 3-fold dilutions were made by transferring 40 ul from the first tube and mixing. The serial dilutions were made on ice. The tubes were capped and then incubated at 60°C for the times indicated. The reaction was stopped by placing the tube at 4°C or on ice.

In the case of real time fluorescence monitoring, an MJ Opticon was programmed as follows: Incubate the reaction mixture for 1 minute at 60°C, read plate, and repeat the incubation-reading plate cycle nine more times.

The data from the MJ Opticon is as follows:

Read* Cycle* Step* A1 A2 A3 A4 AS A6 A7 A8 A9 A10 A11 A12

1 1 2 0128046 01485 0161408 0164963 0167681 0157263 015164 0147126 0168339 014914 0143644 0133121

2 2 2 0165069 0175484 018395 0186111 0187796 0173571 0168418 016475 019013 0167293 0161788 0147754

3 3 2 0243122 0228875 0223781 022292 0222131 0202743 0196445 0192024 022189 019403 0187079 0169358

4 4 2 03288 0289224 026795 0261181 0258058 0233274 0225503 0220908 0253681 0220813 0213776 0 91471

5 5 2 0408918 0348146 0310746 0299058 029428 0262728 0252691 024903 0284911 0245821 0237843 0212426

6 6 2 047699 040238 0351655 0336259 0327854 0291047 0279201 0276299 0314497 0270086 0261809 0232674

7 7 2 0529418 0455267 0390384 0371448 0359009 0317695 0304786 0301726 0342336 0293182 0284277 0251841

8 8 2 0568091 0502951 0428259 0405857 039009 0343244 0329164 0327073 0368776 031448 0305113 0270293

4030218 3274672 244309 2197462 2022941 1696725 1607461 1623233 178646 1471866 1433252 122539

The data in line 10 is the difference between the values in lines 9 and 3 times 100. The results indicate that the lowest level of detection was the 11^th and last dilution (14.33 RFU vs 12.25 RFU for the control, see line 10 in the table above). In the case of analysis by mass spectrometry the following methods were used: The plate was loaded onto the LC/MS (Micromass LTD, Manchester UK and Beverly, MA, USA), which is a LCT time-of-flight using electrospray in the negative mode. The conditions are as follows:

The chromatography system is an Agilent HPLC-1100 composed of a binary pump, degasser, a column oven, a diode array detector, and thermostatted microwell plate autoinjector (Palo Alto, CA). The column is a Waters Xterra, incorporating C18 packing with 3 uM particle size, with 300 Angstrom pore size, 2.1 mm x 50 mm (Waters Inc. Milford, MA). The column was run at 30C with a gradient of acetonitrile in 5 mM Triethylamine acetate (TEAA). Buffer A is 5 mM TEAA, buffer B is 5 mM TEAA and 25% (V/V) acetonitrile. The gradient begins with a hold at 10%B for one minute then ramps to 50%B over 4 minutes followed by 30 seconds at 95%B and finally returning to 10%B for a total run time of six minutes. The column temperature was held constant at 30C. The flow rate was 0.416 ml per minute. The injection volume was 10 microliters. Flow into the mass spectrometer was 200ul/min, half the LC flow was diverted to waste using a tee. The mass spectrometer is a Micromass LCT Time-of-Flight with an electrospray inlet (Micromass Inc. Manchester UK). The samples were run in electrospray negative mode with a scan range from 700 to 2300 amu using a 1 second scan time. Instrument parameters were: TDC start voltage 700, TDC stop voltage 50, TDC threshold 0, TDC gain control 0, TDC edge control 0, Lteff 1117.5, Veff 4600. Source parameters: Desolvation gas 862 L/hr, Capillary 3000V, Sample cone 25V, RF lens 200V, extraction cone 2V, desolvation temperature 250C, Source temperature 150C, RF DC offset 1 4V, FR DC offset 2 1 V, Aperture 6V, Acceleration 200V, Focus, 10V, Steering 0V, MCP detector 2700V, Pusher cycle time (manual) 60, Ion energy 40V, Tube lens 0V, Grid 2 74V, TOF flight tube

4620V, Reflectron 1790V. Generally the mass to charge ratios larger than 14,000 will not be recorded.

In this amplification reaction, IBceapSP was replaced with IBceapSPm and all the other components were the same as in the exponential amplification reactions that used fluorescence measurements as the detection method. The following trigger is exponentially amplified: The duplex that is made during the reaction that produces the trigger is as follows:

3'- TACGTACGTACTCAGTGTTGGATGGTGACCA

5'- ATGCATGCATGAGTCACAACCTACGACTGGAAAA P-3'

which produces 5'-cctacgactggt-3' which has m/z(3) = 1249.13, m/z(4) = 936.6.

The following extracted ion currents were monitored:

1249.13 with a mass/charge ratio = 3.

The results of the amplification are shown in the following table:

Dilution picomoles per microliter Relative mass units (RMU)

1 5 X 10^"4 28.1

2 1.6 X 10^"4 17.2

3 5.5 x 10^"5 9.6

4 1.8 x 10^"5 5.8

5 6.1 x 10^"6 4.5

6 2.0 x 10^"6 3.5

7 6.9 x 10^"7 2.8

8 2.2 x 10^"7 2.6

9 7.6 x 10^"8 1.2

10 2.5 x 10^"a 0.9

11 8.4 x 10^'9 0.6

12 none <0.02 EXAMPLE 3

EXPONENTIAL AMPLIFICATION OF A SINGLE OLIGONUCLEOTIDE TEMPLATE AND MEASURING THE REACTION USING A BLEED-OUT OLIGONUCLEOTIDE BY MASS

SPECTROMETRY

In this example, EXPAR is combined with the use of a bleed-out template. The template oligonucleotide and the bleed-out template have the following structures:

Template for EXPAR:

5' S' NNNNGACTCA S' A 3'

Bleed-out template

5' -p NNNNGACTC S' 3'

where S' and T' represent two different oligonucleotide sequences. An oligonucleotide (referred to as "signal oligonucleotide") complementary to T1 produced in the reaction does not further function as a primer, thus does not participate in the exponential amplification, but rather "bleeds" the reaction and accumulates in the reaction mixture. T' is designed to produce a signal oligonucleotide that is 6 to 8 nucleotides in length.

The template oligonucleotide for EXPAR (with the antisense strand of the N.BstNB I recognition sequence underlined) has the following sequence:

Ceap: 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA-3' where S' is the sequence 5'-CCTACGACTGG-3'.

The trigger oligonucleotide for the EXPAR reaction has the following sequence: SeqS: 5'- aCCAGTCGTAGG-3'

When the trigger oligonucleotide and the template for the EXPAR reaction anneal to each other, the following duplex is formed:

3'-GGATGCTGACCa- 5' (seqS) δ'-CCTACGACTGGAACAGACJCACCTACGACTGGA- 3' (ceap)

The above duplex is extended to produce the following duplex in the presence of a DNA polymerase (with both the sense and antisense strands of the N.BstNB I recognition sequences underlined):

3'-GGATGCTGACCTTGACTGAGTGGATGCTGACCa-5' 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA- 3'

In the presence of N.BstNB I, the upper strand of the above duplex is nicked to release an oligonucleotide (A1) having a sequence 3'-GGATGCTGACC- 5'. This oligonucleotide (A1 ) may anneal to another un-annealed T1 molecule, which ultimately results in exponential amplification of A1 itself. In addition, the oligonucleotide A1 may also anneal to the bleed-out oligonucleotide that has the following sequence (with the antisense strand of the N.BstNB I recognition sequence underlined):

BleedCEAP: 5'-atqcatgcAACAGACTCACCTACGACTGGA-3'

The annealing between A1 and BleedCEAP produces the following duplex: 3'-GGATGCTGACC-5' (A1) 5'-atgcatgcAACAGAO CACCTACGACTGGA-3' (BleedCEAP)

The extension of the above duplex produces the following double- strand nucleic acid (with both the sense and antisense strands underlined):

3'-tacgtacgTTGTCTGAGTGGATGCTGACC-5' (A1 ) 5'-atgcatgcAACAGACTCACCTACGACTGGA-3' (BleedCEAP)

The upper strand of the above double-strand nucleic acid is then cleaved by N.BstNB I, releasing a signal sequence having the sequence 3'- tacgtacg-5'. The released signal sequence having an exact mass of 1243.8 with 3' phosphate (H₂PO₄) (mass/charge of 2) can be easily measured by mass spectrometry. The reaction conditions are: 85 mM KCI, 25 mM Tris-HCI (pH 8.8 at

25°C), 2.0 mM MgSO4, 5 mM MgCI₂, 10 mM (NH₄)₂SO₄, 0.1% Triton X-100, 0.5 mM DTT, 0.4 units N.BstNB I nicking enzyme (NEB), 0.05 units 9°N_m™ DNA polymerase (NEB), 0.2 M Trehalose, 600 micromolar dNTPs, 10 micrograms/ml BSA (NEB), 0.2 M trehalose, 0.1 micromolar template oligonucleotide in ultra-pure water that is nuclease free (Ambion). In the case of fluorescence monitoring,

SYBR^® green (Molecular Probes) was added to 5x concentration (SYBR^® green is supplied by the manufacturer at a concentration of 10,000X).

The following reaction mixture was assembled in a 5 ml polypropylene tube on ice (4°C). 100 ul 10x Thermopol Reaction buffer

50 uHOx N.BstNB I buffer

1 ul template oligonucleotide (ceap) at 100 uM stock 1 ul "bleed-off oligonucleotide (BleedCEAP) at 100 uM stock 24 ul 25 mM dNTPs 1 ul 10 mg/ml BSA

40 ul N.BstNB I nicking enzyme at 10 units/ul

24 ul 9°N_m™ DNA polymerase

760 ul ultra-pure water The reaction was mixed to homogeneity with a 1 ml pipetor. In a set of 12 microtubes, 120 ul was added to the first tube, and 80 ul was then aliquoted over the remaining 11 tubes. The trigger oligonucleotide was diluted 1-1000 from the stock concentration of 100 uM, to a final concentration of 0.1 uM. One microliter of the 0.1 uM solution was added to the first tube, and eleven 3-fold dilutions were then made by transferring 40 ul from the first tube and mixing. The serial dilutions were made on ice. The tubes were capped and then incubated at 60°C for the times indicated. The reaction was stopped by placing the tube at 4°C or on ice.

The reacfion was analysis by mass spectrometry as described in Example 2. The following extracted ion current was monitored:

1243.8 with a mass/charge ratio = 2

The results shown in the table below illustrates that a signal oligonucleotide were amplified using a bleed-out template oligonucleotide as a template and readily detected by mass spectrometry.

Dilution picomoles per microliter Relative mass units (RMU)

1 1 x 10^"3 205

2 3 x 10^"4 143

3 5 x 10^"4 11.9

4 3.7 x 10^"5 2.3

5 1.2 x 10^"5 0.6

6 4.1 x 10^"6 0.3

7 1.3 x 10^"6 <0.02

8 4.5 x 10^"7 <0.02

9 1.5 x 10^"7 <0.02

10 5.0 x 10^"8 <0.02

11 1.7 x 10^"8 <0.02

12 none <0.02 EXAMPLE 4

EXPONENTIAL AMPLIFICATION AS DETECTED BY REAL TIME FLUORESCENCE MONITORING

USING THE MJ OPTICON I

In this example, EXPAR amplification reaction were performed using the following type of template oligonucleotides:

5' S' NNNNGACTCA S' A 3'

which may be initiated by a trigger oligonucleotide comprising the sequence S that is complementary to the sequence S'.

The template oligonucleotide is shown below with the antisense strand of N.BstNB I recognition sequence underlined:

ceap: 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA- 3'

where S' is the sequence 5'-CCTACGACTGG-3'.

The trigger oligonucleotide for the reaction is shown below:

seqS: 5'-aCCAGTCGTAGG-3'

When the trigger oligonucleotide (seqS) and the template (ceap) anneal to each other, the following duplex is formed:

3'-GGATGCTGACCa-5' (seqS)

5'-CCTACGACTGGAACAGACTCACCTACGACTGGA-3' (ceap) The above duplex is extended to produce the following duplex in the presence of a DNA polymerase (with both the sense and antisense strands of the N.BstNB 1 recognition sequences underlined):

3'-GGATGCTGACCTTGTCTGAGTGGATGCTGACCa-5'

5'-CCTACGACTGGAACAGACTCACCTACGACTGGA-3'

The upper strand is cleaved by N.BstNB I and releases an oligonucleotide (A1) having the sequence 3'-GGATGCTGACC-5'. The oligonucleotide A1 may anneal to an un-primed template oligonucleotide, and ultimately results in exponential amplification of A1 itself.

Using SYBR^® green (a fluorescent duplex intercalator), the duplexes formed during the exponential amplification reaction may be detected by an MJ Opticon I. The duplexes detected mostly have the following structures (with both the sense and antisense strands of the N.BstNB I recognition sequence underlined):

3'-GGATGCTGACCTTGTCTGAGTGGATGCTGACC-5' 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA-3', or

3'-TTGTCTGAGTGGATGCTGACC- 5' 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA-3'

The reaction conditions are: 85 mM KCI, 25 mM Tris-HCI (pH 8.8 at 25°C), 2.0 mM MgSO₄, 5 mM MgCI₂, 10 mM (NH₄)₂SO₄, 0.1% Triton X-100, 0.5 mM DTT, 0.4 units N.BstNB I nicking enzyme (NEB), 0.05 units 9°N_m™ DNA polymerase (NEB), 0.2 M Trehalose, 600 micromolar dNTPs, 0.1 micromolar template oligonucleofide (ceap) in ultra-pure water that is nuclease free (Ambion). In the case of fluorescence monitoring, SYBR^® green (Molecular Probes) was added to 5x concentration (SYBR^® green is supplied by the manufacturer at a concentration of 10.0O0X). The following reaction mixture was assembled in a 5 ml polypropylene tube on ice (4°C).

120 ul lOx Thermopol Reaction buffer

60 ul 10x N.BstNB I buffer 1 ul template oligonucleofide (ceap) at 100 uM stock

24 ul 25 mM dNTPs

1 ul 10 mg/ml BSA

60 ul N.BstNB I nicking enzyme at 10 units/microliter

24 ul 9°N_m™ DNA polymerase at 2 units per microliter 961 ul ultra-pure water

The reaction was mixed to homogeneity with a 1 ml pipetor. In a set of 0 microtubes, 150 ul was added to the first tube, and 100 ul was then aliquoted over the remaining 9 tubes. The trigger oligonucleotide (seqS) was diluted 1-100 from the stock concentration of 100 uM, to a final concentration of 1.0 uM. One microliter of the 1.0 uM solution was added to the first tube, then ten 3-fold dilutions were made by transferring 50 ul from the first tube and mixing. The serial dilutions were made on ice. 40 microliters was added to each capillary, and the capillaries were briefly (30 seconds) centrifuged at 500 rpm, capped and placed in the Light Cycler. The instrument was programmed to cycle between 60°C and 30°C about every 30 seconds, at which time the instrument made a reading.

The results are plotted in Figure 7.

EXAMPLE 5 AMPLIFICATION OF A TEMPLATE ON A SOLID PHASE

In this example, EXPAR is combined with the use of a bleed-out template. In addition, both the template oligonucleotide and the bleed-out template oligonucleotide are immobilized to a solid support. These two template oligonucleotides have the following structures, respectively: Template for EXPAR:

5' S' NNNNGACTCA S' -A 3'

Bleed-out template

5' j' NNNNGACTC S' 3'

where S' and T' represent two different oligonucleotide sequences. An oligonucleotide (referred to as "signal oligonucleotide") complementary to T' produced in the reaction does not further function as a primer, thus does not participate in the exponential amplification, but rather "bleeds" the reaction and accumulates in the reaction mixture. T' is designed to produce a signal oligonucleotide that is 6 to 8 nucleotides in length.

ceap: 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA-3'

where S' is the sequence 5'-CCTACGACTGG-3'. The trigger oligonucleotide for the EXPAR reaction has the following sequence:

seqS: 5'- aCCAGTCGTAGG-3'

When the trigger oligonucleotide and the template for the EXPAR reaction anneal to each other, the following duplex is formed: 3'-GGATGCTGACCa- 5' (seqS) 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA- 3' (ceap)

3'-GGATGCTGACCTTGACTGAGTGGATGCTGACCa- 5' 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA- 3'

In the presence of N.BstNB I, the upper strand of the above duplex is nicked to release an oligonucleotide (A1 ) having a sequence 3'-GGATGCTGACC- 5'. This oligonucleotide (A1) may anneal to another un-annealed T1 molecule, which ultimately results in exponential amplification of A1 itself. In addition, the oligonucleotide A1 may also anneal to the bleed-out oligonucleotide that has the following sequence (with the antisense strand of the N.BstNB I recognition sequence underlined):

BleedCEAP: 5'-atgcatgcAACAGACTCACCTACGACTGGA-3'

The annealing between A1 and BleedCEAP produces the following duplex:

3'-GGATGCTGACC-5' (A1 ) 5'-atgcatgcAACAGACTCACCTACGACTGGA-3' (BleedCEAP)

The extension of the above duplex produces the following double- strand nucleic acid (with both the sense and antisense strands underlined): 3'-tacgtacgTTGTCTGAGTGGATGCTGACC-5' (A1 ) 5'-atgcatgcAACAGACTCACCTACGACTGGA-3' (BleedCEAP?

The upper strand of the above double-strand nucleic acid is then cleaved by N.BstNB I, releasing a signal sequence having the sequence 3'- tacgtacg-5'. The released signal sequence having an exact mass of 1243.8 with 3' phosphate (H₂PO₄) (mass/charge of 2) can be easily measured by mass spectrometry.

Oligonucleotide preparation: All oligonucleotides were purchased commercially (Midland Certified Reagents, Midland TX). Template oligonucleotides used for amplification carried 5' terminal primary amine groups, linked via a six-carbon spacer arm. Deprotected, lyophilized oligonucleotides were dissolved in sterile water, extracted twice with water-saturated isobutanol, brought to 0.2M NaCl, and precipitated with 95% ethanol (3 volumes). The pellet was rinsed in 95% ethanol, and resuspended in water. Concentration was determined from absorbance at 260 nm, assuming that a 33 μg per ml solution has an OD of 1. All concentrations reported refer to oligonucleotide strands. All oligonucleotide solutions were stored frozen (-20°C).

Primer activation with cyanuric chloride: The activation protocol is modified from Van Ness, J. Kalbfleisch, S., Petrie, OR., Reed, M.W., Tabone, J.C., Vermeulen, N.J. (1991) A versatile solid support system for oligodeoxynucleotide probe-based hybridization assays. Nucleic Acid. Res. 19, 3345-3350. Standard reactions contained 10 nanomoles 5'-amino-terminal oligonucleotides 3'-amine derived ceap and 3'-amine derived BleedCEAP, 0.1 M sodium borate buffer (SBB) (pH8.3), 50 nanomoles cyanuric chloride (Aldrich), 10% acetonitrile (v/v) (Aldrich), in a total reaction volume of 100 μl. Reactions were carried out for 1-2 hours at room temperature with mixing. Unreacted cyanuric chloride was removed by three cycles of centrifugal ultrafiltration and resuspension in 0.1 M SBB using a Microcon 3 (3000 dalton cutoff, Amicon). Activated oligonucleotides were stored at 4°C, and could be used with no detectable loss of activity for up to 2 months.

PEI-coated polystyrene supports: Polystyrene microbeads, 0.87 μm in diameter, modified with primary aliphatic amines (245 μeq/g beads), were purchased commercially (Bangs Labs, Carmel, IN). Prior to use, beads were washed by centrifugation (12,000 x g, 2 minutes) and resuspensed in 0.1 M KPO buffer (pH 6.8). Beads were reacted with 5% glutaraldehyde (EM grade, Polysciences) in 0.1 M KPO buffer for 1 hour at room temperature with vigorous shaking on a vortex mixer. The beads were washed twice with 0.1 M KPO buffer and once with 0.1 M SBB. The beads were then reacted with 3% polyethyleneimine (PEl, 2000 dalton average MW, Aldrich) in 0.1 M SBB for 1 hour at room temperature, again with vigorous shaking. Ethanolamine was added to 0.5 M (pH 8.0), and shaking was continued for another hour. The beads were washed extensively with 0.1 M SBB and stored at 4°C until use. Attachment of cyanuric chloride-activated oligonucleotides to amine supports: The attachment protocol was modified from Van Ness et al. Cyanuric chloride-activated oligonucleotides and amine-coated beads in 0.1 M SBB were mixed and shaken vigorously at room temperature for 1 hour, using 500 pmoles of activated primer per mg of beads. The beads were spun down and resuspended in 0.1 M succinic anhydride (Sigma), dissolved in 90% DMSO, 0.1 M SBB, to capture unreacted primary amines. The reaction was shaken for 1 hour at room temperature. The beads were washed extensively in 10mM Tris-HCI, 1 mM EDTA, 0.1% Tween 20 (TE/Tw buffer), and stored in the same buffer at 4°C.

Preparation of silica bead CEAP amplification supports: Silica microbeads 0.4 μm in diameter were obtained commercially (Bangs Labs, Carmel, IN) as an aqueous suspension, and were used without additional purification. The beads were silanized with 3-glycidoxypropyltrimethoxysilane. Epoxysilane-treated beads were incubated with primers with 5'-terminal amines (50-100 μM) in 0.1 M KOH for 12 hours at 37°C. Beads were then incubated with 2M ethanolamine (pH 8.0) for an additional 12 hours at 37°C to remove unreacted epoxide groups. Finally, beads were washed extensively with TE/Tw and stored in the same buffer at 4°C.

Measurement of oligonucleotide surface density: Oligonucleotide density was measured by hybridizing Texas Red-labeled complementary oligonucleotides to primer-modified supports. In general, probes were designed to be 20 nucleotides in length, and complementary to the 3' terminal region of the immobilized oligonucleotide. Probes were labeled with Texas Red during synthesis (Midland Oligos, Midland TX). Unincorporated nucleotides were removed using a silica adsorption method (QiaAmp, Qiagen) and centrifugal ultrafiltration on a Microcon 3 (Amicon). Surface area was calculated using the nominal diameter specified by the supplier.

The following reaction mixture was assembled in a 5 ml polypropylene tube on ice (4C). 100 ul 10x Thermopol Reaction buffer

50 uMOx N.BstNB I buffer

24 ul 25 mM dNTPS

1 ul 10 mg/ml BSA

40 ul N.BstNB I nicking enzyme at 10 units/ul 24 ul 9°N_m™ DNA polymerase

762 ul ultra-pure water

The reaction was mixed to homogeneity with a 1 ml pipetor. In a set of 12 microtubes, 10ul of the polystyrene beads were added to each tube (corresponding to 100 ng of ceap and 100 ng of BleedCEAP), 120 ul was added to the first tube, then 80 ul was aliquoted over the remaining 11 tubes. The trigger oligonucleotide was diluted 1-1000 from the stock concentration of 100 uM, to a final concentration of 0.1 uM. One microliter of the 0.1 uM solution was added to the first tube, then eleven 3-fold dilutions were made by transferring 40 ul from the first tube and mixing. The serial dilutions were made on ice. The tubes were capped and then incubated at 60°C for the times indicated. The reaction was stopped by placing the tube at 4°C or on ice.

The following extracted ion currents were monitored:

1243.8 with a mass/charge ratio = 2.

The results shown in the table below indicate an extremely sensitive detection of the trigger sequence using ceap and BleedCEAP both tethered to a solid support.

Dilution ppiiccoommoolleess per microliter Relative mass units (RMU)

1 1 x 10^"3 1130

2 3 X 10^"4 556

3 5 X 10^"4 276

4 3.7 x 10^"5 149

5 1.2 x 10^"5 101

6 4.1 x 10^"6 76

7 1.3 x 10^"6 56

8 4.5 x 10^"7 39

9 1.5 x 10^"7 22

10 5.0 x 10^"8 16

11 1.7 x 10^"8 8.5

12 none <0.02

EXAMPLE 6

PREPARATION OF TEMPLATE OLIGONUCLEOTIDE CONJUGATES FOR USE IN THE EXPONENTIAL AMPLIFICATION ASSAY

In this example, EXPAR is performed using a conjugated template. Such a conjugated template may be resulted from linking individual template oligonucleotides with each other or to a set of dendrimers via the 3' termini of the individual template oligonucleotides. The individual template oligonucleotide has the following structure:

5- S' NNNNGACTCA S' A 3'

where S' represents a nucleotide sequence. An oligonucleotide (referred to as "trigger oligonucleotide") comprising a sequence (S) that is completely complementary to S' is used as a primer to anneal with the template, which initiates exponential amplification of an oligonucleotide having a sequence identical to the sequence S.

ceap: 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA-3'

where S' is the sequence 5'-CCTACGACTGG-3'.

The trigger oligonucleotide for the EXPAR reaction has the following sequence:

seqS: 5'- aCCAGTCGTAGG-3'

3'-GGATGCTGACCa- 5' (seqS) 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA- 3' (ceap) The above duplex is extended to produce the following duplex in the presence of a DNA polymerase (with both the sense and antisense strands of the N.BstNB I recognition sequences underlined):

3'-GGATGCTGACCTTGACTGAGTGGATGCTGACCa- 5'

5'-CCTACGACTGGAACAGACTCACCTACGACTGGA-3'

In the presence of N.BstNB I, the upper strand of the above duplex is nicked to release an oligonucleotide (A1 ) having the sequence 3'- GGATGCTGACC-5'. This oligonucleotide (A1 ) may anneal to another un- annealed T1 molecule, which ultimately results in exponential amplification of A1 itself. The amplified A1 , which has a mass/charge (-3) of 1144.7, is monitored by mass spectrometry.

All oligodeoxyribonucleotide synthesis reagents were purchased from Midland Certified Reagents (Midland Texas)

Cyanuric chloride activation:

100 microliters 3000 micrograms of ceap in 0.0005 mM EDTA,

250 microliters 1 M NaBorate, pH8.4

50 microliters 50 mg/ml cyanuric chloride in 100% ACN. The reaction was incubated for 30 minutes at 25°C. The reaction mixture was then applied to 25 cm x 1 cm G-50 Sephadex column. The peak fractions were pooled and split into two 3 ml fractions. To fraction 1, 1500 micrograms of 3'-amine ceap were added, and to fraction 2, 1000 micrograms of dendrimers were added. The reactions were incubated at 37°C for 20 hours. The dendrimers were purified by size exclusion (see below). The oligonucleotide conjugate was purified as described below.

Reverse phase HPLC analysis and purification of oligonucleotides was done using a Waters Alliance HPLC connected to a computer equipped with the Millennium software package (Version 3.1). The column mobile phase consisted of a mixture of 0.1 M triethylamine acetate (pH 7.0) with (buffer A) or without (buffer B) 25% acetonitrile. The mobile phase temperatures required for optimal resolution of oligonucleotide conjugates were determined empirically by injecting one product for each oligonucleotide at a series of temperatures until the desired sample retention time was observed. Specific values for the gradient ranges (buffer A component indicated), separation times and mobile phase temperatures used to analyze the amplicons described above are as follows: 57.0- 64.2%, 4 min and 58°C for template 1 ; 53.0-59.3%, 3.5 min and 61 °C or 53.0- 59.3%, 3.5 min and 59°C for template 2. Between sample analyses the column was regenerated with a 19:1 mixture of buffers A and B (40 s) and a solution whose buffer A content was 5% less than the low end of the desired gradient range (40 s).

PAMAM dendrimers, which have ethylenediamine as an initiator core, were purchased from Dendritech (Dendritech Inc, Ml) and used without further purification. Cyanuric chloride activated oligonucleotides were prepared as described above. A phosphorothioate 2'-O-methyl-oligonucleotide (5'-ceap-3') and corresponding 3'-TAMRA-labeled derivative were purchased from the Midland Certified Reagent Company (Midland, TX).

The conjugation was also performed as follows: appropriate amounts of cyanuric chloride activated template oligonucleotide (1 mg/ml) were added to the generation 5 dendrimer in 1 ml of 50 mM sodium borate buffer (pH 8.5), after which stirring continued for 3 h in the dark at room temperature. The crude reaction solution was evaporated in a Speed-Vac. This dried pellet was dissolved in a minimum volume of aqueous TFA (0.1%, v/v), and then applied to a PD-10 Sephadex G-25M column equilibrated with aqueous TFA (0.1%, v/v). Fractions recovered from the Sephadex G-25 were analyzed by TLC on a non-fluorescent silica plate using 100% MeOH as theeluent. Under long wavelength UV light, the tagged dendrimers remained almost immobile at the origin. The conjugate products were further confirmed by measuring fluorescence intensity of each fraction using oligogreen (Molecular Probes). The purified fractions were dialyzed, the absorbance measured. The material was completely dried in a Speed-Vac before measuring the weight.

Two reaction mixtures were assembled in a 5 ml polypropylene tubes at 4°C, each containing the following:

200 ul 10x Thermopol Reaction buffer

100 ul 10x N.BstNB I buffer

36 ui 25 mM dNTPS

2 ul 10 mg/ml BSA 75 ul N.BstNB I nicking enzyme at 10 units/ul

36 ul 9°N_m™ DNA polymerase

1580 ul ultra-pure water

The reaction was mixed with a 1 ml pipetor. In a set of 20 microtubes, 120 ul was added to the first tube, then 80 ul was aliquoted over the remaining 15 tubes. The trigger oligonucleotide was diluted 1-1000 from the stock concentration of 100 uM, to a final concentration of 0.1 uM. One microliter of the 0.1 uM solution was added to the first tube, then sixteen 3-fold dilutions were made by transferring 40 ul from the first tube and mixing. The serial dilutions were made on ice. Four no trigger controls were also processed. In each reaction, the template concentration was 0.1 μM.

The tubes were capped and then incubated at 60°C for the times indicated. The temperature was cycled from 60°C to 30°C every minute. The total incubation time was 20 minutes at 60°C. The reaction was stopped by placing the tube at 4 °C or on ice. LC-MS was performed as described in Example 2. The following extracted ion currents were monitored:

1144.7 with a mass/charge ratio = 3

The results are shown in the following table: Dilution picomoles Relative mass units RMU per microliter for the dendrimer (RMU) CEAF

1 1 x 10^"3 3308 1198

2 3X10^"4 3210 987

3 5X10^"4 3287 762

4 3.7 x10^"5 3109 523

5 ' 1.2 x10^"5 2807 329

6 4.1 x10^"6 2198 291

7 1.3 x10^"6 1784 251

8 4.5 x10^"7 1232 201

9 1.5 x10^"7 1099 113

10 5.0 x10^"8 748 58.2

11 1.7 x10^"8 350 25.1

12 5.7 x10^'9 152 12.4

13 1.9 x10^"9 82 6.2

14 6.3 x10^"10 39.4 3.9

15 2.1 x10^"10 14.7 1.2

16 6.7 x10^"11 6.2 <0.02 none no trigger <0.02 <0.02 none no trigger <0.02 <0.02 none no trigger <0.02 <0.02 none no trigger <0.02 <0.02

EXAMPLE 7 THE EFFECT OF MIXING ON THE RATE OF TRIGGER GENERATION

This example describes the effect of mixing on the rate of trigger generation and the lower limit of detection. A comparison of an isothermal reaction (no temperature change) versus incubation at 60°C with a thermocycle to 30°C every minute is made. The thermocycling step induces a small amount of convection that causes mixing on a microscale.

The template oligonucleotide and the trigger oligonucleotide are shown below (with the sense strand of N.BstNB I recognition sequence underlined:

Template oligonucleotide:

ceap: 5'-CCTACGACTGGAACAGACTCACCTACGACTGGA-3'

Trigger oligonucleotide:

seqS: 5'-aCCAGTCGTAGG-3'

Under the reaction conditions described below, an oligonucleotide (A1) having the sequence 3'-GGATGCTGACC-5' was exponentially amplified. The amplified oligonucleotide has calculated mass of 1144.7 amu for a mass/charge ratio of 3.

The reaction conditions are: 85 mM KCI, 25 mM Tris-HCI (pH 8.8 at 25°C), 2.0 mM MgSO₄, 5 mM MgCI₂, 10 mM (NH₄)₂SO₄, 0.1% Triton X-100, 0.5 mM DTT, 0.4 units N.BstNB I nicking enzyme (NEB), 0.05 units 9°N_m™ DNA polymerase (NEB), 0.2 M Trehalose, 600 micromolar dNTPs, 0.1 micromolar template oligonucleofide (ceap) in ultra-pure water that is nuclease free (Ambion). In the case of fluorescence monitoring, SYBR^® green (Molecular Probes) was added to 5x concentration (SYBR^® green) is supplied by the manufacturer at a concentration of 10.000X). The following reaction mixture was assembled in a 5 ml polypropylene tubes on ice or at 4°C.

120 ul 10x Thermopol Reaction buffer 60 uMOx N.BstNB I buffer

1 ul template oligonucleotide (ceap) at 100 uM stock

24 ul 25 mM dNTPS

1 ul 10 mg/ml BSA 60 ul N.BstNB I nicking enzyme at 10 units/microliter

24 ul 9°N_m™ DNA polymerase at 2 units per microliter

961 ul ultra-pure water

The reaction was mixed to homogeneity with a 1 ml pipetor. In a set of 10 microtubes, 150 ul was added to the first tube, then 100 ul was aliquoted over the remaining 9 tubes. The trigger oligonucleotide was diluted 1-100 from the stock concentration of 100 uM, to a final concentration of 1.0 uM. One microliter of the 1.0 uM solution was added to the first tube, then ten 3-fold dilutions were made by transferring 50 ul from the first tube and mixing. The serial dilutions were made on ice. 40 microliters was added to each capillary, the capillaries were briefly (30 seconds) centrifuged at 500 rpm and capped and placed in the Light Cycler. The instrument was programmed to cycle between 60°C and 30°C about every 30 seconds, at which time the instrument made a reading.

The results of real time fluorescence detection of the oligonucleotide amplification by a Roche Light Cycler are shown in Figure 8. The time of amplification is plotted on the X-axis versus the accumulated fluorescence on the Y-axis. Each curve from left to right represents a serial dilution of 3-fold. The starting concentration of the trigger was 0.01 picomoles/microliter.

EXAMPLE 8 TRIGGERING EXPONENTIAL AMPLIFICATION WITH HIGH SPECIFICITY

The present example illustrates another aspect of the present invention, which is a further variation of the EXPAR amplification scheme. This version of EXPAR confers high specificity to the triggering reaction. The modification takes advantage of the observation that the nicking enzyme site can be partially mismatched and still function at nearly 100% activity. This variation works in the following way:

The template is designed with the following sequence:

5 ' -xxxxxxxxxGACTTxxxxxxxxxxxxxx where x is any naturally occurring nucleoside. A trigger then comes in and primes the amplification template as follows:

3' -AGxxxxxxxxxxxxxx 5' -xxxxxxxxxGACTTxxxxxxxxxxxxxx where there is a G/T mismatch one base back from the 3' end of the triggering molecule. Therefore, the dinucleotide sequence 3'-AG has to be present on the trigger in orderforthe recognition siteforthe nicking enzyme N.BstBNI ("GAGTC") to be generated. If a trigger is shorter than the trigger shown above, then the amplification template does not contain the "GAGTC" but rather "AAGTC" if it is mis- primed or inappropriately primed. The nicking enzyme will not recognize "AAGTC", so if the amplification template is misprimed, no amplification takes place, and no trigger is made from the template oligonucleotide.

3 ' - xxxxxxxxxxxxxx 5 ' -xxxxxxxxxGACTTxxxxxxxxxxxxxx goes to 3 ' - xxxxxxxxxAAGTCxxxxxxxxxxxxxx 5 ' -xxxxxxxxxGACTTxxxxxxxxxxxxxx Therefore, triggering can be made highly specific if the trigger is required to have a "3- AG-5' structure at the 3' end of the trigger. The trigger can also take on any of the following forms: 3 ' -AGxxxxxxxxxxxxxx 3 ' -GAGxxxxxxxxxxxxxx 3' -TGAGxxxxxxxxxxxxxx 3 ' -CTGAGxxxxxxxxxxxxxx Triggers can be generated from genomic DNA that contains an AG or GAG or TGAG or CTGAG site in the 3' end, or they can be produced from an amplification template that has the following structure and sequence:

5 ' TCxxxxxxxxxxxGACTCxxxxxxxxxxxx-3 ' OR

5' CTCxxxxxxxxxxxGACTCxxxxxxxxxxxx-3^r OR 5'ACTCxxxxxxxxxxxGACTCxxxxxxxxxxxx-3' OR 5 ' GACTCxxxxxxxxxxxGACTCxxxxxxxxxxxx-3'

This new amplification concept was tested on the following HIV system:

HIV Sequence 5' AACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAGTCctggCTGTGGAAAGAT 3' Complement 5' ATCTTTCCACAGccagG AC Tt TTGCCTGGAGCTGCTTGATGCCCCAGACTGTGAGTT 3'

Ping 5' ATGCATGCATϋAG .CatttATCTTTCCACAG 3' Pong 5' ATGCATGCATGAG ICatttCTGTGGAAAGAT 3'

We designed a probe that would hybridize to the HIV RNA across from a conserved "GAGUC" site in the RNA. The nicking enzyme N.BstNBI was found to recognize GAGUC in RNA when the RNA is in a duplex with a DNA strand. The RNA sequence we targeted was:

5 ' -AGCTCCAGGCAAGAGTCCTGTGGAAAGAT-3 ' (WRITTEN AS DNA)

This HIV RNA was obtained from ARUP (Salt Lake City UT).

We hybridized a probe across the sequence:

₅' AGCTCCAGGCAAGAGTCctggCTGTGGAAAGAT 3'

3' -TCGAGGTCCGTTCTCAGgaccGACACCTTTCTA-5'

We then linearly amplified the sequence using the following conditions: 85 mM KCI, 25 mM Tris-HCI (pH 8.8 @ 25C), 2.0 mM MgSO4, 5 mM MgCI2, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.5 mM DTT, 0.8 units N.BstNBI nicking enzyme (NEB), 0.05 units 9-degree North polymerase (NEB), 200 micromolar dNTPs, 10 micrograms/ml BSA (NEB), and 0.001 to 500 ng of genomic DNA in ultra-pure water that is nuclease free (Ambion). Incubation is at 55°C for the 5 minutes. The product was then measure by mass spectrometry: The chromatography system was an Agilent 1100 Series HPLC composed of a binary pump, degasser, a column oven, a diode array detector, and thermostatted microwell plate autoinjector (Agilent Technologies, Palo Alto, CA). The column is a Waters Xterra MS C18, incorporating C 8 packing with 3.5 uM particle size, with 125 Angstrom pore size, 2.1 mm x 20 mm (Waters Inc. Milford, MA). The column was run at 30°C with a gradient of acetonitrile in 5mM dimethyl-butylamine acetate (DMBAA). As a check on the complete release of the signal oligo during the chromatography and injection we ran the column at 50°C after incubating the sample briefly at 95°C. We saw no increase in the oligo yield over our standard conditions. Buffer A is 5mM DMBAA, buffer B is 5mM DMBAA and 50% (V V) acetonitrile. The gradient begins at 10%B and ramps to 15%B over 0.3 minute, to 30%B over 2 minutes, to 90%B over 0.5 minute, to 10%B over 0.25 minute, then holds at 10%B for 1.25 minutes. The column temperature was held constant at 30°C. The flow rate was 0.25 ml/minute. The injection volume was 10 μl. Flow rate into the mass spectrometer was also 0.25 ml/min. The mass spectrometer is a Micromass LCT Time-of-Flight with an electrospray inlet (Micromass Inc. Manchester UK). The samples were run in electrospray negative mode with a range from 800 to 2000 amu using a 1 second scan time. Source parameters: Desolvation gas 450 L/hr, Capillary 2225V, Sample cone 30V, RF lens 400V, extraction cone 7V, desolvation temperature 275°C, Source temperature 120°C. Analysis of the LC-mass spectrometry data made use of the software supplied by the manufacturer. All HPLC components (water and acetonitrile) were purchased from Fisher Scientific (Pittsburgh, PA). The dimethyl-butylamine was purchased from Sigma-Aldrich Corp. (St. Louis, MO) and a salt was made by the addition of acetic acid (Sigma Aldrich) to pH 8.4. The 2 molar stock solution was filtered using a 0.2 micron nylon filter. First Trigger Results:

The oligonucleofide probe was the changed such that the trigger would end up with a 3'-GA at the 3' end after linear amplification.

5' AGCTCCAGGCAAGAGTCctggCTGTGGAAAGATGA

3'-TCGAGGTCCGTTCTCAGgaccGACACCTTTCTACT-5'

The new (second) trigger produced has the sequence: CTGTGGAAAGATGA-3' and a triply charged mass of 1371.88. Again the trigger was linearly amplified for 15 minutes and measured by mass spectrometry.

Second Trigger Results:

The results showed that 1) the nicking enzyme recognizes RNA and nicks, 2) a DNA trigger can be made in the linear reaction, 3) a 3'-GA can be easily incorporated into the trigger.

Next, we designed modified EXPAR amplification template to exponentially amplify the trigger.

5' -CTGTGGAAAGATGA-3' Amplification template: 3' -GACACCTTTCTATTCAGTTTTGACACCTTTCTACT which is then extended to make the following duplex:

-CTGTGGAAAGATGAGTCAAAACTGTGGAAAGATGA-3 ' .

Amplification template: 3' -GACACCTTTCTATTCAGTTTTGACACCTTTCTACT which generates the trigger. 5 ' -CTGTGGAΆΆGΆTGA-3 ' We then tested the trigger in a real-time fluorescence model.

The exponential reaction conditions are 85 mM KCI, 25 M Tris-HCI (pH 8.8 @ 25C), 2.0 mM MgSO4, 5 mM MgC12, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.5 mM DTT, 0.4 units N.BstNBI nicking enzyme (NEB), 0.05 units 9- degree North polymerase (NEB), 0.2 M trehalose, 200 micromolar dNTPs, 10 micrograms/ml BSA (NEB), 0.1 micromolar template olignucleotide in ultra-pure water that is nuclease free (Ambion). In the case of fluorescence monitoring, SYBR- green (Molecular Probes) was added to 5x concentration (SYBR-green is supplied by the manufacturer at a concentration of 10.000X). Incubation was for 5 minutes at 55C. To determine the lower limit of detection, the following reaction mixture was assembled in a 5 ml polypropylene tubes on ice (4C). 100 ul 10x Thermopol Reaction buffer, 50 ul 10x N.BstNBI buffer, 1 ul template oligonucleotide T1 @ 100 uM stock (T1 and T2 are referred to in the text as "amplification templates), 1 ul template oligonucleotide T2 @ 100 uM stock, 24 ul 25 mM dNTPS, 1 uMO mg/ml BSA, 40 ul N.BstNBI nicking enzyme @ 10 units/ul, 24 ul 9-degree North DNA polymerase, 760 ul ultra-pure water. The reaction was mixed to homogeneity with a 1 ml pipetor. In a set of 12 microtubes, 120 ul was added to the first tube, then 80 ul was aliquoted over the remaining 11 tubes. The trigger oligonucleotide(s) was diluted 1-1000 from the stock concentration of 100 uM, to a final concentration of 0.1 uM. One microliter of the 0.1 uM solution was added to the first tube, then 11 , 3-fold dilutions were made by transferring 40 ul from the first tube and mixing. The serial dilutions were made on ice. The tubes were capped and then incubated at 60C for the times indicated. The reaction was stopped by placing the tube at 4 C or on ice. In the case of real time fluorescence monitoring, an MJ Opticon was programmed as follows: Incubate 10 seconds at 60C, read plate, go to step , 29 more times. All enzymes were purchased from New England Biolabs. The DNA polymerase used was Vent exo- (see Kong, H., Kucera, R.B., Jack, W.E. (1993) Characterization of a DNA polymerase from the hyperthermophile archaea Thermococcus litoraiis. Vent DNA polymerase, steady state kinetics, thermal stability, processivity, strand displacement, and exonuclease activities. J. Biol. Chem. 268(3), 1965-1967). The nicking enzyme (N.BstNBI) has a specific activity of approximately 10⁶ units/mg (H.-M. Kong, unpublished).

All of the above U.S. patents, U.S. patent application publications,

U.S. patent applications, foreign patents, foreign patent applications and non- patent publications referred to in this specification and/or listed in the Application Data Sheet, are incorporated herein by reference, in their entirety.

From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

Claims

1. A method comprising the steps of

(A) forming a reaction mixture that comprises

(1 ) a primer;

(2) a first template that comprises from 5' to 3':

(a) a first region of nucleotides;

(b) a nucleotide sequence of a sense strand of a first nicking agent recognition sequence; and

(c) a second region of nucleo ides that is at least substantially complementary to the primer;

(3) a second template that comprises from 5' to 3':

(a) a first region of nucleotides;

(b) a nucleotide sequence of a sense strand of a second nicking agent recognition sequence;

(c) a second region of nucleotides that is at least substantially identical to the primer;

(4) a DNA polymerase;

(5) a first nicking agent that recognizes the first nicking agent recognition sequence; and

(6) a second nicking agent that recognizes the second nicking agent recognition sequence; and

(B) incubating the reaction mixture under conditions that amplifies an oligonucleotide that is at least substantially identical or complementary to the primer.

2. The method of claim 1 wherein the amplified oligonucleotide is 6-18 nucleotides in length.

3. The method of claim 1 wherein the amplified oligonucleotide is 8-14 nucleotides in length.

4. The method of claim 1 wherein the amplified oligonucleotide is 11- 13 nucleotides in length.

5. The method of claim 1 wherein the second region of the first template is completely complementary to the primer.

6. The method of claim 1 wherein the second region of the first template is completely identical to the primer.

7. The method of claim 1 wherein the first nicking agent recognition sequence is identical to the second nicking agent recognition sequence.

8. The method of claim 7 wherein the first and second nicking agent recognition sequences are recognizable by a nicking endonuclease.

9. The method of claim 8 wherein the nicking endonuclease is N.BstNBI.

10. The method of claim 1 wherein the DNA polymerase is exo^" Vent polymerase or 9°Nm™ polymerase.

11. The method of claim 1 wherein the 3' terminus of the first template is blocked.

12. The method of claim 1 wherein the 3' terminus of the second template is blocked.

13. The method of claim 1 wherein the first and the second templates are immobilized.

14. The method of claim 1 where the first region of the first template is about 10 nucleotides in length.

15. The method of claim 1 wherein the first region of the second template is about 10 nucleotides in length.

16. The method of claim 1 further comprising the step of characterizing the amplified oligonucleotide.

17. The method of claim 16 wherein the characterizing step is performed at least partially by a technique selected from the group consisting of luminescence spectroscopy or spectrometry, fluorescence spectroscopy or spectrometry, mass spectrometry, liquid chromatography, fluorescence polarization, and electrophoresis.

18. The method of claim 17 wherein the reaction mixture further comprises a third template that comprises from 5' to 3':

(A) a first region that is at least substantially identical or complementary to the primer;

(B) the sequence of the antisense strand of a third nicking agent recognition sequence; and

(C) a second region that is not substantially identical or complementary to the primer.

19. The method of claim 18 wherein the first, second and third nicking agent recognition sequences are identical to each other.

20. The method of claim 1 wherein the step of incubating is performed under isothermal conditions.

21. The method of claim 1 wherein the primer is produced by

(A) annealing an oligonucleotide that comprises the sequence of the sense strand of a third nicking agent recogntion sequence to a target nucleic acid that comprises a sequence that is completely complementary to the primer; and

(B) amplifying the primer in the presence of the DNA polymerase and a third nicking agent that recognizes the third nicking agent recognition sequence.

22. The method of claim 21 wherein at least one nucleotide in the sense strand of the third NARS does not form a base pair with the nucleotide at its corresponding position in the target nucleic acid.

23. The method of claim 21 wherein the first, second and third nicking agent recognition sequences are identical to each other.

24. A composition comprising first and second templates wherein each template comprises a nucleotide sequence of a sense strand of a nicking agent recognition sequence, and wherein a 3' portion of the first template is at least substantially complementary to a 3' portion of the second template.

25. The composition of claim 24 wherein the 3' portion of the first template is completely complementary to the 3' portion of the second template.

26. The composition of claim 24 wherein the 3' terminus of the first template is blocked.

27. The composition of claim 24 wherein the 3' terminus of the second template is blocked.

28. The composition of claim 24 further comprising a nicking agent that recognizes the nicking agent recognition sequence.

29. The composition of claim 24 further comprising a DNA polymerase.

30. The composition of claim B1 further comprising an oligonucleotide primer that comprises a sequence that is at least substantially complementary to a region of the first template 3' to the sense strand of the nicking agent recognition sequence.

31. A method for amplifying a signal nucleotide (As) and another nucleic acid (A2) comprising

(a) providing

(i) a first template nucleic acid (T1) that comprises a nucleotide sequence of one strand of a nicking agent recognition sequence (NARS) and is at least substantially complementary to a trigger oligonucleotide primer (trigger ODNP); and

(ii) a signal template nucleic acid (Ts) that comprises a nucleotide sequence of one strand of the NARS; and is at least substantially complementary to the trigger ODNP;

(b) hybridizing the trigger ODNP to T1 and Ts;

(c) extending the trigger ODNP to form

(i) a hybrid (H1) comprising extended trigger ODNP hybridized to T1 , where H1 comprises both strands of the NARS; and

(ii) a hybrid (Hs) comprising extending trigger ODNP hybridized to Ts, where Hs comprises both strands of the NARS;

(d) nicking (i) H1 at a nicking site with a nicking agent (NA) that recognizes the NARS, the fragment having a 5' terminus at the nicking site being named A1 ; and

(ii) Hs at a nicking site with the NA, the fragment having a 5' terminus at the nicking site being named As, wherein As is not substantially identical to A1 ;

(e) repeating steps (c) and (d) to amplify A1 and As;

(f) providing a second template nucleic acid (T2) that comprises the sequence of one strand of the NARS and is at least substantially complementary to A1 , but not to As;

(g) hybridizing A1 to T2;

(h) extending A1 to form a hybrid (H2) comprising extended A1 hybridized to T2, where H2 comprises both strands of the NARS;

(i) nicking H2 with the NA, the fragment having a 5' terminus at the nicking site being named A2;

(j) extending the 3' terminus at the nicking site in H2 to re-form H2; and i

(k) repeating steps (i) and (j) to thereby amplify A2.

32. The method of claim 31 wherein steps (j)-(k) are performed in a single vessel.

33. The method of claim 31 wherein A1 is from 8 to 24 nucleotides in length.

34. The method of claim 31 wherein A2 is from 8 to 24 nucleotides in length.

35. The method of claim 31 wherein As is 4-30 nucleotides in length.

36. The method of claim 31 further comprising the step of detecting As.

37. A method for amplifying a nucleic acid molecule, comprising

(A) forming a mixture comprising

(i) an oligonucleotide primer having a sequence (S1 );

(ii) a first template nucleic acid having the sequence of the antisense strand of a nicking agent recognition sequence (NARS), wherein a sequence substantially complementary to S1 is present both 3' and 5' to the sequence of the antisense strand of the NARS;

(iii) a second template nucleic acid comprising from 5' to 3':

(a) a first region that is at least substantially complementary to S1;

(b) the sequence of the antisense strand of the NARS; and

(c) a second region that is not substantially complementary to S1 ; and

(iv) a nicking agent (NA) that recognizes the NARS; a DNA polymerase; and one or more deoxynucleoside triphosphate(s); and

(B) maintaining said mixture at conditions that amplify

(i) a first single-stranded nucleic acid molecule (A1 ) using the first template nucleic acid as a template; and

(ii) a second single-stranded nucleic acid molecule (As) using the second template nucleic acid as a template.

38. The method of claim 37 wherein the sequence in the first template nucleic acid that is at least substantially complementary to S1 is exactly complementary to S1.

39. The method of claim 37 wherein the amplified nucleic acid molecule A1 has a sequence that is exactly identical to S1.

40. The method of claim 37 further comprising the step of detecting the amplified nucleic acid molecule As.

41. An isolated single-stranded nucleic acid useful in detecting the presence or absence of a first target nucleic acid and a second target nucleic acid, wherein the first target nucleic acid is not adjacent to the second target nucleic acid in a naturally occurring nucleic acid molecule, comprising, from 5' to 3'

(A) a first sequence that is at least substantially complementary to the first target nucleic acid;

(B) a second sequence that is at least substantially complementary to the second target nucleic acid;

(C) the sequence of the antisense strand of a nicking agent recognition sequence; and

(D) a third sequence.

42. The isolated single-stranded nucleic acid of claim 41 wherein the first sequence is completely complementary to the first target nucleic acid.

43. The isolated single-stranded nucleic acid of claim 41 wherein the second sequence is completely complementary to the second target nucleic acid.

44. The isolated single-stranded nucleic acid of claim 41 further comprising a sequence 3' to the sequence of the antisense strand of the nicking agent recognition sequence that is at least substantially complementary to a third target nucleic acid.

45. The isolated single-stranded nucleic acid of claim 41 wherein the sequence of the antisense strand of the nicking agent recognition sequence is 5'- GACTC-3'.

46. The isolated single-stranded nucleic acid of claim 41 wherein the sequence of the antisense strand of the nicking agent recognition sequence is 5'- GATCC-3'.

47. A composition comprising

(A) a first template nucleic acid that comprises, from 5' to 3':

(i) a first nucleotide sequence that is at least substantially complementary to a nucleotide sequence present in a first target nucleic acid;

(ii) a nucleotide sequence which is an antisense strand of a nicking agent recognition sequence; and

(iii) a second nucleotide sequence; and

(B) a second template nucleic acid that comprises, from 5' to 3':

(i) a first sequence that is at least substantially complementary to a second target nucleic acid;

(ii) the sequence of the antisense strand of the nicking agent recognition sequence; and

(iii) a second sequence that is exactly identical to the second sequence of the first template nucleic acid.

48. The composition of claim 47 wherein the first sequence of the first template nucleic acid is completely complementary to the first target nucleic acid.

49. The composition of claim 47 wherein the first sequence of the second template nucleic acid is completely complementary to the second target nucleic acid.

50. The composition of claim 47 further comprising a third template nucleic acid that comprises, from 5' to 3':

(i) a first sequence that is at least substantially complementary to a third target nucleic acid;

(iii) a second sequence that is exactly identical to the second sequence of the first template.

51. An oligonucleotide template conjugate comprising a first oligonucleotide template and a second oligonucleotide template linked with each other, wherein

(i) the first template comprises the sequence of one strand of a first nicking agent recognition sequence; and

(ii) the second template comprises the sequence of one strand of a second nicking agent recognition sequence.

52. The oligonucleotide template conjugate of claim 51 wherein the first and second oligonucleotide templates are linked with each other via a linker.

53. The oligonucleotide template conjugate of claim 52 wherein the 3' terminus of the first oligonucleotide template is linked to the 5' terminus of the second oligonucleotide template via the linker.

54. The oligonucleotide template conjugate of claim 52 wherein the 3' terminus of the first oligonucleotide template is linked to the 3' terminus of the second oligonucleotide template via the linker.

55. The oligonucleotide template conjugate of claim 52 wherein the 5' terminus of the first oligonucleotide template is linked to the 5' terminus of the second oligonucleotide template via the linker.

56. The oligonucleotide template conjugate of claim 52 wherein the 5' terminus of the first oligonucleotide template is linked to the 3' terminus of the second oligonucleotide template via the linker.

57. The oligonucleotide template conjugate of claim 51 wherein the first oligonucleotide template is identical to the second oligonucleotide template.

58. The oligonucleotide template conjugate of claim 51 wherein the first nicking agent recognition sequence is identical to the second nicking agent recognition sequence.

59. The oligonucleotide template conjugate of claim 51 further comprises a third oligonucleotide template that comprises one strand of a third nicking agent recognition sequence.

60. A single-stranded template nucleic acid comprising, from 5' to 3'

(A) a first sequence;

(B) the sequence of the sense strand of a nicking agent recognition sequence; and

(C) a second sequence that is at least substantially complementary to a target nucleic acid; wherein the 5' terminus of the template nucleic acid is immobilized to a solid support, and the 3' terminus of the template nucleic acid is labeled with a detectable group.

61. The template nucleic acid of claim 60 wherein the nicking agent recognition sequence is recognizable by a nicking endonuclease.

62. The template nucleic acid of claim 60 wherein the detectable group is a fluorescent moiety.

63. A method of amplifying an oligonucleotide in the presence of a template nucleic acid and a nicking agent, wherein

(A) the oligonucleofide is 6-18 nucleotides in length;

(B) the template comprises the sequence of one strand of a nicking agent recognition sequence;

(C) the nicking agent recognizes the nicking agent recognition sequence; and

(D) the amplification has the kinetic that fits the equation σ∞ σ₀e ^{β t} where σ₀is an initial concentration of the oligonucleotide, and σ is the concentration of the oligonucleotide after the reaction is performed for a period of t, and β is a constant.