WO2004067000A1 - Benzthiazole-3 oxides useful for the treatment of proliferative disorders - Google Patents

Benzthiazole-3 oxides useful for the treatment of proliferative disorders Download PDF

Info

Publication number
WO2004067000A1
WO2004067000A1 PCT/GB2004/000327 GB2004000327W WO2004067000A1 WO 2004067000 A1 WO2004067000 A1 WO 2004067000A1 GB 2004000327 W GB2004000327 W GB 2004000327W WO 2004067000 A1 WO2004067000 A1 WO 2004067000A1
Authority
WO
WIPO (PCT)
Prior art keywords
oxy
nitro
benzothiazole
use according
compound
Prior art date
Application number
PCT/GB2004/000327
Other languages
French (fr)
Inventor
Campbell Mcinnes
Christopher Meades
Mokdad Mezna
Peter Fischer
Original Assignee
Cyclacel Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cyclacel Limited filed Critical Cyclacel Limited
Priority to JP2006502204A priority Critical patent/JP2006518361A/en
Priority to EP04705459A priority patent/EP1589967B1/en
Priority to DE602004006379T priority patent/DE602004006379T2/en
Publication of WO2004067000A1 publication Critical patent/WO2004067000A1/en
Priority to US11/192,893 priority patent/US20060040997A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • C07D277/62Benzothiazoles
    • C07D277/68Benzothiazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/428Thiazoles condensed with carbocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The present invention relates to the use of a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R1, R2, R3, and R4 are each independently H, N02, CF3, SCF3, CN, halo, OH, OR6, NH2, NHR6, NR6R7, N+R6R7R8, COOH, COOR6, CONH2, CONHR6, CONR6R7, COH, CORE, SR', SORE, S02R6, SO2OH, SO2OR6, S02NH2, S02NHR6, S02NR6R7, alkyl, cycloalkyl, cycloheteroalkyl, aryl, or heteroaryl, with the proviso that at least one of R1, R2, R3, and R4 is other than H; or R1 and R2, R2 and R3, or R3 and R4, may together form part of a fused or unfused saturated or unsaturated ring system, optionally containing up to two heteroatoms selected from N, 0, and S; R5 is OH, OR9, CN, CONH2, CONHNH2, CONHOH, CONHR9, CONR9R10, NH2, NHR9, or NR9R10; each R6, R7 and R8 is independently hydrocarbyl, or two of R6, R7 and R8 together form part of a saturated or unsaturated ring system, optionally containing up to two heteroatoms selected from N, 0, and S; each R9 and R10 is independently hydrocarbyl, or R9 and R10 together form part of a saturated or unsaturated ring system, optionally containing up to two heteroatoms selected from N, 0, and S; in the preparation of a medicament for treating a proliferative disorder.

Description

BENZTHIAZOLE-3 OXIDES USEFUL FOR THE TREATMENT OF PROLIFERATIVE DISORDERS
The present invention relates to the use of heterocyclic N-oxides as therapeutic agents in the treatment of proliferative disorders. More specifically, but not exclusively, the invention relates to the use of heterocyclic N-oxides that are capable of inhibiting polo- like kinases (PLKs).
BACKGROUND TO THE INVENTION
The therapeutic potential of pharmacological PLK inhibition has been noted in the literature (Kraker et al., in: Annual Reports in Medicinal Chemistry; Academic Press: San Diego, CA, 1999; pp 247). As yet though, there have been very few reports of small-molecule PLK inhibitors that may be useful as drugs.
To date, the only characterized biochemical PLK1 inhibitor is scytonemin, a symmetric indolic marine natural product (Stevenson et al., J. Pharmacol. Exp. Ther., 2002, 303, 858; Jacobs et al; WO 2001/062900; University of California). Scytonemin inhibits phosphorylation of CDC25C by recombinant PLK1 with an IC5o value of about 2 μM (at an ATP concentration of 10 μM). Inhibition is apparently reversible and the mechanism with respect to ATP is of mixed-competitive mode. Similar potency against other Ser/Thr and Thr/Tyr cell-cycle kinases, including MYTl , CHKl , CDKl/cyclin B, and PKC, was observed. Scytonemin was shown to have pronounced anti-proliferative effects on various human cell lines in vitro.
Certain 2-benzthiazolyl urea derivatives have been disclosed in the art as protein kinase inhibitors (Cusack et al., WO 2001/057008; BASF). However, there was no evidence to indicate that the 2-benzthiazolyl urea derivatives were capable of inhibiting PLKs.
There are also reports in the literature of benzthiazole-3-oxides having antibacterial and antifungal properties (see for example, Wagner et al., Ger. Offen. 2136923, 36 pp.;
Bayer A.-G.: Germany, 1973). Again though, there was no indication that the biological activity of these benzthiazole-3 -oxides was in any way associated with protein kinase inhibition in general, nor was there any reference to PLK inhibition. The present invention seeks to provide heterocyclic N-oxide compounds that have therapeutic applications in the treatment of a range of proliferative disorders.
STATEMENT OF INVENTION
A first aspect of the invention relates to the use of a compound of formula I, or a pharmaceutically acceptable salt thereof,
Figure imgf000004_0001
I wherein
R1, R2, R3, and R4 are each independently H, NO2, CF3, SCF3, CN, halo, OH, OR6, NH2, NHR6, NR6R7, N R , COOH, COOR6, CONH2, CONHR6, CONR6R7, COH, COR6, SR6, SOR6, SO2R6, SO2OH, SO2OR6, SO2NH2, SO2NHR6, SO2NR6R7, alkyl, cycloalkyl, cycloheteroalkyl, aryl, or heteroaryl, with the proviso that at least one of R1, R2, R3, and R4 is other than H; or R1 and R2, R2 and R3, or R3 and R4, may together form part of a fused or unfused saturated or unsaturated ring system, optionally containing up to two heteroatoms selected from N, O, and S;
RD is OH, ORy, CN, CONH2, CONHNH2, CONHOH, CONHRy, CONR °yτR> 1ι0υ, NH2, NHR9, or NR9R10;
each R6, R7 and R8 is independently hydrocarbyl, or two of R6, R7 and R8 together form part of a saturated or unsaturated ring system, optionally containing up to two heteroatoms selected from N, O, and S;
each R9 and R10 is independently hydrocarbyl, or R9 and R10 together form part of a saturated or unsaturated ring system, optionally containing up to two heteroatoms selected from N, O, and S; in the preparation of a medicament for treating a proliferative disorder.
A second aspect of the invention relates to a pharmaceutical composition comprising a compound of formula I as defined above and a pharmaceutically acceptable diluent, excipient or carrier, for use in the treatment of a proliferative disorder.
Further aspects of the invention relate to selected compounds of formula I, and pharmaceutical compositions comprising said compounds admixed with a pharmaceutically acceptable carrier, diluent or excipient.
Another aspect of the invention relates to a method of treating a PLK-dependent disorder, said method comprising administering to a subject in need thereof, a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined above, in an amount sufficient to inhibit PLK.
Another aspect of the invention relates to a method of inhibiting PLK in a cell comprising contacting said cell with an amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined above, such that PLK is inhibited in said cell.
Yet another aspect of the invention relates to a method of treating a proliferative disorder comprising inhibiting PLK by administering to a subject in need thereof, a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined above, such that treatment of said proliferative disorder occurs.
A further aspect of the invention relates to the use of a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined above, in an assay for identifying further candidate compounds capable of inhibiting PLK.
DETAILED DESCRIPTION
As used herein, the term "hydrocarbyl" refers to a saturated or unsaturated, straight- chain, branched, or cyclic group comprising at least C and H that may optionally comprise one or more other suitable substituents. Examples of such substituents may include halo, hydroxy, CF , CN, amino and nitro. If the hydrocarbyl group comprises more than one C then those carbons need not necessarily be linked to each other. For example, at least two of the carbons may be linked via a suitable element or group. Thus, the hydrocarbyl group may contain heteroatoms. Suitable heteroatoms will be apparent to those skilled in the art and include, for instance, sulphur, nitrogen, oxygen, phosphorus and silicon. Preferably, the hydrocarbyl group is an aryl or alkyl group.
As used herein the term "alkyl" includes both straight chain and branched alkyl groups. The alkyl group may be substituted (mono- or poly-) or unsubstituted. Suitable substituents include, for example, OH, COOH, halo-, alkoxy-, nitro-, CN, CF3 or a cyclic group. Preferably, the alkyl group is a C1.2o alkyl group, more preferably a C1-15, more preferably still a Cι-ι2 alkyl group, more preferably still, a d-6 alkyl group, more preferably a Cι-3 alkyl group. Particularly preferred alkyl groups include, for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl and hexyl.
As used herein, the term "heteroalkyl" includes an alkyl group as defined above which comprises one or more heteroatoms.
As used herein, the term "cycloalkyl" refers to a cyclic alkyl group which may be substituted (mono- or poly-) or unsubstituted. Suitable substituents include, for example, OH, COOH, halo-, alkoxy-, nitro-, CN, CF3 or a cyclic group.
Likewise, the term "cycloheteroalkyl" refers to a cyclic heteroalkyl group which may be substituted (mono- or poly-) or unsubstituted. Suitable substituents include, for example, OH, COOH, halo-, alkoxy-, nitro-, CN, CF3 or a cyclic group.
As used herein, the term "aryl" refers to a Cβ-io aromatic, substituted (mono- or poly-) or unsubstituted group, and includes, for example, phenyl, naphthyl etc. Again, suitable substituents include, for example, OH, COOH, halo-, alkoxy-, nitro-, CN, CF3 or a cyclic group. As used herein, the term "heteroaryl" refers to a C4.ιo aromatic, substituted (mono- or poly-) or unsubstituted group, which comprises one or more heteroatoms. Preferred heteroaryl groups include pyrrole, pyrazole, pyrimidine, pyrazine, pyridine, quinoline, thiophene and furan. Again, suitable substituents include, for example, OH, COOH, halo-, alkoxy-, nitro-, CN, CF3 or a cyclic group.
As used herein the phrase "preparation of a medicament" includes the use of a compound of formula I directly as the medicament in addition to its use in a screening programme for further antiproliferative agents or in any stage of the manufacture of such a medicament.
In one preferred embodiment of the invention:
R1, R2, R3, and R4 are each independently H, NO2, CF3, SCF3, CN, halo, OH, OR6,
NH2, NHR6, NR6R7, N R , COOH, COOR6, CONH2, CONHR6, CONR6R7, COH, COR6, SR6, SOR6, SO2R6, SO2OH, SO2OR6, SO2NH2, SO2NHR6, SO2NR6R7, alkyl, cycloalkyl, cycloheteroalkyl, aryl, or heteroaryl, with the proviso that at least one of R1, R2, R3, and R4 is other than H; or R1 and R2, R2 and R3, or R3 and R4, may together form part of a fused or unfused saturated or unsaturated ring system, optionally containing up to two heteroatoms selected from N, O, and S;
R5 is OH, OR9, CN, CONH2, CONHNH2, CONHOH, CONHR9, CONR9R10, NH2, NHR9, or NR9R10;
each R6, R7, R8, R9 and R10 is independently hydrocarbyl, or two of R6, R7, and R8 may together form part of a saturated or unsaturated ring system.
In one preferred embodiment, R1, R2, R3, and R4 are each independently H, NO2, CF , SCF3, CN, halo, OH, OR6, NH2, NHR6, NR6R7, N'RVR8, COOH, COOR6, CONH2, CONHR6, CONR6R7, COH, COR6, SR6, SOR6, SO2R6, SO2OH, SO2OR6, SO2NH2, SO2NHR6, SO2NR6R7, alkyl, cycloalkyl, cycloheteroalkyl, aryl, or heteroaryl. In one preferred embodiment, each R6, R7 and R8 is independently hydrocarbyl, or two of R6, R7 and R8 together form part of a saturated ring system, optionally containing up to two heteroatoms selected from N, O, and S.
In one preferred embodiment, each R9 and R10 is independently hydrocarbyl, or R9 and R10 together form part of a saturated ring system, optionally containing up to two heteroatoms selected from N, O, and S.
In one particularly preferred embodiment, each R6, R7 and R8 is independently hydrocarbyl, or two of R , R and R together form part of a saturated ring system.
In another particularly preferred embodiment, each R and R 10 is independently hydrocarbyl, or R9 and R10 together form part of a saturated ring system.
In the case where each R6, R7, R8, R9 and R10 is independently hydrocarbyl, preferably the hydrocarbyl group is an alkyl or aryl group, more preferably an alkyl group.
More preferably, R5 is OH, CN, CONH2, CONHNH2, CONHOH or CONR9R 10
Preferably, where R5 is CONR9R10, R9 and R10 together form part of a saturated ring system, optionally containing up to two heteroatoms selected from N, O, and S. Even more preferably, R9 and R10 together form part of a saturated ring system. More preferably still, R9 and R10 together form part of a pyrrolidine ring, i.e. R5 is CO- pyrrolidine.
In one particularly preferred embodiment, R5 is selected from CONH2, CO-pyrrolidine, CONHNH2, CONHOH, CN and OH.
In a more preferred embodiment of the invention, R1, R2, R3, and R4 are each independently H, NO2, CF3, SCF3 or halo.
In one particularly preferred embodiment, R2 is selected from CF3, F, SCF3 and H. In another particularly preferred embodiment, R3 and R1 are both H.
In another particularly preferred embodiment, R4 is NO2.
In one especially preferred embodiment, the compound of formula I is selected from the following:
7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid amide;
(7-Nifro-3-oxy-5-trifluoromethyl-benzothiazol-2-yl)-pyrrolidin-l-yl-methanone;
7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid hydrazide; 5-Cyano-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide;
7-Nifro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid hydroxyamide;
5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide;
5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid hydroxyamide;
7-Nifro-3-oxy-5-trifluoromethyl-benzothiazole-2-carbonitrile; 7-Nitro-3-oxy-5-trifluoromethyl-benzothiazol-2-ol; and
7-Nitro-3-oxy-5-trifluoromethylsulfanyl-benzothiazole-2-carboxylic acid amide.
Even more preferably, the compound of formula I is capable of inhibiting PLK. Preferably, the compound is capable of inhibiting PLKl as measured by an appropriate kinase assay. Details of a suitable assay may be found in the accompanying examples section. Preferably, the compound of formula I exhibits an IC50 value in a PLKl kinase assay of less than 100 μM, more preferably less than 50 μM, more preferably still, less than 25 μM. More preferably, the compound of formula I is selected from the following: 7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid amide; 5-Cyano-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide; 7-Nifro-3-oxy-5-trifluoromethyl-beιιzothiazole-2-carbonitrile; and 7-Nitro-3-oxy-5-trifluoromethylsulfanyl-benzothiazole-2-carboxylic acid amide.
More preferably still, the the compound of formula I exhibits an IC50 value in a PLKl kinase assay of less than 10 μM, more preferably less than 5 μM. hi a highly preferred embodiment, the compound of formula I is selected from: 7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid amide; and
7-Nitro-3-oxy-5-trifluoromethylsulfanyl-benzothiazole-2-carboxylic acid amide.
More preferably still, the compound of formula I exhibits an IC50 value in a PLKl kinase assay of less than 1 μM. In one highly preferred embodiment, the compound pf formula I is mtro-3-oxy-5-tri-_luoromethylsulfanyl-benzothiazole-2-carboxylic acid amide.
Even more preferably, the compound of formula I is capable of exhibiting an anti- proliferative effect as measured by an appropriate assay. Details of a suitable assay may be found in the accompanying examples section. Preferably, the compound of formula I exhibits an IC50 value in an MTT assay using A549, HELA, MCF-7 or U2OS cell lines of less than 100 μM, more preferably less than 50 μM, more preferably still, less than 25 μM, even more preferably, less than 10 μM. Preferably, the compound is selected from the following:
(7-Nitro-3 -oxy-5 -trifluoromethyl-benzothiazol-2-yl)-pyrrolidin- 1 -yl-methanone;
5-Cyano-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide;
5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide;
5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid hydroxyamide; 7-Nitro-3 -oxy-5 -trifluoromethyl-benzothiazole-2-carbonitrile; and
7-Nitro-3-όxy-5-trifluoromethylsulfanyl-benzothiazole-2-carboxylic acid amide.
THERAPEUTIC APPLICATIONS
The compounds of formula I have been found to possess anti-proliferative activity and are therefore believed to be of use in the treatment of proliferative disorders such as cancers, leukaemias and other disorders associated with uncontrolled cellular proliferation such as psoriasis and restenosis. As defined herein, an anti-proliferative effect within the scope of the present invention may be demonstrated by the ability to inhibit cell proliferation in an in vitro whole cell assay, for example using any of the cell lines A549, HELA, MCF-7 or U2OS. These assays, including methods for their performance, are described in more detail in the accompanying Examples. Using such assays it may be determined whether a compound is anti-proliferative in the context of the present invention.
One aspect of the present invention therefore relates to the use of one or more compounds of formula I in the treatment of proliferative disorders. Preferably, the proliferative disorder is a cancer or leukaemia. The term proliferative disorder is used herein in a broad sense to include any disorder that requires control of the cell cycle, for example cardiovascular disorders such as restenosis and cardiomyopathy, auto-immune disorders such as glomerulonephritis and rheumatoid arthritis, dermatological disorders such as psoriasis, anti-inflammatory, anti-fungal, antiparasitic disorders such as malaria, emphysema and alopecia. In these disorders, the compounds of the present invention may induce apoptosis or maintain stasis within the desired cells as required.
In one preferred embodiment of the invention, the proliferative disorder is cancer.
In another preferred embodiment, the proliferative disorder is glomerulonephritis.
In yet another preferred embodiment, the proliferative disorder is rheumatoid arthritis.
In another preferred embodiment, the proliferative disorder is psoriasis.
In another preferred embodiment, the proliferative disorder is a chronic obstructive pulmonary disorder.
The compounds of the invention may inhibit any of the steps or stages in the cell cycle, for example, formation of the nuclear envelope, exit from the quiescent phase of the cell cycle (GO), Gl progression, chromosome decondensation, nuclear envelope breakdown, START, initiation of DNA replication, progression of DNA replication, termination of DNA replication, centrosome duplication, G2 progression, activation of mitotic or meiotic functions, chromosome condensation, centrosome separation, microtubule nucleation, spindle formation and function, interactions with microtubule motor proteins, chromatid separation and segregation, inactivation of mitotic functions, formation of contractile ring, and cytokinesis functions. In particular, the compounds of the invention may influence certain gene functions such as chromatin binding, formation of replication complexes, replication licensing, phosphorylation or other secondary modification activity, proteolytic degradation, microtubule binding, actin binding, septin binding, microtubule organising centre nucleation activity and binding to components of cell cycle signalling pathways.
In one embodiment of the invention, the compound of formula I is administered in an amount sufficient to inhibit at least one PLK enzyme.
The polo-like kinases (PLKs) constitute a family of serine/threonine protein kinases. Mitotic Drosophila melanogaster mutants at the polo locus display spindle abnormalities (Sunkel et al., J. Cell Sci., 1988, 89, 25) and polo was found to encode a mitotic kinase (Llamazares et al, Genes Dev., 1991, 5, 2153). In humans, there exist three closely related PLKs (Glover et al., Genes Dev., 1998, 12, 3777). They contain a highly homologous amino-terminal catalytic kinase domain and their carboxyl termini contain two or three conserved regions, the polo boxes. The function of the polo boxes remains incompletely understood but they are implicated in the targeting of PLKs to subcellular compartments (Lee et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 9301; Leung et al., Nat. Struct. Biol., 2002, 9, 719), mediation of interactions with other proteins (Kauselmann et al., EMBO J., 1999, 18, 5528), or may constitute part of an autoregulatory domain (Nigg, Curr. Opin. Cell Biol., 1998, 10, 776). Furthermore, the polo box-dependent PLKl activity is required for proper metaphase/anaphase transition and cytokinesis (Yuan et al., Cancer Res., 2002, 62, 4186; Seong et al., J. Biol. Chem., 2002, 277, 32282).
Studies have shown that human PLKs regulate some fundamental aspects of mitosis (Lane et al., J. Cell. Biol, 1996, 135, 1701; Cogswell et al., Cell Growth Differ., 2000, 11, 615). In particular, PLKl activity is believed to be necessary for the functional maturation of cenfrosomes in late G2/early prophase and subsequent establishment of a bipolar spindle. Depletion of cellular PLKl through the small interfering RNA (siRNA) technique has also confirmed that this protein is required for multiple mitotic processes and completion of cytokinesis (Liu et al., Proc. Natl. Acad. Sci. USA, 2002, 99, 8672).
In a more preferred embodiment of the invention, the compound of formula I is administered in an amount sufficient to inhibit PLKl .
Of the three human PLKs, PLKl is the best characterized; it regulates a number of cell division cycle effects, including the onset of mitosis (Toyoshima-Morimoto et al., Nature, 2001, 410, 215; Roshak et al, Cell. Signalling, 2000, 12, 405), DNA-damage checkpoint activation (Smits et al., Nat. Cell Biol., 2000, 2, 672; van Nugt et al., J. Biol. Chem., 2001, 276, 41656), regulation of the anaphase promoting complex (Sumara et al., Mol. Cell, 2002, 9, 515; Golan et al., J. Biol. Chem., 2002, 277, 15552; Kotani et al., Mol. Cell, 1998, 1, 371), phosphorylation of the proteasome (Feng et al, Cell Growth Differ., 2001, 12, 29), and centrosome duplication and maturation (Dai et al., Oncogene, 2002, 21, 6195).
Specifically, initiation of mitosis requires activation of M-phase promoting factor (MPF), the complex between the cyclin dependent kinase CDK1 and B-type cyclins (Nurse, Nature, 1990, 344, 503). The latter accumulate during the S and G2 phases of the cell cycle and promote the inhibitory phosphorylation of the MPF complex by WEE1, MIK1, and MYTl kinases. At the end of the G2 phase, corresponding dephosphorylation by the dual-specificity phosphatase CDC25C triggers the activation of MPF (Nigg, Nat. Rev. Mol. Cell Biol., 2001, 2, 21). In interphase, cyclin B localizes to the cytoplasm (Hagting et al., EMBO J., 1998, 17, 4127), it then becomes phosphorylated during prophase and this event causes nuclear translocation (Hagting et al., Curr. Biol., 1999, 9, 680; Yang et al., J. Biol. Chem., 2001, 276, 3604). The nuclear accumulation of active MPF during prophase is thought to be important for initiating M-phase events (Takizawa et al, Curr. Opin. Cell Biol., 2000, 12, 658). However, nuclear MPF is kept inactive by WEE1 unless counteracted by CDC25C. The phosphatase CDC25C itself, localized to the cytoplasm during interphase, accumulates in the nucleus in prophase (Seki et al., Mol. Biol. Cell, 1992, 3, 1373; Heald et al., Cell, 1993, 74, 463; Dalai et al., Mol. Cell. Biol., 1999, 19, 4465). The nuclear entry of both cyclin B (Toyoshima-Morimoto et al., Nature, 2001, 410, 215) and CDC25C
(Toyoshima-Morimoto et al., EMBO Rep., 2002, 3, 341) are promoted through phosphorylation by PLKl (Roshak et al., Cell. Signalling, 2000, 12, 405). This kinase is an important regulator of M-phase initiation.
In one particularly preferred embodiment, the compounds of formula I are ATP- antagonistic inhibitors of PLKl.
In the present context ATP antagonism refers to the ability of an inhibitor compound to diminish or prevent PLK catalytic activity, i.e. phosphotransfer from ATP to a macromolecular PLK substrate, by virtue of reversibly or irreversibly binding at the enzyme's active site in such a manner as to impair or abolish ATP binding.
In another preferred embodiment, the compound of formula I is administered in an amount sufficient to inhibit PLK2 and/or PLK3.
Mammalian PLK2 (also known as SNK) and PLK3 (also known as PRK and FNK) were originally shown to be immediate early gene products. PLK3 kinase activity appears to peak during late S and G2 phase. It is also activated during DNA damage checkpoint activation and severe oxidative stress. PLK3 also plays an important role in the regulation of microtubule dynamics and centrosome function in the cell and deregulated PLK3 expression results in cell cycle arrest and apoptosis (Wang et al., Mol. Cell. Biol., 2002, 22, 3450). PLK2 is the least well understood homologue of the three PLKs. Both PLK2 and PLK3 may have additional important post-mitotic functions (Kauselmann et al., EMBO J., 1999, 18, 5528).
Another aspect of the invention provides a method of treating a PLK-dependent disorder, said method comprising administering to a subject in need thereof, a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined above, in an amount sufficient to inhibit PLK. Preferably, for this aspect of the invention the compound of formula I, or pharmaceutically acceptable salt thereof, is administered in an amount sufficient to inhibit PLKl.
Preferably, the PLK-dependent disorder is a proliferative disorder.
A further aspect of the invention relates to a method of inhibiting PLK in a cell comprising contacting said cell with an amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, such that PLK is inhibited in said cell.
Yet another aspect of the invention relates to a method of treating a proliferative disorder comprising inhibiting PLK by administering to a subject in need thereof, a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, such that treatment of said proliferative disorder occurs.
PHARMACEUTICAL COMPOSITIONS
In one preferred embodiment of the invention, the compound of formula I is administered in combination with a pharmaceutically acceptable excipient, diluent or carrier.
Even though the compounds of the present invention (including their pharmaceutically acceptable salts, esters and pharmaceutically acceptable solvates) can be administered alone, they will generally be administered in admixture with a pharmaceutical carrier, excipient or diluent, particularly for human therapy. The pharmaceutical compositions may be for human or animal usage in human and veterinary medicine.
Examples of such suitable excipients for the various different forms of pharmaceutical compositions described herein may be found in the "Handbook of Pharmaceutical
Excipients, 2nd Edition, (1994), Edited by A Wade and PJ Weller. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack
Publishing Co. (A. R. Gennaro edit. 1985).
Examples of suitable carriers include lactose, starch, glucose, methyl cellulose, magnesium stearate, mannitol, sorbitol and the like. Examples of suitable diluents include ethanol, glycerol and water.
The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as, or in addition to, the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s).
Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flow lactose, beta-lactose, corn sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose and polyethylene glycol.
Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like.
Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used.
SALTS/ESTERS
The compounds of formula I can be present as salts or esters, in particular pharmaceutically acceptable salts or esters. Pharmaceutically acceptable salts of the compounds of the invention include suitable acid addition or base salts thereof. A review of suitable pharmaceutical salts may be found in Berge et al, J Pharm Sci, 66, 1-19 (1977). Salts are formed, for example with strong inorganic acids such as mineral acids, e.g. sulphuric acid, phosphoric acid or hydrohalic acids; with strong organic carboxylic acids, such as alkanecarboxylic acids of 1 to 4 carbon atoms which are unsubstituted or substituted (e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acids, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric acid; with aminoacids, for example aspartic or glutamic acid; with benzoic acid; or with organic sulfonic acids, such as (Cι-C )-alkyl- or aryl-sulfonic acids which are unsubstituted or substituted (for example, by a halogen) such as methane- or p-toluene sulfonic acid.
Esters are formed either using organic acids or alcohols/hydroxides, depending on the functional group being esterified. Organic acids include carboxylic acids, such as alkanecarboxylic acids of 1 to 12 carbon atoms which are unsubstituted or substituted
(e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acid, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric acid; with aminoacids, for example aspartic or glutamic acid; with benzoic acid; or with organic sulfonic acids, such as (Cι-C4)-alkyl- or aryl-sulfonic acids which are unsubstituted or substituted (for example, by a halogen) such as methane- or p-toluene sulfonic acid. Suitable hydroxides include inorganic hydroxides, such as sodium hydroxide, potassium hydroxide, calcium hydroxide, aluminium hydroxide. Alcohols include alkanealcohols of 1-12 carbon atoms which may be unsubstituted or substituted, e.g. by a halogen).
ENANTIOMERS/TAUTOMERS
In all aspects of the present invention previously discussed, the invention includes, where appropriate all enantiomers and tautomers of compounds of formula I. The man skilled in the art will recognise compounds that possess an optical properties (one or more chiral carbon atoms) or tautomeric characteristics. The corresponding enantiomers and/or tautomers may be isolated/prepared by methods known in the art.
STEREO AND GEOMETRIC ISOMERS Some of the specific compounds of formula I may exist as stereoisomers and/or geometric isomers - e.g. they may possess one or more asymmetric and/or geometric centres and so may exist in two or more stereoisomeric and/or geometric forms. The present invention contemplates the use of all the individual stereoisomers and geometric isomers of those inhibitor agents, and mixtures thereof. The terms used in the claims encompass these forms, provided said forms retain the appropriate functional activity (though not necessarily to the same degree).
The present invention also includes all suitable isotopic variations of the compound or a pharmaceutically acceptable salt thereof. An isotopic variation of an agent of the present invention or a pharmaceutically acceptable salt thereof is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually found in nature. Examples of isotopes that can be incorporated into the agent and pharmaceutically acceptable salts thereof include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine and chlorine such as 2H, 3H, 13C, 14C, 15N, 17O, 180, 31P, 32P, 35S, 18F and 36C1, respectively. Certain isotopic variations of the agent and pharmaceutically acceptable salts thereof, for example, those in which a radioactive isotope such as 3H or 14C is incorporated, are useful in drug and/or substrate tissue distribution studies. Tritiated, i.e., 3H, and carbon-14, i.e., 14C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium, i.e., 2H, may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence may be preferred in some circumstances. Isotopic variations of the agent of the present invention and pharmaceutically acceptable salts thereof of this invention can generally be prepared by conventional procedures using appropriate isotopic variations of suitable reagents. SOLVATES
The present invention also includes the use of solvate forms of the compounds of the present invention. The terms used in the claims encompass these forms.
POLYMORPHS
The invention furthermore relates to the compounds of the present invention in their various crystalline forms, polymorphic forms and (an)hydrous forms. It is well established within the pharmaceutical industry that chemical compounds may be isolated in any of such forms by slightly varying the method of purification and or isolation form the solvents used in the synthetic preparation of such compounds.
PRODRUGS
The invention further includes the compounds of the present invention in prodrug form. Such prodrugs are generally compounds of formula I wherein one or more appropriate groups have been modified such that the modification may be reversed upon administration to a human or mammalian subject. Such reversion is usually performed by an enzyme naturally present in such subject, though it is possible for a second agent to be administered together with such a prodrug in order to perform the reversion in vivo. Examples of such modifications include ester (for example, any of those described above), wherein the reversion may be carried out be an esterase etc. Other such systems will be well known to those skilled in the art.
ADMINISTRATION
The pharmaceutical compositions of the present invention may be adapted for oral, rectal, vaginal, parenteral, intramuscular, intraperitoneal, intraarterial, intrathecal, intrabroncbial, subcutaneous, intradermal, intravenous, nasal, buccal or sublingual routes of administration.
For oral administration, particular use is made of compressed tablets, pills, tablets, gellules, drops, and capsules. Preferably, these compositions contain from 1 to 250 mg and more preferably from 10-100 mg, of active ingredient per dose. Other forms of administration comprise solutions or emulsions which may be injected intravenously, intraarterially, intrathecally, subcutaneously, intradermally, intraperitoneally or intramuscularly, and which are prepared from sterile or sterilisable solutions. The pharmaceutical compositions of the present invention may also be in form of suppositories, pessaries, suspensions, emulsions, lotions, ointments, creams, gels, sprays, solutions or dusting powders.
An alternative means of transdermal administration is by use of a skin patch. For example, the active ingredient can be incorporated into a cream consisting of an aqueous emulsion of polyethylene glycols or liquid paraffin. The active ingredient can also be incorporated, at a concentration of between 1 and 10% by weight, into an ointment consisting of a white wax or white soft paraffin base together with such stabilisers and preservatives as may be required.
Injectable forms may contain between 10 - 1000 mg, preferably between 10 - 250 mg, of active ingredient per dose.
Compositions may be formulated in unit dosage form, i.e., in the form of discrete portions containing a unit dose, or a multiple or sub-unit of a unit dose.
DOSAGE
A person of ordinary skill in the art can easily determine an appropriate dose of one of the instant compositions to administer to a subject without undue experimentation. Typically, a physician will determine the actual dosage which will be most suitable for an individual patient and it will depend on a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual undergoing therapy. The dosages disclosed herein are exemplary of the average case. There can of course be individual instances where higher or lower dosage ranges are merited, and such are within the scope of this invention. Depending upon the need, the agent may be administered at a dose of from 0.01 to 30 mg kg body weight, such as from 0.1 to 10 mg/kg, more preferably from 0.1 to 1 mg/kg body weight.
In an exemplary embodiment, one or more doses of 10 to 150 mg/day will be administered to the patient for the treatment of malignancy.
COMBINATIONS
In a particularly preferred embodiment, the one or more compounds of formula I are administered in combination with one or more other antiproliferative agents, for example, existing anticancer drugs available on the market. In such cases, the compounds of the invention may be administered consecutively, simultaneously or sequentially with the one or more other anticancer agents.
Anticancer drugs in general are more effective when used in combination. In particular, combination therapy is desirable in order to avoid an overlap of major toxicities, mechanism of action and resistance mechanism(s). Furthermore, it is also desirable to administer most drugs at their maximum tolerated doses with minimum time intervals between such doses. The major advantages of combining chemotherapeutic drugs are that it may promote additive or possible synergistic effects through biochemical interactions and also may decrease the emergence of resistance in early tumor cells which would have been otherwise responsive to initial chemotherapy with a single agent. An example of the use of biochemical interactions in selecting drug combinations is demonstrated by the administration of leucovorin to increase the binding of an active intracellular metabolite of 5-fluorouracil to its target, thymidylate synthase, thus increasing its cytotoxic effects.
Numerous combinations are used in current treatments of cancer and leukemia. A more extensive review of medical practices may be found in "Oncologic Therapies" edited by E. E. Nokes and H. M. Golomb, published by Springer. Beneficial combinations may be suggested by studying the growth inhibitory activity of the test compounds with agents known or suspected of being valuable in the treatment of a particular cancer initially or cell lines derived from that cancer. This procedure can also be used to determine the order of administration of the agents, i.e. before, simultaneously, or after delivery. Such scheduling may be a feature of all the cycle acting agents identified herein.
COMPOUNDS
The present invention also relates to compounds of formula I.
More specifically, the invention relates to compounds of formula I selected from the following:
7-Nitro-3-oxy-5-trifluoromethyl-benzothiazol-2-yl)-pyrrolidin-l-yl-methanone; 5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide; 5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid hydroxyamide; and
7-Nitro-3-oxy-5-trifluoromethylsulfanyl-benzothiazole-2-carboxylic acid amide.
CHEMICAL SYNTHESIS
The compounds of the present invention can be prepared by any method known in the art. In particular, benzthiazole-3 -oxides 1 can be obtained from nitrobenzenes 2, in which Z is a suitable leaving group, such as halogen or tosyl, by reaction with thioglycolic acid esters 3. Such aromatic nucleophilic substitution can be achieved readily when R2 and/or R4 are substituents that activate such reaction. Alternatively, palladium-catalysed substitution can be employed (Migita et al., Bull. Chem. Soc. Jpn., 1980, 53, 1385). Under the influence of excess tertiary amine base, the initially formed thioanisole adducts spontaneously cyclise to the benzthiazole-3 -oxide carboxylic acid esters 4 or cyclisation can be induced by heating (Wagner et al., Chem. Ber., 1973, 106,
640). The ester function can be transformed in various ways to obtain the desired substituents R5. Thus, carboxamides (1, R5 = CONR6R7) can be prepared by treatment of esters 5 with the corresponding amines, which in turn can be transformed into nitriles (1, R5 = CN), or alcohols (1, R5 = OH) (Wagner et al., Chem. Ber., 1976, 109, 611). Carboxylic acid hydroxamides (1, R5 = CONHOH) and hydrazides (1, R5 =
CONHNH2) can be obtained similarly.
Figure imgf000023_0001
ASSAYS
Another aspect of the invention relates to the use of a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined hereinabove in an assay for identifying further candidate compounds that influence the activity of one or more polo-like kinases.
Preferably, the assay is capable of identifying candidate compounds that are capable of inhibiting one or more polo-like kinases.
More preferably, the assay is a competitive binding assay.
As used herein, the term "candidate compound" includes, but is not limited to, a compound which may be obtainable from or produced by any suitable source, whether natural or not.
The candidate compound may be designed or obtained from a library of compounds, which may comprise peptides, as well as other compounds, such as small organic molecules and particularly new lead compounds. By way of example, the candidate compound may be a natural substance, a biological macromolecule, or an extract made from biological materials - such as bacteria, fungi, or animal (particularly mammalian) cells or tissues, an organic or an inorganic molecule, a synthetic candidate compound, a semi-synthetic candidate compound, a structural or functional mimetic, a peptide, a peptidomimetic, a derivatised candidate compound, a peptide cleaved from a whole protein, or a peptide synthesised synthetically, for example, either using a peptide synthesiser or by recombinant techniques or combinations thereof, a recombinant candidate compound, a natural or a non-natural candidate compound, a fusion protein or equivalent thereof and mutants, derivatives or combinations thereof. The candidate compound may even be a compound that is a modulator of PLK, such as a known inhibitor of PLK, that has been modified in some way eg. by recombinant DNA techniques or chemical synthesis techniques.
Typically, the candidate compound will be prepared by recombinant DNA techniques and/or chemical synthesis techniques.
Once a candidate compound capable of interacting PLK has been identified, further steps may be carried out to select and/or to modify the candidate compounds and/or to modify existing compounds, such that they are able to modulate PLK.
Preferably, the candidate compound is generated by conventional SAR modification of a compound of the invention.
As used herein, the term "conventional SAR modification" refers to standard methods known in the art for varying a given compound by way of chemical derivatisation.
Thus, in one aspect, the identified compound may act as a model (for example, a template) for the development of other compounds. The compounds employed in such a test may be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly. The abolition of activity or the formation of binding complexes between the compound and the agent being tested may be measured.
The assay of the present invention may be a screen, whereby a number of agents are tested. In one aspect, the assay method of the present invention is a high through-put screen. This invention also contemplates the use of competitive drug screening assays in which neutralising antibodies capable of binding a compound specifically compete with a candidate compound for binding to a compound.
Another technique for screening provides for high throughput screening (HTS) of agents having suitable binding affinity to the substances and is based upon the method described in detail in WO 84/03564.
It is expected that the assay methods of the present invention will be suitable for both small and large-scale screening of test compounds as well as in quantitative assays.
One aspect of the invention relates to a process comprising the steps of:
(a) performing an assay method described hereinabove;
(b) identifying one or more candidate compounds capable of binding to a polo-like kinase; and
(c) preparing a quantity of said one or more candidate compounds.
Another aspect of the invention provides a process comprising the steps of: (a) performing an assay method described hereinabove; (b) identifying one or more candidate compounds capable of binding to a polo-like kinase; and (c) preparing a pharmaceutical composition comprising said one or more candidate compounds.
Another aspect of the invention provides a process comprising the steps of:
(a) performing an assay method described hereinabove;
(b) identifying one or more candidate compounds capable of binding to a polo-like kinase;
(c) modifying said one or more candidate compounds capable of binding to a polo- like kinase;
(d) performing the assay method described hereinabove; (e) optionally preparing a pharmaceutical composition comprising said one or more candidate compounds.
The invention also relates to candidate compounds identified by the method described hereinabove.
Yet another aspect of the invention relates to a pharmaceutical composition comprising a candidate compound identified by the method described hereinabove.
Another aspect of the invention relates to the use of a candidate compound identified by the method described hereinabove in the preparation of a pharmaceutical composition for use in the treatment of proliferative disorders.
The above methods may be used to screen for a candidate compound useful as an inhibitor of one or more polo-like kinases.
The present invention is further described by way of example.
EXAMPLES
Example 1
The example compounds of the present invention are listed. in Table 1. Known compounds of structure 1 were prepared as described (Wagner et al., Chem. Ber., 1973, 106, 640; ibid. 1974, 107, 305; ibid. 1976, 109, 611). Compounds with novel chemical composition (lb, If, lg, and lj) were prepared similarly.
For compounds la - le and lh - lj, triethylamine (1.1 eq) was added to a suspension of the appropriate 2-chloro-l,3-dinitro-benzene precursor (1 eq) and mercapto-acetic acid ethyl ester (1 eq) in ethanol (3 mL) at 10 - 20 °C. Onset of reaction was indicated by an exotherm. The mixture was stirred with ice-bath cooling for an additional 3 h. The precipitated 7-nitro-3-oxy-benzothiazole-2-carboxylic acid ethyl ester products were collected by filtration and they were recrystallised from methanol.
For compounds If and lg, 4-fluoro-2,6-dinitrophenol (1 eq) was dissolved in toluene (5 mL) and tosyl chloride (1.1 eq) was added, followed by pyridine (1.1 eq). The mixture was stirred at room temperature for 12 h. After filtration, the filtrate was evaporated in vacuo and the residue of toluene-4-sulfonic acid 4-fluoro-2,6-dinitro-phenyl ester was used without further purification in the reaction with mercapto-acetic acid ethyl ester reaction as described above.
The appropriate 7-nitro-3-oxy-benzothiazole-2-carboxylic acid ethyl ester products were further reacted in methanol with excess ammonium hydroxide (for la, Id, If, and lj), pyrrolidine (for lb), hydrazine (for lc), or hydroxylamine (le and lg) for 4 h at room temperature. Products were filtered, washed with water and methanol, dried, and recrystallised from methanol.
Compound lh was obtained from la by successive treatment with excess phosphorous oxychloride of a solution in pyridine during several hours. After dilution with water, the products were filtered, washed with water, dried, and recrystallised from methanol. Compound li was obtained from lh by treatment with excess aqueous sodium hydroxide solution of a solution in water-methanol. After stirring at room temperature for 3 h, the clear solution was acidified and the precipitated product was filtered, washed with water and methanol, and was recrystallised from methanol.
Analytical data for the compounds in Table 1 are given below. Melting ponts (mp) are not corrected. HPLC analysis was performed using Nydac 218TP54 (4.5 x 250 mm) C18 reversed-phase silica columns. Elution was at 1 mL/min using a linear gradient from 10 to 70 % acetonitrile in 0.1 % aq trifluoroacetic acid over 20 min. Purities were obtained from peak integration of chromatograms (monitoring at λ = 254 nm). 1H- ΝMR spectra were obtained at 500 MHz field strength; chemical shifts are expressed in p. p.m. relative to tetramethylsilane internal standard.
7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid amide (la) 1H-ΝMR (DMSO-d6) δ: 8.76 (2H, s, Ar-H and NH), 8.96 (IH, s, Ar-H), 9.36 (IH, s, NH); mp 222-223 °C; HPLC: tR 13.75 min (100 %).
(7-Nitro-3-oxy-5-trifluoromethyl-benzothiazol-2-yl)-pyrrolidin-l-yl-methanone (lb) 1H-NMR (CDC13) δ: 2.04 (4H, t, J = 3.5 Hz, CH2), 3.76 (4H, dt, J = 18.0, 3.5 Hz, CH2), 8.21 (IH, s, Ar-H), 8.84 (IH, s, Ar-H); mp 176-178 °C; HPLC: tR 14.17 min (100 %).
7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid hydrazide (lc) 1H-NMR (DMSO-d6) δ: 5.20 (2H, s, NH2), 8.88 (IH, s, Ar-H), 8.95 (IH, s, Ar-H), 11.20 (IH, s, NH); mp 229-230 °C; HPLC: tR 11.96 min (100 %).
5-Cyano-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide (Id)
1H-NMR (DMSO-de) δ: 8.86 (IH, s, NH), 9.16 (IH, s, Ar-H), 9.22 (IH, s, Ar-H), 9.33
(IH, s, NH); mp 255-258 °C; HPLC: tR 9.30 min (78 %).
7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid hydroxyamide (le) 1H-NMR (DMSO-d6) δ: 8.86, 8.96 (2H, s, Ar-H), 10.17, 12.13 (2H, s, OH and NH); mp 230-231 °C; MS: m/z (%) 346 (MNa+, 100) and 324 (MH+, 63); HPLC: tR 12.33 min
(94 %).
5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid hydroxyamide (l ) 1H-NMR (DMSO-d6) δ 8.59, 8.79 (2H, s, Ar-H), 10.16, 12.17 (2H, s, OH and NH); mp 224-225 °C; HPLC: tR 8.62 min (100 %).
7-Nitro-3 '-oxy-5 -trifluoromethyl-benzothiazole-2-carbonitrile (lh) 1H-NMR (DMSO-d6) δ. 8.91 (IH, s, Ar-H), 9.02 (IH, s, Ar-H); mp 188-189 °C; HPLC: tR 15.60 min (100 %).
7-Nitro-3-oxy-5-trifluoromethyl-benzothiazol-2-ol (lϊ)
1H-NMR (DMSO-d6) δ: 7.88 (IH, s, Ar-H), 8.35 (IH, s, Ar-H); mp 181-183 °C; HPLC: tR 16.37 min (85 %).
7-Nitro-3-oxy-5-trifluoromethylsulfanyl-benzothiazole-2-carboxylic acid amide (lj) 1H-NMR (DMSO-d6) δ. 8.82, 8.85, 8.90 (3H, s, Ar-H and NH), 9.35 (IH, s, NH); mp 255-256 °C; HPLC ϊR 15.79 min (100 %).
Table 1. Structures of example compounds
Figure imgf000030_0001
Example 2
A full-length human CDC25C clone was isolated by PCR from HeLa mRNA and was inserted on a BamHI-Hindlll fragment into pRsetA. The amino terminal fragment of CDC25C (encoding residues 1-300) was excised from this vector and inserted into pET28a (between the Ncol and BamHI sites). Expression was under the control of the T7 promoter, and the encoded protein contained a His6 tag at the carboxyl terminus. The vector was transformed into E. coli strain BRL(DE3) pLysS for expression experiments. CDC25C was expressed in BL21(DE3) RIL bacteria cells, grown in LB media at 37 °C until OD6oonm of 0.6 was reached. The expression was induced with 1 mM 1PTG and the bacterial culture was grown further for 3 h. The bacteria were harvested by centrifugation and the cell pellet was re-suspended in 50 mM Tris pH 7.5 and 10 % sucrose, flash frozen, and stored at -70 °C until used. CDC25C protein was purified from E. coli inclusion bodies. The inclusion bodies were isolated in a buffer
(50 mM Tris pH 8.0, 2 mM ΕDTA, 100 mM NaCl, 0.5 % triton X-100). After denaturation in the presence of 6 M urea, the protein was refolded via slow dialysis of the urea. The protein was stored in 25 mM Tris pH 8.0, 100 mM NaCl, 1 mM DTT, 1 mM ΕDTA and 10 % glycerol at -70 °C until used.
A full-length human PLKl (XM_047240) (amino acids 1-603) clone was amplified from a foetal lung cDNA library using primers incorporating restriction enzyme sites. The 5' primer (gccgctagcgacgatgacgataagatgagtgctgcagtgactgcagggaagc) had an Nhel site prior to the ATG start codon. The 3' primer (ggaattcttaggaggccttgagacgg) incorporated a stop codon prior to the ΕcoRl site. The PCR product was cloned into the Nhel/ΕcoRl sites of a baculovirus expression vector, pSSPl. Cloning into this vector resulted in a His6 tag fusion at the amino terminus of the PLKl construct. Sf9 cells of a passage number less than 20 were split back to give a 300 mL culture volume, at a cell density of 1.5 x 10 cells/mL. Cells were only used for expression in logarithmic growth phase. PLKl baculovirus (from P2 amplification) was added to give a multiplicity of infection of 3, this is equivalent to 3 virus particles for each insect cell. The flasks were incubated at 27 °C, with shaking at 100 r.p.m. for 48 h. On harvest, cell density and viability was determined, the cultures spun down at 2500 r.p.m. for 5 min and washed with ice-cold phosphate-buffered saline. The wash was re-spun at the same speed and the pellet was snap frozen. PLKl protein was purified on a metal affinity column. The insect cell pellet was lysed in a buffer (10 mM Tris-HCl pH 8.0, 150 mM NaCl, 5 mM β-mercaptoethanol, 1 mM PMSF, 1 mM benzamidine, 20 mM imidazole and protease inhibitor cocktail (Sigma) and the pre-cleared supernatant was loaded onto NiNTA-agarose (Qiagen). The affinity column was washed with the lysis buffer and the bound protein was eluted with 250 mM imidazole in the same buffer. After overnight dialysis against 25 mM Tris HC1, pH 7.5, 100 mM NaCl, 1 mM DTT, 1 mM PMSF, 1 mM benzamidine, protease inhibitors cocktail (Sigma) and 10 % glycerol, the purified protein was stored at —70 °C until used.
Example 3 PLKl protein kinase assays were carried out using a 96-well plate format by incubating CDC25C (2 μg/well) with PLKl (1 μg/well) in 20 mM Tris/HCl buffer pH 7.5, supplemented with 25 mM β-glycerophosphate, 5 mM EGTA, 1 mM DTT and 1 mM NaNO3. Serial dilutions of test compound in assay buffer were added. Reaction was initiated by the addition of 100 μM ATP and 0.5 μCi of [γ-32P]-ATP. The reaction mixture was incubated at 30 °C for 1 h, then stopped with 75 mM aq orthophosphoric acid, transferred onto a 96-well P81 filter plate (Whatman), dried, and the extent of CDC25C phosphorylation was assessed by scintillation counting using a Packard TopCount plate reader. The raw assay data was analysed by non-linear regression analysis parameters and ICso values were determined using the equation: y = A + ((B- A)/(l+((C/x)ΛD))), where y is % inhibition, A is minimum inhibition, B is maximum inhibition, C is EC50, and D is the slope factor.
Cellular proliferation assays using human tumour cell lines (obtained from the American Type Culture Collection, 10801 University Boulevard, Manessas, NA 20110- 2209, USA) were carried out. Standard 72-h MTT (thiazolyl blue; 3-[4,5- dimethylthiazol-2-yl]-2,5-diρhenyltetrazolium bromide) assays were performed (Loveland et al, Biochem. Int., 1992, 27, 501; Haselsberger et al, Anti Cancer Drugs, 1996, 7, 331). In short: cells were seeded into 96-well plates according to doubling time and incubated overnight at 37 °C. Test compounds were made up in DMSO and a 1/3 dilution series prepared in 100 μL cell media, added to cells (in triplicates) and incubated for 72 h at 37 °C. MTT was made up as a stock of 5 mg/mL in cell media and filter-sterilised. Media was removed from cells followed by a wash with 200 μL PBS. MTT solution was then added at 20 μL per well and incubated in the dark at 37 °C for 4 h. MTT solution was removed and cells again washed with 200 μL PBS. MTT dye was solubilised with 200 μL per well of DMSO with agitation. Absorbance was read at 540 nm and data analysed using curve-fitting software (GraphPad Prism version 3.00 for Windows, GraphPad Software, San Diego California USA) to determine IC50 values
(concentration of test compound which inhibits cell growth by 50%).
Inhibition data for the example compounds of this invention are summarised in Table 2.
Table 2. Biological activity.
Figure imgf000033_0001
* Refer Table 1.
** This result was obtained performing the kinase assay at 10 μM ATP in contrast to others performed at 100 μM ATP.
*** n/d: Not determined.
Various modifications and variations of the described aspects of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes of carrying out the invention which are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.

Claims

1. Use of a compound of formula I, or a pharmaceutically acceptable salt thereof,
Figure imgf000034_0001
I wherein
R1, R2, R3, and R4 are each independently H, NO2, CF3, SCF3, CN, halo, OH, OR6, NH2, NHR6, NR6R7, N R'R8, COOH, COOR6, CONH2, CONHR6, CONR6R7, COH, COR6, SR6, SOR6, SO2R6, SO2OH, SO2OR6, SO2NH2, SO2NHR6, SO2NR6R7, alkyl, cycloalkyl, cycloheteroalkyl, aryl, or heteroaryl, with the proviso that at least one of R1, R2, R3, and R4 is other than H; or R1 and R2, R2 and R3, or R3 and R4, may together form part of a fused or unfused saturated or unsaturated ring system, optionally containing up to two heteroatoms selected from N, O, and S;
R5 is OH, OR9, CN, CONH2, CONHNH2, CONHOH, CONHR9, CONR9R10, NH2, NHR9, orNR9R10;
each R6, R7 and R8 is independently hydrocarbyl, or two of R6, R7 and R8 together form part of a saturated or unsaturated ring system, optionally containing up to two heteroatoms selected from N, O, and S; each R9 and R10 is independently hydrocarbyl, or R9 and R10 together form part of a saturated or unsaturated ring system, optionally containing up to two heteroatoms selected from N, O, and S;
in the preparation of a medicament for treating a proliferative disorder.
2. Use according to claim 1 wherein R1, R2, R3, and R4 are each independently H, NO2, CF3, SCF3, CN, halo, OH, OR6, NH2, NHR6, NR6R7, N RV, COOH, COOR6, CONH2, CONHR6, CONR6R7, COH, COR6, SR6, SOR6, SO2R6, SO2OH, SO2OR6,
SO2NH2, SO2NHR6, SO2NR6R7, alkyl, cycloalkyl, cycloheteroalkyl, aryl, or heteroaryl.
3. Use according to claim 1 or claim 2 wherein each R6, R7 and R8 is independently hydrocarbyl, or two of R6, R7 and R8 together form part of a saturated ring system, optionally containing up to two heteroatoms selected from N, O, and S.
4. Use according to any preceding claim wherein each R9 and R10 is independently hydrocarbyl, or R9 and R10 together form part of a saturated ring system, optionally containing up to two heteroatoms selected fromN, O, and S.
5. Use according to any preceding claim wherein the hydrocarbyl group is an alkyl or aryl group.
6. Use according to any preceding claim wherein R5 is OH, CN, CONH2, CONHNH2, CONHOH or CONR9R10.
7. Use according to claim 6 wherein R9 and R10 together form part of a saturated ring system.
8. Use according to any preceding claim wherein R5 is selected from CONH2, CO- pyrrolidine, CONHNH2, CONHOH, CN and OH.
9. Use according to any preceding claim wherein R1, R2, R3, and R4 are each independently H, NO2, CF3, SCF3 or halo.
10. Use according to any preceding claim wherein R2 is selected from CF3, F, SCF3 and H.
11. Use according to any preceding claim wherein R3 and R1 are both H.
12. Use according to any preceding claim wherein R4 is NO2.
13. Use according to any preceding claim wherein said compound of formula I is selected from the following:
7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid amide; (7-Nifro-3-oxy-5-trifluoromethyl-ber-zothiazol-2-yl)-pyrrolidin-l-yl-methanone; 7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid hydrazide; 5-Cyano-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide; 7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid hydroxyamide; 5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide; 5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid hydroxyamide; 7-Nitro-3 -oxy-5 -trifluoromethyl-benzothiazole-2-carbonitrile; 7-Nitro-3 -oxy-5 -trifluoromethyl-benzothiazol-2-ol; and 7-Nitro-3-oxy-5-trifluoromethylsulfanyl-benzothiazole-2-carboxylic acid amide.
14. Use according to claim 13 wherein the compound of formula I is selected from the following:
7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carboxylic acid amide; 5-Cyano-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide; 7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carbonitrile; and 7-Nitro-3-oxy-5-trifluoromethylsulfanyl-benzothi-_zole-2-carboxylic acid amide.
15. Use according to claim 13 wherein the compound of formula I is selected from the following:
(7-Nifro-3-oxy-5-trifluoromethyl-benzotMazol-2-yl)-pyrrolidin-l-yl-methanone; 5-Cyano-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide; 5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide; 5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid hydroxyamide; 7-Nitro-3-oxy-5-trifluoromethyl-benzothiazole-2-carbonitrile; and 7-Nitro-3-oxy-5-trifluoromethylsulfanyl-benzothiazole-2-carboxylic acid amide.
16. Use according to any preceding claim wherein the proliferative disorder is cancer.
17. Use according to any one of claims 1 to 15 wherein the proliferative disorder is glomerulonephritis.
18. Use according to any one of claims 1 to 15 wherein the proliferative disorder is rheumatoid arthritis.
19. Use according to any one of claims 1 to 15 wherein the proliferative disorder is psoriasis.
20. Use according to any one of claims 1 to 15 wherein the proliferative disorder is a chronic obstructive pulmonary disorder.
21. Use according to any preceding claim wherein said compound of formula I is administered in an amount sufficient to inhibit at least one PLK enzyme.
22. Use according to claim 21 wherein the PLK enzyme is PLKl .
23. Use according to any preceding claim wherein said compound of formula I is administered in combination with a pharmaceutically acceptable excipient, diluent or carrier.
24. Use according to any preceding claim wherein said compound of formula I is administered in combination with a further anti-proliferative agent.
25. A method of treating a proliferative disorder, said method comprising administering to a subject a compound of formula I as defined in any one of claims 1 to 15.
26. A pharmaceutical composition comprising a compound of formula I as defined in any one of claims 1 to 15 and a pharmaceutically acceptable diluent, excipient or carrier, for use in the treatment of a proliferative disorder.
27. A compound selected from the following:
(7-Nifro-3-oxy-5-trifluoromethyl-berιzothiazol-2-yl)-pyrrolidin-l-yl-methanone; 5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid amide; 5-Fluoro-7-nitro-3-oxy-benzothiazole-2-carboxylic acid hydroxyamide; and 7-Nitro-3-oxy-5-trifluoromethylsulfanyl-benzothiazole-2-carboxylic acid amide.
28. A pharmaceutical composition comprising a compound according to claim 27 admixed with a pharmaceutically acceptable diluent, excipient or carrier.
29. A method of treating a PLK-dependent disorder, said method comprising administering to a subject in need thereof, a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined in any one of claims 1 to 15, in an amount sufficient to inhibit PLK.
30. A method according to claim 29 wherein the compound of formula I, or pharmaceutically acceptable salt thereof, is administered in an amount sufficient to inhibit PLKl.
31. A method according to claim 29 or 30 wherein the PLK-dependent disorder is a proliferative disorder.
32. A method of inhibiting PLK in a cell comprising contacting said cell with an amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined in any one of claims 1 to 15, such that PLK is inhibited in said cell.
33. A method of treating a proliferative disorder comprising inhibiting PLK by administering to a subject in need thereof, a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined in any one of claims 1 to 15, such that treatment of said proliferative disorder occurs.
34. Use of a compound of formula I as defined in any one of claims 1 to 15 in an assay for identifying further candidate compounds capable of inhibiting PLK.
5. Use according to claim 34 wherein said assay is a competitive binding assay.
PCT/GB2004/000327 2003-01-30 2004-01-27 Benzthiazole-3 oxides useful for the treatment of proliferative disorders WO2004067000A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2006502204A JP2006518361A (en) 2003-01-30 2004-01-27 Benzothiazole-3-oxide useful for the treatment of proliferative diseases
EP04705459A EP1589967B1 (en) 2003-01-30 2004-01-27 Benzthiazole-3 oxides useful for the treatment of proliferative disorders
DE602004006379T DE602004006379T2 (en) 2003-01-30 2004-01-27 BENZTHIAZOLE-3 OXIDE FOR THE TREATMENT OF PROLIFERATIVE DISORDER
US11/192,893 US20060040997A1 (en) 2003-01-30 2005-07-28 Benzthiazole-3 oxides useful for the treatment of proliferative disorders

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB0302220.9A GB0302220D0 (en) 2003-01-30 2003-01-30 Use
GB0302220.9 2003-01-30

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/192,893 Continuation US20060040997A1 (en) 2003-01-30 2005-07-28 Benzthiazole-3 oxides useful for the treatment of proliferative disorders

Publications (1)

Publication Number Publication Date
WO2004067000A1 true WO2004067000A1 (en) 2004-08-12

Family

ID=9952174

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2004/000327 WO2004067000A1 (en) 2003-01-30 2004-01-27 Benzthiazole-3 oxides useful for the treatment of proliferative disorders

Country Status (7)

Country Link
US (1) US20060040997A1 (en)
EP (1) EP1589967B1 (en)
JP (1) JP2006518361A (en)
AT (1) ATE361749T1 (en)
DE (1) DE602004006379T2 (en)
GB (1) GB0302220D0 (en)
WO (1) WO2004067000A1 (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7504513B2 (en) 2006-02-27 2009-03-17 Hoffman-La Roche Inc. Thiazolyl-benzimidazoles
US8044213B2 (en) 2008-12-18 2011-10-25 Hoffmann-La Roche Inc. Thiazolyl-benzimidazoles
FR2967672A1 (en) * 2010-11-22 2012-05-25 Sanofi Aventis NITROBENZOTHIAZOLE DERIVATIVES, PREPARATION THEREOF AND THERAPEUTIC APPLICATIONS THEREOF
US8391652B2 (en) 2002-10-07 2013-03-05 Vascular Imaging Corporation Systems and methods for minimally-invasive optical-acoustic imaging
EP2610256A1 (en) 2007-09-28 2013-07-03 Cyclacel Limited Pyrimidine derivatives as protein kinase inhibitors
WO2013144632A1 (en) 2012-03-30 2013-10-03 Cyclacel Limited Treatment of proliferative diseases with pyrimidodiazepinones
US8560048B2 (en) 2008-10-02 2013-10-15 Vascular Imaging Corporation Optical ultrasound receiver
WO2021032959A1 (en) 2019-08-16 2021-02-25 Cyclacel Limited Crystalline forms of pyrimidino diazepine derivative
WO2021032958A1 (en) 2019-08-16 2021-02-25 Cyclacel Limited Process for the preparation of a pyrimidino-diazepine derivative
US11162083B2 (en) 2018-06-14 2021-11-02 University Of South Carolina Peptide based inhibitors of Raf kinase protein dimerization and kinase activity

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0012528D0 (en) * 2000-05-23 2000-07-12 Univ Palackeho Triterpenoid derivatives
GB0219052D0 (en) * 2002-08-15 2002-09-25 Cyclacel Ltd New puring derivatives
US20170283445A1 (en) 2016-04-05 2017-10-05 University Of South Carolina Small Molecule Inhibitors Selective For Polo-Like Kinase Proteins
KR102081417B1 (en) * 2018-11-23 2020-02-25 주식회사 이뮤니스바이오 Use of BTO-1 for proliferating NK cells

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE2013434A1 (en) * 1970-03-20 1971-10-07 Farbenfabriken Bayer Ag, 5090 Lever Kusen Benzothiazole 3-oxides as concrementinhibitors
US3691186A (en) * 1969-01-31 1972-09-12 Bayer Ag Certain substituted benzthiazole-n-oxides and their preparation
EP0334138A1 (en) * 1988-03-25 1989-09-27 Bayer Ag 7-Substituted 2-carbonamido-benzthiazole-3 oxides
WO2000004901A1 (en) * 1998-07-21 2000-02-03 Thomas Jefferson University Small molecule inhibitors of bcl-2 proteins

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3691186A (en) * 1969-01-31 1972-09-12 Bayer Ag Certain substituted benzthiazole-n-oxides and their preparation
DE2013434A1 (en) * 1970-03-20 1971-10-07 Farbenfabriken Bayer Ag, 5090 Lever Kusen Benzothiazole 3-oxides as concrementinhibitors
EP0334138A1 (en) * 1988-03-25 1989-09-27 Bayer Ag 7-Substituted 2-carbonamido-benzthiazole-3 oxides
WO2000004901A1 (en) * 1998-07-21 2000-02-03 Thomas Jefferson University Small molecule inhibitors of bcl-2 proteins

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8391652B2 (en) 2002-10-07 2013-03-05 Vascular Imaging Corporation Systems and methods for minimally-invasive optical-acoustic imaging
US7504513B2 (en) 2006-02-27 2009-03-17 Hoffman-La Roche Inc. Thiazolyl-benzimidazoles
EP2610256A1 (en) 2007-09-28 2013-07-03 Cyclacel Limited Pyrimidine derivatives as protein kinase inhibitors
US8560048B2 (en) 2008-10-02 2013-10-15 Vascular Imaging Corporation Optical ultrasound receiver
US8044213B2 (en) 2008-12-18 2011-10-25 Hoffmann-La Roche Inc. Thiazolyl-benzimidazoles
FR2967672A1 (en) * 2010-11-22 2012-05-25 Sanofi Aventis NITROBENZOTHIAZOLE DERIVATIVES, PREPARATION THEREOF AND THERAPEUTIC APPLICATIONS THEREOF
WO2012069743A1 (en) * 2010-11-22 2012-05-31 Sanofi Nitrobenzothiazole derivatives and use thereof for treating tuberculosis
US8993561B2 (en) 2010-11-22 2015-03-31 Sanofi Nitrobenzothiazole derivatives, preparation thereof and therapeutic applications thereof
WO2013144632A1 (en) 2012-03-30 2013-10-03 Cyclacel Limited Treatment of proliferative diseases with pyrimidodiazepinones
US11162083B2 (en) 2018-06-14 2021-11-02 University Of South Carolina Peptide based inhibitors of Raf kinase protein dimerization and kinase activity
WO2021032959A1 (en) 2019-08-16 2021-02-25 Cyclacel Limited Crystalline forms of pyrimidino diazepine derivative
WO2021032958A1 (en) 2019-08-16 2021-02-25 Cyclacel Limited Process for the preparation of a pyrimidino-diazepine derivative

Also Published As

Publication number Publication date
EP1589967A1 (en) 2005-11-02
ATE361749T1 (en) 2007-06-15
DE602004006379D1 (en) 2007-06-21
EP1589967B1 (en) 2007-05-09
US20060040997A1 (en) 2006-02-23
GB0302220D0 (en) 2003-03-05
JP2006518361A (en) 2006-08-10
DE602004006379T2 (en) 2008-01-10

Similar Documents

Publication Publication Date Title
US20060040997A1 (en) Benzthiazole-3 oxides useful for the treatment of proliferative disorders
KR102275338B1 (en) N-[4-fluoro-5-[[(2S,4S)-2-methyl-4-[(5-methyl-1,2,4-oxadiazol-3-yl)methoxy] as OGA inhibitor -1-piperidyl]methyl]thiazol-2-yl]acetamide
US7576091B2 (en) Thiazolo-, oxazalo and imidazolo-quinazoline compounds capable of inhibiting protein kinases
RU2478100C2 (en) Pyrimidine derivatives used as protein kinase inhibitors
US20090215805A1 (en) 4-Heteroaryl Pyrimidine Derivatives and use thereof as Protein Kinase Inhibitors
US20090318446A1 (en) 4-(1H-Indol-3-yl)-Pyrimidin-2-Ylamine Derivatives and Their Use in Therapy
US20060241297A1 (en) Pyridinylamino-pyrimidine derivatives as protein kinase inhibitors
JP2006523219A (en) Protein kinase inhibitor
US11319300B2 (en) Polyfluoro-substituted aromatic heterocyclic derivative, pharmaceutical composition containing same, and applications thereof
US9233965B2 (en) 3,4-dihydropyrrolo[1,2-A]pyrazine-2,8(1H)-dicarboxamide derivatives, preparation thereof and therapeutic use thereof for diseases involving casein kinase 1 epsilon and/or casein kinase 1 delta
KR20180083411A (en) 1,3,4-thiadiazole compounds and uses thereof in the treatment of cancer
JP2020529465A (en) Substituted pyrazolopyrimidine useful as a kinase inhibitor
BRPI0313480B1 (en) PURINA DERIVATIVES, ITS PREPARATION PROCESSES, PHARMACEUTICAL COMPOSITIONS UNDERSTANDING THE SAME AND USES OF THE ABOVE DERIVED FROM THE PREPARATION OF MEDICINES
WO2012121168A1 (en) Kinase inhibitor
KR101812128B1 (en) 3-Isoxazol-3-yl)-pyrazolo[3,4-d]pyrimidine-4-amine derivatives as protein kinase inhibitors
CN116693470A (en) Histamine H3 receptor inhibitor and medical application thereof
KR20100073454A (en) Novel pyrazolodiazepine compound as an transglutaminase inhibitor, the preparation method thereof and a composition containing the same

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2004705459

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 11192893

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2006502204

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2004705459

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 11192893

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 2004705459

Country of ref document: EP