WO2004055048A2 - Chimeric alpha q-gustducin g-proteins - Google Patents

Chimeric alpha q-gustducin g-proteins Download PDF

Info

Publication number
WO2004055048A2
WO2004055048A2 PCT/CH2003/000830 CH0300830W WO2004055048A2 WO 2004055048 A2 WO2004055048 A2 WO 2004055048A2 CH 0300830 W CH0300830 W CH 0300830W WO 2004055048 A2 WO2004055048 A2 WO 2004055048A2
Authority
WO
WIPO (PCT)
Prior art keywords
protein
chimeric
receptor
cells
gustducin
Prior art date
Application number
PCT/CH2003/000830
Other languages
French (fr)
Other versions
WO2004055048A3 (en
Inventor
Jay Patrick Slack
Thomas Scott Mccluskey
Original Assignee
Givaudan Sa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Givaudan Sa filed Critical Givaudan Sa
Priority to DE60320682T priority Critical patent/DE60320682T2/en
Priority to AU2003286069A priority patent/AU2003286069A1/en
Priority to JP2004559553A priority patent/JP4654038B2/en
Priority to US10/538,038 priority patent/US7919236B2/en
Priority to EP03776743A priority patent/EP1581555B1/en
Priority to CA002507387A priority patent/CA2507387A1/en
Publication of WO2004055048A2 publication Critical patent/WO2004055048A2/en
Publication of WO2004055048A3 publication Critical patent/WO2004055048A3/en
Priority to US13/035,435 priority patent/US8609362B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4722—G-proteins

Definitions

  • the invention relates to chimeric G-proteins, and in particular those that mediate in taste receptor transduction pathways.
  • the invention also relates to assays based on heterologous expression systems containing said proteins, and their use in screening for modulators of bitter, sweet and umami taste response in humans.
  • Taste sensation can be classified into five separate modalities: bitter, salty, sour, sweet and umami.
  • Tastants affect the palatability of food and beverages, thereby influencing human nutritional habits. They also affect the palatability of other ingestibles such as orally administered pharmaceuticals and nutraceuticals. Understanding and manipulating the mechanism of taste transduction has implications for the food and pharmaceutical industries. If the taste transduction pathways can be manipulated, it may be possible to create assays based on heterologous expression systems, which in turn may be used to identify compounds that can modulate taste response, and thereby render certain foods more palatable or increase patient compliance in oral pharmaceutics and nutraceutics.
  • GPCRs are cell surface proteins that are able to bind to tastant molecules whereupon they couple to G-proteins initiating cellular processes producing secondary messengers, such as calcium ions, that enable the cells to send a signal to the brain indicating a taste response.
  • GPCRs are classified as G q -, Gr, G 0 -, and G s -coupled receptors, which notation is reflective of the primary G-protein effector in their requisite signal transduction pathways.
  • Taste receptors are classified as Gj-coupled GPCRs because of their interaction with Gustducin, which is a G ⁇ i -type G-protein.
  • a second problem is the provision of G-proteins that not only are able to couple with many different types of GPCRs (often, such G-proteins are referred to as "promiscuous"), but also couple with high efficiency, such that even with relatively low surface concentrations of GPCRs, the cell signal is as strong as possible .
  • G ⁇ q proteins G ⁇ ⁇ s and G ⁇ i 6
  • GPCRs couple GPCRs to the activation of phopholipase C which leads to an increase in intracellular calcium levels.
  • This signalling cascade can be easily and quickly measured by measuring the calcium levels in the cells as is well known in the art (see for example WO 0118050).
  • 5 and G ⁇ ⁇ are not considered to be truly universally promiscuous G-proteins since there are several receptors that are . incapable of activating them, see for example, Offermanns, S. and Simon, M., 1995, J. Biol.
  • G ⁇ i6 can complex with beta/gamma sub-units endogenous to mammalian cells, such as cells of the HEK 293 cell line. It is faster, easier and more sensititive to employ G ⁇ 16 rather than G ⁇ j-type of G-protein such as Gustducin.
  • G-proteins that display high affinity for a wide range of taste receptors and in particular, sweet, umami and bitter receptors, that can be incorporated into heterologous expression system assays to screen for modulators of the human taste response, thereby to quantify the activity of known tastant molecules and to discover new ones.
  • the use of chimeric G-proteins has been suggested in the prior art.
  • WO 02/36622 a G ⁇ q chimeric protein is describe that is substituted with at least 5 amino acid units from the C-terminus of Transducin.
  • Such Chimeric proteins are described as being more promiscuous than the native G ⁇ q in relation to two chemosensory GPCRs.
  • the only taste receptor tested in this reference was a mouse bitter receptor. Therefore, it is not clear whether any of the chimeric G-proteins described would couple more efficiently to human bitter, sweet or umami taste receptors.
  • chimeric G-proteins based on G ⁇ q -Gustducin are able to bind to a wide range of known and putative bitter taste receptors, and sweet and umami receptors with high affinity.
  • the invention provides in a first aspect a G ⁇ q -Gu s tduci ⁇ chimeric G- protein.
  • the chimeric G ⁇ q -Gustducin is a G ⁇ 15 or i6-Gustducin protein, more specifically a G ⁇ ⁇ 6 -Gustducin protein.
  • the G-protein is one wherein at least the last 5 amino acids of the G ⁇ q are replaced by a corresponding number of amino acids of Gustducin, more particularly the last 44 amino acid sequences of the G ⁇ q is replaced with a 44 amino acid unit of Gustducin.
  • Another aspect the invention provides a nucleic acid encoding for a protein as herein above defined.
  • nucleic acid comprises the nucleotide sequence set forth in SEQ ID 1.
  • the chimeric proteins of the present invention may be formed by making substitutions at the C-terminus of Gustducin
  • substitutions or mutations may be incorporated into the G-proteins that may affect their promiscuity and/or their degree of coupling to a given receptor, and these variants of the G-proteins form another aspect of the present invention.
  • substitutions or mutations may be formed without the skilled person having recourse to any inventive activity, simply by using routine techniques in gene technology such as PCR, gene cloning, site-directed mutagenesis or cDNAs, transfection of host cells, and in-vitro transcription. Thereafter, these variants may be screened for functional coupling to receptors.
  • a variant that is a polypeptide having 80%, preferably 90%, more preferably 95% or greater homology to the sequence as set forth in SEQ ID No. 2.
  • aspects of the invention are an expression vector comprising nucleic acid encoding for chimeric G-proteins defined herein, and host cells transformed or transfected with said vector.
  • a method of producing a chimeric G-protein as defined comprising the step of culturing host cells as defined having contained therein an expression vector encoding for the chimeric G-protein, under conditions sufficient for expression of said G-protein, thereby causing production of the protein, and recovering the protein produced by the cell.
  • a mammalian cell-based assay employing a transiently transfected gene or cDNA encoding a chimeric protein of the invention and a taste receptor, in particular a bitter, sweet or umami receptor, the method comprising the steps of contacting a compound with the cells, and determining the functional effects of the compound on the receptor: chimeric G-protein complex, such as an increase in cytosolic secondary messengers.
  • the invention is directed to a mammalian cell-based assay using a stably-expressed gene or cDNA.
  • the invention is directed to a mammalian cell-based assay wherein the cells stably express both the receptor and the chimeric G-Protein, preferably in inducible form.
  • a compound, or collection of compounds containing the compound that acts to modulate taste response of taste receptors, in particular bitter, sweet or umami receptors, for use in an assay method defined herein.
  • GPCR taste receptors and in particular bitter taste receptors, sweet and umami receptors.
  • Cells expressing both a G-protein of the invention and a GPCR may be contacted with known tastant compounds.
  • bitter tastant compounds that may be used in the present invention are selected from the group consisting of Acteoside, Adhumulone.Adlupulone, Aesculetin, Aesculin, L-Alanine, L-alanyl-L-alanyl-L-Alanine, L-alanyl-L-isoleucyl- Alanine L-, L-valyl-L-valyl-Amarogentin, Amaropanin Amaroswerin, Amygdalin, Angustifoline, Antiacetylhumulone, Antiisohumulone, Arginine, L-Arginyl Leucine, Arginyl Leucy Leucine, Arginyl Proline, Asaronaldehyde, Aspartyl Aspartic acid, Asparasaponin I, Atropine, Benzyl beta-D-arabinoside, Benzyl beta-L- arabinoside, Benzyl beta-fructoside
  • sweet tastants or compounds that modifiy sweet taste there may be mentioned Theasaponin E1 , Acesulfame K, Alitame, Aspartame, CH 401, Dulcin, Erythritol, Guanidine Sweetener, Isomalt, Isomaltosylfructoside, Isoraffinose, NC 174, Neotame, Perillartine, Phenylacetylglycyl-L-Lysine, Saccharin, SC 45647, sodium Cyclamate, Sorbitol, Sucralose, Sucrononic Acid, Suosan, Superaspartame, Methyl alpha-L-arabinoside, Methyl beta-L- arabinoside, Methyl beta-D-Glucoside, Methyl a-D-mannoside, Methyl beta-L- xylopyranoside, Methyl alpha-D-xy
  • Methyl beta-D-fructoside Methyl alpha-D-galactoside, Methyl beta-D-galactoside,
  • Gymnemasaponin V Gymnemic Acid I, Gymnemic Acid II, Gymnemic Acid III,
  • Gymnemic Acid IV Hodulcin, Jujubasaponin II, Jujubasaponin III, Propionic Acid,
  • Hoduloside I 4-Nitrophenyl a-D-galactoside, 4-Nitrophenyl alpha-D-glucoside,
  • Methyl alpha-D-Glucoside Methyl alpha-D-Glucoside 2,3-Di-alanine,
  • Methyl alpha-D-Glucoside 2,3-Di-glycine Methyl alpha-D-Glucoside 2,3-Di- proline, Methyl alpha-D-Glucoside 2,3-Di-valine, Aniline, 2-Butoxy-5-Nitro-
  • Glutathione Glutamyl Glutamic Acid
  • (Z)-6-Dodecen-4-oIide Inosinic acid
  • Dodec-Z6-en-4-olide Glutamic Acid
  • L- Aconitic Acid N-(1-deoxy-fructos-1-yl) glutamate
  • hydrolyzed vegetable protein Methyl alpha-D-Glucoside, 2,3-Di-lysine, Methyl alpha-D-Glucoside 2,3-Di- omithine
  • L-Asparagine L-a-glutamyl-L-a-glutamyl-L-Glutamic acid, L-a-aspartyl- L-a-glutamyl-Glutamyl valine
  • Wheat gluten hydrolyzate Aspartic acid L-, L-a- aspartyl-L-a-aspartyl-L-a-aspartyl-Docosahex
  • the functional effects of the tastant molecules on the G-protein may be determined by measuring changes in parameters of the transduction pathways such as intracellular IP3 and Ca 2+ , or by other G-protein specific assays such as labeling with GTP ⁇ S, according to techniques known in the art and that are described more fully herein below.
  • bitter receptors Many functional and orphan bitter taste receptors, and sweet and umami receptors are able to couple with the chimeric G-proteins of the present invention.
  • bitter receptors one can mention those so-called T2Rs or TAS2Rs described in Bufe et al in Nature Genetics 32: 397-401 , or Chandrashekar et al. in Cell,
  • G-proteins of the present invention are able to elicit a stronger cell reponse when a ligand binds to a given GPCR, compared with the native G ⁇ q proteins and those reported chimeric G ⁇ q proteins referred to herein above.
  • Mammalian cells e.g. HEK293T cells transfected with a known functional bitter taste receptor known as TAS2R16 as described and characterised by Bufe (see above reference) and the chimeric G-protein G ⁇ ⁇ 6 .
  • gustducin 4 4 of the present invention may be contacted with 5mM salicin or 5mM phenyl-beta-D-glucopyranoside (both known bitter tastants) according to the following protocol to elicit a robust fluorescent signal (using Flexstation) that is about 3-times stronger than a reference chimeric G-protein (G ⁇ 16 . z4 ), and about 7-times stronger than the wild-type G ⁇ 16 .
  • Day 0 96-well plates are seeded with 20K cells per well and maintained at 37 degrees C overnight in nutritive growth media.
  • Day 1 Cells are transfected using 300 ng of GPCR DNA and 0.6 ⁇ l of Lipofectamine 2000 (Invitrogen) per well. Transfected cells are and maintained at 37 degrees C overnight in nutritive growth media.
  • Day 2 Growth media is discarded and cells are incubated for 1 hour (at room temperature in the dark) with 75 ⁇ l of calcium assay solution consisting of 1.5 ⁇ M Fluo-4 AM (Molecular Probes) and 2.5 mM probenicid dissolved in a Hanks balanced salts solution (HBSS) that has been supplemented with 10 mM Hepes, 200 ⁇ M calcium chloride and 0.1% bovine serum albumin, pH 7.4 at 37 degrees C.
  • HBSS Hanks balanced salts solution
  • wash buffer consisting of 2.5 mM probenicid dissolved in a Hanks balanced salts solution (HBSS) that has been supplemented with 10 mM Hepes, 200 ⁇ M calcium chloride and 0.1% bovine serum albumin, pH 7.4 at 37 degrees C, is added to each well and the plate is further incubated for 30 minutes at room temperature in the dark.
  • HBSS Hanks balanced salts solution
  • Buffer solutions are discarded and plate is washed 3 times with 100 ⁇ l wash buffer and cells are reconstituted in 200 ⁇ l of wash buffer and incubated for 15 minutes at 37 degrees C.
  • HEK293T cells transfected with a known functional bitter taste receptor known as mouse T2R5 (see Chandreshekar et al, in Cell, Vol. 100, 70-711, March 17 2000) and the chimeric G-protein G ⁇ i6-gustducin 44 of the present invention were contacted with 10 uM cycloheximide which was able to elicit a robust flurorescence signal that was 5-times stronger than the wild-type G ⁇ ⁇ 6 .
  • HEK293 T-RexTM cells stably transfected with TAS2R38 (a proposed bitter receptor for phenylthiocarbamide, see Kim et al. in Science 299, 1221-5 and Bufe et al in Nature Genetics 32: 397-401 ) and the chimeric G- protein G16-gustducin 44 of the present invention were contacted with 250 uM phenylthiocarbamide, which was able to elicit a robust fluorescence signal. Similarly 250 ⁇ M propythiouracil elicited a robust response.
  • HEK293 T-RexTM cells stably transfected with TAS2R43 and the chimeric G-protein G16-gustducin 44 of the present invention were contacted with 10 ⁇ M aristolochic acid, which was able to elicit a robust fluorescence signal.
  • HEK293 T-RexTM cells stably transfected with TAS2R44 and the chimeric G-protein G16-gustducin 44 of the present invention were contacted with 10 ⁇ M aristolochic acid, which was able to elicit a robust fluorescence signal.
  • HEK293T cells transfected with the known functional sweet taste receptor complex that is formed by a heterodimer of human TAS1R2 and TAS1R3 (Li, X. et ai, 2002, PNAS USA, 99: 4692-4696; Nelson, G. et al., 2001 , Cell, 101:381-390.;) and the chimeric G-protein G ⁇ ⁇ 6 .
  • gustducin 44 were contacted with either 2.5 mM aspartame, acesulfame K or sucralose, all of which were able to elicit a robust flurorescence signal that was 2- times stronger than the wild-type G ⁇ - ⁇ 6 .
  • chimeric constructs may be produced in a manner known per se using Polymerase Chain Reactions.
  • chimeric constructs may be produced using a bridge overlap PCR mutagenesis strategy as described in Mody S. M. et al, 2000, Mol. Pharmacol., 57:13-23, whereby a primer is designed to anneal with a terminus, e.g. the C-terminus of a G ⁇ q and also code for the at least 5 gustducin-derived amino acids.
  • the chimeric products of the PCR may be cloned into a suitable vector, for example pCR2.1-Topo (commercially available from Invitrogen) and submitted for DNA sequencing in order to verify correct replacement of the terminus of the G ⁇ q .
  • chimeric G ⁇ q - Gus tducin cDNA fragments may be sub-cloned into a suitable vector, e.g. pcDNA 3.1 mammalian expression vector and transiently transfected in a mammalian host cell, for example HEK293T or HEK T-RexTM to verify correct expression of the transgene.
  • a suitable vector e.g. pcDNA 3.1 mammalian expression vector and transiently transfected in a mammalian host cell, for example HEK293T or HEK T-RexTM to verify correct expression of the transgene.
  • cell lysates may be prepared, analysed by a Western-Blot analysis in order to confirm correct expression of the chimeric proteins.
  • suitable mammalian cells e.g. HEK293T cells or HEK T-RexTM may be transfected to generate cells stably expressing chimeric G ⁇ q -Gustducin according to techniques well known in the art.
  • a strong promoter to direct transcription e.g., E. coli, Bacillus sp., and Salmonella
  • a strong promoter to direct transcription e.g., E. coli, Bacillus sp., and Salmonella
  • kits for such expression systems are commercially available.
  • eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.
  • the eukaryotic expression vector may be, for example an adenoviral vector, an adeno-associated vector, or a retroviral vector.
  • the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the G-protein or receptor-encoding nucleic acid in host cells.
  • a typical expression cassette thus contains a promoter operably linked to the nucleic acid sequence encoding the G-protein or receptor and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination.
  • the nucleic acid sequence encoding the G-protein or receptor as the case may be, may typically be linked to a membrane-targeting signal such as the N-terminal 45 amino acids of the rat Somatostatin-3 receptor sequence to promote efficient cell-surface expression of the recombinant G- protein or receptor. Additional elements may include, for example enhancers.
  • An expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination.
  • the termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.
  • vectors for expression in eucaryotic or procaryotic cells include, but are not limited to standard bacterial expression vectors including plasmids such as pBR322-based plasmids, pSKF, pET23D, and fusion expression systems such as GST and LacZ.
  • Expression vectors containing regulatory elements from eukaryotic viruses are typically used in eukaryotic expression vectors, e.g., SV40 vectors, cytomegalovirus vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus.
  • exemplary eukaryotic vectors include pMSG, pAV009/A.sup.+, pMTO10/A.sup.+, pMAMneo-5, baculovirus pDSVE, pcDNA3.1 , plRES and any other vector allowing expression of proteins under the direction of the SV40 early promoter, SV40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
  • Some expression systems have markers that provide gene amplification such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.
  • markers that provide gene amplification such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.
  • high yield expression systems not involving gene amplification are also suitable.
  • the elements that are typically included in expression vectors also include a replicon that functions in E. coli, a gene encoding drug resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in non-essential regions of the plasmid to allow insertion of eukaryotic sequences.
  • the particular drug resistance gene chosen is not critical, any of the many drug resistance genes known in the art are suitable.
  • the prokaryotic sequences are optionally chosen such that they do not interfere with the replication of the DNA in eukaryotic cells, if necessary.
  • Standard transfection methods can be used to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of the G-protein or receptor, which are then purified using standard techniques.
  • Any of the well known procedures for introducing nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, liposomes, microinjection, plasma vectors, viral vectors and any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell. It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the receptor.
  • the T-RexTM expression system (Invitrogen Corp., Carlsbad, CA) may be used.
  • the T-RexTM System is a tetracycline-regulated mammalian expression system that uses regulatory elements from the E. coli Tn10-encoded tetracycline (Tet) resistance operon (Hillen and Berens 1994, Annu. Rev. Microbiol. 48, 345-369 ; Hillen et al., 1983, Control, J. Mol.Biol. 169, 707-721).
  • Tetracycline regulation in the T-RexTM System is based on the binding of tetracycline to the Tet repressor and derepression of the promoter controlling expression of the gene of interest (Yao et al. 1998, Hum. Gene Ther. 9, 1939- 1950).
  • the transfected cells may be cultured under standard culturing conditions.
  • the G-protein or receptor protein may be recovered from the culture using standard techniques. For example the cells may be burst open either mechanically or by osmotic shock before being subject to precipitation and chromatography steps, the nature and sequence of which will depend on the particular recombinant material to be recovered.
  • the recombinant G-protein or receptor may be recovered from the culture medium in which the recombinant cells had been cultured.
  • the activity of a receptor in binding to ligands, and the coupling of the G-protein to the receptor may be assessed using a variety of in vitro and in vivo assays to determine functional, chemical, and physical effects, e.g., measuring ligand binding, secondary messengers (e.g., cAMP, cGMP, IP 3 , DAG, or Ca 2+ ), ion flux, phosphorylation levels, transcription levels, neurotransmitter levels, and the like.
  • secondary messengers e.g., cAMP, cGMP, IP 3 , DAG, or Ca 2+
  • ion flux e.g., phosphorylation levels
  • transcription levels e.g., phosphorylation levels
  • neurotransmitter levels e.g., neurotransmitter levels
  • assays can be used to test for inhibitors of the receptors as is well known in the art. Samples or assays that are treated with a potential receptor inhibitor may be compared to control samples without the test compound
  • test compounds upon the function of the receptors can be measured by examining any of the parameters described above. Any suitable physiological change that affects receptor activity can be used to assess the influence of a test compound on the coupling of receptors to G-proteins of this invention. When the functional consequences are determined using intact cells or animals, one can measure a variety of effects such as changes in intracellular secondary messengers such as Ca 2+ , IP 3 or cAMP. Suitable assays for making such measurements are described in WO 01 18050 which is hereby incorporated by reference.
  • G-protein coupled receptors include cells that are loaded with ion sensitive dyes to report receptor activity, as are more fully set out in "G- protein coupled receptors (Signal Transduction Series), CRC Press 1999; 1 st Edition; Eds Haga and Berstein, which is incorporated herein by reference.
  • assays for identifying modulatory compounds changes in the level of ions in the cytoplasm or membrane voltage will be monitored using an ion sensitive or membrane voltage fluorescent indicator, respectively.
  • Receptor activation typically initiates subsequent intracellular events, e.g., increases in second messengers such as IP 3 , which releases intracellular stores of calcium ions.
  • second messengers such as IP 3
  • IP 3 inositol triphosphate
  • IP 3 phospholipase C-mediated hydrolysis of phosphatidylinositol (Berridge & Irvine, Nature 312:315-21 (1984)).
  • IP 3 in turn stimulates the release of intracellular calcium ion stores.
  • a change in cytoplasmic calcium ion levels, or a change in second messenger levels such as IP 3 can be used to assess G-protein coupled receptor function.
  • Cells expressing such G-protein coupled receptors may exhibit increased cytoplasmic calcium levels as a result of contribution from both intracellular stores and via activation of ion channels, in which case it may be desirable, although not necessary, to conduct such assays in calcium-free buffer, optionally supplemented with a chelating agent such as EDTA, to distinguish fluorescence response resulting from calcium release from internal stores.
  • a chelating agent such as EDTA
  • receptor activity is measured by expressing the receptor in a cell with a G-protein as defined herein above, that links the receptor to a phospholipase C signal transduction pathway.
  • the cell line is HEK- 293, although other mammalian cells are also preferred such as CHO and COS cells.
  • Modulation of taste transduction is assayed by measuring changes in intracellular Ca + levels, which change in response to modulation of the receptor signal transduction pathway via administration of a molecule that associates with tthhee rreecceeppttoorr..
  • the ligand-binding domains of the receptors can be employed in vitro in soluble or solid-state reactions to assay for ligand binding.
  • Ligand binding in a receptor, or a domain of a receptor can be tested in solution, in a bilayer membrane attached to a solid phase in a lipid monolayer or vesicles.
  • the binding of a modulator to the receptor, or domain can be observed using changes in spectroscopic characteristics, e.g. fluorescence, absorbance or refractive index; or hydrodynamic (e.g. shape), chromatographic, or solubility properties, as is generally known in the art.
  • the compounds tested as modulators of receptors can be any small chemical compound, or a biological entity, such as a protein, sugar, nucleic acid or lipid.
  • test compounds will be small chemical molecules.
  • any chemical compound can be used as a potential modulator or ligand in the assays of the invention, although knowledge of the ligand specificity of an individual receptor would enable the skilled person to make pre-selection of interesting compounds.
  • Some preferred compounds have been set forth herein above.
  • the assays may be designed to screen large chemical libraries by automating the assay steps and providing compounds from any convenient source to assays, which are typically run in parallel (e.g., in microtiter formats on microtiter plates in robotic assays). The skilled person will understand that there are many suppliers of libraries of chemical compounds.
  • Assays may be run in high throughput screening methods that involve providing a combinatorial chemical or peptide library containing a large number of potential therapeutic, or tastant compounds (that are potential ligand compounds). Such libraries are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as lead compounds to further develop modulators for final products, or can themselves be used as actual modulators.
  • a combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical "building blocks” such as reagents.
  • a linear combinatorial chemical library such as a polypeptide library is formed by combining a set of chemical building blocks (amino acids) in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.
  • Lead compounds found by assay technology herein above described, or development compounds formed from such leads can be administered directly to a human subject to modulate taste.
  • such compounds can be formulated with other ingredients of preparations to be taken orally, for example, foods and beverages, pharmaceutical or neutraceutical or homeopathic preparations.
  • the amount of compound to be taken orally must be sufficient to effect a beneficial response in the human subject, and will be determined by the efficacy of the particular taste modulators and the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular compound.
  • HEK293 cells were used; for transient transfection of the receptors, HEK293T cells were used, and for stable transfection of the receptors, T-RexTM HEK293 cells (Invitrogen Corp., Carlsbad, CA) were used.
  • the G ⁇ i6gu std u c in44 was constructed by bridge overlap PCR mutagenesis using the human G ⁇ 16 and rat gustducin cDNAs in pcDNA3.1 as templates with T7 and
  • SP6 promoter sequences as outer flanking primer regions.
  • Gene specific primers used were :
  • 16gust44-S (5' GGCCCCGAGGGCAGCAACTTAAAAAAAGAAGATAAGGAA 3')
  • 16gust44-AS (5' TTCCTTATCTTCTTTTTTTAAGTTGCTGCCCTCGGGGCC 3')
  • wash buffer consisting of 2.5 mM probenicid dissolved in HBSS that has been supplemented with 10 mM Hepes, 200 ⁇ M calcium chloride and 0.1% bovine serum albumin, pH 7.4 at 37 degrees C, is added to each well and the plate is further incubated for 30 minutes at room temperature in the dark to allow for complete deesterification of the Fluo-4-AM.
  • the buffer solutions are discarded, the plate is washed 3 times with 100 ⁇ l wash buffer and finally the cells are reconstituted in 200 ⁇ l of wash buffer and incubated for 15 minutes at 37 degrees C.
  • a fluorescent microplate reader for example the Flexstation (Molecular Devices)
  • cells stably expressing the G-protein are plated in a 6-well plate at a density of 800,000-950,000 cells per well and grown overnight in selective growth media.
  • the media is changed to an antibiotic-free growth media and the cells are transfected using 2 ⁇ g of T1 R2 and 2 ⁇ g of T1 R3 cDNA and 10 ⁇ l of Lipofectamine 2000 (Invitrogen).
  • the cells are maintained overnight in antibiotic- free growth media.
  • the cells are replated into a black, clear-bottom 96 well plate at 20,000 cells per well and grown overnight.
  • the media is replaced with low glucose media supplemented with Glutamax and dialyzed FBS to minimize receptor desensitization by sugars and glutamate.
  • the cells are further incubated in this media for 6 hours at 37 degrees C. At the end of this period, the cells are processed for the calcium assay according to conditions described above.
  • the example was performed essentially as described in example 5, except that tetra-cycline-inducible cell lines stably expressing human TAS2R10 and G16gust44 were used instead of transient transfection. Cells were kept at a cell density of 75-80%. The following results were obtained:
  • G-protein only control w/o tetracycline
  • G-protein + human TAS2R10 24280 All data are expressed in relative fluorescence units (RFUs) and represents the increase in mean fluorescence over baseline following ligand addition.
  • the ligand and final concentration used was 250 ⁇ M strychnine.
  • the example was performed essentially as described in example 5, except that tetracycline-inducible cell lines stably expressing human TAS2R38 and G16gust44 were used instead of transient transfection. Cells were kept at a cell density of 75-80%. The following results were obtained:
  • TAS2R43 Functional activity of human bitter receptor (TAS2R43) with G-proteins.
  • TAS2R43 tetra-cycline-inducible cell lines stably expressing human TAS2R43 and G16gust44 were used instead of transient Transfection. Cells were kept at a cell density of 75-80%. The following results were obtained:
  • TAS2R44 Functional activity of human bitter receptor (TAS2R44) with G-proteins.
  • TAS2R44 tetra-cycline-inducible cell lines stably expressing human TAS2R44 and G16gust44 were used instead of transient Transfection. Cells were kept at a cell density of 75-80%. The following results were obtained:
  • G-protein + human TAS2R44 17254 All data are expressed in relative fluorescence units (RFUs) and represents the increase in mean fluorescence over baseline following ligand addition.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Gαq-Gustducin chimeric G-proteins that functionally couple to G-protein coupled receptors. The chimeras can be expressed in heterologous cell systems and can be used as the basis of assays for identifying modulators of taste response, in particular bitter, sweet or umami taste responses.

Description

G-Proteins
The invention relates to chimeric G-proteins, and in particular those that mediate in taste receptor transduction pathways. The invention also relates to assays based on heterologous expression systems containing said proteins, and their use in screening for modulators of bitter, sweet and umami taste response in humans.
Taste sensation can be classified into five separate modalities: bitter, salty, sour, sweet and umami. Tastants affect the palatability of food and beverages, thereby influencing human nutritional habits. They also affect the palatability of other ingestibles such as orally administered pharmaceuticals and nutraceuticals. Understanding and manipulating the mechanism of taste transduction has implications for the food and pharmaceutical industries. If the taste transduction pathways can be manipulated, it may be possible to create assays based on heterologous expression systems, which in turn may be used to identify compounds that can modulate taste response, and thereby render certain foods more palatable or increase patient compliance in oral pharmaceutics and nutraceutics.
Much has already been published on the mechanism of taste transduction. The sensation of taste is initiated by the interaction of tastant molecules with their receptors located in the membrane of cells found in the taste buds, which are located in the lingual epithelium of the fungiform, folate and circumvallate papillae as well as in the soft palate and the epiglottis. Recent advances in biochemical and physiological studies have enabled researchers to conclude that sweet, umami and bitter taste transduction is largely mediated by so-called G-protein coupled receptors or GPCRs.
GPCRs are cell surface proteins that are able to bind to tastant molecules whereupon they couple to G-proteins initiating cellular processes producing secondary messengers, such as calcium ions, that enable the cells to send a signal to the brain indicating a taste response. In general, GPCRs are classified as Gq-, Gr, G0-, and Gs-coupled receptors, which notation is reflective of the primary G-protein effector in their requisite signal transduction pathways. Taste receptors are classified as Gj-coupled GPCRs because of their interaction with Gustducin, which is a Gαi-type G-protein.
The recent identification of genes encoding GPCRs believed to be involved in bitter, sweet and umami taste sensation allows for the development of heterologous expressions systems that can be useful in the identification of chemical molecules that modulate taste transduction pathways. For, example the availability and use of receptors in heterologous expression systems permits of the screening for high affinity agonists, antagonists, inverse agonists and modulators of taste activity. However, there are many technical challenges in developing reliable assays based on an heterologous expression systems. One problem resides in the reliable expression of high concentrations of GPCRs at the surface of a foreign host cell. A second problem is the provision of G-proteins that not only are able to couple with many different types of GPCRs (often, such G-proteins are referred to as "promiscuous"), but also couple with high efficiency, such that even with relatively low surface concentrations of GPCRs, the cell signal is as strong as possible .
With regard to this second problem, the so-called Gαq proteins, Gαιs and Gαi6, are known to bind to many classes of GPCRs. Furthermore, they couple GPCRs to the activation of phopholipase C which leads to an increase in intracellular calcium levels. This signalling cascade can be easily and quickly measured by measuring the calcium levels in the cells as is well known in the art (see for example WO 0118050). However, Gα-|5 and Gα β are not considered to be truly universally promiscuous G-proteins since there are several receptors that are . incapable of activating them, see for example, Offermanns, S. and Simon, M., 1995, J. Biol. Chem., 270: 15175-15180; Lee, J.W.M. et al., 1998, J Neurochem., 70:2203-2211); Huang, Y. et al., 1996, J. Biol. Chem. 271 :3975- 3978.; Wu, D. et al., 1992, J. Biol. Chem. 267: 25798-25802; Wu, D. et al., 1993, Science, 261:101-103; Zhu, X and Bimbaumer, L, PNAS USA, 93: 2827-2831; Parmentier, M.L. et al., 1998, Mol. Pharmacol., 53: 778-786). Furthermore, published literature indicates that most of these GPCRs that are particularly ineffective in activating G^and Gαi6 G-proteins are the Grtype GPCRs (Mody, S.M. et al., 2000, Mol. Pharmacol., 57:13-23).
Thus, since sweet, umami and bitter taste receptors are believed to couple to gustducin (a Gαi-type G-protein) and the aforementioned studies suggest that, Gαi5 and Gαι6 are not the optimal partners for Gαi-type GPCRs, a skilled person would not expect efficient coupling of activated taste receptors to either Gαιs or Gαi6. On the other hand, Gustducin itself does not offer a practical solution as this G-protein modulates release of cyclic nucleotides (cNMPs) which are not as easily measured as, for example, increases in Calcium ions. It is technically difficult to measure cNMPs and requires an immunoassay that generally takes in the order of 4 to 6 hours, and then only provides an end-point assessment. Still further, it is complicated to use a specialised Gαj protein, such as Gustducin in a heterologous cell expression system. To do so, one would have to introduce two additional G-protein sub-units (the beta and gamma sub-units) into the heterologous host cells to fully reconstitute the taste-receptor- G-protein complex. Gαi6 on the other hand can complex with beta/gamma sub-units endogenous to mammalian cells, such as cells of the HEK 293 cell line. It is faster, easier and more sensititive to employ Gα16 rather than Gαj-type of G-protein such as Gustducin.
There remains a need to develop G-proteins that display high affinity for a wide range of taste receptors and in particular, sweet, umami and bitter receptors, that can be incorporated into heterologous expression system assays to screen for modulators of the human taste response, thereby to quantify the activity of known tastant molecules and to discover new ones. The use of chimeric G-proteins has been suggested in the prior art. In WO 02/36622 a Gαq chimeric protein is describe that is substituted with at least 5 amino acid units from the C-terminus of Transducin. Such Chimeric proteins are described as being more promiscuous than the native Gαq in relation to two chemosensory GPCRs. Notably, however, the only taste receptor tested in this reference was a mouse bitter receptor. Therefore, it is not clear whether any of the chimeric G-proteins described would couple more efficiently to human bitter, sweet or umami taste receptors.
Mody S.M. in Molecular Pharmacology 57: 13-23 (2000) describes chimeras of Gαi6 and a specific sequence of Gαz and their increased promiscuity toward Gj- coupled receptors. Mody concludes that the chimeric proteins are not universal adaptors for GPCRs, but they are able to improve the recognition of specific subsets of GPCRs. Notably, none of the GPCRs in the sub-sets studied included taste receptors.
Surprisingly, we have now found that chimeric G-proteins based on Gαq-Gustducin are able to bind to a wide range of known and putative bitter taste receptors, and sweet and umami receptors with high affinity.
Accordingly the invention provides in a first aspect a Gαq-Gustduciπ chimeric G- protein.
In a specific embodiment the chimeric Gαq-Gustducin is a Gα15 ori6-Gustducin protein, more specifically a Gαι6-Gustducin protein.
In a further specific embodiment the G-protein is one wherein at least the last 5 amino acids of the Gαq are replaced by a corresponding number of amino acids of Gustducin, more particularly the last 44 amino acid sequences of the Gαq is replaced with a 44 amino acid unit of Gustducin. In a preferred embodiment there is provided a protein having amino acid sequences as set forth in the SEQ ID 2.
Another aspect the invention provides a nucleic acid encoding for a protein as herein above defined.
In a preferred embodiment the nucleic acid comprises the nucleotide sequence set forth in SEQ ID 1.
Whereas the chimeric proteins of the present invention may be formed by making substitutions at the C-terminus of Gustducin, the skilled person will appreciate that other substitutions or mutations may be incorporated into the G-proteins that may affect their promiscuity and/or their degree of coupling to a given receptor, and these variants of the G-proteins form another aspect of the present invention. Furthermore, such substitutions or mutations may be formed without the skilled person having recourse to any inventive activity, simply by using routine techniques in gene technology such as PCR, gene cloning, site-directed mutagenesis or cDNAs, transfection of host cells, and in-vitro transcription. Thereafter, these variants may be screened for functional coupling to receptors.
In a specific embodiment of this aspect of the invention there is provided a variant that is a polypeptide having 80%, preferably 90%, more preferably 95% or greater homology to the sequence as set forth in SEQ ID No. 2.
Other aspects of the invention are an expression vector comprising nucleic acid encoding for chimeric G-proteins defined herein, and host cells transformed or transfected with said vector.
In yet another aspect of the invention there is provided a method of producing a chimeric G-protein as defined comprising the step of culturing host cells as defined having contained therein an expression vector encoding for the chimeric G-protein, under conditions sufficient for expression of said G-protein, thereby causing production of the protein, and recovering the protein produced by the cell.
In still another aspect of the invention there is provided a method of analysis and discovery of modulators of taste receptors, in particular bitter, sweet, and umami receptors, using the chimeric proteins defined herein.
In a specific embodiment a mammalian cell-based assay employing a transiently transfected gene or cDNA encoding a chimeric protein of the invention and a taste receptor, in particular a bitter, sweet or umami receptor, the method comprising the steps of contacting a compound with the cells, and determining the functional effects of the compound on the receptor: chimeric G-protein complex, such as an increase in cytosolic secondary messengers.
In another specific embodiment of this aspect, the invention is directed to a mammalian cell-based assay using a stably-expressed gene or cDNA.
In yet another specific embodiment, the invention is directed to a mammalian cell-based assay wherein the cells stably express both the receptor and the chimeric G-Protein, preferably in inducible form.
In yet another aspect of the invention, there is provided a compound, or collection of compounds containing the compound, that acts to modulate taste response of taste receptors, in particular bitter, sweet or umami receptors, for use in an assay method defined herein.
In still another aspect of the invention there is provided a compound, or collection of compounds containing the compound that is identified as a modulator of taste response using the assay method described herein, and foods beverages or oral pharmaceutical or neutraceutical preparations containing same.
The various aspects of the present invention will be further described herein with reference to the detailed description, sequence listing and Examples.
Detailed Description of the Invention
Well established transient expression systems, which are discussed in more detail below, may be employed to establish the ability of the chimeric G-proteins of the present invention to couple with GPCR taste receptors, and in particular bitter taste receptors, sweet and umami receptors.
Cells expressing both a G-protein of the invention and a GPCR may be contacted with known tastant compounds.
Examples of bitter tastant compounds that may be used in the present invention are selected from the group consisting of Acteoside, Adhumulone.Adlupulone, Aesculetin, Aesculin, L-Alanine, L-alanyl-L-alanyl-L-Alanine, L-alanyl-L-isoleucyl- Alanine L-, L-valyl-L-valyl-Amarogentin, Amaropanin Amaroswerin, Amygdalin, Angustifoline, Antiacetylhumulone, Antiisohumulone, Arginine, L-Arginyl Leucine, Arginyl Leucy Leucine, Arginyl Proline, Asaronaldehyde, Aspartyl Aspartic acid, Asparasaponin I, Atropine, Benzyl beta-D-arabinoside, Benzyl beta-L- arabinoside, Benzyl beta-D-fructoside, Benzyl beta-D-galactoside, Benzyl alpha- D-glucoside, Benzyl beta-D-glucoside, Benzyl alpha-D-mannoside, Bitter Peptides, Bitter Peptides from Soy Proteins, Butyl alpha-D-glucoside, Butyl beta- D-glucoside, Caffeine, Carnosifloside II, Carnosifloside III, Carnosifloside IV, Catechin, Epicatechin, Epicatechin gallate, Chaconine, alpha-Chaconine, beta2- Chloramphenicol, Cholic Acid, Cichoriin, Cohumulone, Colupulone, Cryptochlorogenic Acid, gamma-lactone, Cucurbitacin B, Cucurbitacin D, Cyclo Alanine-glycine, Cyclo Alanine-phenylanaline, Cyclo Alanine-valine, Cyclo(L- arginylglycyl-L-prolyl-L-prolyl-L-phenylalanyl-L-isoleucyl-L-valyl), Cyclo Asparagine-phenylalanine, Cyclo Glycine-phenylalanine, Cycloheximide Cyclo Lucine-Tryptophan, Cyclopent(b)azepin-8(1 H)-one, 7-Methyl-2,3,6,7- Tetrahydro-Cyclopent(b)azepin-8(1H)-one, 2,3,6,7-tetrahydro-7-hydroxy-7- methyl-Cyclopent-2-en-1-one, 2,5-dihydroxy-5-methyl-3-(1-piperidinyl)- Cyclopent-2-en-1-one, 2,5-dihydroxy-5-methyl-3-(1-pyrrolidinyl) Cyclopent-2-en-1-one, 2,3-di-1-pyrrolidinyl-Cyclopent-2-en-1-one, 5-hydroxy-5- methyl-2,3-di-1-piperidinyl-Cyclopent-2-en-1-one, 5-hydroxy-5-methyl-2,3-di-1- pyrrolidinyl-Cyclopent-2-en-1-one, 5-methyl-2,3-di-1-pyrrolidinyl-Cyclopent-2-en- 1 -one, 5-methylene-2,3-di-1 -pyrrolidinyl-Cyclopent-2-en-1 -one, 3-methyl-2-(1 - pyrrolidinyl)-Cyclo Phenyalanine-aspartic acid, Cyclo Proline-alanine, Cyclo Proline-asparagine, Cyclo Proline-glycine, Cyclo Proline-isolucine, Cyclo Proline- leucine, Cyclo Proline-methionine, Cyclo Proline-phenylalanine, Cyclo Proline- proline, Cyclo Proline-valine, Cyclo Valine-phenylalanine, Cynaratriol, Cynaropicrin, Cynaropicrin, Daidzein, Daidzin Denatonium benzoate, Denatonium saccharide, Dhurrin, Dihydroxybenzoic Acid, 2,3-Dihydroxybenzoic Acid, 2,4-Ethyl b-L-arabinoside, Ethyl alpha-D-Glucoside, Ethyl beta-D- Glucoside, Eustomoroside, Eustomoside, Gallic Acid, Epigallocatechin, Epigallocatechin gallate, Gaudichaudioside F, Gelidoside, Genistein, Genistin, Gentiopicroside, Gentistic Acid, Gentomoside, Geshoidin, 6'-O-beta-D- Glucosylgentiopicroside, ucozaluzanin C, Glutamyl Aspartic Acid, Glutamyl Glutamic Acid, Glycyl Leucine, Goitrin, Gramine, Grosshemin, Haematoxylin Tetramethyl Ether Helicin, Heptadeca-16-ene, 1-Acetoxy-2,4-Dihydroxy- Heptadeca-16-ene, 1,2,4-Trihydroxy-Histidine, L-Hulupone, Humulinone, Humulone, Hydroxybenzoic Acid, 4-Hymenoside A, Hymenoside B, Hymenoside C, Hymenoside D, Hymenoside E, Hymenoside F, Isohumulone, cis- Isohumulone, trans-lsoleucine, L-lsolupanine, Isosparteine, beta-lsosparteine, 10,17-Dioxo-beta-lsosparteine, 10-oxo-beta-Lactucin, L-Leucine, L-alanyl-L- alanyl-L-Leucine,N-[(2R)-6-amino-2-[(4S)-2,5-dioxo-4-(phenylmethyl)-1- imidazolidinyl]-1 -oxohexyl]-L-leucyl-L-methionyl-N-methyl-L-phenylalanyl-, (4-1 )- lactam, L-Leucine, glycyl-L-alanyl-Leucine, L-L-Leucine, N-(N2-L-leucyl-L- glutaminyl)-L-Leucine, N-(N-L-leucyl-L-a-glutamyl)-L-Leucine, N-[N2-[N2-[N-(1-L- leucyl-L-prolyl)-L-phenylalanyl]-L-asparaginyl]-L-glutaminyl]-L-Leucine, N-[N2-[N- [N-(1-L-leucyl-L-prolyl)-L-phenylalanyl]-L-seryl]-L-glutaminyl]-L-Leucine, L-leucyl- L-valyl-Leucy Leucine, Leucyl Phenylalanine, Limonin, Limoninmonolactone, Linamarin, Lotaustralin, Lupine, Lupanine, 13-Hydroxy-Lupanine, 7-hydroxy- Lupinine, Epilupinine Lupoxes B, Lupoxes C, Lupulone, Luputrione, Mellein, 6- Methoxy-Methionine, L- Methyl alpha-L-arabinoside, Methyl beta-L-arabinoside, Methyl beta-D-Glucoside, Methyl alpha-D-Glucoside 2,3-Di-isoleucine, Methyl alpha-D-Glucoside 2,3-Di-leucine, Methyl alpha-D-Glucoside 2,3-Di-L- phenylalanine, Methyl alpha-D-Glucoside 2,3-Di-threonine, Methyl alpha-D- Glucoside 2,3-Di-tyrosine, Methyl a-D-mannoside, Methyl beta-L-xylopyranoside, Methyl alpha-D-xyloside, Naringin, Neochlorogenic Acid, gamma-Lactone, Neohesperidin, Nuezhenide, Oleonuezhenide, Oleuropein, Olivieroside A, Olivieroside B, Olivieroside C, Perrottetin H, Phenylalanine, L-Phenyl alpha-D- galactoside, Phenyl alpha-D-glucoside, Phenyl beta-D-glucoside, Phenylthiourea, Phlomisoside II, Piperidine-2-carboxylic acid, 4-[(2-carboxy-2-hydroxyethyl)thio]- Piperidinecarboxylic acid-2, 4-[(2-carboxy-2-hydroxyethyl)thio]-Prehumulone, Prelupulone, Propyl beta-D-fructoside, Propyl alpha-D-glucoside, Propyl beta-D- glucoside, Protocatechuic Acid, Prunasin, Pulcherrimine, Quinidine, Quinine, Quinolizinium-7-olate, Ranitidine, Rebaudioside C, Salicin, Salidroside, Scabraside, Scandenoside R5, Sclareolide, Scopolin, Septemfidoside, Seryl Lysyl Glycyl Leucine, Sinapine, Solanine, alpha-Sparteine, Sparteine, 17-oxo- Stevisalioside A, Strychnine, Suavioside C1, Suavioside D2, Suavioside F, Sucrose Octaacetate, Sweroside, Swertiamarin, Swertiapunimarin, Taxiphyllin, TFI (Furostan, beta-D-galactopyranoside), Theaflavin, Theaflavin Gallate A, Theaflavin Gallate B, Tomatidine, Tomatine, alpha- Tricyclodehydroisohumulone, Trifloroside, Trihydroxybenzoic Acid, 2,4,6- Tryptophan, L-Uracil, 6-propyl-2-thio-L-Valine, L-arginylglycyl-L-prolyl-L-prolyl-L- phenylalanyl-L-isoleucyl- (BPIa)Valine, and L-Yohimbine. As examples of sweet tastants, or compounds that modifiy sweet taste there may be mentioned Theasaponin E1 , Acesulfame K, Alitame, Aspartame, CH 401, Dulcin, Erythritol, Guanidine Sweetener, Isomalt, Isomaltosylfructoside, Isoraffinose, NC 174, Neotame, Perillartine, Phenylacetylglycyl-L-Lysine, Saccharin, SC 45647, sodium Cyclamate, Sorbitol, Sucralose, Sucrononic Acid, Suosan, Superaspartame, Methyl alpha-L-arabinoside, Methyl beta-L- arabinoside, Methyl beta-D-Glucoside, Methyl a-D-mannoside, Methyl beta-L- xylopyranoside, Methyl alpha-D-xyloside, Methyl alpha-D-Glucoside 2,3-Di- threonine, Methyl alpha-D-Glucoside 2,3-Di-isoleucine, Protocatechuic Acid, Cynarin, Glycyphyllin, Rebaudioside C, Abrusoside A, Abrusoside B, Abrusoside C, Abrusoside D, Abrusoside E, Apioglycyrrhizin, Araboglycyrrhizin, Baiyunoside, Brazzein, Bryodulcoside, Carnosifloside V, Carnosifloside VI, D. cumminsii, Cyclocarioside A, Cyclocarioside I, Dulcoside A, Fluorene-4-alpha,6-dicarboxylic acid, 4-beta, 10-alpha-dimethyl-1 ,2,3,4,5, 10-hexahydor-Gaudichaudioside A, Glycyrrhizic Acid, Hernandulcin, Hernandulcin, 4beta-hydroxy-Hesperitin-7- Glucoside Dihydrochalcone, Huangqioside E, Huangqioside E, 3- Hydroxyphloridzin, Kaempferol, 2,3-Dihydro-6-Methoxy 3-O-Acetate, Mabinlin Maltosyl-Alpha-(1,6)-Neohesperidin Dihydrochalcone, Mogroside HE, Mogroside III, Mogroside HIE, Mogroside IV, Mogroside V, 11-Oxo Mogroside V, Monatin, Monellin, Monoammonium Glycyrrhizinate (Mag), Mukurozioside lib, Naringin Dihydrochalcone, Neoastilbin, Neohesperidin Dihydrochalcone (NHDHC), Neomogroside, Osladin, Pentadin, Periandrin I, Periandrin II, Periandrin III, Periandrin IV, Periandrin V, Phlomisoside I, Phlorizin, Phyllodulcin, Polypodoside A, Potassium magnesium calcium glycyrrhizin, Pterocaryosides A, Pterocaryosides B, Quercetin, 2,3-Dihydro-3-O-Acetate, Quercetin, 2,3-Dihydro- 6-Methoxy-Quercetin, 2,3-Dihydro-6-Methoxy-3-O-Acetate, Rebaudioside A, Rebaudioside B, Rubusoside, Scandenoside R6, Siamenoside I, Sodium glycyrrhizinate, Steviolbioside, Stevioside, Stevioside, alpha-Glycosyl Suavioside A, Suavioside B, Suavioside G, Suavioside H, Suavioside I, Suavioside J, Thaumatin, Triammonium Glycyrrhizinate (TAG), Trilobatin Selligueain A, Haematoxylin, Maltitol, Mannitol, Methyl alpha-D-Glucoside 2,3-Di- aspartic acid, Benzoic Acid, 2-(4-Dimethylaminobenzoyl)-Benzoic Acid,
2-Hydroxy-4-aminomethyl-Benzoic Acid, 2-(3-Hydroxy-4-Methoxybenzoyl)-
Methyl beta-D-fructoside, Methyl alpha-D-galactoside, Methyl beta-D-galactoside,
Curculin, Strogin 1 , Strogin 2, Strogin 4, Miraculin, Phenylacetic Acid, 3,4-
Dimethoxy-Aminobenzoic Acid, 3-Anisic Acid, Benzyl alcoho, 3-Amino-4-n- propoxyl , 3,4 -Caffeic Acid, Cinnamic Acid, Dihydroxycinnamic Acid, 2,4-
Ferulic Acid, Hydrolyzed Guar Gum, Hydroxyaminobenzoic Acid, 2,4-
Nigerooligosaccharides, Sugarcane Bagasse Extract, Dihydroxybenzoic Acid,
2,3-Dihydroxybenzoic Acid, 2,4-Coumaric Acid, p-Dihydroxybenzoic Acid, 3,5-
Hydroxybenzoic Acid, 3-Gurmarin, Gymnemasaponin III, Gymnemasaponin IV,
Gymnemasaponin V, Gymnemic Acid I, Gymnemic Acid II, Gymnemic Acid III,
Gymnemic Acid IV, Hodulcin, Jujubasaponin II, Jujubasaponin III, Propionic Acid,
(-)-2-(4-Methoxyphenoxy)-Ziziphin, Ethyl Maltol, Maltol, Butanoic Acid, 2-Oxo-3-
Methyl-Alanine, N-(1-Methyl-4-oxo-2-imidazolin-2-yl) Creatinine, Abrusoside E, mono-methyl ester, Lactitol, Periandrinic acd I, monoglucuronide, Periandrinic acid II, monoglycuronide, Xylitol, Tagatose, d-Benzoyloxyacetic acid, 4-Methoxy
Hoduloside I, 4-Nitrophenyl a-D-galactoside, 4-Nitrophenyl alpha-D-glucoside,
4-Nitrophenyl beta-D-glucoside, 4-Nitrophenyl alpha-D-mannopyranoside,
Urea, (N-(4-cyanophenyl)-N'-((sodiosulfo)methyl)-Chloramphenicol, Chlorogenic
Acid, Methyl alpha-D-Glucoside, Methyl alpha-D-Glucoside 2,3-Di-alanine,
Methyl alpha-D-Glucoside 2,3-Di-glycine, Methyl alpha-D-Glucoside 2,3-Di- proline, Methyl alpha-D-Glucoside 2,3-Di-valine, Aniline, 2-Butoxy-5-Nitro-
Aniline, 2-Ethoxy-5-Nitro-Aniline, 2-Methoxy-5-Nitro-Aniline, 3-Nitro-
(+)-Baiyunol-beta-D-gluccoside-alpha-D-glucoside, Aniline, 1 ,3-Hydroxy-4- methoxybenzylAniline, 2-Propxy-5-Nitro- (P4000)Benzo-1 ,4-dioxane 2-(3-
Hydroxy-4-Methoxyphenyl)-Benzoe-1,3-dioxan-4-one 2-(3-Hydroxy-4- methoxyphenyl)-Benzoic Acid, 2-Benzoyl-4-Methoxy-Benzoic Acid, 2-(4-
Methoxybenzoyl)-Benzo-1,3(4H)-xathiane, 2-(3-Hydroxy-4-Methoxyphenyl)-
Benzo-1 ,4-xathiane 3-(3-Hydroxy-4-methoxyphenyl)- Butanoic acid, 4-[3,5-dihydroxy-4-[3-(3-hydroxy-4-methoxyphenyl)-1- oxopropyl]phenoxy]-2-hydroxy-monosodium salt, Butanoic acid, 4-[3,5-dihydroxy- 4-[3-(3-hydroxy-4-methoxyphenyl)-1-oxopropyl]phenoxy]-3-oxo- monosodium salt,Cy ohexadiene-1 ,4 1-Carboxaldehyde- 4-(Methoxymethyl)-, (E)oxime Ethylbenzene, beta- (1 ,3-Hydroxy-4-methoxybenzyl)-Hespertin Dihydrochalcone, 3'-Carboxy-Hespertin Dihydrochalcone, 3'-Formyl-lsocoumarin, 3,4-Dihydro- 3- (3-Hydroxy-4-methoxy)-Perillartine, 8,9-epoxy-Phenyl 3-Hydroxy-4- methoxybenzyl Ether, Phosphonic acid, [3-[3,5-dihydroxy-4-[3-(3-hydroxy-4- methoxyphenyl)-1-oxopropyl]phenoxy]propyl] monopotassium salt, Stevioside analogue, Sulfamic acid, [2-[3,5-dihydroxy-4-[3-(3-hydroxy-4-methoxyphenyl)-1- oxopropyl]phenoxy]ethyl]-monopotassium salt, Urea, and N-(4-cyanophenyl)-N'- (2-carboxyethyl)-L-Theanine.
As umami tastants there may be mentioned Glutathione, Glutamyl Glutamic Acid, (Z)-6-Dodecen-4-oIide, Inosinic acid, Dodec-Z6-en-4-olide, Glutamic Acid, L- Aconitic Acid, N-(1-deoxy-fructos-1-yl) glutamate, hydrolyzed vegetable protein, Methyl alpha-D-Glucoside, 2,3-Di-lysine, Methyl alpha-D-Glucoside 2,3-Di- omithine, L-Asparagine, L-a-glutamyl-L-a-glutamyl-L-Glutamic acid, L-a-aspartyl- L-a-glutamyl-Glutamyl valine, Wheat gluten hydrolyzate, Aspartic acid L-, L-a- aspartyl-L-a-aspartyl-L-a-aspartyl-Docosahexaenoic acid, and (4Z.7Z, 10Z, 13Z, 16Z, 19Z)-L-Theanine.
The functional effects of the tastant molecules on the G-protein may be determined by measuring changes in parameters of the transduction pathways such as intracellular IP3 and Ca2+, or by other G-protein specific assays such as labeling with GTPγS, according to techniques known in the art and that are described more fully herein below.
Many functional and orphan bitter taste receptors, and sweet and umami receptors are able to couple with the chimeric G-proteins of the present invention. As bitter receptors, one can mention those so-called T2Rs or TAS2Rs described in Bufe et al in Nature Genetics 32: 397-401 , or Chandrashekar et al. in Cell,
100: 703-711 , or Matsunami in Nature, 404: 601-604. Whereas, as sweet or umami receptors one can mention the known T1 R receptors as described in Li,
X. et al., 2002, PNAS USA, 99: 4692-4696; Nelson, G. et al., 2002, Nature, 416:
199-202; and Nelson, G. et al., 2001, Cell, 101 :381-390. Still further, the chimeric
G-proteins of the present invention are able to elicit a stronger cell reponse when a ligand binds to a given GPCR, compared with the native Gαq proteins and those reported chimeric Gαq proteins referred to herein above.
To illustrate this, Mammalian cells, e.g. HEK293T cells transfected with a known functional bitter taste receptor known as TAS2R16 as described and characterised by Bufe (see above reference) and the chimeric G-protein Gαι6. gustducin44 of the present invention may be contacted with 5mM salicin or 5mM phenyl-beta-D-glucopyranoside (both known bitter tastants) according to the following protocol to elicit a robust fluorescent signal (using Flexstation) that is about 3-times stronger than a reference chimeric G-protein (Gα16.z4 ), and about 7-times stronger than the wild-type Gα16.
The protocol is described in "G-protein coupled receptors (Signal Transduction Series)"; Editors: Tatsuya Haga and Gabriel Berstein, 1st ed., 424pp.CRC Press - Boca Raton FL; September 1999, and may be summarised as follows:
1. Day 0: 96-well plates are seeded with 20K cells per well and maintained at 37 degrees C overnight in nutritive growth media.
2. Day 1: Cells are transfected using 300 ng of GPCR DNA and 0.6 μl of Lipofectamine 2000 (Invitrogen) per well. Transfected cells are and maintained at 37 degrees C overnight in nutritive growth media.
3. Day 2: Growth media is discarded and cells are incubated for 1 hour (at room temperature in the dark) with 75 μl of calcium assay solution consisting of 1.5 μM Fluo-4 AM (Molecular Probes) and 2.5 mM probenicid dissolved in a Hanks balanced salts solution (HBSS) that has been supplemented with 10 mM Hepes, 200μM calcium chloride and 0.1% bovine serum albumin, pH 7.4 at 37 degrees C.
4. 125 μl of wash buffer consisting of 2.5 mM probenicid dissolved in a Hanks balanced salts solution (HBSS) that has been supplemented with 10 mM Hepes, 200μM calcium chloride and 0.1% bovine serum albumin, pH 7.4 at 37 degrees C, is added to each well and the plate is further incubated for 30 minutes at room temperature in the dark.
5. Buffer solutions are discarded and plate is washed 3 times with 100 μl wash buffer and cells are reconstituted in 200 μl of wash buffer and incubated for 15 minutes at 37 degrees C.
6. Plate is placed in a fluorescent microplate reader, for example the Flexstation (Molecular Devices) or the FLIPR (Molecular Devices) and receptor activation is initiated following addition of 20 μl of a 10X concentrated ligand stock solution. Fluorescence is continuously monitored for 15 seconds prior to ligand addition and for 45 - 75 seconds after ligand addition. Receptor activation levels are defined as by the two following equations: % Activation = (Maximum fluorescence - baseline fluorescence/baseline fluorescence) * 100 or Fluorescence Increase = Maximum Fluorescence - baseline fluorescence, where baseline fluorescence represents the average fluorescence levels prior to ligand addition.
In another example, HEK293T cells transfected with a known functional bitter taste receptor known as mouse T2R5 (see Chandreshekar et al, in Cell, Vol. 100, 70-711, March 17 2000) and the chimeric G-protein Gαi6-gustducin44 of the present invention were contacted with 10 uM cycloheximide which was able to elicit a robust flurorescence signal that was 5-times stronger than the wild-type Gαι6.
In another example, HEK293 T-Rex™ cells stably transfected with the known functional human bitter taste receptor TAS2R10 (see Bufe et al in Nature Genetics 32: 397-401) and the chimeric G-protein G16-gustducin 44 of the present invention were contacted with 250 uM strychnine, which was able to elicit a robust flurorescence signal.
In another example, HEK293 T-Rex™ cells stably transfected with TAS2R38 (a proposed bitter receptor for phenylthiocarbamide, see Kim et al. in Science 299, 1221-5 and Bufe et al in Nature Genetics 32: 397-401 ) and the chimeric G- protein G16-gustducin 44 of the present invention were contacted with 250 uM phenylthiocarbamide, which was able to elicit a robust fluorescence signal. Similarly 250 μM propythiouracil elicited a robust response.
In another example, HEK293 T-Rex™ cells stably transfected with TAS2R43 and the chimeric G-protein G16-gustducin 44 of the present invention were contacted with 10 μM aristolochic acid, which was able to elicit a robust fluorescence signal.
In another example, HEK293 T-Rex™ cells stably transfected with TAS2R44 and the chimeric G-protein G16-gustducin 44 of the present invention were contacted with 10 μM aristolochic acid, which was able to elicit a robust fluorescence signal.
Still further in another example, HEK293T cells transfected with the known functional sweet taste receptor complex that is formed by a heterodimer of human TAS1R2 and TAS1R3 (Li, X. et ai, 2002, PNAS USA, 99: 4692-4696; Nelson, G. et al., 2001 , Cell, 101:381-390.;) and the chimeric G-protein Gαι6. gustducin44, were contacted with either 2.5 mM aspartame, acesulfame K or sucralose, all of which were able to elicit a robust flurorescence signal that was 2- times stronger than the wild-type Gα-ι6.
The chimeric constructs may be produced in a manner known per se using Polymerase Chain Reactions. In one embodiment, chimeric constructs may be produced using a bridge overlap PCR mutagenesis strategy as described in Mody S. M. et al, 2000, Mol. Pharmacol., 57:13-23, whereby a primer is designed to anneal with a terminus, e.g. the C-terminus of a Gαq and also code for the at least 5 gustducin-derived amino acids. The chimeric products of the PCR may be cloned into a suitable vector, for example pCR2.1-Topo (commercially available from Invitrogen) and submitted for DNA sequencing in order to verify correct replacement of the terminus of the Gαq .
After verfication of the sequence, chimeric Gαq-Gustducin cDNA fragments may be sub-cloned into a suitable vector, e.g. pcDNA 3.1 mammalian expression vector and transiently transfected in a mammalian host cell, for example HEK293T or HEK T-Rex™ to verify correct expression of the transgene.
After a post-transfection period, e.g. 48hours, cell lysates may be prepared, analysed by a Western-Blot analysis in order to confirm correct expression of the chimeric proteins. Once correct protein expression is confirmed, suitable mammalian cells, e.g. HEK293T cells or HEK T-Rex™ may be transfected to generate cells stably expressing chimeric Gαq-Gustducin according to techniques well known in the art.
In practising the various aspects and embodiments of the present invention in relation to cloning, elucidating ligand-receptor pairs, and finding modulators of the bitter, sweer or umami response, recourse is made to conventional techniques in molecular biology, microbiology and recombinant technology. Accordingly, the skilled person is fully apprised of such techniques and as such they are hereafter treated only summarily in order to more fully describe the context of the present invention.
In order to express cDNAs encoding the G-proteins or receptors, one typically subclones the appropriate cDNA into an expression vector that contains a strong promoter to direct transcription, a transcription/translation terminator, and a ribosome-binding site for translational initiation. Suitable bacterial promoters are well known in the art, e.g., E. coli, Bacillus sp., and Salmonella, and kits for such expression systems are commercially available. Similarly eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available. The eukaryotic expression vector may be, for example an adenoviral vector, an adeno-associated vector, or a retroviral vector.
In addition to the promoter, the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the G-protein or receptor-encoding nucleic acid in host cells. A typical expression cassette thus contains a promoter operably linked to the nucleic acid sequence encoding the G-protein or receptor and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. The nucleic acid sequence encoding the G-protein or receptor as the case may be, may typically be linked to a membrane-targeting signal such as the N-terminal 45 amino acids of the rat Somatostatin-3 receptor sequence to promote efficient cell-surface expression of the recombinant G- protein or receptor. Additional elements may include, for example enhancers.
An expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.
For expression of the G- proteins or receptors, conventional vectors for expression in eucaryotic or procaryotic cells well known in the art may be used. Examples of vectors include, but are not limited to standard bacterial expression vectors including plasmids such as pBR322-based plasmids, pSKF, pET23D, and fusion expression systems such as GST and LacZ.
Expression vectors containing regulatory elements from eukaryotic viruses are typically used in eukaryotic expression vectors, e.g., SV40 vectors, cytomegalovirus vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus. Other exemplary eukaryotic vectors include pMSG, pAV009/A.sup.+, pMTO10/A.sup.+, pMAMneo-5, baculovirus pDSVE, pcDNA3.1 , plRES and any other vector allowing expression of proteins under the direction of the SV40 early promoter, SV40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
Some expression systems have markers that provide gene amplification such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase. Alternatively, high yield expression systems not involving gene amplification are also suitable.
The elements that are typically included in expression vectors also include a replicon that functions in E. coli, a gene encoding drug resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in non-essential regions of the plasmid to allow insertion of eukaryotic sequences. The particular drug resistance gene chosen is not critical, any of the many drug resistance genes known in the art are suitable. The prokaryotic sequences are optionally chosen such that they do not interfere with the replication of the DNA in eukaryotic cells, if necessary.
Standard transfection methods can be used to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of the G-protein or receptor, which are then purified using standard techniques.
Any of the well known procedures for introducing nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, liposomes, microinjection, plasma vectors, viral vectors and any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell. It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the receptor.
For example, the T-Rex™ expression system (Invitrogen Corp., Carlsbad, CA) may be used. The T-Rex™ System is a tetracycline-regulated mammalian expression system that uses regulatory elements from the E. coli Tn10-encoded tetracycline (Tet) resistance operon (Hillen and Berens 1994, Annu. Rev. Microbiol. 48, 345-369 ; Hillen et al., 1983, Control, J. Mol.Biol. 169, 707-721). Tetracycline regulation in the T-Rex™ System is based on the binding of tetracycline to the Tet repressor and derepression of the promoter controlling expression of the gene of interest (Yao et al. 1998, Hum. Gene Ther. 9, 1939- 1950).
After the expression vector is introduced into the cells, the transfected cells may be cultured under standard culturing conditions. The G-protein or receptor protein may be recovered from the culture using standard techniques. For example the cells may be burst open either mechanically or by osmotic shock before being subject to precipitation and chromatography steps, the nature and sequence of which will depend on the particular recombinant material to be recovered. Alternatively, the recombinant G-protein or receptor may be recovered from the culture medium in which the recombinant cells had been cultured.
The activity of a receptor in binding to ligands, and the coupling of the G-protein to the receptor may be assessed using a variety of in vitro and in vivo assays to determine functional, chemical, and physical effects, e.g., measuring ligand binding, secondary messengers (e.g., cAMP, cGMP, IP3, DAG, or Ca2+), ion flux, phosphorylation levels, transcription levels, neurotransmitter levels, and the like. Furthermore, such assays can be used to test for inhibitors of the receptors as is well known in the art. Samples or assays that are treated with a potential receptor inhibitor may be compared to control samples without the test compound, to examine the extent of modulation. Control samples (untreated with inhibitors) are assigned a relative receptor activity value of 100. Inhibition of receptor activity is achieved when the receptor activity value relative to the control is lower, and conversely receptor activity is enhanced when activity relative to the control is higher.
The effects of the test compounds upon the function of the receptors can be measured by examining any of the parameters described above. Any suitable physiological change that affects receptor activity can be used to assess the influence of a test compound on the coupling of receptors to G-proteins of this invention. When the functional consequences are determined using intact cells or animals, one can measure a variety of effects such as changes in intracellular secondary messengers such as Ca2+, IP3 or cAMP. Suitable assays for making such measurements are described in WO 01 18050 which is hereby incorporated by reference.
Preferred assays for G-protein coupled receptors include cells that are loaded with ion sensitive dyes to report receptor activity, as are more fully set out in "G- protein coupled receptors (Signal Transduction Series), CRC Press 1999; 1st Edition; Eds Haga and Berstein, which is incorporated herein by reference. In assays for identifying modulatory compounds, changes in the level of ions in the cytoplasm or membrane voltage will be monitored using an ion sensitive or membrane voltage fluorescent indicator, respectively.
Receptor activation typically initiates subsequent intracellular events, e.g., increases in second messengers such as IP3, which releases intracellular stores of calcium ions. Activation of some G-protein coupled receptors stimulates the formation of inositol triphosphate (IP3) through phospholipase C-mediated hydrolysis of phosphatidylinositol (Berridge & Irvine, Nature 312:315-21 (1984)). IP3 in turn stimulates the release of intracellular calcium ion stores. Thus, a change in cytoplasmic calcium ion levels, or a change in second messenger levels such as IP3 can be used to assess G-protein coupled receptor function. Cells expressing such G-protein coupled receptors may exhibit increased cytoplasmic calcium levels as a result of contribution from both intracellular stores and via activation of ion channels, in which case it may be desirable, although not necessary, to conduct such assays in calcium-free buffer, optionally supplemented with a chelating agent such as EDTA, to distinguish fluorescence response resulting from calcium release from internal stores.
In a preferred embodiment, receptor activity is measured by expressing the receptor in a cell with a G-protein as defined herein above, that links the receptor to a phospholipase C signal transduction pathway. Optionally the cell line is HEK- 293, although other mammalian cells are also preferred such as CHO and COS cells. Modulation of taste transduction is assayed by measuring changes in intracellular Ca + levels, which change in response to modulation of the receptor signal transduction pathway via administration of a molecule that associates with tthhee rreecceeppttoorr.. CChhaannggeess iinn CCaa22++ lleevveellss aarree ooppttiiconally measured using fluorescent Ca2+ indicator dyes and fluorometric imaging.
In yet another embodiment, the ligand-binding domains of the receptors can be employed in vitro in soluble or solid-state reactions to assay for ligand binding. Ligand binding in a receptor, or a domain of a receptor, can be tested in solution, in a bilayer membrane attached to a solid phase in a lipid monolayer or vesicles. Thereby, the binding of a modulator to the receptor, or domain, can be observed using changes in spectroscopic characteristics, e.g. fluorescence, absorbance or refractive index; or hydrodynamic (e.g. shape), chromatographic, or solubility properties, as is generally known in the art.
The compounds tested as modulators of receptors can be any small chemical compound, or a biological entity, such as a protein, sugar, nucleic acid or lipid. Typically, test compounds will be small chemical molecules. Essentially any chemical compound can be used as a potential modulator or ligand in the assays of the invention, although knowledge of the ligand specificity of an individual receptor would enable the skilled person to make pre-selection of interesting compounds. Some preferred compounds have been set forth herein above. The assays may be designed to screen large chemical libraries by automating the assay steps and providing compounds from any convenient source to assays, which are typically run in parallel (e.g., in microtiter formats on microtiter plates in robotic assays). The skilled person will understand that there are many suppliers of libraries of chemical compounds.
Assays may be run in high throughput screening methods that involve providing a combinatorial chemical or peptide library containing a large number of potential therapeutic, or tastant compounds (that are potential ligand compounds). Such libraries are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as lead compounds to further develop modulators for final products, or can themselves be used as actual modulators.
A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical "building blocks" such as reagents. For example, a linear combinatorial chemical library such as a polypeptide library is formed by combining a set of chemical building blocks (amino acids) in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.
Preparation and screening of combinatorial chemical libraries is well known to those of skill in the art and no more needs to be stated here. In the high throughput assays of the invention, it is possible to screen up to several thousand different modulators or ligands in a single day. In particular, each well of a microtiter plate can be used to run a separate assay against a selected potential modulator, or, if concentration or incubation time effects are to be observed, every 5-10 wells can test a single modulator. Thus, a single standard microtiter plate can assay about 100 (e.g., 96) modulators. If 1536 well plates are used, then a single plate can easily assay from about 100 to about 1500 different compounds. It is possible to assay several different plates per day; assay screens for up to about 6,000-20,000 different compounds is possible using the integrated systems of the invention.
Lead compounds found by assay technology herein above described, or development compounds formed from such leads can be administered directly to a human subject to modulate taste. Alternatively, such compounds can be formulated with other ingredients of preparations to be taken orally, for example, foods and beverages, pharmaceutical or neutraceutical or homeopathic preparations.
The amount of compound to be taken orally must be sufficient to effect a beneficial response in the human subject, and will be determined by the efficacy of the particular taste modulators and the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular compound.
There now follows a series of examples that serve to illustrate the invention.
For all examples, HEK293 cells were used; for transient transfection of the receptors, HEK293T cells were used, and for stable transfection of the receptors, T-Rex™ HEK293 cells (Invitrogen Corp., Carlsbad, CA) were used.
Example 1 :
Figure imgf000025_0001
The Gαi6gustducin44 was constructed by bridge overlap PCR mutagenesis using the human Gα16 and rat gustducin cDNAs in pcDNA3.1 as templates with T7 and
SP6 promoter sequences as outer flanking primer regions. Gene specific primers used were :
16gust44-S: (5' GGCCCCGAGGGCAGCAACTTAAAAAAAGAAGATAAGGAA 3') 16gust44-AS: (5' TTCCTTATCTTCTTTTTTTAAGTTGCTGCCCTCGGGGCC 3')
First, two overlapping PCR fragments that correspond to Gαιβ and gustducin were amplified. The 5' Gα16 fragment was made using the T7 primer in conjunction with the 16gust44-AS primer, whereas the 3' gustducin fragment was made using the SP6 primer in conjunction with the 16gust44-S primer. The individual PCR products were separated by agarose gel electrophoresis and purified. The purified PCR products were mixed, annealed together and then the full-length chimeric fragments were amplified using T7 and SP6 primers. 1.5 mM MgCI2 was included in the PCR mixtures and the PCR products were amplified with thermal cycling parameters at 94° C for 45 s, 50° C for 90 s and 72° C for 120 s using a GeneAmp PCR System 9700 from Applied Biosystems. The assembled chimeric PCR fragment was subcloned into pcDNA3.1 and checked for integrity by DNA sequencing and restriction mapping. Proper expression of the fusion protein was confirmed via Western blot analysis of whole cell lysates from transfected cells using an anti-Gαι6 polyclonal antibody (Torrey Pines Biolabs). Example 2
Fluo-4 Calcium Assay
All assays are performed using black, clear-bottom 96-well plates that have been seeded the day before with 20K transfected cells per well and have been maintained at 37 degrees C overnight in appropriate growth media. At the time of the assay, the growth media is discarded and cells are incubated for 1 hour (at room temperature in the dark) with 75 μl of a calcium assay solution consisting of 1.5 μM Fluo-4 AM (Molecular Probes) and 2.5 mM probenicid (Sigma-Aldrich) dissolved in a Hanks balanced salts solution (HBSS) that has been supplemented with 10 mM Hepes, 200μM calcium chloride and 0.1% bovine serum albumin, pH 7.4 at 37 degrees C. After the initial 1 hour loading period, 125 μl of wash buffer consisting of 2.5 mM probenicid dissolved in HBSS that has been supplemented with 10 mM Hepes, 200μM calcium chloride and 0.1% bovine serum albumin, pH 7.4 at 37 degrees C, is added to each well and the plate is further incubated for 30 minutes at room temperature in the dark to allow for complete deesterification of the Fluo-4-AM. The buffer solutions are discarded, the plate is washed 3 times with 100 μl wash buffer and finally the cells are reconstituted in 200 μl of wash buffer and incubated for 15 minutes at 37 degrees C. For assay reading, the plate is placed in a fluorescent microplate reader, for example the Flexstation (Molecular Devices), and receptor activation is initiated following addition of 20 μl of a 10X concentrated ligand stock solution. Fluorescence is continuously monitored for 15 seconds prior to ligand addition and for 45 - 75 seconds after ligand addition. Receptor activation levels are defined as by the two following equations: % Activation = (Maximum fluorescence - baseline fluorescence/baseline fluorescence) * 100 or Fluorescence Increase = Maximum Fluorescence - baseline fluorescence, where baseline fluorescence represents the average fluorescence levels prior to ligand addition. Example 3
Transfections for T2R bitter receptors
At day 0, cells stably expressing the G-protein are plated in black, clear-bottom
96-well plate at 20,000 cells per well and grown overnight in selective growth media. On day 1, the media is changed to an antibiotic-free growth media and the cells are transfected using 300 ng GPCR DNA and 0.6 μl of Lipofectamine
2000 (Invitrogen). The cells are grown overnight and processed the next day using the Fluo-4 calcium assay conditions described in Example 2 above.
Example 4
Transfections for T1R Sweet Receptors
At day 0, cells stably expressing the G-protein are plated in a 6-well plate at a density of 800,000-950,000 cells per well and grown overnight in selective growth media. On day 1, the media is changed to an antibiotic-free growth media and the cells are transfected using 2 μg of T1 R2 and 2 μg of T1 R3 cDNA and 10 μl of Lipofectamine 2000 (Invitrogen). The cells are maintained overnight in antibiotic- free growth media. On day 2, the cells are replated into a black, clear-bottom 96 well plate at 20,000 cells per well and grown overnight. The morning of the calcium assay, the media is replaced with low glucose media supplemented with Glutamax and dialyzed FBS to minimize receptor desensitization by sugars and glutamate. The cells are further incubated in this media for 6 hours at 37 degrees C. At the end of this period, the cells are processed for the calcium assay according to conditions described above.
Example 5
Activation of human TAS2R16 by a bitter qlucoside in cells expressing different
G-proteins.
5 mM of phenyl-β-D-glucopyranoside was added in cells expressing hTAS2R16 and either wild-type Gαι6, a chimera of the invention Gαi6gustducin44, and a comparative chimera Gα16z 4. Cells stably expressing the different G-proteins were transiently transfected for 24 hours with the human TAS2R16 bitter receptor. Following transfection, the cells were treated with Fluo-4 and intracellular calcium fluorescence was measured as described above in Example 2. Cellular fluorescence was monitored constantly and the mean fluorescence measured for 15 seconds prior to ligand addition was considered as the baseline, non-stimulated level of fluorescence. Cells expressing the Gαi6gustducin44 chimera displayed a greater degree of receptor activation following ligand stimulation than cells expressing Gαi6-
Table 1 : Functional activity of human bitter receptor with G-protein variants
Promiscuous G-protein
Taste Receptor Gα16gustducin44 Gα16 Gα16z44
sham transfected (control) 2162 1024 1541 human TAS2R16 23821 3494 8296
All data are expressed in relative fluorescence units (RFUs) and represents the increase in mean fluorescence over baseline following ligand addition. The ligand and final concentration used was 5 mM phenyl-β-D-glucopyranoside. Similar results were also obtained using 5 mM D-salicin.
Example 6
Functional activity of mouse bitter receptor (T2R5) with G-proteins
Following the methodology as described in Example 5 the following results were obtained :-
Table 2:
Promiscuous G-protein Taste Receptor Gα16gustducin44 Gα16
sham transfected (control) 3989 1705 mouse T2R5 10407 2569
All data are expressed in relative fluorescence units (RFUs) and represents the increase in mean fluorescence over baseline following ligand addition. The ligand and final concentration used was 10 μM cycloheximide.
Example 7
Activation of human bitter receptor TAS2R10 by strychnine in cells stably expressing G„ifiηllstH.,rin44and TAS2R10
The example was performed essentially as described in example 5, except that tetra-cycline-inducible cell lines stably expressing human TAS2R10 and G16gust44 were used instead of transient transfection. Cells were kept at a cell density of 75-80%. The following results were obtained:
Table 3
Promiscuous G-protein
Taste Receptor Gαi6gustducin44
G-protein only (control w/o tetracycline) 13238 G-protein + human TAS2R10 (with tetracycline) 24280 All data are expressed in relative fluorescence units (RFUs) and represents the increase in mean fluorescence over baseline following ligand addition. The ligand and final concentration used was 250 μM strychnine.
Example 8
Activation of human bitter receptor TAS2R38 by phenylthiocarbamide or propythiouracil in cells stably expressing Gai6austducin44 and TAS2R38
The example was performed essentially as described in example 5, except that tetracycline-inducible cell lines stably expressing human TAS2R38 and G16gust44 were used instead of transient transfection. Cells were kept at a cell density of 75-80%. The following results were obtained:
Table 4
Promiscuous G-protein
Taste Receptor Gαι6gustducin44
G-protein only(control w/o tetracycline) 3422
G-protein + human TAS2R38 (with tetracycline) 8989
All data are expressed in relative fluorescence units (RFUs) and represents the increase in mean fluorescence over baseline following ligand addition. The ligand and final concentration used was 250 μM phenylthiocarbamide. Similar results were obtained using 250 μM propythiouracil.
Example 9
Functional activity of human bitter receptor (TAS2R43) with G-proteins. Using similar methodology as Example 5 except that tetra-cycline-inducible cell lines stably expressing human TAS2R43 and G16gust44 were used instead of transient Transfection. Cells were kept at a cell density of 75-80%. The following results were obtained:
Table 5
Promiscuous G-protein
Taste Receptor Gαi6gustducin44
G-protein only 3955
G-protein + human TAS2R43 26766
All data are expressed in relative fluorescence units (RFUs) and represents the increase in mean fluorescence over baseline following ligand addition. The ligand and final concentration used was 10 μM aristolochic acid.
Example 10
Functional activity of human bitter receptor (TAS2R44) with G-proteins. Using similar methodology as Example 5 except that tetra-cycline-inducible cell lines stably expressing human TAS2R44 and G16gust44 were used instead of transient Transfection. Cells were kept at a cell density of 75-80%. The following results were obtained:
Table 6
Promiscuous G-protein
Taste Receptor Gαi6gustducin44
G-protein only 5700
G-protein + human TAS2R44 17254 All data are expressed in relative fluorescence units (RFUs) and represents the increase in mean fluorescence over baseline following ligand addition. The ligand and final concentration used was 10 μM aristolochic acid.
Example 11
Functional activity of human sweet receptor with G-proteins
Following the methodology as described in Example 5 the following results were obtained:-
Table 7:
Promiscuous G-protein
Taste Receptor Gα16gustducin44 Gα15
sham transfected (control) 1370 643 human TAS1R2/TAS1R3 4617 1300
All data are expressed in relative fluorescence units (RFUs) and represents the increase in mean fluorescence over baseline following ligand addition. The ligand and final concentration used was 2.5 mM sucralose. Similar results were also obtained using 2.5 mM aspartame or acesulfame K.

Claims

Claims
1. A Gαq-Gustducin chimeric G-protein.
2. The chimeric Gαq-Gustducin of claim 1 characterised in that it is a Gα15 ori6- Gustducin protein
3. The chimeric G-protein of claim 1 or claim 2 wherein at least the last 5 amino acids of the Gαq are replaced by a corresponding number of amino acids of Gustducin.
4. The chimeric G-protein of claim 3 wherein the last 44 amino acid sequences of the Gαq is replaced with a 44 amino acid unit of Gustducin.
5. A chimeric G-protein according to claim 1 having an amino acid sequence set forth in the SEQ ID 2.
6. A G-protein according to claim 1 encoded for by a nucleic acid comprising a nucleotide sequence set forth in SEQ ID 1
7. A nucleic acid comprising the nucleotide sequence set forth in SEQ ID 1 encoding for a G-protein defined in claim 1.
8. An expression vector comprising nucleic acid comprising the nucleotide sequence set forth in SEQ ID 1 encoding for a G-protein defined in claiml .
9. A host cell transfected with an expression vector as defined in claim 8.
10. The host cell of claim 9 stably expressing the chimeric G-Potein and a taste receptor.
11. A method of producing a chimeric G-protein as defined in claim 1 , comprising the step of culturing host cells having contained therein an expression vector encoding for the chimeric G-protein, under conditions sufficient for expression of said G-protein, thereby causing production of the protein, and recovering the protein produced by the cell.
12. A method of analysis and discovery of modulators of taste receptors, using the chimeric proteins defined in claim 1.
13. A method of analysis and discovery of modulators of taste receptors, selected from the group of bitter taste receptors, sweet taste receptors, and umami taste receptors, using the chimeric proteins defined in claim 1.
14. Method according to claim 12 employing a mammalian cell-based assay employing a transfected gene or cDNA encoding a chimeric protein of the invention and a taste receptor, the method comprising the steps of contacting a compound with cells, and determining the functional effect of the compound on the receptor.chimeric G-protein complex.
15. A method according to any one of claims 12 to 14 wherein the functional effect is determined by measuring the changes in intracellular messengers such as IP3 or calcium2+.
PCT/CH2003/000830 2002-12-18 2003-12-17 Chimeric alpha q-gustducin g-proteins WO2004055048A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
DE60320682T DE60320682T2 (en) 2002-12-18 2003-12-17 CHIMERIC ALPHA Q-GUSTDUCINE G PROTEINS
AU2003286069A AU2003286069A1 (en) 2002-12-18 2003-12-17 Chimeric alpha q-gustducin g-proteins
JP2004559553A JP4654038B2 (en) 2002-12-18 2003-12-17 Chimeric alpha Q-gustducin G protein
US10/538,038 US7919236B2 (en) 2002-12-18 2003-12-17 G-proteins
EP03776743A EP1581555B1 (en) 2002-12-18 2003-12-17 Chimeric alpha q-gustducin g-proteins
CA002507387A CA2507387A1 (en) 2002-12-18 2003-12-17 Chimeric alpha q-gustducin g-proteins
US13/035,435 US8609362B2 (en) 2002-12-18 2011-02-25 G-proteins

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US43479002P 2002-12-18 2002-12-18
US60/434,790 2002-12-18

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US10538038 A-371-Of-International 2003-12-17
US13/035,435 Division US8609362B2 (en) 2002-12-18 2011-02-25 G-proteins

Publications (2)

Publication Number Publication Date
WO2004055048A2 true WO2004055048A2 (en) 2004-07-01
WO2004055048A3 WO2004055048A3 (en) 2004-09-16

Family

ID=32595305

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CH2003/000830 WO2004055048A2 (en) 2002-12-18 2003-12-17 Chimeric alpha q-gustducin g-proteins

Country Status (10)

Country Link
US (2) US7919236B2 (en)
EP (1) EP1581555B1 (en)
JP (2) JP4654038B2 (en)
CN (1) CN1726224A (en)
AT (1) ATE393778T1 (en)
AU (1) AU2003286069A1 (en)
CA (1) CA2507387A1 (en)
DE (1) DE60320682T2 (en)
ES (1) ES2305536T3 (en)
WO (1) WO2004055048A2 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1759595A1 (en) 2005-09-02 2007-03-07 Quest International Services B.V. Flavour modulating substance
WO2007121599A1 (en) 2006-04-20 2007-11-01 Givaudan Sa Functional method to identify tastants
EP1854782A1 (en) 2006-05-05 2007-11-14 Quest International Services B.V. Taste improving composition
WO2008119195A1 (en) * 2007-03-30 2008-10-09 Givaudan Sa Methods to identify modulators
JP2009534018A (en) * 2006-04-20 2009-09-24 ジボダン エス エー Methods for sweetness enhancement
EP2108954A1 (en) 2008-04-10 2009-10-14 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. A test system for detecting intracellular cyclic nucleotide level and methods and uses thereof
US7897190B2 (en) 2004-10-29 2011-03-01 Quest International Services B.V. Flavour modulating substances
US8039233B2 (en) 2007-01-18 2011-10-18 Givaudan S.A. Nucleic acid sequences and their use in methods to identify umami modulatiors
US8053013B2 (en) 2004-10-29 2011-11-08 Quest International Services B.V. Flavour modulating substances
WO2011138456A1 (en) 2010-05-07 2011-11-10 Givaudan Sa Methods to identify modulators of tas2r4s receptors
WO2011138455A1 (en) 2010-05-07 2011-11-10 Givaudan Sa Methods to identify modulators
WO2013072332A1 (en) 2011-11-14 2013-05-23 Givaudan Sa Methods of using antagonists of bitter taste receptors
WO2014149829A1 (en) 2013-03-15 2014-09-25 Afb International Feline bitter taste receptors and methods
EP2924050A1 (en) 2014-03-28 2015-09-30 Ajinomoto Co., Inc. Sweet taste receptor chimeric proteins and use thereof
US9671390B2 (en) 2001-03-07 2017-06-06 Senomyx, Inc. In vitro method using hetero-oligomeric T1R1/T1R3 taste receptors to identify umami tastants
AU2014262543B2 (en) * 2013-05-10 2017-07-20 Pepsico, Inc. Cells as a model to identify potential taste modulators
US9766236B2 (en) 2013-05-10 2017-09-19 Pepsico, Inc. Taste receptor internalization assay
US9804157B1 (en) 2013-03-15 2017-10-31 Senomyx, Inc. Screening assays to identify compounds which modulate T1R associated taste modalities which eliminate false positives
CN108611324A (en) * 2018-05-07 2018-10-02 云南中烟工业有限责任公司 A kind of eukaryotic cell lines and preparation method thereof of stable coexpression recombination human source sweet receptor albumen
US10088472B2 (en) 2001-04-19 2018-10-02 Senomyx, Inc. Methods of using TIR hetero-oligomeric receptors for screening compounds that modulate sweet or umami taste

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2305536T3 (en) * 2002-12-18 2008-11-01 Givaudan Sa PROTEINS G ALFA Q-GUSTDUCINA CHEMERICAS.
US20110097741A1 (en) * 2006-04-20 2011-04-28 Jay Patrick Slack Partial t1r2 nucleic acid sequence, receptor protein and its use in screening assays
EP1975611A1 (en) * 2007-03-29 2008-10-01 Deutsches Institut für Ernährungsforschung Potsdam -Rehbrücke-Stiftung des öffentlichen Rechts- Vertreten durch den Stiftungsvorstand Agonists of bitter taste receptors and uses thereof
JP2011506464A (en) * 2007-12-10 2011-03-03 メタプロテオミクス， エルエルシー Replacement 1,3-cyclopentadione multitarget protein kinase modulators of cancer, angiogenesis and their associated inflammatory pathways
EP2300830B1 (en) * 2008-06-13 2015-05-20 Givaudan SA Methods of identifying modulators of the bitter taste receptor tas2r44
JP5576653B2 (en) * 2008-12-26 2014-08-20 サントリー食品インターナショナル株式会社 Cyclic dipeptide-containing beverage
JP5906013B2 (en) * 2010-12-10 2016-04-20 花王株式会社 Evaluation and selection methods for bitterness inhibitors
WO2013103919A2 (en) 2012-01-06 2013-07-11 Elcelyx Therapeutics, Inc. Compositions and methods for treating metabolic disorders
KR20140035331A (en) 2011-01-07 2014-03-21 엘셀릭스 테라퓨틱스 인코포레이티드 Chemosensory receptor ligand-based therapies
US9795792B2 (en) 2011-02-25 2017-10-24 Medtronic, Inc. Emergency mode switching for non-pacing modes
EP2742350B1 (en) 2011-08-08 2019-10-30 The Coca-Cola Company Cell lines comprising endogenous taste receptors and their uses
EP2800561B1 (en) 2012-01-06 2020-08-19 Anji Pharma (US) LLC Biguanide compositions and methods of treating metabolic disorders
JP2015522080A (en) 2012-07-11 2015-08-03 エルセリクス セラピューティクス インコーポレイテッド Compositions for reducing cardiovascular metabolic risk comprising statins, biguanides, and additional agents
EP2941245B1 (en) 2013-01-05 2024-06-26 Anji Pharmaceuticals Inc. Delayed-release composition comprising biguanide
US20180255816A1 (en) * 2015-10-16 2018-09-13 Cornell University Sweeteners having enhanced organoleptic properties
JP6924590B2 (en) * 2016-03-14 2021-08-25 サントリーホールディングス株式会社 Fusion protein for bitterness evaluation and bitterness evaluation method

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002036622A2 (en) * 2000-10-30 2002-05-10 Senomyx, Inc. GαqPROETIN VARIANTS AND THEIR USE IN THE ANALYSIS AND DISCOVERY OF AGONISTS AND ANTAGONISTS OF CHEMOSENSORY RECEPTORS

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5817759A (en) * 1992-04-09 1998-10-06 Linguagen Corporation Gustducin polypeptides and fragments
IL148593A0 (en) 1999-09-10 2002-09-12 Univ California T2r, a novel family of taste receptors
US6462178B1 (en) * 1999-11-17 2002-10-08 Yong Hou Wong G protein
US7041457B2 (en) * 2000-10-30 2006-05-09 Senomyx, Inc. Gαq protein variants and their use in the analysis and discovery of agonists and antagonists of chemosensory receptors
ES2305536T3 (en) * 2002-12-18 2008-11-01 Givaudan Sa PROTEINS G ALFA Q-GUSTDUCINA CHEMERICAS.

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002036622A2 (en) * 2000-10-30 2002-05-10 Senomyx, Inc. GαqPROETIN VARIANTS AND THEIR USE IN THE ANALYSIS AND DISCOVERY OF AGONISTS AND ANTAGONISTS OF CHEMOSENSORY RECEPTORS

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KOSTENIS E: "Is Galpha16 the optimal tool for fishing ligands of orphan G-protein-coupled receptors?" TRENDS IN PHARMACOLOGICAL SCIENCES, ELSEVIER TRENDS JOURNAL, CAMBRIDGE, GB, vol. 22, no. 11, 1 November 2001 (2001-11-01), pages 560-564, XP004320245 ISSN: 0165-6147 *
MODY SEJAL M ET AL: "Incorporation of Galphaz-specific sequence at the carboxyl terminus increases the promiscuity of Galpha16 toward Gi-coupled receptors" MOLECULAR PHARMACOLOGY, BALTIMORE, MD, US, vol. 57, no. 1, January 2000 (2000-01), pages 13-23, XP002199066 ISSN: 0026-895X *
UEDA TAKASHI ET AL: "Functional interaction between T2R taste receptors and G-protein alpha subunits expressed in taste receptor cells." JOURNAL OF NEUROSCIENCE, vol. 23, no. 19, 13 August 2003 (2003-08-13), pages 7376-7380, XP009033223 ISSN: 0270-6474 *

Cited By (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10114009B2 (en) 2001-03-07 2018-10-30 Senomyx, Inc. Methods of detecting T1R hetero-oligomeric taste receptor expression to identify cells that are potentially sensitive to sweet tastants
US9671390B2 (en) 2001-03-07 2017-06-06 Senomyx, Inc. In vitro method using hetero-oligomeric T1R1/T1R3 taste receptors to identify umami tastants
US10670584B2 (en) 2001-03-07 2020-06-02 Firmenich Incorporated In vitro methods of detecting heteroligomeric T1R2/T2R3-expressing cells that are potentially sensitive to sweet tastants
US10591464B2 (en) 2001-04-19 2020-03-17 Firmenich Incorporated Methods of using T1R hetero-oligomeric taste receptors to screen for compounds which modulate sweet or umami taste signaling
US10088472B2 (en) 2001-04-19 2018-10-02 Senomyx, Inc. Methods of using TIR hetero-oligomeric receptors for screening compounds that modulate sweet or umami taste
US8053013B2 (en) 2004-10-29 2011-11-08 Quest International Services B.V. Flavour modulating substances
US7897190B2 (en) 2004-10-29 2011-03-01 Quest International Services B.V. Flavour modulating substances
EP1759595A1 (en) 2005-09-02 2007-03-07 Quest International Services B.V. Flavour modulating substance
KR101356892B1 (en) * 2006-04-20 2014-01-28 지보당 에스아 Functional method to identify tastants
WO2007121599A1 (en) 2006-04-20 2007-11-01 Givaudan Sa Functional method to identify tastants
US8124360B2 (en) 2006-04-20 2012-02-28 Givaudan S.A. Use of a T1R2 nucleic acid sequence to identify tastants
US8124361B2 (en) 2006-04-20 2012-02-28 Givaudan Sa Methods of screening for sweet taste modulators
EP2995950A1 (en) 2006-04-20 2016-03-16 Givaudan SA Method relating to sweetness enhancement
JP2009533065A (en) * 2006-04-20 2009-09-17 ジボダン エス エー Functional methods for taste substance identification
JP2009534018A (en) * 2006-04-20 2009-09-24 ジボダン エス エー Methods for sweetness enhancement
US8691311B2 (en) 2006-05-05 2014-04-08 Givaudan Nederland Services B.V. Taste improving substances
EP1854782A1 (en) 2006-05-05 2007-11-14 Quest International Services B.V. Taste improving composition
US8263161B2 (en) 2006-05-05 2012-09-11 Quest International Services B.V. Taste improving substances
US8039233B2 (en) 2007-01-18 2011-10-18 Givaudan S.A. Nucleic acid sequences and their use in methods to identify umami modulatiors
US8597896B2 (en) 2007-03-30 2013-12-03 Givaudan S.A. Methods to identify modulators using TAS2R bitter taste receptor
WO2008119195A1 (en) * 2007-03-30 2008-10-09 Givaudan Sa Methods to identify modulators
US8187822B2 (en) 2007-03-30 2012-05-29 Givaudan S.A. Methods to identify modulators
EP2108954A1 (en) 2008-04-10 2009-10-14 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. A test system for detecting intracellular cyclic nucleotide level and methods and uses thereof
WO2011138455A1 (en) 2010-05-07 2011-11-10 Givaudan Sa Methods to identify modulators
WO2011138456A1 (en) 2010-05-07 2011-11-10 Givaudan Sa Methods to identify modulators of tas2r4s receptors
WO2013072332A1 (en) 2011-11-14 2013-05-23 Givaudan Sa Methods of using antagonists of bitter taste receptors
US9804157B1 (en) 2013-03-15 2017-10-31 Senomyx, Inc. Screening assays to identify compounds which modulate T1R associated taste modalities which eliminate false positives
US10281467B2 (en) 2013-03-15 2019-05-07 Senomyx, Inc. Screening assays to identify compounds which modulate T1R associated taste modalities which eliminate false positives
WO2014149829A1 (en) 2013-03-15 2014-09-25 Afb International Feline bitter taste receptors and methods
US9766236B2 (en) 2013-05-10 2017-09-19 Pepsico, Inc. Taste receptor internalization assay
US10107794B2 (en) 2013-05-10 2018-10-23 Pepsico, Inc. Methods of using U2-OS cells to identify potential sweet taste modulators
AU2014262543B2 (en) * 2013-05-10 2017-07-20 Pepsico, Inc. Cells as a model to identify potential taste modulators
EP2924050A1 (en) 2014-03-28 2015-09-30 Ajinomoto Co., Inc. Sweet taste receptor chimeric proteins and use thereof
CN108611324A (en) * 2018-05-07 2018-10-02 云南中烟工业有限责任公司 A kind of eukaryotic cell lines and preparation method thereof of stable coexpression recombination human source sweet receptor albumen

Also Published As

Publication number Publication date
JP4654038B2 (en) 2011-03-16
US7919236B2 (en) 2011-04-05
JP5425651B2 (en) 2014-02-26
AU2003286069A1 (en) 2004-07-09
AU2003286069A8 (en) 2004-07-09
US8609362B2 (en) 2013-12-17
CA2507387A1 (en) 2004-07-01
CN1726224A (en) 2006-01-25
US20110177545A1 (en) 2011-07-21
EP1581555B1 (en) 2008-04-30
EP1581555A2 (en) 2005-10-05
JP2010187666A (en) 2010-09-02
DE60320682T2 (en) 2009-06-10
ATE393778T1 (en) 2008-05-15
WO2004055048A3 (en) 2004-09-16
ES2305536T3 (en) 2008-11-01
DE60320682D1 (en) 2008-06-12
JP2006524483A (en) 2006-11-02
US20060275765A1 (en) 2006-12-07

Similar Documents

Publication Publication Date Title
US8609362B2 (en) G-proteins
JP7018000B2 (en) Methods for enhancing sweetness
US7964376B2 (en) Chimeric proteins and their use in methods to screen for sweet taste modulators
US8124360B2 (en) Use of a T1R2 nucleic acid sequence to identify tastants
US20110097741A1 (en) Partial t1r2 nucleic acid sequence, receptor protein and its use in screening assays
KR101511394B1 (en) Chimeric umami taste receptor, nucleic acid encoding it and use thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003776743

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2507387

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2006275765

Country of ref document: US

Ref document number: 10538038

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 1241/CHENP/2005

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2004559553

Country of ref document: JP

Ref document number: 20038A65075

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2003776743

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 10538038

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 2003776743

Country of ref document: EP