WO2004048597A2

WO2004048597A2 - Composition and method for inhibition of microorganisms

Info

Publication number: WO2004048597A2
Application number: PCT/US2003/037526
Authority: WO
Inventors: Michael P. Doyle; Tong Zhao
Original assignee: University Of Georgia Research Foundation, Inc.
Priority date: 2002-11-25
Filing date: 2003-11-24
Publication date: 2004-06-10
Also published as: WO2004048597A3; US7575744B2; AU2003294495A8; US8440448B2; EP1570047A4; EP1570047B1; DE60329120D1; AU2003294495A1; US20090324550A1; ATE441701T1; EP1570047A2; US20060073129A1

Abstract

A composition and method for the inhibition of microorganisms.

Description

COMPOSITION AND METHOD FOR INHIBITION OF MICROORGANISMS

CROSS-REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. provisional application serial No. 60/428,863 filed November 25, 2002, which is hereby incorporated herein by reference.

FIELD OF THE INVENTION

The present invention relates generally to a composition and method for the inhibition of microorganisms, and more particularly to a composition and method for controlling Listeria monocytogenes in food processing facilities or on a food product by, for example, a probiotic microorganism, such as competitive exclusion microorganisms.

BACKGROUND OF THE INVENTION

The control of contamination by microorganisms is a recognized problem in the food processing industry. The process of preparing food products is largely concerned with preventing the contamination of such food products with harmful microorganisms. For example, in the meat packing industry, many types of microorganisms can cause food poisoning if contamination takes place. These microorganisms include E. coli, Salmonella, Listeria monocytogenes, Staphylococcus aureus, Bacillus anthracis, Campylobacter coli, Campylobacter jejuni, Yersinia enterocolitica, Yersinia pseudotuberculosis, Brucella, and Clostridium. One microorganism of particular concern for the food processing industry is Listeria monocytogenes (hereinafter referred to as L. monocytogenes) since studies indicate that certain strains of L. monocytogenes can become well established in a food- processing facility and remain members of the resident microbial flora for months or years. Moreover, investigations of several outbreaks of listeriosis revealed that environmental contamination of food processing facilities was the primary source of L. monocytogenes in many commercially prepared ready-to-eat (RTE) processed foods.

In general, L. monocytogenes has a widespread occurrence in nature and is capable of surviving and growing under a variety of conditions, including growing in soil and aqueous environments. For example, L. monocytogenes has been isolated from 8.4 to 44% of samples obtained from grain fields, pastures, mud, animal feces, wildlife feeding grounds, and related sources, and can survive in moist soils for more than 295 days. Furthermore, L. monocytogenes is a nonfastious organism that thrives in cool, damp environments. Moreover, this organism can grow at temperatures typically used to refrigerate processed foods which presents particular problems for the food processing industry.

As previously mentioned, L. monocytogenes thrives in cool, damp environments which is why high populations of this organism frequently occur in floor drains of food processing facilities. These L. monocytogenes-contaminated floor drains can serve as a point of contamination for the processing plant environment and food products. Decontaminating floor drains of listerae is especially challenging because the population of L. monocytogenes is typically enveloped in a biofilm, and the biofilm provides the microorganism with unusual protection against disinfectants and conventional treatments available to control pathogens on environmental surfaces. Therefore, although major improvements have been made in food processing plant layout, equipment design, and in procedures for cleaning and sanitizing food processing facilities, controlling the widely distributed psychrotrophic L. monocytogenes in food processing facilities remains a formidable challenge for the entire food industry as demonstrated by the fact that environmental testing results indicate that L. monocytogenes continues to be introduced into food processing environments. Accordingly, a composition and method for the inhibition of microorganisms such as L. monocytogenes is desirable.

SUMMARY OF THE INVENTION

According to one illustrative embodiment, there is provided a method of treating a surface of a food processing facility which has a first population of microorganisms disposed thereon. The method includes disposing (i) a biofilm containing a second population of microorganisms and/or (ii) a second population of microorganisms that forms a biofilm onto the surface of the food processing facility. The method also includes inhibiting the growth of the first population of microorganisms on the surface of the food processing facility with the second population of microorganisms. According to another illustrative embodiment, there is provided a method of inhibiting the growth of Listeria monocytogenes on a surface of a food processing facility. The method includes inoculating the surface of the food processing facility with antimicrobial bacteria that can adhere to surfaces. The method also includes inhibiting the growth of the Listeria monocytogenes on the surface of the food processing facility with the bacteria adhering to the surface. For example, the bacteria can be contained in a biofilm so that it adheres to the surface or the bacteria can be one that forms a biofilm such that it adheres to the surface.

According to another illustrative embodiment, there is provided a method of inhibiting the growth of Listeria monocytogenes on a surface of a food processing facility. The method includes inoculating the surface of the food processing facility with a microorganism selected from the group consisting of bacteria from the genus Enterococcus and bacteria from the genus Lactococcus . The method also includes inhibiting the growth of the Listeria monocytogenes on the surface of the food processing facility with the bacteria.

According to still another illustrative embodiment, there is provided a method of inhibiting the growth of Listeria monocytogenes on a surface of a food processing facility. The method includes inoculating the surface of the food processing facility with antimicrobial bacteria that can adhere to surfaces such as antimicrobial bacteria contained in a biofilm, wherein the bacteria are selected from the group consisting of Enterococcus durans, Lactococcus lactis, and Lactobacillus plantarum. The method also includes inhibiting the growth of the Listeria monocytogenes on the surface of the food processing facility with the bacteria contained in the biofilm. According to yet another illustrative embodiment, there is provided a kit for inhibiting the growth of a first microorganism population disposed on a surface. The kit can include a biofilm and a second microorganism population disposed in the biofilm. In the alternative, the kit can include a microorganism capable of forming a biofilm when disposed on a surface. In another alternative the kit can include a biofilm and a microorganism, where the microorganism is placed in the biofilm prior to being disposed on the surface. The second microorganism population is inhibitory to the first microorganism population when the second microorganism population is placed in the presence of the first microorganism population.

According to still another illustrative embodiment, there is provided an inoculant composition. The inoculant composition includes a biofilm having disposed therein at least one of the following Enterococcus durans 141-1 having ATCC accession number PTA-4758, Enterococcus durans 152 having ATCC accession number PTA-4759, Lactococcus lactis C-l-92 having ATCC accession number PTA- 4760, ox Lactococcus lactis C-l-152 having ATCC accession number PTA-4761 or mixtures thereof. According to yet another illustrative embodiment, there is provided a biologically pure culture of bacteria selected from Enterococcus durans 141-1 having ATCC accession number PTA-4758, Enterococcus durans 152 having ATCC accession number PTA-4759, Lactococcus lactis C-l-92 having ATCC accession number PTA-4760, or Lactococcus lactis C-l-152 having ATCC accession number PTA-4761..

According to still another illustrative embodiment, there is provided a kit for inhibiting the growth of a first microorganism population disposed on a surface. The kit includes a biofilm and a second microorganism population for disposing in the biofilm. The second microorganism population is inhibitory to the first microorganism population when the second microorganism population is placed in the presence of the first microorganism population.

According to yet another illustrative embodiment, there is provided a method for selecting bacteria which inhibit the growth of Listeria monocytogenes. The method includes isolating naturally-occurring bacteria from a food processing facility. The method also includes culturing the isolated naturally-occurring bacteria. The method further includes testing the isolated naturally-occurring bacteria for the ability to inhibit the growth of Listeria monocytogenes.

According to still another illustrative embodiment, there is provided a method of selecting inhibitory bacteria. The method includes isolating naturally- occurring bacteria populations from a food processing facility. The method also includes culturing the isolated naturally-occurring bacteria populations. The method further includes testing each isolated naturally-occurring bacteria population for the ability to inhibit the growth of a microorganism, where isolated naturally-occurring bacteria populations having the ability to inhibit the growth of the microorganism are identified as a population of inhibitory bacteria.

According to still another illustrative embodiment, there is provided a culture of microorganisms that includes Enterococcus durans having ATCC accession number PTA-4758.

According to still another illustrative embodiment, there is provided a culture of microorganisms that includes Enterococcus durans having ATCC accession number PTA-4759.

According to still another illustrative embodiment, there is provided a culture of microorganisms that includes Lactococcus lactis having ATCC accession number PTA-4760.

According to still another illustrative embodiment, there is provided a culture of microorganisms that includes Lactococcus lactis having ATCC accession number PTA-4761. According to still another illustrative embodiment, there is provided a method of treating a food product having a first population of microorganisms disposed thereon. The method includes (a) disposing a second population of microorganisms onto the surface of the food product and (b) inhibiting the growth of the first population of microorganisms on the food product with the second population of microorganisms. If desired, the second population of microorganisms can be capable of forming a biofilm.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 illustrates the results of analyzing four probiotic isolates for their DNA fingerprinting by pulsed field-gel electrophoresis; lane 1 Lambda ladder DNA standard, lane 2 C-l-92 [L. lactis subsp. lactis], lane 3 C-l-152 [L. lactis subsp. lactis], lane 4 141-1 [E. durans], and lane 5 152 [E. durans].

DETAILED DESCRIPTION While the invention is susceptible to various modifications and alternative forms, specific exemplary embodiments thereof have been shown by way of example in the drawings and will herein be described in detail. It should be understood, however, that there is no intent to limit the invention to the particular forms disclosed, but on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within in the spirit and scope of the invention.

Materials and Methods Bacterial strains: A five-strain mixture ofE monocytogenes, including LM101 (serotype 4, salami isolate), LM112 (serotype 4, salami isolate), LM113 (serotype 4, pepperoni isolate), H9666 (serotype l/2c, human isolate) and ATCC 5779 (serotype l/2c, cheese isolate) from the UGA Center for Food Safety culture collection were used. Each strain was individually grown in tryptic soy broth with 0.6% yeast extract (TSBYE, Becton Dickinson, Sparks, MD) at 37°C for 16 h. The cultures were sedimented by centrifugation at 8,000 x g for 20 min and resuspended in 0.1% peptone. The optical density of each strain was adjusted in a spectrophotometer with 0.1 % peptone to an OD reading of 0.5 (ca. 10 cfu ml) at 630 run. An equal volume of culture of each of the five strains was combined to obtain a 5-strain mixture of approximately equal cell numbers of each strain. Isolation and screening of microorganisms for metabolites antagonistic to L. monocytogenes: Biofilm samples collected from floor drains at different food processing plants having a recent history of no detectable L. monocytogenes were used to obtain isolates of bacteria and yeasts. Two methods, which included a direct plating and an enrichment culture procedure, were used to isolate these microorganisms. Tryptic soy broth (TSB, 10 ml) was added to each biofilm sample (ca. 1 g) and biofilm preparations were serially diluted (1 :10) in 0.1% peptone to 10^"3. A volume of 0.1 ml of each dilution was plated on dichloran rose bengal chloramphenicol agar (DRBC) and tryptic soy agar (TSA) plates in duplicate, with DRBC plates incubated at 30°C for 72 h and TSA plates incubated at 37°C for 24 h. Biofilm preparation (1 ml) also was added to 9 ml of TSB and incubated at 37°C for 24 h. Enrichment cultures were serially diluted in 0.1% peptone and 0.1 -ml portions of dilutions of 10^"5 to 10^"8 were plated onto TSA and DRBC plates, and incubated according to the conditions described above. Ten colonies per biofilm specimen were selected randomly from plates and streaked for isolation.

Two methods, including the spot-on-lawn assay and the double layer assay, and two temperatures (37°C and 15°C) were used to screen isolates for anti- listerial activity. For the spot on-lawn-assay, 0.1 ml of ca. 10⁷ cells of the 5-strain mixture of L. monocytogenes/ l was plated onto each of duplicate TSA plates. Candidate competitive exclusion inhibition isolates were grown individually in TSB at 37°C for 24 h, cells were sedimented by centrifugation (4,000 x g for 20 min), and the supernatant fluid of each culture was filter-sterilized (0.22-μm-pore-size cellulose acetate membrane; Nalgene Co., Rochester, NY). A 12-mm disc (Dispens-O-Disc; Difco Laboratories, Detroit, MI) was placed onto the surface of each TSA plate, and 0.1 ml of filter-sterilized supernatant fluid from a single culture was applied to the surface of the disc. The plates were incubated at 37°C for 24 h and observed for zones of inhibition. In addition, a disc with nisin (3.125 μg; Sigma, St. Louis, MO) was used as the positive control and a disc with 0.1 M phosphate-buffered saline (PBS), pH 7.2, was used as the negative control.

The double-layer assay, also a two-step procedure, involved first growing a spot-inoculated candidate competitive inhibition isolate on TSA and then applying a second layer of growth medium containing the 5-strain mixture of L. monocytogenes. Specifically, an individual colony of competitive bacteria was inoculated in the center of each of two the TSA plates and incubated for 24 h at 37°C. A 5-strain mixture of L. monocytogenes was added at 10 cfu/ml to brain heart infusion with 0.4% agar (BHIA, Difco) at 50°C and mixed for 1 min at 200 rpm with a magnetic stir bar. The mixture (8 ml) was poured onto each TSA plate as a second layer and allowed to cool to room temperature. The cultures were incubated for 24 h at 37°C and observed for zones of inhibition. Nisin-producing Lactococcus lactis subsp. lactis (ATCC 11454) was used as the positive control and a yeast isolate, which was obtained from this study and confirmed to have no inhibitory effect on the growth of L. monocytogenes was used as the negative control. Competitive inhibition in broth cultures at different temperatures:

All isolates having anti- monocytogenes activity were further tested in TSBYE for competitive growth at temperatures ranging from about 4°C to about 37°C, for example, 4°C, 8°C, 15°C or 37°C. An individual isolate of a candidate competitive microorganism at ca. 10⁷ to 10⁹ (range 10^6'7 - 10⁹⁰) cfu in 0.1 ml and 0.1 ml of ca. 10⁵ to 10⁶ (range 10^5'2 -10^6'6) cfu of a 5-strain mixture of L. monocytogenes were added to 10 ml of TSBYE and incubated at 4°, 8°, 15° or 37°C. Cultures (1 ml) were sampled at intervals of 0, 8 and 24 h for incubation at 37°C, at 0, 1, 2, 3, 7, 10 and 14 days for 15°C, at 0, 1, 7, 14 and 21 days for 8°C, and at 0, 2, 7, 14, 21 and 28 days for 4°C, and enumerated for L. monocytogenes on modified Oxford agar (MOX, Difco) at 37°C for 48 h and for competitive microorganism count on TSA at 37°C for 48 h.

Identification of competitive microorganisms: Bacterial isolates having antagonistic activity to L. monocytogenes at all four temperatures evaluated were assayed by Gram stain, biochemical assays (API CHB and API CHL; bioMerieux Industry, I'Etoile, France), and 16S rRNA gene alignment profile analysis (Midi Labs, Newark, DE) for identification of genus and species. Preparation of stainless steel coupons: Stainless steel (T-304, Tull Metals Company, Atlanta, GA) coupons (4 cm x 2.5 cm) were washed by a 10-min immersion with agitation (150 rpm) in 1000 ml of an aqueous 2% RBS 35 Detergent solution (20 ml of RBS 35 Concentrate per liter of tap water at 50°C; Pierce, Rockford, IL), and rinsed by immersion in 1000 ml of tap water (initially at 50°C) with agitation (150 rpm) for 25 min. Five additional 1-min immersions with agitation (150 rpm) in 1000 ml of distilled water at ambient temperature were performed. The coupons were dried and a hydrophobic marker was used to encircle an area of 1.13 cm in diameter. The coupons were then individually wrapped in aluminum foil and autoclaved at 121°C for 30 min. Competitive inhibition of L. monocytogenes in a biofilm: Biofilms were grown using a modification of the protocol described by Leriche and Carpentier, Viable but non- culturable Salmonella typhimurium in single- and binary-species biofilms in response to chlorine treatment. J. Food Prot. 58:1186-1191 (1995) which is incorporated herein by reference and Chae and Schraft, Cell viability of Listeria monocytogenes biofilms. Food Microbiol. 18:103-112 (2001) which is incorporated herein by reference. The protocol was modified to include increasing the circle to a diameter of 1.13 cm and adjusting the incubation temperatures and sampling times to produce examples of the biofilms described herein. A biofilm is defined as an assemblage, or organized group, of microbial cells, wherein the assemblage is irreversibly associated with a surface and enclosed in a matrix of primarily polysaccharide material. An inoculum of 0.1 ml of 10^{6 0}-10^{8 4} cfu of candidate competitive microorganisms and 0.1 ml of 10^{2 6}-10 ⁶ cfu of a 5-strain mixture of L. monocytogenes were deposited in a biofilm and placed within the marked area of the stainless steel coupon. The coupon was then placed in a humidity-controlled incubator (ca. 95% relative humidity) at 4°, 8°, 15° or 37°C for 6 h. Non-adherent bacteria were removed by vacuum aspiration after 6 h of incubation and replaced with 0.1 ml of fresh TSB. The stainless steel coupons were reincubated at the same temperature and the media were replaced every 7, 3, 3 and 1 days for incubation at 4°, 8°, 15° or 37°C, respectively. At each sampling time, selected coupons in duplicate were transferred to a laminar flow hood in which weakly adherent bacteria were removed by washing the marked area of each coupon 3 times with PBS, then removing the remaining liquid from the marked area by vacuum aspiration. Each coupon was placed in a 50-ml centrifuge tube containing 9.9 ml of PBS and 30 glass beads (5 mm, Fisher Scientific, Norcross, GA) and agitated by a Vortex mixer (Fisher Scientific) for 2 min to disrupt bacteria in the adherent biofilm. The suspended bacteria were serially diluted (1:10) in 0.1 % peptone and plated in duplicate on TSA for enumeration of competitive microorganisms or total bacteria (if L. monocytogenes counts on MOX were greater than or equal to the bacterial counts on TSA) and MOX for L. monocytogenes. The plates were incubated for 48 h at about 37°C and competitive microorganism and L. monocytogenes counts were determined. Coupons inoculated with only 10^{2 6}-10^{4 6} L. monocytogenes served as positive controls, whereas coupons inoculated only with 10⁶⁰-10^{8 4} competitive microorganisms served as negative controls. Results reported were the average of duplicate determinations. Identification ofnisA and nisB competitive microorganisms: A polymerase chain reaction (PCR) method was used to identify competitive microorganisms that encode NisA and NisB. Bacterial DNA was extracted using a microbial genomic DNA isolation kit according to the protocol described by the manufacturer (Mo Bio Laboratories, Solana Beach, CA). The oligonucleotide sequences of the primers used for nisA were 5-CGGCTCTGATTAAATTCTGAAG and 5- CGGTTGAGCTTTAAATGAAC and for nisB were 5-

AGAGAAGTTATTTACGATCAAC and 5-ATCTGACAACAAATCTTTTTGT. PCR was performed with an Icycler 96 Well Reaction Module (Bio-Rad Laboratories, Hercules, CA) according to the procedure described by Olasupo, N. A., U. Schillinger, A. Narbad, H. Dodd, and W. H. Holzapfel, Occurrence of nisin Z production in Lactococcus lactis BFE 1500 isolated from wara, a traditional Nigerian cheese product. Int. J. Food Microbiol. 53:141-152 (1999) incorporated herein by reference. Results A total of 12 biofilms from floor drains of four different food processing facilities were screened for microorganisms inhibitory to L. monocytogenes. A total of 156 yeast and 257 bacterial isolates were obtained from the biofilms and assayed for antagonistic activity against E. monocytogenes. Twenty- four isolates, including 3 yeasts and 21 bacteria, were inhibitory to L. monocytogenes (0.5 to 3.5 mm zones of inhibition), with no bacteria and 3 yeasts identified by the spot-on-lawn assay and 21 bacteria and no yeast identified by the double-layer assay. All isolates antagonistic to L. monocytogenes were evaluated individually for their ability to inhibit growth or inactivate a 5-strain mixture of L. monocytogenes in TSB at about 37°C. Under these conditions, two yeast isolates were weakly antagonistic to L. monocytogenes, repressing growth of listeriae by 0.7 logio cfu ml compared to the positive control of L. monocytogenes only. In contrast, nine of the biologically pure bacterial isolates were strongly antagonistic to L. monocytogenes, with each providing a greater than 5 logio cfu ml differential at 24 h when compared with the L. monocytogenes -only positive control as shown in Table 1 below. Four of these bacterial isolates are deposited with the American Type Culture Collection, located at 10801 University Blvd, Manassas, VA 20110-2209, on October 15, 2002. In particular, the following microorganisms are deposited with the ATCC, Enterococcus durans 141-1 having ATCC accession number PTA-4758,

Enterococcus durans 152 having ATCC accession number PTA-4759, Lactococcus lactis C-l-92 having ATCC accession number PTA-4760, or Lactococcus lactis C-l- 152 having ATCC accession number PTA-4761.

Table 1. Inhibition at about 37°C of L. monocytogenes (LM) by competitive microorganism (CM) in tryptic soy broth

L. monocytogenes or competitive microorganism count (logio cfuml)

81, 24 h

Isolate No

LM LM CM LM LM CM LM LM CM

+ + only⁰ CM" only only CM only only CM only

Bacteria

C-2-I0I 30 30 57 67 64 74 94 90 84

C-l-152 30 28 63 64 53 91 98 78 92

C-2-188 35 27 65 64 67 65 91 93 77

C-I-92 33 32 60 63 <07^cl 95 93 07 93

143 32 29 61 65 17 91 88 <07 93

375-1 30 29 58 67 22 94 95 28 94

129 28 30 64 66 52 92 94 85 94

123 35 33 63 67 65 82 92 90 96

B-2-18 33 32 57 67 58 91 94 76 96

152 36 34 62 67 24 91 87 33 95

141 35 34 60 79 35 88 95 3 I 91

123 32 32 60 64 66 85 90 92 97

147 32 32 61 76 27 94 94 36 93

375-3 29 28 58 57 59 77 93 69 94

107 (tiny) 30 31 61 67 61 86 96 67 90

123 32 32 63 67 62 82 96 83 96

375-2 33 31 63 64 20 94 94 31 93

107 33 32 60 72 64 78 94 77 92

141 (2) 31 30 63 74 31 91 96 38 96

143 (2) 32 32 70 75 34 93 93 40 93

107 (2) 32 32 60 73 68 82 90 67 94

Yeast C-2-45 26 26 45 67 55 66 96 96 76

C-2- 187 27 27 44 57 53 69 99 92 78

C-3-53 29 27 56 70 56 72 100 93 78 ^a LM onIy=i monocytogenes count ^b LM+CM=Z, monocytogenes count ^CCM only=Competιtιve microorganism count ^d M inimum detection limit 07 logio cfu/ml

Twelve isolates were assayed under the same conditions, but at about 15°C. Three of the isolates were highly antagonistic to L. monocytogenes, with greater than a 4 logic L. monocytogenes differential at day 7 compared to L. monocytogenes-only positive control, and one isolate, C-l-92, was exceptionally bactericidal, with no detectable L. monocytogenes present (>8 logio L. monocytogenes /ml differential compared with positive control) at 7 and 14 days, see Table 2 below.

Table 2. Inhibition at about 15°C of L. monocytogenes (LM) by competitive microorganisms (CM) in tryptic soy broth

L monocvtnpp.nes or competitive microorganism count dog in cfu/ml) at dav

Isolate

No LM LM CM LM LM CM LM LM CM LM LM CM LM LM CM

Only" +CM^b only^c only +CM only only +CM only only +CM only only +CM only

141 34 34 62 68 54 88 98 29 96 97 84 96 90 91 84

141-2 34 34 62 73 27 96 97 28 96 98 72 98 90 76 98

B-2-18 35 33 67 72 63 96 98 72 99 94 80 102 96 80 102

152 34 34 62 72 60 91 98 41 94 97 73 94 91 86 94

143-2 35 34 55 74 72 88 98 47 95 96 85 97 88 81 96

147 35 34 63 75 26 94 99 24 96 97 74 97 93 85 97

375-2 36 33 64 78 23 95 99 30 98 99 66 95 87 77 99

129 35 32 55 66 55 98 103 51 98 96 69 93 90 86 69

C-l-92 34 33 64 80 17 99 102 10 98 92 <07^d 92 90 <07 78

375-1 34 34 63 65 62 91 97 30 97 93 38 94 91 72 98

C-l-152 35 34 63 79 71 94 99 80 95 97 82 93 90 95 94

143 36 34 64 72 70 80 97 35 95 83 41 93 85 76 95

' LM only=t monocytogenes count ^b LM+CM=i monocytogenes count

^CCM only=Competιtιve microorganism count ^d Minimum detection limit 07 logio cfu/ml

These same twelve isolates were assayed for antagonistic activity to L. monocytogenes in TSB at about 8°C. Six of isolates were highly inhibitory, with greater than a 4 logio L. monocytogenes Iml differential at 14 days compared to the L. monocytogenes only positive control, and one isolate, 152, was exceptionally antimicrobial, with a 6.3 logio L. monocytogenes Iml differential at 21 days, see Table 3 below.

Table 3. Inhibition at about 8°C of L. monocytogenes (LM) by competitive microorganisms (CM) in tryptic soy broth

L monocvtoeenes or competitive microoreanism count (lθ£|n cfu/miϊ

Isolate

No LM LM CM LM LM CM LM LM CM LM LM CM LM LM CM only* +CM^b only^c only +CM only only +CM only only +CM only only +CM only

Bacteria

141 33 33 61 40 40 64 89 44 93 98 52 95 98 64 94

141-2 34 33 63 37 38 63 85 50 92 97 53 94 98 76 95

B-2-18 33 35 67 42 42 70 89 74 91 98 90 90 93 87 94

152 33 32 62 42 40 66 90 27 91 99 29 93 98 35 94

143-2 32 31 64 37 35 64 80 60 83 94 64 89 95 80 91

147 35 35 64 37 38 62 85 73 92 94 92 94 95 89 95

375-2 33 32 63 42 35 64 93 32 91 98 55 92 98 75 95

129 33 31 52 35 38 63 93 69 89 98 69 92 98 75 92

C-l-92 35 34 63 37 35 60 91 57 83 98 53 88 99 51 88

375-1 35 35 63 39 39 64 95 46 91 97 47 91 98 65 93

C-l-152 32 33 64 40 40 64 89 56 94 97 67 93 98 79 94

143 32 26 61 37 35 70 95 52 84 98 69 92 97 79 94

Yeast

C-2-45 23 25 57 32 31 54 81 81 77 96 91 78 98 94 79

C-3-53 25 27 58 34 32 56 81 82 80 99 78 63 98 92 81

C-2- 187 22 23 47 27 28 44 85 73 51 97 93 77 98 97 65 ^α LM on\y=L monocytogenes count ^b LM+CM=I monocytogenes count ^CCM only=Competιtιve microorganism count

Nine isolates with antagonistic activity to L. monocytogenes at all three temperatures were assayed for their activity against L. monocytogenes at about 4°C. Three isolates were highly antagonistic, with greater than a 4 logio L. monocytogeneslml differential at 28 days compared to the positive control, and one isolate, 152, was exceptionally antimicrobial, with a 6 logio differential at 28 days, see Table 4 below.

Table 4. Inhibition at about 4°C of L. monocytogenes (LM) by competitive microorganisms (CM) in tryptic soy broth

L monocvtoeenes or competitive microorganism count (login cfu/ml)

0 time 7d 14d 21 d 28 d

Isolate

No LM LM CM LM LM CM LM LM CM LM LM CM LM LM CM only" +CM^b only^c only +CM only only +CM only only +CM only only +CM only

141-1 27 26 50 42 41 56 60 65 65 86 66 82 95 63 87

152 34 34 64 41 37 66 70 43 75 85 45 87 99 39 92

C-l-92 35 30 65 41 37 59 69 58 57 82 67 50 99 80 53

143-1 29 25 50 33 33 52 67 59 52 80 75 64 95 83 69

C-l-152 27 29 59 37 35 56 65 61 66 83 71 73 95 74 84

375-1 28 24 52 42 38 54 70 64 67 84 72 80 97 73 86

143-2 33 32 59 42 33 64 68 49 73 83 50 82 93 54 88

141-2 32 32 61 40 37 64 68 49 72 80 52 80 94 54 89

375-2 34 33 64 41 36 64 63 45 68 80 50 84 90 50 90

" LM on\y=L monocytogenes count ^b LM+CM=L monocytogenes count ^CCM only=Competιtιve microorganism count

As previously indicated, identification of the nine most antagonistic cultures revealed that six (isolates no. 141-1, 141-2, 143-2, 152, 375-1 and 375-2) were Enterococcus durans and 16S rRNA analysis indicated all are indistinguishable; two (isolates no. C-l-92 and C-l-152) were Lactococcus lactis subsp. lactis; and one (isolate no. 143-1) was Lactobacillus plantarum. L. lactis subsp. lactis C-l-92 encoded both nisA and nisB, but none of the other competitive microorganisms evaluated encoded either nisA or nisB .

The nine antagonistic bacterial isolates and two yeast isolates were evaluated at about 37°C at two different cell number combinations (highest level at 6.9 (for yeast) or 8.3-8.4 (for bacteria) logio competitive microorganisms/cm² and 4.6 logio L. monocytogeneslcm ; and lower level at 6.4-6.5 logio competitive microorganisms/cm and 2.9 logio L. monocytogeneslcm ) for their ability to control L. monocytogenes in biofilms on stainless steel coupons. Results of studies with the highest combination of microbial populations revealed a more than 6 logio L. monocytogeneslcm² (to an undetectable level by a direct plating method; <1.7 logic cfu/cm²) differential compared to the positive control for eight isolates at 37°C for 24 h and a 3 to 5 logic L. monocytogeneslcm² differential for one isolate, see Table 5 below. There was only a 0.2-0.9 logio L. monocytogeneslcm² differential for the two yeast isolates (see Table 5 below). Studies with a lower combination of microbial populations resulted in all nine competitive bacterial isolates providing a greater than a 6 logio L. monocytogeneslcm differential compared to the L. monocytogenes-only positive control, see Table 6 below.

Table 5. Inhibition at about 37°C of L. monocytogenes (LM) by competitive microorganisms (CM) in biofilms formed on stainless steel coupons

L monocvtozenes or conroetitive microorganism count (login cfu/cm² )

Trial No 1 Trial No 2

Isolate 0 time 24 h Otime 24h

No LM LM CM LM LM CM LM LM CM LM LM CM

Only" +CM^b only^c only +CM only only +CM only only +CM only

Bacteria

141-1 46 46 83 78 <17^d 75 46 46 83 78 <17^d 72

152 46 46 84 78 <I 7 76 46 46 83 78 <17 77

C-l-92 46 46 84 78 <17 66 46 46 84 78 <17 73

143-1 46 46 83 78 27 70 46 46 83 78 42 71

C-l-152 46 46 84 78 <17 71 46 46 84 78 <17 74

375-1 46 46 83 78 <17 73 46 46 83 78 <17 77

143-2 46 46 84 78 <17 69 46 46 84 78 <17 74

141-2 46 46 84 78 <17 74 46 46 84 78 <17 73

375-2 46 46 84 78 <17 74 46 46 84 78 <17 75

Yeast

C-2-45 46 46 69 78 73 50 46 46 69 78 74 72

C-3-53 46 46 69 78 76 73 46 46 69 78 69 63 ^a LM only= monocytogenes count ^b LM+CM=I monocytogenes count ^c CM only=Competιtιve microorganism count ^d Minimum detection limit I 7 logio cfu/cm²

Table 6. Inhibition at about 37°C of L. monocytogenes (LM) by competitive microorganism (CM) in biofilms formed on stainless steel coupons

L monocvtosenes or competitive microorganism count dθg,n' cfu/cm²)

0 time 24 h

Isolate

No LM LM CM LM LM CM only" +CM^b only^c only +CM only

141-1 29 29 65 77 <17^d 79

152 29 29 66 77 <17 78

143-1 29 29 64 77 <17 73

C-l-152 29 29 64 77 <17 78

375-1 29 29 64 77 <I 7 80

143-2 29 29 65 77 <17 80

141-2 29 29 65 77 <17 78

375-2 29 29 66 77 <17 79

C-l-92 26 26 64 71 <17 72

⁸ LM only=, monocytogenes count ^b LM+CM=Z, monocytogenes count ^c CM only=Co petιtιve microorganism count ^d Minimum detection limit 17 log_lu cfu/cm²

Six competitive bacterial isolates were evaluated under similar conditions (initial cell populations of 3.7 logio L. monocytogeneslcm and 6.3-6.5 logio competitive microorganisms/cm²) at about 15°C, of which two isolates, L. lactis subsp. lactis C-l-92 and C-l-152, controlled L. monocytogenes to an undetectable level (>7.8 logio L. monocytogeneslcm² differential) through 28 days, which was the end of the study, see Table 7 below.

Table 7. Inhibition at about 15°C of L. monocytogenes (LM) by competitive microorganisms (CM) in biofilms formed on stainless steel coupons

L monocytogenes or competitive microorganism count (logio cfu/cm²)

Isolate

No LM LM CM LM LM CM LM LM CM LM LM CM only" +CM^b only'' only +CM only only +CM only only +CM only

141-1 37 37 65 85 <17^d 81 92 53 82 95 66 88

152 37 37 63 85 17 79 92 43 87 95 65 84

375-1 37 37 64 85 27 77 92 53 87 95 66 90

C-l-92 37 37 66 85 <17 67 92 <17 86 95 <17 85

143-1 37 37 65 85 47 77 92 26 78 95 64 90

C-l-152 37 37 63 85 <17 75 92 <17 67 95 <17 83

^* LM only=i monocytogenes count ^b LM+CM=Z monocytogenes count ^c CM only=Competιtιve microorganism count ^d Minimum detection limit 17 logio cfu/cm²

The same six competitive bacterial isolates (at initial populations of 6.0-6.7 logio cfu/cm²) were evaluated in combination with an initial population of 3.7 logio L. monocytogeneslcm² on stainless steel coupons at about 8°C. Four isolates, E durans 141-1, 152 and 375-1 and c. Lactis subsp. lactis C-l-92, were highly inhibitory to L. monocytogenes, with no listeriae detected (>6.8 logio cfu/cm² differential) at 21 and 28 days, see Table 8 below.

Table 8. Inhibition at about 8°C of L. monocytogenes (LM) by competitive microorganisms (CM) in biofilms formed on stainless steel coupons

L monocytogenes or competitive microorganism count (logio cfu/cnr ^:)

0 time 7d 14 d 21 d 28 d

Isolate

No LM" LM^b CM^C LM LM CM LM LM CM LM LM CM LM LM CM only +CM only only +CM only only +CM only only +CM only only +CM only

141-1 37 37 60 68 37 74 85 33 84 85 <17^d 80 88 <17 77

152 37 37 64 68 39 75 85 35 82 85 <17 76 88 <17 78

375-1 37 37 65 68 37 76 85 30 85 85 <17 78 88 <17 78

C-l-92 37 37 67 68 <17 47 85 <17 65 85 <17 54 88 <17 47

143-1 37 37 65 68 39 72 85 44 81 85 59 75 88 33 77

C-l-152 37 37 64 68 31 74 85 45 81 85 49 78 88 64 77 ^* LM only=I monocytogenes count ^b LM+CM=Z, monocytogenes count ^c CM only=Competιtιve microorganism count .7 logio cfu/cm²

Five and six competitive bacterial isolates (at initial populations of 6.3- 6.6 logic cfu/cm²) were evaluated in combination with two initial populations of L. monocytogenes 2.6 and 4.3 logio L. monocytogenes /cm on stainless coupons held at about 4°C. One competitive isolate Lc. Lactis subsp. lactis C-l-92 was especially effective in controlling L. monocytogenes, with no detectable L. monocytogenes (differentials of >5.1 and >7.0 logio L. monocytogeneslcm compared to positive L. monocytogenes-only control) at 35 days when either initial population of L. monocytogenes was used (see Tables 9 and 10 below). Interestingly, Lc. lactis subsp. lactis C-l-92 did not grow but rather declined in cell numbers (3.6-3.8 logio cfu/cm² reduction) during 35 days at about 4°C, whereas cell populations of all five other competitive microorganisms increased by 1 to 2 logio cfu/cm under the same conditions. The other five competitive microorganisms also were inhibitory to L. monocytogenes through 35 days at about 4°C, with differentials of L. monocytogenes cell populations in biofilms compared to L. monocytogenes-only positive controls ranging from 2.0 to >7.0 logio cfu/cm².

Table 9. Inhibition at about 4°C of L. monocytogenes (LM) by competitive microorganisms (CM) in biofilms formed on stainless steel coupons

L monocytogenes or competitive microorganism count (logκ i cfucm²)

Isolate

141-1 26 26 64 37 22 64 45 23 70 60 23 76 68 32 79

152 26 26 66 37 <17 66 45 <17 73 60 27 78 68 25 78

375-1 26 26 65 37 22 62 45 22 70 60 <17 73 68 24 78

C-l-92 26 26 63 37 <17 38 45 <17 39 60 <17 35 68 <17 25

143-1 26 26 65 37 <17 59 45 22 65 60 <17 69 68 30 75

C-l-152 26 26 65 37 20 61 45 <17 64 60 25 72 68 34 74 ' LM only=-- monocytogenes count ^b LM+CM=.- monocytogenes count ^c CM only=Competιtιve microorganism count ^d Minimum detection limit 17 logio cfu/cm²

Table 10. Inhibition at about 4°C of L. monocytogenes (LM) by competitive microorganisms (CM) in biofilms formed on stainless steel coupons

L monocytogenes or competitive microorganism count (logi io cfu/cm²)

Isolate

No LM LM CM LM LM CM LM LM CM LM LM CM LM LM CM only" +CM^b only only +CM only only +CM only only +CM only only +CM only

141-1 43 43 64 36 17 61 51 32 69 66 26 73 87 25 80

152 43 43 65 36 30 64 51 <17^d 69 66 <17 76 87 <17 83

C-l-92 43 43 65 36 <17 43 51 29 39 66 20 35 87 <17 29

143-1 43 43 65 36 30 61 51 17 66 66 45 70 87 48 74

C-l-152 43 43 66 36 <17 60 51 31 68 66 17 71 87 67 70

³ LM only=i monocytogenes count ^b LM+CM=i monocytogenes count ^c CM only=Competιtιve microorganism count ^d Minimum detection limit 17 logio cfu/cm²

DNA finge rinting of the probiotic bacteria As shown in FIG. 1, four probiotic isolates deposited with the ATCC, i.e., C-l-92 [L. lactis subsp. lactis] (lane 2), C-l-152 [L. lactis subsp. lactis] (lane 3), 141-1 [E. durans] (lane 4) and 152 [E durans] (lane 5), were analyzed for their DNA fingerprinting by pulsed field-gel electrophoresis. Strains were grown in Brain Heart Infusion agar (BHIA) at 37°C for 16-18 h individually. Bacteria were collected by a cotton swab and suspended in 3 ml of TΕ (10 mM Tris:l mM ΕDTA, pH 8.0). Bacterial concentration was adjusted to an OD reading of 1.0 at 600 nm. 240 μl of each bacterial suspension was transferred to a 1.5 ml tube and 60 μl of lysozyme solution was added (10 mg/ml). The tubes were incubated at 37°C for 10 min and 1.2% SeaKem Gold agarose containing proteinase K (20 mg/ml) was added and mixed with the cell suspension. The melted mixture was transferred to a mold and incubated at room temperature for 15 min to solidify. Plugs were then treated for 2 h at 54°C in lysis buffer. Following washing, the plugs were digested with 4 μl (40 U/μl) Apal (Roche Diagnostics Corp., Indianapolis, IN) at 30°C for 16 h and electrophoresed on 1.0% agarose gel in 0.5X Tris-borate-ΕDTA buffer (0.445 M Tris, 0.0125 M ΕDTA, and 0.445 M boric acid) with a contour-clamped homogeneous electric field device (CHEF MAPPER, Bio-Rad, Hercule, CA). After electrophoresis for 20 h at 6 V/cm with pulse times of 4 to 40.01 s at 14°C, the gels were stained with ethidium bromide, and the bands were visualized and photographed with UV transillumination (See Figure 1).

As discussed above, L. monocytogenes can attach through biofilms to various types of surfaces including stainless steel, glass, and rubber. Biofilms, which entrap and protect L. monocytogenes from disinfectants, have been documented in meat and dairy processing plant environments. Furthermore, it is well documented that strains of L. monocytogenes can become well established in a food processing environment and remain members of the resident microbial flora for many years. As indicated above, the present disclosure describes the isolation and characterization of a number of microorganisms that (i) thrive in combination with . monocytogenes within a biofilm at a wide range of temperatures that occur in food processing facilities (especially under refrigeration conditions) and (ii) compete to inhibit listeriae growth. In particular, initial screening identified 24 promising candidates with anti-listerial activity. Further competitive testing between the candidate microorganisms and L. monocytogenes in broth and in biofilms at different temperatures identified nine bacterial isolates that effectively reduced, controlled, or eliminated detectable E. monocytogenes depending on environmental conditions. One strain in particular, Lc. lactis subsp. lactis C-l-92, was especially effective in controlling L. monocytogenes when in biofilms for extended periods of time, including at about 4°C. This strain uniquely produced nisin A and nisin B, which are inhibitory to L. monocytogenes . Two other isolates, Entercoccus durans 141-1 and 152, also were very effective in controlling L. monocytogenes in biofilms. These isolates (E. durans 141-1 and 152) grow at refrigeration temperatures and have antagonistic activity to L. monocytogenes under refrigeration conditions. These strains are useful in food processing locations that require a low temperature environment such as for processing ready-to-eat foods.

Application of probiotic bacteria in ready-to-eat meat for reduction of L. monocytogenes

Three probiotic bacteria, including C-l-92 (Lactococcus lactis subsp. lactis), C-l-152 (Lactococcus lactis subsp. lactis), and 143 (Lactobacillus plantarum) were evaluated for their effect to control L. monocytogenes in ready-to-eat meat at a population of 10⁶ cfu/cm². A 5-strain mixture of L. monocytogenes (LMl 13, LM51779, LMl 12, LM9666 and LM101) including serotype l/2a, l/2b and 4b was used as the inoculum. Frankfurters purchased from a local retail store were tested.

Frankfurters were immersed first in a suspension of probiotic bacteria (10⁶ cfu/ml) for 30 seconds and dried in a laminar flow hood for 20 minutes, and then immersed in the suspension of L. monocytogenes (10 cfu/ml) according to the same procedure.

Two storage temperatures, 4°C and 8°C, were evaluated. Following inoculation, each frankfurter was individually sealed in a Ziploc bag, held at 4 and 8°C, and sampled at weekly intervals for the shelf life of the product as determined by the use of the date printed on the label. Samples were placed in a Whirl-Pak bag containing 10 ml of 0.1% peptone. The bags were agitated on a shaker at 200 rpm for 2 min with intermittent massaging by hands. Sample suspensions were serially diluted (1 :10) in 0.1% peptone and a volume of 0.1 ml from each dilution tube was inoculated in duplicate onto modified Oxford agar (MOX) and tryptic soy agar (TSA) plates. The plates were incubated for 24 h at 37°C. Typical colonies (black) on MOX were enumerated as L. monocytogenes.

Results indicated that at 4°C the treatment by probiotic bacteria reduced the population of L. monocytogenes from 0.7 to 0.8 logio cfu/cm² (see Table 11 below) and at 8°C either kept the population at the same level or reduced the population oiL. monocytogenes from 0.1 to 0.3 logio cfu/cm² (see Table 12 below) depending on different combinations at the end of the experiment when compared with the population at the beginning.

Table 11. L. monocytogenes counts on frankfurters with and without combinations of probiotic bacteria held at 4°C

Treatment Microbial count (logio cfu/cm ) at week:

0 1 2 3 4 5

L. M. only 3.8 3.9 4.0 4.2 4.5 4.3 4.2

C-l-92 & 143 + L. M.^a 3.5 3.1 2.7 2.8 2.7 3.2 2.7

C-l-92 & C-l-152 + L. M. 3.6 2.8 4.2 3.1 3.1 3.0 2.9

143 & C-l-152 + L. M. 3.6 3.2 3.0 3.2 3.2 3.0 2.9

C-l-92 & 143 & C-1-152+ L. M. 3.8 3.0 2.7 3.0 3.1 3.0 3.0

L. M. = Listeria monocytogenes.

Table 12. L. monocytogenes counts on frankfurters with and without combinations of probiotic bacteria held at 8°C

Treatment Microbial count (logio cfu/cm ) at week: 0 1 2 3 4 5

L. M^a only 3.8 4.5 4.4 4.7 4.8 6.9 C-l-92 & 143 + L. M. 3.5 4.2 2.8 4.0 3.5 3.8 C-l-92 & C-l-152 + L. M. 3.6 3.7 3.1 3.6 3.8 3.7 143 & C-l-152 + L. M. 3.6 3.2 2.8 3.1 4.4 3.7

C-l-92 & 143 & C-l-152 + L. M. 3.8 4.2 2.9 3.2 3.5 3.8

L. M. = Listeria monocytogenes.

Application of probiotic bacteria in floor drains for reduction/elimination of L. monocytogenes in a poultry processing plant Two probiotic bacteria, C-l-92 (Lactococcus lactis subsp. lactis) and 152 (Enterococcus durans) were selected as the treatment strains and a poultry processing plant was selected for the field trial. Five floor drains in the plant at temperatures ranging from 0.3 to 29°C were selected for microbiological observation. Before the treatment these floor drains were evaluated every two weeks for five times plus one time after sanitation in the plant for the baseline determination of L. monocytogenes and aerobic bacterial count. Whirl-Pak "speci- sponge" bags (Nasco, Fort Atkinson, WI) were used for collection of the samples. Sterilized gloves were worn during the collection and processing of the samples so as to prevent cross-contamination. Samples from five locations in and around each floor drain were collected. These locations included (i) fluid from the drain, (ii) the right side of the drain, (iii) the left side of the drain, (iv) inside of the drain (3.8 x 7.6 cm), and (v) the surface of the floor within 1 foot of the drain. The samples were kept at 5°C and transported to the laboratory within 12 h and assayed within 72 h. A 10 ml volume of brain heart infusion (Becton Dickinson Microbiological Systems, Sparks, MD) was added into each bag. The bag was individually pummeled in a stomacher for 1 min at about 130 RPM. The samples were then serially (1 : 10) diluted in 0.1% peptone to 10^" cfu/ml. A 0.1 ml volume from each dilution tube was plated on the surface of Modified Oxford medium (MOX, Oxford Ltd., Basingstoke, Hampshire, UK) and plate count agar (PCA, Becton Dickinson) in duplicate. For counting the bacterial number the MOX plates were incubated at 37°C for 48 h, and PCA plates were incubated at 30°C for 48 h. Typical L. monocytogenes colonies (black) were counted as presumptive L. monocytogenes. Up to five colonies from the highest dilution were randomly picked for confirmation of L. monocytogenes by a latex precipitation assay (Oxoid). A population of 10⁷ probiotic bacteria ml in a one-time application of foam formula were used to treat the floor drain after the sanitation process was finished daily for four times in a first week (Monday through Thursday). Then the treatment was performed twice a week (Tuesday and Thursday) for the next three weeks. Samples were collected once a week for the five weeks after the treatment was started. Bacteria were individually grown in 300 ml LactobaciUi MRS broth (MRS, Becton Dickinson) at 32°C for 24 h. The bacterial broth was precipitated at 10,000 x g for 20 min at 4°C. The bacteria were then resuspended in 25 ml MRS broth at about 10⁹ cfu/ml. A volume of 1 ml was serially (1:10) diluted in 0.1% peptone to 10^" cfu/ml. A quantity of 0.1 ml from dilution tubes (10^" to 10^" ) was plated on MRS agar and tryptic soy agar in duplicate for the actual counting of the bacterial number. After arriving at the processing plant, the two isolates (25 ml each), 20 ml of Dy-gest I, 20 ml of Dy-gest II, plus 1 gallon of water were added to the tank foamer (Ecolab, St. Paul, MN). After connecting the air supply to the tank foamer, the foam was applied in each floor drain. Results demonstrated that the average number of L. monocytogenes in floor drains sampled at six different times (at two week intervals) in this poultry processing plant before the treatment by probiotic bacteria ranged from 3.3 to 4.0 logio cfu/cm for drain #1, from 4.2 to 5.4 logio cfu/cm for drain #3, from 3.4 to 4.5 logio cfu/cm for drain #4, from 3.2 to 4.2 logio cfu/cm for drain #6, and from 6.1 to 8.2 logio cfu/cm² for drain #8 (see Table 13 below). Table 13. The mean and standard deviation of L. monocytogenes count (logio cfu/cm²) from drain samples located at different temperatures and collected at six different times

Floor drains Location

#1 #3 #4 #6 #8

Drain 3.3±0.8 4.2±1.2 4.2+1.1 4.2+1.2 7.6+1.1

Right side 3.9±0.7 5.0±0.9 4.3+0.8 3.5+1.9 7.6+0.8

Left side 4.0±1.0 4.4+1.3 3.4+1.1 3.2+1.5 8.2+0.5 Inside 3.5±0.8 5.4+1.3 4.5+1.1 3.6+1.3 7.8+0.9

Floor (1 foot) 3.6±0.9 5.3+0.6 4.3+1.4 3.3+1.3 6.1+1.9

Temperature 21.8±2.9 18.6+2.3 4.7+1.3 5+1.2 28.6+0.9

After the treatment by these two probiotic bacteria, the average number of L. monocytogenes ranged from 1.8 to 2.0 logio cfu/cm² for drain #1, 1.9 to 2.8 logio cfu/cm² for drain #3, 1.7 to 2.1 logio cfu/cm² for drain #4, 1.9 to 2.1 logio cfu cm² for drain #6 and 3.5 to 4.0 logio cfu/cm² for drain #8 (see Table 14 below).

Table 14. The mean and standard deviation of L. monocytogenes count (log_]0 cfu/cm ) from drain samples collected after probiotic treatment at five different times

Floor drains

Location

#1 #3 #4 #6 #8

Drain 1.8+0.4 1.9+0.3 1.9+0.3 2.1+0.4 4.0+2.0

Right side 2.0+0.5 2.1+0.8 1.7+0.1 1.9+0.7 3.9+2.0 Left side 2.0+0.6 2.3+0.6 2.1+1.2 1.9+0.4 3.9+2.2

Inside 2.0+0.5 2.8+1.4 1.7+0.1 2.0+0.7 3.7+1.8

Floor (1 foot) 1.9+0.5 2.1+0.6 2.1+0.9 1.9+0.6 3.5+0.8

Temperature 11.7+2.2 11.5+2.2 0.9+1.0 2.5+0.9 23.5+1.5

Compared with the L. monocytogenes counts before the treatment, the average population of L. monocytogenes after the probiotic treatment was reduced 1.7 logio cfu/cm² for drain #1, 2.6 logio cfu/cm² for drain #3, 2.2 logio cfu/cm² for drain #4, 1.6 logio cfu/cm² for drain #6 and 3.7 logio cfu/cm² for drain #8 • These results demonstrated that the application of these two probiotic bacteria significantly reduced the population of L. monocytogenes in the floor drains located at various temperatures in this poultry processing plant.

Accordingly, in light of the above discussion, it should be appreciated that compositions for, and methods of, treating one or more surfaces of a food processing facility are provided. For example, one or more surfaces in a facility that processes substances consumed for their nutritive and/or recreational value (e.g., alcoholic beverages) can be treated by the methods described herein. It should be understood that any surface of a food processing facility that serves, or potentially could serve, as a point of contamination for the processing plant environment and/or food products can be treated by the methods described herein. For example, these surfaces include, but are not limited to, surfaces included in the plumbing system of a food processing facility (e.g., drain surfaces), surfaces of food processing equipment, and structural surfaces of a food processing facility. In addition, it should be appreciated that compositions for, and methods of, treating a food product (e.g., a food product can be a substance consumed or eaten for its nutritive and/or recreational value) are provided. For example, a method of treating a food product of the present invention can include placing the food product in contact with one or more probiotic bacteria (e.g., competitive exclusion microorganisms) described herein. It should be understood that any portion of a food product that serves, or potentially could serve, as a point of contamination for the food product can be treated by the methods described herein. The methods described herein inhibit the growth of undesirable microorganisms on such surfaces of food processing facilities and on food products. For example, inhibiting the growth of undesirable microorganisms (e.g., L. monocytogenes) includes, but is not limited to, the killing of, decreasing or stopping the growth of, exclusion of, or any other mechanism by which growth of undesirable microorganisms is controlled. One illustrative method contemplated for treating a surface of a food processing facility or food product which has, or could have, a first population of microorganisms disposed thereon includes inoculating the surface with a composition that includes a second population of microorganisms. In one embodiment, the second population of microorganisms can be disposed in a biofilm. For example, an illustrative method includes disposing a biofilm containing a second population of microorganisms onto a surface, where the second population of microorganisms is inhibitory or bactericidal to the first population so that when the second population is placed in the presence of the first population the second populations inhibits the growth of the first population of microorganisms. Accordingly, it should be appreciated that a goal of the aforementioned inoculation is to contact a surface with a sufficient quantity of biofilm so that a second population of microorganisms contained in the biofilm can colonize the surface and inhibit the growth of a first population of microorganisms. It is also contemplated that, initially, the second population of microorganisms is not contained in a biofilm, but is capable of forming a biofilm after being placed on the surface. Therefore, this type of microorganism (i.e., the second population of microorganism) would initially not be contained in a biofilm when placed on the surface, but would thereafter form one to be contained in. It should be appreciated that having a probiotic microorganism, such as a competitive microorganism, in a biofilm facilitates the competitive microorganism's ability to inhibit the growth of undesirable microorganisms since the biofilm enables the competitive microorganism to adhere to surfaces for an extended period of time and not be washed away or significantly damaged by routine sanitation procedures. However, it should be appreciated that a biofilm is not absolutely required, and a goal of the aforementioned inoculation can be to contact a surface with a sufficient quantity of the second microorganism so that the second microorganism can colonize the surface and inhibit the growth of the first of microorganism in the absence of a biofilm. The above described methods and techniques discussed in reference to a surface in a food processing facility are also applicable to inhibiting the growth of undesirable microorganisms on the surfaces of food products.

As indicated above, a non- limiting example of a first population of microorganisms is one that includes L. monocytogenes, while examples of second populations of microorganisms include, but are not limited to, those competitive microorganisms discussed above which possess antagonistic activity to L. monocytogenes. In particular, with respect to controlling the growth of L. monocytogenes, the second population of microorganisms can include Enterococcus durans 141-1 having ATCC accession number PTA-4758, Enterococcus durans 152 having ATCC accession number PTA-4759, Lactococcus lactis C-l-92 having ATCC accession number PTA-4760, or Lactococcus lactis C-l-152 having ATCC accession number PTA-4761.

In addition to the subject matter discussed above, a kit for inhibiting the growth of or killing a first microorganism population disposed on a surface is contemplated. An illustrative example of such a kit can include a container containing a biofilm with a second microorganism population disposed in the biofilm. The second microorganism population is inhibitory to the first microorganism population so that when the surface is inoculated with the biofilm (i.e., the second microorganism population is placed in the presence of said first microorganism population) the second microorganism population inhibits the growth of the first population of microorganisms. In an alternative embodiment, the kit can include one container with a biofilm disposed therein and another container with the second microorganism population disposed therein. The second microorganism population can be mixed into the biofilm just prior to inoculating the surface, or the biofilm can be disposed onto the surface first, followed by the disposing of the second microorganism population into the biofilm. In another alternative, the kit can include, as discussed above, a second microorganism population capable of forming a biofilm after being disposed on the surface. Accordingly, this type of second microorganism population initially is not contained in a biofilm when place on the surface, but thereafter forms one to be contained in. As indicated above, a non-limiting example of a first population of microorganisms is one that includes L. monocytogenes, while examples of second populations of microorganisms which can be utilized in the kit include, but are not limited to, those competitive microorganisms discussed above which possess antagonistic activity to L. monocytogenes.

It should also be appreciated that the present disclosure also provides a method of selecting a population of inhibitory bacteria. An illustrative example of one such method includes (a) isolating naturally-occurring bacteria populations from a food processing facility, (b) culturing the isolated naturally-occurring bacteria populations; and (c) testing each isolated naturally-occurring bacteria population for the ability to inhibit the growth of a microorganism, where the isolated naturally- occurring bacteria populations having the ability to inhibit the growth of the microorganism are identified as a population of inhibitory bacteria. As indicated herein, one exemplary microorganism the aforementioned selecting method can be utilized for is L. monocytogenes.

While the invention has been illustrated and described in detail in the foregoing description, such an illustration and description is to be considered exemplary and not restrictive in character, it being understood that only the illustrative embodiments have been shown and described and that all changes and modifications within the spirit of the invention are desired to be protected.

There are a plurality of advantages of the present invention arising from the various features of the invention described herein. It will be noted that alternative embodiments of the present invention may not include all of the features described, but yet still benefit from at least some of the advantages of such features.

Claims

CLALMS:

1. A method of treating a surface of a food processing facility, said surface having a first population of microorganisms disposed thereon, comprising:

(a) disposing (i) a biofilm containing a second population of microorganisms and/or (ii) a second population of microorganisms capable of forming a biofilm onto the surface of the food processing facility; and

(b) inhibiting the growth of said first population of microorganisms on said surface of said food processing facility with said second population of microorganisms.

2. The method of claim 1, wherein: said first population of said microorganisms includes Listeria monocytogenes.

3. The method of claim 2, wherein: said second population of microorganisms includes bacteria from the genus Enterococcus.

4. The method of claim 3, wherein: said Enterococcus bacteria includes Enterococcus durans.

5. The method of claim 2, wherein: said second population of microorganisms includes bacteria from the genus Lactococcus.

6. The method of claim 5, wherein: said Lactococcus bacteria includes Lactococcus lactis.

7. The method of claim 3, wherein: said second population microorganisms includes bacteria from the genus Lactobacillus.

8. The method of claim 7, wherein: said Lactobacillus bacteria includes Lactobacillus plantarum.

9. A method of inhibiting the growth of Listeria monocytogenes on a surface of a food processing facility, comprising: (a) inoculating said surface of said food processing facility with (i) a biofilm containing bacteria and/or (ii) bacteria capable of forming a biofilm on said surface of said food processing facility; and

(b) nhibiting the growth of said Listeria monocytogenes on said surface of said food processing facility with said bacteria.

10. The method of claim 9, wherein: said bacteria includes Enterococcus durans.

11. The method of claim 9, wherein: said bacteria includes Lactococcus lactis.

12. The method of claim 9, wherein: said bacteria includes Lactobacillus plantarum.

13. The method of claim 9, wherein:

(b) includes inhibiting the growth of said Listeria monocytogenes on said surface of ≤aid food processing facility with said bacteria contained in said biofilm at a temperature ranging from about 4°C to about 37°C.

14. A method of inhibiting the growth of Listeria monocytogenes on a surface of a food processing facility, comprising:

(a) inoculating said surface of said food processing facility with a microorganism selected from the group consisting of bacteria from the genus Enterococcus and bacteria from the genus Lactococcus ; and

(b) inhibiting the growth of said Listeria monocytogenes on said surface of said food processing facility with said bacteria.

15. A method of inhibiting the growth of Listeria monocytogenes on a surface of a food processing facility, comprising: (a) inoculating said surface of said food processing facility with (i) bacteria contained in a biofilm and/or (ii) bacteria capable of forming a biofilm, wherein said bacteria are selected from the group consisting of Enterococcus durans, Lactococcus lactis, and Lactobacillus plantarum; and

16. The method of claim 15 , wherein : (b) includes inhibiting the growth of said Listeria monocytogenes on said surface of said food processing facility with said bacteria contained in said biofilm at a temperature ranging from about 4°C to about 37°C.

17. A kit for inhibiting the growth of a first microorganism population disposed on a surface, comprising: a biofilm; and a second microorganism population disposed in said biofilm, wherein said second microorganism population is inhibitory to said first microorganism population when said second microorganism population is placed in the presence of said first microorganism population.

18. The kit of claim 17, wherein: said first microorganism population includes Listeria monocytogenes, and said second microorganism population includes Enterococcus durans.

19. The kit of claim 17, wherein: said first microorganism population includes Listeria monocytogenes, and said second microorganism population includes Lactococcus lactis.

20. The kit of claim 17, wherein: said first microorganism population includes Listeria monocytogenes, and said second microorganism population includes Lactobacillus plantarum.

21. An inoculant composition, comprising: a biofilm having disposed therein at least one of the following

Enterococcus durans having ATCC accession number PTA-4758, Enterococcus durans having ATCC accession number PTA-4759, Lactococcus lactis having ATCC accession number PTA-4760, Lactococcus lactis having ATCC accession number PTA-4761.

22. A biologically pure culture of bacteria which includes at least one of the following Enterococcus durans having ATCC accession number PTA- 4758, Enterococcus durans having ATCC accession number PTA-4759, Lactococcus lactis having ATCC accession number PTA-4760, Lactococcus lactis having ATCC accession number PTA-4761 and mixtures thereof disposed in a biofilm.

23. A kit for inhibiting the growth of a first microorganism population disposed on a surface, comprising: a biofilm; and a second microorganism population for disposing in said biofilm, wherein said second microorganism population is inhibitory to said first microorganism population when said second microorganism population is placed in the presence of said first microorganism population.

24. The kit of claim 23, wherein: said first microorganism population includes Listeria monocytogenes, and said second microorganism population includes Enterococcus durans.

25. The kit of claim 23, wherein: said first microorganism population includes Listeria monocytogenes, and said second microorganism population includes Lactococcus lactis.

26. The kit of claim 23, wherein: said first microorganism population includes Listeria monocytogenes, and said second microorganism population includes Lactobacillus plantarum.

27. A method for selecting bacteria which inhibit the growth of Listeria monocytogenes, comprising: (a) isolating naturally-occurring bacteria from a food processing facility;

(b) culturing said isolated naturally-occurring bacteria; and

(c) testing said isolated naturally-occurring bacteria for the ability to inhibit the growth of Listeria monocytogenes.

28. The method of claim 27, wherein:

(a)includes isolating said naturally-occurring bacteria from a drain of said food processing facility.

29. A method of selecting inhibitory bacteria, comprising:

(a) isolating naturally occurring bacteria populations from a food processing facility;

(b) culturing said isolated naturally occurring bacteria populations; and

(c) testing each isolated naturally-occurring bacteria population for the ability to inhibit the growth of a microorganism, wherein isolated naturally- occurring bacteria populations having the ability to inhibit the growth of said microorganism are identified as a population of inhibitory bacteria.

30. A culture of microorganisms, comprising Enterococcus durans having ATCC accession number PTA-4758.

31. A culture of microorganisms, comprising Enterococcus durans having ATCC accession number PTA-4759.

32. A culture of microorganisms, comprising Lactococcus lactis having ATCC accession number PTA-4760.

33. A culture of microorganisms, comprising Lactococcus lactis having ATCC accession number PTA-4761.

34. A method of treating a food product, said food product having a first population of microorganisms disposed thereon, comprising: (a) disposing a second population of microorganisms onto said surface of said food product; and

(b) inhibiting the growth of said first population of microorganisms on said food product with said second population of microorganisms.

35. The method of claim 34, wherein said second population microorganisms includes at least one of the following Enterococcus durans having ATCC accession number PTA-4758, Enterococcus durans having ATCC accession number PTA-4759, Lactococcus lactis having ATCC accession number PTA-4760, Lactococcus lactis having ATCC accession number PTA-4761.