WO2004044210A2 - Materials and methods for the efficient production of acetate and other products - Google Patents

Materials and methods for the efficient production of acetate and other products Download PDF

Info

Publication number
WO2004044210A2
WO2004044210A2 PCT/US2003/035878 US0335878W WO2004044210A2 WO 2004044210 A2 WO2004044210 A2 WO 2004044210A2 US 0335878 W US0335878 W US 0335878W WO 2004044210 A2 WO2004044210 A2 WO 2004044210A2
Authority
WO
WIPO (PCT)
Prior art keywords
acetate
production
glucose
frt
pyruvate
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2003/035878
Other languages
French (fr)
Other versions
WO2004044210A3 (en
Inventor
Thomas B. Causey
Lonnie O'neal Ingram
Shengde Zhou
Keelnathan T. Shanmugan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Florida
Original Assignee
University of Florida
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Florida filed Critical University of Florida
Priority to AU2003287625A priority Critical patent/AU2003287625A1/en
Publication of WO2004044210A2 publication Critical patent/WO2004044210A2/en
Anticipated expiration legal-status Critical
Publication of WO2004044210A3 publication Critical patent/WO2004044210A3/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/54—Acetic acid
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the subject invention was made with government support under research projects supported by USDA/NRI, Grant No. 2001-35504-10669; USDA/IFAS, Grant No. 00- 52104-9704; and USDOE Grant No. FG02-96ER20222. The government has certain rights in this invention.
  • Acetic acid a widely used specialty chemical in the food industry, has recently emerged as a potential bulk chemical for the production of plastics and solvents. Acetic acid has been produced using microbial systems; however, the production of acetic acid in microbial systems competes with the production of CO 2 and cell mass. Thus, while efficient acetate-producing microbial systems are important for industrial uses, the systems must have an increased output of acetate with a decreased input of expensive microbial nutrients.
  • carbohydrates can be anaerobically metabolized to acetic acid at substantially higher yields (3 acetates per glucose) by Clostridia that contain the Ljungdahl-Wood pathway for acetogenesis (Berraud, C, 2000 "Production of highly concentrated vinegar in fed-batch culture” Biotechnol. Lett. 22:451-454; Ljungdahl, L. G., 1986 "The autotrophic pathway of acetate synthesis in acetogenic bacteria” Ann. Rev. Microbiol. 40:415-450).
  • Clostridium thermoaceticum containing the Ljungdahl-Wood pathway produces high yields of acetic acid (Cheryan, M., S.
  • Dekkera/Brettanomyces yeasts World J. Microbiol. Biotechnol 18:271-275 identified yeast strains (Dekkera and Brettanomyces) that produce acetic acid as a primary product from glucose for potential use in acetic acid production. All three of these current microbial acetic acid production systems require complex nutrients, which increase the cost of materials, acetate purification, and waste disposal. Escherichia coli is widely used as a biocatalyst for high value products such as recombinant proteins (Akesson, M., P. Hagander, and J. P. Axelsson, 2001 "Avoiding acetate accumulation in Escherichia coli cultures using feedback control of glucose feeding" Biotechnol. Bioeng.
  • Escherichia coli generate acetyl ⁇ CoA during fermentative and oxidative metabolism, which the cell then uses to produce small amounts of acetate (Akesson, M., P. Hagander, and J. P. Axelsson, 2001 "Avoiding acetate accumulation in Escherichia coli cultures using feedback control of glucose feeding" Biotechnol. Bioeng. 73:223-230;
  • Microbiol 57:3541-3546 adipic acid (Niu, W., K. M. Draths, and J. W. Frost, 2002 "Benzene-free synthesis of adipic acid” Biotechnol. Prog. 18:201-211), lactic acid (Chang, D., S. Shin, J. Rhee, and J. Pan, 1999 "Homofermentative production of D- or L- lactate in metabolically engineered Escherichia coli RR1" Appl. Environ. Microbiol
  • Pyruvic acid is currently manufactured for use as a food additive, nutriceutical, and weight control supplement (Li, Y., J. Chen, and S.-Y. Lun, 2001 "Biotechnological production of pyruvic acid” Appl. Microbiol Biotechnol. 57:451-459). Pyruvic acid can also be used as a starting material for the synthesis of amino acids such as alanine, tyrosine, phenylalanine, and tryptophan and for acetaldehyde production.
  • Pyruvate is produced commercially by both chemical and microbial processes. Chemical synthesis involves the decarboxylation and dehydration of calcium tartrate, a by-product of the wine industry. This process involves toxic solvents and is energy intensive with an estimated production cost of $8,650 per ton of pyruvate. Microbial pyruvate production is based primarily on two microorganisms, a multi-vitamin auxotroph of the yeast Torulopsis glabrata (Li, Y., J. Chen, and S.-Y. Lun, and X. S. Rui, 2001 "Efficient pyruvate production by a multi-vitamin auxotroph of Torulopsis glabrata: key role and optimization of vitamin levels" Appl. Microbiol Biotechnol.
  • Appl. Microbiol. Biotechnol. 62:76-82.2003 have described a new mutant strain of E. coli for pyruvate production.
  • This strain contains three mutations, ppc (phosphoenolpyruvate carboxylase), aceF (pyruvate dehydrogenase), and adhE (alcohol dehydrogenase) and is capable of producing 0.65 grams pyruvate per gram of glucose using complex media supplemented with acetate.
  • Typical production rates of pyruvate for biocatalysts are around lg L "1 h "1 with yields exceeding half the weight of substrate.
  • Torulopsis glabrata the yeast strain currently used for the commercial production of pyruvate, can achieve pyruvate titers of 69 g L "1 .
  • T. glabrata strains used in the commercial process are multivitamin auxotrophs requiring tight regulation of vitamin concentrations which result in complex vitamin feeding strategies during fermentation (Li, Y., J. Chen, and S.-Y.
  • the subject invention provides materials and methods wherein unique and advantageous combinations of gene mutations are used to direct carbon flow from sugars to a desired product.
  • the techniques of the subject invention can be used to obtain products from native pathways as well as from recombinant pathways.
  • the materials and methods of the subject invention can be used to produce a variety of products with only mineral salts and sugar as nutrients.
  • Useful products include pure acetic acid; 1,3-propanediol; 2,3-propanediol; pyruvate; dicarboxylic acids; adipic acid; amino acids, including aliphatic and aromatic amino acids; and alcohols including ethanol, butanol, isopropanol, and propanol.
  • the subject invention provides new materials and methods for the efficient production of acetate.
  • the subject invention provides advantageous biocatalysts for acetate production and for pyruvate production.
  • the subject invention provides a recombinant derivative of Escherichia coli W3110 that contains six chromosomal deletions (focA-pflB frdBC IdhA atpFH sucA adhE).
  • the resulting strain (TC36) exhibits approximately a 2-fold increase in maximal rates of acetate production (specific and volumetric) over W3110. This increase can be attributed to the mutation in the (F ⁇ F 0 )H + -ATP synthase, which eliminates ATP production by oxidative phosphorylation while retaining cytoplasmic Fi- ATP synthase for the gratuitous consumption of ATP.
  • TC36 produces acetic acid in mineral salts medium containing glucose with a yield of 68% of the maximum theoretical yield using native pathways (two acetates per glucose).
  • TC36 is devoid of plasmids and antibiotic resistance genes.
  • Further embodiments of the subject invention provide additional derivatives of Escherichia coli W3110 as new biocatalysts for the production of homo-acetate.
  • homo-acetate production by the new strain, TC36 approaches the theoretical maximum of two acetates per glucose. Eliminating the fermentation pathways of W3110 resulted in the new strain SZ47 and doubled the loss of carbon as volatile products. While the rate of acetate production decreased in SZ47 as compared to W3110, the cell yield increased. The inactivation of oxidative phosphorylation ( ⁇ atpFH) in SZ47 to produce TC24 resulted in a 5-fold increase in acetate yield and a 3-fold improvement in carbon recovery.
  • ⁇ atpFH oxidative phosphorylation
  • the subject invention provides a method to reduce the loss of substrate carbon into cell mass and/or into carbon dioxide. Also, the subject invention provides a method to reduce oxygen demand during bioconversion process.
  • the subject invention provides a new biocatalyst for the efficient production of pyruvate from glucose that requires only simple mineral salts as nutrients.
  • FIG. 1 Diagram summarizing genetic modifications used to redirect glucose metabolism to acetate.
  • Bold arrows mark principle metabolic routes in TC36. Reactions which have been blocked by gene deletions in TC36 are marked with solid circles. Genes encoding enzymes are shown in italics.
  • B Oxidative phosphorylation. The ATPsynthase is inactive in TC36 although the electron transport system remains functional as the primary route for NADH oxidation in TC36 (bold arrows).
  • C. Fi-ATPase remains active in TC36 for the regeneration of ADP but lacks subunits for membrane assembly.
  • Figure 2 Diagram summarizing plasmid constructions.
  • Figure 3 Effects of selected mutations on growth (A), glucose utilization (B), and base consumption (C). Symbols: ⁇ , W3110 (wild type); D, SZ47(A(focA- pflB)::FRT AfrdBC AldhA ); O, TC24(A(focA-pflB)::FRT AfrdBC AldhA
  • Figure 4 Effects of selected mutations on the production of acetate (A), dicarboxylic acids (B), and pyruvate (C).
  • FIG. 5 Fermentation of 6% glucose to acetate by TC36 in mineral salts medium. Fermentation was begun with 3% glucose followed by a second addition of 3% glucose after 12 h. Symbols: D, cell mass; O, glucose; •, acetate.
  • FIG. 6 Summary of central metabolism in E. coli.
  • Figure 7 Effect of oxygen level on pyruvate production by TC36.
  • Cells were inoculated into fermentation broth at 100% air saturation and continuously sparged with air until the oxygen levels declined to 5% saturation. At this time, oxygen was blended to maintain 5% saturation during the remaining period of incubation (open symbols).
  • media was sparged with a mixture of air and nitrogen to provide 5% air saturation prior to inoculation and sparging switched to air and oxygen as needed to maintain 5% air saturation (closed symbols).
  • FIG. 8 Batch fermentation of glucose by mutant strains of E. coli.
  • SEQ ID NO:l is a sense primer used according to the subject invention.
  • SEQ ID NO:2 is an antisense primer used according to the subject invention.
  • the subject invention provides materials and methods wherein unique and advantageous combinations of gene mutations are used to direct carbon flow to a desired product.
  • the techniques of the subject invention can be used to obtain products from native pathways as well as from recombinant pathways.
  • the subject invention provides a versatile platform for the production of a variety of products with only mineral salts and sugar as nutrients.
  • Useful products include pure acetic acid; 1,3-propanediol; 2,3-propanediol; pyruvate; dicarboxylic acids; adipic acid; and amino acids, including aliphatic and aromatic amino acids.
  • the subject invention provides new materials and methods for the efficient production of acetate.
  • the subject invention provides strains of E. coli (lacking plasmids and antibiotic resistance genes) as biocatalysts for the production of chemically pure acetate and/or pyruvate.
  • E. coli lacking plasmids and antibiotic resistance genes
  • the subject invention can employ a single step process using sugars as substrates, high rates of acetate production (almost two-fold higher), high acetate yields, simple nutrition requirements (mineral salts medium), and a robust metabolism permitting the bioconversion of hexoses, pentoses, and many dissacharides.
  • TC36 chromosomal deletions
  • Escherichia coli W3110 as new biocatalysts for the production of acetate. Eliminating the fermentation pathways of W3110 resulted in the new strain SZ47 and doubled the loss of carbon as volatile products. While the rate of acetate production decreased in SZ47 as compared to W3110, the cell yield increased. The inactivation of oxidative phosphorylation ( ⁇ atpFH) in SZ47 to produce TC24 resulted in a 5-fold increase in acetate yield and a 3-fold improvement in carbon recovery. Homo-acetate production by the new strain, TC36, approaches the theoretical maximum of two acetates per glucose.
  • deletions are used to inactivate pathways.
  • Deletions provide maximum stability; with deletions, there is no opportunity for a reverse mutation to restore function.
  • mutants includes changes in sequence or deletions unless the context clearly indicates otherwise.
  • deletions in W3110 that inactivate oxidative phosphorylation ( ⁇ atpFH), disrupt the cyclic function of the tricarboxylic acid cycle ( ⁇ sucA), and eliminate all major fermentation pathways ( ⁇ focA-pflB, AfrdBC, AldhA, AadhE) are combined.
  • TC36 oxidative phosphorylation
  • TC36 metabolizes sugars to acetate with the efficiency of fermentative metabolism, diverting a mimmum of carbon to cell mass (biocatalyst) and CO 2 , which results in extremely high product yields.
  • acetic acid yields For improved acetic acid yields, a simple two-step batch feeding strategy can be used in which a second addition of 3% glucose is added at the end of the growth phase (12h). Further improved acetic acid yields can be obtained by combining this two-step batch feeding strategy with a nitrogen limitation.
  • carbohydrates can be anaerobically metabolized to acetic acid at substantially higher yields (3 acetates per glucose) by Clostridia (anaerobic) that contain the Ljungdahl-Wood pathway for acetogenesis (Berraud, C, 2000 "Production of highly concentrated vinegar in fed-batch culture” Biotechnol. Lett. 22:451-454; Ljungdahl, L. G., 1986, "The autotrophic pathway of acetate synthesis in acetogenic bacteria” Ann. Rev. Microbiol 40:415-450).
  • Clostridium thermoaceticum containing the Lungdahl-Wood pathway produce higher yields of acetate than TC36 (Cheryan, M., S. Parekh, M. Shah and K. Witjitra, 1997 "Production of acetic acid by Clostridium thermoaceticum” Adv. Appl. Microbiol. 43:1-33).
  • maximum titres with TC36 are lower than can be achieved by ethanol oxidation using Acetobacter in the two-step commercial process (Berraud, C, 2000 "Production of highly concentrated vinegar in fed-batch culture” Biotechnol. Lett. 22:451-454).
  • the specific gene deletions of TC36 lead to acetate production rates almost two-fold higher than either of the aforementioned processes and require only mineral salts as nutrients.
  • E. coli TC36 offers a unique set of advantages over currently employed biocatalysts for the commercial production of acetate: a single step process using sugars as substrates, high rates of acetate production, high acetate yields, simple nutrition
  • the subject invention provides a new biocatalyst for the efficient production of pyruvate from glucose that requires only simple mineral salts as nutrients.
  • the materials and methods of the subject invention provide at least the following advantages:
  • E. coli W3110 was developed to produce acetic acid as the primary product from glucose during aerobic growth using only mineral salts as nutrients.
  • the resulting biocatalyst (TC36) contains multiple chromosomal alterations (Figure 1) that direct carbon flow to acetate and mimmize carbon loss to cell mass, CO 2 , and alternative products.
  • Strain TC36 is devoid of plasmids and antibiotic resistance genes, both potential advantages for commercial use.
  • the subject invention provides an additional derivative of Escherichia coli W3110 as a new biocatalyst for the production of homo-acetate. Acetate production by this new strain (TC36) approaches the theoretical maximum of two acetate per glucose due to the disruption of oxidative phosphorylation.
  • ATP production from ⁇ ADH oxidation can be eliminated (or substantially reduced) by deleting the portion of (F]Fo)H + -ATP synthase involved in membrane assembly while preserving a functional cytoplasmic Fi-ATPase to provide gratuitous hydrolysis of ATP.
  • a maximum of 4 ATP molecules (net) can be produced per glucose (assumes all pyruvate is metablized to acetyl ⁇ CoA and acetate) as compared to a theoretical maximum of 33 ATP molecules for wild-type strains of E. coli.
  • Substantial reduction refers to a greater than 80% reduction.
  • Excess pyruvate can also be directly oxidized to acetate by pyruvate oxidase (poxB), an enzyme that is induced during the latter stages of growth and by environmental stress (Chang, Y.-Y., A.-Y. Wang, and
  • the subject invention utilizes strategies that delete subunits concerned with the membrane assembly of the (F ⁇ F 0 )H + -ATP synthase, create futile cycles for ATP consumption, or increase cytoplasmic levels of the ATPase activities, to decrease cell yield, increase metabolic flux, and increase product yield in bioconversion processes.
  • Strain TC36 can be used as a biocatalysis platform for the efficient production of oxidized products. Under conditions of glucose excess, strain TC36 produced a maximum of 878 mM acetate, 75% of the maximum theoretical yield or 0.50 g acetate per g glucose. Only cell mass and small amounts of organic acids were produced as co- products with acetate. It is likely that 878 mM acetate approaches the upper limit of tolerance for the metabolism in TC36. Concentrations as low as 50 mM acetate have been shown to induce a stress response in E. coli (Kirkpatrick, C, L. M. Maurer, N. ⁇ . Oyelakin, Y. N. Yoncheva, R. Maurer, and J. L. Slonczewski, 2001 "Acetate and formate stress: Opposite responses in the proteomes of Escherichia coir J. Bacteriol. 183:6466- 6477). The minimal inhibitory concentration for growth has been previously reported as
  • TC36 ⁇ focApflB ⁇ frdCD ⁇ ldhA ⁇ atpFH AsucA AadhE
  • TC36 ⁇ focApflB ⁇ frdCD ⁇ ldhA ⁇ atpFH AsucA AadhE
  • TC36 ⁇ focApflB ⁇ frdCD ⁇ ldhA ⁇ atpFH AsucA AadhE
  • E. coli TC36 can produce acetate in a simpler, single step process using glucose and mineral salts with titres and yields equivalent or higher than current batch processes. Although yields for TC36 were lower than those reported for Clostridium thermoaceticum which contain the Ljungdahl-Wood Pathway (Cheryan, M., S. Parekh, M. Shah and K. Witjitra, 1997 "Production of acetic acid by Clostridium thermoaceticum” Adv. Appl. Microbiol.
  • E. coli TC36 offers a unique set of advantages over currently employed biocatalysts for the commercial production of acetate: a single step process using sugars as substrates, high rates of acetate production, high acetate yields, simple nutrition (mineral salts), and a robust metabolism permitting the bioconversion of hexoses, pentoses, and many dissacharides.
  • E. coli W3110 (ATCC 27325) derivatives were maintained on a mineral salts medium (per liter: 3.5 g KH 2 PO 4 ; 5.0 g K 2 HPO 4 ; 3.5 g (NH ) 2 HPO 4 , 0.25 g MgSO 4 * 7 H O, 15 mg CaCl 2 ' 2 H 2 O, 0.5 mg thiamine, and 1 ml of trace metal stock) containing glucose (2% in plates; 3% in broth) and 1.5% agar.
  • a mineral salts medium per liter: 3.5 g KH 2 PO 4 ; 5.0 g K 2 HPO 4 ; 3.5 g (NH ) 2 HPO 4 , 0.25 g MgSO 4 * 7 H O, 15 mg CaCl 2 ' 2 H 2 O, 0.5 mg thiamine, and 1 ml of trace metal stock
  • the trace metal stock was prepared in 0.1 M HC1 (per liter: 1.6 g FeCl 3j 0.2 g CoCl 2 ' 6 H 2 O, 0.1 g CuCl 2 , 0.2 g ZnCl 2 ' 4 H 2 O, 0.2 g aMoO 4 , and 0.05 g H 3 BO 3 ).
  • MOPS 0.1 M, pH 7.1
  • Minimal medium was also prepared using succinate (1 g L "1 ) and glycerol (1 g L "1 ) as sole sources of carbon (nonfermentable).
  • Glucose (2%) was added to LB medium for all strains containing mutations in synthase.
  • Antibiotics were included as appropriate (kanamycin, 50 mg L “1 ; ampicillin, 50 mg L “1 ; and tetracycline, 12.5 or 6.25 mg L “1 ). Fusaric acid plates were used to select for loss of tetracycline resistance.
  • Genetic methods Standard methods were used for plasmid construction, phage PI transduction, electroporation, and polymerase chain reaction (PCR) (Miller, J. H., 1992 "A short course in bacterial genetics: A laboratory manual and handbook for Escherichia coli and related bacteria" Cold Spring Harbor Press, Cold Spring Harbor, NY; Sambrook, J. and D. W. Russell, 2001 "Molecular cloning: A laboratory manual”
  • Chromosomal DNA from E. coli W3110 served as a template to amplify genes using primers complementary to coding regions (ORFmers) purchased from the Sigma Scientific Company (St. Louis, MO).
  • PCR products were initially cloned into plasmid vector pCR2.1-TOPO.
  • restriction products were converted to blunt ends using either the Klenow fragment of DNA polymerase (5' overhang) or T4 DNA polymerase (3' overhang) as needed. Integration of linear DNA was facilitated by using pKD46 (temperature conditional) containing an arabinose-inducible red recombinase (Datsenko, K. A. and B. L. Wanner, 2000 "One-step inactivation of chromosomal genes in
  • Escherichia coli K-12 using PCR products Proc. Natl Acad. Sci. USA 97:6640-6645. Integrants were selected for tetracycline resistance (6.25 mg L "1 ) and screened for appropriate antibiotic resistance markers and phenotypic traits. At each step, mutations were verified by analyses of PCR products and fermentation products. FRT-flanked antibiotic resistance genes used for selection were deleted using a temperature- conditional plasmid (pFT-A) expressing FLP recombinase from a chlortetracycline- inducible promoter (Martinez-Morales, F., A. G. Borges, A. Martinez, K. T. Shanmugam, and L. O.
  • pFT-A temperature- conditional plasmid
  • FRT-tet-FRT A removable tetracycline cassette (FRT-tet-FRT) was constructed (pLOI2065) which is analogous to the kanamycin cassette (FRT-kan-FRT) in pKD4 (Datsenko, K. A. and B. L. Wanner, 2000 "One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products" Proc. Natl Acad. Sci. USA 97:6640-6645).
  • flanking FRT sites are oriented in the same direction to allow efficient in vivo excision by FLP recombinanase (Posfai, G., M. D. Koob, H. A. Kirkpatrick, amd F.
  • Plasmid pLOI2065 contains two EcoRI sites and two Sm ⁇ l sites for isolation of the FRT-tet-FRT cassette. The sequence forpLOI2065 has been deposited in GenBank (Accession No. AF521666). Deletion of adhE. To construct an adhE mutant, the coding region (2.68 kbp) was amplified by PCR and cloned into pCR2.1-TOPO.
  • the central region of adhE (1.06 kbp) was deleted using HincU (2 sites) and replaced with a 1.7 kbp Smal fragment from ⁇ LOI2065 containing the FRT-tet-FRT cassette to produce pLOI2803.
  • This plasmid was linearized by digestion with Pvul and Seal, and served as a template to amplify (adhE primers) the 3.17 kbp region containing adhE:: FRT-tet-FRT.
  • Amplified DNA was purified and introduced into W3110 by electroporation. Recombinants from double crossover events were identified by antibiotic markers, confirmed by analysis of PCR and fermentation products. One clone was selected and designated TC20.
  • PI transduction was used to transfer a mutation (frdBC zid::T_ ⁇ 10) from S ⁇ 1706 into SZ32, designated SZ35( ⁇ /oc-4- ⁇ ?R::FRT AfrdBC zid::Tr_10).
  • the tet gene was removed from SZ35 by fusaric acid selection to produce SZ40(AfocA-p ⁇ B:FRT AfrdBC).
  • a focA-pflB::FRT mutation was constructed using the method of Datsenko and Wanner (Datsenko, K. A. and B. L. Wanner, 2000 "One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products" Proc. Natl. Acad. Sci. USA 97:6640-6645).
  • Hybrid primers were designed which are complementary to E. coli chromosomal genes and to the antibiotic cassette (FRT-kan- FRT) in pKD4.
  • the sense primer (TTACTCCGTATTTGCATAAAAA- CCATGCGAGTTACGGGCCTATAAGTGTAGGCTGGAGCTGCTTC) (SEQ ID NO.:l) consisted of an initial 45 bp (bold) corresponding to the -130 to -85 region of foe followed by 20 bp (underlined) corresponding to the primer 1 region of pKD4.
  • the antisense primer TAGATTGAGTGAAGGTACGAGTAATAACGTCCTGCTGC-
  • TGTTCTCATATGAATATCCTCCTTAG1 (SEQ ID NO.:2) consisted of an initial 45 bp (bold) of the C-terminal end of pflB followed by 20 bp (underlined) corresponding to primer 2 region of pKD4.
  • the FRT-kan-FRT cassette was amplified by PCR using these primers and pKD4 as the template. After purification, amplified DNA was electroporated into E. coli BW25113 (pKD46).
  • a phage PI lysate prepared from AH218 (pflB::FRT-kan-FRT) was used to transfer this mutation into W3110 to produce strain SZ31 (pflB::FRT-kan-FRT).
  • the kan gene was removed from the chromosome by FLP recombinase using a temperature- conditional helper plasmid (pFT-A). After removal of helper plasmid by growth at 42°C, the resulting kanomycin-sensitive strain (focA-pflB::FRT) was designated SZ32.
  • the atpEFH coding region of the atpIBEFHAGDC operon was amplified by PCR using primers (ORFmers, Sigma Scientific, St. Louis, MO) complementary to the 5'- end of the atpE gene and the 3'- end of the atpH .
  • the amplified fragment (1.3 kbp) was cloned into pCR2.1-TOPO and one clone selected in which the atpEFH genes were oriented to permit expression from the lac promoter (pLOI2805; Figure 2).
  • the atpF gene and 117 nucleotides at the 5' end of atpH gene were removed from pLOI2805 by digestion with Hpal and ifatEII (Klenow-treated).
  • pLOI2807 This region was replaced with a 1.7 kbp Smal fragment from pLOI2065 containing the FRT-tet-FRT cassette to produce pLOI2807 (Fig.2).
  • pLOI2807 served as a template for amplification of the at ⁇ EA(FH)::FRT-tet-FRT region (2.4 kbp) using the 5' atpE and 3' atpH primers.
  • Amplified DNA was precipitated, digested again with Seal to disrupt any residual plasmid, and purified by phenol extraction. This DNA was introduced into E. coli W3110(pKD46) by electroporation while expressing red recombinase.
  • Plasmid pKD46 was eliminated by growth at 42°C. Recombinants (double cross-over) were identified using antibiotic markers (tetracycline resistant; sensitive to ampicillin and kanamycin) and by the inability to grow on succinate-minimal plates or glycerol-minimal plates in the absence of glucose (fermentable carbon source).
  • Phage PI was used to transduce the Aatp(FH)::FRT-tet-FRT mutation in TC21 to SZ47 and produce TC23.
  • the tet gene was removed from TC23 by the FLP recombinase
  • sucA coding region was amplified using ORFmers.
  • the resulting 2.8 kbp PCR product was cloned into pCR2.1-TOPO to produce pLOI2800 ( Figure 2) in which the sucA coding region was oriented to permit expression from the lac promoter.
  • a 1.1 kbp fragment was removed from central region of sucA by digestion of pLOI2800 with Sn ⁇ BI and -4ccl (Klenow-treated). This region was replaced with a 1.7 kbp Sm ⁇ l fragment containing the FRT-tet-FRT cassette from pLOI2065 to produce pLOI2801 ( Figure 2).
  • Plasmid pLOI2801 was digested with Pvu ⁇ and Seal and used as a template to amplify the 3.3 kbp region containing sucA:: FRT-tet-FRT using sucA ORFmers. Amplified DNA was precipitated, digested with Pvul and Seal to disrupt any residual circular plasmid, and extracted with phenol. Purified DNA was electroporated into E. coli W3110(pKD46) while expressing red recombinase. Plasmid pKD46 was eliminated by growth at 42 °C.
  • sucA ORFmers 2.8 kbp fragment for wild type and 3.3 kbp for sucA ::FRTrtet-FRT mutants
  • Phage PI was used to transduce the sucA ::FRT-tet-FRT mutation from TC25 into
  • the resulting strain was designated TC36 (Succ + , A(focA- pflB)::FRT AfrdBC AldhA Aatp(FH)::FRT AadhEv.FRT AsucA::FRT).
  • ATPase ATPase.
  • Cells were grown for enzyme assays as described above for seed cultures. Upon reaching 0.75-1.0 OD 55 o ⁇ m , cultures were chilled on ice and harvested by centrifugation (8000 x g, 5 min at 4°C). Cell pellets were washed 5 times with 0.1 M Tris-HCl (pH 7.55), resuspended in 1 ml of this buffer, and broken using a model W220F ultrasonic cell disruptor (Heat Systems Ultrasonics, Plainview, NY, USA). Total ATPase activity in disrupted cell preparations was assayed at pH 7.55 essentially as described by Evans (Evans, D.
  • Example 1 Construction of a homo-acetate fermentation pathway in E. coli W3110.
  • Bacteriol 181:2351-2357 To construct a strain for homo-acetate production, removable antibiotic resistance genes were used to sequentially inactivate chromosomal genes encoding alternative pathways.
  • TCA tricarboxlyic acid
  • TC36 has absolute requirements for a fermentable carbon source (substrate level phosphoylation) and for an external electron acceptor that can couple to the electron transport system during growth in mineral salts medium to maintain redox balance. With genetic blocks in all major fermentation pathways and oxidative phosphorylation, this strain is relatively insensitive to variations in dissolved oxygen.
  • TC36(dfocApflB ⁇ frdCD ⁇ ldltA ⁇ atpFH ⁇ sucA ⁇ adhE) metabolizes sugars to acetate with the efficiency of fermentative metabolism, diverting a minimum of carbon to cell mass (biocatalyst) and CO 2 . By replacing the acetate pathway, a variety of alternative oxidized products can be produced using the mutational strategies employed for the construction of TC36.
  • Example 2 Effects of gene disruptions on growth and glycolytic flux.
  • TC36 was genetically engineered for the production of acetate from carbohydrates such as glucose. Batch fermentations with pH control were used to compare the performance of this strain with W3110 (wild type) and two intermediate strains used for construction, SZ47 ( ⁇ pflB, ⁇ frdCD, ⁇ ldhA) and TC24( ⁇ pflB, ⁇ frdCD, ⁇ ldhA ⁇ atpFH). Under 5% oxygen saturation and 3% glucose (37°C) test conditions, the broth pH was maintained at neutrality to minimize toxicity from undissociated acids (Chotani, G., T.
  • TC24 Cell yield and growth rate were lowest for strain TC36 containing additional mutations in 2-ketoglutarate dehydrogenase (AsucA) and alcohol dehydrogenase (AadhE), approximately 80% of the unmodified parent W3110.
  • the maximum specific rate of glucose utilization was 9 mmole h "1 g "1 dry cell weight in the unmodified parent (W3110), 20 mmole h “1 g “1 dry cell weight in TC24, and 18 mmole h “1 g “1 dry cell weight in TC36.
  • the slightly lower glycolytic flux in TC36 as compared to TC24 may be related to the increase in ATP yield resulting from improvements in acetate yield (1 ATP per acetate). Assuming protein represents 55% of dry cell weight, maximal glycolytic flux in TC36 is approximately 0.55 ⁇ moles glucose min "1 mg "1 protein.
  • the (F]Fo)H + -ATP synthase and 2-ketoglutarate dehydrogenase mutations introduced into TC36 to minimize the levels of ATP and NAD(P)H from glucose under oxidative conditions also promote glycolysis through native allosteric controls (Neidhardt, F. C, J. L. Ingraham, and M. Schaechter, 1990 "Physiology of the bacterial cell: A molecular approach” Sinauer Associates, Inc., Sunderland, Mass.; Underwood, S.
  • Carbon recovery represents the percentage of substrate carbon recovered. Recovered carbon was calculated as the sum of carbon in cell mass, fermentation products, and C02. '' In the final sample, 44 mM glucose was present. ' Excess glucose (9.5%) was added to fermentation to maintain levels above 100 mM; 107 mM glucose was present in the final sample.
  • Strain W3110 accumulated the highest levels of dicarboxylic acids (primarily succinate and 2-ketoglutarate produced through the TCA cycle) during glucose metabolism, approximately 3-fold that of the engineered strains (Figure 4B).
  • the order of appearance of dicarboxylic acids in the broth correlated with growth rate and the order in which each strain entered into stationary phase. Dicarboxylic acids were partially consumed as glucose levels declined, and may represent spillover products from excessive glycolysis during the transition from exponential to stationary phase. Although dicarboxylic acids were produced by each strain, no significant accumulation of pyruvate was observed for W3110, SZ47 or TC24. Pyruvate levels in the broth of TC36 increased (16 mM at 12 h) during the transition stage (Figure 4C).
  • Dicarboxylic acids and cell mass were the dominant competing co-products from glucose.
  • Acetate yield was not improved by increasing the oxygen level from 5% dissolved oxygen to 15% dissolved oxygen, by reducing ammonia nitrogen (2 g L "1 ammonium phosphate) by 40% to limit growth, or by increasing the initial concentration of glucose from 3% to 6% (Table 3).
  • a simple two-step batch feeding strategy was beneficial.
  • a second addition of 3% glucose at the end of the growth phase (12 h) was metabolized to completion and produced 523 mM acetate with minimal increase in cell mass (Figure 5).
  • Acetate yield for this two-step addition was 78% of the theoretical maximum as compared to 68% for 3% glucose.
  • the highest acetate yield, 86% of the theoretical maximum was obtained by combining the one-step addition of 3% glucose with the nitrogen limitation (Table 3).
  • Additional fed-batch experiments were conducted in which multiple additions were made to glucose levels above 100 mM. With this approach, 878 mM acetate was produced representing 75% of the maximum theoretical yield (Table 3).
  • Strain TC36 can be used as a biocatalysis platform for the efficient production of oxidized products. Under conditions of glucose excess, strain TC36 produced a maximum of 878 mM acetate, 75% of the maximum theoretical yield (Table 3) or 0.50 g acetate per g glucose.
  • 878 mM acetate approaches the upper limit of tolerance for the metabolism in TC36.
  • Concentrations as low as 50 mM acetate have been shown to induce a stress response in E. coli (Kirkpatrick, C, L. M. Maurer, N. ⁇ . Oyelakin, Y. N. Yoncheva, R. Maurer, and J. L. Slonczewski, 2001 "Acetate and formate stress: Opposite responses in the proteomes of Escherichia coli" J. Bacteriol. 183:6466-6477).
  • the minimal inhibitory concentration for growth has been previously reported as 300- 400 mM acetate at neutral pH (Lasko, D. R., N. Zamboni, and U.
  • Oxygen transfer often becomes limiting during aerobic bioconversion processes, promoting the accumulation of reduced products (Tsai, P. S., M. Nageli, and J. E. Bailey, 2002 "Intracellular expression of Vitreoscilla hemoglobin modifies microaerobic Escherichia coli metabolism through elevated concentration and specific activity of the cytochrome o" Biotechnol. Bioeng. 79:558-567; Narma, A., B. W. Boesch, and B. O.
  • E. coli TC36 offers a unique set of advantages over currently employed biocatalysts for the commercial production of acetate: a single step process using sugars as substrates, high rates of acetate production, high acetate yields, simple nutrition
  • Example 6 are listed in Table 4.
  • Working cultures of E. coli W3110 (ATCC 27325) and derivatives were maintained on a minimal medium containing mineral salts (per liter: 3.5 g KH 2 PO 4 ; 5.0 g K 2 HPO 4 ; 3.5 g (NH 4 ) 2 HPO 4 , 0.25 g MgSO 4 - 7 H 2 0 , 15 mg CaCl 2 2 H 2 O, 0.5 mg thiamine, and 1 ml of trace metal stock), glucose (2% in plates; 3%> in broth), and 1.5% agar.
  • the trace metal stock was prepared in 0.1 M HCl (per liter: 1.6 g
  • MOPS 0.1 M, pH 7.4
  • LB Luria-Bertani
  • Glucose 2%) was added to LB medium for all strains containing mutations in synthase.
  • Antibiotics were included as appropriate (kanamycin, 50 mg L “1 ; ampicillin, 50 mg L “1 ; apramycin, 50 mg L “1 ; and tetracycline, 12.5 or 6.25 mg L “1 ).
  • poxB pyruvate oxidase
  • the poxB coding region (1.7 kbp) was amplified by PCR using primers (ORFmers) obtained from Sigma-Genosys (The Woodlands, Texas) and ligated into ⁇ CR2.1-TOPO.
  • ORFmers primers obtained from Sigma-Genosys (The Woodlands, Texas) and ligated into ⁇ CR2.1-TOPO.
  • a single clone was selected in which the poxB gene was oriented in the same direction as the lac promoter (pLOI2075).
  • the EcoRI fragment from pLOI2075 containing poxB was ligated into the unique EcoRI site of pLOI2403 to produce plasmid pLOI2078.
  • the small Sm ⁇ l fragment (1.63 kbp) from pLOI2065 containing a tet gene flanked by FRT sites was ligated into the unique BsaBI site within the poxB gene in pLOI2078 to produce pLOI2080.
  • pLOI2080 served as a template for the amplification of poxB::FRT-tet-FRT (3.4 kbp) using poxB primers.
  • Amplified DNA was electroporated into E. coli W3110(pKD46) while expressing Red recombinase. Plasmid pKD46 was eliminated by incubation at 42°C.
  • Double crossover recombinants were identified using antibiotic markers (tetracycline resistant; sensitive to ampicillin and kanamycin) and confirmed by PCR analysis using the poxB ORFmers (1.7 kbp fragment for W3110; 3.4 kbp fragment for mutants).
  • antibiotic markers tetracycline resistant; sensitive to ampicillin and kanamycin
  • poxB ORFmers 1.7 kbp fragment for W3110; 3.4 kbp fragment for mutants.
  • One clone was selected and designated LY74.
  • Phage PI was used to transduce the poxB::FRT-tet-FRT mutation from LY74 into TC36 to produce TC41.
  • the tet gene was removed from TC41 using the FLP recombinase (pFT-A). After elimination of pFT-A by growth at 42°C, the/?oxR::ERrwas confirmed by a comparison of PCR products using poxB primers (1.8 kbp for the mutant; 1.7 kbp for the wild type).
  • the resulting strain was designated TC42 ⁇ (focA-pflB::FRT) frdBC: :FRT IdhA atpFH: :FRTadhE: :FRTsucA : :FRTpoxB: :FRT .
  • Datsenko, K. A. and B. L. Wanner.2000 One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.
  • Phage PI was used to transduce the ackA::FRT-tet-FRT mutation from SZ61 (Zhou, S., T. B. Causey, A. Hasona, K. T. Shanmugam and L. O. Ingram, 2003 "Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110" Appl.
  • strain TC38 was constructed from TC36 by deleting the central region of the ackA gene. This additional deletion reduced the net production of ATP by 30% (Figure 6A), cell yield by 36% ( Figure 8A; Table 5), and the rate of growth by 45% (Table 6). This mutation also reduced glycolytic flux by 45%
  • a pyruvate oxidase (poxB) mutation on pyruvate production.
  • Pyruvate can be converted directly to acetate by the membrane-bound protein pyruvate oxidase using the electron transport system to couple oxygen as the terminal electron acceptor.
  • the poxB gene is typically repressed during exponential growth but is induced by stress or entry into stationary phase (Chang, Y.-Y. and J. E. Cronan Jr. 1983; Chang, Y.-Y. et al. 1994).
  • Strain TC42 was constructed from TC36 by inserting a short DNA segment containing stop codons into the central region of poxB.
  • strain TC44 (pflB frdBC . IdhA atpFH adhE sucA poxB::FRT ackA) was constructed in which both acetate kinase and pyruvate oxidase are inactive. Inactivation of poxB was beneficial for growth and pyruvate production (Figure 8A; Table 5 and Table 6) in comparison to TC38, an isogenic strain containing a functional poxB. Adding the poxB mutation substantially restored both volumetric and specific rates of glucose metabolism to that observed for TC36 (Table 6) in which both acetate pathways are functional, while further reducing acetate production.
  • Acetate production by TC44 was reduced by more than half in comparison to TC38 (acetate kinase deletion) and pyruvate yield was increased by 17%.
  • the specific rate of pyruvate production by TC44 was 8- fold that of TC36 and twice that of TC38 (Table 5).
  • the time required to complete fermentation with TC44 was 30 % shorter than with TC 38 ( Figure 8B).
  • Broth containing 3%> glucose (167 mM) was converted into 2.2% pyruvate (252 mM) after 18 h in mineral salts medium (Figure 8D).
  • acetate levels were substantially reduced by the combining of poxB and ackA mutation (Figure 8C), acetate and dicarboxylic acids remained as minor products.
  • the beneficial role of apoxB mutation for pyruvate production The pyruvate oxidase catalyzed oxidation of pyruvate to acetate (and CO 2 ) also contributes to the requirement for oxygen as an electron acceptor. Oxygen transfer rates are frequently limiting during aerobic fermentations at relatively high levels of saturation, and may be even more problematic under fermentation conditions (5%> of air saturation). Eliminating the primary route for acetyl ⁇ CoA dissimilation (ackA) in TC38 increased pyruvate production and may also increase the amount of pyruvate that is metabolized by PoxB. Increasing oxygen saturation from 5%> to 50% during TC38 fermentations (Table 5 and Table 6) was beneficial.
  • the new biocatalyst of the subject invention requires only mineral salts and glucose.
  • the lack of a requirement for vitamin supplements, complex nutrients or complicated process controls for TC44 provides a substantial savings in production costs.
  • the lack of complex nutrients in the fermentation broth reduces costs associated with product purification and waste disposal.
  • Pyruvate can be produced by a variety of microorganism including mutants of yeasts and bacteria.
  • E. coli TC44 provides a competitive alternative to the current pyruvate-producing biocatalysts due to high yields, high product titers, simple fermentation conditions, and the ability to grow well in mineral salts medium with glucose as the sole carbon source (Table 7).
  • the maximum pyruvate concentration measured during glucose fermentations ranged from 14.88 mM to 111.89 mM.
  • Pyruvate excretion in TC36 is very sensitive to dissolved oxygen, where elevated dissolved oxygen results in more pyruvate being excreted.
  • the concentration of acetate at the time all glucose has been consumed depends on the amount of pyruvate produced. Pyruvate is rapidly converted to acetate after glucose is depleted.
  • the high standard deviations are a result of small differences in dissolved oxygen concentrations between fermentors and co-metabolism of the excreted pyruvate and glucose. k Not detected.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)

Abstract

The subject invention provides materials and methods wherein unique and advantageous combinations of gene mutations are used to direct carbon flow from sugars to a single product. The techniques of the subject invention can be used to obtain products from native pathways as well as from recombinant pathways. In preferred embodiments, the subject invention provides new materials and methods for the efficient production of acetate and pyruvic acid.

Description

DESCRIPTION
MATERIALS AND METHODS FOR THE EFFICIENT PRODUCTION OF ACETATE AND OTHER PRODUCTS
The subject invention was made with government support under research projects supported by USDA/NRI, Grant No. 2001-35504-10669; USDA/IFAS, Grant No. 00- 52104-9704; and USDOE Grant No. FG02-96ER20222. The government has certain rights in this invention.
Cross-Reference to Related Applications This application claims the benefit of U.S. Provisional Application Serial No. 60/424,372, filed November 6, 2002.
Background of Invention
Recent trends toward the production of "green" chemicals will require development of innovative synthesis techniques that are highly efficient and cost effective. Throughout the past decade, a number of traditional chemical companies in the
United States and Europe have begun to develop infrastructures for the production of compounds using biocatalytic processes. Considerable progress has been reported toward new processes for commodity chemicals such as ethanol (Ingram, L. O., H. C.
Aldrich, A. C. C. Borges, T. B. Causey, A. Martinez, F. Morales, A. Saleh, S. A. Underwood, L. P. Yomano, S. W. York, J. Zaldivar, and S. Zhou, 1999 "Enteric bacterial catalyst for fuel ethanol production" Biotechnol. Prog. 15:855-866; Underwood, S. A., S.
Zhou, T. B. Causey, L. P. Yomano, K.T. Shanmugam, and L. O. Ingram, 2002 "Genetic changes to optimize carbon partitioning between ethanol and biosynthesis in ethanologenic Escherichia coli." Appl Environ. Microbiol 68:6263-6272), lactic acid (Zhou, S., T. B. Causey, A. Hasona, K. T. Shanmugam and L. O. Ingram, 2003 "Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110" Appl Environ. Microbiol 69:399-407; Chang, D., S. Shin, J. Rhee, and J. Pan, 1999 "Homofermentative production of D- or L-lactate in metabolically engineered Escherichia coli RR1" Appl. Environ. Microbiol. 65:1384- 1389; Dien, B. S., N. N. Nichols, and R. J. Bothast, 2001 "Recombinant Escherichia coli engineered for the production of L-lactic acid from hexose and pentose sugars" J. Ind. Microbiol Biotechnol. 27:259-264), 1,3-propanediol (Nakamura, US Patent 6,013,494; Tong, L, H. H. Liao, and D. C. Cameron, 1991 "1,3-propanediol production by Escherichia coli expressing genes from the Klebsiella- pneumoniae-DHA regulon" App. Env. Microbiol. 57:3541-3546), and adipic acid (Niu, W., K. M. Draths, and J. W. Frost,
2002 "Benzene-free synthesis of adipic acid" Biotechnol. Prog. 18:201-211).
In addition, advances have been made in the genetic engineering of microbes for higher value specialty compounds such as acetate, polyketides (Beck, B. J., C. C. Aldrich, R. A. Fecik, K. A. Reynolds, and D. H. Sherman, 2003 "Iterative chain elongation by a pikromycin monomodular polyketide synthase" J. Am. Chem. Soc.
125:4682-4683; Dayem, L. C, J. R. Carney, D. V. Santi, B. A. Pfeifer, C. Khosla, and J. T. Kealey, 2002 "Metabolic engineering of a methylmalonyl-CoA mutase - epimerase pathway for complex polyketide biosynthesis in Escherichia coli. " Biochem. 41:5193- 5201) and carotenoids (Wang, Chia-wei, Min-Kyu Oh, J. C. Liao, 2000 "Directed evolution of metabolically engineered Escherichia coli for carotenoid production"
Biotechnol. Prog. 16:922-926).
Acetic acid, a widely used specialty chemical in the food industry, has recently emerged as a potential bulk chemical for the production of plastics and solvents. Acetic acid has been produced using microbial systems; however, the production of acetic acid in microbial systems competes with the production of CO2 and cell mass. Thus, while efficient acetate-producing microbial systems are important for industrial uses, the systems must have an increased output of acetate with a decreased input of expensive microbial nutrients.
The biological production of acetic acid has been largely displaced by petrochemical routes as the uses for this commodity chemical have expanded from food products to plastics, solvents, and road de-icers (Freer, S.N., 2002 "Acetic acid production by Dekkera/Brettanomyces yeasts" World J. Microbiol. Biotechnol. 18:271- 275). In 2001, the world production of acetic acid reached an estimated 6.8 million metric tons, half of which was produced in the United States. Previously, three microbial approaches have been explored for acetic acid production. In the two-step commercial process, sugars are fermented to ethanol by Saccharomyces yeast. Then, the resulting beers are oxidized to acetic acid by Acetobacter under aerobic conditions (Berraud, C, 2000 "Production of highly concentrated vinegar in fed-batch culture" Biotechnol. Lett. 22:451-454; Cheryan, M., S. Parekh, M. Shah, and K. Witjitra, 1997 "Production of acetic acid by Clostridium thermoaceticum" Adv. Appl. Microbiol. 43:1-33). Using this process, acetic acid titres of around 650 mM are typically produced; however, higher titres can be readily achieved by the addition of complex nutrients in fed-batch processes requiring 60-120 hours. Overall yields for this commercial process have been estimated to be 76% of the theoretical maximum (2 acetate per glucose; 0.67g acetic acid per g glucose).
Under a second approach, carbohydrates can be anaerobically metabolized to acetic acid at substantially higher yields (3 acetates per glucose) by Clostridia that contain the Ljungdahl-Wood pathway for acetogenesis (Berraud, C, 2000 "Production of highly concentrated vinegar in fed-batch culture" Biotechnol. Lett. 22:451-454; Ljungdahl, L. G., 1986 "The autotrophic pathway of acetate synthesis in acetogenic bacteria" Ann. Rev. Microbiol. 40:415-450). In particular, Clostridium thermoaceticum containing the Ljungdahl-Wood pathway produces high yields of acetic acid (Cheryan, M., S. Parekh, M. Shah, and K. Witjitra, 1997 "Production of acetic acid by Clostridium thermoaceticum" Adv. Appl. Microbiol. 43:1-33). Recently, Freer (Freer, S. N., 2002 "Acetic acid production by
Dekkera/Brettanomyces yeasts" World J. Microbiol. Biotechnol 18:271-275) identified yeast strains (Dekkera and Brettanomyces) that produce acetic acid as a primary product from glucose for potential use in acetic acid production. All three of these current microbial acetic acid production systems require complex nutrients, which increase the cost of materials, acetate purification, and waste disposal. Escherichia coli is widely used as a biocatalyst for high value products such as recombinant proteins (Akesson, M., P. Hagander, and J. P. Axelsson, 2001 "Avoiding acetate accumulation in Escherichia coli cultures using feedback control of glucose feeding" Biotechnol. Bioeng. 73:223-230; Aristidou, A. A., K. San, and G. N. Bennett, 1995 "Metabolic engineering of Escherichia coli to enhance recombinant protein production through acetate reduction" Biotechnol. Prog. 11:475-478; Contiero, J., C. Beatty, S. Kumar, C. L. DeSanti, W. R. Strohl, and A. Wolfe, 2000 "Effects of mutations in acetate metabolism on high-cell-density growth of Escherichia coli" J. Ind. Microbiol. 24:421-430; Luli, G. W. and R. Strohl, 1990 "Comparison of growth, acetate production and acetate hώibition of Escherichia coli strains in batch and fed-batch fermentations"
Appl. Environ. Microbiol. 56:1004-1011) and amino acids (Chotani, G., T. Dodge, A. Hsu, M. Kumar, R. LaDuca, D. Trimbur, W. Weyler, and K. Sanford, 2000 "The commercial production of chemicals using pathway engineering" Biochem. Biophys. Ada 1543:434-455; Eggeling, L., W. Pfefferle, and H. Sahm, 2001 "Amino acids," p. 281-304 in C. Ratledge and B. Kristiansen (ed.), Basic Biotechnology, 2nd edition. Cambridge
University Press. Cambridge, U.K.).
Escherichia coli generate acetyl~CoA during fermentative and oxidative metabolism, which the cell then uses to produce small amounts of acetate (Akesson, M., P. Hagander, and J. P. Axelsson, 2001 "Avoiding acetate accumulation in Escherichia coli cultures using feedback control of glucose feeding" Biotechnol. Bioeng. 73:223-230;
Contiero, J., C. Beatty, S. Kumar, C. L. DeSanti, W. R. Strohl, and A. Wolfe, 2000 "Effects of mutations in acetate metabolism on high-cell-density growth of Escherichia coli" J. Ind. Microbiol. 24:421-430).
Many E.coli strains grow well in simple mineral salts medium and readily metabolize all of the hexose and pentose sugar constituents of plant biomass (Ingram, L.
O., H. C. Aldrich, A. C. C. Borges, T. B. Causey, A. Martinez, F. Morales, A. Saleh, S. A. Underwood, L. P. Yomano, S. W. York, J. Zaldivar, and S. Zhou, 1999 "Enteric bacterial catalyst for fuel ethanol production" Biotechnol. Prog. 15:855-866). During aerobic and anaerobic carbohydrate metabolism, acetate is typically produced as a minor product. Recent successes have been reported in the engineering of E.coli strains for commodity chemicals such as propanediol (Nakamura, C. E., A. A. Gatenby, Hsu, A. K.- H., R. D. LaReau, S. L. Haynie, M. Diaz-Torres, D. E. Trimbur, G. M. Whited, V. Nagarajan, M. S. Payne, S. K. Picataggio, and R. V. Nair, 2000 "Method for the production of 1,3-propanediol by recombinant microorganisms" U.S. Patent No. 6,013,494; Tong, I., H. H. Liao, and D. C. Cameron, 1991 "1,3-propanediol production by Escherichia coli expressing genes from the Klebsiella-pneumoniae-DHA regulon" App. Env. Microbiol 57:3541-3546), adipic acid (Niu, W., K. M. Draths, and J. W. Frost, 2002 "Benzene-free synthesis of adipic acid" Biotechnol. Prog. 18:201-211), lactic acid (Chang, D., S. Shin, J. Rhee, and J. Pan, 1999 "Homofermentative production of D- or L- lactate in metabolically engineered Escherichia coli RR1" Appl. Environ. Microbiol
65:1384-1389; Dien, B. S., N. N. Nichols, and R. J. Bothast, 2001 "Recombinant Escherichia coli engineered for the production of L-lactic acid from hexose and pentose sugars" J. Ind. Microbiol. Biotechnol. 27:259-264), succinic acid (Donnelly, M. I., C. Sanville-Millard, and R. Chatterjee, 1998 "Method for construction of bacterial strains with increased succinic acid production" U.S. Patent No. 6,159,738; Nemuri, G. Ν., M.
A. Altman, and E. Altman, 2002 "Effects of growth mode and pyruvate carboxylase on succinic acid production by metabolically engineered strains of Escherichia coli" J. Bacteriol 68:1715-1727), and ethanol (Ingram, L. O., H. C. Aldrich, A. C. C. Borges, T.
B. Causey, A. Martinez, F. Morales, A. Saleh, S. A. Underwood, L. P. Yomano, S. W. York, J. Zaldivar, and S. Zhou, 1999 "Enteric bacterial catalyst for fuel ethanol production" Biotechnol. Prog. 15:855-866). In using these aerobic and anaerobic processes, the resultant production of acetate by the native pathway (phosphotransacetylase and acetate kinase) has generally been regarded as an undesirable consequence of excessive glycolytic flux (Akesson, M., P. Hagander, and J. P. Axelsson, 2001 "Avoiding acetate accumulation in Escherichia coli cultures using feedback control of glucose feeding" Biotechnol. Bioeng. 73:223-230; Aristidou, A. A., K. San, and G. Ν. Bennett, 1995 "Metabolic engineering of Escherichia coli to enhance recombinant protein production through acetate reduction" Biotechnol Prog. 11:475-478; Contiero, J.,
C. Beatty, S. Kumar, C. L. DeSanti, W. R. Strohl, and A. Wolfe, 2000 "Effects of mutations in acetate metabolism on high-cell-density growth of Escherichia coli" J. Ind. Microbiol. 24:421-430; Farmer, W. R., and J. C. Liao, 1997 "Reduction of aerobic acetate production by Escherichia coli 1997" Appl. Environ. Microbiol. 63:3205-3210).
Chao and Liao (Chao, Y., and J. C. Liao, 1994 "Metabolic responses to substrate futile cycling in Escherichia coli" J. Biol. Chem. 269:5122-5126) and Patnaik et al. (Patnaik, R., W. D. Roof, R. F. Young, and J. C. Liao, 1992 "Stimulation of glucose catabolism in Escherichia coli by a potential futile cycle" J. Bacteriol 174:7525-7532) demonstrated a 2-fold stimulation of glycolytic flux in E. coli using plasmids to express genes that created futile cycles to consume ATP.
Recently, Koebmann et al. (Koebmann, B. J., H. N. Westerhoff, J. L. Snoep, D. Νilsson, and P. R. Jensen, 2002 "The glycolytic flux in Escherichia coli is controlled by the demand for ATP" J. Bacteriol. 184:3909-3916) independently concluded that glycolytic flux is limited by ATP utilization during the oxidative metabolism of glucose. In their studies, flux increased in a dose-dependent manner with controlled expression of Fi ATPase from a plasmid. Thus glycolytic flux appears to be regulated by the economy of supply and demand as proposed by Hofmeyr and Cornish-Bowden (Hofmeyer, , J.-H.
S., and A. Cornish-Bowden, 2000 "Regulating the cellular economy of supply and demand" FEBS ed. 467:47-51).
Currently, only the two-part commercial process, the Ljungdahl-Wood pathway- containing Clostridia, as well as special yeast strains have been investigated as potential biocatalysts for the production of acetate. Due to the competing production of dicarboxylic acids and cell mass from glucose, the level of acetate production using these methods has been relatively low. Indeed, none of these methods have been reported to grow and produce acetate efficiently in mineral salts media containing sugar. In fact, each of these methods requires the use of complex nutrients, which ultimately increases the cost of materials, acetate purification, and waste disposal. Therefore, a need remains for better biocatalysts that efficiently produce acetate and other fermentation products using a mineral salts medium.
Pyruvic acid is currently manufactured for use as a food additive, nutriceutical, and weight control supplement (Li, Y., J. Chen, and S.-Y. Lun, 2001 "Biotechnological production of pyruvic acid" Appl. Microbiol Biotechnol. 57:451-459). Pyruvic acid can also be used as a starting material for the synthesis of amino acids such as alanine, tyrosine, phenylalanine, and tryptophan and for acetaldehyde production.
Pyruvate is produced commercially by both chemical and microbial processes. Chemical synthesis involves the decarboxylation and dehydration of calcium tartrate, a by-product of the wine industry. This process involves toxic solvents and is energy intensive with an estimated production cost of $8,650 per ton of pyruvate. Microbial pyruvate production is based primarily on two microorganisms, a multi-vitamin auxotroph of the yeast Torulopsis glabrata (Li, Y., J. Chen, and S.-Y. Lun, and X. S. Rui, 2001 "Efficient pyruvate production by a multi-vitamin auxotroph of Torulopsis glabrata: key role and optimization of vitamin levels" Appl. Microbiol Biotechnol.
55:680-68) and a lipoic acid auxotroph of Escherichia coli containing a mutation in the Fi ATPase component of (FιF0)H+-ATP synthase (Yokota, A., Y. Terasawa, N. Takaoka, H. Shimizu, and F. Tomita, 1994 "Pyruvic acid production by an Fi-ATPase- defective mutant of Escherichia coli W1485/zp2" Biosci. Biotech. Biochem. 58:2164- 2167). Both of these production strains require precise regulation of media composition during fermentation and complex supplements. The estimated production costs of pyruvate production by microbial fermentation with these strains is estimated to be 14.5 % ($1,255 per ton pyruvate) of that for chemical synthesis.
Recently, Tomar et al. (Tomar, A., M. A. Eiteman, and E. Altman, 2003 "The effect of acetate pathway mutations on the production of pyruvate in Escherichia coli."
Appl. Microbiol. Biotechnol. 62:76-82.2003) have described a new mutant strain of E. coli for pyruvate production. This strain contains three mutations, ppc (phosphoenolpyruvate carboxylase), aceF (pyruvate dehydrogenase), and adhE (alcohol dehydrogenase) and is capable of producing 0.65 grams pyruvate per gram of glucose using complex media supplemented with acetate.
Typical production rates of pyruvate for biocatalysts are around lg L"1 h"1 with yields exceeding half the weight of substrate. Torulopsis glabrata, the yeast strain currently used for the commercial production of pyruvate, can achieve pyruvate titers of 69 g L"1. As noted above, T. glabrata strains used in the commercial process are multivitamin auxotrophs requiring tight regulation of vitamin concentrations which result in complex vitamin feeding strategies during fermentation (Li, Y., J. Chen, and S.-Y.
Lun, 2001 "Biotechnological production of pyruvic acid" Appl Microbiol. Biotechnol.
57:451-459). Previous E. coli strains constructed for pyruvate production were cultured in complex media and have been plagued by low titers and yields (Tomar, A. et al. 2003, "The effect of acetate pathway mutations on the production of pyruvate in Escherichia coli." Appl. Microbiol. Biotechnol. 62:76-82; Yokota A. et al., 1994 "Pyruvic acid production by an Fi-ATPase-defective mutant of Escherichia coli W1485/zp2." Biosci.
Biotech. Biochem. 58:2164-6167).
Nutrients in culture medium often represent a major cost associated with commercial fermentations. The use of a mineral salts medium and inexpensive carbon source offers the potential to improve the economics of many biological processes by reducing the costs of materials, product purification, and waste disposal (Zhang, J. and R.
Greasham, 1999. Appl. Microbiol Biotechnol. 51:407-421).
There is a need in the art to identify and develop new, efficient, and environmentally friendly processes for producing specialty compounds.
Brief Summary The subject invention provides materials and methods wherein unique and advantageous combinations of gene mutations are used to direct carbon flow from sugars to a desired product. The techniques of the subject invention can be used to obtain products from native pathways as well as from recombinant pathways.
The materials and methods of the subject invention can be used to produce a variety of products with only mineral salts and sugar as nutrients. Useful products include pure acetic acid; 1,3-propanediol; 2,3-propanediol; pyruvate; dicarboxylic acids; adipic acid; amino acids, including aliphatic and aromatic amino acids; and alcohols including ethanol, butanol, isopropanol, and propanol. In preferred embodiments, the subject invention provides new materials and methods for the efficient production of acetate. In further preferred embodiments, the subject invention provides advantageous biocatalysts for acetate production and for pyruvate production. In a specific embodiment, the subject invention provides a recombinant derivative of Escherichia coli W3110 that contains six chromosomal deletions (focA-pflB frdBC IdhA atpFH sucA adhE). The resulting strain (TC36) exhibits approximately a 2-fold increase in maximal rates of acetate production (specific and volumetric) over W3110. This increase can be attributed to the mutation in the (FιF0)H+-ATP synthase, which eliminates ATP production by oxidative phosphorylation while retaining cytoplasmic Fi- ATP synthase for the gratuitous consumption of ATP.
TC36 produces acetic acid in mineral salts medium containing glucose with a yield of 68% of the maximum theoretical yield using native pathways (two acetates per glucose). Advantageously, TC36 is devoid of plasmids and antibiotic resistance genes.
Further embodiments of the subject invention provide additional derivatives of Escherichia coli W3110 as new biocatalysts for the production of homo-acetate. In one embodiment, homo-acetate production by the new strain, TC36, approaches the theoretical maximum of two acetates per glucose. Eliminating the fermentation pathways of W3110 resulted in the new strain SZ47 and doubled the loss of carbon as volatile products. While the rate of acetate production decreased in SZ47 as compared to W3110, the cell yield increased. The inactivation of oxidative phosphorylation (ΔatpFH) in SZ47 to produce TC24 resulted in a 5-fold increase in acetate yield and a 3-fold improvement in carbon recovery. In accordance with the subject invention, competing pathways are eliminated by chromosomal inactivation of genes encoding lactate dehydrogenase, pyruvate formatelyase, and fumarate reductase (Δ(focA-pflB)::FRT ΔfrdBC ΔldhA), (F]F0)H+-ATP synthase (atpFH), alcohol/aldehyde dehydrogenase (adhE), and 2-ketoglutarate dehydrogenase (sucA), which increases the production of acetate. Using a simple two-step batch feeding strategy can increase acetate production.
Specifically, a second addition of 3% glucose added at the end of the growth phase (12h) and metabolized to completion results in 78% of the theoretical maximum. A further increase in acetate production can be obtained by combining the two-step batch feeding strategy with a nitrogen limitation, which results in 86% of the theoretical maximum. The subject invention provides a method to reduce the loss of substrate carbon into cell mass and/or into carbon dioxide. Also, the subject invention provides a method to reduce oxygen demand during bioconversion process.
The use of mineral salts medium, lack of antibiotic resistance genes or plasmids, high yield of homo-acetate, and high product purity achieved according to the subject invention are advantageous because of reduced costs associated with nutrients, purification, containment, BOD, and waste treatment.
In an alternative embodiment, the subject invention provides a new biocatalyst for the efficient production of pyruvate from glucose that requires only simple mineral salts as nutrients.
Brief Description of the Figures
Figure 1 Diagram summarizing genetic modifications used to redirect glucose metabolism to acetate. Bold arrows mark principle metabolic routes in TC36. Reactions which have been blocked by gene deletions in TC36 are marked with solid circles. Genes encoding enzymes are shown in italics. A. Central carbon metabolism. Bold arrows indicate the primary pathway for acetate production from glucose in TC36. This strain produces a net of 4 ATP equivalents (~P) per glucose molecule. B. Oxidative phosphorylation. The ATPsynthase is inactive in TC36 although the electron transport system remains functional as the primary route for NADH oxidation in TC36 (bold arrows). C. Fi-ATPase remains active in TC36 for the regeneration of ADP but lacks subunits for membrane assembly.
Figure 2 Diagram summarizing plasmid constructions.
Figure 3 Effects of selected mutations on growth (A), glucose utilization (B), and base consumption (C). Symbols: ■, W3110 (wild type); D, SZ47(A(focA- pflB)::FRT AfrdBC AldhA ); O, TC24(A(focA-pflB)::FRT AfrdBC AldhA
Aatp(FH)::FRT) ; •, TC36 (succ+ ; A(focA-pflB)::FRT AfrdBC AldhA Aatp(FH)::FRT
AadhE: :FRT AsucA : :FRT).
Figure 4 Effects of selected mutations on the production of acetate (A), dicarboxylic acids (B), and pyruvate (C). Symbols: ■, W3110 (wild type); D, SZ47(A(focA-pflB)::FRT AfrdBC AldhA); O, TC24(A(focA-pβB)::FRT AfrdBC AldhA Aatp(FH)::FRT) ; •, TC36 (Succ+ ; A(focA-pflB)::FRT AfrdBC AldhA Aatp(FH)::FRT AadhE::FRT AsucA::FRT).
Figure 5 Fermentation of 6% glucose to acetate by TC36 in mineral salts medium. Fermentation was begun with 3% glucose followed by a second addition of 3% glucose after 12 h. Symbols: D, cell mass; O, glucose; •, acetate.
Figure 6 Summary of central metabolism in E. coli. A. Carbon metabolism. B. Oxidative phosphorylation. C. Cytoplasmic FiATPase subunit (active).
Figure 7 Effect of oxygen level on pyruvate production by TC36. Cells were inoculated into fermentation broth at 100% air saturation and continuously sparged with air until the oxygen levels declined to 5% saturation. At this time, oxygen was blended to maintain 5% saturation during the remaining period of incubation (open symbols). Alternatively, media was sparged with a mixture of air and nitrogen to provide 5% air saturation prior to inoculation and sparging switched to air and oxygen as needed to maintain 5% air saturation (closed symbols).
Figure 8 Batch fermentation of glucose by mutant strains of E. coli. A. Cell growth; B. Glucose utilization; C. Acetate production; D. Pyruvate production.
Brief Description of the Sequences SEQ ID NO:l is a sense primer used according to the subject invention.
SEQ ID NO:2 is an antisense primer used according to the subject invention.
Detailed Disclosure The subject invention provides materials and methods wherein unique and advantageous combinations of gene mutations are used to direct carbon flow to a desired product. The techniques of the subject invention can be used to obtain products from native pathways as well as from recombinant pathways.
Advantageously, the subject invention provides a versatile platform for the production of a variety of products with only mineral salts and sugar as nutrients. Useful products include pure acetic acid; 1,3-propanediol; 2,3-propanediol; pyruvate; dicarboxylic acids; adipic acid; and amino acids, including aliphatic and aromatic amino acids. In preferred embodiments, the subject invention provides new materials and methods for the efficient production of acetate.
In preferred embodiments, the subject invention provides strains of E. coli (lacking plasmids and antibiotic resistance genes) as biocatalysts for the production of chemically pure acetate and/or pyruvate. Unlike other acetate-producing microbial systems, the subject invention can employ a single step process using sugars as substrates, high rates of acetate production (almost two-fold higher), high acetate yields, simple nutrition requirements (mineral salts medium), and a robust metabolism permitting the bioconversion of hexoses, pentoses, and many dissacharides.
Specifically exemplified herein is a new E. coli biocatalyst containing six chromosomal deletions (ΔfocApflB ΔfrdCD ΔldhA ΔatpFH ΔsucA ΔadhE). The resulting strain (TC36) contains no plasmids or antibiotic resistance genes and produces high yields of acetate from glucose in a mineral salts medium. Further embodiments of the subject invention provide additional derivatives of
Escherichia coli W3110 as new biocatalysts for the production of acetate. Eliminating the fermentation pathways of W3110 resulted in the new strain SZ47 and doubled the loss of carbon as volatile products. While the rate of acetate production decreased in SZ47 as compared to W3110, the cell yield increased. The inactivation of oxidative phosphorylation (ΔatpFH) in SZ47 to produce TC24 resulted in a 5-fold increase in acetate yield and a 3-fold improvement in carbon recovery. Homo-acetate production by the new strain, TC36, approaches the theoretical maximum of two acetates per glucose.
The methods of the subject invention are particularly advantageous because, in a preferred embodiment, deletions (rather than mutations which simply change a sequence) are used to inactivate pathways. Deletions provide maximum stability; with deletions, there is no opportunity for a reverse mutation to restore function. Please note, however, that as used herein, "mutations" includes changes in sequence or deletions unless the context clearly indicates otherwise. Such changes or deletions in polynucleotide sequences are also referred to herein as genetic "modifications." For optimal acetate production in accordance with a specific embodiment of the subject invention, deletions in W3110 that inactivate oxidative phosphorylation (ΔatpFH), disrupt the cyclic function of the tricarboxylic acid cycle (ΔsucA), and eliminate all major fermentation pathways (ΔfocA-pflB, AfrdBC, AldhA, AadhE) are combined. One such strain, TC36, metabolizes sugars to acetate with the efficiency of fermentative metabolism, diverting a mimmum of carbon to cell mass (biocatalyst) and CO2, which results in extremely high product yields.
For improved acetic acid yields, a simple two-step batch feeding strategy can be used in which a second addition of 3% glucose is added at the end of the growth phase (12h). Further improved acetic acid yields can be obtained by combining this two-step batch feeding strategy with a nitrogen limitation.
Although production of homo-acetate using a recombinant gene is specifically exemplified herein, those skilled in the art having the benefit of the subject disclosure could utilize other genes (single genes or combinations), to produce alternative oxidized or reduced products.
The choice of genes for inactivation of competing fermentation pathways, as described herein, is important to maximize yield and minimize nutritional requirements. For example, carbohydrates can be anaerobically metabolized to acetic acid at substantially higher yields (3 acetates per glucose) by Clostridia (anaerobic) that contain the Ljungdahl-Wood pathway for acetogenesis (Berraud, C, 2000 "Production of highly concentrated vinegar in fed-batch culture" Biotechnol. Lett. 22:451-454; Ljungdahl, L. G., 1986, "The autotrophic pathway of acetate synthesis in acetogenic bacteria" Ann. Rev. Microbiol 40:415-450). Specifically, Clostridium thermoaceticum containing the Lungdahl-Wood pathway produce higher yields of acetate than TC36 (Cheryan, M., S. Parekh, M. Shah and K. Witjitra, 1997 "Production of acetic acid by Clostridium thermoaceticum" Adv. Appl. Microbiol. 43:1-33). As well, maximum titres with TC36 are lower than can be achieved by ethanol oxidation using Acetobacter in the two-step commercial process (Berraud, C, 2000 "Production of highly concentrated vinegar in fed-batch culture" Biotechnol. Lett. 22:451-454). However, the specific gene deletions of TC36 lead to acetate production rates almost two-fold higher than either of the aforementioned processes and require only mineral salts as nutrients.
E. coli TC36 offers a unique set of advantages over currently employed biocatalysts for the commercial production of acetate: a single step process using sugars as substrates, high rates of acetate production, high acetate yields, simple nutrition
(mineral salts medium), and a robust metabolism permitting the bioconversion of hexoses, pentoses, and many dissacharides.
In an alternative embodiment, the subject invention provides a new biocatalyst for the efficient production of pyruvate from glucose that requires only simple mineral salts as nutrients.
As discussed herein, in a preferred embodiment, the materials and methods of the subject invention provide at least the following advantages:
1. The ability to convert hexose and pentose sugars to acetate at very high carbon efficiency in mineral salts medium without the addition of complex nutrients. 2. The lack of plasmids, which may be lost during scale up. This results in a simplified process at less cost.
3. The absence of a need for antibiotic selection. This provides cost and public health advantages.
4. The absence of antibiotic resistance genes. This also provides a public health advantage.
Production of Acetate
Genetically modified E. coli W3110 was developed to produce acetic acid as the primary product from glucose during aerobic growth using only mineral salts as nutrients. The resulting biocatalyst (TC36) contains multiple chromosomal alterations (Figure 1) that direct carbon flow to acetate and mimmize carbon loss to cell mass, CO2, and alternative products. Strain TC36 is devoid of plasmids and antibiotic resistance genes, both potential advantages for commercial use. The subject invention provides an additional derivative of Escherichia coli W3110 as a new biocatalyst for the production of homo-acetate. Acetate production by this new strain (TC36) approaches the theoretical maximum of two acetate per glucose due to the disruption of oxidative phosphorylation.
Chromosomal deletions were used instead of point mutations to maximize stability. All antibiotic resistance genes and auxotrophic requirements were eliminated to permit growth in simple mineral salts medium. During oxidative metabolism, up to half of the substrate carbon can be converted to roughly equal amounts of cell mass and CO2 (Contiero, J., C. Beatty, S. Kumar, C. L. DeSanti, W. R. Strohl, and A. Wolfe, 2000 "Effects of mutations in acetate metabolism on high-cell-density growth of Escherichia coir J. Ind. Microbiol. 24:421-430; Neidhardt, F. C, J. L. Ingraham, and M. Schaechter, 1990 "Physiology of the bacterial cell: A molecular approach" Sinauer Associates, Inc.,
Sunderland, Mass.; Narma, A., B. W. Boesch, and B. O. Palsson, 1993 "Stoichiometric interpretation of Escherichia coli glucose catabolism under various oxygenation rates" Appl. Environ. Microbiol. 59:2465-2473) with minimal carbon flow into alternative products, such as acetate. To reduce the opportunity for excessive growth during oxidative metabolism,
ATP production from ΝADH oxidation (oxidative phosphorylation) can be eliminated (or substantially reduced) by deleting the portion of (F]Fo)H+-ATP synthase involved in membrane assembly while preserving a functional cytoplasmic Fi-ATPase to provide gratuitous hydrolysis of ATP. With this mutation, a maximum of 4 ATP molecules (net) can be produced per glucose (assumes all pyruvate is metablized to acetyl~CoA and acetate) as compared to a theoretical maximum of 33 ATP molecules for wild-type strains of E. coli. Substantial reduction refers to a greater than 80% reduction.
Excessive oxidation of substrate to CO2 and ΝADH production were eliminated by disrupting the cyclic function of the tricarboxylic acid cycle (AsucA) with the added benefit of reducing oxygen demand for ΝADH oxidation. Additional mutations were introduced to eliminate all major fermentation pathways as alternative routes for ΝADH oxidation, minimizing the formation of alternative products. The resulting strain, TC36, has absolute requirements for substrate level phosphorylation and for an external electron acceptor that can couple to the electron transport system during growth in mineral salts medium to maintain redox balance. With genetic blocks in all major fermentation pathways and oxidative phosphorylation, this strain is relatively insensitive to variations in dissolved oxygen.
The (F]F0)H+-ATP synthase and 2-ketoglutarate dehydrogenase mutations introduced into TC36 to miminize the levels of ATP and NAD(P)H from glucose under oxidative conditions would also be expected to promote glycolysis through native allosteric controls (Neidhardt, F. C, J. L. frigraham, and M. Schaechter, 1990 "Physiology of the bacterial cell: A molecular approach" Sinauer Associates, Inc., Sunderland, Mass.; Underwood, S. A., M. L. Buszko, K. T. Shanmugam, and L. O. Ingram, 2002 "Flux through citrate synthase limits the growth of ethanologenic Escherichia coli KO11 during xylose fermentation" Appl. Environ. Microbiol. 68:1071-
1081), providing a mechanism for the observed 2-fold increase in glycolytic flux as compared to W3110 (wild type).
With additional mutations in fermentation pathways, further metabolism of pyruvate was limited primarily to small biosynthetic needs and conversion to acetyl~CoA by the pyruvate dehydrogenase complex. Although pyruvate dehydrogenase is activated by low NADH, acetyl~CoA production may be limited by the availability of free CoA (note pyruvate accumulation in TC36 broth between 9 h and 15 h; Figure 4C). Resulting rises in pyruvate pools would serve as an allosteric activator of phosphotransferase (Suzuki, T., 1969 "Phosphotransacetylase of Escherichia coli B, activation by pyruvate and inhibition by NADH and certain nucleotides" Biochim. Biophys. Ada 191:559-569), the first committed step for acetate production, from acetyl~CoA. Gratuitous ATP hydrolysis by FI -ATPase should ensure the availability of ADP for the final step in acetate production catalyzed by acetate kinase (Figure 1). Excess pyruvate can also be directly oxidized to acetate by pyruvate oxidase (poxB), an enzyme that is induced during the latter stages of growth and by environmental stress (Chang, Y.-Y., A.-Y. Wang, and
J. E. Cronan, Jr., 1994 "Expression of Escherichia coli pyruvate oxidase (PoxB) depends on the sigma factor enocoded by the rpoS (katF) gene" Mol. Microbiol. 11:1019-1028). This enzyme may also contribute to acetate production by TC36.
Eliminating oxidative phosphorylation while preserving Fi ATPase resulted in a 2-fold increase in glycolytic flux (TC24 and TC36). In a specific embodiment, the subject invention utilizes strategies that delete subunits concerned with the membrane assembly of the (FιF0)H+-ATP synthase, create futile cycles for ATP consumption, or increase cytoplasmic levels of the ATPase activities, to decrease cell yield, increase metabolic flux, and increase product yield in bioconversion processes.
Strain TC36 can be used as a biocatalysis platform for the efficient production of oxidized products. Under conditions of glucose excess, strain TC36 produced a maximum of 878 mM acetate, 75% of the maximum theoretical yield or 0.50 g acetate per g glucose. Only cell mass and small amounts of organic acids were produced as co- products with acetate. It is likely that 878 mM acetate approaches the upper limit of tolerance for the metabolism in TC36. Concentrations as low as 50 mM acetate have been shown to induce a stress response in E. coli (Kirkpatrick, C, L. M. Maurer, N. Ε. Oyelakin, Y. N. Yoncheva, R. Maurer, and J. L. Slonczewski, 2001 "Acetate and formate stress: Opposite responses in the proteomes of Escherichia coir J. Bacteriol. 183:6466- 6477). The minimal inhibitory concentration for growth has been previously reported as
300- 400 mM acetate at neutral pH (Lasko, D. R., N. Zamboni, and U. Sauer, 2000 "Bacterial response to acetate challenge: a comparison of tolerance among species" Appl. Microbiol. Biotechnol. 54:243-247; Zaldivar, J., and L. O. Ingram, 1999 "Effects of organic acids on the growth and fermentation of ethanologenic Escherichia coli LY01" Biotechnol. Bioengin. 66:203-210).
Oxygen transfer often becomes limiting during aerobic bioconversion processes, promoting the accumulation of reduced products (Tsai, P. S., M. Nageli, and J. E. Bailey, 2002 "Intracellular expression of Vitreoscilla hemoglobin modifies microaerobic Escherichia coli metabolism through elevated concentration and specific activity of the cytochrome o" Biotechnol. Bioeng. 79:558-567; Varma, A., B. W. Boesch, and B. O.
Palsson, 1993 "Stoichiometric interpretation of Escherichia coli glucose catabolism under various oxygenation rates" Appl. Environ. Microbiol. 59:2465-2473). Synthesis of reduced products was eliminated by mutations in genes (ΔfocApflB ΔfrdCD ΔldhA AadhE) encoding the four major fermentation pathways. Excessive oxygen demand and NADH production were also reduced by a deletion in succinate dehydrogenase (sucAA). The resulting strain, TC36 (ΔfocApflBΔfrdCD ΔldhA ΔatpFH AsucA AadhE) metabolizes sugars to acetate with the efficiency of fermentative metabolism, diverting a minimum of carbon to cell mass (biocatalyst) and CO2. By replacing the acetate pathway, a variety of alternative oxidized products can be produced using the mutational strategies employed for the construction of TC36.
Genetically engineered E. coli TC36 can produce acetate in a simpler, single step process using glucose and mineral salts with titres and yields equivalent or higher than current batch processes. Although yields for TC36 were lower than those reported for Clostridium thermoaceticum which contain the Ljungdahl-Wood Pathway (Cheryan, M., S. Parekh, M. Shah and K. Witjitra, 1997 "Production of acetic acid by Clostridium thermoaceticum" Adv. Appl. Microbiol. 43:1-33) and maximum titres with TC36 are lower than can be achieved by ethanol oxidation using Acetobacter (Berraud, C, 2000 "Production of highly concentrated vinegar in fed-batch culture" Biotechnol. Lett. 22:451-454), acetate production rates by TC36 are almost two-fold higher than both and required only mineral salts as nutrients.
E. coli TC36 offers a unique set of advantages over currently employed biocatalysts for the commercial production of acetate: a single step process using sugars as substrates, high rates of acetate production, high acetate yields, simple nutrition (mineral salts), and a robust metabolism permitting the bioconversion of hexoses, pentoses, and many dissacharides.
Materials and Methods Bacterial strains and plasmids. Selected E. coli strains and plasmids are listed in Table 1.
Figure imgf000020_0001
Table 1. Strains and plasmids.
Strains & Plasmids Relevant Characteristics Reference pLOI2800 bla kan sucA Described herein pLOI2801 bla kan sucA::FRT-tet-FRT Described herein pLOI2802 bla kan adhE Described herein pLOI2803 bla kan adhE::FRT-tet-FRT Described herein pLOI2805 bla kan atpEFH Described herein pLOI2807 bla kan atpFH::FRT-tet-FRT Described herein
1 Ohta, K., D.S. Beall, J.P. Mejia, K.T. Shanmugam, and L.O. Ingram (1991) "Genetic improvement of Escherichia coli for ethanol production of chromosomal integration of Zymamonas mobilis genes encoding pyruvate decarboxylase and alcohol dehydrogenase II. Appl. Environ. Microbiol. 57:893-900.
2. Posfai, G., M. D. Koob, H. A. Kirkpatrick, and F. C. Blattner. 1997. Versatile insertion plasmids for targeted genome manipulations in bacteria: Isolation, deletion, and rescue of the pathogenicity island LEE of 'the Escherichia coli 0157:H7 genome. J. Bacteriol. 179:4426-4428.
3 Datsenko, K. A. and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coliK-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.
Working cultures of E. coli W3110 (ATCC 27325) derivatives were maintained on a mineral salts medium (per liter: 3.5 g KH2PO4; 5.0 g K2HPO4; 3.5 g (NH )2HPO4, 0.25 g MgSO4 * 7 H O, 15 mg CaCl2 ' 2 H2O, 0.5 mg thiamine, and 1 ml of trace metal stock) containing glucose (2% in plates; 3% in broth) and 1.5% agar. The trace metal stock was prepared in 0.1 M HC1 (per liter: 1.6 g FeCl3j 0.2 g CoCl2 ' 6 H2O, 0.1 g CuCl2, 0.2 g ZnCl2 ' 4 H2O, 0.2 g aMoO4, and 0.05 g H3BO3 ). MOPS (0.1 M, pH 7.1) was added to both liquid and solid media (autoclaved separately) when needed for pH control, but was not included in medium used for 10-L fermentations. Minimal medium was also prepared using succinate (1 g L"1) and glycerol (1 g L"1) as sole sources of carbon (nonfermentable). Succinate (1 g L"1) was added as a supplement to glucose- minimal medium when needed. During plasmid and strain construction, cultures were grown in Luria-Bertani (LB) broth or on LB plates (1.5% agar) (Sambrook, J. and D. W. Russell, 2001 "Molecular cloning: A laboratory manual" Cold Spring Harbor Press, Cold
Spring Harbor, NY). Glucose (2%) was added to LB medium for all strains containing mutations in
Figure imgf000021_0001
synthase. Antibiotics were included as appropriate (kanamycin, 50 mg L"1; ampicillin, 50 mg L"1; and tetracycline, 12.5 or 6.25 mg L"1). Fusaric acid plates were used to select for loss of tetracycline resistance. Genetic methods. Standard methods were used for plasmid construction, phage PI transduction, electroporation, and polymerase chain reaction (PCR) (Miller, J. H., 1992 "A short course in bacterial genetics: A laboratory manual and handbook for Escherichia coli and related bacteria" Cold Spring Harbor Press, Cold Spring Harbor, NY; Sambrook, J. and D. W. Russell, 2001 "Molecular cloning: A laboratory manual"
Cold Spring Harbor Press, Cold Spring Harbor, NY). Chromosomal DNA from E. coli W3110 (and derivatives) served as a template to amplify genes using primers complementary to coding regions (ORFmers) purchased from the Sigma Scientific Company (St. Louis, MO). PCR products were initially cloned into plasmid vector pCR2.1-TOPO. During plasmid constructions, restriction products were converted to blunt ends using either the Klenow fragment of DNA polymerase (5' overhang) or T4 DNA polymerase (3' overhang) as needed. Integration of linear DNA was facilitated by using pKD46 (temperature conditional) containing an arabinose-inducible red recombinase (Datsenko, K. A. and B. L. Wanner, 2000 "One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products" Proc. Natl Acad. Sci. USA 97:6640-6645). Integrants were selected for tetracycline resistance (6.25 mg L"1) and screened for appropriate antibiotic resistance markers and phenotypic traits. At each step, mutations were verified by analyses of PCR products and fermentation products. FRT-flanked antibiotic resistance genes used for selection were deleted using a temperature- conditional plasmid (pFT-A) expressing FLP recombinase from a chlortetracycline- inducible promoter (Martinez-Morales, F., A. G. Borges, A. Martinez, K. T. Shanmugam, and L. O. Ingram, 1999 "Chromosomal integration of heterologous DNA in Escherichia coli with precise removal of markers and replicons during construction" J. Bacteriol 181:7143-7148; Posfai, G., M. D. Koob, H. A. Kirkpatrick, and F. C. Blattner, 1997
"Versatile insertion plasmids for targeted genome manipulations in bacteria: Isolation, deletion, and rescue of the pathogenicity island LΕΕ of the Escherichia coli O157:H7 genome" J. Bacteriol. 179:4426-4428).
A removable tetracycline cassette (FRT-tet-FRT) was constructed (pLOI2065) which is analogous to the kanamycin cassette (FRT-kan-FRT) in pKD4 (Datsenko, K. A. and B. L. Wanner, 2000 "One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products" Proc. Natl Acad. Sci. USA 97:6640-6645). In both cassettes, flanking FRT sites are oriented in the same direction to allow efficient in vivo excision by FLP recombinanase (Posfai, G., M. D. Koob, H. A. Kirkpatrick, amd F. C. Blattner, 1997 "Versatile insertion plasmids for targeted genome manipulations in bacteria: Isolation, deletion, and rescue of the pathogenicity island LEE of the Escherichia coli O157:H7 genome" J. Bacteriol. 179:4426-4428). Plasmid pLOI2065 contains two EcoRI sites and two Smαl sites for isolation of the FRT-tet-FRT cassette. The sequence forpLOI2065 has been deposited in GenBank (Accession No. AF521666). Deletion of adhE. To construct an adhE mutant, the coding region (2.68 kbp) was amplified by PCR and cloned into pCR2.1-TOPO. The central region of adhE (1.06 kbp) was deleted using HincU (2 sites) and replaced with a 1.7 kbp Smal fragment from ρLOI2065 containing the FRT-tet-FRT cassette to produce pLOI2803. This plasmid was linearized by digestion with Pvul and Seal, and served as a template to amplify (adhE primers) the 3.17 kbp region containing adhE:: FRT-tet-FRT. Amplified DNA was purified and introduced into W3110 by electroporation. Recombinants from double crossover events were identified by antibiotic markers, confirmed by analysis of PCR and fermentation products. One clone was selected and designated TC20.
PI transduction was used to transfer a mutation (frdBC zid::T_\10) from SΕ1706 into SZ32, designated SZ35(Δ/oc-4-^ ?R::FRT AfrdBC zid::Tr_10). The tet gene was removed from SZ35 by fusaric acid selection to produce SZ40(AfocA-pβB:FRT AfrdBC).
Deletion oϊpflB. A focA-pflB::FRT mutation was constructed using the method of Datsenko and Wanner (Datsenko, K. A. and B. L. Wanner, 2000 "One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products" Proc. Natl. Acad. Sci. USA 97:6640-6645). Hybrid primers were designed which are complementary to E. coli chromosomal genes and to the antibiotic cassette (FRT-kan- FRT) in pKD4. The sense primer (TTACTCCGTATTTGCATAAAAA- CCATGCGAGTTACGGGCCTATAAGTGTAGGCTGGAGCTGCTTC) (SEQ ID NO.:l) consisted of an initial 45 bp (bold) corresponding to the -130 to -85 region of foe followed by 20 bp (underlined) corresponding to the primer 1 region of pKD4. The antisense primer TAGATTGAGTGAAGGTACGAGTAATAACGTCCTGCTGC-
TGTTCTCATATGAATATCCTCCTTAG1 (SEQ ID NO.:2) consisted of an initial 45 bp (bold) of the C-terminal end of pflB followed by 20 bp (underlined) corresponding to primer 2 region of pKD4. The FRT-kan-FRT cassette was amplified by PCR using these primers and pKD4 as the template. After purification, amplified DNA was electroporated into E. coli BW25113 (pKD46). The resulting kanamycin-resistant recombinant, pAH218, contained FRT-kan-FRT in the deleted region of pflB (46 bp remaining). A phage PI lysate prepared from AH218 (pflB::FRT-kan-FRT) was used to transfer this mutation into W3110 to produce strain SZ31 (pflB::FRT-kan-FRT). After verifying this mutation by analyses of PCR products, fermentation products, and antibiotic markers, the kan gene was removed from the chromosome by FLP recombinase using a temperature- conditional helper plasmid (pFT-A). After removal of helper plasmid by growth at 42°C, the resulting kanomycin-sensitive strain (focA-pflB::FRT) was designated SZ32.
Deletion of focA-pflB:FRT, frdBC, IdhA. The IdhAv.ΥwlQ mutation in E. coli SE2279 was transduced into E. coli W3110 using phage PI to produce strain SZ33. PI phage grown on SZ33 was used to transfer this mutation into SZ40(A(focA-pflB)::FRT AfrdCD) to produce SZ46. Tetracycline-sensitive derivatives of SZ46 were selected using fusaric acid medium. One clone was designated SZ47 (A(focA-pflB)::FRT AfrdBC AldhA). The AldhA mutation in SZ47 was confirmed by the absence of lactate in fermentation broth, an inability to grow anaerobically in glucose-minimal media, and by
PCR analysis using IdhA ORFmers (1.0 kbp for the wild type IdhA as compared to 1.1 kbp for SZ47). The slightly larger size of the amplified product from SZ47 is attributed to remnants of TnlO.
Deletion of atpFH. The atpEFH coding region of the atpIBEFHAGDC operon was amplified by PCR using primers (ORFmers, Sigma Scientific, St. Louis, MO) complementary to the 5'- end of the atpE gene and the 3'- end of the atpH . The amplified fragment (1.3 kbp) was cloned into pCR2.1-TOPO and one clone selected in which the atpEFH genes were oriented to permit expression from the lac promoter (pLOI2805; Figure 2). The atpF gene and 117 nucleotides at the 5' end of atpH gene were removed from pLOI2805 by digestion with Hpal and ifatEII (Klenow-treated). This region was replaced with a 1.7 kbp Smal fragment from pLOI2065 containing the FRT-tet-FRT cassette to produce pLOI2807 (Fig.2). After digestion with Seal, pLOI2807 served as a template for amplification of the atρEA(FH)::FRT-tet-FRT region (2.4 kbp) using the 5' atpE and 3' atpH primers. Amplified DNA was precipitated, digested again with Seal to disrupt any residual plasmid, and purified by phenol extraction. This DNA was introduced into E. coli W3110(pKD46) by electroporation while expressing red recombinase. Plasmid pKD46 was eliminated by growth at 42°C. Recombinants (double cross-over) were identified using antibiotic markers (tetracycline resistant; sensitive to ampicillin and kanamycin) and by the inability to grow on succinate-minimal plates or glycerol-minimal plates in the absence of glucose (fermentable carbon source).
Integration was further confirmed by PCR analysis using the 5' atpE primer and the 3' atpH primer (1.3 kbp fragment for W3110; 2.3 kbp fragment for mutants). One clone was selected and designated TC2\(Aatp(FH)::FRT-tet-FRT).
Phage PI was used to transduce the Aatp(FH)::FRT-tet-FRT mutation in TC21 to SZ47 and produce TC23. The tet gene was removed from TC23 by the FLP recombinase
(pFT-A). After elimination of pFT-A by growth at 42°C, the Aatρ(FH)::FRT mutation was further confirmed by PCR analysis using the 5' atpE primer and the 3' atpH primer (0.8 kbp for deletion and 1.3 kbp for SZ47). The resulting strain was designated TC24(AfocA-pflB::FRT AfrdBC AldhA AatpFH::FRT). Deletion of adhE. Phage PI was used to transduce the AadhE::FRT-tet-FRT mutation in TC20 to TC24 and produce TC30. Chromosomal integration was confirmed by PCR analysis using adhE primers (2.7 kbp for TC24 and 3.2 kbp for the AadhE::FRT- tet-FRT mutant). The tet gene was deleted from TC30 by FLP recombinase using pFT-A. After elimination of pFT-A by growth at 42°C, a clone was selected and designated TC31(A(focA-pflB)::FRT AfrdBC AldhA Aatp(FH)::FRT AadhE::FRT).
Deletion of part of sucA. The sucA coding region was amplified using ORFmers. The resulting 2.8 kbp PCR product was cloned into pCR2.1-TOPO to produce pLOI2800 (Figure 2) in which the sucA coding region was oriented to permit expression from the lac promoter. A 1.1 kbp fragment was removed from central region of sucA by digestion of pLOI2800 with SnαBI and -4ccl (Klenow-treated). This region was replaced with a 1.7 kbp Smαl fragment containing the FRT-tet-FRT cassette from pLOI2065 to produce pLOI2801 (Figure 2). Plasmid pLOI2801 was digested with Pvuϊ and Seal and used as a template to amplify the 3.3 kbp region containing sucA:: FRT-tet-FRT using sucA ORFmers. Amplified DNA was precipitated, digested with Pvul and Seal to disrupt any residual circular plasmid, and extracted with phenol. Purified DNA was electroporated into E. coli W3110(pKD46) while expressing red recombinase. Plasmid pKD46 was eliminated by growth at 42 °C. Disruption of sucA was confirmed by PCR analysis using sucA ORFmers (2.8 kbp fragment for wild type and 3.3 kbp for sucA ::FRTrtet-FRT mutants) and designated TC25. Phage PI was used to transduce the sucA ::FRT-tet-FRT mutation from TC25 into
TC31. Transfer was verified by PCR analysis (2.8 kbp for wild type sucA and 3.3 kbp for .SMC_4 ::FRT-tet-FRT mutants) and phenotype (succ~). Inactivation of 2-ketoglutarate dehydrogenase (AsucA) in this AfrdBC background resulted in an undesirable auxotrophic requirement for succinate (Succ~ ) during growth on glucose-minimal medium. The resulting strain was designated TC32(Succ~, A(focA-pflB)::FRT AfrdBC
AldhA Aatp(FH)::FRT AadhE::FRT AsucA::FRT-tet-FRT).
Elimination of Succ" mutants. Spontaneous Succ+ mutants of TC32 were readily obtained after serial transfers in glucose-minimal broth containing decreasing amounts of succinate (4 mM to 0.4 mM) followed by selection on glucose-minimal plates without succinate. Over 170 clones were recovered per ml of culture after enrichment, approximately 3% of viable cells. Ten clones were tested and all grew well in glucose minimal broth without succinate and produced acetate as the dominant product. One was selected (TC35) for deletion of the tet gene using the FLP recombinase. This deletion was confirmed by analysis of PCR products using sucA primers (3.3 kbp for TC35 and 1.8 kbp after tet deletion). The resulting strain was designated TC36 (Succ+, A(focA- pflB)::FRT AfrdBC AldhA Aatp(FH)::FRT AadhEv.FRT AsucA::FRT).
Total ATPase activity was examined in disrupted cell extracts of TC36 and W3110 (wild type). The activity in TC36 (0.355 U mg"1 protein) was equivalent to 71% of the unmodified parent (0.502 U mg"1 protein), confirming that Fi-ATPase was not inactivated by the AatpFHr.FRT mutation. This is similar to the levels of ATPase reported for an atpH mutant of E. coli which blocked membrane assembly and coupling to oxidative phosphorylation (Sorgen, P. L., T. L. Caviston, R. C. Perry, and B. D. Cain, 1998 "Deletions in the second stalk of F1F0-ATP synthase in Escherichia coli" J. Biol Chem. 273:27873-27878). Fermentation. Acetate production was examined in glucose-minimal medium containing 167 mM glucose using a New Brunswick Bioflow 3000 fermentor with a 10 L working volume (37°C, dual Rushton impellers, 450 rpm). Dissolved oxygen was maintained at 5% of air saturation (unless otherwise stated) by altering the proportion of N2 and O2. Broth was maintained at pH 7.0 by the automatic addition of 11.4 M KOH. For fed batch experiments, additional glucose was added from a sterile 60% stock. Three fed batch regimes were investigated: A. 3% glucose initially with the addition of 3% after 12 h (6% total); B. 6% glucose initially with the addition of 4% glucose after 16 h (10%) total); C. 3% glucose initially with multiple additions to maintain glucose levels above 100 mM. Seed cultures were prepared by inoculating colonies from a fresh plate (48 h) into
3 ml of glucose-minimal medium (13 x 100 mm tube) containing 0.1 M MOPS. After incubation for 14 h (120 rpm rotator), cultures were diluted 400-fold into 1-L baffled flask containing 200 ml of mineral salts medium (37°C, 280 rpm). When cells reached 1.5-2.2 OD550nm, sufficient culture volume was harvested (5000 rpm, 25 °C) to provide an inoculum of 33 mg dry cell weight L"1 in the 10-L working volume.
Broth samples were removed to measure organic acids, residual glucose, and cell mass. Volumetric and specific rates were estimated from measured values for glucose and acetate using Prism software (GraphPad Software, San Diego, CA). A smooth curve was generated with 10 points per min (Lowess method) to fit measured results. The first derivative (acetate or glucose versus time) of each curve served as an estimate of volumetric rate. Specific rates (mmoles L"1 h"1 mg"1 dry cell weight) were calculated by dividing volumetric rates by respective values for cell mass.
ATPase. Cells were grown for enzyme assays as described above for seed cultures. Upon reaching 0.75-1.0 OD55oπm , cultures were chilled on ice and harvested by centrifugation (8000 x g, 5 min at 4°C). Cell pellets were washed 5 times with 0.1 M Tris-HCl (pH 7.55), resuspended in 1 ml of this buffer, and broken using a model W220F ultrasonic cell disruptor (Heat Systems Ultrasonics, Plainview, NY, USA). Total ATPase activity in disrupted cell preparations was assayed at pH 7.55 essentially as described by Evans (Evans, D. J., Jr., 1969 "Membrane adenosine triphosphate of Escherichia coli: activation by calcium ion and inhibition by cations" J. Bacteriol. 100:914-922). Inorganic phosphate was measured by the method of Rathbun and Betlach (Rathbun, W. B., and M. V. Betlach, 1969 "Estimation of enzymatically produced orthophosphate in the presence of cysteine and adenosine triphosphate" Anal. Biochem. 20:436-445). Results represent an average for three cultures of each strain. Specific activity is expressed as μmol Pj released min"1 mg"1 protein.
Total ATPase activity was examined in disrupted cell extracts of TC36 and W3110 (wild type). The activity in TC36 (0.355 U mg"1 protein) was equivalent to 71% of the unmodified parent (0.502 U mg"1 protein), confirming that Fi-ATPase was not inactivated by the AatpFH::FRT mutation. This is similar to the levels of ATPase reported for an atpH mutant of E. coli which blocked membrane assembly and coupling to oxidative phosphorylation (Sorgen, P. L., T. L. Caviston, R. C. Perry, and B. D. Cain, 1998 "Deletions in the second stalk of F1F0-ATP synthase in Escherichia coli" J. Biol Chem. 273:27873-27878).
Analyses. Organic acids and glucose concentrations were determined using a Hewlett Packard HPLC (HP 1090 series II) equipped with a UN monitor (210 mn) and Rl detector. Products were separated using a Bio-Rad HPX 87H column (10 μl injection) with 4 mM H2SO4 as the mobile phase (0.4 ml min"1, 45 °C). Cell mass was estimated by measuring ODssonm (1-0 ODssonm is equivalent to 0.33 g L"1 dry cell weight) using a Bausch & Lomb Spectronic 70 spectrophotometer with 10 x 75 mm culture tubes as cuvettes. Protein concentration was determined using the BCA Protein Assay Kit from
Pierce (Rockford, IL).
Following are examples which illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted. Example 1 - Construction of a homo-acetate fermentation pathway in E. coli W3110.
Fermentation of sugars through native pathways in E. coli produces a mixture of organic acids, ethanol, CO2 and H2 (Figure 1). Acetate and ethanol are typically produced in approximately equimolar amounts from acetyl~CoA to provide redox balance (Clark, D. P., 1989 "The fermentation pathways of Escherichia coli. FEMS"
Microbiol. Rev. 63:223-234; de Graef, M. R., S. Alexeeva, J. L. Snoep, and M. J.
Teixiera de Mattos, 1999 "The steady-state internal redox state (NADH/NAD) reflects the external redox state and is correlated with catabolic adaptation in Escherichia coli" J.
Bacteriol 181:2351-2357). To construct a strain for homo-acetate production, removable antibiotic resistance genes were used to sequentially inactivate chromosomal genes encoding alternative pathways.
Inspection of native pathways in E. coli (Figure 1) indicated that the production of acetate and CO2 as sole metabolic products from glucose will require an external electron acceptor such as oxygen. Due to low oxygen solubility, however, it is difficult to satisfy the oxygen demand from active E. coli metabolism and a portion of substrate is typically converted to fermentation products such as lactate and ethanol. This problem was eliminated by combining deletions in genes encoding lactate dehydrogenase, pyruvate formatelyase, and alcohol/aldehyde dehydrogenase.
A deletion was inserted into the pflB gene, the IdhA gene, and the adhE gene of W3110. These mutations eliminated the production of CO2, lactate, and ethanol in 3% glucose-minimal media (Table 2)
Table 2. Comparison of metabolic rates.
Max Vol a Max Spec Max Vol 1 Max Spec
Specific Glucose Glucose b Acetate Acetate
Growth Utilization Utilization Production Production
Strain Rate μ) (mmol liter"1 h"1) (mmol h"1 g"1) (mmol liter"1 h"1) (mmol h"1 g"1)
W3110 0.87 18 9 9.5 10
SZ47 0.87 22 11 9 10
TC24 0.78 28 20 26 16
TC36 0.69 33 18 23 16
Maximum volumetric rates for glucose utilization and acetate production.
Maximim specific rates (dry cell weight basis) for glucose utilization and acetate production. Values for glucose represents a measure of maximal glycolytic flux.
Several different mutations can be used to block succinate production (Figure 1). During fermentation, the tricarboxlyic acid (TCA) pathway serves primarily as a source of carbon skeletons for biosynthesis. Previous experience with E. coli B strains (Ingram, L. O., H. C. Aldrich, A. C. C. Borges, T. B. Causey, A. Martinez, F. Morales, A. Saleh,
S. A. Underwood, L. P. Yomano, S. W. York, J. Zaldivar, and S. Zhou, 1999 "Enteric bacterial catalysts for fuel ethanol production." Biotechnol. Prog. 15:855-866) engineered for ethanol production has shown that a deletion in the frdABCD operon can be used as an alternative method to block succinate production by preventing the production of fumarate reductase. Thus, the deletion of the frdCD gene eliminates the production of succinate by reductive reactions.
The TCA cycle was further disrupted by the deletion of sucA (Figure 1) During oxidative growth, up to 50% of substrate carbon can be lost as CO2 (Neidhardt, F. C, J. L. Ingraham, and M. Schaechter, 1990 "Physiology of the bacterial cell: A molecular approach" Sinauer Associates, Inc., Sunderland, Mass.). This loss of carbon can be attributed in large measure to the high efficiency of the TCA cycle and the electron transport system (NADH oxidation). During fermentative metabolism, the production of CO2 and NADH are reduced primarily by strong repression of sucAB encoding 2- ketoglutarate dehydrogenase (Cunningham, L. and J. R. Guest, 1998 "Transcription and transcript processing in the sdhCDAB-sucABCD operon of Escherichia coli"
Microbiology 144:2113-2123; Park, S.-J., G. Chao, and R. P. Gunsalus, 1997 "Aerobic regulation of the sucABCD gene of Escherichia coli, which encode α-ketoglutarate dehydrogenase and succinyl coenzyme A synthetase: roles of ArcA, Fnr, and the upstream sdhCDAB promoter" J. Bacteriol. 179:4138-4142), disrupting the cyclic function of the TCA cycle. Deleting part of the sucA gene imposed a restriction in carbon flow through the TCA cycle.
Again, growth under oxidative conditions is characterized by conversion of up to 50% of substrate carbon to cell mass (Neidhardt, F. C, J. L. Ingraham, and M. Schaechter, 1990 "Physiology of the bacterial cell: A molecular approach" Sinauer Associates, Inc., Sunderland, Mass.). To reduce the potential drain of substrate into cell mass, a mutation was introduced into SZ47 that deleted portions of two subunits in
(FιF0)H+-ATP synthase concerned with assembly to the plasma membrane (Sorgen, P. L., T. L. Caviston, R. C. Perry, and B. D. Cain, 1998 "Deletions in the second stalk of F1F0- ATP synthase in Escherichia coli" J. Biol Chem. 273:27873-27878), disrupting oxidative phosphorylation while preserving the hydrolytic activity of Fi -ATPase in the cytoplasm. Thus, the strain is able to grow in minimal medium without a fermentable carbon source
(substrate level phosphorylation) and retains the ability to oxidize NADH by the electron transport system.
These deletions resulted in strain TC32, which required succinate for growth on glucose-minimal medium. Thus, spontaneous Succ+ mutants of TC32 were obtained by performing serial transfers in glucose-minimal broth containing decreasing amounts of succinate followed by selection on glucose-minimal plates without succinate.
The resulting strain, TC36 has absolute requirements for a fermentable carbon source (substrate level phosphoylation) and for an external electron acceptor that can couple to the electron transport system during growth in mineral salts medium to maintain redox balance. With genetic blocks in all major fermentation pathways and oxidative phosphorylation, this strain is relatively insensitive to variations in dissolved oxygen. TC36(dfocApflB ΔfrdCD ΔldltA ΔatpFH ΔsucA ΔadhE) metabolizes sugars to acetate with the efficiency of fermentative metabolism, diverting a minimum of carbon to cell mass (biocatalyst) and CO2. By replacing the acetate pathway, a variety of alternative oxidized products can be produced using the mutational strategies employed for the construction of TC36.
Example 2 - Effects of gene disruptions on growth and glycolytic flux. TC36 was genetically engineered for the production of acetate from carbohydrates such as glucose. Batch fermentations with pH control were used to compare the performance of this strain with W3110 (wild type) and two intermediate strains used for construction, SZ47 (ΔpflB,ΔfrdCD,ΔldhA) and TC24(ΔpflB,ΔfrdCD,ΔldhA ΔatpFH). Under 5% oxygen saturation and 3% glucose (37°C) test conditions, the broth pH was maintained at neutrality to minimize toxicity from undissociated acids (Chotani, G., T.
Dodge, A. Hsu, M. Kumar, R. LaDuca, D. Trimbur, W. Weyler, and K. Sanford, 2000 "The commercial production of chemicals using pathway engineering" Biochim. Biophys. Ada 1543:434-455).
Disruption of oxidative phosphorylation and the cyclic function of the tricarboxylic acid cycle, elimination of the primary fermentation pathways, and the production of acetate as the primary end-product from glycolysis had relatively little effect on the growth of E. coli. The maximum growth rates for strains W3110 (wild type) and SZ47 (lacking the three native fermentation pathways) were similar although the cell yield for SZ47 was higher (Figure 3A; Table 2 and Table 3). Inactivation of oxidative phosphorylation (ΔatpFH) resulted in a small reduction in growth rate and cell yield
(TC24). Cell yield and growth rate were lowest for strain TC36 containing additional mutations in 2-ketoglutarate dehydrogenase (AsucA) and alcohol dehydrogenase (AadhE), approximately 80% of the unmodified parent W3110.
Maximal rates for glucose utilization (specific and volumetric) were higher for TC36 and TC24 than for W3110 and SZ47 (Table 2). This increase in metabolic activity can be primarily attributed to the ΔatpFH mutation. ATP levels serve as an allosteric regulator of several key glycolytic enzymes (Neidhardt, F. C, J. L. Ingraham, and M. Schaechter, 1990 "Physiology of the bacterial cell: A molecular approach" Sinauer Associates, Inc., Sunderland, Mass.), and acetate kinase (Suzuki, T., 1969 "Phosphotransacetylase of Escherichia coli B, activation by pyruvate and inhibition by NADH and certain nucleotides" Biochim. Biophys. Ada 191:559-569). Differences between strains were particularly evident when comparing incubation times required to complete sugar metabolism (Figure 3B). With TC36 and TC24, glucose was exhausted in 16-18 h as compared to 26 h for SZ47 and 30 h for W3110. The maximum specific rate of glucose utilization (glycolytic flux) was 9 mmole h"1 g"1 dry cell weight in the unmodified parent (W3110), 20 mmole h"1 g"1 dry cell weight in TC24, and 18 mmole h"1 g"1 dry cell weight in TC36. The slightly lower glycolytic flux in TC36 as compared to TC24 may be related to the increase in ATP yield resulting from improvements in acetate yield (1 ATP per acetate). Assuming protein represents 55% of dry cell weight, maximal glycolytic flux in TC36 is approximately 0.55 μmoles glucose min"1 mg"1 protein.
The (F]Fo)H+-ATP synthase and 2-ketoglutarate dehydrogenase mutations introduced into TC36 to minimize the levels of ATP and NAD(P)H from glucose under oxidative conditions also promote glycolysis through native allosteric controls (Neidhardt, F. C, J. L. Ingraham, and M. Schaechter, 1990 "Physiology of the bacterial cell: A molecular approach" Sinauer Associates, Inc., Sunderland, Mass.; Underwood, S.
A., M. L. Buszko, K. T. Shanmugam, and L. O. Ingram, 2002 "Flux through citrate synthase limits the growth of ethanologenic Escherichia coli KO11 during xylose fermentation" Appl. Environ. Microbiol 68:1071-1081), providing a mechanism for the observed 2-fold increase in glycolytic flux as compared to W3110(wild type).
Example 3 - Production of other organic acids.
A substantial portion of glucose carbon was not recovered in the carbon balance (Table 3) for W3110 (40%) and SZ47 (80%). This loss is attributed to the production of volatile products by high flux through the tricarboxylic acid cycle (CO2) but may also include the reduction of acetyl~CoA to acetaldehyde and ethanol (Figure 1).
Figure imgf000034_0001
N-limited
TC36 3+3% glucose 3.8 523 21 <1 3 14 2 78 95 5% DO
TC36 3+3% glucose 3.0 572 33 <1 <1 <1 6 86 102 5% DO N-limited
TC36 6% glucose 4.18 415 47 0.3 <1 46 7 62 92 5% DO
TC36 6+4% glucose'1 4.5 767 37 0.5 <1 72 5 72 97 5% DO
TC36 Fed batch6 4.1 878 33 3.4 <1 <1 25 75 88 5% DO
* Concentrations in broth after all glucose had been depleted, except as noted.
'' Yield expressed as a percentage of the maximal theoretical yield (0.67 g acetate per g glucose).
' Carbon recovery represents the percentage of substrate carbon recovered. Recovered carbon was calculated as the sum of carbon in cell mass, fermentation products, and C02. '' In the final sample, 44 mM glucose was present. ' Excess glucose (9.5%) was added to fermentation to maintain levels above 100 mM; 107 mM glucose was present in the final sample.
Although ethanol was absent in broth samples from all pH-controlled fermentations (sparged at 1 L min"1), a small amount of ethanol (6 mM) was found in seed cultures of W3110 (shaken flasks). No ethanol was present in seed cultures of TC36, because of the mutation in alcohol dehydrogenase E (adhE). In W3110, the electron transport system (5% dissolved oxygen) and native fermentation pathways (Table 3) serve as complementary routes for NADH oxidation.
Eliminating the fermentation pathways to produce the strain SZ47, doubled the loss of carbon as volatile products (Table 3) through the TCA cycle. While SZ47 cell yield increased, the rate of acetate production in comparison to W3110 decreased (Table 2 and Table 3).
Strain W3110 accumulated the highest levels of dicarboxylic acids (primarily succinate and 2-ketoglutarate produced through the TCA cycle) during glucose metabolism, approximately 3-fold that of the engineered strains (Figure 4B). The order of appearance of dicarboxylic acids in the broth correlated with growth rate and the order in which each strain entered into stationary phase. Dicarboxylic acids were partially consumed as glucose levels declined, and may represent spillover products from excessive glycolysis during the transition from exponential to stationary phase. Although dicarboxylic acids were produced by each strain, no significant accumulation of pyruvate was observed for W3110, SZ47 or TC24. Pyruvate levels in the broth of TC36 increased (16 mM at 12 h) during the transition stage (Figure 4C). Although this pyruvate was subsequently metabolized, the excretion of pyruvate indicates that glucose uptake and glycolysis per se may not be limiting for acetate production. Because of the various mutations in TC36, metabolism of pyruvate is limited primarily to small biosynthetic needs and conversion to acetyl~CoA by the pyruvate dehydrogenase complex (Figure 1). Although pyruvate dehydrogenase is activated by low NADH, acetyl~CoA production may be limited by the availability of free CoA. Resulting rises in pyruvate pools (Figure 4C), would serve as an allosteric activator of phosphotransferase (Suzuki, T., 1969 "Phosphotransacetylase of Escherichia coli B, activation by pyruvate and inhibition by NADH and certain nucleotides" Biochim. Biophys. Ada 191:559-569), since phosphotransferase (pta) is the first committed step for acetate production from acetyl~CoA (Fig.l). Gratuitous ATP hydrolysis by FI -ATPase (Figure IC) should ensure the availability of ADP for the final step in acetate production catalyzed by acetate kinase (ackA) (Figure 1). Excess pyruvate can also be directly oxidized to acetate by pyruvate oxidase (poxB), an enzyme that is induced during the latter stages of growth and by environmental stress (Chang, Y.-Y., A.-
Y. Wang, and J. E. Cronan, Jr., 1994 "Expression of Escherichia coli pyruvate oxidase (PoxB) depends on the sigma factor enocoded by the rpoS (katF) gene" Mol. Microbiol. 11:1019-1028). Thus, pyruvate oxidase (poxB) may also contribute to acetate production by TC36. Total organic acid production can be measured by the consumption of base to maintain pH 7.0 (Figure 3C). Consistent with a more rapid glucose metabolism, TC24 and TC36 exhibit higher rates and maxima. In general, variations in glucose utilization were accompanied by corresponding changes in base utilization. Thus, a higher consumption of base corresponds to a higher utilization of glucose. The exponential nature of the early time points reflects growth of the biocatalysts.
Example 4 - Production of acetate.
Inactivation of oxidative phosphorylation (ΔatpFH ) in SZ47 to produce TC24 resulted in a 5-fold increase in acetate yield and a 3-fold improvement in carbon recovery, (Table 3), since less carbon was used in the production of cell mass. Acetate yield and carbon recovery increased by another 30% with the introduction of the sucA and adhE mutations to produce TC36. The sucA mutation disrupted the TCA cycle, while the adhE mutation blocked the production of ethanol; therefore, both mutations directed carbon atoms to the production of acetate instead of other competing products. With 3% glucose mineral salts medium, TC36 produced an average of 224 mM acetate in
16 h with only small amounts of other competing products (Table 2). This represents 68% of the maximum theoretical yield using native pathways (2 acetates per glucose), remaining carbon being divided between cell mass, dicarboxylic acids, and CO2.
The maximal rates of acetate production (specific and volumetric) were approximately 2-fold higher for TC24 and TC36 than for SZ47 and W3110 (Table 3), a difference which can be attributed solely to the mutation in the
Figure imgf000037_0001
synthase. This mutation eliminated ATP production by oxidative phosphorylation while retaining cytoplasmic (FιF0)H+-ATP synthase for the gratuitous consumption of ATP. Thus, less carbon was used in building cell mass, but rather carbon was efficiently directed to the assimilation of acetate.
The consumption of base to maintain pH 7.0 provides an overall measure of total organic acid production (Figure 3C). Higher rates and maxima for TC24 and TC36 are consistent with more rapid glucose metabolism. In general, variations in glucose utilization were accompanied by corresponding changes in base utilization. Thus, a higher consumption of base corresponds to a higher utilization of glucose. The exponential nature of the early time points reflects growth of the biocatalysts.
Example 5 - Improving acetate yields.
Dicarboxylic acids and cell mass were the dominant competing co-products from glucose. In order to evaluate the potential for process changes to improve acetate yield, experiments were conducted. Acetate yield was not improved by increasing the oxygen level from 5% dissolved oxygen to 15% dissolved oxygen, by reducing ammonia nitrogen (2 g L"1 ammonium phosphate) by 40% to limit growth, or by increasing the initial concentration of glucose from 3% to 6% (Table 3). However, a simple two-step batch feeding strategy was beneficial. A second addition of 3% glucose at the end of the growth phase (12 h) was metabolized to completion and produced 523 mM acetate with minimal increase in cell mass (Figure 5). Acetate yield for this two-step addition (6% total glucose) was 78% of the theoretical maximum as compared to 68% for 3% glucose. The highest acetate yield, 86% of the theoretical maximum, was obtained by combining the one-step addition of 3% glucose with the nitrogen limitation (Table 3). Additional fed-batch experiments were conducted in which multiple additions were made to glucose levels above 100 mM. With this approach, 878 mM acetate was produced representing 75% of the maximum theoretical yield (Table 3). Strain TC36 can be used as a biocatalysis platform for the efficient production of oxidized products. Under conditions of glucose excess, strain TC36 produced a maximum of 878 mM acetate, 75% of the maximum theoretical yield (Table 3) or 0.50 g acetate per g glucose. Along with the acetate, only cell mass and small amounts of organic acids were produced. It is likely that 878 mM acetate approaches the upper limit of tolerance for the metabolism in TC36.
Concentrations as low as 50 mM acetate have been shown to induce a stress response in E. coli (Kirkpatrick, C, L. M. Maurer, N. Ε. Oyelakin, Y. N. Yoncheva, R. Maurer, and J. L. Slonczewski, 2001 "Acetate and formate stress: Opposite responses in the proteomes of Escherichia coli" J. Bacteriol. 183:6466-6477). The minimal inhibitory concentration for growth has been previously reported as 300- 400 mM acetate at neutral pH (Lasko, D. R., N. Zamboni, and U. Sauer, 2000 "Bacterial response to acetate challenge: a comparison of tolerance among species" Appl. Microbiol. Biotechnol. 54:243-247; Zaldivar, J., and L. O. Ingram, 1999 "Effects of organic acids on the growth and fermentation of ethanologenic Escherichia coli LY01" Biotechnol. Bioengin. 66:203-
210). Oxygen transfer often becomes limiting during aerobic bioconversion processes, promoting the accumulation of reduced products (Tsai, P. S., M. Nageli, and J. E. Bailey, 2002 "Intracellular expression of Vitreoscilla hemoglobin modifies microaerobic Escherichia coli metabolism through elevated concentration and specific activity of the cytochrome o" Biotechnol. Bioeng. 79:558-567; Narma, A., B. W. Boesch, and B. O.
Palsson, 1993 "Stoichiometric interpretation of Escherichia coli glucose catabolism under various oxygenation rates" Appl. Environ. Microbiol. 59:2465-2473).
Synthesis of reduced products was eliminated by mutations in genes (ΔfocApflB ΔfrdCD ΔldhA AadhE) encoding the four major fermentation pathways. Excessive oxygen demand and ΝADH production were also reduced by a deletion in succinate dehydrogenase (sucAA). The resulting strain, TC36(ΔfocApflBΔfrdCD ΔldhA ΔatpFH AsucA AadhE) metabolizes sugars to acetate with the efficiency of fermentative metabolism, diverting a minimum of carbon to cell mass (biocatalyst) and CO2. By replacing the acetate pathway, a variety of alternative oxidized products can be produced - using the mutational strategies employed for the construction of TC36. E. coli TC36 offers a unique set of advantages over currently employed biocatalysts for the commercial production of acetate: a single step process using sugars as substrates, high rates of acetate production, high acetate yields, simple nutrition
(mineral salts), and a robust metabolism permitting the bioconversion of hexoses, pentoses, and many dissacharides.
Example 6 - Production of Pyruvic Acid
Materials and Methods Microorganisms and media. Strains and plasmids used according to this
Example 6 are listed in Table 4. Working cultures of E. coli W3110 (ATCC 27325) and derivatives were maintained on a minimal medium containing mineral salts (per liter: 3.5 g KH2PO4; 5.0 g K2HPO4; 3.5 g (NH4)2HPO4, 0.25 g MgSO4- 7 H20 , 15 mg CaCl2 2 H2O, 0.5 mg thiamine, and 1 ml of trace metal stock), glucose (2% in plates; 3%> in broth), and 1.5% agar. The trace metal stock was prepared in 0.1 M HCl (per liter: 1.6 g
FeCl3) 0.2 g CoCl2 6 H2O, 0.1 g CuCl2, 0.2 g ZnCfc 4 H2O, 0.2 g NaMoO4, and 0.05 g H3BO ). MOPS (0.1 M, pH 7.4) was added to both liquid and solid media when needed for pH control, but was not included in pH-controlled fermentations. During plasmid and strain construction, cultures were grown in Luria-Bertani (LB) broth or on LB plates (1.5% agar) (Miller, J.H. 1992). Glucose (2%) was added to LB medium for all strains containing mutations in
Figure imgf000039_0001
synthase. Antibiotics were included as appropriate (kanamycin, 50 mg L"1; ampicillin, 50 mg L"1; apramycin, 50 mg L"1; and tetracycline, 12.5 or 6.25 mg L"1).
Genetic Methods. Standard methods were used for plasmid construction, phage PI transduction, electroporation, and polymerase chain reaction (PCR) (Miller, J. H.,
1992 "A short course in bacterial genetics: A laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor Press, Cold Spring Harbor, NY; Sambrook, J. and D. W. Russell, 2001 Molecular cloning: A laboratory manual. Cold Spring Harbor Press, Cold Spring Harbor, NY). Chromosomal DNA served as a template to amplify ackA and poxB genes using primers (ORFmers) complementary to coding regions purchased from Sigma-Genosys, Inc. (The Woodlands, TX). PCR products were initially cloned into plasmid vector pCR2.1-TOPO.. Integration of linear DNA was facilitated by using pKD46 (temperature conditional) containing an arabinose- inducible Red recombinase (Datsenko, K.A. & Wanner, B.L. 2000). Integrants were selected for tetracycline (6.25 mg L"1) resistance and screened for appropriate antibiotic resistance markers and phenotypic traits. At each step, mutations were verified by analyses of PCR products and fermentation profiles. The ER-T-flahked antibiotic resistance genes used for selection were deleted using a temperature-conditional plasmid (pFT-A) expressing FLP recombinase from a chlortetracycline-inducible promoter (Martinez-Morales, F., A. G. Borges, A. Martinez, K. T. Shanmugam, and L. O. Ingram,
1999 "Chromosomal integration of heterologous DNA in Escherichia coli with precise removal of markers and replicons during construction" J. Bacteriol. 181:7143-7148; Posfai, G., M. D. Koob, H. A. Kirkpatrick, and F. C. Blattner, 1997 "Versatile insertion plasmids for targeted genome manipulations in bacteria: Isolation, deletion, and rescue of the pathogenicity island LEE of the Escherichia coli O157:H7 genome" J Bacteriol.
179:4426-4428).
Disruption of pyruvate oxidase (poxB). The poxB coding region (1.7 kbp) was amplified by PCR using primers (ORFmers) obtained from Sigma-Genosys (The Woodlands, Texas) and ligated into ρCR2.1-TOPO. A single clone was selected in which the poxB gene was oriented in the same direction as the lac promoter (pLOI2075). To eliminate extraneous BsaBI sites in the vector, the EcoRI fragment from pLOI2075 containing poxB was ligated into the unique EcoRI site of pLOI2403 to produce plasmid pLOI2078. The small Smαl fragment (1.63 kbp) from pLOI2065 containing a tet gene flanked by FRT sites was ligated into the unique BsaBI site within the poxB gene in pLOI2078 to produce pLOI2080. After digestion with Hindill, pLOI2080 served as a template for the amplification of poxB::FRT-tet-FRT (3.4 kbp) using poxB primers. Amplified DNA was electroporated into E. coli W3110(pKD46) while expressing Red recombinase. Plasmid pKD46 was eliminated by incubation at 42°C. Double crossover recombinants were identified using antibiotic markers (tetracycline resistant; sensitive to ampicillin and kanamycin) and confirmed by PCR analysis using the poxB ORFmers (1.7 kbp fragment for W3110; 3.4 kbp fragment for mutants). One clone was selected and designated LY74.
Phage PI was used to transduce the poxB::FRT-tet-FRT mutation from LY74 into TC36 to produce TC41. The tet gene was removed from TC41 using the FLP recombinase (pFT-A). After elimination of pFT-A by growth at 42°C, the/?oxR::ERrwas confirmed by a comparison of PCR products using poxB primers (1.8 kbp for the mutant; 1.7 kbp for the wild type). The resulting strain was designated TC42 \(focA-pflB::FRT) frdBC: :FRT IdhA atpFH: :FRTadhE: :FRTsucA : :FRTpoxB: :FRT .
Table 4. Sources and characteristics of strains and plasmids used in Example 6.
Strains/Plasmids Relevant Characteristics Reference
Strains
W3110 K12 wild type ATCC 27325
TOP10F' lacP (episome) Invitrogen
LY01 E. coli B,frdpfl::pdczm adhEzm cat Footnote1
LY74 W3110, ApoxB::FRT-tet-FRT Described herein
SZ61 W3110, AackA::FRT-tet-FRT Footnote2
TC36 W3110, (Succ+), A(focA-pflB)::FRT AfrdBC AldhA Footnote3 Aatp(FH) : :FRT AadhE: :FRT AsucA : :FRT
TC37 W3110, (Succ+), A(focA-pflB)::FRT AfrdBC AldhA Described herein Aatp(FH)::FRT AadhE::FRT AsucA::FRT AackA::FRT- tet-FRT
TC38 W3110, (Succ+), A(focA-pflB)::FRT AfrdBC AldhA Described herein Aatp(FH)::FRT AadhE::FRT AsucA::FRT AackA::FRT
TC41 W3110, (Succ+), A(focA-pflB)::FRT AfrdBC AldhA Described herein Aatp(FH)::FRT AadhE::FRT sucA::FRT ApoxB::FRT- tet-FRT
TC42 W3110, (Succ+), A(focA-pflB)::FRT AfrdBC AldhA Described herein Aatp(FH)::FRT AadhE::FRT sucA::FRT ApoxB::FRT
TC43 W3110, (Succ+), A(focA-pflB)::FRT AfrdBC AldhA Described herein Aatp(FH)::FRT AadhE::FRT AsucA::FRT ApoxB::FRT AackA::FRT-tet-FRT
TC44 W3110, (Succ+), A(focA-pflB)::FRT AfrdBC AldhA Described herein Aatp(FH)::FRT AadhE::FRT AsucAv.FRT ApoxB::FRT AackA::FRT
Plasmids pCR2.1-TOPO bla kan, TOPO 1M TA cloning vector Invitrogen pFT-A blaflp low-copy vector containing recombinase and Footnote4 temperature-conditional pSClOl replicon pKD46 bla γ β exo low-copy vector containing red recombinase Footnote3 and temperature-conditional pSClOl replicon pLOI2065 bla, Smal fragment with ERJ flanked tet gene Footnote0 pLOI2075 bla kanpoxB Described herein pLOI2078 blapoxB Described herein pLOI2080 bla poxB::FRT-tet-FRT Described herein pLOI2403 bla Footnote'
Yomano, L. P., S. W. York, and L. O. Ingram. 1998. Isolation and characterization of ethanol-tolerant mutants of Escherichia coli KOI 1 for fuel ethanol production. J. Ind. Microbiol. Biot. 20: 132-138. 2' Zhou, S., T. B. Causey, A. Hasona, K. T. Shanmugam and L. 0. Ingram.2003. Production of optically pure D- lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110. Appl. Environ. Microbiol. 69:399-407. Causey, T. B., S. Zhou, K. T. Shanmugam, L. O. Ingram. 2003. Engineering Escherichia coli W3110 for the conversion of sugar to redox-neutral and oxidized products: Homoacetate production. Proc. Natl. Acad. Sci, USA.
100:825-832.
4 4 Posfai, G., M. D. Koob, H. A. Kirkpatrick, and F. C. Blattner. 1997. Versatile insertion plasmids for targeted genome manipulations in bacteria: Isolation, deletion, and rescue of the pathogenicity island LEE of the Escherichia coli 0157:H7 genome. J. Bacteriol.
Datsenko, K. A. and B. L. Wanner.2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.
Underwood, S. A., S. Zhou, T. B. Causey, L. P. Yomano, K.T. Shanmugam, and L. O. Ingram.2002. Genetic changes to optimize carbon partitioning between ethanol and biosynthesis in ethanologenic Escherichia coli. Appl. Environ. Microbiol. 68:6263-6272. η
Martinez-Morales, F., A. G. Borges, A. Martinez, K. T. Shanmugam, and L. O. Ingram. 1999. Chromosomal integration of heterologous DNA in Escherichia coli with precise removal of markers and replicons during construction. J. Bacteriol. 181:7143-7148.
Deletion of ackA (acetate kinase). Phage PI was used to transduce the ackA::FRT-tet-FRT mutation from SZ61 (Zhou, S., T. B. Causey, A. Hasona, K. T. Shanmugam and L. O. Ingram, 2003 "Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110" Appl.
Environ. Microbiol. 69:399-407) into TC36 and TC42 to produce strain TC37 [(focA- pflB::FRT) frdBC::FRT . IdhA ,atpFH::FRT adhE::FRT sucA::FRT ackA::FRT-tet-FRT and TC43 [(focA-pflB::FRT) frdBC::FRT . IdhA atpFH::FRT adhE::FRT sucA::FRT poxBv.FRT ackA::FRT-tet-FRT, respectively. Chromosomal integration was verified by comparison of PCR products obtained from SZ61(2.8 kbp) and W3110 (1.2 kbp) using ackA primers (ORFmers, Sigma-Genosys). A reduction in acetate production was verified for each strain by HPLC analysis of broth obtained from overnight cultures grown in mineral salts medium containing 167 mM glucose (37°C,120-rpm). Plasmid pFT-A containing the FLP recombinase was used to excise the tet genes. After removal of this plasmid by incubation at 42°C, resulting strains were designated TC38 (focA-pflB::FRT) frdBC::FRT . IdhA atpFH::FRT adhE::FRT sucA::FRT ackA::FRT) and TC44 [(focA- pflB: :FRT) frdBC: :FRT IdhA atpFH: :FRTadhE: :FRTsucA::FRT poxBv.FRT ackA : :FRT\, respectively.
Fermentation. Ten-liter batch fermentations (37°C, dual Rushton impellers, 450 rpm) with strain TC36 were conducted in minimal medium containing glucose (170 mM and 340 mM) using New Brunswick Bioflow 3000 fermentors (New Brunswick Scientific) as described previously (Causey, T. B., S. Zhou, K. T. Shanmugam, L. O. Ingram, 2003 "Engineering Escherichia coli W3110 for the conversion of sugar to redox- neutral and oxidized products: Homoacetate production" Proc. Natl. Acad. Sci, USA 100:825-832). Five-liter batch fermentations (37°C, dual Rushton impellers, 350 rpm) were carried out in 8 L vessels. Unless stated otherwise, dissolved oxygen levels were 100% of air saturation at the time of inoculation and allowed to fall to 5 % of air saturation during continuous sparging with air (0.2 wm). This 5% level was maintained during subsequent incubation by mixing O2 with air while maintaining a constant flow rate of 1.0 L min"1. Broth was maintained at pH 7.0 by the automatic addition of 11.4 M KOH. During fed-batch experiments, glucose was added from a sterile 4 M stock. Two fed batch regimes were investigated: 1) 3% initial glucose followed the addition of 3%> glucose after 15 h (6 % total); 2) 3% initial glucose with the addition of 590 ml of 4 M glucose at a constant rate over a 20-h period (9.8 % total glucose). Seed cultures were prepared by inoculating colonies from a fresh plate (48 h) into
3 ml of glucose-minimal medium (13 x 100 mm tube) containing 0.1 M MOPS. One ml of this cell suspension was diluted 100-fold into 1-L baffled flasks containing 200 ml of mineral salts medium (37°C, 280 rpm). When cells reached 1.0-1.5 OD550nm, sufficient culture volume was harvested (5000 x g, 25°C) to provide an inoculum of 16.5 mg dry cell weight L'1.
Broth samples were removed to measure organic acids, residual glucose, and cell mass. Volumetric and specific rates were estimated from measured values for glucose and acetate using GraphPad Prism (GraphPad Software, San Diego, CA). A smooth curve was generated with 10 points per min (Lowess method) to fit measured results. The first derivative (acetate or glucose versus time) of each curve served as an estimate of volumetric rate. Specific rates (mmoles L"1 h"1 mg"1 dry cell weight) were calculated by dividing volumetric rates by respective values for cell mass.
Analyses. Organic acids and glucose were measured using a Hewlett Packard HPLC (HP 1090 series II) equipped with a UN monitor (210 nm) and refractive index detector. Products were separated using a Bio-Rad HPX-87H column (10 μl injection) with 4 mM H2SO4 as the mobile phase (0.4 ml min"1, 45°C). Cell mass was estimated by measuring ODssonm (1.0 OD550nm is equivalent to 0.33 g L"1 dry cell weight) using a Bausch & Lomb Spectronic 70 spectrophotometer and 10 x 75 mm culture tubes as cuvettes.
Results and Methods Pyruvate as a co-product during acetate fermentations. Escherichia coli TC36 (pflB frdBC . IdhA atpFH adhE sucA), as described above, was engineered from W3110 (prototrophic) for the production of acetate (Figure 6A) by combining chromosomal deletions which minimize cell yield, fermentation products (reduced), oxygen consumption, and CO2 evolution (Causey, T.B. et al. 2003). In this strain, glycolytic flux was 2-fold that of the parent W3110 due to deletion of genes (atpFH) encoding two membrane proteins that coupling the Fi and F0 components of the FιF0(H+)ATP synthase complex. This mutation eliminated ATP production by oxidative phosphorylation and also created an active, cytoplasmic Fι(H+) ATPase (Figure 6B and
6C). Glycolytic flux in TC36 exceeded the capacity for acetate production under the conditions used for acetate production (5% air saturation at inoculation and during fermentation) resulting in the transient accumulation of approximately 16 mM pyruvate near the end of exponential growth (Figure 7).. By inoculating the fermentor at an initial dissolved oxygen level of 100% air saturation (rather than 5% of saturation) and sparging with air until the oxygen level declined from 100% to 5%> air saturation, then adding oxygen to maintain 5% of air saturation, the peak level of pyruvate of was increased to 81 mM (Figure 7). Under these conditions, pyruvate yields were 25% of the maximum theoretical yield at the peak and 11 % of the maximum theoretical yield at the end of fermentation when glucose was fully metabolized (Table 5).
Effect of an acetate kinase (ackA) mutation on pyruvate production. Although there are many metabolic routes that can lead to acetate, the primary catabolic routes for acetate production in E. coli are the conversion of acetyl~CoA to acetate by phosphotransacetylase (pta) and acetate kinase (ackA) and the direct oxidation of pyruvate to acetate by pyruvate oxidase (poxB) (Figure 6A).
To block the acetate kinase route, strain TC38 was constructed from TC36 by deleting the central region of the ackA gene. This additional deletion reduced the net production of ATP by 30% (Figure 6A), cell yield by 36% (Figure 8A; Table 5), and the rate of growth by 45% (Table 6). This mutation also reduced glycolytic flux by 45%
(Table 6) and increased the time required to complete fermentations from 18 h for TC36 to 24 h for TC44 (Figure 8B). Acetate production was reduced by 85% (Figure 8C; Table 5), consistent with the acetate kinase pathway being the dominant route for acetate production in TC36. Although both volumetric and specific rates of glucose metabolism were lower for TC38 (Table 6), the pyruvate yield was 5.5-fold higher (Table 5; Figure 8D) and the specific rate of pyruvate production was 4-fold higher (Table 6) than for TC36. Small amounts of 2-oxoglutarate, succinate, and fumarate were produced by both strains. From 10% to 15% of the carbon was not recovered as cell mass or acidic fermentation products and may have been lost as CO2 due to metabolic cycling. With strain TC38, the pyruvate yield was 58% of the theoretical maximum. Acetate (28.9 mM) remained as the second most abundant product.
Effect of a pyruvate oxidase (poxB) mutation on pyruvate production. Pyruvate can be converted directly to acetate by the membrane-bound protein pyruvate oxidase using the electron transport system to couple oxygen as the terminal electron acceptor. The poxB gene is typically repressed during exponential growth but is induced by stress or entry into stationary phase (Chang, Y.-Y. and J. E. Cronan Jr. 1983; Chang, Y.-Y. et al. 1994). Strain TC42 was constructed from TC36 by inserting a short DNA segment containing stop codons into the central region of poxB. In contrast to the ackA deletion (TC38), f epoxB mutation (TC42) caused relatively small changes in metabolic products (Table 5) consistent with a minor role for the PoxB pathway. Acetate levels for TC42 were 10% lower and pyruvate levels were higher than for TC36 (Table 5; Figure 8C and 8D). Although this represented a 2-fold improvement in pyruvate yield over TC36, the overall yield for pyruvate with TC42 was less than 30% of the theoretical maximum (Table 5). These changes in metabolic products would have little effect on ATP yields (Figure 6A). Unlike the mutation in ackA, inactivation of poxB did not reduce the rate of growth or glucose metabolism (Figure 6A; Table 6). Effect of combining mutations in pyruvate oxidase (poxB) and acetate kinase
(ackA) on the production of pyruvate. To improve pyruvate yield and reduce acetate production, strain TC44 (pflB frdBC . IdhA atpFH adhE sucA poxB::FRT ackA) was constructed in which both acetate kinase and pyruvate oxidase are inactive. Inactivation of poxB was beneficial for growth and pyruvate production (Figure 8A; Table 5 and Table 6) in comparison to TC38, an isogenic strain containing a functional poxB. Adding the poxB mutation substantially restored both volumetric and specific rates of glucose metabolism to that observed for TC36 (Table 6) in which both acetate pathways are functional, while further reducing acetate production. Acetate production by TC44 was reduced by more than half in comparison to TC38 (acetate kinase deletion) and pyruvate yield was increased by 17%. The specific rate of pyruvate production by TC44 was 8- fold that of TC36 and twice that of TC38 (Table 5). The time required to complete fermentation with TC44 was 30 % shorter than with TC 38 (Figure 8B). Broth containing 3%> glucose (167 mM) was converted into 2.2% pyruvate (252 mM) after 18 h in mineral salts medium (Figure 8D). Although acetate levels were substantially reduced by the combining of poxB and ackA mutation (Figure 8C), acetate and dicarboxylic acids remained as minor products.
The beneficial role of apoxB mutation for pyruvate production. The pyruvate oxidase catalyzed oxidation of pyruvate to acetate (and CO2) also contributes to the requirement for oxygen as an electron acceptor. Oxygen transfer rates are frequently limiting during aerobic fermentations at relatively high levels of saturation, and may be even more problematic under fermentation conditions (5%> of air saturation). Eliminating the primary route for acetyl~CoA dissimilation (ackA) in TC38 increased pyruvate production and may also increase the amount of pyruvate that is metabolized by PoxB. Increasing oxygen saturation from 5%> to 50% during TC38 fermentations (Table 5 and Table 6) was beneficial. Cell yield, pyruvate yield, and the specific rate of glucose metabolism were 8% to 41% higher for TC38 at 50%> air saturation than at 5% air saturation. These results were very similar to those observed for the isogenic poxB mutant, TC44, during fermentation at 5% air saturation. Increasing the oxygen saturation during TC38 fermentations also decreased the final concentrations of acetate to a level equivalent to TC44 at 5% air saturation and decreased the production of dicarboxylic acids. As with TC44, low levels of acetate and dicarboxylic acids were also present at the end of fermentation with TC38 (50% air saturation) (Table 5).
Improving pyruvate yields and titers in TC44 by altering fermentation conditions. With TC44 decreasing the ammonia level by half did not increase product yields (Table 5). Doubling of the initial concentration of glucose or providing a second addition of glucose (3% plus 3%) resulted in a small increase (11%) in yield accompanied by a 2-fold increase in final pyruvate titer. The highest level of pyruvate, 749 mM, was produced with excess glucose. This may represent the limit for pyruvate tolerance. When pyruvate is added to mimmal media at 600 mM, growth of wild type strains of E. coli is substantially inhibited.
In contrast to biocatalysts where vitamins and other complex nutrients are required for effective production of pyruvate by fermentation, the new biocatalyst of the subject invention, E. coli TC44, requires only mineral salts and glucose. The lack of a requirement for vitamin supplements, complex nutrients or complicated process controls for TC44 provides a substantial savings in production costs. In addition, the lack of complex nutrients in the fermentation broth reduces costs associated with product purification and waste disposal.
Pyruvate can be produced by a variety of microorganism including mutants of yeasts and bacteria. However, E. coli TC44 provides a competitive alternative to the current pyruvate-producing biocatalysts due to high yields, high product titers, simple fermentation conditions, and the ability to grow well in mineral salts medium with glucose as the sole carbon source (Table 7).
Table 5. Products formed from glucose catabolism by E. coli strains described herein.
Product Concentrations (mM)
Cell mass Carbon Pyruvate yield
Strain Condition Replicates (g • L" ) Balance (%) (% theoretical) Pyruvate Acetate 2-Oxoglutarate Succinate Fumar
3% Glucose
3.64±0.31 97.9±4.8 0.31±0.22 1.0±0.7 223.8±14.0 29.0±23.7 4.6±2.2 <0.1
TC36 5% DOc
3% Glucose
3.47±0.23 89.0±2.7 10.5±7.9 38.1±27.2j 197.7±21.1 16.6±16.2 13.7±13.2 1.4-1:0.
TC36 100->5% DOd
3% Glucose
2.21±0.09 28.9±16.7 10.5±1.9 8.1±9.1 0.8±0.
TC38 100->5% DOd 84.3±5.2 57.5±2.6 194.5±9.1
3% Glucose ndk ndk
TC38 100->50% DOe 2.40 84.7 68.8 241.9 7.0 7.9
3% Glucose
TC42 100->5% DOd 3.40 86.8 29.1 79.0 178.4 76.2 24.3 1.7
3% Glucose
2.36±0.10 88.5±0.6 69.3±1.5 252.5±6.2 11.6±1.2 3.6±1.2 16.8±0J 1.1±0.
TC44 100->5% DOd
3% Glucose
V_ Nitrogen
TC44 100->5% DOf 2.02 73.6 38.8 125.2 50.3 30.0 7.7 2.9
3+3% Glucose
TC44 100->5% DOB 2.63 86.7 72.3 479.8 39.8 31.7 10.9 0.7
6% Glucose 77.9 ndκ
TC44 100->5% DOh 1.95 94.8 588.9 46.0 26.1 0.7
Excess Glucose na1 na1 na1 na
TC44 100->5% DO' 2.51 749.0 45.3 4.9 a Unless stated otherwise the concentrations represent measurements at the time of complete glucose consumption. b Maximum theoretical yield is 2 moles pyruvate per mole glucose (0.978 g pyruvate g"1 glucose ). c 3 % glucose 10 L batch fermentation with the dissolved oxygen controlled at 5 % of air saturation by adjusting the ratio of 02 and N2 (Causey et al.
2003). d 3 % glucose 5 L batch fermentation with the dissolved oxygen allowed to fall from 100 % to 5 % of air saturation. e 3% glucose 5 L batch fermentation with the dissolved oxygen allowed to fall from 100 % to 50 % of air saturation. f 3% glucose 5 L batch fermentation with the dissolved oxygen allowed to fall from 100 % to 50 % of air saturation. The (NH4)2Pθ4 concentration was reduced to 1.25 g L" . s 3% initial glucose 5 L batch fermentation with the addition of 3 % glucose after 15 h. The dissolved oxygen was allowed to fall from 100 % to 50
% of air saturation.
6% glucose 5 L batch fermentation with the dissolved oxygen allowed to fall from 100 % to 50 % of air saturation. 1 3% initial glucose 5 L batch fermentation with the automatic addition of 590 ml of 4 M glucose over a period of 20 h. The dissolved oxygen was allowed to fall from 100 % to 50 % of air saturation.
S:\SH-APPS\UF\UF-341XCl-pct.doc
j The maximum pyruvate concentration measured during glucose fermentations ranged from 14.88 mM to 111.89 mM. Pyruvate excretion in TC36 is very sensitive to dissolved oxygen, where elevated dissolved oxygen results in more pyruvate being excreted. The concentration of acetate at the time all glucose has been consumed depends on the amount of pyruvate produced. Pyruvate is rapidly converted to acetate after glucose is depleted.
The high standard deviations are a result of small differences in dissolved oxygen concentrations between fermentors and co-metabolism of the excreted pyruvate and glucose. k Not detected.
1 Not available
S:\SH-APPS\UF\UF-341 XC1 -pctdoc
Table 6. Comparison of biocatalysts for pyruvate production.
Volumetric Pyruvate
Relevant Carbon Nitrogen Fermentation [Pyruvate] Production Yield
Strain genotype/phenotype Source Source Time (h) (g • -1) (g ' L-1 h"1) (g • g ') Referenci
Candida lipolytica Bf Met" glucose NH4NO3 72 44 0.61 0.44 Footnote
AJ 14353
Debaryomyces Bf Bio" glucose Peptone 96 42 0.44 0.42 Footnote hansenii
Y-256
Torulopsis B," Bio" B6 "NA" glucose Soybean 47 60 1.28 0.68 Footnote glabrata acetate leaky hydrolysate
ACII-3 (NH4)2S04
Torulopsis Bι" Bio" B6 " NA" glucose NH4CI 56 69 1.23 0.62 Footnote glabrata
WSH-IP 303
Escherichia coli lipA2 bgt atpA401 glucose Polypeptone 24 30 1.25 0.60 Footnote'
TBLA-1
Escherichia coli aceFfadR adhEppc glucose Tryptone 36 35 0.97 0.65 Footnote'
CGSC7916 acetate (NH4)2HP04
Escherichia coli pflB frdBC IdhA glucose (NH4)2HP04 43 52 1.21 0.76 Described herein
TC44 atpFH adhE sucA ackA poxB
Li, Y., J. Chen, and S.-Y. Lun, and X. S. Rui, 2001 "Efficient pyruvate. production by a multi-vitamin auxotroph of Torulopsis glabrata: key role and optimization of vitamin levels" Appl. Microbiol. Biotechnol. 55:680-685.
2
Yokota, A., Y. Terasawa, N. Takaoka, H. Shimizu, and F. Tomita, 1994 "Pyruvic acid production by an F ATPase-defective mutant of Escherichia coli Wl4S5lip2"Biosci. Biotech. Biochem. 58:2164-2167.
Tomar, A., M. A. Eiteman, and E. Altman, 2003 "The effect of acetate pathway mutations on the production of pyruvate in Escherichia coli." Appl. Microbiol. Biotechnol. 62:76-82.
S:\SH-APPS\UF\UF-341XCl-pct.doc
Table 7. Comparison of metaboUc rates.
Glucose Consumption Rate Pvruvate : Production Rate
HΗiax Volumetric11 Specific Volumetric3 Specific
Strain (h-1) (mmol -L"1 -h"1) (mmol ■ iT h- ' cdw ) (mmol -L"1 -h"1) (mmol • L'1 • h"1 -g-' cd
TC36 C
(pflB frdBC IdhA atpFH adhE sucA) 0.49±0.03 10.1±2.6 17.6±1.5 nd f ndf
TC36 d
(pflB frdBC IdhA atpFH adhE sucA) 0.51-tO.Ol 10J±0.9 29.7±3.5 3.8±3.0 5.3±3.1
TC38 d
(pflB frdBC IdhA atpFH adhE sucA ackA) 0.28±0.01 6.7±0.6 16.3±2.2 8.3±0.7 21.1±3.7
TC38 e'E
(pflB frdBC IdhA atpFH adhE sucA ackA) 0.21 6 28 8 28 TC4248 (pflB frdBC IdhA atpFH adhE sucA poxB) 0.55 10 17 6 10
TC44 d
(pflB frdBC IdhA atpFH adhE sucA poxB ackA) 0.34±0.02 9.7±0.7 27.2±4.1 13.1±0.3 40.4±7.4
Average volumetric rates of glucose utilization and pyruvate production.
Maximum specific rates of glucose utilization and pyruvate production per g dry cell weight (dew). c 3 % glucose 10 L batch fermentation with the dissolved oxygen controlled at 5 % of air saturation by adjusting the ratio of 02 and N2. d 3 % glucose 5 L batch fermentation with the dissolved oxygen allowed to fall from 100 % to 5 % of air saturation. e Fermentation conducted with the dissolved oxygen controlled at 50 % of air saturation. f Not determined. B Average of two experiments.
S:\SH-APPS\UF\UF-341 XC 1 -pct.doc
All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.
It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.
S:\SH-APPS\UFYUF-341XCl-pct.doc

Claims

Claims We claim:
1. A method for enhancing the microbial production of a desired product wherein said method comprises culturing a microbe having one or more genetic modifications that reduce ATP, such that the microbe's sugar metabolism is increased as is the rate of production of the desired product.
2. The method, according to claim 1, wherein said modification(s) decrease the amount of ATP produced during metabolism.
3. The method, according to claim 1, wherein said modification(s) increase the rate of ATP consumption during metabolism.
4. The method, according to claim 1, wherein said modification(s) decrease the amount of ATP produced during metabolism and increase the rate of ATP consumption during metabolism.
5. The method, according to claim 1, wherein said genetic modification(s) result in the elimination or substantial reduction of ATP production by oxidative phosphorylation.
6. The method, according to claim 4, wherein there is a retention of cytoplasmic F, - ATP synthase for consumption of ATP.
7. The method, according to claim 1, wherein said microbe comprises genetic modifications that inactivate oxidative phosphorylation, disrupt the cyclic function of the tricarboxylic acid cycle, and eliminate one or more fermentation pathways.
S:\SH-APPS\UF\UF-341 XC1 -pct.doc
8. The method, according to claim 1, wherein the microbe is a derivative of E. coli that comprises one or more chromosomal deletions selected from the group consisting of focA-pflB; frdBC; IdhA; atpFH; sucA and adhE.
9. The method, according to claim 1, which comprises introducing into said microbe, one or more mutations into chromosomal genes thereby inactivating one or more pathways selected from the group consisting of lactate dehydrogenase, pyruvate foimatelyase, fumarate reductase, ATP synthase, alcohol/aldehyde dehydrogenase, and 2- ketoglutarate dehydrogenase.
10. The method, according to claim 1, wherein the desired product is selected from the group consisting of acetic acid; 1,3-propanediol; 2,3-propanediol; pyruvate; dicarboxylic acids; adipic acid; amino acids; and alcohols.
11. The method, according to claim 10, wherein said product is acetic acid.
12. The method, according to claim 10, wherein said product is pyruvic acid.
13. The method, according to claim 10, wherein said amino acid is selected from the group consisting of aliphatic and aromatic amino acids.
14. The method, according to claim 10, wherein said alcohol is selected from the group consisting of ethanol, butanol, isopropanol and propanol.
15. The method, according to claim 1, wherein said microbe is an E. coli.
16. The method, according to claim 1, wherein said microbe is selected from the group consisting of TC36, TC24, TC44, and SZ47.
17. The method, according to claim 16, wherein said microbe is TC36.
S:\SH-APPS\UFYUF-341 XC1 -pct.doc
18. The method, according to claim 16, wherein said microbe is TC44.
19. The method, according to claim 1, wherein the desired product is produced via a natural pathway.
20. The method, according to claim 1, wherein the desired product is produced via a recombinant pathway.
21. The method, according to claim 1, wherein said microbe is devoid of plasmids and antibiotic resistance genes.
22. The method, according to claim 1, wherein said method comprises a two- step batch feeding strategy wherein a second addition of glucose follows the end of an initial growth phase.
23. The method, according to claim 22, wherein said method further comprises a nitrogen limitation.
24. A biocatalyst for acetate production wherein said biocatalyst is TC36.
25. A biocatalyst for pyruvate production wherein said biocatalyst is TC44.
S :\SH-APPS\UF\UF-341 XC1 -pct.doc
PCT/US2003/035878 2002-11-06 2003-11-06 Materials and methods for the efficient production of acetate and other products Ceased WO2004044210A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003287625A AU2003287625A1 (en) 2002-11-06 2003-11-06 Materials and methods for the efficient production of acetate and other products

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US42437202P 2002-11-06 2002-11-06
US60/424,372 2002-11-06

Publications (2)

Publication Number Publication Date
WO2004044210A2 true WO2004044210A2 (en) 2004-05-27
WO2004044210A3 WO2004044210A3 (en) 2009-05-07

Family

ID=32312800

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/035878 Ceased WO2004044210A2 (en) 2002-11-06 2003-11-06 Materials and methods for the efficient production of acetate and other products

Country Status (3)

Country Link
US (3) US20040152159A1 (en)
AU (1) AU2003287625A1 (en)
WO (1) WO2004044210A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008513023A (en) * 2004-09-17 2008-05-01 ライス ユニバーシティー Highly succinic acid producing bacteria
CN102459566A (en) * 2009-06-26 2012-05-16 阿彻丹尼尔斯米德兰德公司 Improvement of ethanol yield and reduction of biomass accumulation in recombinant strain of saccharomyces cerevisiae overexpressing atp degrading enzymes
CN108531518A (en) * 2017-03-06 2018-09-14 中国科学院天津工业生物技术研究所 A method of it improving Escherichia coli and accumulates pyruvic acid

Families Citing this family (76)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011123154A2 (en) 2009-11-18 2011-10-06 Myriant Technologies Llc Metabolic evolution of escherchia coli strains that produce organic acids
EP1922405A4 (en) * 2005-08-05 2009-04-01 Univ Michigan State GENES FROM ACTINOBACILLUS SUCCINOGENES 130Z (ATCC 55618) FOR THE PRODUCTION OF CHEMICAL AGENTS FROM ROUTES C4 OF A. succinogenes
DK2305826T3 (en) 2005-08-10 2016-06-27 Univ Florida Materials and methods for the efficient production of lactic acid
CN101389752B (en) * 2006-02-24 2015-08-05 三菱化学株式会社 Bacteria capable of producing organic acids and method for producing organic acids
AU2007275036A1 (en) 2006-07-21 2008-01-24 Xyleco, Inc. Conversion systems for biomass
EP2084288A1 (en) * 2006-10-31 2009-08-05 Metabolic Explorer Process for the biological production of 1,3-propanediol from glycerol with high yield
WO2008052596A1 (en) * 2006-10-31 2008-05-08 Metabolic Explorer Process for the biological production of n-butanol with high yield
KR100971793B1 (en) * 2006-12-15 2010-07-21 바이오퓨얼켐 주식회사 Method for producing butanol using bacteria having the ability to biosynthesize butanol using ｕｔｙｒｙｌ-COA as an intermediate
CA2675026A1 (en) * 2007-01-12 2008-07-24 The Regents Of The University Of Colorado, A Body Corporate Compositions and methods for enhancing tolerance for the production of organic chemicals produced by microorganisms
US8673601B2 (en) * 2007-01-22 2014-03-18 Genomatica, Inc. Methods and organisms for growth-coupled production of 3-hydroxypropionic acid
PL389665A1 (en) 2007-02-09 2010-07-05 The Regents of the University of CaliforniaThe Regents of the University of California Production of bio-fuel by the recombinant microorganisms
BRPI0823327A2 (en) 2007-03-16 2013-10-22 Genomatica Inc MICROBIAN BIOCATALIZERS NOT NATURALLY OCCURING AND METHODS FOR 4-HYDROXIBUTANOIC ACID BIOSYNTHESIS AND 1,4-BUTANHYDROL
ES2527402T3 (en) * 2007-03-20 2015-01-23 University Of Florida Research Foundation, Inc. Materials and methods for the effective production of succinate and malate
US20090111154A1 (en) * 2007-04-04 2009-04-30 The Regents Of The University Of California Butanol production by recombinant microorganisms
US8026386B2 (en) * 2007-08-10 2011-09-27 Genomatica, Inc. Methods for the synthesis of olefins and derivatives
US7947483B2 (en) 2007-08-10 2011-05-24 Genomatica, Inc. Methods and organisms for the growth-coupled production of 1,4-butanediol
JP2010535531A (en) * 2007-08-10 2010-11-25 カーネギー インスチチューション オブ ワシントン How to use RET nanosensor
BRPI0817545A2 (en) * 2007-10-12 2014-11-25 Univ California RECOMBINANT MICROORGANISM, METHODS TO PRODUCE A RECOMBINANT MICROORGANISM AND TO PRODUCE ISOPROPANOL, RECOMBINANT VECTOR, AND, RECOMBINANT HOST CELL.
US8048624B1 (en) 2007-12-04 2011-11-01 Opx Biotechnologies, Inc. Compositions and methods for 3-hydroxypropionate bio-production from biomass
CA2712779C (en) 2008-01-22 2021-03-16 Genomatica, Inc. Methods and organisms for utilizing synthesis gas or other gaseous carbon sources and methanol
DK2262901T3 (en) 2008-03-05 2019-01-21 Genomatica Inc ORGANISMS PRODUCING PRIMARY ALCOHOL
US20090246841A1 (en) * 2008-03-26 2009-10-01 Jamieson Andrew C Methods and compositions for production of acetaldehyde
ES2656790T3 (en) * 2008-03-27 2018-02-28 Genomatica, Inc. Microorganisms for the production of adipic acid and other compounds
WO2009135074A2 (en) * 2008-05-01 2009-11-05 Genomatica, Inc. Microorganisms for the production of methacrylic acid
BRPI0913901A2 (en) * 2008-06-17 2016-12-13 Genomatica Inc microorganisms and methods for fumarate, malate and acrylate biosynthesis
WO2010006076A2 (en) * 2008-07-08 2010-01-14 Opx Biotechnologies Inc. Methods, compositions and systems for biosynthetic bio production of 1,4-butanediol
US20100021978A1 (en) * 2008-07-23 2010-01-28 Genomatica, Inc. Methods and organisms for production of 3-hydroxypropionic acid
WO2010017230A2 (en) * 2008-08-04 2010-02-11 The Regents Of The University Of Colorado Methods, systems and compositions related to microbial bio-production of butanol and/or isobutanol
EP3514242A3 (en) * 2008-09-10 2019-08-28 Genomatica, Inc. Microrganisms for the production of 1,4-butanediol
KR101613754B1 (en) 2008-10-03 2016-04-19 메타볼릭 익스플로러 Method for purifying an alcohol from a fermentation broth using a falling film, a wiped film, a thin film or a short path evaporator
WO2010057022A1 (en) * 2008-11-14 2010-05-20 Genomatica, Inc. Microorganisms for the production of methyl ethyl ketone and 2-butanol
WO2010059616A2 (en) * 2008-11-18 2010-05-27 University Of Florida Research Foundation, Inc. Biocatalysts and methods for conversion of hemicellulose hydrolsates to biobased products
EP2373781A4 (en) * 2008-12-16 2012-10-10 Genomatica Inc Microorganisms and methods for conversion of syngas and other carbon sources to useful products
CA2756705C (en) 2009-04-02 2017-04-11 University Of Florida Research Foundation, Inc. Engineered bacterial cells for succinate production
BRPI1013505A2 (en) 2009-04-30 2018-02-14 Genomatica Inc organisms for the production of isopropanol, n-butanol, and isobutanol
MY176050A (en) 2009-04-30 2020-07-22 Genomatica Inc Organisms for the production of 1,3-butanediol
EP2427544B1 (en) 2009-05-07 2019-07-17 Genomatica, Inc. Microorganisms and methods for the biosynthesis of adipate, hexamethylenediamine and 6-aminocaproic acid
JP2012526561A (en) * 2009-05-15 2012-11-01 ゲノマチカ， インク． Organisms for the production of cyclohexanone
LT2438036T (en) * 2009-06-04 2017-06-26 Genomatica, Inc. Process of separating components of a fermentation broth
WO2010141920A2 (en) 2009-06-04 2010-12-09 Genomatica, Inc. Microorganisms for the production of 1,4-butanediol and related methods
EP2440669A4 (en) * 2009-06-10 2013-08-28 Genomatica Inc Microorganisms and methods for carbon-efficient biosynthesis of mek and 2-butanol
WO2010147642A1 (en) 2009-06-15 2010-12-23 Massachusetts Institute Of Technology Production of triacylglycerides, fatty acids, and their derivatives
EP3190174A1 (en) 2009-08-05 2017-07-12 Genomatica, Inc. Semi-synthetic terephthalic acid via microorganisms that produce muconic acid
US8715971B2 (en) 2009-09-09 2014-05-06 Genomatica, Inc. Microorganisms and methods for the co-production of isopropanol and 1,4-butanediol
MX2012003604A (en) 2009-09-27 2012-09-12 Opx Biotechnologies Inc Method for producing 3-hydroxypropionic acid and other products.
US8809027B1 (en) 2009-09-27 2014-08-19 Opx Biotechnologies, Inc. Genetically modified organisms for increased microbial production of 3-hydroxypropionic acid involving an oxaloacetate alpha-decarboxylase
KR20120083908A (en) 2009-10-13 2012-07-26 게노마티카 인코포레이티드 Microorganisms for the production of 1,4-butanediol, 4-hydroxybutanal, 4-hydroxybutyryl-coa, putrescine and related compounds, and methods related thereto
KR20180014240A (en) 2009-10-23 2018-02-07 게노마티카 인코포레이티드 Microorganisms for the production of aniline
US8778656B2 (en) 2009-11-18 2014-07-15 Myriant Corporation Organic acid production in microorganisms by combined reductive and oxidative tricaboxylic acid cylce pathways
US10017793B2 (en) 2009-11-18 2018-07-10 Myriant Corporation Metabolic evolution of Escherichia coli strains that produce organic acids
US20110125118A1 (en) * 2009-11-20 2011-05-26 Opx Biotechnologies, Inc. Production of an Organic Acid and/or Related Chemicals
US8530210B2 (en) 2009-11-25 2013-09-10 Genomatica, Inc. Microorganisms and methods for the coproduction 1,4-butanediol and gamma-butyrolactone
KR20120120493A (en) * 2009-12-10 2012-11-01 게노마티카 인코포레이티드 Methods and organisms for converting synthesis gas or other gaseous carbon sources and methanol to 1,3-butanediol
JP2013517796A (en) 2010-01-29 2013-05-20 ジェノマティカ・インコーポレイテッド Method and microorganism for biosynthesis of p-toluic acid and terephthalic acid
US8445244B2 (en) 2010-02-23 2013-05-21 Genomatica, Inc. Methods for increasing product yields
US8048661B2 (en) 2010-02-23 2011-11-01 Genomatica, Inc. Microbial organisms comprising exogenous nucleic acids encoding reductive TCA pathway enzymes
US9023636B2 (en) 2010-04-30 2015-05-05 Genomatica, Inc. Microorganisms and methods for the biosynthesis of propylene
CA2797409C (en) 2010-05-05 2019-12-24 Genomatica, Inc. Microorganisms and methods for the biosynthesis of butadiene
PH12013500158A1 (en) 2010-07-26 2013-03-11 Genomatica Inc Microorganisms and methods for the biosynthesis of aromatics, 2,4-pentadienoate and 1,3-butadiene
WO2012177599A2 (en) * 2011-06-22 2012-12-27 Genomatica, Inc. Microorganisms for producing n-propanol 1, 3-propanediol, 1,2-propanediol or glycerol and methods related thereto
US9169486B2 (en) 2011-06-22 2015-10-27 Genomatica, Inc. Microorganisms for producing butadiene and methods related thereto
US9347077B2 (en) 2011-07-08 2016-05-24 University Of Florida Research Foundation, Incorporated Over-expression of a putative oxidoreductase (UcpA) for increasing furfural or 5-hydroxymethylfurfural tolerance
KR101928688B1 (en) 2011-07-22 2018-12-13 피티티지씨 이노베이션 아메리카 코포레이션 Fermentation of glycerol to organic acids
SI2855687T1 (en) 2012-06-04 2020-09-30 Genomatica, Inc. Microorganisms and methods for production of 4-hydroxybutyrate, 1,4-butanediol and related compounds
MX2015001780A (en) 2012-08-10 2015-09-28 Opx Biotechnologies Inc Microorganisms and methods for the production of fatty acids and fatty acid derived products.
WO2014071286A1 (en) 2012-11-05 2014-05-08 Genomatica, Inc. Microorganisms for enhancing the availability of reducing equivalents in the presence of methanol, and for producing 1,2-propanediol
US9441253B2 (en) 2013-02-11 2016-09-13 William Marsh Rice University Metabolic transistor in bacteria
WO2014145344A2 (en) * 2013-03-15 2014-09-18 Opx Biotechnologies, Inc. Control of growth-induction-production phases
US20150119601A1 (en) 2013-03-15 2015-04-30 Opx Biotechnologies, Inc. Monofunctional mcr + 3-hp dehydrogenase
EP2976141A4 (en) 2013-03-15 2016-10-05 Cargill Inc FLASH EVAPORATION FOR PRODUCTION PURIFICATION AND RECOVERY
US11408013B2 (en) 2013-07-19 2022-08-09 Cargill, Incorporated Microorganisms and methods for the production of fatty acids and fatty acid derived products
EP3022310B1 (en) 2013-07-19 2019-10-16 Cargill, Incorporated Microorganisms and methods for the production of fatty acids and fatty acid derived products
EP2993228B1 (en) 2014-09-02 2019-10-09 Cargill, Incorporated Production of fatty acid esters
MX2019007406A (en) 2016-12-21 2019-12-16 Creatus Biosciences Inc Xylitol producing metschnikowia species.
US11345938B2 (en) 2017-02-02 2022-05-31 Cargill, Incorporated Genetically modified cells that produce C6-C10 fatty acid derivatives
CN112961814A (en) * 2020-12-08 2021-06-15 天津大学 Construction method of escherichia coli engineering bacteria preferring to efficiently secrete acetic acid and FFA by utilizing xylose

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0162545A3 (en) * 1984-05-23 1987-09-02 Betz Europe, Inc. Enhanced bioconversion processes
IL80510A0 (en) * 1985-11-08 1987-02-27 Genetics Inst Improved yeast strains
ATE419371T1 (en) * 1996-09-06 2009-01-15 Jensen Peter Ruhdal METHOD FOR IMPROVED PRODUCTION OF A DESIRED PRODUCT FROM A CELL
JP4327909B2 (en) * 1996-11-13 2009-09-09 イー・アイ・デユポン・ドウ・ヌムール・アンド・カンパニー Method for producing 1,3-propanediol by recombinant organisms
US6159738A (en) * 1998-04-28 2000-12-12 University Of Chicago Method for construction of bacterial strains with increased succinic acid production
US7098009B2 (en) * 2004-03-04 2006-08-29 University Of Florida Research Foundation, Inc. Production of chemicals from lignocellulose, biomass or sugars
DK2305826T3 (en) * 2005-08-10 2016-06-27 Univ Florida Materials and methods for the efficient production of lactic acid
US20070072280A1 (en) * 2005-09-19 2007-03-29 University Of Florida Research Foundation, Inc. Materials and methods for the efficient production of xylitol
ES2527402T3 (en) 2007-03-20 2015-01-23 University Of Florida Research Foundation, Inc. Materials and methods for the effective production of succinate and malate
WO2008119009A2 (en) 2007-03-27 2008-10-02 University Of Florida Research Foundation, Inc. Materials and methods for efficient alanine production

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008513023A (en) * 2004-09-17 2008-05-01 ライス ユニバーシティー Highly succinic acid producing bacteria
CN102459566A (en) * 2009-06-26 2012-05-16 阿彻丹尼尔斯米德兰德公司 Improvement of ethanol yield and reduction of biomass accumulation in recombinant strain of saccharomyces cerevisiae overexpressing atp degrading enzymes
EP2446017A4 (en) * 2009-06-26 2013-07-17 Archer Daniels Midland Co IMPROVING ETHANOL YIELD AND REDUCING BIOMASS ACCUMULATION IN THE RECOMBINANT STRAIN OF SACCHAROMYCES CEREVISIAE OVEREXPRESSING ATP DEGRADATION ENZYMES
CN102459566B (en) * 2009-06-26 2014-12-17 阿彻丹尼尔斯米德兰德公司 Improvement of ethanol yield and reduction of biomass accumulation in recombinant strain of saccharomyces cerevisiae overexpressing atp degrading enzymes
CN108531518A (en) * 2017-03-06 2018-09-14 中国科学院天津工业生物技术研究所 A method of it improving Escherichia coli and accumulates pyruvic acid

Also Published As

Publication number Publication date
US8383374B2 (en) 2013-02-26
US20090148914A1 (en) 2009-06-11
AU2003287625A8 (en) 2009-06-04
WO2004044210A3 (en) 2009-05-07
US7977075B2 (en) 2011-07-12
AU2003287625A1 (en) 2004-06-03
US20040152159A1 (en) 2004-08-05
US20110281310A1 (en) 2011-11-17

Similar Documents

Publication Publication Date Title
US8383374B2 (en) Materials and methods for the efficient production of acetate and other products
Jantama et al. Combining metabolic engineering and metabolic evolution to develop nonrecombinant strains of Escherichia coli C that produce succinate and malate
Zhang et al. Production of L-alanine by metabolically engineered Escherichia coli
Jantama et al. Eliminating side products and increasing succinate yields in engineered strains of Escherichia coli C
Zhou et al. Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110
Yazdani et al. Engineering Escherichia coli for the efficient conversion of glycerol to ethanol and co-products
AU2008228948B2 (en) Materials and methods for efficient succinate and malate production
Zhang et al. L-malate production by metabolically engineered Escherichia coli
Zhou et al. Fermentation of 12%(w/v) glucose to 1.2 M lactate by Escherichia coli strain SZ194 using mineral salts medium
Sánchez et al. Novel pathway engineering design of the anaerobic central metabolic pathway in Escherichia coli to increase succinate yield and productivity
US5000000A (en) Ethanol production by Escherichia coli strains co-expressing Zymomonas PDC and ADH genes
US8465953B2 (en) Ethanol production in non-recombinant hosts
Li et al. Engineering Escherichia coli for fumaric acid production from glycerol
JP4991205B2 (en) Effective materials and methods for lactic acid production
US20120225461A1 (en) Organic acid production in microorganisms by combined reductive and oxidative tricaboxylic acid cylce pathways
WO2008119009A2 (en) Materials and methods for efficient alanine production
US8486686B2 (en) Large scale microbial culture method
Kwon et al. Acetate-assisted carbon monoxide fermentation of Clostridium sp. AWRP
Phosriran et al. An efficient production of bio-succinate in a novel metabolically engineered Klebsiella oxytoca by rational metabolic engineering and evolutionary adaptation
CN103667163B (en) Produce recombinant microorganism and the method for isopropylcarbinol
Cao et al. Efficient L-valine production using systematically metabolic engineered Klebsiella oxytoca
Tian et al. High-efficiency conversion of glycerol to D-lactic acid with metabolically engineered Escherichia coli
US9605280B2 (en) Escherichia coli containing mutated lpdA gene and application thereof
Yang et al. Improvement of pyruvate production based on regulation of intracellular redox state in engineered Escherichia coli
US20090082600A1 (en) Native homoethanol Pathway for ethanol production in E. coli

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2004552038

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP