WO2004043335A2 - Methods of treating infection by drug resistant bacteria - Google Patents

Methods of treating infection by drug resistant bacteria Download PDF

Info

Publication number
WO2004043335A2
WO2004043335A2 PCT/US2002/029379 US0229379W WO2004043335A2 WO 2004043335 A2 WO2004043335 A2 WO 2004043335A2 US 0229379 W US0229379 W US 0229379W WO 2004043335 A2 WO2004043335 A2 WO 2004043335A2
Authority
WO
WIPO (PCT)
Prior art keywords
compound
substituted
group
seq
unsubstituted
Prior art date
Application number
PCT/US2002/029379
Other languages
French (fr)
Other versions
WO2004043335A3 (en
Inventor
Heinz E. Moser
Eldon E. Baird
Roland W. Burli
Yigong Ge
Sarah White
Original Assignee
Genesoft, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genesoft, Inc. filed Critical Genesoft, Inc.
Priority to JP2004551348A priority Critical patent/JP2005538183A/en
Priority to AU2002368274A priority patent/AU2002368274A1/en
Priority to EP02807922A priority patent/EP1572072A4/en
Priority to CA002458926A priority patent/CA2458926A1/en
Publication of WO2004043335A2 publication Critical patent/WO2004043335A2/en
Publication of WO2004043335A3 publication Critical patent/WO2004043335A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/38Heterocyclic compounds having sulfur as a ring hetero atom
    • A61K31/381Heterocyclic compounds having sulfur as a ring hetero atom having five-membered rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • A61K31/41781,3-Diazoles not condensed 1,3-diazoles and containing further heterocyclic rings, e.g. pilocarpine, nitrofurantoin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41961,2,4-Triazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42Oxazoles
    • A61K31/422Oxazoles not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/427Thiazoles not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/444Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring heteroatom, e.g. amrinone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/4709Non-condensed quinolines and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965Non-condensed pyrazines
    • A61K31/497Non-condensed pyrazines containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50Pyridazines; Hydrogenated pyridazines
    • A61K31/501Pyridazines; Hydrogenated pyridazines not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D207/00Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/30Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members
    • C07D207/34Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D409/00Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/14Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D413/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings

Definitions

  • dsDNA double stranded deoxyribonucleic acid
  • dsDNA double stranded deoxyribonucleic acid
  • the compounds bind to different parts of the nucleic acid. Some bind to the major groove while others associate with the minor groove. Still others intercalate between adjacent base pairs.
  • Combination binding modes are also known, in which a compound has binding interactions with more than one site in the nucleic acid.
  • Certain dsDNA binding compounds can be used to regulate the expression of genes for medical purposes. If a disease is characterized by the overexpression or the undesired expression of a gene (e.g., an oncogene), the disease may be treated by suppressing in toto or in part the expression of the gene by the binding of such compounds to the gene or a promoter site thereof. Infections by pathogens such fungi, bacteria, and viruses may be combated with compounds that affect the expression of genes essential for the proliferation or existence/survival of the pathogen. [0005] Whatever the application, the compound must strongly bind to dsDNA, generally meaning that it binds with an association constant of at least 10 6 M "1 , preferably at least about 10 9 M "1 .
  • binding strength alone is not determinative of efficaciousness, whether in a therapeutic, anti-infective, or other applications.
  • a compound that is acceptable or superior in one characteristic may be fatally deficient in another characteristic.
  • the present invention provides a method for treating an infection by gram-positive bacteria in a mammal, by administering to the mammal an effective amount of a compound that binds noncovalently in the minor groove of duplex DNA, which compound: i) binds with a dissociation constant of equal to or less than 100 nM to at least one of:
  • Ill exhibits a MIC of less than or equal to 2 ⁇ g/mL against at least one of Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus ATCC 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422; iii) exhibits a MIC of greater than or equal to 32 ⁇ g/mL against Candida albicans ATCC 38247; and iv) has a molecular weight of from 100 to about 1100.
  • the present invention provides methods as above, wherein the compound has activity ratio X/Y equal to or greater than 16, wherein X is the MIC of the compound against Candida albicans ATCC 38247 and Y is the lowest MIC of the compound from among the MIC's fox Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422.
  • the present invention provides a compound useful for the treatment of a bacterial infection, the compound having the formula:
  • B is a member selected from a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, and an unsubstituted amino group or a mono- or di-alkyl amino group.
  • the compounds of the invention i) bind with a dissociation constant of equal to or less than 100 nM to at least one of the target sequences noted above in (a) through (k); ii) exhibit a MIC of less than or equal to 2 ⁇ g/mL against at least one of Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus ATCC 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422; iii) exhibit a MIC of greater than or equal to 32 ⁇ g/mL against Candida albicans ATCC 38247; and iv) have a molecular weight of from 100 to about 1100. [0009]
  • Figures 1 -4 illustrate structures of compounds useful in the present invention.
  • Figures 5-7 illustrate maps of plasmids used in DNA binding protocols.
  • alkyl by itself or as part of another substituent, means, unless otherwise stated, a straight or branched chain, or cyclic hydrocarbon radical, or combination thereof, which may be fully saturated, mono- or polyunsaturated and can include di- and multivalent radicals, having the number of carbon atoms designated (i.e. Ci-Cio means one to ten carbons).
  • saturated hydrocarbon radicals include groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n- octyl, and the like.
  • An unsaturated alkyl group is one having one or more double bonds or triple bonds.
  • unsaturated alkyl groups include vinyl, 2-propenyl, crotyl, 2- isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(l,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and the higher homologs and isomers.
  • alkylene by itself or as part of another substituent means a divalent radical derived from an alkane, as exemplified by -CH 2 CH 2 CH 2 CH 2 -.
  • an alkyl (or alkyl ene) group will have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred in the present invention.
  • a “lower alkyl” or “lower alkylene” is a shorter chain alkyl or alkylene group, generally having six or fewer carbon atoms.
  • alkoxy alkylamino and “alkylthio” (or thioalkoxy) are used in their conventional sense, and refer to those alkyl groups attached to the remainder of the molecule via an oxygen atom, an amino group, or a sulfur atom, respectively.
  • heteroalkyl by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched chain, or cyclic hydrocarbon radical, or combinations thereof, consisting of the stated number of carbon atoms and from one to tliree heteroatoms selected from the group consisting of O, N, Si and S, and wherein the nitrogen and sulfur atoms may optionally be oxidized and the nitrogen heteroatom may optionally be quaternized.
  • the heteroatom(s) O, N and S may be placed at any interior position of the heteroalkyl group.
  • the heteroatom Si may be placed at any position of the heteroalkyl group, including the position at which the alkyl group is attached to the remainder of the molecule.
  • heteroalkylene by itself or as part of another substituent means a divalent radical derived from heteroalkyl, as exemplified by -CH 2 -CH 2 -S-CH 2 CH 2 - and -CH 2 -S-CH 2 -CH 2 -NH-CH 2 -.
  • heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like).
  • heteroalkyl respectively. Additionally, for heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like.
  • heterocycloalkyl examples include 1 -(1,2,5,6-tetrahydropy ⁇ idyl), 1- ⁇ iperidinyl, 2-pi ⁇ eridinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1 -piperazinyl, 2-piperazinyl, and the like.
  • halo or halogen
  • haloalkyl by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.
  • terms such as “haloalkyl,” are meant to include monohaloalkyl and polyhaloalkyl.
  • halo(C ⁇ -C 4 )alkyl is mean to include trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the like.
  • aryl means, unless otherwise stated, a polyunsaturated, typically aromatic, hydrocarbon substituent which can be a single ring or multiple rings (up to three rings) which are fused together or linked covalently.
  • heteroaryl refers to aryl groups (or rings) that contain from zero to four heteroatoms selected from N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized.
  • a heteroaryl group can be attached to the remainder of the molecule through a heteroatom.
  • Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2- imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5- benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinoly
  • aryl when used in combination with other terms (e.g. , aryloxy, arylthioxy, arylalkyl) includes both aryl and heteroaryl rings as defined above.
  • arylalkyl is meant to include those radicals in which an aryl group is attached to an alkyl group (e.g., benzyl, phenethyl, pyridylmethyl and the like) including those alkyl groups in which a carbon atom (e.g., a methylene group) has been replaced by, for example, an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl, 3-(l- naphthyloxy)propyl, and the like).
  • alkyl group e.g., benzyl, phenethyl, pyridylmethyl and the like
  • an oxygen atom e.g., phenoxymethyl, 2-pyridyloxymethyl, 3-(l- naphthyloxy)propyl, and the like.
  • R', R" and R'" each independently refer to hydrogen, unsubstituted (C ⁇ -C 8 )alkyl and heteroalkyl, unsubstituted aryl, aryl substituted with 1-3 halogens, unsubstituted alkyl, alkoxy or thioalkoxy groups, or aryl-(C ⁇ -C )alkyl groups.
  • R' and R" When R' and R" are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 5-, 6-, or 7-membered ring.
  • -NR'R is meant to include 1-py ⁇ olidinyl and 4-morpholinyl.
  • alkyl is meant to include groups such as haloalkyl (e.g., -CF 3 and - CH 2 CF 3 ) and acyl (e.g., -C(O)CH 3 , -C(O)CF 3 , -C(O)CH 2 OCH 3 , and the like).
  • the substituted alkyl and heteroalkyl groups have from 1 to 4 substituents, more preferably 1 , 2 or 3 substituents. Exceptions are those perhalo alkyl groups (e.g., pentafluoroethyl and the like) which are also preferred and contemplated by the present invention.
  • substituents for the aryl and heteroaryl groups are varied and are selected from: -halogen, -OR', -OC(O)R', -NR'R", -SR ⁇ -R', -CN, -NO 2 , -CO 2 R', -CONR'R", -C(O)R', -OC(O)NR'R", -NR"C(O)R', -NR"C(O) 2 R', ,-NR'-C(O)NR"R'",
  • Two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -T-C(O)-(CH 2 ) q -U-, wherein T and U are independently -NH-, -O-, -CH 2 - or a single bond, and q is an integer of from 0 to 2.
  • two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -A-(CH 2 ),-B-, wherein A and B are independently -CH 2 -, -O-, -NH-, -S-, -S(O)-, -S(O) 2 -, -S(O) 2 NR'- or a single bond, and r is an integer of from 1 to 3.
  • One of the single bonds of the new ring so formed may optionally be replaced with a double bond.
  • two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -(CH 2 ) S - X-(CH 2 ) ⁇ , where s and t are independently integers of from 0 to 3; and X is -0-, -NR'-, -S-, - S(O)-, -S(O) 2 -, or -S(O) 2 NR'-.
  • the substituent R' in -NR'- and -S(O) 2 NR'- is selected from hydrogen or unsubstituted (C ⁇ -C 6 )alkyl.
  • the term "heteroatom” is meant to include oxygen (O), nitrogen (N), sulfur (S) and silicon (Si).
  • salts are meant to include salts of the active compounds which are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein.
  • base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent.
  • pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt.
  • acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent.
  • Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from relatively nontoxic organic acids like acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, mandelic, phthalic, benzenesulfonic, p- tolylsulfonic, citric, tartaric, methanesulfonic, and the like.
  • inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like,
  • salts of amino acids such as arginate and the like, and salts of organic acids like glucuronic or galactunonc acids and the like (see, for example, Berge, S.M., et al, "Phanriaceutical Salts", Journal of Pharmaceutical Science, 1977, 66, 1-19).
  • Certain specific compounds of the present invention contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts.
  • the neutral forms of the compounds may be regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner.
  • the parent forai of the compound differs from the various salt forms in certain physical properties, such as solubility in polar solvents, but otherwise the salts are equivalent to the parent form of the compound for the purposes of the present invention.
  • the present invention provides compounds which are in a prodrug form.
  • Prodrugs of the compounds described herein are those compounds that readily undergo chemical changes under physiological conditions to provide the compounds of the present invention.
  • prodrugs can be converted to the compounds of the present invention by chemical or biochemical methods in an ex vivo environment. For example, prodrugs can be slowly converted to the compounds of the present invention when placed in a transdermal patch reservoir with a suitable enzyme or chemical reagent.
  • Certain compounds of the present invention can exist in unsolvated forms as well as solvated fonns, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are intended to be encompassed within the scope of the present invention. Certain compounds of the present invention may exist in multiple crystalline or amorphous forms. In general, all physical fonns are equivalent for the uses contemplated by the present invention and are intended to be within the scope of the present invention. [0029] Certain compounds of the present invention possess asymmetric carbon atoms (optical centers) or double bonds; the racemates, diastereomers, geometric isomers and individual isomers are all intended to be encompassed within the scope of the present invention.
  • the compounds of the present invention may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds.
  • the compounds may be radiolabeled with radioactive isotopes, such as for example tritium ( 3 H), iodine-125 ( 125 I) or carbon-14 ( 14 C). All isotopic variations of the compounds of the present invention, whether radioactive or not, are intended to be encompassed within the scope of the present invention.
  • dsDNA as the nucleic acid, but it is to be understood that the invention is not limited to dsDNAand is applicable to other nucleic acids, i.e., ribonucleic acid.
  • the present invention derives from the surprising discovery that a number of compounds found to interact predominantly in the minor groove of bacterial DNA share certain common structural as well as functional features, in particular bactericidal activity against Gram-positive bacteria. Accordingly, assays have been developed to screen for such compounds and methods are provided for the use of such compounds.
  • Double-helical DNA also refened to as double-stranded DNA, B-DNA, or beta-DNA
  • B-DNA double-stranded DNA
  • beta-DNA double-stranded DNA
  • the asymmetry of the backbone residues leads to the two grooves being of unequal size.
  • the larger (or major) groove is about 11.6 A wide and about 8.5 A deep, while the smaller (or minor) groove is about 6.0 A wide and about 8.2 A deep.
  • the minor groove is nanower, reportedly in the range of 3-4 A.
  • the compounds provided herein are crescent shaped, providing a conformational fit enabling them to nestle in the minor groove.
  • a compound may bind individually within the minor groove (the 1 : 1 mode), or it may bind side-by-side with another compound (the 2: 1 mode).
  • the binding may be sequence-selective, that is, the compound recognizes and selectively binds to particular DNA sequences.
  • the binding sites identified herein — having a prevalence of A and T — have been selected for their identity with or similarity to promoter sequences of bacterial genes, which are typically A,T rich.
  • the binding of the compound to the target site prevents formation of the complex necessary for the transcription of the conesponding bacterial gene, possibly by displacing or inhibiting the binding of essential transcription factors or enzymes, and results in the downregulation or shutting down of the gene.
  • the compounds herein are believed to ultimately cause bacterial death. Because multiple genes are affected, it is more difficult for bacteria to develop resistance. Additionally, antifungal activity can be predictive of cytotoxic effects in other eukaryotic cells. Accordingly, the present antibacterial compounds have reduced antifungal activity (as determined by activity against Candida albicans ATCC 38247).
  • the present invention provides, in one aspect, methods for treating infection by Gram-positive bacteria in a mammal, by administering to the mammal an effective amount of a compound that binds noncovalently in the minor groove of duplex DNA, which compound: i) binds with a dissociation constant of equal to or less than 100 nM to at least one of: (a) a target sequence AAAAAGCAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I;
  • a target sequence AATTAATCAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; 0) a target sequence ACAATTA in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; and (k) a target sequence ACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO.
  • Ill exhibits a MIC of less than or equal to 2 ⁇ g/mL against at least one of Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus ATCC 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422; iii) exhibits a MIC of greater than or equal to 32 ⁇ g/mL against Candida albicans ATCC 38247; and iv) has a molecular weight of from 100 to about 1100.
  • a compound is deemed to bind to one or more of the recited target sequences if, when contacted with duplex DNA of SEQ. LD. NO. I, II or III (with each complementary strand), the compound binds with the noted dissociation constant and exhibits at least 50%, more preferably 60%, 70%, 80% or even 90% overlap with the indicated residues. In the most prefened embodiments, the compound exhibits 100% overlap with the indicated residues.
  • the sequence of DNA targeted by the compounds provided herein can be determined to nucleotide resolution using MPE Footprinting or alternatively using DNase and MPE footprinting to determine affinity and target sequence (see, Nan Dyke, et al., Nucl Acids Res. (1983) 11:5555 and Nan Dyke, et al., Scz ' ence (1984) 225:1122.
  • compounds having the functional properties described above, or advantageously having formula (I) below are administered.
  • administration of the compounds is in the form of pharmaceutical compositions thereof and such administration is made orally, parenterally and/or topically at a dosage to obtain and maintain a concentration, that is, an amount, or blood-level of active component in the animal undergoing treatment which will be antib act eri ally effective.
  • a concentration that is, an amount, or blood-level of active component in the animal undergoing treatment which will be antib act eri ally effective.
  • such antibacterially effective amount of dosage of active component will be in the range of about 0.1 to about 100 mg/kg, more preferably about 3.0 to about 50 mg/kg of body weight/day. It is to be understood that the dosages may vary depending upon the requirements of the patient, the severity of the bacterial infection being treated, and the particular compound being used.
  • the initial dosage administered may be increased beyond the above upper level in order to rapidly achieve the desired blood-level or the initial dosage may be smaller than the optimum and the daily dosage maybe progressively increased during the course of treatment depending on the particular situation. If desired, the daily dose may also be divided into multiple doses for administration, e.g., two to four times per day.
  • the compounds of formula (I) according to this invention are administered parenterally, i.e., by injection, for example, by intravenous injection or by other parenteral routes of administration.
  • compositions for parenteral administration will generally contain a pharmaceutically acceptable amount of the compound according to formula (I) as a soluble salt (acid addition salt or base salt) dissolved in a pharaiaceutically acceptable liquid canier such as, for example, water- for-injecti on and a suitably buffered isotonic solution, for example, having a pH of about 3.5-6.
  • a pharaiaceutically acceptable liquid canier such as, for example, water- for-injecti on and a suitably buffered isotonic solution, for example, having a pH of about 3.5-6.
  • Suitable buffering agents include, for example, trisodium orthophosphate, sodium bicarbonate, sodium citrate, N- methylglucamine, L(+)-lysine and L(+)-arginine, to name a few.
  • the compound according to formula (I) generally will be dissolved in the canier in an amount sufficient to provide a pharmaceutically acceptable injectable concentration in the range of about 1 mg/mL to about 400 mg/mL.
  • the resulting liquid pharmaceutical composition will be administered so as to obtain the above-mentioned antibacterially effective amount of dosage.
  • the compounds of formula (I) according to this invention are advantageously administered orally in solid and liquid dosage forms.
  • the compounds are administered in combination with a second agent that is either an antibacterial or antimicrobial agent.
  • Antibacterial agents useful in the present compositions and methods include in general the ⁇ -lactam antibiotics and the quinolone antibiotics. More particularly, the agents can be naficillin, oxacillin, penicillin, amoxacillin, ampicillin, cefotaxime, ceftriaxone, rifampin, minocycline, ciprofloxacin, norfloxacin, erytlrromycin, vancomycin, or an analog thereof.
  • Antimicrobial agents useful in the present compositions and methods include in general sulfanilamide, sulfamethoxazole, sulfacetamide, sulfisoxazole, sulfadiazine, penicillins (e.g., penecillins G and V, methicillin, oxacillin, naficillin, ampicillin amoxacillin, carbenicillin, ticarcillin, mezlocillin and piperacillin), cephalosporins (e.g., cephalothin, cefaxolin, cephalexin, cefadroxil, cefamandole, cefoxitin, cefaclor, cefuroxine, loracarbef, cefonicid, cefotetan, ceforanide,cefotaxime, cefbodoxime proxetil, ceftizoxime, cefoperazone, ceftazidime and cefepime), aminogly
  • the compounds described and provided herein, as well as those compounds identified using the criteria established above, can be prepared in a number of pharmaceutical compositions.
  • the compounds can be prepared and administered in a wide variety of oral, topical and parenteral dosage forms.
  • the compounds of the present invention can be administered by injection, that is, intravenously, intramuscularly, intracutaneously, subcutaneously, intraduodenally, or intraperitoneally.
  • the compounds described herein can be administered by inhalation, for example, intranasally.
  • the compounds of the present invention can be administered transderaially.
  • compositions comprising a pharmaceutically acceptable canier or excipient and either a compound of formula (I) or a pharmaceutically acceptable salt of a compound of formula (I).
  • pharmaceutically acceptable carriers can be either solid or liquid. Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules.
  • a solid canier can be one or more substances which may also act as diluents, flavoring agents, binders, preservatives, tablet disintegrating agents, or an encapsulating material.
  • the canier is a finely divided solid which is in a mixture with the finely divided active component, hi tablets, the active component is mixed with the canier having the necessary binding properties in suitable proportions and compacted in the shape and size desired.
  • the powders and tablets preferably contain from 5% or 10% to 70% of the active compound.
  • Suitable caniers are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like.
  • the tenn "preparation” is intended to include the formulation of the active compound with encapsulating material as a canier providing a capsule in which the active component with or without other caniers, is sunounded by a canier, which is thus in association with it.
  • a low melting wax such as a mixture of fatty acid glycerides or cocoa butter
  • the active component is dispersed homogeneously therein, as by stining.
  • the molten homogeneous mixture is then poured into convenient sized molds, allowed to cool, and thereby to solidify.
  • Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water/propylene glycol solutions.
  • liquid preparations can be formulated in solution in aqueous polyethylene glycol solution.
  • Aqueous solutions suitable for oral use can be prepared by dissolving the active component in water and adding suitable colorants, flavors, stabilizers, and thickening agents as desired.
  • Aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, and other well-known suspending agents.
  • liquid form preparations which are intended to be converted, shortly before use, to liquid form preparations for oral administration.
  • liquid fonns include solutions, suspensions, and emulsions.
  • These preparations may contain, in addition to the active component, colorants, flavors, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilizing agents, and the like.
  • the pharmaceutical preparation is preferably in unit dosage form.
  • the preparation is subdivided into unit doses containing appropriate quantities of the active component.
  • the unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation, such as packeted tablets, capsules, and powders in vials or ampoules.
  • the unit dosage form can be a capsule, tablet, cachet, or lozenge itself, or it can be the appropriate number of any of these in packaged form.
  • the quantity of active component in a unit dose preparation may be varied or adjusted from 0.1 mg to 1000 mg, preferably 1.0 mg to 100 mg according to the particular application and the potency of the active component.
  • the composition can, if desired, also contain other compatible therapeutic agents.
  • formula (I) includes, for example, polyaromatic compounds having the following formulae:
  • n in prefened embodiments the value of n is from 2 to 5. More preferably, n is 2, 3 or 4.
  • the first terminal group A can be, as noted above, a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, or an amino group that is either an unsubstituted amino group or a mono- or di-alkyl amino group.
  • A is a substituted or unsubstituted aryl or heteroaryl group selected from phenyl, 1-naphthyl, 2-naphthyl, 1-pynolyl, 2-pynolyl, 3-pynolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5- isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2- pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 2-benzothienyl, 2-benzothiazolyl, purinyl, 2-benzimidazolyl, 2-
  • A is a substituted or unsubstituted thienyl group, a substituted or unsubstituted phenyl group, a substituted or unsubstituted benzothienyl group, or a substituted or unsubstituted isoquinolinyl group.
  • the substituents are preferably selected from halogen, nitro, cyano, (C ⁇ -C 6 )alkyl, (C ⁇ -C 6 )alkoxy, (C 2 -C 6 )alkenyl, (C 2 -C 6 )alkynyl, halo(C C 6 )alkyl, halo(d-C 6 )alkoxy, halo(C 2 -C 6 )alkenyl, and halo(C 2 - C 6 )alkynyl.
  • the substituents are selected from F, CI, Br, nitro, cyano and halo(d-C 6 )alkyl. Most preferably, the substituents are F, CI, or Br. Particularly prefened A groups are 4,5-dibromo-2-thienyl, 3-chloro-2-thienyl, 3-fluoro-2-thienyl, 3-chloro-2- benzothienyl, 2-fluoro-4-chlorophenyl, 2,4-difluorophenyl, and isoquinolinyl.
  • the linking group components of formula I include -CONH-, -SO 2 NH-, -CONR-, -SO 2 NR-, (C ⁇ -C 6 )alkylene, -NH-, -NR-, (C ⁇ -C 6 )heteroalkylene, and combinations thereof wherein R is (C ⁇ -C 6 )alkyl, optionally substituted by one or more halogens.
  • R is (C ⁇ -C 6 )alkyl, optionally substituted by one or more halogens.
  • the linking groups provided above no particular orientation is implied.
  • the recitation -CONH- is meant to include -NHCO-.
  • the terai "and combinations thereof refers to a combination of components (e.g., 2, 3, or 4 components) that can be same or different, including for example, -CONH-(C ⁇ -C 6 )alkylene-CONH-, -(Ci- C 6 )alkylene-CONH-, -(C ⁇ -C 6 )alkylene-CONH-(C ⁇ -C 6 )alkylene, -(C ⁇ -C 6 )alkylene-SO 2 NH-, and -CONR-(C ⁇ -C 6 )alkylene-SO 2 NR-.
  • components e.g., 2, 3, or 4 components
  • each Ar can be the same or different and is preferably selected from substituted or unsubstituted fo ns of pynole, thiophene, thiazole, isothiazole, oxazole, isoxazole, pyrazole, pyrazine, pyridine, isoquinoline, benzothiazole, benzimidazole, benzoxazole, benzothiophene, and indole.
  • Ar components are selected from substituted or unsubstituted forms of pynole, thiophene, thiazole, isothiazole, oxazole, isoxazole, pyrazole, pyrazine, pyridine, benzothiophene, isoquinoline, pyridine and benzimidazole.
  • substituents are generally halogen or substituted or unsubstituted (C ⁇ -C 6 )alkyl groups.
  • the substituents are unsubstituted (C]-C 6 )alkyl groups, more preferably unsubstituted (C ⁇ -C 4 )alkyl, and most preferably, methyl or ethyl groups.
  • the substituents are substituted (C ⁇ -C 6 )alkyl groups in which the substituent on the alkyl group is a 5- or 6-membered unsubstituted heterocycle selected from piperidine, pynolidine, morpholine, piperazine, pyran and furan.
  • L x is selected from -CONH-, -SO 2 NH-, -CONR-, -SO 2 NR-, (d- C 6 )alkylene, (d-C 6 )heteroalkylene, -CONH-(C ⁇ -C 6 )alkylene-, -CONH-(C ⁇ -C 6 )alkylene- CONH-, -CONH-(C ⁇ -C 6 )alkylene-CONH-(C ⁇ -C 6 )alkylene, -(C ⁇ -C 6 )alkylene-CONH-, -(d- C 6 )alkylene-CONH-(C ⁇ -C 6 )alkylene, -(d-C 6 )alkylene-SO 2 NH-, and -CONR-(d-)
  • L x is selected from -CONH-, -CONR-, (C,-C 6 )alkylene, -CONH-(C ⁇ -C 6 )alkylene-, -CONH-(C ⁇ -C 6 )alkylene-CONH-, -CONH-(C ⁇ -C 6 )alkylene-CONH-(C ⁇ -C 6 )alkylene, -(C ⁇ -C 6 )alkylene-CONH-, and -(d- C ⁇ )alkylene-CONH-(C ⁇ -C 6 )alkylene.
  • L x is selected from -CONH-, -CONH-(C ⁇ -C 6 )alkylene-, and -CONH-(d-C 6 )alkylene-CONH-(C ⁇ -C 6 )alkylene.
  • the letter B in formula (I) represents a second terminal group that can be a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, or an amino or mono- or di-alkyl amino group.
  • the substituted or unsubstituted aryl or heteroaryl groups are preferably nitrogen-containing heteroaryl groups such as, for example, pyridine, thiazole, isothiazole, pynole, quinonline or isoquinoline.
  • the substituted or unsubstituted heteroaryl groups are pyridine, thiazole or isothiazole.
  • Prefened substituents for the heteroaryl groups are unsubstituted (C ⁇ -C 6 )alkyl groups that are linear or branched.
  • the substituted or unsubstituted heterocychc groups are nitrogen-containing heterocycles such as, for example, piperidine, morpholine, pynolidine, thiomorpholine and hexamethyleneimine (homopiperidine).
  • each of these heterocycles is unsubstituted other than the point of attachment to L x .
  • the compounds used in the present methods have the formula:
  • A is selected from substituted or unsubstituted thiophene, substituted or unsubstituted thiazole, and substituted or unsubstituted benzothiophene (thianaphthene). More preferably, A is a substituted or unsubstituted thiophene, still more preferably a substituted thiophene. hi the most prefened embodiments, A is a halogen-substituted thiophene.
  • L 1 is preferably -CONH-, -CONR-, (Ci- C 6 )alkylene, -CONH-(C ⁇ -C 6 )alkylene- or -CONR-(C ⁇ -C 6 )alkylene-. More preferably, L 1 is -CONH- or -CONR-, most preferably -CONH-.
  • the first aryl group, Ar 1 is preferably a 5- membered heteroaryl moiety selected from pynole, thiazole, isothiazole and isoxazole.
  • Ar 1 is a substituted or unsubstituted pynole, wherein the substituents, when present are halogen or (C ⁇ -C 4 )alkyl.
  • Ar 1 is N-methyl pynole and the linking groups are attached at the 2- and 4-positions of the pynole ring.
  • L 2 is preferably -CONH-, -CONR-, (C ⁇ -C 6 )alkylene, -CONH-(d-C 6 )alkylene- or -CONR-(C ⁇ -C 6 )alkylene-.
  • L 2 is -CONH- or -CONR-, most preferably -CONH-.
  • Prefened groups for each of Ar 2 , Ar 3 and Ar 4 are the same as the prefened groups for Ar 1 .
  • L 3 is preferably a linking group that combines amide and alkylene groups.
  • L 3 is preferably a linking group selected from -CONH-(d-C 6 )alkylene, -CONH-(C ⁇ -C 6 )alkylene-CONH-, -CONH-(d-C 6 )alkylene- CONH-(C ⁇ -C 6 )alkylene, -(C ⁇ -C 6 )alkylene-CONH- and -(C ⁇ -C 6 )alkylene-CONH-(C ⁇ - C 6 )alkylene.
  • the alkylene portion is preferably methylene, ethylene, propylene or butylene, more preferably ethylene.
  • L 3 is -CONH-(C 2 -C )alkylene-CONH-.
  • Prefened embodiments of L 4 in formula (la) are the same as those provided above for L 2 .
  • the linking group L x like L 3 is preferably a combination of amide and alkylene groups.
  • L x is preferably -CONH-(d-C 6 )alkylene, -CONH-(C,-C 6 )alkylene-CONH-, -CONH-(C,- C 6 )alkylene-CONH-(C ⁇ -C 6 )alkylene and -(C t -C 6 )alkylene-CONH-(C ⁇ -C 6 )alkylene. More preferably, L x is -CONH-(C ⁇ -C 6 )alkylene-CONH-(C ⁇ -C 6 )alkylene. Still more preferably, L x is -CONH-(C ⁇ -C 3 )alkylene-CONH-(C 2 -C 5 )alkylene.
  • the alkylene groups are preferably linear or branched, and optionally substituted with from 1 to 3 substituents that are halogen, methyl or ethyl.
  • the letter B represents the terminal functional group and is preferably a dialkyl amine or a nitrogen heterocycle (e.g., piperidine, hexamethyleneimine, morpholine, pynolidine, or thiomorpholine).
  • B is a dialkyl amine
  • most prefened are -NR ] R 2 in which R 1 and R 2 can be the same or different and individually have from one to four carbon atoms.
  • an unsubstituted piperidine is most prefened.
  • A is a halogen-substituted thiophene (e.g., 4-bromothiophene or 4,5-dibromothiophene);
  • Ar 1 , Ar 2 , Ar 3 and Ar 4 are each N-methylpynole with linking groups attached at the 2- and 4- positions;
  • L 1 , L 2 and L 4 are each -CONH-;
  • L 3 is -CONH-(C 2 -C 4 )alkylene-CONH-;
  • L x is -CONH-(C ⁇ -C 3 )alkylene-CONH-(C2-C 5 )alkylene;
  • B is selected from dimethylamino, diethylamino, diisopropylamino, piperidine, pyno
  • A is selected from substituted or unsubstituted thiophene, substituted or unsubstituted benzene, substituted or unsubstituted isoquinoline, substituted or unsubstituted thiazole, substituted or unsubstituted benzothiophene (thianaphthene) and a substituted or unsubstituted 5- to 7-membered nitrogen heterocycle (e.g., piperidine, pyrrolidine, morpholine, hexamethyleneimine).
  • A is a substituted thiophene, substituted benzene, unsubstituted isoquinoline, substituted benzothiophene (thianaphthene) or a substituted or unsubstituted 6-membered nitrogen heterocycle (e.g., piperidine or morpholine).
  • the substituents when present, are preferably halogen, nitro, cyano, or (C ⁇ -C )alkyl. Most preferably, the substituents are halogens selected from F, CI and Br.
  • L 1 is preferably -CONH-, -CONR-, (C ⁇ -C 6 )alkylene, -CONH-(C ⁇ -C 6 )alkylene-, -(C ⁇ -C 6 )alkylene-NH- or -NH-(C ⁇ -C 6 )alkylene-. More preferably, L 1 is -CONH-, -CONR-, or -(C ⁇ -C 6 )alkylene-NH- , most preferably -CONH- or -CH 2 CH 2 NH-.
  • the remaining L groups (other than L x ) are all preferably -CONH- or -CONR-, most preferably -CONH-.
  • Ar 1 is preferably a 5-membered heteroaryl moiety selected from pynole, thiophene, thiazole, isothiazole and isoxazole. More preferably, Ar 1 is a substituted or unsubstituted pynole, substituted or unsubstituted thiophene, substituted or unsubstituted isoxazole, or a substituted or unsubstituted isothiazole, wherein the substituents, when present are halogen or (C ⁇ -C )alkyl.
  • Ar 1 is selected from pynole and N-methyl pynole wherein the linking groups are attached at the 2- and 4-positions of the pynole ring; unsubstituted thiophene having the linking groups attached at the 2- and 4-positions; 4- chloroisothiazole having the linking groups attached at the 2- and 4-positions; and isoxazole having the linking groups attached at the 3- and 5-positions.
  • prefened groups for each of Ar and Ar are the same as the prefened groups for Ar .
  • each of Ar 2 and Ar 3 are substituted pynole wherein the substituents are attached to the nitrogen atom and are selected from (C ⁇ -C )alkyl and heterocyclyl(C ⁇ -C 4 ) alkyl. Still more preferably, Ar 2 and Ar 3 are selected from N-methylpynole, N-(2-(N- morpholino)ethyl)pynole.
  • the linking group L x is preferably an amide group or a combination of amide and alkylene groups.
  • L x is preferably -CONH-, -CONR- -CONH-(C,-C 6 )alkylene and -CONH-(Ci-C 6 )alkylene-CONH-. More preferably, L x is -CONH- or -CONH-(C t -C 6 )alkylene. Still more preferably, L x is -CONH- or -CONH-(C r C 3 )alkylene-. Within this group of prefened embodiments, the alkylene groups are preferably linear and unsubstituted.
  • the letter B represents the terminal functional group and is preferably a nitrogen heterocycle (e.g., piperidine, hexamethyleneimine, morpholine, pynolidine, or thiomo ⁇ holine) or a heteroaryl group selected from isothiazole and pyridine.
  • B is a nitrogen heterocycle
  • an unsubstituted piperidine, morpholine, thiomorpholine or hexamethyleneimine is most prefened.
  • A is a halogen-substituted thiophene (e.g., 3 -chloro thiophene or 3-fluorothiophene), 3- chlorothianaphthene, 2-fluoro-4-chlorobenzene, piperidine, isoquinoline, or a 2,4- difiuorobenzene;
  • Ar 1 , Ar 2 and Ar 3 are each N-methylpynole, N-(2-(N- morpholino)ethyl)pynole or unsubstituted pynole with linking groups attached at the 2- and 4-positions, 4-chloroisothiazole, thiophene, isoxazole and isothiazole;
  • L , L and L are each -CONH-;
  • L x is -CONH-(C ⁇ -C 3 )alkylene-;
  • B is selected from morpholine, thiomorpho
  • the conesponding commercially available carboxylic acids were activated with 2-(lH-benzotriazole-l-yl)-l,l,3,3-tetramethyluronium hexafluorophosphate ("HBTU", 0.95 equiv.) for 30 min at room temperature in N,N- dimethylformamide (“DMF”) or N-methylpynolidone (“NMP”) in the presence of diisopropylethylamine (“DIEA").
  • DMF N,N- dimethylformamide
  • NMP N-methylpynolidone
  • HAPU 0-(7-Azabenzotriazol-l-yl)-N,N,N',N'- tetramethyluronium hexafluorophosphate
  • the coupling reaction can be carried out at a more elevated temperature.
  • Boc-Py-Py-OH [0089] To a solution of Boc-Py-OH (40 g, 167 mmol) in 150 mL DMF was added 1.2 eq hydroxybenzotriazole ("HOBt,” 27 g, 0.2 mmol) followed by 1.2 eq dicyclohexyl- carbodiimide ("DCC,” 40.4 g, 0.2 mmol). The solution was stined for 5 hours at room temperature, after which the DCC was removed by filtration followed by a rinse with N,N- dimethylformamide (“DMF,” 50 mL).
  • DMF N,N- dimethylformamide
  • Part II Scheme C describes the solid-phase synthesis of compound (1) proper.
  • the starting point is commercially available Boc- ⁇ -alanine-PAM-resin (see also the '947 patent).
  • This resin has a Boc-protected ⁇ -alanyl residue attached to the resin via a phenylacetamidomethyl (PAM) linkage:
  • Boc— ⁇ -PAM— jiesjrT will be used for convenience, where " ⁇ ” and “PAM” represent
  • Wash cycle A consists of tliree steps — step one is tliree cycles of adding NMP (5mL) to each vessel, mixing for 2 minutes and draining the NMP from the vessels using a controlled flow of compressed nitrogen, steps two and tliree are the same as step one, but with the substitution of methanol and CH 2 C1 2 , respectively, for NMP.
  • Wash cycle B uses the same tliree steps as wash cycle one, using CH 2 ⁇ 2 , methanol and NMP in that order.
  • the coupling cycle consists of heating the vessels to 37 °C and mixing for 2 hours. In the cleavage cycle, the vessels are heated to either 55 °C or 90 °C and mixed for 12 hours.
  • Boc- ⁇ -alanine-PAM resin (C-l, 200 mg) was placed in a vessel and manually washed with CH 2 C1 2 .
  • the protecting Boc group was then removed by manually adding 100% trifluoro acetic acid ("TFA," 5 mL) and mixing for 20 minutes.
  • TFA trifluoro acetic acid
  • the deprotected resin was washed using wash cycle B.
  • Boc-Py-Py-OH 125 mg, 0.34 mmol
  • HBTU 121 mg, 0.34 mmol
  • TEA TEA
  • Part I relates to the synthesis of the intermediate Boc-Py-Py-Py-Mp (D-4).
  • D-4 the intermediate Boc-Py-Py-Py-Mp
  • H-Py-OMe hydrochloride (D-2, 34 g, 160 mmol) was added, followed by TEA (80 mL) and the reaction was stined at 50 °C for 10 hours. The reaction mixture was then added dropwise to a stined solution of ice water (2 L) and the solution stored at 4 °C overnight. The resulting precipitate was collected by vacuum filtration and dried overnight to provide methyl 4-[t-butoxycarbonyl)amino]-l-methylpynole-2-[4- carboxamido-l-methylpynole-2-(4-carboxamido-l-methylpynole)]-2-carboxylate.
  • Boc-Py-Py-Py-OH (D-3) as a white powder.
  • Boc-Py-Py-Py-OH (D-3, 0.1 mmol, 1 eq.) is activated with HBTU (0.095 mmole, 0.95 eq) in 50 mL DMF and 25 mL TEA for about 45 minutes at RT.
  • N-(2-aminoethyl)- mo ⁇ holine (0.12 mmol, 1.2 eq) is added to the mixture and the reaction is stined at 37 °C overnight.
  • the product mixture is concentrated in vacuo and TFA (150 mL) is added to the reaction, which is then stined at room temperature for 3 hours.
  • the solution is concentrated in vacuo, after which acetic acid (40 mL) and water (200 mL) is added.
  • the solution is extracted with diethyl ether three times, then product D-4 is purified using reverse phase HPLC with a gradient of 1 % acetonitrile/minute in 0.5 % acetic acid.
  • Acid E-12 (0.70 g) was treated with a solution of ethyl acetate (saturated with HCl, 10 ml) and stined at 4 °C for 30 minutes. The suspension was then added dropwise into ethyl ether (400 mL), from which the solid was filtered and dried in vacuo to yield amino acid E-13 (357 mg).
  • the reaction was allowed to slowly reach 10 °C. At this point the temperature can increase rapidly. Between 10 and 20 °C, the solution was immediately poured onto ice (480 g). The reaction was allowed to sit at room temperature overnight. Crystals fornied. The solution was brought to 5 °C for 1 h, then filtered. The crystals foraied were recrystalized from 100 mL of ethanol to provide 10.1 g of the desired isomer F-5. Further crystallization from ethanol provided an additional 7.64 g of desired isomer F-5.
  • Oxalyl chloride (1.67 mL, 19.19 mmol) was added drop-wise to a suspension of isoquinoline-3-carboxylic acid (G-1, 332.3 mg, 1.92 mmol) in THF (2 mL) and the reaction heated at reflux (oil bath 85 °C) for 3 hours. All volatile components were then removed in vacuo. The resulting solid (presumed acid chloride) was then dissolved in NMP (1 mL) and pyridine (1 mL), and ethyl 3-aminoisoxazole-5-carboxylate G-2 (prepared as described in Lepage et al, FR 2,750,425 (1998), 300mg, 1.92 mmol) was then added.
  • Oxalyl chloride (0.22 mL, 2.54 mmol) was added drop-wise to a suspension of acid G-4 (72 mg, 0.254 mmol) in THF (1 mL) and the reaction heated at reflux (oil bath 85 C) for 3 hours. All volatile components were then removed in vacuo. The resulting solid (presumed acid chloride) was then dissolved in NMP (0.5 mL) and pyridine (0.5 mL). A solution of amine G-6 (105 mg, 0.254 mmol) in NMP (1 mL) and DIEA (0.5 mL) was then added and the reaction stined at 60 °C for 12 hours. The reaction mixture was then diluted with 50% acetic acid solution and directly purified by HPLC to give the desired product, compound (20) (25 mg, 16%). The 1H-NMR spectrum was consistent with the assigned structure.
  • NCLS National Committee for Clinical Laboratory Standards
  • Col. C S. aureus ATCC 43300 Col.
  • D E. faecium ATCC 51559 Col.
  • E S. pneumoniae ATCC 51422 Col.
  • F C. albicans ATCC 38247
  • Murine Neutropenic Thigh Model This example demonstrates in vivo efficacy against infection by methicillin resistant Staphylococcus aureus ATCC 33591, using a murine neutropenic thigh model.
  • a S. aureus ATCC 33591 culture was grown to log phase overnight and diluted in phosphate buffered saline (pH 7.2) to an optical density of about 0.1 at 600 nm, giving an approximate concentration of 10 8 cfu/mL. The suspension was diluted 1:100 in phosphate buffered saline (pH 7.2) for a final concentration of 10 6 cfu/mL.
  • Outbred female CF1 mice (approx.
  • mice 20 gram body weight were rendered neutropenic by treatment with cyclophosphamide (200 mg/kg body weight, intraperitoneal injection) at 2 and 4 days prior to inoculation.
  • Groups of 5 mice were inoculated with 0.05 mL of the bacteria (approx. 10 6 cfu/mL) into the anterior thigh.
  • Each group was treated intravenously two hours post infection with vehicle (phosphate buffered saline) or test compound.
  • the mice were sacrificed at either 6 or 24 hrs after treatment and thighs were collected aseptically.
  • Each thigh was weighed, placed into sterile saline, and homogenized. The tissue homogenates were diluted appropriately for plating on agar plates. Colony counts were recorded (cfu/gram) and compared to control groups.
  • Table III The data are presented in Table III below:
  • This example demonstrates in vivo efficacy against infection by methicillin resistant Staphylococcus aureus ATCC 33591, using a mouse protection assay.
  • a S. aureus ATCC 33591 culture was grown to log phase overnight and diluted in phosphate buffered saline (pH 7.2) to an optical density of about 0.1 at 600 nm, giving an approximate concentration of 10 s cfu/mL.
  • Porcine mucin was added to the suspension to a final concentration of 5%> mucin.
  • the suspension was diluted 1 : 100 for a final concentration of l0 6 cfu/mL.
  • mice Female balb/c mice (20g body weight) were injected mtraperitoneally with 0.5 mL of bacterial suspension (10 6 cfu/mL). Vehicle (phosphate buffered saline, pH 7.2) or test compound were administered intravenously at 2, 8, 18, and 24 hours post infection. The animals were monitored twice daily and survival counts were recorded up to 48 hours post infection. The results are provided in Table IV:
  • Plasmid A was prepared by hybridizing two sets of 5 '-phosphorylated complementary oligonucleotides, the first set being
  • Plasmid B was prepared by hybridizing two sets of 5 '-phosphorylated complementary oligonucleotides, the first set being
  • Plasmid B A map of Plasmid B is shown in Fig. 6.
  • Plasmid C was the plasmid pTrc99a, obtained from Amersham Pharaiacia Biotech, Inc. A map of Plasmid C is shown in Fig. 7. [0139] The 3'-P32 end-labeled EcoRI/PvuII fragments from each plasmid were prepared by digesting the plasmids with EcoRI and PvuII with simultaneous fill-in using Sequenase v. 2.0, [alpha-P32]-deoxyadenosine-5'-triphosphate, and [alpha-P32]-thymidine-5'- triphosphate, and isolating the cloned fragments by nondenaturing gel electrophoresis.
  • Plasmid A contained the target sequences AAAAAGCAAAAA, AAAAAGACAAAAA, and AAAAAGTACAAAAA.
  • the 310 base pair dsDNA restriction fragment (SEQ ID NO. V) of Plasmid B contained the target sequences AGTACT, AATACT, and ATT ACT.
  • the 352 base pair dsDNA restriction fragment (SEQ ID NO. VI) of Plasmid C contained the target sequences TGACAATTAAT, GACAATTAATCA, AATTAATCAT, ACAATTA, and ACAATTAAT. These fragments were used for quantitative DNase I footprinting experiments.
  • Target sites bind to at least one of the target sites with a equal to or less than 100 nM, preferably equal to or less than 50 nM, and more preferably equal to or less than 20 nM.
  • the target sequences were selected for the identity with, or similarity to, promoter sites for bacterial genes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Pyrrole Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Methods are provided for treating an infection by Gram-positive bacteria in a mammal, by admistering to the mammal an effective amount of a compound that binds noncovalently in the minor groove of duplex DNA, the compound being identified by a number of DNA binding parameters and, in many instances, being a polyaromatic compound.

Description

Methods of Treating Infection by Drug Resistant Bacteria
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Ser. No. 60/322,704 filed September 13, 2001 ; the disclosures of which is incorporated herein by reference
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
[0002] The United States government may have certain rights to this invention under DARPA Grant No. N65236-99-1-5427.
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER PROGRAM LISTING APPENDIX SUBMITTED ON A COMPACT DISK.
BACKGROUND OF THE INVENTION
[0003] Many compounds, either naturally occurring or synthetic, have been found to bind to double stranded nucleic acid, especially double stranded deoxyribonucleic acid ("dsDNA"). Depending on their structure, the compounds bind to different parts of the nucleic acid. Some bind to the major groove while others associate with the minor groove. Still others intercalate between adjacent base pairs. Combination binding modes are also known, in which a compound has binding interactions with more than one site in the nucleic acid.
[0004] Certain dsDNA binding compounds can be used to regulate the expression of genes for medical purposes. If a disease is characterized by the overexpression or the undesired expression of a gene (e.g., an oncogene), the disease may be treated by suppressing in toto or in part the expression of the gene by the binding of such compounds to the gene or a promoter site thereof. Infections by pathogens such fungi, bacteria, and viruses may be combated with compounds that affect the expression of genes essential for the proliferation or existence/survival of the pathogen. [0005] Whatever the application, the compound must strongly bind to dsDNA, generally meaning that it binds with an association constant of at least 106 M"1, preferably at least about 109 M"1. However, binding strength alone is not determinative of efficaciousness, whether in a therapeutic, anti-infective, or other applications. Many other factors come into play, including, for instance, cellular uptake, stability, toxicity, binding specificity, and the like. A compound that is acceptable or superior in one characteristic may be fatally deficient in another characteristic. Thus, there is a continuing need to develop new classes of nucleic acid binding compounds for use in such applications.
BRIEF SUMMARY OF THE INVENTION
[0006] In one aspect, the present invention provides a method for treating an infection by gram-positive bacteria in a mammal, by administering to the mammal an effective amount of a compound that binds noncovalently in the minor groove of duplex DNA, which compound: i) binds with a dissociation constant of equal to or less than 100 nM to at least one of:
(a) a target sequence AAAAAGCAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I;
(b) a target sequence AAAAAGACAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I;
(c) a target sequence AAAAAGTACAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I; (d) a target sequence AGTACT in the 310 base pair EcoRJ/PvuII restriction fragment of a polynucleotide of SEQ LD NO. II;
(e) a target sequence AATACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. II;
(f) a target sequence ATT ACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. II;
(g) a target sequence TGACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill;
(h) a target sequence GACAATTAATCA in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (i) a target sequence AATTAATCAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (j) a target sequence ACAATTA in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ LD NO. HI; and (k) a target sequence ACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; ii) exhibits a MIC of less than or equal to 2 μg/mL against at least one of Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus ATCC 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422; iii) exhibits a MIC of greater than or equal to 32 μg/mL against Candida albicans ATCC 38247; and iv) has a molecular weight of from 100 to about 1100. [0007] In a related aspect, the present invention provides methods as above, wherein the compound has activity ratio X/Y equal to or greater than 16, wherein X is the MIC of the compound against Candida albicans ATCC 38247 and Y is the lowest MIC of the compound from among the MIC's fox Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422.
[0008] In yet another aspect, the present invention provides a compound useful for the treatment of a bacterial infection, the compound having the formula:
A-((LVArVLx-B (I) wherein A is a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, an unsubstituted amino group or a mono- or di-alkyl amino group; the subscript n is an integer of from 2 to 7; the subscript p in each instance is an integer of from 0 to 1, indicating the presence or absence of each linking group (L1); each L' is a linking group in which the superscript i is an integer of from 1 to n, and each linking group can be the same or different from the other linking groups and is selected from the group consisting of-NH-, -NR-, -CONH-, -SO2NH-, -CONR-, -S02NR-, (Cι-C6)alkylene, (Cι-C6)heteroalkylene, and combinations thereof in which each R is independently (C\- C6)alkyl; Ar1 is a substituted or unsubstituted aryl or heteroaryl group, in which the superscript i is an integer of from 1 to n and denotes the position away from A that is occupied by each aryl or heteroaryl group, and each Ar group can be the same or different from any other Ar group; Lx is a linking group selected from -NH-, -NR-, -CONH-,
-SO2NH-, -CONR-, -S02NR-, (C C6)alkylene, (Cι-C6)heteroalkylene, and combinations thereof; and B is a member selected from a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, and an unsubstituted amino group or a mono- or di-alkyl amino group. Additionally, the compounds of the invention: i) bind with a dissociation constant of equal to or less than 100 nM to at least one of the target sequences noted above in (a) through (k); ii) exhibit a MIC of less than or equal to 2 μg/mL against at least one of Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus ATCC 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422; iii) exhibit a MIC of greater than or equal to 32 μg/mL against Candida albicans ATCC 38247; and iv) have a molecular weight of from 100 to about 1100. [0009] These and other features of the present invention will be apparent to one of skill in the art upon reading the complete disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figures 1 -4 illustrate structures of compounds useful in the present invention. [0011] Figures 5-7 illustrate maps of plasmids used in DNA binding protocols.
DETAILED DESCRIPTION OF THE INVENTION
Abbreviations and Definitions
[0012] The term "alkyl," by itself or as part of another substituent, means, unless otherwise stated, a straight or branched chain, or cyclic hydrocarbon radical, or combination thereof, which may be fully saturated, mono- or polyunsaturated and can include di- and multivalent radicals, having the number of carbon atoms designated (i.e. Ci-Cio means one to ten carbons). Examples of saturated hydrocarbon radicals include groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n- octyl, and the like. An unsaturated alkyl group is one having one or more double bonds or triple bonds. Examples of unsaturated alkyl groups include vinyl, 2-propenyl, crotyl, 2- isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(l,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and the higher homologs and isomers.
[0013] The term "alkylene" by itself or as part of another substituent means a divalent radical derived from an alkane, as exemplified by -CH2CH2CH2CH2-. Typically, an alkyl (or alkyl ene) group will have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred in the present invention. A "lower alkyl" or "lower alkylene" is a shorter chain alkyl or alkylene group, generally having six or fewer carbon atoms. [0014] The terms "alkoxy," "alkylamino" and "alkylthio" (or thioalkoxy) are used in their conventional sense, and refer to those alkyl groups attached to the remainder of the molecule via an oxygen atom, an amino group, or a sulfur atom, respectively.
[0015] The term "heteroalkyl," by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched chain, or cyclic hydrocarbon radical, or combinations thereof, consisting of the stated number of carbon atoms and from one to tliree heteroatoms selected from the group consisting of O, N, Si and S, and wherein the nitrogen and sulfur atoms may optionally be oxidized and the nitrogen heteroatom may optionally be quaternized. The heteroatom(s) O, N and S may be placed at any interior position of the heteroalkyl group. The heteroatom Si may be placed at any position of the heteroalkyl group, including the position at which the alkyl group is attached to the remainder of the molecule. Examples include -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S- CH2-CH3, -CH2-CH2,-S(O)-CH3, -CH2-CH2-S(O)2-CH3, -CH=CH-O-CH3, -Si(CH3)3, -CH2- CH=N-OCH3, and -CH=CH-N(CH3)-CH3. Up to two heteroatoms may be consecutive, such as, for example, -CH2-NH-OCH3 and -CH2-O-Si(CH3)3. Similarly, the term "heteroalkylene" by itself or as part of another substituent means a divalent radical derived from heteroalkyl, as exemplified by -CH2-CH2-S-CH2CH2- and -CH2-S-CH2-CH2-NH-CH2-. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, no orientation of the linking group is implied. [0016] The terms "cycloalkyl" and "heterocycloalkyl", by themselves or in combination with other terms, represent, unless otherwise stated, cyclic versions of "alkyl" and
"heteroalkyl", respectively. Additionally, for heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include 1 -(1,2,5,6-tetrahydropyιidyl), 1-ρiperidinyl, 2-piρeridinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1 -piperazinyl, 2-piperazinyl, and the like.
[0017] The terms "halo" or "halogen," by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom. Additionally, terms such as "haloalkyl," are meant to include monohaloalkyl and polyhaloalkyl. For example, the term "halo(Cι-C4)alkyl" is mean to include trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the like.
[0018] The term "aryl" means, unless otherwise stated, a polyunsaturated, typically aromatic, hydrocarbon substituent which can be a single ring or multiple rings (up to three rings) which are fused together or linked covalently. The term "heteroaryl" refers to aryl groups (or rings) that contain from zero to four heteroatoms selected from N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized. A heteroaryl group can be attached to the remainder of the molecule through a heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2- imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5- benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2- quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below. [0019] For brevity, the term "aryl" when used in combination with other terms (e.g. , aryloxy, arylthioxy, arylalkyl) includes both aryl and heteroaryl rings as defined above. Thus, the term "arylalkyl" is meant to include those radicals in which an aryl group is attached to an alkyl group (e.g., benzyl, phenethyl, pyridylmethyl and the like) including those alkyl groups in which a carbon atom (e.g., a methylene group) has been replaced by, for example, an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl, 3-(l- naphthyloxy)propyl, and the like).
[0020] Each of the above terms (e.g., "alkyl," "heteroalkyl," "aryl" and "heteroaryl") are meant to include both substituted and unsubstituted forms of the indicated radical. Preferred substituents for each type of radical are provided below. [0021] Substituents for the alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) can be a variety of groups selected from: -OR', =O, =NR\ =N-OR', -NR'R", -SR', -halogen, -SiR'R"R"\ -OC(O)R\ -C(O)R\ - CO2R', -CONR'R", -OC(O)NR'R", -NR"C(O)R', -NR'-C(O)NR"R"\ -NR"C(O)2R', -NH- C(NH2)=NH, -NR'C(NH2)=NH, -NH-C(NH2)=NR', -S(O)R', -S(O)2R', -S(O)2NR'R", -CN and -N02 in a number ranging from zero to (2m'+l), where m' is the total number of carbon atoms in such radical. R', R" and R'" each independently refer to hydrogen, unsubstituted (Cι-C8)alkyl and heteroalkyl, unsubstituted aryl, aryl substituted with 1-3 halogens, unsubstituted alkyl, alkoxy or thioalkoxy groups, or aryl-(Cι-C )alkyl groups. When R' and R" are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 5-, 6-, or 7-membered ring. For example, -NR'R" is meant to include 1-pyιτolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term "alkyl" is meant to include groups such as haloalkyl (e.g., -CF3 and - CH2CF3) and acyl (e.g., -C(O)CH3, -C(O)CF3, -C(O)CH2OCH3, and the like). Preferably, the substituted alkyl and heteroalkyl groups have from 1 to 4 substituents, more preferably 1 , 2 or 3 substituents. Exceptions are those perhalo alkyl groups (e.g., pentafluoroethyl and the like) which are also preferred and contemplated by the present invention.
[0022] Similarly, substituents for the aryl and heteroaryl groups are varied and are selected from: -halogen, -OR', -OC(O)R', -NR'R", -SR\ -R', -CN, -NO2, -CO2R', -CONR'R", -C(O)R', -OC(O)NR'R", -NR"C(O)R', -NR"C(O)2R', ,-NR'-C(O)NR"R'",
-NH-C(NH2)=NH, -NR'C(NH2)=NH, -NH-C(NH2)=NR', -S(O)R', -S(O)2R\ -S(0)2NR'R", - N3, -CH(Ph)2, perfluoro(Cι-C )alkoxy, and perfluoro(Cι-C4)alkyl, in a number ranging from zero to the total number of open valences on the aromatic ring system; and where R', R" and R'" are independently selected from hydrogen, (Cι-C8)alkyl and heteroalkyl, unsubstituted aryl and heteroaryl, (unsubstituted aryl)-(Cι-C )alkyl, and (unsubstituted aryl)oxy-(Cι- C4)alkyl.
[0023] Two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -T-C(O)-(CH2)q-U-, wherein T and U are independently -NH-, -O-, -CH2- or a single bond, and q is an integer of from 0 to 2. Altematively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -A-(CH2),-B-, wherein A and B are independently -CH2-, -O-, -NH-, -S-, -S(O)-, -S(O)2-, -S(O)2NR'- or a single bond, and r is an integer of from 1 to 3. One of the single bonds of the new ring so formed may optionally be replaced with a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -(CH2)S- X-(CH2)π, where s and t are independently integers of from 0 to 3; and X is -0-, -NR'-, -S-, - S(O)-, -S(O)2-, or -S(O)2NR'-. The substituent R' in -NR'- and -S(O)2NR'- is selected from hydrogen or unsubstituted (Cι-C6)alkyl. [0024] As used herein, the term "heteroatom" is meant to include oxygen (O), nitrogen (N), sulfur (S) and silicon (Si).
[0025] The term "pharmaceutically acceptable salts" is meant to include salts of the active compounds which are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein. When compounds of the present invention contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt. When compounds of the present invention contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from relatively nontoxic organic acids like acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, mandelic, phthalic, benzenesulfonic, p- tolylsulfonic, citric, tartaric, methanesulfonic, and the like. Also included are salts of amino acids such as arginate and the like, and salts of organic acids like glucuronic or galactunonc acids and the like (see, for example, Berge, S.M., et al, "Phanriaceutical Salts", Journal of Pharmaceutical Science, 1977, 66, 1-19). Certain specific compounds of the present invention contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts. [0026] The neutral forms of the compounds may be regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner. The parent forai of the compound differs from the various salt forms in certain physical properties, such as solubility in polar solvents, but otherwise the salts are equivalent to the parent form of the compound for the purposes of the present invention. [0027] In addition to salt forms, the present invention provides compounds which are in a prodrug form. Prodrugs of the compounds described herein are those compounds that readily undergo chemical changes under physiological conditions to provide the compounds of the present invention. Additionally, prodrugs can be converted to the compounds of the present invention by chemical or biochemical methods in an ex vivo environment. For example, prodrugs can be slowly converted to the compounds of the present invention when placed in a transdermal patch reservoir with a suitable enzyme or chemical reagent. [0028] Certain compounds of the present invention can exist in unsolvated forms as well as solvated fonns, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are intended to be encompassed within the scope of the present invention. Certain compounds of the present invention may exist in multiple crystalline or amorphous forms. In general, all physical fonns are equivalent for the uses contemplated by the present invention and are intended to be within the scope of the present invention. [0029] Certain compounds of the present invention possess asymmetric carbon atoms (optical centers) or double bonds; the racemates, diastereomers, geometric isomers and individual isomers are all intended to be encompassed within the scope of the present invention.
[0030] The compounds of the present invention may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (3H), iodine-125 (125I) or carbon-14 (14C). All isotopic variations of the compounds of the present invention, whether radioactive or not, are intended to be encompassed within the scope of the present invention. [0031] In the discussions below, reference is made to dsDNA as the nucleic acid, but it is to be understood that the invention is not limited to dsDNAand is applicable to other nucleic acids, i.e., ribonucleic acid.
General
[0032] Over the last two decades, there has been a shift in the hospital environment from a predominance of Gram-negative bacteria to Gram-positive bacteria, such that Gram-positive bacteria currently account for about 70% of the bloodstream infections in hospitalized patients. Such a change in predominance has been reported not only in the United States, but also in Europe and is probably a worldwide phenomenon.
[0033] Further, there has been an alarming increase in resistance of various bacterial strains to different classes of antibiotics; e.g., in some hospitals, 50% of S. aureus infections are caused by methicillin-resistant strains, most of which are also resistant to macro lides and quinolones. hi these cases, patients must be treated with the glycopeptide vancomycin.
Usage of large quantities of vancomycin has led to the emergence of S. aureus strains with reduced susceptibility to the drug. In addition, Enter ococci with high levels of vancomycin resistance now constitute a major challenge. Accordingly, there is an increasing need for new antibiotics with activity against Gram-positive bacteria, particularly for agents with a novel mechanism of action and without cross-resistance to known drugs. [0034] The present invention derives from the surprising discovery that a number of compounds found to interact predominantly in the minor groove of bacterial DNA share certain common structural as well as functional features, in particular bactericidal activity against Gram-positive bacteria. Accordingly, assays have been developed to screen for such compounds and methods are provided for the use of such compounds. [0035] Without being bound by theory, compounds provided herein are believed to bind to a target bacteria's DNA, in particular its minor groove. Double-helical DNA (also refened to as double-stranded DNA, B-DNA, or beta-DNA) has two helical grooves running along its length, with the edges of the bases forming the groove floors and the sugar and phosphate backbone residues forming the groove walls. The asymmetry of the backbone residues leads to the two grooves being of unequal size. The larger (or major) groove is about 11.6 A wide and about 8.5 A deep, while the smaller (or minor) groove is about 6.0 A wide and about 8.2 A deep. In A,T rich dsDNA regions, the minor groove is nanower, reportedly in the range of 3-4 A. See Neidle, Nat. Prod. Rep., 2001, 18, 291-309. The compounds provided herein are crescent shaped, providing a conformational fit enabling them to nestle in the minor groove. Depending on molecular structure and the width of the minor groove, a compound may bind individually within the minor groove (the 1 : 1 mode), or it may bind side-by-side with another compound (the 2: 1 mode). The binding may be sequence-selective, that is, the compound recognizes and selectively binds to particular DNA sequences. The binding sites identified herein — having a prevalence of A and T — have been selected for their identity with or similarity to promoter sequences of bacterial genes, which are typically A,T rich. The binding of the compound to the target site prevents formation of the complex necessary for the transcription of the conesponding bacterial gene, possibly by displacing or inhibiting the binding of essential transcription factors or enzymes, and results in the downregulation or shutting down of the gene. By downregulating multiple essential bacterial genes, the compounds herein are believed to ultimately cause bacterial death. Because multiple genes are affected, it is more difficult for bacteria to develop resistance. Additionally, antifungal activity can be predictive of cytotoxic effects in other eukaryotic cells. Accordingly, the present antibacterial compounds have reduced antifungal activity (as determined by activity against Candida albicans ATCC 38247). DESCRIPTION OF THE SPECIFIC EMBODIMENTS
Methods for Reducing Bacterial Gene Expression
[0036] hi view of the more general discussion above, the present invention provides, in one aspect, methods for treating infection by Gram-positive bacteria in a mammal, by administering to the mammal an effective amount of a compound that binds noncovalently in the minor groove of duplex DNA, which compound: i) binds with a dissociation constant of equal to or less than 100 nM to at least one of: (a) a target sequence AAAAAGCAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I;
(b) a target sequence AAAAAGACAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I;
(c) a target sequence AAAAAGTACAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I;
(d) a target sequence AGTACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. II;
(e) a target sequence AATACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. II; (f) a target sequence ATTACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ LD NO. II; (g) a target sequence TGACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (h) a target sequence GACAATTAATCA in the 352 base pair EcoRI PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill;
(i) a target sequence AATTAATCAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; 0) a target sequence ACAATTA in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; and (k) a target sequence ACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; ii) exhibits a MIC of less than or equal to 2 μg/mL against at least one of Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus ATCC 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422; iii) exhibits a MIC of greater than or equal to 32 μg/mL against Candida albicans ATCC 38247; and iv) has a molecular weight of from 100 to about 1100.
[0037] Of particular note regarding the method above, is the identification of specific sequences that can be targeted for binding agents useful for reducing bacterial gene expression. A compound is deemed to bind to one or more of the recited target sequences if, when contacted with duplex DNA of SEQ. LD. NO. I, II or III (with each complementary strand), the compound binds with the noted dissociation constant and exhibits at least 50%, more preferably 60%, 70%, 80% or even 90% overlap with the indicated residues. In the most prefened embodiments, the compound exhibits 100% overlap with the indicated residues. The sequence of DNA targeted by the compounds provided herein can be determined to nucleotide resolution using MPE Footprinting or alternatively using DNase and MPE footprinting to determine affinity and target sequence (see, Nan Dyke, et al., Nucl Acids Res. (1983) 11:5555 and Nan Dyke, et al., Scz'ence (1984) 225:1122. [0038] In therapeutic use for treating, or combatting bacterial infections in humans and other animals that have been diagnosed with bacterial infections, compounds having the functional properties described above, or advantageously having formula (I) below are administered. Typically administration of the compounds is in the form of pharmaceutical compositions thereof and such administration is made orally, parenterally and/or topically at a dosage to obtain and maintain a concentration, that is, an amount, or blood-level of active component in the animal undergoing treatment which will be antib act eri ally effective. Generally, such antibacterially effective amount of dosage of active component will be in the range of about 0.1 to about 100 mg/kg, more preferably about 3.0 to about 50 mg/kg of body weight/day. It is to be understood that the dosages may vary depending upon the requirements of the patient, the severity of the bacterial infection being treated, and the particular compound being used. Also, it is to be understood that the initial dosage administered may be increased beyond the above upper level in order to rapidly achieve the desired blood-level or the initial dosage may be smaller than the optimum and the daily dosage maybe progressively increased during the course of treatment depending on the particular situation. If desired, the daily dose may also be divided into multiple doses for administration, e.g., two to four times per day. [0039] The compounds of formula (I) according to this invention are administered parenterally, i.e., by injection, for example, by intravenous injection or by other parenteral routes of administration. Pharmaceutical compositions for parenteral administration will generally contain a pharmaceutically acceptable amount of the compound according to formula (I) as a soluble salt (acid addition salt or base salt) dissolved in a pharaiaceutically acceptable liquid canier such as, for example, water- for-injecti on and a suitably buffered isotonic solution, for example, having a pH of about 3.5-6. Suitable buffering agents include, for example, trisodium orthophosphate, sodium bicarbonate, sodium citrate, N- methylglucamine, L(+)-lysine and L(+)-arginine, to name a few. The compound according to formula (I) generally will be dissolved in the canier in an amount sufficient to provide a pharmaceutically acceptable injectable concentration in the range of about 1 mg/mL to about 400 mg/mL. The resulting liquid pharmaceutical composition will be administered so as to obtain the above-mentioned antibacterially effective amount of dosage. The compounds of formula (I) according to this invention are advantageously administered orally in solid and liquid dosage forms.
[0040] In certain embodiments, the compounds are administered in combination with a second agent that is either an antibacterial or antimicrobial agent. Antibacterial agents useful in the present compositions and methods include in general the β-lactam antibiotics and the quinolone antibiotics. More particularly, the agents can be naficillin, oxacillin, penicillin, amoxacillin, ampicillin, cefotaxime, ceftriaxone, rifampin, minocycline, ciprofloxacin, norfloxacin, erytlrromycin, vancomycin, or an analog thereof. Antimicrobial agents useful in the present compositions and methods include in general sulfanilamide, sulfamethoxazole, sulfacetamide, sulfisoxazole, sulfadiazine, penicillins (e.g., penecillins G and V, methicillin, oxacillin, naficillin, ampicillin amoxacillin, carbenicillin, ticarcillin, mezlocillin and piperacillin), cephalosporins (e.g., cephalothin, cefaxolin, cephalexin, cefadroxil, cefamandole, cefoxitin, cefaclor, cefuroxine, loracarbef, cefonicid, cefotetan, ceforanide,cefotaxime, cefbodoxime proxetil, ceftizoxime, cefoperazone, ceftazidime and cefepime), aminoglycosides (e.g., gentamycin, tobramycin, amikacin, netilmicin, neomycin, kanamycin, streptomycin, and the like), tetracyclines (e.g., chlortetracycline, oxytetracycline, demeclocycline, methacycline, doxycycline and minocycline), macro lides (e.g., erythromycin, clarithromycin, azithromycin), and the like. Pharmaceutical Compositions
[0041] The compounds described and provided herein, as well as those compounds identified using the criteria established above, can be prepared in a number of pharmaceutical compositions. In particular, the compounds can be prepared and administered in a wide variety of oral, topical and parenteral dosage forms. Thus, the compounds of the present invention can be administered by injection, that is, intravenously, intramuscularly, intracutaneously, subcutaneously, intraduodenally, or intraperitoneally. Also, the compounds described herein can be administered by inhalation, for example, intranasally. Additionally, the compounds of the present invention can be administered transderaially. Accordingly, the present invention also provides pharmaceutical compositions comprising a pharmaceutically acceptable canier or excipient and either a compound of formula (I) or a pharmaceutically acceptable salt of a compound of formula (I). [0042] For preparing pharmaceutical compositions from the compounds of the present invention, pharmaceutically acceptable carriers can be either solid or liquid. Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules. A solid canier can be one or more substances which may also act as diluents, flavoring agents, binders, preservatives, tablet disintegrating agents, or an encapsulating material. [0043] hi powders, the canier is a finely divided solid which is in a mixture with the finely divided active component, hi tablets, the active component is mixed with the canier having the necessary binding properties in suitable proportions and compacted in the shape and size desired. [0044] The powders and tablets preferably contain from 5% or 10% to 70% of the active compound. Suitable caniers are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like. The tenn "preparation" is intended to include the formulation of the active compound with encapsulating material as a canier providing a capsule in which the active component with or without other caniers, is sunounded by a canier, which is thus in association with it.
Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration. [0045] For preparing suppositories, a low melting wax, such as a mixture of fatty acid glycerides or cocoa butter, is first melted and the active component is dispersed homogeneously therein, as by stining. The molten homogeneous mixture is then poured into convenient sized molds, allowed to cool, and thereby to solidify. [0046] Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water/propylene glycol solutions. For parenteral injection, liquid preparations can be formulated in solution in aqueous polyethylene glycol solution.
[0047] Aqueous solutions suitable for oral use can be prepared by dissolving the active component in water and adding suitable colorants, flavors, stabilizers, and thickening agents as desired. Aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, and other well-known suspending agents.
[0048] Also included are solid form preparations which are intended to be converted, shortly before use, to liquid form preparations for oral administration. Such liquid fonns include solutions, suspensions, and emulsions. These preparations may contain, in addition to the active component, colorants, flavors, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilizing agents, and the like.
[0049] The pharmaceutical preparation is preferably in unit dosage form. In such form the preparation is subdivided into unit doses containing appropriate quantities of the active component. The unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation, such as packeted tablets, capsules, and powders in vials or ampoules. Also, the unit dosage form can be a capsule, tablet, cachet, or lozenge itself, or it can be the appropriate number of any of these in packaged form. [0050] The quantity of active component in a unit dose preparation may be varied or adjusted from 0.1 mg to 1000 mg, preferably 1.0 mg to 100 mg according to the particular application and the potency of the active component. The composition can, if desired, also contain other compatible therapeutic agents.
Compounds for Inhibiting Bacterial Gene Expression
[0051] One class of compounds that can be used in the method of this invention has the following formula:
A-((Li)p-Ari)n-Lx-B (I) wherein A is a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, an unsubstituted amino group or a mono- or di-alkyl amino group; the subscript n is an integer of from 2 to 7; the subscript p in each instance is an integer of from 0 to 1, indicating the presence or absence of each linking group (L1); each V is a linking group in which the superscript i is an integer of from 1 to n, and each linking group can be the same or different from the other linking groups and is selected from the group consisting of-NH-, -NR-, -CONH-, -SO2NH-, -CONR-, -SO2NR-, (d-C6)alkylene, (C|-C6)heteroalkylene, and combinations thereof in which each R is independently (Ci- C6)alkyl; Ar1 is a substituted or unsubstituted aryl or heteroaryl group, in which the superscript i is an integer of from 1 to n and denotes the position away from A that is occupied by each aryl or heteroaryl group, and each Ar group can be the same or different from any other Ar group; Lx is a linking group selected from -NH-, -NR-, -CONH-,
-S02NH-, -CONR-, -SO2NR-, (C C6)alkylene, (Cι-C6)heteroalkylene, and combinations thereof; and B is a member selected from a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, and an unsubstituted amino group or a mono- or di-alkyl amino group. The formula above is further meant to include all pharmaceutically acceptable salts, prodrug forms, protected forms and mixtures of isomers. [0052] Thus, formula (I) includes, for example, polyaromatic compounds having the following formulae:
A-L1-Ar1-L2-Ar2-L3-Ar3-L4-Ar4-L5-Ar5-Lx-B A-L1-Ar1-L2-Ar2-Ar3-L4-Ar4-L5-Aι-5-Lx-B A-L1-ArI-L2-Ar2-L3-Ar3-L4-Ar4-Lx-B
A-L1-Ar1-L2-Ar2-L3-Ar3-Lx-B
A-L1-Ar1-L2-Ar2-Lx-B
A-L1-Ar1-Ar2-Lx-B
[0053] A number of components are prefened for use in the methods of the present invention.
[0054] Turning first to the subscript n, in prefened embodiments the value of n is from 2 to 5. More preferably, n is 2, 3 or 4. [0055] The first terminal group A can be, as noted above, a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, or an amino group that is either an unsubstituted amino group or a mono- or di-alkyl amino group. In one group of embodiments, A is a substituted or unsubstituted aryl or heteroaryl group selected from phenyl, 1-naphthyl, 2-naphthyl, 1-pynolyl, 2-pynolyl, 3-pynolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5- isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2- pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 2-benzothienyl, 2-benzothiazolyl, purinyl, 2-benzimidazolyl, 2-indolyl, 1-isoquinolyl, 2-quinoxalinyl, 3-quinolyl, and 6- quinolyl. More preferably, A is a substituted or unsubstituted thienyl group, a substituted or unsubstituted phenyl group, a substituted or unsubstituted benzothienyl group, or a substituted or unsubstituted isoquinolinyl group. For those embodiments in which A is a substituted thienyl, phenyl, benzothienyl or isoquinolinyl group, the substituents are preferably selected from halogen, nitro, cyano, (Cι-C6)alkyl, (Cι-C6)alkoxy, (C2-C6)alkenyl, (C2-C6)alkynyl, halo(C C6)alkyl, halo(d-C6)alkoxy, halo(C2-C6)alkenyl, and halo(C2- C6)alkynyl. More preferably, the substituents are selected from F, CI, Br, nitro, cyano and halo(d-C6)alkyl. Most preferably, the substituents are F, CI, or Br. Particularly prefened A groups are 4,5-dibromo-2-thienyl, 3-chloro-2-thienyl, 3-fluoro-2-thienyl, 3-chloro-2- benzothienyl, 2-fluoro-4-chlorophenyl, 2,4-difluorophenyl, and isoquinolinyl. [0056] The linking group components of formula I (e.g., L1, L2, L3 etc.) include -CONH-, -SO2NH-, -CONR-, -SO2NR-, (Cι-C6)alkylene, -NH-, -NR-, (Cι-C6)heteroalkylene, and combinations thereof wherein R is (Cι-C6)alkyl, optionally substituted by one or more halogens. For the linking groups provided above, no particular orientation is implied. For example, the recitation -CONH- is meant to include -NHCO-. Additionally, the terai "and combinations thereof refers to a combination of components (e.g., 2, 3, or 4 components) that can be same or different, including for example, -CONH-(Cι-C6)alkylene-CONH-, -(Ci- C6)alkylene-CONH-, -(Cι-C6)alkylene-CONH-(Cι-C6)alkylene, -(Cι-C6)alkylene-SO2NH-, and -CONR-(Cι-C6)alkylene-SO2NR-. Particularly prefened linking groups are -CONH-, -CONR- and -CONH-(d-C6)alkylene-CONH-. [0057] Turning next to the Ar components of the present antibacterial agents, each Ar can be the same or different and is preferably selected from substituted or unsubstituted fo ns of pynole, thiophene, thiazole, isothiazole, oxazole, isoxazole, pyrazole, pyrazine, pyridine, isoquinoline, benzothiazole, benzimidazole, benzoxazole, benzothiophene, and indole. Particularly prefened Ar components are selected from substituted or unsubstituted forms of pynole, thiophene, thiazole, isothiazole, oxazole, isoxazole, pyrazole, pyrazine, pyridine, benzothiophene, isoquinoline, pyridine and benzimidazole. When these Ar groups are substituted, the substituents are generally halogen or substituted or unsubstituted (Cι-C6)alkyl groups. In one group of embodiments, the substituents are unsubstituted (C]-C6)alkyl groups, more preferably unsubstituted (Cι-C4)alkyl, and most preferably, methyl or ethyl groups. In another group of embodiments, the substituents are substituted (Cι-C6)alkyl groups in which the substituent on the alkyl group is a 5- or 6-membered unsubstituted heterocycle selected from piperidine, pynolidine, morpholine, piperazine, pyran and furan. Particularly prefened substituents on the Ar components are 2-(N-morpholinyl)ethyl, 2-(N-piperidinyι)ethyl and 2- (N-pynolidinyl) ethyl. [0058] The symbol Lx represents yet another linking group component, hi general, this linking group can be the same or different from any of the linking groups described above. In prefened embodiments, Lx is selected from -CONH-, -SO2NH-, -CONR-, -SO2NR-, (d- C6)alkylene, (d-C6)heteroalkylene, -CONH-(Cι-C6)alkylene-, -CONH-(Cι-C6)alkylene- CONH-, -CONH-(Cι-C6)alkylene-CONH-(Cι-C6)alkylene, -(Cι-C6)alkylene-CONH-, -(d- C6)alkylene-CONH-(Cι-C6)alkylene, -(d-C6)alkylene-SO2NH-, and -CONR-(d-
C6)alkylene-S02NR-. In particularly prefened embodiments, Lx is selected from -CONH-, -CONR-, (C,-C6)alkylene, -CONH-(Cι-C6)alkylene-, -CONH-(Cι-C6)alkylene-CONH-, -CONH-(Cι-C6)alkylene-CONH-(Cι-C6)alkylene, -(Cι-C6)alkylene-CONH-, and -(d- Cό)alkylene-CONH-(Cι-C6)alkylene. In the most prefened embodiments, Lx is selected from -CONH-, -CONH-(Cι-C6)alkylene-, and -CONH-(d-C6)alkylene-CONH-(Cι-C6)alkylene. [0059] The letter B in formula (I) represents a second terminal group that can be a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, or an amino or mono- or di-alkyl amino group. The substituted or unsubstituted aryl or heteroaryl groups are preferably nitrogen-containing heteroaryl groups such as, for example, pyridine, thiazole, isothiazole, pynole, quinonline or isoquinoline.
More preferably, the substituted or unsubstituted heteroaryl groups are pyridine, thiazole or isothiazole. Prefened substituents for the heteroaryl groups are unsubstituted (Cι-C6)alkyl groups that are linear or branched. Similarly, the substituted or unsubstituted heterocychc groups are nitrogen-containing heterocycles such as, for example, piperidine, morpholine, pynolidine, thiomorpholine and hexamethyleneimine (homopiperidine). Preferably, each of these heterocycles is unsubstituted other than the point of attachment to Lx. [0060] In one group of particularly prefened embodiments, the compounds used in the present methods have the formula:
A-L1-Ar,-L2-Ar2-L3-Ar3-L4-Ar4-Lx-B (la) [0061] In this group of particularly prefened embodiments, A is selected from substituted or unsubstituted thiophene, substituted or unsubstituted thiazole, and substituted or unsubstituted benzothiophene (thianaphthene). More preferably, A is a substituted or unsubstituted thiophene, still more preferably a substituted thiophene. hi the most prefened embodiments, A is a halogen-substituted thiophene. L1 is preferably -CONH-, -CONR-, (Ci- C6)alkylene, -CONH-(Cι-C6)alkylene- or -CONR-(Cι-C6)alkylene-. More preferably, L1 is -CONH- or -CONR-, most preferably -CONH-. The first aryl group, Ar1 is preferably a 5- membered heteroaryl moiety selected from pynole, thiazole, isothiazole and isoxazole. More preferably, Ar1 is a substituted or unsubstituted pynole, wherein the substituents, when present are halogen or (Cι-C4)alkyl. In the most prefened embodiments, Ar1 is N-methyl pynole and the linking groups are attached at the 2- and 4-positions of the pynole ring. Continuing along formula (la), L2 is preferably -CONH-, -CONR-, (Cι-C6)alkylene, -CONH-(d-C6)alkylene- or -CONR-(Cι-C6)alkylene-. More preferably, L2 is -CONH- or -CONR-, most preferably -CONH-. Prefened groups for each of Ar2, Ar3 and Ar4 are the same as the prefened groups for Ar1. L3 is preferably a linking group that combines amide and alkylene groups. Accordingly, L3 is preferably a linking group selected from -CONH-(d-C6)alkylene, -CONH-(Cι-C6)alkylene-CONH-, -CONH-(d-C6)alkylene- CONH-(Cι-C6)alkylene, -(Cι-C6)alkylene-CONH- and -(Cι-C6)alkylene-CONH-(Cι- C6)alkylene. In each of the L3 linking groups, the alkylene portion is preferably methylene, ethylene, propylene or butylene, more preferably ethylene. In the most prefened embodiments of formula (la), L3 is -CONH-(C2-C )alkylene-CONH-. Prefened embodiments of L4 in formula (la) are the same as those provided above for L2. The linking group Lx, like L3 is preferably a combination of amide and alkylene groups. In particular, Lx is preferably -CONH-(d-C6)alkylene, -CONH-(C,-C6)alkylene-CONH-, -CONH-(C,- C6)alkylene-CONH-(Cι-C6)alkylene and -(Ct-C6)alkylene-CONH-(Cι-C6)alkylene. More preferably, Lx is -CONH-(Cι-C6)alkylene-CONH-(Cι-C6)alkylene. Still more preferably, Lx is -CONH-(Cι-C3)alkylene-CONH-(C2-C5)alkylene. Within this group of prefened embodiments, the alkylene groups are preferably linear or branched, and optionally substituted with from 1 to 3 substituents that are halogen, methyl or ethyl. [0062] The letter B represents the terminal functional group and is preferably a dialkyl amine or a nitrogen heterocycle (e.g., piperidine, hexamethyleneimine, morpholine, pynolidine, or thiomorpholine). For those prefened embodiments in which B is a dialkyl amine, most prefened are -NR]R2 in which R1 and R2 can be the same or different and individually have from one to four carbon atoms. For those prefened embodiments in which B represents a nitrogen heterocycle, an unsubstituted piperidine is most prefened.
[0063] Having provided prefened groups for each of the components of foraiula (la), one of skill in the art will appreciate that certain combinations of these prefened groups are particularly prefened. For example, in one groups of particularly prefened embodiments, A is a halogen-substituted thiophene (e.g., 4-bromothiophene or 4,5-dibromothiophene); Ar1, Ar2, Ar3 and Ar4 are each N-methylpynole with linking groups attached at the 2- and 4- positions; L1, L2 and L4 are each -CONH-; L3 is -CONH-(C2-C4)alkylene-CONH-; Lx is -CONH-(Cι-C3)alkylene-CONH-(C2-C5)alkylene; and B is selected from dimethylamino, diethylamino, diisopropylamino, piperidine, pynolidine and hexamethyleneimine. [0064] In another group of particularly prefened embodiments, the compounds used in the present methods have the formula:
A-L1-Ar1-L2-Ar2-L3-Ar3-Lx-B (lb)
[0065] In this group of particularly prefened embodiments, A is selected from substituted or unsubstituted thiophene, substituted or unsubstituted benzene, substituted or unsubstituted isoquinoline, substituted or unsubstituted thiazole, substituted or unsubstituted benzothiophene (thianaphthene) and a substituted or unsubstituted 5- to 7-membered nitrogen heterocycle (e.g., piperidine, pyrrolidine, morpholine, hexamethyleneimine). More preferably, A is a substituted thiophene, substituted benzene, unsubstituted isoquinoline, substituted benzothiophene (thianaphthene) or a substituted or unsubstituted 6-membered nitrogen heterocycle (e.g., piperidine or morpholine). In this group of prefened embodiments for A, the substituents, when present, are preferably halogen, nitro, cyano, or (Cι-C )alkyl. Most preferably, the substituents are halogens selected from F, CI and Br. L1 is preferably -CONH-, -CONR-, (Cι-C6)alkylene, -CONH-(Cι-C6)alkylene-, -(Cι-C6)alkylene-NH- or -NH-(Cι-C6)alkylene-. More preferably, L1 is -CONH-, -CONR-, or -(Cι-C6)alkylene-NH- , most preferably -CONH- or -CH2CH2NH-. The remaining L groups (other than Lx) are all preferably -CONH- or -CONR-, most preferably -CONH-.
[0066] Turning next to the aryl groups in formula (lb), the first aryl group, Ar1 is preferably a 5-membered heteroaryl moiety selected from pynole, thiophene, thiazole, isothiazole and isoxazole. More preferably, Ar1 is a substituted or unsubstituted pynole, substituted or unsubstituted thiophene, substituted or unsubstituted isoxazole, or a substituted or unsubstituted isothiazole, wherein the substituents, when present are halogen or (Cι-C )alkyl. In the most prefened embodiments, Ar1 is selected from pynole and N-methyl pynole wherein the linking groups are attached at the 2- and 4-positions of the pynole ring; unsubstituted thiophene having the linking groups attached at the 2- and 4-positions; 4- chloroisothiazole having the linking groups attached at the 2- and 4-positions; and isoxazole having the linking groups attached at the 3- and 5-positions. Continuing along formula (lb), prefened groups for each of Ar and Ar are the same as the prefened groups for Ar . More preferably, each of Ar2 and Ar3 are substituted pynole wherein the substituents are attached to the nitrogen atom and are selected from (Cι-C )alkyl and heterocyclyl(Cι-C4) alkyl. Still more preferably, Ar2 and Ar3 are selected from N-methylpynole, N-(2-(N- morpholino)ethyl)pynole. The linking group Lx is preferably an amide group or a combination of amide and alkylene groups. In particular, Lx is preferably -CONH-, -CONR- -CONH-(C,-C6)alkylene and -CONH-(Ci-C6)alkylene-CONH-. More preferably, Lx is -CONH- or -CONH-(Ct-C6)alkylene. Still more preferably, Lx is -CONH- or -CONH-(Cr C3)alkylene-. Within this group of prefened embodiments, the alkylene groups are preferably linear and unsubstituted.
[0067] The letter B represents the terminal functional group and is preferably a nitrogen heterocycle (e.g., piperidine, hexamethyleneimine, morpholine, pynolidine, or thiomoφholine) or a heteroaryl group selected from isothiazole and pyridine. For those prefened embodiments in which B is a nitrogen heterocycle, an unsubstituted piperidine, morpholine, thiomorpholine or hexamethyleneimine is most prefened. [0068] Having provided prefened groups for each of the components of formula (lb), one of skill in the art will appreciate that certain combinations of these prefened groups are particularly prefened. For example, in one groups of particularly prefened embodiments, A is a halogen-substituted thiophene (e.g., 3 -chloro thiophene or 3-fluorothiophene), 3- chlorothianaphthene, 2-fluoro-4-chlorobenzene, piperidine, isoquinoline, or a 2,4- difiuorobenzene; Ar1, Ar2 and Ar3 are each N-methylpynole, N-(2-(N- morpholino)ethyl)pynole or unsubstituted pynole with linking groups attached at the 2- and 4-positions, 4-chloroisothiazole, thiophene, isoxazole and isothiazole; L , L and L are each -CONH-; Lx is -CONH-(Cι-C3)alkylene-; and B is selected from morpholine, thiomorpholine, 3-methylisothiazole, pyridine, piperidine and hexamethyleneimine. [0069] Illustrative specific compounds (l)-(20) are shown in Figs. 1-4, along with their respective approximate molecular weights. [0070] Certain compounds are further illustrated in the context of formula (I), below.
Figure imgf000024_0003
Figure imgf000024_0001
Figure imgf000024_0004
Figure imgf000024_0002
[0071] The practice of this invention can be further understood by reference to the following examples and procedures, which are provided by way of example and not limitation. Synthesis of compounds - General
[0072] Compounds having a halogenated thiophene-2-carboxylic acid residue, such as compounds 1-7 and 11-12, can be synthesized by the methods described in U.S. Provisional Application Ser. No. 60/286,454, filed April 26, 2001, and entitled "Halogen-Substituted Thienyl Compounds" (the '"454 application"), the disclosure of which is incorporated herein by reference.
[0073] Compounds having aryl-benzimidazole moieties, as in compounds 12 and 18, can synthesized by the methods described in U.S. Provisional Application Ser. No. 60/298,206, filed June 13, 2001, and entitled "Aryl-Benzimidazole DNA-Binding Compounds" (the '"206 application"), the disclosure of which is incorporated herein by reference. [0074] Compounds having isothiazole-3 -carboxylic acid residues, as in compound 13, can be synthesized by the methods described in U.S. Application Ser. No. 09/808,729, filed March 14, 2001, and entitled "Charged Compounds Comprising a Nucleic Acid Binding Moiety and Uses Therefor" (the '"729 application"), the disclosure of which is incorporated herein by reference.
[0075] Additional documents disclosing synthetic techniques suitable for the synthesis of compounds of this invention include Dervan et al., U.S. Patent No. 6,090,947 (2000) (the '"947 patent"); Kelly et al., Proc. Nat'lAcad. Sci. USA, July 1996, 93, 6981 ("Kelly"); and Wade et al., J. Am. Chem. Soc, 1992, 114, 8783 ("Wade"), the disclosures of which are incoφorated herein by reference. Generally, the '947 patent relates to solid phase synthetic methods while Kelly and Wade relate to solution phase synthetic methods. [0076] In the synthesis compounds incoφorating one of the following groups (typically as a portion of A-L1)
Figure imgf000025_0001
such as in compounds 8-10 and 14-20, the conesponding commercially available carboxylic acids were activated with 2-(lH-benzotriazole-l-yl)-l,l,3,3-tetramethyluronium hexafluorophosphate ("HBTU", 0.95 equiv.) for 30 min at room temperature in N,N- dimethylformamide ("DMF") or N-methylpynolidone ("NMP") in the presence of diisopropylethylamine ("DIEA").
[0077] In the synthesis of compounds having the B-terminal residue H
Figure imgf000026_0001
such as compound 13, commercially available 5-amino-3-methylisothiazole was used. It was to coupled to a desired carboxylic acid activated with 0-(7-Azabenzotriazol-l-yl)-N,N,N',N'- tetramethyluronium hexafluorophosphate ("HAPU"), which produces a more activated ester than HBTU, compensating for the lesser reactivity of the aromatic amine group compared to aliphatic amines. In some instances, the coupling reaction can be carried out at a more elevated temperature.
[0078] The use of HBTU and HATU activated esters to synthesize compounds of this invention generally followed the procedures described in the '947 patent, the '454, '206, and '729 applications and in Wade and Kelly.
Synthesis of precursors of pyrrole carboxamide residues having: pendant morpholine groups.
[0079] The procedure for the synthesis of precursors for the introduction of pynole carboxamide precursors having pendant moφholine groups
Figure imgf000026_0002
as exemplified by compounds 16 and 17, is summarized in Scheme A:
Scheme A
Figure imgf000027_0001
A-1 A-2
Figure imgf000027_0002
A-3 A-5a: X = 0 A-5b: X = CH2
Figure imgf000027_0003
A-6a: X = O A-6b: X = CH2
[0080] Synthesis of Ester A-2. A mixture of ethyl 4-nitropynole-2-carboxylate A-1 (20.00 g, 1.0 equiv.), 4-(2-chloroethyl)morpholine hydrochloride (28.28 g, 1.4 equiv.), Nal (16.28 g, 1.0 equiv.) and K2CO3 (28.78 g, 1.92 equiv.) in DMF (200 mL) was stined at 60°C for 10.5 h and poured into a mixture of H2O and sat. aq. K2CO3 (550/50 mL). The resulting solution was extracted with AcOEt (4x, each 200 mL). The combined organic layers were dried (MgS04) and evaporated to give ester A-2 as pale yellow crystals (31.4 g, 97%). The 1H- NMR spectrum was consistent with the assigned structure. [0081] Synthesis ofAcidA-3. A suspension of the ester A-2 (31.4 g, 1.0 equiv.) and KOH (8.13 g, 2 equiv.) in EtOH (100 mL) and H2O (100 mL) was stined at room temperature ("RT") for 16 h (complete dissolution occuned after 1 h). The mixture was acidified with 1M aq. HCl to pH 3.0 and the resulting precipitate collected by filtration and dried in vacuo to give acid A-3 as a white solid (23.0 g, 81%). The H-NMR spectrum was consistent with the assigned structure.
[0082] Synthesis of compounds A-5a andA-όa. A mixture of the acid A-3 (1.5 g, 1.0 equiv.) and HBTU (1.8 g, 1 equiv.) in DMF (8 mL) and DIEA (2 mL) was stined at RT for lh, treated with the amine A-4a (0.70 mL, 1.1 equiv.) and stined for 15 h at RT. The solution was added dropwise to ice-water (150 mL) and extracted with AcOEt (5x). The combined organic layers were dried (MgSO ) and evaporated to give compound A-5a as a brown solid (1.6 g, ^-NMR spectrum consistent with the assigned structure). The crude product was dissolved in AcOEt (50 mL), treated with 10% Pd-C (ca. 100 mg), and stined at RT under H2 (1 atm) for 48 h. The mixture was filtered through Celite and the solids washed with MeOH. The filtrate was concentrated in vacuo, diluted with E.2O (250 mL) and AcOEt (50 mL), and treated with HCl (g) for 1 min. Evaporation of the solvents gave compound A-6a as orange solids (1.7 g), which was subsequently used without further purification for the preparation of compounds such as compound 17, generally following the procedures described in the '454, '206, and '729 applications and in Wade and Kelly. [0083] Synthesis of compounds A-5b and A-6b. A mixture of the acid A-3 (1.5 g, 1.0 equiv.) and HBTU (1.8 g, 1 equiv.) in DMF (8 mL) and DIEA (2 mL) was stined at RT for lh, treated with the amine A-4b (0.75 mL, 1.1 equiv.) and stined for 15 h at RT. The solution was added dropwise to ice-water (150 mL) and extracted with Et2O (3x) and AcOEt (4x). The combined organic layers were dried (MgSO ) and evaporated to give compound A-5b as a brown solid (1.7 g, 1H-NMR spectrum consistent with the assigned structure). The crade product was dissolved in AcOEt (25 mL), treated with 10% Pd-C (ca. 50 mg), and stined at RT under H2 (1 atm) for 24 h. The mixture was filtered through Celite and the solids washed with MeOH. The filtrate was concentrated in vacuo, diluted with E.2O (ca. 125 mL), and treated with HCl (g) for 1 min. The resulting precipitate was collected by filtration and dried in vacuo to give compound A-6b (1.78 g), which was subsequently used for the preparation of compounds such as compound 16 without further purification, generally following the procedures described in the '454, '206, and '729 applications and in Wade and Kelly. Synthesis of precursor for isothiazole carboxamide residues. [0084] The procedure for the synthesis of precursors for the introduction of isothiazole carboxamide residues
Figure imgf000029_0001
as exemplified by compound 19, is summarized in Scheme B:
Scheme B
Figure imgf000029_0002
B-2 B-3
Figure imgf000029_0003
B-4
[0085] Synthesis of Compound B-3. A mixture of the nitro acid B-l (300 mg, 1.2 equiv., J. Heindl, E. Schroder, H.-W. Kelm, Eur. J. Med. Chem. - Chimica Therapeutica, 1975, 10,
591-593, and references therein) and HBTU (620 mg, 1.14 equiv.) in DMF (2 mL) and DIEA (0.4 mL) was stined at 37°C for 18 h and treated with the amine B-2 (204 μL, 1.0 equiv.) and stined for 24 h at RT. The mixture was diluted with H2O (ca. 40 mL) and extracted with AcOEt (3x). The combined organic layers were dried (MgSO ) and evaporated to give compound B-3 (400 mg, 98%). The 1H-NMR spectrum was consistent with the assigned structure.
[0086] Synthesis of Compound B-4. A suspension of compound B-3 (400 mg, crude product from above procedure) and 10%o Pd-C (ca. 500 mg) in AcOEt (30 mL) was stined at RT for 24 h under H2 (1 atm). The mixture was filtered through Celite and the solids washed with AcOEt. The filtrate was concentrated in vacuo, diluted with Et20, and treated with HCl (g) for ca. 1 min. The resulting precipitate was collected by filtration and dried to give compound B-4 as a light yellow powder (110 mg, 27%). The 1H-NMR spectrum was consistent with the assigned structure (ca. 90 to 95% pure). Without frirther purification, this material was subsequently used for the synthesis of compounds such as compound 19, generally following the procedures described in the '454, '206, and '729 applications and in Wade and Kelly.
[0087] By way of further illustration, the synthesis of specific compounds for use in this invention is provided below. Those skilled in the art will appreciate that variant stractures can be synthesized by reference to these syntheses, mutatis mutandis.
Synthesis of Compound (1) [0088] Compound (1) was synthesized by the route shown in Scheme C. Part I of Scheme C describes the synthesis of the intermediate labeled Boc-Py-Py-OH, where "Py" denotes:
Figure imgf000030_0001
Scheme C: Part I
Figure imgf000030_0002
Boc-Py-OH H-Py-OMe
Figure imgf000030_0003
Boc-Py-Py-OH [0089] To a solution of Boc-Py-OH (40 g, 167 mmol) in 150 mL DMF was added 1.2 eq hydroxybenzotriazole ("HOBt," 27 g, 0.2 mmol) followed by 1.2 eq dicyclohexyl- carbodiimide ("DCC," 40.4 g, 0.2 mmol). The solution was stined for 5 hours at room temperature, after which the DCC was removed by filtration followed by a rinse with N,N- dimethylformamide ("DMF," 50 mL). H-Py-OMe hydrochloride (34 g, 160 mmol) was added, followed by triethylamine ("TEA," 80 mL) and the reaction was stined at 50 °C for 10 hr. The reaction mixture was then added dropwise to a stined solution of ice water (2 L) and the solution placed at 4 °C overnight. The resulting precipitate was collected by vacuum filtration and dried overnight to provide methyl 4-[t-butoxycarbonyl)amino]-l-methylpyιτole- 2-(4-carboxamido)-l-methylpynole-2-carboxylate (53 g, 83% yield). The ester was dissolved in methanol (200 mL), NaOH (3M, 200 mL) was added, and the resulting mixture stined for 3 hours at 50 °C. Excess methanol was removed in vacuo and the resulting solution acidified to pH 3 using H2SO4. The resulting precipitate was collected by filtration and dried in vacuo to yield Boc-Py-Py-OH as a white powder (43 g, 90% yield).
[0090] Part II Scheme C describes the solid-phase synthesis of compound (1) proper. The starting point is commercially available Boc-β-alanine-PAM-resin (see also the '947 patent). This resin has a Boc-protected β-alanyl residue attached to the resin via a phenylacetamidomethyl (PAM) linkage:
Figure imgf000031_0001
Boc-β-alanine-PAM resin [0091] Hereinafter, the more compact notation
Boc— β-PAM— jiesjrT) will be used for convenience, where "β" and "PAM" represent
and respectively.
Figure imgf000031_0003
Figure imgf000031_0002
Scheme C: Part II
^ -^ i) TFA
Boc— β-PAM— ResirT) -*- Boc-PyPy-β-PAM- ii) Boc-Py2-OH,
C-l HBTU, TEA c_2 i) TFA i) TFA
Boc— β-Py-Py— β-PAM— Resirv ii) Boc-β-OH, ii) Boc-Py2-OH, HBTU, TEA C-3 HBTU, TEA
Boc— PyPy-β-P
Figure imgf000032_0001
Figure imgf000032_0002
C-5
Figure imgf000032_0003
Compound (1) [0092] An Argonaut Quest 210 semi-automated synthesizer was used. This instrument has 20 disposable reaction vessels with volumes 10 of mL each, which can be washed, heated, mixed and drained using automated cycles or manually. Wash cycle A consists of tliree steps — step one is tliree cycles of adding NMP (5mL) to each vessel, mixing for 2 minutes and draining the NMP from the vessels using a controlled flow of compressed nitrogen, steps two and tliree are the same as step one, but with the substitution of methanol and CH2C12, respectively, for NMP. Wash cycle B uses the same tliree steps as wash cycle one, using CH2θ2, methanol and NMP in that order. The coupling cycle consists of heating the vessels to 37 °C and mixing for 2 hours. In the cleavage cycle, the vessels are heated to either 55 °C or 90 °C and mixed for 12 hours.
[0093] In the first cycle, Boc-β-alanine-PAM resin (C-l, 200 mg) was placed in a vessel and manually washed with CH2C12. The protecting Boc group was then removed by manually adding 100% trifluoro acetic acid ("TFA," 5 mL) and mixing for 20 minutes. The deprotected resin was washed using wash cycle B. Boc-Py-Py-OH (125 mg, 0.34 mmol) was then activated with HBTU (121 mg, 0.34 mmol) in NMP (0.66 mL) and TEA (0.33 mL) and added to the deprotected resin in a 2:1 solution NMP/TEA (1.0 mL). The Quest automated coupling step was used, followed by wash cycle A, to yield Boc-Py-Py-β-PAM resin (C-2). In the second cycle, Boc-β-alanine-OH (65 mg, 0.34 mmol) was used instead of the Boc-Py- Py-OH, all other steps remaining the same, to form H-β-Py-Py-β-PAM resin (C-3). In the third cycle, the first cycle was repeated to form Boc-Py-Py-β-Py-Py-β-PAM resin (C-4). In the last cycle, the addition of 2,3-dibromothiophene-5-carboxylic acid to Boc-Py-Py-β-Py- Py- β-PAM resin, compound C-4 was deprotected and washed using wash cycle B. 2,3- Dibromothiophene-5-carboxylic acid (98.4 mg, 0.34 mmol) was then activated and added to the deprotected resin in a solution NMP/TEA (2:1, 1.0 mL). The automated coupling step was used, followed by wash cycle A and a manual wash with NMP to yield 2,3- dibromothiophene-5- Py-Py-β-Py-Py-β-PAM resin (C-5). The compound was cleaved from the resin by adding dimethylaminopropylamine ("H-Dp," 3 mL) and using the automated cleavage cycle at 55 °C then purified by reversed phase preparative HPLC to yield compound (1), characterized by NMR. [0095] Structurally related compounds (2)-(4) can be synthesized by an analogous method.
Synthesis of Compound (6) [0096] Compound (6) was synthesized by the route shown in Scheme D, Parts I and II.
Scheme D: Part I
Figure imgf000033_0001
D-l D-2
Figure imgf000033_0002
D-3, Bob-Py-Py-Py-OH D-4, H-Py-Py-Py-Mp
[0097] Part I relates to the synthesis of the intermediate Boc-Py-Py-Py-Mp (D-4). [0098] To a solution of Boc-Py-Py-OH (D-l, 60.4 g, 167mmol) in 150 mL DMF was added 1.2 eq HOBt (27 g, 0.2 mmol) followed by 1.2 eq DCC (40.4 g, 0.2 mmol). The solution was stined for 5 hours at room temperature, after which the DCC was removed by filtration followed by a rinse with DMF (50 mL). H-Py-OMe hydrochloride (D-2, 34 g, 160 mmol) was added, followed by TEA (80 mL) and the reaction was stined at 50 °C for 10 hours. The reaction mixture was then added dropwise to a stined solution of ice water (2 L) and the solution stored at 4 °C overnight. The resulting precipitate was collected by vacuum filtration and dried overnight to provide methyl 4-[t-butoxycarbonyl)amino]-l-methylpynole-2-[4- carboxamido-l-methylpynole-2-(4-carboxamido-l-methylpynole)]-2-carboxylate. The ester was dissolved in methanol (200 mL), NaOH (3M, 200 mL) was added, and the resulting mixture stined for 3 hours at 50 °C. Excess methanol was removed in vacuo and the resulting solution acidified to pH 3 using H2SO4. The resulting precipitate was collected by filtration and dried in vacuo to yield Boc-Py-Py-Py-OH (D-3) as a white powder. [0099] Boc-Py-Py-Py-OH (D-3, 0.1 mmol, 1 eq.) is activated with HBTU (0.095 mmole, 0.95 eq) in 50 mL DMF and 25 mL TEA for about 45 minutes at RT. N-(2-aminoethyl)- moφholine (0.12 mmol, 1.2 eq) is added to the mixture and the reaction is stined at 37 °C overnight. The product mixture is concentrated in vacuo and TFA (150 mL) is added to the reaction, which is then stined at room temperature for 3 hours. The solution is concentrated in vacuo, after which acetic acid (40 mL) and water (200 mL) is added. The solution is extracted with diethyl ether three times, then product D-4 is purified using reverse phase HPLC with a gradient of 1 % acetonitrile/minute in 0.5 % acetic acid.
Scheme D: Part II
Figure imgf000035_0001
D-5 D-4
Figure imgf000035_0002
Compound (6) [0100] Part II of Scheme D describes the synthesis of compound (6) from the precursor made in Part I.
[0101] 3-Chlorothiophene-2-carboxylic acid (D-5, 10 mmol, 1.2 eq.) is activated with HBTU (3.7 g., 9.8 mmol, 1.14 eq.) in DMF (20 mL) and TEA (13 mL). The solution is stined for 10 minutes at RT, after which H-Py-Py-Py-Mp (D-4, 8.5 mmol, 1 eq.) is added. DMF (4 mL) is added to complete the transfer of the solid material, and the resulting solution is stined at 37 °C overnight. The reaction is then dried in vacuo, 10% aqueous acetic acid (200 mL) is added and the product is purified using reversed phase preparative HPLC to yield compound (6).
Synthesis of Compound (7) [0102] The synthesis of compound (7) is shown in Scheme E. Scheme E has tliree parts. In Part I, the synthesis of intermediate 4-boc(amino)-2-thiophene carboxylic acid (E-6) is described. In Part II, the synthesis of the interaiediate 3-fluorothiophene-2-carboxylic acid (E-10) is described. Lastly, Part III describes the synthesis of compound (7) proper. Scheme E: Part I
Figure imgf000036_0001
Figure imgf000036_0002
E-2: R = NO2, R = H E-4: R1 = NH3C1, R2 = H E^ R^ ^ R^ NOs E-5: R1 = H, R2 = NH3C1
Figure imgf000036_0003
[0103] A solution of ethyl-2-thiophene carboxylate (E- 1 , 200g, 1 mol) in TFA (200 mL) was slowly added to a mixture of TFA (900 mL) and fuming nitric acid (200 mL) at 5°C. The cooling was removed and the reaction mixture stined at 45°C for 14 hr, cooled to 10°C, and poured into vigorously stined ice water (4 L). The resulting precipitate was collected by filtration and washed with ice water (2x). Lyophilization of the resulting solids gave a mixture of compounds E-2 and E-3 (2:3 ratio, by 1H-NMR, 194.2 g, 79%). [0104] A mixture of E-2 and E-3 (2:3 ratio, 20g) in EtOAc (135 mL) and methanol (15 mL) was treated with 10% Pd-C (1 g) and stined under H2 (100 psi) for 6 days at room temperature. The reaction mixture was filtered through Celite and concentrated to a volume of 25 ml under reduced pressure. The residual solution was diluted with ethyl ether (500 mL), cooled to 0°C, and treated with HCl (gas) for 2 min. The resulting precipitate was collected by filtration and dried in vacuo to give a mixture of E-4 and E-5 (0.9:1 ratio by 1H-NMR, 19.02 g, 93%). [0105] A mixture of compounds E-4 and E-5 (0.9/1, 15 g) in methanol (500 mL) was treated at 0°C with a solution of KOH (9 g) in H20 (75 mL) and stined for 3 hr. The reaction mixture was then diluted with H2O (400 mL) and washed with EtOAc (3x, 200 mL). The aqueous layer was neutralized to pH 6.5 with a 1 M aq. HCl solution, treated with Na2C0 (15 g) and a solution of Boc anhydride (15 g) in dioxane (150 mL) and stined for 24 h at RT. The reaction mixture was washed with EtOAc (3x, 200 mL), cooled to 0°C, acidified to pH 2.8 with aqueous HCl (50%), and extracted with EtOAc (3x, 200 mL). The combined organic layers were dried (MgSO4) and evaporated. The remaining oil was dissolved in methanol and treated with activated carbon (5 g). The mixture was filtered through Celite and the filtrate evaporated to yield compound E-6.
Scheme E: Part II
BF4 ~
S C02Me ii)NaBF4 s C02Me S C02Me ii) HCl X S C02H
E-7 E-8 E-9 E-10
[0106] A suspension of aminothiophene ester E-7 (2 g, 12.72 mmol) in cone. aq. HCl (10 mL) and H20 (20 mL) was treated dropwise with a solution of NaNO2 (1.1 gram, 15.74 mmol) in H2O (5 mL) at 0 °C. The mixture was stined at 0° C for 20 minutes and treated with NaBF4 (10 g) in H2O (saturated). The solids were collected by filtration and washed with ice water, treated with tetrahydrofuran ("THF"), dried (MgSO ), and evaporated. [0107] The crade diazonium salt E-8 was distributed in a glass tube under a strong flow of N2 that was passed through a cooling trap. The material was heated until the vigorous evolution of a gas that condensed upon cooling. The condensed material was collected with AcOEt. Evaporation gave fluorothiophene ester E-9 (720 mg) as a brown liquid. [0108] A solution of the ester 3C (700 mg) and KOH (5 mL, 2 M) in ethanol (5 mL) was stined for 28 hr at room temperature and diluted with H2O (25 mL). The mixture was washed with AcOEt (2x) and acidified to pH 2 with IM aq. HCl. Extraction of the mixture with AcOEt (2x), drying (MgSO ) of the combined organic layers and evaporation gave 3- fluorothiophene-2-carboxylic acid E-10 (667 mg) as a brown solid.
Scheme E: Part III
BocHN. BocHN. i i)) H rnB3T 1U u,, D UI1EJ-.AΛ,, D uMivirF
Py-Py-OR
XS COOH ϋ H2NPyPyOMe S O
E-l 1 : R = Me — 1 i) aq. NaOH, E-12: R = H -— ' MeOH
Figure imgf000038_0001
Figure imgf000038_0002
[0109] A solution of HOBt (1.51 g, 9.3 mmole, 1 eq.), DCC (2.31 g, 9.3 mmol, 1 eq.), and compound E-6 (2.2 g, 9.3 mmol, 1 eq.) in DMF (15 mL) was stined for 45 min at room temperature, treated with H-Py-Py-OMe (2.9 g, 9.3 mmol, 1 eq., Bailly et al., J. Pharm. Sci. Nov. 1989, 78, 11, 910-917) and diisopropylethylamine ("DIEA") (2 mL), and stined for 14 hr.
Figure imgf000038_0003
H-Py-Py-OMe [0110] The mixture was added dropwise to ice-water (800 ml) and the resulting precipitate was collected by filtration and dried in vacuo to yield compound E-l 1 (4.2 g). [0111] A solution of compound E-l 1 (2.3 g) in MeOH (20 mL) was treated with a 2M solution of NaOH in H2O (20 mL) and stined for 3 hours at 50 °C. The reaction mixture was diluted with H20 and acidified to pH 2 with aqueous IM HCl and extracted (AcOEt) three times. The combined organic layers were dried (MgSO ) and evaporated to give acid E-12 (1.83 g, 83%).
[0112] Acid E-12 (0.70 g) was treated with a solution of ethyl acetate (saturated with HCl, 10 ml) and stined at 4 °C for 30 minutes. The suspension was then added dropwise into ethyl ether (400 mL), from which the solid was filtered and dried in vacuo to yield amino acid E-13 (357 mg). [0113] A solution of 3-fluorothiophene-2-carboxylic acid (0.4 mmol, 1 eq.), HBTU (156 mg, 0.4 mmole, 1 eq.) in NMP (1 mL) and DIEA (0.1 mL) is stined for 45 minutes at 37 °C, treated with the amino acid E-13 (140 mg, 0.4 mmol, 1 eq.), and stined for 12 hr. The reaction mixture is added dropwise to ice water (400 mL) to form a precipitate, which is then filtered and dried in vacuo. The product compound E-14 (0.08 mmol) is then treated with HBTU (40 mg, 0.1 mmol) in NMP (0.5 mL) and DIEA (0.05 mL) for 2 hours at room temperature, after which 4-(2-aminoethyl)morpholine (1.1 mL) is added and allowed to react for 15 hours at RT. The mixture is diluted with AcOH/H2O, and washed with ethyl ether (3x). HPLC purification of the aqueous phase gives compound (7).
Synthesis of Compound (12) [0114] The synthesis of compound (12) is shown in Scheme F:
Scheme F
Figure imgf000039_0001
F-l F-2 F-3
+ other isomer(s)
Figure imgf000039_0002
F-4 F-5
Figure imgf000039_0003
F-6 F-7
Figure imgf000039_0004
F-8
Figure imgf000040_0001
Figure imgf000040_0002
[0115] Synthesis of intermediate carboxylic acid F-3. To 3-chlorothiophene-2-carboxylic acid (F-l, 5.31 g, 32.6 mmol, commercially available) in DMF (30 mL) was added HBTU (11.8 g, 31.1 mmol) and diisopropylethylamine ("DIEA," 6 mL). The reaction was stined at room temperature for 30 min. To the solution was added methyl 4-amino- 1-methylp ynole-2- carboxylate hydrochloride (F-2, 5.19 g, 27.2 mmol). The reaction was stined at room temperature for 12 h. The reaction was poured dropwise into stining ice water (800 mL). The precipitate was collected over a coarse frit, washed with hot water, and lyophilized to provide 9.1 g (112% yield) of crude methyl ester of compound F-3. To the methyl ester (8.1 g) was added water (50 mL), ethanol (50 mL), and KOH (5 g). The reaction was stined at room temperature for 12 h. To the reaction was added water (500 mL). The solution was extracted with ethyl acetate (1x100 mL). The aqueous layer was cooled to 0 °C and acidified to pH 2 with 7 M HCl. The resulting precipitate was filtered and washed successively with water, then dried in vacuo to provide near quantitative yield of the intermediate carboxylic acid F-3. [0116] Nitration ofN-methylpyrrole carboxaldehyde F-4. To acetic anhydride (240 mL) cooled at 0 °C was added fuming nitric acid (33.5 mL). After cooling, the mixture was added dropwise via addition funnel to a solution of N-methyl pynole carboxaldehyde (F-4, 50 g, 458 mmol, commercially available) in acetic anhydride (240 mL) cooled to -40 °C in dry ice acetonitrile bath. Following addition of the nitration reagent and upon temperature stabilization, the reaction was allowed to slowly reach 10 °C. At this point the temperature can increase rapidly. Between 10 and 20 °C, the solution was immediately poured onto ice (480 g). The reaction was allowed to sit at room temperature overnight. Crystals fornied. The solution was brought to 5 °C for 1 h, then filtered. The crystals foraied were recrystalized from 100 mL of ethanol to provide 10.1 g of the desired isomer F-5. Further crystallization from ethanol provided an additional 7.64 g of desired isomer F-5.
[0117] Synthesis of benzimidazole intermediate F-8. A solution of 3-nitro pynole-5- carboxaldehyde (F-5, 10 g, 64.9 mmol) and ethyl-3,4-diaminobenzoate (F-6, 12.4 g, 69.1 mmol) in DMF (325 mL) was brought to 80 °C and stined for 1 h. To the reaction was added benzoquinone (10.6 g, 97.6 mmol). The reaction was brought to 120 °C and stined for 2 h. Solvent was removed in vacuo and 600 mL of dichloromethane were added to the solids. The suspension was boiled down to half volume, then stored at -25 °C for 1 h. Solids were filtered, rinsed with dichloromethane until filtrate ran clear. The solids were brought up in ethanolic HCl. Solvent was removed in vacuo. The product was crashed, precipitated from ethanol (600 mL), and filtered, and rinsed with cold ethanol (100 mL). Removal of ethanol from solids provided 17.49 g of the HCl salt of the nitro analog of compound F-8. To the HCl salt (0.37 g, 1.17 mmol) was added DMF (6 mL) and 10% Pd on carbon (0.3 g). The flask was fitted with a H2 balloon and stined overnight. The solution was filtered to provide compound F-8, which was used in subsequent steps without removal of the solvent. [0118] Coupling of compounds F-3 and F-8. In a separate flask, compound F-3 (0.122 g, 0.43 mmol) was activated with HBTU (0.16 g, 0.41 mmol), DIEA (0.10 mL, 0.59 mmol), in DMF (1 mL). A solution of compound F-8 representing a theoretical amount of 0.39 mmol was added to activated compound F-3. The reaction was shaken in a 37 °C incubator for 2 h. Solvents were removed in vacuo. The resulting crude ethyl ester of compound F-9 was suspended in MeOH (3.2 mL) and 2 N NaOH (3.2 mL). The reaction was stined at 60 °C overnight. MeOH was removed in vacuo. The basic solution was neutralized with 2 N HCl. The precipitated compound F-9 was filtered and washed with water. Excess water was removed in vacuo.
[0119] Conversion to compound (12). The resulting crude compound F-9 (0.17 g, 0.32 mmol) was activated with HBTU (0.12 g, 0.32 mmol), DIEA (0.11 mL, 0.65 mmol), in DMF (1 mL). To the activated compound F-9 was added N-aminoethylmoφholine (0.21 mL, 1.6 mmol). The solution was shaken at 37 °C for 2 h. Solvents were removed in vacuo. The final product was purified as before by reverse phase HPLC to yield 67 mg of compound (12). 1H ΝMR <5 (DMSO- 0 10.2 (s, IH), 10.1 (s, IH), 9.57 (s, IH), 8.69 (s, IH) 7.87 (d, IH, J=5.6 Hz), 7.74 (d, IH, J=8.0 Hz), 7.36 (s, IH), 7.30 (s, IH), 7.19 (d, IH, J=5.2 Hz), 7.14 (s, IH), 7.10 (s, IH), 4.08 (s, 3H), 4.02 (m, 2H), 3.89 (s, 3H), 3.62 (m, 7 H), 3.18 (m, 4H). /../z (ES) 636.1 (MH+).
Synthesis of Compound (20)
[0120] Compound (20) was synthesized according to Scheme G.
Scheme G
1. THF, C02C12, reflux
2. NMP, pyridine
Figure imgf000043_0001
Figure imgf000043_0002
[0121] Oxalyl chloride (1.67 mL, 19.19 mmol) was added drop-wise to a suspension of isoquinoline-3-carboxylic acid (G-1, 332.3 mg, 1.92 mmol) in THF (2 mL) and the reaction heated at reflux (oil bath 85 °C) for 3 hours. All volatile components were then removed in vacuo. The resulting solid (presumed acid chloride) was then dissolved in NMP (1 mL) and pyridine (1 mL), and ethyl 3-aminoisoxazole-5-carboxylate G-2 (prepared as described in Lepage et al, FR 2,750,425 (1998), 300mg, 1.92 mmol) was then added. The reaction was stined at room temperature for 3 hours. The mixture was then added drop-wise to a rapidly stined solution of ice-cold water (2 mL), which caused precipitation of the desired product ester-amide G-3 as a white solid (300 mg, 50%). This was filtered and dried by lyophilisation. The Η-NMR spectrum was consistent with the assigned structure. [0122] Sodium hydroxide (IN, 2 mL, 2 mmol) was added to a solution of ester-amide G-3 (250 mg, 0.803 mmol) in ethanol (2 mL). The reaction was stined for 30 minutes at room temperature, at which point, TLC analysis indicated complete consumption of the starting material. The mixture was then acidified to pH 2-3 with a 2N solution of hydrochloric acid, which caused precipitation of the product acid G-4 as a white solid (245 mg, quantitative yield). This was filtered and dried by lyophilisation. The lH-NMR spectrum was consistent with the assigned structure. [0123] Carboxylic acid G-5, having a Boc-protected amino group, was converted to amide- amine G-6 as follows: Compound G-5 was activated with HBTU (0.95 eq.) in DMF/TEA at RT for 45 min, followed by addition of 4-(2-aminoethyl)moφholine (1.2 eq.) and reaction at 37 °C overnight. Volatiles were removed in vacuo, and TFA was added. The reaction mixture was stined at RT for 3 hr. Work-up yielded compound G-6. See the '454 application for the synthesis of compound G-5 and analogous reactions thereof.
[0124] Oxalyl chloride (0.22 mL, 2.54 mmol) was added drop-wise to a suspension of acid G-4 (72 mg, 0.254 mmol) in THF (1 mL) and the reaction heated at reflux (oil bath 85 C) for 3 hours. All volatile components were then removed in vacuo. The resulting solid (presumed acid chloride) was then dissolved in NMP (0.5 mL) and pyridine (0.5 mL). A solution of amine G-6 (105 mg, 0.254 mmol) in NMP (1 mL) and DIEA (0.5 mL) was then added and the reaction stined at 60 °C for 12 hours. The reaction mixture was then diluted with 50% acetic acid solution and directly purified by HPLC to give the desired product, compound (20) (25 mg, 16%). The 1H-NMR spectrum was consistent with the assigned structure.
Anti-bacterial Activity
[0125] In vitro antibacterial activity data were collected for the following Gram-positive bacteria: Staphylococcus aureus (ATCC 27660, ATCC 33591 and ATCC 43300, all methicillin resistant strains (MRSA's)); Streptococcus pneumoniae (ATCC 51422, a penicillin resistant strain (PRSP)), Enterococcus faecium (ATCC 51559, and/or a vancomycin resistant strain (VRE)). Additionally, antifungal activity data were collected for Candida albicans (ATCC 38247). Minimal inhibition concentrations (MIC's) were deteraiined using the National Committee for Clinical Laboratory Standards (NCCLS) broth microdilution assay in microtiter plates, as set forth in: (1) the guidelines of the National Committee for Clinical Laboratory Standards (NCCLS) Document M7-A4 (NCCLS, 1997); (2) the guidelines of the National Committee for Clinical Laboratory Standards (NCCLS) Document Ml 1-A4 (NCCLS, 1997); and (3) the guidelines and reference method of the National Committee for Clinical Laboratory Standards (NCCLS) Document M27-T (NCCLS, 1995). For antifungal essays, the method recommended in Munay, PR., 1995 Manual of Clinical Microbiology (ASM Press, Washington, DC), was employed. The results are presented in Table II below.
Figure imgf000045_0001
Key:
Col. A = S. aureus ATCC 27660 Col. B = S. aureus ATCC 33591
Col. C = S. aureus ATCC 43300 Col. D = E. faecium ATCC 51559 Col. E = S. pneumoniae ATCC 51422 Col. F = C. albicans ATCC 38247
+ = MIC <2 ++ = MIC <1
- = MIC > 2 +/- = Inconsistent data points
ND = No data
Murine Neutropenic Thigh Model [0126] This example demonstrates in vivo efficacy against infection by methicillin resistant Staphylococcus aureus ATCC 33591, using a murine neutropenic thigh model. [0127] A S. aureus ATCC 33591 culture was grown to log phase overnight and diluted in phosphate buffered saline (pH 7.2) to an optical density of about 0.1 at 600 nm, giving an approximate concentration of 108 cfu/mL. The suspension was diluted 1:100 in phosphate buffered saline (pH 7.2) for a final concentration of 106 cfu/mL. [0128] Outbred female CF1 mice (approx. 20 gram body weight) were rendered neutropenic by treatment with cyclophosphamide (200 mg/kg body weight, intraperitoneal injection) at 2 and 4 days prior to inoculation. Groups of 5 mice were inoculated with 0.05 mL of the bacteria (approx. 106 cfu/mL) into the anterior thigh. Each group was treated intravenously two hours post infection with vehicle (phosphate buffered saline) or test compound. The mice were sacrificed at either 6 or 24 hrs after treatment and thighs were collected aseptically. Each thigh was weighed, placed into sterile saline, and homogenized. The tissue homogenates were diluted appropriately for plating on agar plates. Colony counts were recorded (cfu/gram) and compared to control groups. The data are presented in Table III below:
Figure imgf000047_0001
[0129] In vivo efficacy was shown by a decrease in colony count (log cfu/gram of tissue) in the compound-treated animals when compared against the colony count in animals given only the vehicle.
Mouse Protection Assay
[0130] This example demonstrates in vivo efficacy against infection by methicillin resistant Staphylococcus aureus ATCC 33591, using a mouse protection assay. [0131] A S. aureus ATCC 33591 culture was grown to log phase overnight and diluted in phosphate buffered saline (pH 7.2) to an optical density of about 0.1 at 600 nm, giving an approximate concentration of 10s cfu/mL. Porcine mucin was added to the suspension to a final concentration of 5%> mucin. The suspension was diluted 1 : 100 for a final concentration of l06 cfu/mL.
[0132] Female balb/c mice (20g body weight) were injected mtraperitoneally with 0.5 mL of bacterial suspension (106 cfu/mL). Vehicle (phosphate buffered saline, pH 7.2) or test compound were administered intravenously at 2, 8, 18, and 24 hours post infection. The animals were monitored twice daily and survival counts were recorded up to 48 hours post infection. The results are provided in Table IV:
Figure imgf000047_0002
[0133] In vivo efficacy was shown by an increase in survival at 48 hr post infection in the compound-treated animals, compared to vehicle treated animals. DNA Binding
[0134] Compounds (1) through (20) according to this invention were screened for their ability to bind to specified DNA target sequences, using DNase I footprinting. Generally, the procedure described in Dervan, WO 98/50582 (1998), was followed. [0135] Three double stranded circular plasmids A, B, and C were used to prepare double stranded DNA-binding probes containing the target sequences for the DNase I footprint titration experiments. Plasmids A, B, and C had nucleotide sequences given by SEQ ID NO. I, SEQ ID NO. II, and SEQ ID NO. Ill, respectively.
[0136] Plasmid A was prepared by hybridizing two sets of 5 '-phosphorylated complementary oligonucleotides, the first set being
5 ' -CCGGGAACGTAGCGTACCGGTGCAAAAAGCAAAAAGGCTCGACGCCGC
AAAAAGACAAAAAGGCTCGA-3 ' and
5 ' -GGCGTCGAGCCTTTTTGTCTTTTTGCGGCGTCGAGCCTTTTTGCTTTTT GCACCGGTACGCTACGTTC-3 ' ; and the second set being
5 ' -GCCGCAAAAAGTACAAAAAGGCTCGACGCCGCAGCTCGTCCTAGCTAGC
GTCGTAGCGTCTTAAG-3 ' and 5' -CGACTTAAGACGCTACGACGCTAGCTAGGACGAGCTGCGGCGTCGAGCC
TTTTTGTACTTTTTGC-3 ' and ligating the resulting duplexes to the large pUC19 Aval/Sail restriction fragment. A map of Plasmid A is shown in Fig. 5.
[0137] Plasmid B was prepared by hybridizing two sets of 5 '-phosphorylated complementary oligonucleotides, the first set being
5 ' -CTAGATGCCGCTAAGTACTATGCCGCTAACTACTATGCCGCTAAT
TACTATGCCGC-3' and
5 ' - CATAGTAATTAGCGGCATAGTAGTTAGCGGCATAGTACTTAGCGGCAT -
and the second set being
5 ' - TAAATACTATGCCGCTAACTAGTATGCCGCTATGCA- 3 and
5 ' -TAGCGGCATACTAGTTAGCGGCATAGTATTTAGCGG- 3 and ligating the resulting duplexes to the large pUC19 Xbal/Pstl restriction fragment. A map of Plasmid B is shown in Fig. 6.
[0138] Plasmid C was the plasmid pTrc99a, obtained from Amersham Pharaiacia Biotech, Inc. A map of Plasmid C is shown in Fig. 7. [0139] The 3'-P32 end-labeled EcoRI/PvuII fragments from each plasmid were prepared by digesting the plasmids with EcoRI and PvuII with simultaneous fill-in using Sequenase v. 2.0, [alpha-P32]-deoxyadenosine-5'-triphosphate, and [alpha-P32]-thymidine-5'- triphosphate, and isolating the cloned fragments by nondenaturing gel electrophoresis. A and G sequencing reactions were canied out as described (See Maxam and Gilbert, Methods Enzymol, 1980, 65, 499-560; Iverson and Dervan, Methods Enzymol, 1987, 15, 7823-7830; Sambrook et al., 1989, Molecular Cloning, 2nd ed., Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY.) Standard methods were used for all DNA manipulations (Sambrook et al., ibid.) The cut sites for EcoRI and PvuII are indicated by bars in the respective maps of Plasmids A, B, and C in Figs. 5, 6, and 7. [0140] The 351 base pair dsDNA restriction fragment (SEQ LD NO. IV) of Plasmid A contained the target sequences AAAAAGCAAAAA, AAAAAGACAAAAA, and AAAAAGTACAAAAA. The 310 base pair dsDNA restriction fragment (SEQ ID NO. V) of Plasmid B contained the target sequences AGTACT, AATACT, and ATT ACT. The 352 base pair dsDNA restriction fragment (SEQ ID NO. VI) of Plasmid C contained the target sequences TGACAATTAAT, GACAATTAATCA, AATTAATCAT, ACAATTA, and ACAATTAAT. These fragments were used for quantitative DNase I footprinting experiments. Compounds used in the method of this invention bind to at least one of the target sites with a equal to or less than 100 nM, preferably equal to or less than 50 nM, and more preferably equal to or less than 20 nM. The target sequences were selected for the identity with, or similarity to, promoter sites for bacterial genes.
[0141] Quantitative DNase I footprint titration experiments were canied out as described previously (Dervan, WO 98/50582, 1998) with the following changes. All reactions were canied out in a total volume of 400 μL, with compound stock solution or water added to 15,000 cpm radiolabeled restriction fragment affording final solution conditions of 10 mM TrisHCl, 10 mM KCl, 10 mM MgCl2, 5 mM CaCl2, pH 7.0 and 0.01 nM, 0.1 nM, 1.0 nM, 10.0 nM compound or no compound for reference lanes. The compounds were allowed to equilbrate at 22°C for 16 h. Footprinting reactions were initiated with addition of 10 μL of a DNase I stock solution (at the appropriate concentration to give -50% intact DNA) containing 1 mM DTT and allowed to proceed for 7 min at 22°C The reactions were stopped, ethanol precipitated, resuspended in loading buffer, heat denatured, and placed on ice as described previously (Dervan WO 98/50582, 1998). The reaction products were separated on a precast 8% polyacrylamide denaturing sequencing Castaway gel with 32 preforaied wells from Stratagene in IX TBE at 2000 V. Gels were dried according to the manufacturer and exposed to a storage phosphor screen (Molecular Dynamics). Quantitation and data analysis were canied out as described in Dervan, WO 98/50582, 1998. [0142] dsDNA binding results are provided in Table V:
Figure imgf000051_0001
Figure imgf000052_0001

Claims

WHAT IS CLAIMED IS:
1. A method for treating an infection by Gram-positive bacteria in a mammal, said method comprising administering to said mammal an effective amount of a compound that binds noncovalently in the minor groove of duplex DNA, which compound: i) binds with a dissociation constant of equal to or less than 100 nM to at least one of: (a) a target sequence AAAAAGCAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I; (b) a target sequence AAAAAGACAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I; (c) a target sequence AAAAAGTACAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I; (d) a target sequence AGTACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ LD NO. II; (e) a target sequence AATACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. II; (f) a target sequence ATTACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. II; (g) a target sequence TGACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (h) a target sequence GACAATTAATCA in the 352 base pair EcoRI PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (i) a target sequence AATTAATCAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (j) a target sequence ACAATTA in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; and (k) a target sequence ACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; ii) exhibits a MIC of less than or equal to 2 μg/mL against at least one of Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus ATCC 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422; iii) exhibits a MIC of greater than or equal to 32 μg/mL against Candida albicans ATCC 38247; and iv) has a molecular weight of from 100 to about 1100.
2. A method according to claim 1, wherein the dissociation constant is equal to or less than 50 nM.
3. A method in accordance with claim 1, wherein the dissociation constant is equal to or less than 20 nM.
4. A method in accordance with claim 1, wherein the compound has a MIC of equal to or less than 2 μg/mL against each of Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus ATCC 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422.
5. A method in accordance with claim 1, wherein the compound has a MIC of equal to or less than 1 μg/mL against each of Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus ATCC ATCC 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422.
6. A method in accordance with claim 1, wherein the compound has a , molecular weight of from about 400 to about 800.
7. A method for treating an infection by Gram-positive bacteria in a mammal, said method comprising administering to said mammal an effective amount of a compound that binds noncovalently to duplex DNA, which compound i) binds with a dissociation constant of equal to or less than 100 nM to at least one of: (a) a target sequence AAAAAGCAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I; (b) a target sequence AAAAAGACAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I; (c) a target sequence AAAAAGTACAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I; (d) a target sequence AGTACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. II; (e) a target sequence AATACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. II; (f) a target sequence ATTACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ LD NO. II; (g) a target sequence TGACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (h) a target sequence GACAATTAATCA in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (i) a target sequence AATTAATCAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (j) a target sequence ACAATTA in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; and (k) a target sequence ACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; ii) has activity ratio X/Y equal to or greater than 16, wherein X is the MIC of the compound against Candida albicans ATCC 38247 and Y is the lowest MIC of the compound from among the MIC's for Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422; and iii) has a molecular weight of from 100 to about 1100.
8. A method in accordance with claim 1, wherein X/Y is equal to or greater than 32.
9. A method in accordance with claim 7, wherein said compound binds with a dissociation constant of equal to or less than 100 nM to at least three of the target sequences in (a) through (k).
10. A method in accordance with claim 7, wherein said compound binds with a dissociation constant of equal to or less than 100 nM to at least five of the target sequences in (a) through (k).
11. A method in accordance with claim 7, wherein said compound binds with a dissociation constant of equal to or less than 100 nM to each of the target sequences in (a) through (k).
12. A method in accordance with claim 7, wherein said compound has a half- life of greater than four hours in plasma.
13. A method in accordance with claim 7, wherein said compound has the formula: A-((L -Ari)n-Lx-B (I) wherein A is member selected from the group consisting of a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, an amino group and a mono- or di-alkyl amino group; the subscript n is an integer of from 2 to 7; the subscript p in each instance is an integer of from 0 to 1, indicating the presence or absence of each linking group (L1); L1 is a linking group in which the superscript i is an integer of from 1 to n, and each linking group can be the same or different from the other linking groups and is selected from the group consisting of-NH-, -NR-, -CONH-, -SO2NH-, - CONR-, -SO2NR-, (Cι-C6)alkylene, (Cι-C6)heteroalkylene, and combinations thereof in which each R is independently (d -C6)alkyl; Ar' is a substituted or unsubstituted aryl or heteroaryl group, in which the superscript i is an integer of from 1 to n and denotes the position away from A that is occupied by each aryl or heteroaryl group, and each Ar group can be the same or different from any other Ar group; Lx is a linking group selected from -NH-, -NR-, -CONH-, -SO2NH-, -CONR-, -SO2NR-, (Cι-C6)alkylene, (Cι-C6)heteroalkylene, and combinations thereof in which each R is independently (Cι-C6)alkyl; and B is a member selected from the group consisting of a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, an amino group and a mono- or di-alkyl amino group; or a pharmaceutically acceptable salt, prodrug form or protected forai thereof.
14. A method in accordance with claim 13, wherein said compound has a formula selected from the group consisting of: A-L1-Ar,-L2-Ar2-L3-Ar3-L4-Ar4-L5-Ar5-Lx-B; A-L1-Ar1-L2-Ar2-Ar3-L4-Ar4-L5-Ar5-Lx-B; A-L1-Ar'-L2-Ar2-L3-Ar3-L4-Ar4-Lx-B; A-Ll-Ar'-L2-Ar2-L3-Ar3-Lx-B; A-L1-Ar1-L2-Ar2-Lx-B; and
A-L1-Ar1-Ar2-Lx-B.
15. A method in accordance with claim 13, wherein said compound has the formula A-L1-Ar1-L2-Ar2-L3-Ar3-L4-Ar4-Lx-B.
16. A method in accordance with claim 13, wherein said compound has the formula A-L1-Ar1-L2-Ar2-L3-Ar3-Lx-B.
17. A method in accordance with claim 13, wherein said compound binds in the minor groove of a DNA duplex comprising an AT-rich sequence selected from the group consisting of the target sequences (a) through (f).
18. A method in accordance with claim 13, wherein said compound binds in the minor groove of a DNA duplex comprising an AT-rich sequence selected from the group consisting of the target sequences (g) through (k).
19. A method in accordance with claim 13, wherein said compound is soluble in water at pH 7.5 in an amount greater than or equal to 0.1 mg/mL.
20. A method in accordance with claim 1, wherein said compound exhibits less than or equal to 90% protein binding in an in vitro protein binding assay.
21. A compound useful for the treatment of an infection by Gram-positive bacteria, said compound having the formula: A-((Li)p-Ari)n-Lx-B (I) wherein A is member selected from the group consisting of a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, an amino group and a mono- or di-alkyl amino group; the subscript n is an integer of from 2 to 7; the subscript p in each instance is an integer of from 0 to 1, indicating the presence or absence of each linking group (L1); L1 is a linking group in which the superscript i is an integer of from 1 to n, and each linking group can be the same or different from the other linking groups and is selected from the group consisting of-NH-, -CONH-, -SO2NH-, -CONR-, -SO2NR-, (Cι-C6)alkylene, (Cι-C6)heteroalkylene, and combinations thereof; Ar1 is a substituted or unsubstituted aryl or heteroaryl group, in which the superscript i is an integer of from 1 to n and denotes the position away from A that is occupied by each aryl or heteroaryl group, and each Ar group can be the same or different from any other Ar group; Lx is a linking group selected from -CONH-, -SO2NH-, -CONR-, -SO2NR-, (Q- C6)alkylene, (Cι-C6)heteroalkylene, and combinations thereof; and B is a member selected from the group consisting of a substituted or unsubstituted aryl or heteroaryl group, a substituted or unsubstituted heterocychc group, an amino group and a mono- or di-alkyl amino group; or a pharmaceutically acceptable salt, prodrug form or protected form thereof; wherein said compound i) binds with a dissociation constant of equal to or less than 100 nM to at least one of: (a) a target sequence AAAAAGCAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I; (b) a target sequence AAAAAGACAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I; (c) a target sequence AAAAAGTACAAAAA in the 351 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. I; (d) a target sequence AGTACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. II; (e) a target sequence AATACT in the 310 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. II; (f) a target sequence ATTACT in the 310 base pair EcoRI PvuII restriction fragment of a polynucleotide of SEQ LD NO. II; (g) a target sequence TGACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (h) a target sequence GACAATTAATCA in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; (i) a target sequence AATTAATCAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ED NO. Ill; (j) a target sequence ACAATTA in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; and (k) a target sequence ACAATTAAT in the 352 base pair EcoRI/PvuII restriction fragment of a polynucleotide of SEQ ID NO. Ill; ii) has activity ratio X/Y equal to or greater than 16, wherein X is the MIC of the compound against Candida albicans ATCC 38247 and Y is the lowest MIC of the compound from among the MIC's for Enterococcus faecium ATCC 51559, Staphylococcus aureus ATCC 27660, Staphylococcus aureus 33591, Staphylococcus aureus ATCC 43300, and Streptococcus pneumoniae ATCC 51422; and iii) has a molecular weight of from 100 to about 1100.
22. A compound in accordance with claim 21, having a formula selected from the group consisting of: A-L1-Ar1-L2-Ar2-L3-Ar3-L4-Ar4-L5-Ar5-Lx-B; A-L1-Ar1-L2-Ar2-Ar3-L4-Ar4-L5-Ar5-Lx-B; A-L1-Ar1-L2-Ar2-L3-Ar3-L4-Ar4-Lx-B; A-L'-Ar1-L2-Ar2-L3-Ar3-Lx-B; A-L1-Ar1-L2-Ar2-Lx-B; and A-L'-Ar'-Ar2-Lx-B.
23. A compound in accordance with claim 21, wherein each Ar is independently selected from the group consisting of substituted and unsubstituted thienyl, substituted and unsubstituted thiazolyl, substituted and unsubstituted isothiazolyl, substituted and unsubstituted imidazolyl, substituted and unsubstituted pynolyl, substituted and unsubstituted oxazolyl, substituted and unsubstituted triazolyl, substituted and unsubstituted isoquinolyl, substituted and unsubstituted pyrazolyl, substituted and unsubstituted benzothienyl, substituted and unsubstituted pyrazinyl, substituted and unsubstituted pyradinyl and substituted and unsubstituted phenyl.
24. A compound in accordance with claim 21, wherein each Ar is independently selected from the group consisting of substituted and unsubstituted thienyl, substituted and unsubstituted thiazolyl, substituted and unsubstituted isothiazolyl, substituted and unsubstituted imidazolyl, substituted and unsubstituted isoquinolyl, substituted and unsubstituted pyrazolyl, substituted and unsubstituted benzothienyl, substituted and unsubstituted pyrazinyl, substituted and unsubstituted pyradinyl and substituted and unsubstituted pynolyl; and each Y is independently selected from the group consisting of -C(O)-, -NHC(O)- and -C(O)NH-.
25. A compound in accordance with claim 21, wherein said compound has a molecular weight of from 100 to 750.
26. The use of a compound of claim 21 for the preparation of a medicament useful for the treatment of an infection by Gram-positive bacteria in a mammal.
PCT/US2002/029379 2001-09-13 2002-09-12 Methods of treating infection by drug resistant bacteria WO2004043335A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2004551348A JP2005538183A (en) 2001-09-13 2002-09-12 Methods for treating infections caused by drug-resistant bacteria
AU2002368274A AU2002368274A1 (en) 2001-09-13 2002-09-12 Methods of treating infection by drug resistant bacteria
EP02807922A EP1572072A4 (en) 2001-09-13 2002-09-12 Methods of treating infection by drug resistant bacteria
CA002458926A CA2458926A1 (en) 2001-09-13 2002-09-12 Methods of treating infection by drug resistant bacteria

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US32270401P 2001-09-13 2001-09-13
US60/322,704 2001-09-13

Publications (2)

Publication Number Publication Date
WO2004043335A2 true WO2004043335A2 (en) 2004-05-27
WO2004043335A3 WO2004043335A3 (en) 2007-06-14

Family

ID=32312318

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/029379 WO2004043335A2 (en) 2001-09-13 2002-09-12 Methods of treating infection by drug resistant bacteria

Country Status (6)

Country Link
US (1) US20030199516A1 (en)
EP (1) EP1572072A4 (en)
JP (1) JP2005538183A (en)
AU (1) AU2002368274A1 (en)
CA (1) CA2458926A1 (en)
WO (1) WO2004043335A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8008303B2 (en) 2005-09-16 2011-08-30 Astrazeneca Ab Biphenyl derivatives and their use in treating hepatitis C
US8466180B2 (en) 2006-09-11 2013-06-18 Syngenta Crop Protection Llc Insecticidal compounds
WO2017075426A1 (en) * 2015-10-30 2017-05-04 Novozymes A/S Polynucleotide constructs for in vitro and in vivo expression

Families Citing this family (91)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030236198A1 (en) * 2001-06-13 2003-12-25 Genesoft, Inc. Antipathogenic benzamide compounds
WO2004012736A1 (en) 2002-08-02 2004-02-12 Genesoft Pharmaceuticals, Inc. Biaryl compounds having anti-infective activity
US7265129B2 (en) 2002-10-25 2007-09-04 Genesoft Pharmaceuticals, Inc. Anti-infective biaryl compounds
WO2004052304A2 (en) * 2002-12-10 2004-06-24 Oscient Pharmaceuticals Corporation Antibacterial compounds having a (pyrrole carboxamide)-(benzamide)-(imidazole carboxamide) motif
EP1831225A2 (en) 2004-11-19 2007-09-12 The Regents of the University of California Anti-inflammatory pyrazolopyrimidines
WO2006094236A1 (en) * 2005-03-03 2006-09-08 Sirtris Pharmaceuticals, Inc. N-phenyl benzamide derivatives as sirtuin modulators
US20060280694A1 (en) * 2005-06-09 2006-12-14 John Peldyak Composition for the mineralization of dental hard tissues and the reduction of caries-inducive microflora
WO2007019417A1 (en) 2005-08-04 2007-02-15 Sirtris Pharmaceuticals, Inc. Oxazolopyridine derivatives as sirtuin modulators
US7855289B2 (en) * 2005-08-04 2010-12-21 Sirtris Pharmaceuticals, Inc. Sirtuin modulating compounds
US8088928B2 (en) * 2005-08-04 2012-01-03 Sirtris Pharmaceuticals, Inc. Sirtuin modulating compounds
US8093401B2 (en) * 2005-08-04 2012-01-10 Sirtris Pharmaceuticals, Inc. Sirtuin modulating compounds
EA200870409A1 (en) 2006-04-04 2009-04-28 Дзе Риджентс Оф Дзе Юниверсити Оф Калифорния ANTAGONISTS OF KINASE PI3
TW200916472A (en) * 2007-06-20 2009-04-16 Sirtris Pharmaceuticals Inc Sirtuin modulating compounds
WO2009046448A1 (en) 2007-10-04 2009-04-09 Intellikine, Inc. Chemical entities and therapeutic uses thereof
CA2704336A1 (en) * 2007-11-01 2009-05-07 Sirtris Pharmaceuticals, Inc. Amide derivatives as sirtuin modulators
US20110009381A1 (en) * 2007-11-08 2011-01-13 Sirtis Pharmaceuticals, Inc. Solubilized thiazolopyridines
US8193182B2 (en) * 2008-01-04 2012-06-05 Intellikine, Inc. Substituted isoquinolin-1(2H)-ones, and methods of use thereof
MX2010007418A (en) * 2008-01-04 2010-11-12 Intellikine Inc Certain chemical entities, compositions and methods.
KR20100137439A (en) * 2008-03-04 2010-12-30 엘란 파마 인터내셔널 리미티드 Stable liquid formulations of anti-infective agents and adjusted anti-infective agent dosing regimens
US8637542B2 (en) 2008-03-14 2014-01-28 Intellikine, Inc. Kinase inhibitors and methods of use
US8993580B2 (en) 2008-03-14 2015-03-31 Intellikine Llc Benzothiazole kinase inhibitors and methods of use
BRPI0915231A2 (en) 2008-07-08 2018-06-12 Intellikine Inc kinase inhibitor compounds and methods of use
US20110224223A1 (en) 2008-07-08 2011-09-15 The Regents Of The University Of California, A California Corporation MTOR Modulators and Uses Thereof
WO2010036380A1 (en) 2008-09-26 2010-04-01 Intellikine, Inc. Heterocyclic kinase inhibitors
DK2358720T3 (en) 2008-10-16 2016-06-06 Univ California Heteroarylkinaseinhibitorer fused-ring
US8476282B2 (en) 2008-11-03 2013-07-02 Intellikine Llc Benzoxazole kinase inhibitors and methods of use
EA021424B1 (en) 2008-12-19 2015-06-30 Сертрис Фармасьютикалз, Инк. Thiazolopyridine sirtuin modulating compounds
CA2760791C (en) 2009-05-07 2017-06-20 Intellikine, Inc. Heterocyclic compounds and uses thereof
EP2440053A4 (en) 2009-06-09 2012-10-31 California Capital Equity Llc Benzyl substituted triazine derivatives and their therapeutical applications
CN102573480B (en) 2009-06-09 2015-06-10 加利福尼亚资本权益有限责任公司 Triazine derivatives and their therapeutical applications
ES2557453T3 (en) 2009-06-09 2016-01-26 Nantbioscience, Inc. Isoquinoline, quinoline and quinazoline derivatives as inhibitors of Hedgehog signaling
DK2987487T3 (en) 2009-08-10 2020-12-07 Samumed Llc INDAZOLINE INHIBITORS OF THE WNT SIGNAL ROAD AND ITS THERAPEUTIC USES
US8980899B2 (en) 2009-10-16 2015-03-17 The Regents Of The University Of California Methods of inhibiting Ire1
EP3305073B1 (en) 2009-12-21 2019-05-15 Samumed, LLC 1h-pyrazolo[3,4-b]pyridines and therapeutic uses thereof
EP2571357B1 (en) 2010-05-21 2016-07-06 Infinity Pharmaceuticals, Inc. Chemical compounds, compositions and methods for kinase modulation
WO2012064973A2 (en) 2010-11-10 2012-05-18 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
AR084824A1 (en) 2011-01-10 2013-06-26 Intellikine Inc PROCESSES TO PREPARE ISOQUINOLINONES AND SOLID FORMS OF ISOQUINOLINONAS
AR085397A1 (en) 2011-02-23 2013-09-25 Intellikine Inc COMBINATION OF QUINASA INHIBITORS AND THEIR USES
AU2012284088B2 (en) 2011-07-19 2015-10-08 Infinity Pharmaceuticals Inc. Heterocyclic compounds and uses thereof
CN103946226A (en) 2011-07-19 2014-07-23 无限药品股份有限公司 Heterocyclic compounds and uses thereof
WO2013032591A1 (en) 2011-08-29 2013-03-07 Infinity Pharmaceuticals Inc. Heterocyclic compounds and uses thereof
AU2012341028C1 (en) 2011-09-02 2017-10-19 Mount Sinai School Of Medicine Substituted pyrazolo[3,4-D]pyrimidines and uses thereof
PE20141678A1 (en) 2011-09-14 2014-11-21 Samumed Llc INDAZOL-3-CARBOXAMIDES AND THEIR USE AS INHIBITORS OF THE WNT / B-CATENIN SIGNALING PATHWAY
PH12017500997A1 (en) 2012-04-04 2018-02-19 Samumed Llc Indazole inhibitors of the wnt signal pathway and therapeutic uses thereof
US8940742B2 (en) 2012-04-10 2015-01-27 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
ES2752192T3 (en) 2012-05-04 2020-04-03 Samumed Llc 1H-pyrazolo [3,4-b] pyridines and therapeutic uses thereof
US8828998B2 (en) 2012-06-25 2014-09-09 Infinity Pharmaceuticals, Inc. Treatment of lupus, fibrotic conditions, and inflammatory myopathies and other disorders using PI3 kinase inhibitors
WO2014052669A1 (en) 2012-09-26 2014-04-03 The Regents Of The University Of California Modulation of ire1
MX370487B (en) 2013-01-08 2019-12-16 Samumed Llc 3-(benzoimidazol-2-yl)-indazole inhibitors of the wnt signaling pathway and therapeutic uses thereof.
US9481667B2 (en) 2013-03-15 2016-11-01 Infinity Pharmaceuticals, Inc. Salts and solid forms of isoquinolinones and composition comprising and methods of using the same
JP6466924B2 (en) 2013-10-04 2019-02-06 インフィニティー ファーマシューティカルズ, インコーポレイテッド Heterocyclic compounds and uses thereof
WO2015051241A1 (en) 2013-10-04 2015-04-09 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
US9775844B2 (en) 2014-03-19 2017-10-03 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
US20150320755A1 (en) 2014-04-16 2015-11-12 Infinity Pharmaceuticals, Inc. Combination therapies
WO2016040181A1 (en) 2014-09-08 2016-03-17 Samumed, Llc 3-(1h-imidazo[4,5-c]pyridin-2-yl)-1h-pyrazolo[3,4-c]pyridine and therapeutic uses thereof
WO2016040193A1 (en) 2014-09-08 2016-03-17 Samumed, Llc 3-(1h-imidazo[4,5-c]pyridin-2-yl)-1h-pyrazolo[3,4-b]pyridine and therapeutic uses thereof
WO2016040190A1 (en) 2014-09-08 2016-03-17 Samumed, Llc 3-(3h-imidazo[4,5-b]pyridin-2-yl)-1h-pyrazolo[3,4-b]pyridine and therapeutic uses thereof
WO2016040180A1 (en) 2014-09-08 2016-03-17 Samumed, Llc 3-(1h-benzo[d]imidazol-2-yl)-1h-pyrazolo[3,4-c]pyridine and therapeutic uses thereof
WO2016040188A1 (en) 2014-09-08 2016-03-17 Samumed, Llc 3-(3h-imidazo[4,5-c]pyridin-2-yl)-1h-pyrazolo[3,4-c]pyridine and therapeutic uses thereof
WO2016040185A1 (en) 2014-09-08 2016-03-17 Samumed, Llc 2-(1h-indazol-3-yl)-3h-imidazo[4,5-b]pyridine and therapeutic uses thereof
WO2016040182A1 (en) 2014-09-08 2016-03-17 Samumed, Llc 2-(1h-indazol-3-yl)-1h-imidazo[4,5-c]pyridine and therapeutic uses thereof
WO2016040184A1 (en) 2014-09-08 2016-03-17 Samumed, Llc 3-(3h-imidazo[4,5-b]pyridin-2-yl)-1h-pyrazolo[3,4-c]pyridine and therapeutic uses thereof
US9708348B2 (en) 2014-10-03 2017-07-18 Infinity Pharmaceuticals, Inc. Trisubstituted bicyclic heterocyclic compounds with kinase activities and uses thereof
WO2017023988A1 (en) 2015-08-03 2017-02-09 Samumed, Llc. 3-(3h-imidazo[4,5-c]pyridin-2-yl)-1h-pyrazolo[4,3-b]pyridines and therapeutic uses thereof
US10285983B2 (en) 2015-08-03 2019-05-14 Samumed, Llc 3-(1H-pyrrolo[2,3-B]pyridin-2-yl)-1H-pyrazolo[3,4-B] pyridines and therapeutic uses thereof
US10166218B2 (en) 2015-08-03 2019-01-01 Samumed, Llc 3-(1H-indol-2-yl)-1H-pyrazolo[3,4-C]pyridines and therapeutic uses thereof
WO2017024025A1 (en) 2015-08-03 2017-02-09 Sunil Kumar Kc 3-(1h-pyrrolo[2,3-c]pyridin-2-yl)-1h-pyrazolo[4,3-b]pyridines and therapeutic uses thereof
WO2017024010A1 (en) 2015-08-03 2017-02-09 Samumed, Llc. 3-(1h-pyrrolo[3,2-c]pyridin-2-yl)-1h-indazoles and therapeutic uses thereof
WO2017024004A1 (en) 2015-08-03 2017-02-09 Samumed, Llc. 3-(1h-pyrrolo[2,3-b]pyridin-2-yl)-1h-pyrazolo[4,3-b]pyridines and therapeutic uses thereof
WO2017024015A1 (en) 2015-08-03 2017-02-09 Samumed, Llc. 3-(3h-imidazo[4,5-b]pyridin-2-yl)-1h-pyrazolo[4,3-b]pyridines and therapeutic uses thereof
US10350199B2 (en) 2015-08-03 2019-07-16 Samumed, Llc 3-(1h-pyrrolo[2,3-b]pyridin-2-yl)-1h-indazoles and therapeutic uses thereof
WO2017023980A1 (en) 2015-08-03 2017-02-09 Samumed, Llc. 3-(1h-pyrrolo[2,3-b]pyridin-2-yl)-1h-pyrazolo[3,4-c]pyridines and therapeutic uses thereof
US10206908B2 (en) 2015-08-03 2019-02-19 Samumed, Llc 3-(1H-pyrrolo[3,2-C]pyridin-2-YL)-1H-pyrazolo[3,4-C]pyridines and therapeutic uses thereof
US10392383B2 (en) 2015-08-03 2019-08-27 Samumed, Llc 3-(1H-benzo[d]imidazol-2-yl)-1H-pyrazolo[4,3-b]pyridines and therapeutic uses thereof
WO2017023986A1 (en) 2015-08-03 2017-02-09 Samumed, Llc 3-(1h-indol-2-yl)-1h-indazoles and therapeutic uses thereof
US10383861B2 (en) 2015-08-03 2019-08-20 Sammumed, LLC 3-(1H-pyrrolo[2,3-C]pyridin-2-yl)-1H-pyrazolo[3,4-C]pyridines and therapeutic uses thereof
WO2017023972A1 (en) 2015-08-03 2017-02-09 Samumed, Llc. 3-(1h-imidazo[4,5-c]pyridin-2-yl)-1h-pyrazolo[4,3-b]pyridines and therapeutic uses thereof
US10226448B2 (en) 2015-08-03 2019-03-12 Samumed, Llc 3-(1H-pyrrolo[3,2-C]pyridin-2-yl)-1H-pyrazolo[3,4-B]pyridines and therapeutic uses thereof
WO2017024003A1 (en) 2015-08-03 2017-02-09 Samumed, Llc 3-(1h-pyrrolo[3,2-c]pyridin-2-yl)-1h-pyrazolo[4,3-b]pyridines and therapeutic uses thereof
WO2017023993A1 (en) 2015-08-03 2017-02-09 Samumed, Llc. 3-(1h-indol-2-yl)-1h-pyrazolo[4,3-b]pyridines and therapeutic uses thereof
CA2998469A1 (en) 2015-09-14 2017-03-23 Infinity Pharmaceuticals, Inc. Solid forms of isoquinolinones, and process of making, composition comprising, and methods of using the same
BR112018009252A2 (en) 2015-11-06 2018-11-06 Samumed Llc osteoarthritis treatment
WO2017161116A1 (en) 2016-03-17 2017-09-21 Infinity Pharmaceuticals, Inc. Isotopologues of isoquinolinone and quinazolinone compounds and uses thereof as pi3k kinase inhibitors
SI3464285T1 (en) 2016-06-01 2023-02-28 Biosplice Therapeutics, Inc. Process for preparing n-(5-(3-(7-(3-fluorophenyl)-3h-imidazo(4,5-c)pyridin-2-yl)-1h-indazol-5-yl)pyridin-3-yl)-3-methylbutanamide
US10919914B2 (en) 2016-06-08 2021-02-16 Infinity Pharmaceuticals, Inc. Heterocyclic compounds and uses thereof
SG11201811237WA (en) 2016-06-24 2019-01-30 Infinity Pharmaceuticals Inc Combination therapies
AU2017345699A1 (en) 2016-10-21 2019-05-16 Samumed, Llc Methods of using indazole-3-carboxamides and their use as Wnt/B-catenin signaling pathway inhibitors
WO2018085865A1 (en) 2016-11-07 2018-05-11 Samumed, Llc Single-dose, ready-to-use injectable formulations
TWI794742B (en) 2020-02-18 2023-03-01 美商基利科學股份有限公司 Antiviral compounds
CN116209663A (en) 2020-08-17 2023-06-02 安力高医药股份有限公司 Methods and compositions for targeting PD-L1
EP4323362A1 (en) 2021-04-16 2024-02-21 Gilead Sciences, Inc. Methods of preparing carbanucleosides using amides

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6090947A (en) * 1996-02-26 2000-07-18 California Institute Of Technology Method for the synthesis of pyrrole and imidazole carboxamides on a solid support
US6635417B1 (en) * 1996-07-31 2003-10-21 California Institute Of Technology Complex formation between DSDNA and oligomer of cyclic heterocycles
US7122626B2 (en) * 2001-04-26 2006-10-17 Genesoft Pharmceuticals, Inc. Halogen-substitued thienyl compounds
EP1470119A4 (en) * 2001-06-13 2005-10-19 Genesoft Pharmaceuticals Inc Benzothiophene compounds having antiinfective activity

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
OPALINSKA J.B. ET AL.: 'Nucleic-acid therapeutics: Basic principles and recent applications' NATURE REVIEWS vol. 1, July 2002, pages 503 - 514, XP003007480 *
See also references of EP1572072A2 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8008303B2 (en) 2005-09-16 2011-08-30 Astrazeneca Ab Biphenyl derivatives and their use in treating hepatitis C
US8466180B2 (en) 2006-09-11 2013-06-18 Syngenta Crop Protection Llc Insecticidal compounds
WO2017075426A1 (en) * 2015-10-30 2017-05-04 Novozymes A/S Polynucleotide constructs for in vitro and in vivo expression
CN108138188A (en) * 2015-10-30 2018-06-08 诺维信公司 For the polynucleotide constructs of in vitro and in vivo expression

Also Published As

Publication number Publication date
CA2458926A1 (en) 2003-03-13
US20030199516A1 (en) 2003-10-23
WO2004043335A3 (en) 2007-06-14
AU2002368274A8 (en) 2004-06-03
EP1572072A2 (en) 2005-09-14
AU2002368274A1 (en) 2004-06-03
JP2005538183A (en) 2005-12-15
EP1572072A4 (en) 2009-04-01

Similar Documents

Publication Publication Date Title
WO2004043335A2 (en) Methods of treating infection by drug resistant bacteria
JP6399148B2 (en) Substituted pyrrolidines as factor XIa inhibitors for the treatment of thromboembolism
US6825228B2 (en) Benzothiophene compounds having antiinfective activity
JP5154609B2 (en) Method for assaying effect of test substance on PTH production
CA3183740A1 (en) Anti-viral compounds for treating coronavirus, picornavirus, and norovirus infections
AU2006205877B2 (en) 3,4,(5)-substituted tetrahydropyridines
AU776053B2 (en) Diazepan derivatives or salts thereof
WO2002101007A2 (en) Antipathogenic benzamide compounds
WO2001021615A1 (en) Benzimidazole derivatives
AU2003211381A1 (en) Fused pyridazine derivative compounds and drugs containing the compounds as the active ingredient
JP6337750B2 (en) Compound
KR100266467B1 (en) Sulfonamide derivatives
US6716866B2 (en) Aryl-benzimidazole compounds having antiinfective activity
US20020119962A1 (en) Novel urea compounds, compositions and methods of use and preparation
KR20000005238A (en) Cephem compound and drug containing the compound
AU779426B2 (en) Triazoles as farnesyl transferase inhibitors
AU2006254396A1 (en) Piperazine derivative renin inhibitors
CA2921082A1 (en) Linear peptide antibiotics
WO2004101514A1 (en) Cyanofluoropyrrolidine derivative
KR20060030895A (en) Kappa agonists, especially for the treatment and/or prophylaxis of irritable bowel syndrome
EP1443934A1 (en) Benzotriazepines as gastrin and cholecystokinin receptor ligands
JP2007527903A (en) Indole-2-carboxylic acid hydrazide compound
WO2004101533A1 (en) 1, 3, 4-benzotriazepin-2-one salts and their use as cck receptor ligands
JP2008115165A (en) Thiopeptide compound
WO2004098609A1 (en) Benzotriazepine derivatives and their use as gastrin and cholecystokinin receptor ligands

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 2458926

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2004551348

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2002807922

Country of ref document: EP

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWP Wipo information: published in national office

Ref document number: 2002807922

Country of ref document: EP

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)