WO2004026407A1

WO2004026407A1 - Use of inhibitors of compounds involved in the jun kinase (jnk) biochemical cellular pathway for the treatment or diagnosis of liposarcomas

Info

Publication number: WO2004026407A1
Application number: PCT/EP2003/009867
Authority: WO
Inventors: Alain Aurias; Frédéric Chibon; Odette Mariani
Original assignee: Institut Curie; Universite Pierre Et Marie Curie (Paris Vi); Institut National De La Sante Et De La Recherche Medicale Inserm
Priority date: 2002-09-06
Filing date: 2003-09-05
Publication date: 2004-04-01
Also published as: AU2003294668A8; AU2003294668A1

Abstract

The invention relates to the use of inhibitors of compounds involved in the JUN kinase (JNK) biochemical cellular pathway, these compounds being the ASK1 mitogen activated protein (MAP) kinase, or other MAP kinases involved in said pathway, or the TNFα receptors, or the c-JUN protein, for the manufacture of a medicament for the treatment of pathologies such as liposarcomas, or the use of said compounds, or of cells overexpressing ASK1 and/or c-JUN, for the screening of molecules that can be used against said pathologies, or the use of compounds liable to bind with ASK1 or c-JUN for the in vitro diagnosis of said pathologies.

Description

USE OF INHIBITORS OF COMPOUNDS INVOLVED IN THE JUN KINASE (JNK) BIOCHEMICAL CELLULAR PATHWAY FOR THE TREATMENT OR DIAGNOSIS OF LIPOSARCOMAS

Malignant fibrous histiocytoma (MFH) is. considered as the most frequent undifferentiated soft tissue sarcoma of late adult life. Nevertheless, increasing clinical and pathological evidence suggests that MFH comprises a heterogeneous tumor type [Fletcher et al., 2001; 19:3045-50]. The analysis by comparative genomic hybridization (CGH) of a large series of MFH [Mairal et al, 1999] supports this hypothesis, and suggests that at least two main groups of tumors -are classified as MFH: The first group' (around 80% of so-called MFHs), is composed of tumors with complex, but recurrent, genomic imbalances, and has been recently proposed to correspond to undifferentiated leiomyosarcomas [Derre et al, 2001]. The second group of tumors (around 20%o of MFHs), associated with a much more simple cytogenetics, exhibits high level coarnplifϊcation of the 12ql4-ql5 chromosome region with other loci, a genetics strongly reminiscent of what has been observed for well differentiated liposarcomas. Nevertheless, these MFHs differ from liposarcomas, at the chromosome level, by the high recurrence of coamplified partners, since these coamplified loci are localized in lp32 or 6q23 chromosome regions. This observation suggests that amplification of specific loci, by interfering with the differentiation process, could lead to the undifferentiation of liposarcomas, and subsequently to their classification as MFHs.

The invention relies on the characterization of the 6q23 amplified region, by CGH, microsatellite analysis, fluorescence in-situ hybridization (FISH) and CGH- array, and on the demonstration by the Inventors that amplification and overexpression of ASK1, a gene of the JNK-MAPK signaling pathway, inhibits the adipocytic differentiation process of the tumoral cells. Thus, the present invention relies on the demonstration that treatment of a cell line harboring 12ql4 and 6q23 amplifications with a specific inhibitor of ASK1 can bypass the differentiation block, leading to dramatic modifications of morphology and accumulation of lipid droplets in the cytoplasm. These observations confirm that ASK1 is a relevant target for new therapeutic managements of these aggressive tumors with 6q23 amplification. The invention relates to the use of inhibitors of compounds involved in the JUN kinase (JNK) biochemical cellular pathway, or of inhibitors of the cellular biosynthesis of said compounds, for the manufacture of a medicament, for the treatment of - pathologies wherein cell differentiation is inhibited as a result of an overexpression of the ASKl kinase or of the c-JUN protein in cells which become undifferentiated and undergo division and proliferation.

The invention relates more particularly. to the use of inhibitors as defined above, for the manufacture of a medicament for the treatment of cancers wherein the ASKl kinase or the c-JUN protein are overexpressed in the cells. The invention more particularly concerns the use of inhibitors as defined above,

■for the manufacture of -a medicament-for the treatment of τnalignant--fιbriobistiocytomas- ^■■ (MFH).

The invention relates more particularly to the use of inhibitors as defined above, for the manufacture of a medicament for the treatment of liposarcomas. The invention more particularly concerns the use for the manufacture of a medicament for the treatment of pathologies wherein the ASKl kinase or the c-JUN protein are overexpressed in the cells as defined above, of inhibitors chosen among inhibitors of ASKl, or inhibitors of the cellular biosynthesis of ASKl.

Advantageously, the above-mentioned inhibitors are direct inhibitors of ASKl, chosen among molecules inhibiting the enzymatic activity of ASKl (i.e. the pl osphorylation of target proteins), such as thioredoxin, or fragments or analogs thereof.

The invention also concerns the use as defined above, wherein the inhibitor of ASKl is an indirect inhibitor, such as N-acetylcysteine complexing the ASKl activating free radicals.

The invention also relates to the use as defined above, of inhibitors of the cellular biosynthesis of ASKl, selected in a group comprising antisense sequences hybridizing with the mRNA encoding ASKl corresponding to the ADNc represented by SEQ ID

NO : 1, and ohgonucleotides derived from the mRNA encoding ASKl and degrading said mRNA by RNA interference.

The invention relates more particularly to the use as defined above, wherein the inhibitor consists in at least two mRNA encoding ASKl interference ohgonucleotides of 15 to 25 nucleotides derived from the mRNA encoding ASKl corresponding to the ADNc represented by SEQ ID NO : 1. The invention concerns more particularly the use as defined above, wherein the inhibitor consists in two lriRNA encoding ASKl interference ohgonucleotides corresponding to the following sequences :..

ASKl-SI : UGACAGAGUCGUUUUAGGAdTdT SEQIDNO : 2 ASK1-AS1: UCCUAAAACGACUCUGUCAdCdC SEQID NO: 3

The invention also concerns the use for the manufacture of a medicament for the treatment of pathologies wherein . the ASKl kinase or the c-JUN protein are overexpressed in the cells as defined above, of inhibitors chosen among inhibitors of the TNFα receptors. The invention relates more particularly to the use as defined above, of the mόfiόc'lOflaTantib^'oα'y ^' MAB225 lfreetetf ^'against the TNFα 'receptor 1 (TNFR1 ),^"" such^' as described in Liu and Fan, 2001.

The invention also relates to the use as defined above, of inhibitors of c-JUN, or of inhibitors of the cellular biosynthesis of c-JUN, for the manufacture of a medicament for the treatment of pathologies wherein the c-JUN protein is overexpressed in the cells.

The invention also concerns the use of ASKl, or other MAP kinases implicated in the JNK cellular pathway, for carrying out a method for the screening of molecules inhibiting the enzymatic activity of ASKl, said molecules being candidate as a drug for the treatment of pathologies mentioned above. The invention also relates to the use of the c-JUN protein for carrying out a method for the screening of molecules inhibiting said protein, said molecules being candidate as a drug for the treatment of pathologies mentioned above.

The invention also concerns the use of the TNFα. receptors for carrying out a method for the screemng of molecules inhibiting the enzymatic activity of ASKl, said molecules being candidate as a drug for the treatment of pathologies mentioned above.

The invention also relates to the use of cells overexpressing ASKl and/or c-JUN for carrying out a method for the screening of molecules being candidate as a drug for the treatment of pathologies mentioned above.

In this respect, the invention relates more particularly to the use for carrying out a method for the screening of molecules being candidate as a drug for the treatment of pathologies mentioned above, of undifferentiated tumoral cells overexpressing ASKl such as deposited at the Centre National de Cultures de Micro-Organismes (CNCM) of INSTITUT PASTEUR, Paris, on June 11, 2002, under the number 1-2882, and on September 2, 2003, under the number 1-3077.

The invention also relates to the cells overexpressing ASKl such as deposited at the Centre National de Cultures de Micro-Organismes (CNCM) of INSTITUT PASTEUR, Paris, on June 11 2002, under the number 1-2882, September 2, 2003, under the number 1-3077.

The invention also concerns a method for the screening of molecules being candidate as a drug for the treatment of pathologies mentioned above, said method comprising : - contacting a molecule to be tested with ASKl, or other MAP kinases implicated in the JNK cellular pathways ^*

- detecting an interaction between said molecule and ASKl, or other MAP kinases implicated in the JNK cellular pathway, by measuring the loss of enzymatic property of said kinases. The invention also relates to a method for the screening of molecules being candidate as a drug for the treatment of pathologies mentioned above, said method comprising :

- contacting a molecule to be tested with c-JUN,

- detecting an interaction between said molecule and ASKl, or other MAP kinases implicated in the JNK cellular pathway, by measuring the loss of enzymatic property of said kinases.

The invention also concerns a method for the screening of molecules being candidate as a drug for the treatment of pathologies mentioned above, said method comprising : - contacting a molecule to be tested with TNFα receptors,

- detecting an interaction between said molecule and TNFα receptors, by measuring the activity of the JNK pathway.

The invention also relates to a method for the screening of molecules being candidate as a drug for the treatment of pathologies mentioned above, said method comprising :

- contacting a molecule to be tested with cells overexpressing ASKl and/or c-JUN as mentioned above, - detecting the inhibition of the division of said cells and their passage from an undifferentiated state without production of fat, to a differentiated state with production of fat in said cells.

The invention also concerns a method for the in vitro diagnosis of pathologies mentioned above, said method comprising :

- contacting a biological sample from a patient liable to suffer from said pathologies with a compound capable of binding with ASKl and/or c-JUN in conditions such that the formation of a complex between said compound and ASKl or c-JUN can occur, - detecting said complex, and comparing the amount of said complex with the amount of said complex which is detected in a biological sample from" an^* healthy person.

The invention relates more particularly to a method for the in vitro diagnosis of pathologies mentioned above, characterized in that the compound used for the detection of ASKl or c-JUN are antibodies against these proteins, these antibodies being if necessary labeled, for example radiolabeled or by fluorescence.

The invention also concerns polyclonal or monoclonal antibodies against ASKl or c-JUN, and the use of said antibodies for carrying out a method for the in vitro diagnosis of pathologies mentioned above. The invention will be further illustrated with the following experimental data showing the effect of irihibition of ASKl on liposarcoma cells in culture, and corresponding to cells overexpressing ASKl such as deposited at the Centre National de

Cultures de Micro-Organismes (CNCM) of LNSTITUT PASTEUR, Paris, on June 11

2002, under the number 1-2882, and on September 2, 2003, funder the number 1-3077, and the effect in vivo of NAC treatment on the growth and differentiation of the tumor cells

The Inventors have demonstrated that around 20% of malignant fibrous histiocytomas (MFHs) are characterized by high-level amplifications of 12ql4-ql5 chromosome region, associated with either lp32 or 6q23 bands amplification. This genetics strongly suggests (i) that these tumors correspond to undifferentiated liposarcomas, and (ii) that undifferentiation could be the consequence of amplification of target genes localized in lp32 or 6q23 bands.

The characterization by CGH-array of the 6q23 amplified region is hereby reported by the Inventors. Their findings demonstrate that amplification and overexpression of ASKl, a gene of the JNK-MAPK signalling pathway localized in 6q23 chromosome band, inhibit the adipocytic differentiation process of the tumoral cells. Treatments of a cell line with specific inhibitors of ASKl bypass . the differentiation block and induce a strong adipocytic differentiation. These observations indicate that ASKl is a target for new therapeutic managements of these aggressive tumors.

INTRODUCTION

In a CGH analysis of a series of 108 MFHs (Mairal et al., 1999; Derre et al, 2001), the Inventors found 22 tumors with high-level amplification of 12ql4-ql5 chromosome region-associated- in -9-cases with lp32 amplification- and~in"'6- cases~with'"

6q23 amplification. This genetics strongly suggested that these tumors correspond to undifferentiated liposarcomas, and that in most cases undifferentiation could be the consequence of amplification of target genes localized in lp32 or 6q23 bands. No case with simultaneous lp32 and 6q23 amplifications was observed, suggesting that the corresponding driver genes could encode proteins with similar functions, or involved in the same pathway. A subset of these tumors, exhibiting amplified regions strictly limited, at the cytogenetic level, to 6q23 sub-band, were chosen for a preliminary analysis of allelic imbalances of microsatelhte loci localized in this region. This first step allowed us to restrict the 6q23 amplified region between D6S472 and D6S1684, a region of 11.7 cM and 7.7 Mb on the June 2002 assembly of the human genome. The medium size of this region prompted us to design a CGH-array of BAG and PAC clones covering the region.

MATERIAL AND METHODS

Tumors.

All the tumors but one (T5) were obtained as frozen samples. They were classified as MFHs by the French Sarcoma Group. MFHs were defined as pleomorphic and spindle cell sarcomas showing no distinct line of differentiation. A specific line of differentiation was looked for by histo logical reviewing of all slides and immunohistochemistry. The minimum set of antibodies used was cytokeratin, SI 00 protein, alpha smooth muscle actin and desmin. Microarrays.

In a first step, BAC and PAC clones were selected by BLAST search in htgs databases, with queries ,, corresponding to D6S1698, D6S407, D6S262, D6S457, D6S1656, D6S472, D6S1626, D6S1 84 and D6S311. Additional clones were obtained by searching the Human Genome Browser at UCSC and the Human Chromosome 6 database at Sanger Center (http://Renome.ucsc.edu/index.html. http://www.sanger.ac.uk/HGPΛ- The final contig obtained in band 6q23 contained 59 clones, and covered a region of 10 megabases in the June 2002 release of the Golden Path (http ://genome.ucsc. edu/cgi-bin/hgGateway?db^:=hg 12) . Another series of 120 clones, corresponding to loci with normal copy number on standard CGH, were also selected for-data-normalization. Large-cultures (500ml) of clones"Were^~performed"'ifrLB'" medium with appropriate antibiotics. We used the Qiagen Plasmid Maxi kit to isolate DNA, following the manufacturer's protocol. DNA purity was ascertained by Hindlll digestion and electrophoresis through a 0.80% agarose gel. We then verified by FISH the chromosome localizations of all clones. Sonicated DNA solutions (400ng/μl in

3XSSC) were transferred to 96-well microtitre plates for robotic arraying. Poly-1-lysine coated slides were prepared according to the Patrick Brown laboratory's protocols (http://cmgm.stanford.edu/pbrown/protocols/l slides.html . Samples were printed in separated duplicates using an Omnigrid 2 printer (Genemachines). Slides were then treated and stored according to P. Brown's protocols. Tumor and control DNAs were labeled by random priming using Cy5- or Cy3-dCTP (Amersham). We then combined 2 μg of tumor and 2 μg of control DNA with Cot-1 DNA (300 μg ; Gibco BRL). Hybridizations were performed in a moist chamber for 72h at 37°C, in 20μl of hybridization buffer (50% formamide, 2X SSC, 10% dexti sulfate, 1% SDS, 40 mM NaH₂PO₄, IX Denhardt, pH7). After hybridization, slides were rinsed in 0.5X SSC,

0.03% SDS at 65°C for 5 min, and then in 0.2X SSC at room temperature for 5 min. Cy3 and Cy5 images were acquired with a Scanarray 5000 scanner (Packard Bioscience), and then analyzed with the GenePix Pro 4.0 software (Axon Instruments). Copy number ratios (Cy5/Cy3) were calculated on the means of the median values observed for each locus. Normalization was obtained by comparison with the ratios observed on the series of 120 unamplified loci. Loci with ratios > 1.5 were considered as amplified. Real-time PCR assay.

RNA was isolated using the Trizol extraction kit (Gibco BRL). A total of 1 μg of RNA was reverse transcribed using random hexamers in a total volume of 20 μl using the Gene Amp RNA PCR kit (PE Biosystems). Real-time PCR was performed with an ABI Prism 7700 sequence detection system, using the Sybr Green PCR Core Reagents

Kit (PE Biosystems). Reactions were set up in 25 μl final volume containing 50ng cDNA, 5mM MgCl2, and 0.2 μM primers. The amplification program included an initial step at 50°C for 2 min, followed by a second step at 95 °C for 10 min, and 40 cycles of denaturation at 95 °C for 15 s, annealing and extension at 60 °C for 1 min. The relative amount of the tested transcripts was normalized to the amount of human TBP

^'transcript Tor each^" cDNA^* Pniner sequences to amplify TBP, ASKl and TNFAJP3 were the following : TBP-F, AGTGAAGAACAGTCCAGACTG and TBP-R, TGAGCCAGAGTTATTTCCTGGT ; ASKl-F, CCCTGGAAACCCTGCATTTTG and ASK1-R, GAGTCCGAGTTAGTATCACAG ; TNFAJP3-F, CGGGAGATCATCCACAAAGC and TNFAJP3-R, GCGTGTGTCTGTTTCCTTG.

Results of the real-time PCR data were calculated with the previously published _j formu ιla ( mDe τ P_>ret_.er e ₊t aιl., 2 _IΛ0_Λ02_I\) : 2 -,-ΔΔCt = (1+E) -ΔCt gene / , (1+E) -ΔCt reference gene

Cell line differentiation. Culture conditions

T5L cultures were performed in six-well microplates, with RPMI 1640 medium supplemented with 10% fetal calf serum and penicillin-streptomycin. Chemicals and cell treatments

Thioredoxin (TRX 1-104) and NAC were purchased from BD Pharmingen and Sigma-Aldrich, respectively. Troglitazone was obtained from Sankyo Co., LTD.

(Japan). T5L cells were treated with TRX (lμg/ml), NAC (lOmM), or Troglitazone

(lOμM) for 5 to 21 days. Medium was removed every 2 days for the treatment with

NAC and every 7 days for the others.

Oil Red O staining.

Cultures were rinsed with PBS, fixed in 4% formaldehyde, and then stained with oil red O 0.3% (Sigma Aldrich) in isopropanol H2O for 20mn at room temperature, and then rinsed in H2O and stained with hematoxylin for lrnn at room temperature. RESULTS Microarrays

Hybridization on the corresponding arrays (Fig. 1) of differentially labelled tumor and control DNAs allowed us to precisely define the boundaries of amplified regions in each of the 6 tumors analyzed (Fig.2) and to delineate the minimal common regions of amplification where driver genes would be localized. As previously observed in other analyses (Albertson et al., 2000; Fritz et al, 2002), amplicons were often discontinuous for a given tumor. Nevertheless, only two loci were amplified in all tumors. The first locus corresponds to RP3-325F22 and RP1-4K15 overlapping clones in 6q23 band. This locus contains^' coding sequences corresponding to ASKT(MAP3K5), a gene^' involved in ^' the JNK signalling pathway. A more distal locus, corresponding to RP11-35612, was also amplified in all tumors. This locus contains TNFAJP3, a gene which protects cells from TNF-mediated apoptosis. ASKl and TNFAIP3 amplifications were confirmed by FISH on metaphases or frozen sections from the 6 tumors (data not shown).

Real-time PCR

In order to document the overexpression of the candidate genes, we then analyzed by real-time PCR their expression in 1 undifferentiated tumor (Tl) and in a cell line (T5L), established in the laboratory from tumor T5, two samples for which good quality

RNAs were available, in comparison with the well differentiated liposarcoma cell line 93449, a cell line with 12ql4 amplification (Pedeutour et al, 1999). As shown in Table 1, high levels of ASKl mRNA were observed in these two tumors with 6q23 amplification, demonstrating that the amplification of this gene is associated with its overexpression. Overexpression of TNFAIP3 was also observed in both samples, but essentialy in Tl tumor.

Cell line differentiation.

In the JNK-MAPK signalling pathway (Fig. 4), ASKl acts immediately downstream of the TNFR1/TRADD/TRAF2 complex, and upstream of MAP2K4/7 and

JNK (Wang et al., 1996; Ichijo et al, 1997). JNK then phosphorylates different target proteins, leading to the activation of some of them, JUN in particular (Ip et al, 1998) or to the inactivation of others, PPARG in particular by decreasing its sensitivity to its ligands (Shao et al., 1998). It is well demonstrated that PPARG plays a key role in adipogenesis (Barak et al., 1999; Rosen et al., 1999), that its inactivation results in inhibition of adipogenesis (Hu et al., 1996; Adams et al., 1997), and that its activation by synthetic ligand can partially bypass this inhibition in some liposarcoma .cells or patient tumors (Tontonoz et al., 1997; Demetri et al., 1999). Our data suggest that the signalling pathway leading to PPARG inactivation in tumors with 6q23 amplification could act through ASKl/JNK activation. In order to document this hypothesis, we used the T5L cell line, which harbors 12ql4 and 6q23 amplifications, for in vitro experiments. Treatment of this cell line with thioredoxin, a well-known inhibitor of ASKl (Liu H. et al., 2000) led to dramatic modifications of morphology after 6 days, and progressive accumulation of lipids as demonstrated by oil red O staining (fig 3b).

Neither modification of morphology - nor Tipid accumulation ere" observed" when" an^" undifferentiated malignant fibrous histiocytoma cell line was treated with thioredoxin (data not shown). Intense lipid accumulation was also obtained when T5L was treated for 5 days with N-Acetylcysteine (NAC), a molecule which prevents activation of ASKl by reactive oxygen species (Gotoh et al., 1998) (fig 3c). Treatment of the T5L cell line with troglitazone, a synthetic ligand of PPARG (Tontonoz et al., 1997; Demetri et al., 1999), did not modify the morphology of the cells. (fig 3d), suggesting that this treatment could not bypass the differentiation block induced by ASKl overexpression.

CONCLUSION

These data confirm that MFHs with 12ql4-ql5 amplification very likely correspond to undifferentiated liposarcomas, and strongly suggest that, for some of them, the undifferentiation is closely associated with amplification and overexpression of ASKl, a gene localized in 6q23 and encoding a protein which acts upstream of

PPARG, and contributes to its phosphorylation/inactivation. These results are in good agreement with those published (1) by Fritz et al. (2002), which showed that DLK (MAP3K12), an upstream activator of the JNK pathway, is often overexpressed in pleomorphic or dedifferentiated liposarcomas, and (2) by Tontonoz et al. (1997) which demonstrated that synthetic PPARG ligands induce the differentiation of some liposarcoma cell lines. Taken together, all these data show that excessive activation of the ASKl/JNK pathway is a main molecular event associated with liposarcoma undifferentiation. In tumors with 6q23 amplification, the combined overexpression of TNFAJP3 could also play a role in the oncogenic process, by inhibiting the TNF/ASK1- mediated apoptosis in these tumors (Lademann et al., 2001; He et al., 2002). Induction of terminal differentiation represents an interesting therapeutic approach to undifferentiated malignancies. ASKl protein is a relevant target for therapeutic interventions in undifferentiated sarcomas with 6q23 amplification with specific inhibitors, such as thioredoxin and NAC.

Exprimental data in vivo with NAC on mouse model

Xenografts of fresh tumor samples were performed in nude mice, in order to test in vivo the efficiency of N-Acetylcysteine (NAC: C5H9NO3S) treatment on the growth

^• and differentiation of the-tumor cellsrFour series-ofTO xenografts were designed:

- mice without any treatment

- mice with standard chemotherapy (Adriamycin Ifosfamid 60mg/kg)

- mice treated with NAC ( 1 Og/1 in drinking water) - mice treated with NAC and chemotherapy

Efficiency of the treatment was appreciated on the size of the tumors, and on the differentiation status. Preliminary results show a growth inhibition when NAC is associated with chemotherapy, in comparison with untreated and chemotherapy treated tumors (figure 5).

Interference RNA

In vitro inhibition of the ASKl gene (NM_005923) in tumor cell lines was performed using interference RNA. Ohgonucleotides were designed as follows : low GC richness of the corresponding genomic region - GC richness of the ohgonucleotides around 50%

No more than 3 successive G or C nucleotides in the ohgonucleotides Sequences of the nucleotides were : ASKl -SI :UGACAGAGUCGUUUUAGGAdTdT ASKl -AS 1 : UCCUAAAACGACUCUGUCAdCdC Transfection efficiency was tested with oligofectamine and lipofectamine, with an

FITC control oligonucleotide. A very high efficiency was observed with both transfection systems (around 100% of the cells).

Transfection was then performed with the ASKl ohgonucleotides. RNAs and proteins were extracted at 24, 48 and 72h, and quantified by real-time PCR and western blotting, respectively. When compared with the untreated cells, ASKl expression levels inNAC-treated cells were 50%, 80%, and 80% at 24, 48 and 72h, respectively.

FIGURES and TABLE

Fig 1 . Representative hybridization image of the CGH-array.

Fig 2 . Results of CGH experiments

Bottom panel: the 59 clones that define the region of copy number aberrations are indicated. The filled squares correspond to amplification at a given locus (normalized copy number ratios>1.5). Copy number ratios observed at each locus in the critical region are indicated for each tumor (top panel).

Fig 3. Differentiation of the T5L-cell-line-. -

(a)Untreated cell line, (b) Cell culture was treated by lμg/ml of thioredoxin for 6 days. Accumulation of lipids is demonstrated by a strong positivity of the cytoplasmic droplets after oil red O staining. Similar results were obtained after a 5 days treatment with NAC lOmM (c). Treatment of T5L cell line with lOμM Troglitazone for 21 days did not lead to any induction of differentiation (d).

Fig 4. Schematic presentation of the TNFRl/JNK pathway.

Fig 5. Efficiency of NAC treatment on the growth and differentiation of the tumor cells

Table 1. Real-time PCR results.

number, by comparison with the control well-differentiated liposarcoma 449 cell line, and are normalized for the TBP transcripts.

ASKl activates the JNK pathway, through MAP2K4/7 phosphorylation, leading to inactivation of PPARG and adipocyte undifferentiation. Thioredoxin-ASKl interaction blocks ASKl activation. REFERENCES

Adams M, Reginato MJ, Shao D, Lazar MA, Chatterjee NK. 1997. Transcriptional activation by peroxisome proliferator-activated receptor gamma is inhibited by phosphorylation at a consensus mitogen-activated protein kinase site. J Biol Chem 272: 5128-5132. Albertson DG, Ylstra B, Segraves R, Collins C, Dairkee SH, Kowbel D, Kuo WL, Gray JW, Pinkel D. 2000. Quantitative mapping of amplicon structure by array CGH identifies CYP24 as a candidate oncogene.Νat Genet 25:144-146 Barak Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien KR, Koder A, Evans RM. 1999. PPAR gamma is required for placental, cardiac, and adipose tissue development. Mol Cell 4: 585-595. Demetri GD, Fletcher CD, Mueller E, Sarraf P, Naujoks R, Campbell N, Spiegelman BM, Singer S. 1999. Induction of solid tumor differentiation by the peroxisome proliferator- activated receptor-gamma ligand troglitazone in patients with liposarcoma. Proc Natl

Acad Sci U S A 96: 3951-3956. De Prefer K, Speleman F, Combaret V, Lunec J, Laureys G, Eussen BH, Francotte N, Board ^• J, Pearson AD, De Paepe A, Van Roy N, Nandesompele J. 2002. Quantification of MYCΝ, DDX1, and NAG gene copy number in neuroblastoma using a real-time quantitative PCR assay. Mod Pathol 15 : 159- 166.

Derre J, Lagace R, Nicolas A, Mairal A, Chibon F, Coindre JM, Terrier P, Sastre X, Aurias A. 2001. Leiomyosarcomas and most malignant fibrous histiocytomas share very similar comparative genomic hybridization imbalances: an analysis of a series of 27 leiomyosarcomas. Lab Invest 81: 211-215. Fletcher CD, Gustafson P, Rydholm A, Willen H, Akerman M. Clinicopathologic re- evaluation of 100 malignant fibrous histiocytomas: Prognostic relevance of subclassification. J.Clin Oncol 2001; 19:3045-50.

Fritz B, Schubert F, Wrobel G, Schwaenen C, Wessendorf S, Nessling M, Korz C, Rieker RJ, Montgomery K, Kucherlapati R, Mechtersheimer G, Eils R, Joos S, Lichter P. 2002.

Microarray-based copy number and expression profiling in dedifferentiated and pleomorphic liposarcoma. Cancer Res 62: 2993-2998.

Gotoh Y and Cooper JA. 1998. Reactive oxygen species- and dimerization-induced activation of apoptosis signal-regulating kinase 1 in tumor necrosis factor-alpha signal transduction. J Biol Chem 273: 17477-17482.

He KL and Ting AT. 2002. A20 inhibits tumor necrosis factor (TNF) alpha-induced apoptosis by disrupting recruitment of TRADD and RIP to the TNF receptor 1 complex in Jurkat T cells. Mol Cell Biol 22: 6034-6045. Hu E, Kim JB, Sarraf P, Spiegelman BM. 1996. rnhibition of adipogenesis through MAP kinase-mediated phosphorylation of PPARgarnma. Science 274: 2100-2103.

Ichijo H, Nishida E, e K, ten Dijke P, Saitoh M, Moriguchi T, Takagi M, Matsumoto K, Miyazono K, Gotoh Y. 1997. Induction of apoptosis by ASKl, a mammalian MAPKKK that activates SAPK JNK and p38 signaling pathways. Science 275: 90-94. Ip YT and Davis RJ. 1998. Signal transduction by the c-Jun N-terminal kinase (JNK)~from inflammation to development. Curr Opin Cell Biol 10: 205-219.

Lademann U, Kdlunki T, Jaattela M. 2001. A20 zinc finger protein inhibits TNF-induced apoptosis and stress response early in the signaling cascades and independently of binding to TRAF2 or 14-3-3 proteins. Cell Death Differ 3: 265-272.

Liu H, Nishitoh H, Ichijo H, Kyriakis JM. 2000. Activation of apoptosis signal-regulating kinase 1 (ASKl) by tumor necrosis factor receptor-associated factor 2 requires prior dissociation of the ASKl inhibitor thioredoxin. Mol Cell Biol 6: 2198-2208. Liu, B and Fan, Z. The monoclonal antibody 225 activates caspase-8 and induces apoptosis through a tumor necrosis factor recdeptor family-independent pathway. Oncogene 2001, 20 : 3726-34.

Mairal A, Terrier P, Chibon F, Sastre X, Lecesne A, Aurias A. 1999. Loss of chromosome 13 is the most frequent genomic imbalance in malignant fibrous histiocytomas. Cancer

Genet Cytogenet 111: 134-138.

Pedeutour F, Forus A, Coindre JM, Berner JM, Nicolo G, Michiels JF, Terrier P, Ranchere-

Nince D, Colhn F, Myklebost O, Turc-Carel C. 1999. Structure of the supernumerary ring and giant rod chromosomes in adipose tissue tumors. Genes Chromosomes Cancer 24:30-41.

Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, Spiegelman BM, Mortensen RM. 1999. PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro. Mol Cell 4: 611-617. Shao D, Rangwala SM, Bailey ST, Krakow SL, Reginato MJ, Lazar MA. 1998. Interdomain communication regulating ligand binding by PPAR-gamma. Nature 396: 377-380.

Tontonoz P, Singer S, Forman BM, Sarraf P, Fletcher JA, Fletcher CD, Brun RP, Mueller E, Altiok S, Oppenheim H, Evans RM, Spiegelman BM. 1997. Terminal differentiation of human liposarcoma cells induced by ligands for peroxisome proliferator-activated receptor gamma and the retinoid X receptor. Proc Natl Acad Sci U S A 94: 237-241. Wang XS, Diener K, Jannuzzi D, Trollinger D, Tan TH, Lichenstein H, Zukowski M, Yao Z. 1996. Molecular cloning and characterization of a novel protein kinase with a catalytic domain homologous to mitogen-activated protein kinase kinase kinase. J Biol Chem 271: 31607-31611.

Claims

1. Use of inhibitors. of compounds involved in the JUN kinase (JNK) biochemical: cellular pathway, or of inhibitors of the cellular biosynthesis of said compounds, for the manufacture of a medicament for the treatment of pathologies wherein cell differentiation is irjhibited as a result of an overexpression of the ASKl kinase or of the c-JUN protein in cells which become undifferentiated and undergo division and proliferation.

2. Use of inhibitors according to claim 1, for the manufacture of a medicament for the treatment of cancers wherein the ASKl kinase or the- c-JUN "protein ' are ^■ overexpressed in the cells.

3. Use of inhibitors according to claim 1 or 2, for the manufacture of a medicament for the treatment of malignant fibriohistiocytomes (MFH) .

4. Use of inhibitors according to anyone of claims 1 to 3, for the manufacture of a medicament for the treatment of liposarcomes.

5. Use according to anyone of claims 1 to 4, wherein the inhibitor of compounds involved in the JNK biochemical cellular pathway, is an inhibitor of ASKl, or of the cellular biosynthesis of ASKl .

6. Use according to anyone of claims 1 to 5, wherein the irihibitor of ASKl is a direct irihibitor chosen among molecules inhibiting the enzymatic activity of ASKl, such as thioredoxin, or fragments or analogs thereof.

7. Use according to anyone of claims 1 to 5, wherein the inhibitor of ASKl is an indirect inhibitor, such as N-acetylcysteine complexing the ASKl activating free radicals.

8. Use according to anyone of claims 1 to 5, wherein the inhibitors of the cellular biosynthesis of ASKl are selected in a group comprising antisense sequences hybridizing with the mRNA encoding ASKl corresponding to the ADNc represented by SEQ ID NO : 1, and ohgonucleotides derived from the mRNA encoding ASKl and degrading said mRNA by RNA interference.

9. Use according to claim 8, wherein the inhibitor consists in at least two mRNA encoding ASKl interference ohgonucleotides of 15 to 25 nucleotides derived from the mRNA encoding ASKl corresponding to the ADNc represented by SEQ ID NO : 1.

10. Use according to claim 8 or 9, of two mRNA encoding ASKl interference ohgonucleotides corresponding to the following sequences : ASK1-S1 : UGACAGAGUCGUUUUAGGAdTdT SEQ ID NO : 2

ASKl-ASf : UCCUAAAAGGACUCUGUCAdCdC ' SEQTD NO : 3

11. Use according to anyone of claims 1 to 4, of mhibitors of the TNFα receptors for the manufacture of a medicament for the treatment of pathologies wherein the ASKl kinase or the c-JUN protein are overexpressed in the cells.

12. Use according to claim 11, wherein the inhibitor is the monoclonal antibody MAB225 directed against the TNFα receptor 1 (TNFR1), such as described in [8].

13. Use according to anyone of claims 1 to 4, of inhibitors of c-JUN, or of inhibitors of the cellular biosynthesis of c-JUN, for the manufacture of a medicament for the treatment of pathologies wherein the c-JUN protein is overexpressed in the cells.

14. Method for the screening of molecules candidate as a drug for the treatment of pathologies mentioned in claims 1 to 4, said method comprising :

- contacting a molecule to be tested with ASKl, or other MAP kinases implicated in the JNK cellular pathway,

15. Method for the screening of molecules candidate as a drug for the treatment of pathologies mentioned in claims 1 to 4, said method comprising :

- contacting a molecule to be tested with c-JUN, - detecting an interaction between said molecule and ASKl, or other MAP kinases implicated in the JNK cellular pathway, by measuring the loss of enzymatic property of said kinases.

16. Method for the screening of molecules candidate as a drug for the treatment of pathologies mentioned in claims 1 to 4, said method comprising :

- contacting a molecule to be tested with TNFα receptors,

- detecting an interaction between said molecule and TNFα receptors.

17. Method for the screening of molecules candidate as a drug for the treatment of pathologies mentioned nr claims 1 to 4, said method comprising :

- contacting a molecule to be tested with cells overexpressing ASKl and/or c- JUN,

- detecting the inhibition of the division of said cells and their passage from an undifferentiated state without production of fat, to a differentiated state with production of fat in said cells.

18. Method according to claim 17, wherein said undifferentiated tumoral cells overexpressing ASKl are chosen among those deposited at the Centre National de Cultures de Micro-Organismes (CNCM) of INSTITUT PASTEUR, Paris, on June 11

2002, under the number 1-2882, and on September 2, 2003, under the number 1-3077.

19. Method for the in vitro diagnosis of pathologies mentioned in claims 1 to 4, said method comprising : - contacting a biological sample from a patient suspected to suffer from said pathologies with a compound capable of binding with ASKl and/or c-JUN in conditions such that the formation of a complex between said compound and ASKl or c-JUN can occur,

- detecting said complex, and comparing the amount of said complex with the amount of said complex which is detected in a biological sample from an healthy person.

20. Method for the in vitro diagnosis according to claim 19, characterized in that the compound used for the detection of ASKl or c-JUN are antibodies against these proteins, these antibodies being if necessary labeled, for example radiolabeled or by florescence.

21. Cells overexpressing ASKl such as deposited at the Centre National de Cultures de Micro-Organismes (CNCM) of INSTITUT PASTEUR, Paris, on June 11 2002, under the number 1-2882, and on September 2, 2003, under the number 1-3077.