WO2004018516A1 - Regulation of human secretin-type gpcr (latrophilin) - Google Patents

Regulation of human secretin-type gpcr (latrophilin) Download PDF

Info

Publication number
WO2004018516A1
WO2004018516A1 PCT/EP2003/009157 EP0309157W WO2004018516A1 WO 2004018516 A1 WO2004018516 A1 WO 2004018516A1 EP 0309157 W EP0309157 W EP 0309157W WO 2004018516 A1 WO2004018516 A1 WO 2004018516A1
Authority
WO
WIPO (PCT)
Prior art keywords
latrophilin
secretin
type gpcr
polypeptide
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2003/009157
Other languages
French (fr)
Inventor
Alex Smolyar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer AG
Original Assignee
Bayer Healthcare AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Healthcare AG filed Critical Bayer Healthcare AG
Priority to AU2003255459A priority Critical patent/AU2003255459A1/en
Publication of WO2004018516A1 publication Critical patent/WO2004018516A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor

Definitions

  • the invention relates to the regulation of human secretin-type GPCR (latrophilin).
  • GPCR G-protein coupled receptors
  • GPCRs include receptors for such diverse agents as dopamine, calcitonin, adrenergic hormones, endoftielin, cAMP, adenosine, acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1, rhodopsins, odorants, cytomegalovirus, G-proteins themselves, effector proteins such as phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator protems such as protein kinase A and protein kinase C.
  • GPCRs possess seven conserved membrane-spanning domains connecting at least eight divergent hydrophilic loops. GPCRs (also known as 7TM receptors) have been characterized as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. Most GPCRs have single conserved cysteine residues in each of the first two extracellular loops, which form disulfide bonds that are believed to stabilize functional protein structure. The seven transmembrane regions are designated as TM1, TM2, TM3,
  • TM4 has been implicated in signal transduction.
  • Phosphorylation and lipidation (palmitylation or farnesylation) of cysteine residues can influence signal transduction of some GPCRs.
  • Most GPCRs contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus.
  • GPCRs such as the ⁇ -adrenergic receptor, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization.
  • the ligand binding sites of GPCRs are believed to comprise hydrophilic sockets formed by several GPCR transmembrane domains.
  • the hydrophilic sockets are surrounded by hydrophobic residues of the GPCRs.
  • the hydrophilic side of each GPCR transmembrane helix is postulated to face inward and form a polar ligand binding site.
  • TM3 has been implicated in several GPCRs as having a ligand binding site, such as the TM3 aspartate residue.
  • TM5 serines, a TM6 asparagine, and TM6 or TM7 phenylalanines or tyrosines also are implicated in ligand binding.
  • GPCRs are coupled inside the cell by heterotrimeric G-proteins to various intracellular enzymes, ion channels, and transporters (see Johnson et al., Endoc. Rev. 10, 317-331, 1989).
  • Different G-protein alpha-subunits preferentially stimulate particular effectors to modulate various biological functions in a cell.
  • Phosphorylation of cytoplasmic residues of GPCRs is an important mechanism for the regulation of some GPCRs.
  • the effect of hormone binding is the activation inside the cell of the enzyme, adenylate cyclase.
  • Enzyme activation by hormones is dependent on the presence of the nucleotide GTP.
  • GTP also influences hormone binding.
  • a G-protein connects the hormone receptor to adenylate cyclase. G-protein exchanges GTP for bound GDP when activated by a hormone receptor. The GTP-carrying form then binds to activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form.
  • the G-protein serves a dual role, as an mtermediate that relays the signal from receptor to effector, and as a clock that controls the duration ofthe signal.
  • GPCRs which can play a role in preventing, ameliorating, or correcting dysfunctions or diseases including, but not limited to, infections such as bacterial, fungal, protozoan, and viral infections, particularly those caused by HIV viruses, pain, cancers, anorexia, bulimia, asthma, Parkinson's diseases, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, several mental retardation, and dyskinesias, such as Huntington's disease and Tourett's syndrome.
  • infections such as bacterial, fungal, protozoan, and viral infections
  • infections such as bacterial, fungal, protozoan, and viral infections
  • infections such as bacterial, fungal, protozoan, and viral infections
  • infections such as bacterial, fungal, protozoan, and viral infections
  • Alpha-latrotoxin a neurotoxic protein contained in black widow spider venom, stimulates a robust release of neurotransmitters and the subsequent degeneration ofthe affected nerve terminals. This effect is mediated by ALX binding to a G protein-coupled receptor called latrophilin (Ichtchenko et al., J. Biol. Chem. 274, 5491-98, 1999; Rahman et al, Philos. Trans. R. Soc. Lond. B Biol. Sci. 28, 39- 86, 1999). Because of the dramatic effect of ALX on exocytosis, there is a need in the art to identify additional members of the latrophilin receptor family whose activity can be regulated to provide therapeutic effects.
  • Secretin a hormone from the duodenum, is a heptacosipeptide of the formula: H-His-Ser-Asp-Gly-Thr-Phe-Thr-Ser-Glu-Leu-Ser-Arg-Leu-Arg-Asp-Ser-Ala-Arg-L eu-Gln-Arg-Leu-Leu-Gln-Gly-Leu-Val-NH .
  • Secretin stimulates the pancreatic secretion of water and bicarbonate.
  • secretin stimulates pepsin secretion, stimulates the pyloric sphincter, inhibits gastrin-stimulated acid secretion, inhibits food-stimulated gastrin release, and inhibits motility.
  • secretin promises to be a good medicament for gastrointestinal disorders, such as, for example, for lesions in the gastrointestinal tract.
  • Secretin also stimulates cyclic AMP formation in the brain. Fremeau et al, J. Neurochem. 46, 1947-55, 1986.
  • Fig. 1 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin) Polypeptide (SEQ ID NO:l).
  • Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of Fig.l
  • FIG. 3 shows the DNA-sequence encoding the secretin-type GPCR (Latrophilin)
  • Fig. 4 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
  • Fig. 5 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
  • Fig. 6 shows • the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
  • Fig. 7 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin) Polypeptide (SEQ ID NO:7).
  • Fig. 8 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
  • Fig. 9 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
  • Fig. 10 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
  • Fig. 11 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
  • Fig. 12 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin) Polypeptide (SEQ ID NO: 12).
  • Fig. 13 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
  • the invention relates to an isolated polynucleotide from the group consisting of:
  • amino acid sequences which are at least about 95% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
  • the protein of the invention is a novel human secretin-type GPCR (latrophilin).
  • Human secretin-type GPCR comprises the amino acid sequence shown in SEQ ID NO:2.
  • a coding sequence for human secretin-type GPCR is shown in SEQ ID NO:l. This sequence is located on chromosome 4pl5.2.
  • Related mouse ESTs (SEQ ID NOS:4-13) are expressed in neuroblastoma cells, retino- blastoma, teratocarcinoma, adenocarcinoma cell line, renal cell adenocarcinoma, melanotic melanoma, glioblastoma primitive neuroectoderm, and amygdala.
  • the protein of SEQ ID NO:2 is a 7 transmembrane receptor (secretin family) region, latrophilin/CL-1-like GPS (GPCR proteolysis site) domain and hormone receptor domain regions are identified.
  • the hormone receptor domain has a weak score but the four conserved cysteines, that probably form disulphide bridges, are present.
  • the disulfide bridge domain is found in a variety of hormone receptors. Additionally,
  • SEQ ID NO:2 has an immunoglobulin domain on its N-terminus.
  • Human secretin-type GPCR (latrophilin) ofthe invention is expected to be useful for the same purposes as previously identified secretin-type (latrophilin) GPCRs.
  • Human secretin-type GPCR (latrophilin) is believed to be useful in therapeutic methods to treat disorders such as obesity, cardiovascular disorders, dermatological disorders, endocrine and hormonal disorders, metabolic disorders, including diabetes, cancer, hematological disorders, gastrointestinal and liver disorders, neurological disorders, respiratory disorders, reproductive disorders, and genitourinary disorders.
  • Human secretin-type GPCR (latrophilin) also can be used to screen for human secretin-type GPCR (latrophilin) activators and inhibitors.
  • One embodiment of the present invention is an expression vector containing any polynucleotide ofthe present invention.
  • Yet another embodiment of the present invention is a host cell containing any expression vector of he present invention.
  • Still another embodiment ofthe present invention is a substantially purified Secretin- type GPCR (Latrophilin) polypeptide encoded by any polynucleotide of the present invention.
  • Yet another embodiment of the present invention is a method of producing a Secretin-type GPCR (Latrophilin) polypeptide of the present invention, wherein the method comprises the following steps:
  • Yet another embodiment of the present invention is a method for detecting a polynucleotide encoding a Secretin-type GPCR (Latrophilin) polypeptide in a biological sample comprising the following steps:
  • Still another embodiment of the present invention is a method for detecting a poly- nucleotide of the present invention or a Secretin-type GPCR (Latropliilin) polypeptide ofthe present invention comprising the steps of:
  • a contacting a biological sample with a reagent which specifically interacts with the polynucleotide or the Secretin-type GPCR (Latrophilin) polypeptide and b. detecting the interaction
  • Yet another embodiment of the present invention is a diagnostic kit for conducting any method ofthe present invention.
  • Yet another embodiment ofthe present invention is a method of screening for agents which decrease the activity of a Secretin-type GPCR (Latrophilin), comprising the steps of:
  • Still another embodiment ofthe present invention is a method of screening for agents which regulate the activity of a Secretin-type GPCR (Latrophilin), comprising the steps of:
  • a test compound contacting a test compound with a Secretin-type GPCR (Latrophilin) polypeptide encoded by any polynucleotide ofthe present invention; and b. detecting a Secretin-type GPCR (Latrophilin) activity of the polypeptide, wherein a test compound which increases the Secretin-type GPCR (Latrophilin) activity is identified as a potential therapeutic agent for increasing the activity ofthe Secretin-type GPCR (Latrophilin), and wherein a test compound which decreases the Secretin-type GPCR (Latrophilin) activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity ofthe Secretin-type GPCR (Latrophilin).
  • a test compound which increases the Secretin-type GPCR (Latrophilin) activity is identified as a potential therapeutic agent for increasing the activity ofthe Secretin-type GPCR (Latrophilin)
  • a test compound which decreases the Secretin-type GPCR (Latrophilin) activity of the polypeptide is identified as
  • Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a Secretin-type GPCR (Latrophilin), comprising the step of:
  • test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of Secretin-type GPCR (Latrophilin).
  • Yet another embodiment ofthe present invention is a method of reducing the activity of a Secretin-type GPCR (Latrophilin), comprising the step of:
  • a reagent which specifically binds to any polynucleotide ofthe present invention or any Secretin-type GPCR (Latrophilin) polypeptide ofthe present invention, whereby the activity of Secretin-type GPCR (Latrophilin) is reduced.
  • Still another embodiment of the present invention is a reagent that modulates the activity of a Secretin-type GPCR (Latrophilin) polypeptide or a polynucleotide wherein said reagent is identified by any methods ofthe present invention.
  • composition comprising:
  • an expression vector of the present invention or a reagent of the present invention and a pharmaceutically acceptable carrier is provided.
  • Yet another embodiment ofthe present invention is the use of an expression vector of the present invention or a reagent ofthe present invention for modulating the activity of a Secretin-type GPCR (Latrophilin) in a disease, preferably obesity, a cardiovascular disorder, a dermatological disorder, an endocrine and hormonal disorder, a metabolic disorder, including diabetes, cancer, a gastrointestinal and liver disorder, a hematological disorder, a neurological disorder, a respiratory disorder, a reproductive disorder or a genitourinary disorder.
  • a Secretin-type GPCR preferably obesity, a cardiovascular disorder, a dermatological disorder, an endocrine and hormonal disorder, a metabolic disorder, including diabetes, cancer, a gastrointestinal and liver disorder, a hematological disorder, a neurological disorder, a respiratory disorder, a reproductive disorder or a genitourinary disorder.
  • the invention thus provides a human secretin-type GPCR (latrophilin) that can be used to identify test compounds that may act, for example, as activators or inhibitors.
  • latrophilin human secretin-type GPCR
  • Human secretin-type GPCR (latrophilin) and fragments thereof also are useful in raising specific antibodies that can block the protein's functional activity.
  • Human secretin-type GPCR (latrophilin) polypeptides according to the invention comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 500, 600, 700, 800, 900, 1000, or 1076 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO. -2 or a biologically active variant thereof, as defined below.
  • a secretin-type GPCR (latrophilin) polypeptides comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 500, 600, 700, 800, 900, 1000, or 1076 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO. -2 or a biologically active variant thereof, as defined below.
  • (latrophilin) polypeptide ofthe invention therefore can be a portion of a secretin-type GPCR (latrophilin) protein, a full-length secretin-type GPCR (latrophilin) protein, or a fusion protein comprising all or a portion of a secretin-type GPCR (latrophilin) protem.
  • Human secretin-type GPCR (latrophilin) polypeptide variants which are biologically active, e.g., retain an enzymatic activity, also are human secretin-type GPCR (latrophilin) polypeptides.
  • human secretin-type GPCR (latrophilin) polypeptide variants Preferably, naturally or non-naturally occurring human secretin-type GPCR (latrophilin) polypeptide variants have amino acid sequences which are at least about 95, 96, or 98% identical to the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof. Percent identity between a putative human secretin-type GPCR (latrophilin) polypeptide variant and an amino acid sequence of SEQ ID NO:2 is determined by conventional methods. See, for example, Altschul et al, Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl Acad.
  • the "FASTA" similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant.
  • the FASTA algorithm is described by Pearson & Lipman, Proc. Nat'l Acad. Sci. USA 55:2444(1988), and by Pearson, Meth.
  • FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above.
  • the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
  • % identity of a first sequence towards a second sequence means the % identity which is calculated as follows: First the optimal global alignment between the two sequences is determined with the CLUSTALW algorithm [Thomson JD, Higgins DG, Gibson TJ. 1994. ClustalW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22:
  • Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
  • Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a human secretin-type GPCR (latrophilin) polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
  • the invention additionally, encompasses secretin-type GPCR (latrophilin) polypeptides that are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications can be carried out by known techniques including, but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH , acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
  • secretin-type GPCR latrophilin
  • Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression.
  • the secretin-type GPCR (latrophilin) polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation ofthe protein.
  • the invention also provides chemically modified derivatives of secretin-type GPCR
  • the chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol, and the like.
  • the polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
  • Whether an amino acid change or a polypeptide modification results in a biologically active secretin-type GPCR (latrophilin) polypeptide can readily be determined by assaying for functional activity, as described for example, in the specific examples, below.
  • Fusion proteins are useful for generating antibodies against secretin-type GPCR (latrophilin) polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a human secretin-type GPCR (latrophilin) polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
  • a human secretin-type GPCR (latrophilin) polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
  • the first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 500, 600, 700, 800, 900, 1000, or 1076 contiguous amino acids of SEQ ID NO:2 or of a biologically active variant, such as those described above.
  • the first polypeptide segment also can comprise full-length secretin-type GPCR (latrophilin) protein.
  • the second polypeptide segment can be a full-length protein or a protein fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV- G tags, and thioredoxin (Trx) tags.
  • Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4
  • a fusion protein also can be engineered to contain a cleavage site located between the secretin-type GPCR (latrophilin) polypeptide-encoding sequence and the heterologous protein sequence, so that the secretin-type GPCR (latrophilin) polypeptide can be cleaved and purified away from the heterologous moiety.
  • a fusion protein can be synthesized chemically, as is known in the art.
  • a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
  • Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO:l in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
  • kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WT), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA- KITS).
  • Species homologs of human secretin-type GPCR (latrophilin) polypeptide can be obtained using secretin-type GPCR (latrophilin) polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of secretin-type GPCR (latrophilin) polypeptide, and expressing the cDNAs as is known in the art.
  • a human secretin-type GPCR (latrophilin) polynucleotide can be single- or double- stranded and comprises a coding sequence or the complement of a coding sequence for a secretin-type GPCR (latrophilin) polypeptide.
  • a coding sequence for human secretin-type GPCR (latrophilin) is shown in SEQ ID NO:l.
  • cDNA Complementary DNA
  • latrophilin secretin-type GPCR
  • latrophilin secretin-type GPCR
  • Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO:
  • amino acids NO:l or its complement also are secretin-type GPCR (latrophilin) polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
  • secretin-type GPCR latrophilin
  • Variants and homologs of the secretin-type GPCR (latrophilin) polynucleotides described above also are secretin-type GPCR (latrophilin) polynucleotides.
  • homologous secretin-type GPCR (latrophilin) polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known secretin- type GPCR (latrophilin) polynucleotides under stringent conditions, as is known in the art.
  • homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
  • Species homologs of the secretin-type GPCR (latrophilin) polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
  • Human variants of secretin-type GPCR (latrophilin) polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81, 123 (1973).
  • Variants of human secretin-type GPCR (latrophilin) polynucleotides or secretin-type GPCR (latrophilin) polynucleotides of other species can therefore be identified by hybridizing a putative homologous secretin-type GPCR (latrophilin) polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:l or the complement thereof to form a test hybrid.
  • the melting temperature ofthe test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
  • Nucleotide sequences which hybridize to secretin-type GPCR (latrophilin) polynucleotides or their complements following stringent hybridization and/or wash conditions also are secretin-type GPCR (latrophilin) polynucleotides.
  • Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
  • T m a combination of temperature and salt concentration should be chosen that is approximately 12-20 °C below the calculated T m of the hybrid under study.
  • nucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
  • Stringent wash conditions include, for example, 4X SSC at 65 °C, or 50% formamide, 4X SSC at 42 °C, or 0.5X SSC, 0.1% SDS at 65 °C.
  • Highly stringent wash conditions include, for example, 0.2X SSC at 65 °C.
  • a human secretin-type GPCR (latrophilin) polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated secretin-type GPCR
  • polynucleotide polynucleotides.
  • restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise secretin-type GPCR (latrophilin) nucleotide sequences. Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90%) free of other molecules.
  • Human secretin-type GPCR (latrophilin) cDNA molecules can be made with standard molecular biology techniques, using secretin-type GPCR (latrophilin) mRNA as a template. Human secretin-type GPCR (latrophilin) cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
  • the partial sequence disclosed herein can be used to identify the corresponding full- length gene from which it was derived.
  • the partial sequence can be nick-translated or end-labeled with 32 P using polynucleotide kinase using labeling methods known to those with skill in the art (BASIC METHODS IN MOLECULAR BIOLOGY, Davis et al, eds., Elsevier Press, N.Y., 1986).
  • a lambda library prepared from human tissue can be directly screened with the labeled sequences of interest or the library can be converted en masse to pBluescript (Stratagene Cloning Systems, La Jolla, Calif. 92037) to facilitate bacterial colony screening (see Sambrook et al, MOLECULAR
  • filters with bacterial colonies containing the library in pBluescript or bacterial lawns containing lambda plaques are denatured, and the DNA is fixed to the filters.
  • the filters are hybridized with the labeled probe using hybridization conditions described by Davis et al, 1986.
  • the partial sequences, cloned into lambda or pBluescript can be used as positive controls to assess background binding and to adjust the hybridization and washing stringencies necessary for accurate clone identification.
  • the resulting auto- radiograms are compared to duplicate plates of colonies or plaques; each exposed spot corresponds to a positive colony or plaque.
  • the colonies or plaques are selected, expanded and the DNA is isolated from the colonies for further analysis and sequencing.
  • Positive cDNA clones are analyzed to determine the amount of additional sequence they contain using PCR with one primer from the partial sequence and the other primer from the vector.
  • Clones with a larger vector-insert PCR product than the original partial sequence are analyzed by restriction digestion and DNA sequencing to determine whether they contain an insert ofthe same size or similar as the mRNA size determined from Northern blot Analysis.
  • the complete sequence of the clones can be determined, for example after exonuclease III digestion (McCombie et al, Methods 3, 33-40, 1991).
  • a series of deletion clones are generated, each of which is sequenced. The resulting overlapping sequences are assembled into a single contiguous sequence of high redundancy (usually three to five overlapping sequences at each nucleotide position), resulting in a highly accurate final sequence.
  • PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
  • restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
  • Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988).
  • Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Madison, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72 °C.
  • the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
  • capture PCR involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods Applic. 1, 111-119, 1991).
  • multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment ofthe DNA molecule before performing PCR.
  • Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.
  • capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products.
  • capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) that are laser activated, and detection of the emitted wavelengths by a charge coupled device camera.
  • Output/light intensity can be converted to electrical signal using appropriate software ⁇ e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled.
  • Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA that might be present in limited amounts in a particular sample.
  • Human secretin-type GPCR (latrophilin) polypeptides can be obtained, for example, by purification from human cells, by expression of secretin-type GPCR (latrophilin) polynucleotides, or by direct chemical synthesis.
  • Human secretin-type GPCR (latrophilin) polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with secretin-type GPCR (latrophilin) polynucleotides.
  • a purified secretin-type GPCR (latrophilin) polypeptide is separated from other compounds that normally associate with the secretin-type GPCR (latrophilin) polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
  • Human secretin-type GPCR (latrophilin) polypeptide can be conveniently isolated as a complex with its associated G protein, as described in the specific examples, below.
  • a preparation of purified secretin-type GPCR (latrophilin) polypeptides is at least 80%) pure; preferably, the preparations are 90%), 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS- polyacrylamide gel electrophoresis.
  • the poly- nucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well l ⁇ iown to those skilled in the art can be used to construct expression vectors containing sequences encoding secretin-type GPCR (latrophilin) polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in
  • a variety of expression vector/host systems can be utilized to contain and express sequences encoding a human secretin-type GPCR (latrophilin) polypeptide.
  • These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors ⁇ e.g., baculovirus), plant cell systems transformed with virus expression vectors ⁇ e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus,
  • TMV TMV
  • bacterial expression vectors ⁇ e.g., Ti or pBR322 plasmids
  • animal cell systems e.g., TMV, TMV, TMV, TMV, or with bacterial expression vectors ⁇ e.g., Ti or pBR322 plasmids), or animal cell systems.
  • control elements or regulatory sequences are those non-translated regions of the vector ⁇ enhancers, promoters, 5' and 3' untranslated regions — which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the
  • BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life kits).
  • the baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells
  • vectors ⁇ e.g., heat shock, RUBISCO, and storage protein genes
  • plant viruses ⁇ e.g., viral promoters or leader sequences
  • promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a human secretin-type GPCR (latrophilin) polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
  • latrophilin human secretin-type GPCR
  • a number of expression vectors can be selected depending upon the use intended for the secretin-type GPCR (latrophilin) polypeptide.
  • vectors which direct high level expression of fusion proteins that are readily purified can be used.
  • vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene).
  • a sequence encoding the secretin-type GPCR (latrophilin) polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ⁇ -galactosidase so that a hybrid protein is produced.
  • pIN vectors Van Heeke & Schuster, J. Biol. Chem. 264, 5503-5509, 1989
  • pGEX vectors Promega, Madison, Wis.
  • GST glutathione S-transferase
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
  • yeast Saccharomyces cerevisiae a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used.
  • constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH.
  • sequences encoding secretin- type GPCR (latrophilin) polypeptides can be driven by any of a number of promoters.
  • viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987).
  • plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671-1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Probl Cell Differ. 17, 85-105, 1991).
  • constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection.
  • pathogen-mediated transfection Such techniques are described in a number of generally available reviews ⁇ e.g., Hobbs or Murray, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).
  • An insect system also can be used to express a human secretin-type GPCR (latrophilin) polypeptide.
  • a human secretin-type GPCR (latrophilin) polypeptide for example, in one such system Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding secretin- type GPCR (latrophilin) polypeptides can be cloned into a non-essential region ofthe virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of secretin-type GPCR (latrophilin) polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
  • AcNPV Autographa californica nuclear polyhedrosis virus
  • the recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which secretin-type GPCR (latrophilin) polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
  • secretin-type GPCR latrophilin
  • a number of viral-based expression systems can be used to express secretin-type
  • GPCR (latrophilin) polypeptides in mammalian host cells are used as an expression vector.
  • sequences encoding secretin-type GPCR (latrophilin) polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region ofthe viral genome can be used to obtain a viable virus which is capable of expressing a human secretin-type GPCR (latrophilin) polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984).
  • transcription enhancers such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.
  • RSV Rous sarcoma virus
  • HACs Human artificial chromosomes
  • 6M to 10M are constructed and delivered to cells via conventional delivery methods ⁇ e.g., liposomes, polycationic amino polymers, or vesicles).
  • Specific initiation signals also can be used to achieve more efficient translation of sequences encoding secretin-type GPCR (latrophilin) polypeptides.
  • Such signals include the ATG initiation codon and adjacent sequences.
  • sequences encoding a human secretin-type GPCR (latrophilin) polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed.
  • exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert.
  • Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic.
  • the efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al, Results Probl. Cell Differ. 20, 125-162, 1994).
  • enhancers which are appropriate for the particular cell system which is used (see Scharf et al, Results Probl. Cell Differ. 20, 125-162, 1994).
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed secretin-type GPCR (latrophilin) poly- peptide in the desired fashion.
  • modifications ofthe polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
  • Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities ⁇ e.g. , CHO, HeLa, MDCK, HEK293, and
  • WI38 are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing ofthe foreign protein.
  • Stable expression is preferred for long-term, high-yield production of recombinant proteins.
  • cell lines which stably express secretin-type GPCR (latrophilin) polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the intro- duction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium.
  • the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced secretin-type GPCR (latrophilin) sequences.
  • Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.
  • herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosyl ⁇ ransferase (Lowy et al, Cell 22, 817-23, 1980) genes that can be employed in tk ⁇ or aprf cells, respectively.
  • antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection.
  • dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci.
  • npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol. 150, 1-14, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988).
  • Visible markers such as anthocyanins, ⁇ -glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995).
  • marker gene expression suggests that the secretin-type GPCR (latrophilin) polynucleotide is also present, its presence and expression may need to be confirmed.
  • a sequence encoding a human secretin-type GPCR (latrophilin) polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a secretin-type GPCR (latrophilin) polypeptide can be identified by the absence of marker gene function.
  • a marker gene can be placed in tandem with a sequence encoding a secretin-type GPCR (latrophilin) polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression ofthe secretin-type GPCR (latrophilin) polynucleotide.
  • host cells which contain a human secretin-type GPCR (latrophilin) polynucleotide and which express a human secretin-type GPCR (latrophilin) poly- peptide can be identified by a variety of procedures known to those of skill in the art.
  • DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques that include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein.
  • a polynucleotide sequence encoding a secretin-type GPCR (latrophilin) polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a human secretin-type GPCR (latrophilin) polypeptide.
  • Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a secretin-type GPCR (latrophilin) polypeptide to detect transformants which contain a secretin-type GPCR (latrophilin) polynucleotide.
  • latrophilin secretin-type GPCR
  • a variety of protocols for detecting and measuring the expression of a human secretin-type GPCR (latrophilin) polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS fluorescence activated cell sorting
  • a two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a human secretin-type GPCR (latrophilin) polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et al, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn.,
  • labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays.
  • Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding secretin-type GPCR (latrophilin) polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • sequences encoding a human secretin-type GPCR (latrophilin) polypeptide can be cloned into a vector for the production of an mRNA probe.
  • RNA probes are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • GPCR (latrophilin) polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode secretin-type GPCR can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • latrophilin polypeptides can be designed to contain signal sequences which direct secretion of soluble secretin-type GPCR (latrophilin) polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound secretin-type GPCR (latrophilin) polypeptide.
  • purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.).
  • cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the secretin-type GPCR (latrophilin) polypeptide also can be used to facilitate purification.
  • One such expression vector provides for expression of a fusion protein containing a human secretin-type GPCR (latrophilin) polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobilized metal ion affinity chromatography, as described in Porath et al, Prot. Exp. Purif.
  • enterokinase cleavage site provides a means for purifying the secretin-type GPCR (latrophilin) polypeptide from the fusion protein.
  • Vectors that contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441-453, 1993.
  • sequences encoding a human secretin-type GPCR (latrophilin) polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al Nucl. Acids Res. Symp. Ser. 225-232, 1980).
  • a human secretin-type GPCR latrophilin
  • (latrophilin) polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
  • fragments of secretin-type GPCR (latrophilin) polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.
  • the newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography ⁇ e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983).
  • the composition of a synthetic secretin-type GPCR (latrophilin) polypeptide can be confirmed by amino acid analysis or sequencing ⁇ e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the secretin-type GPCR (latrophilin) polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
  • codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter secretin-type GPCR (latrophilin) polypeptide- encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
  • site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
  • antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a human secretin-type GPCR (latrophilin) polypeptide.
  • Fab fragment antigen binding protein
  • F(ab') 2 fragment antigen binding protein
  • Fv fragment antigen binding protein
  • epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
  • an antibody which specifically binds to an epitope of a human secretin-type GPCR (latrophilin) polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • immunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
  • an antibody which specifically binds to a human secretin-type GPCR (latrophilin) polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immuno- chemical assay.
  • antibodies which specifically bind to secretin-type GPCR (latrophilin) polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immuno- chemical assay.
  • antibodies which specifically bind to secretin-type GPCR (latrophilin) polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immuno- chemical assay.
  • antibodies which specifically bind to secretin-type GPCR (latrophilin) polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immuno- chemical assay.
  • GPCR (latrophilin) polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a human secretin-type GPCR (latrophilin) polypeptide from solution.
  • Human secretin-type GPCR (latrophilin) polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies.
  • a human secretin-type GPCR (latrophilin) polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyro- globulin, and keyhole limpet hemocyanin.
  • a carrier protein such as bovine serum albumin, thyro- globulin, and keyhole limpet hemocyanin.
  • various adjuvants can be used to increase the immunological response.
  • adjuvants include, but are not limited to, Freund's adjuvant, mineral gels ⁇ e.g., aluminum hydroxide), and surface active substances ⁇ e.g.
  • Monoclonal antibodies which specifically bind to a human secretin-type GPCR (latrophilin) polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al, Nature 256,
  • chimeric antibodies the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al, Proc. Natl. Acad. Sci. 81, 6851-6855, 1984; Neuberger et al, Nature 312, 604-608, 1984; Takeda et al, Nature 314, 452-454, 1985).
  • Monoclonal and other antibodies also can be "humanized” to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues.
  • humanized antibodies can be produced using recombinant methods, as described in GB2188638B.
  • Antibodies that specifically bind to a human secretin-type GPCR (latrophilin) polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
  • single chain antibodies can be adapted using methods known in the art to produce single chain antibodies that specifically bind to secretin-type GPCR (latrophilin) polypeptides.
  • Antibodies with related specificity, but of distinct idiotypic composition can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).
  • Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J.
  • Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, J. Biol. Chem. 269, 199-206.
  • a nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below.
  • single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J Immunol. Meth. 165, 81-91).
  • Antibodies which specifically bind to secretin-type GPCR (latrophilin) polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).
  • antibodies can be constructed and used therapeutically in methods of the invention.
  • chimeric antibodies can be constructed as disclosed in WO 93/03151.
  • Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared.
  • Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a human secretin-type GPCR (latrophilin) polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt con- centration.
  • latrophilin human secretin-type GPCR
  • Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of secretin-type GPCR (latrophilin) gene products in the cell.
  • latrophilin secretin-type GPCR
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a com- bination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.
  • Modifications of secretin-type GPCR (latrophilin) gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the secretin-type GPCR (latrophilin) gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
  • Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a secretin-type GPCR (latrophilin) polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent secretin-type GPCR (latrophilin) nucleotides, can provide sufficient targeting specificity for secretin-type GPCR (latrophilin) mRNA.
  • each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length.
  • Non-complementary intervening sequences are preferably 1, 2,
  • Antisense oligonucleotides can be modified without affecting their ability to hybridize to a human secretin-type GPCR (latrophilin) polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule.
  • internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose.
  • Modified bases and/or sugars such as arabinose instead of ribose, or a 3', 5 '-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.
  • modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawai et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem. Rev. 90, 543-584, 1990; Uhlmann et al, Tetrahedron. Lett.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236,
  • Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art ⁇ e.g., Haseloff et al, U.S. Patent 5,641,673).
  • the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a human secretin-type GPCR (latrophilin) polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the secretin-type GPCR (latrophilin) polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art ⁇ see Haseloff et al. Nature 334, 585-591, 1988).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).
  • Specific ribozyme cleavage sites within a human secretin-type GPCR (latrophilin) RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable.
  • RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity ofthe hybridization sequence for the target.
  • the hybridizing and cleavage regions ofthe ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
  • Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease secretin-type GPCR (latrophilin) expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome ofthe cells, as is known in the art.
  • a ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
  • ribozymes can be engineered so that ribozyme expression will occur in response to factors that induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. Differentially expressed genes
  • genes whose products interact with human secretin-type GPCR may represent genes that are differentially expressed in disorders including, but not limited to, obesity, gastrointestinal and liver disorders, cardiovascular disorders, dermatological disorders, endocrine and hormonal disorders, metabolic disorders, including diabetes, cancer, hematological disorders, neurological disorders, respiratory disorders, reproductive disorders, and genitourinary disorders. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human secretin-type GPCR (latrophilin) gene or gene product may itself be tested for differential expression.
  • the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
  • standard characterization techniques such as differential display techniques.
  • Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
  • RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc.
  • tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
  • Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311).
  • the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human secretin-type GPCR (latrophilin).
  • treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human secretin-type GPCR
  • the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human secretin-type GPCR (latrophilin) gene or gene product are up-regulated or down-regulated.
  • the invention provides assays for screening test compounds that bind to or modulate the activity of a human secretin-type GPCR (latrophilin) polypeptide or a human secretin-type GPCR (latrophilin) polynucleotide.
  • a test compound preferably binds to a human secretin-type GPCR (latrophilin) polypeptide or polynucleotide. More preferably, a test compound decreases or increases functional activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence ofthe test compound. Test compounds
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the com- pounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to secretin-type GPCR (latrophilin) polypeptides or polynucleotides or to affect secretin-type GPCR (latrophilin) activity or secretin-type GPCR (latrophilin) gene expression using high throughput screening.
  • high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
  • the most widely established techniques utilize 96-well microtiter plates. The wells ofthe microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
  • free format assays or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change. Yet another example is described by Salmon et al., Molecular Diversity 2, 57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • the test compound is preferably a small molecule that binds to the secretin-type GPCR (latrophilin) polypeptide, such that normal biological activity is prevented.
  • small molecules include, but are not limited to, small peptides or peptide-like molecules.
  • either the test compound or the secretin-type GPCR (latrophilin) polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • a detectable label such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • Detection of a test compound that is bound to the secretin-type GPCR (latrophilin) polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
  • a microphysiometer can be used to detect binding of a test compound with a human secretin-type GPCR (latrophilin) polypeptide.
  • a microphysiometer e.g., CytosensorTM
  • LAPS light-addressable potentiometric sensor
  • Determining the ability of a test compound to bind to a human secretin-type GPCR (latrophilin) polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705,
  • BiA Bimolecular Interaction Analysis
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants ⁇ e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • SPR surface plasmon resonance
  • a human secretin-type GPCR (latrophilin) polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al, BioTechniques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA constructs.
  • polynucleotide encoding a human secretin-type GPCR (latrophilin) polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor ⁇ e.g., GAL-4).
  • a DNA sequence that encodes an unidentified protein (“prey" or "sample” can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
  • the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene ⁇ e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression ofthe reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the secretin-type GPCR (latrophilin) polypeptide.
  • a reporter gene ⁇ e.g., LacZ
  • Expression ofthe reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the secretin-type GPCR (latrophilin) polypeptide.
  • either the secretin-type GPCR (latrophilin) polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
  • Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
  • any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a human secretin-type GPCR (latrophilin) polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
  • the secretin-type GPCR (latrophilin) polypeptide is a fusion protein comprising a domain that allows the secretin-type GPCR (latrophilin) polypeptide to be bound to a solid support.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed secretin-type GPCR (latrophilin) polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH).
  • Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
  • a human secretin-type GPCR (latrophilin) polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated secretin-type GPCR (latrophilin) polypeptides (or polynucleotides) or test com- pounds can be prepared from biotin-NHS(N- hydroxysuccinimide) using techniques well known in the art ⁇ e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • antibodies which specifically bind to a secretin-type GPCR (latrophilin) polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site can be derivatized to the wells of the plate.
  • Unbound target or protein can be trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to the secretin-type GPCR (latrophilin) polypeptide or test compound and SDS gel electrophoresis under non-reducing conditions.
  • secretin-type GPCR latrophilin
  • Screening for test compounds which bind to a human secretin-type GPCR (latrophilin) polypeptide or polynucleotide also can be carried out in an intact cell.
  • Any cell which comprises a secretin-type GPCR (latrophilin) polypeptide or poly- nucleotide can be used in a cell-based assay system.
  • a secretin-type GPCR (latrophilin) polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a secretin-type GPCR (latrophilin) polypeptide or polynucleotide is determined as described above.
  • Test compounds can be tested for the ability to increase or decrease the functional activity of a human secretin-type GPCR (latrophilin) polypeptide. Functional activity can be measured, for example, as described in the specific examples, below.
  • Functional assays can be carried out after contacting either a purified secretin-type GPCR (latrophilin) polypeptide, a cell membrane preparation, or an intact cell with a test compound.
  • a test compound that decreases functional activity of a human secretin-type GPCR (latrophilin) polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100%o is identified as a potential therapeutic agent for decreasing secretin-type GPCR (latrophilin) activity.
  • a test compound which increases functional activity of a human secretin-type GPCR (latrophilin) polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human secretin- type GPCR (latrophilin) activity.
  • test compounds that increase or decrease secretin-type GPCR (latrophilin) gene expression are identified.
  • a secretin-type GPCR (latrophilin) polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the secretin-type GPCR (latrophilin) poly- nucleotide is determined.
  • the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
  • the test compound can then be identified as a modulator of expression based on this comparison.
  • test compound when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer ofthe mRNA or polypeptide expression.
  • test compound when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
  • the level of secretin-type GPCR (latrophilin) mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a human secretin-type GPCR (latrophilin) polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
  • polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a human secretin-type GPCR (latrophilin) polypeptide.
  • Such screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell that expresses a human secretin-type GPCR (latrophilin) polynucleotide can be used in a cell-based assay system.
  • the secretin-type GPCR (latrophilin) polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
  • Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
  • compositions of the in- vention can comprise, for example, a human secretin-type GPCR (latrophilin) polypeptide, secretin-type GPCR (latrophilin) polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a secretin-type GPCR (latrophilin) polypeptide, or mimetics, activators, or inhibitors of a human secretin- type GPCR (latrophilin) polypeptide activity.
  • latrophilin human secretin-type GPCR
  • latrophilin secretin-type GPCR
  • latrophilin secretin-type GPCR
  • ribozymes or antisense oligonucleotides antibodies which specifically bind to a secretin-type GPCR (latrophilin) polypeptide, or mimetics, activators, or inhibitors of a human secretin- type GPCR (latrophilin) polypeptide activity.
  • compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • agent such as stabilizing compound
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxy- propylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i. e. , dosage.
  • compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
  • Aqueous injection suspensions can contain substances that increase the viscosity ofthe suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Non-lipid polycationic amino polymers also can be used for delivery.
  • the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
  • the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2%> sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
  • compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
  • Human secretin-type GPCR can be regulated to treat obesity, cardiovascular disorders, dermatological disorders, endocrine and hormonal disorders, metabolic disorders, including diabetes, cancer, hematological disorders, gastrointestinal and liver disorders, neurological disorders, respiratory disorders, reproductive disorders, and genitourinary disorders.
  • Obesity can be regulated to treat obesity, cardiovascular disorders, dermatological disorders, endocrine and hormonal disorders, metabolic disorders, including diabetes, cancer, hematological disorders, gastrointestinal and liver disorders, neurological disorders, respiratory disorders, reproductive disorders, and genitourinary disorders.
  • Obesity and overweight are defined as an excess of body fat relative to lean body mass. An increase in caloric intake or a decrease in energy expenditure or both can bring about this imbalance leading to surplus energy being stored as fat. Obesity is associated with important medical morbidities and an increase in mortality. The causes of obesity are poorly understood and may be due to genetic factors, environmental factors or a combination ofthe two to cause a positive energy balance. In contrast, anorexia and cachexia are characterized by an imbalance in energy intake versus energy expenditure leading to a negative energy balance and weight loss.
  • Agents that either increase energy expenditure and/or decrease energy intake, absorption or storage would be useful for treating obesity, overweight, and associated comorbidities.
  • Agents that either increase energy intake and/or decrease energy expenditure or increase the amount of lean tissue would be useful for treating cachexia, anorexia and wasting disorders.
  • This gene, translated proteins and agents which modulate this gene or portions ofthe gene or its products are useful for treating obesity, overweight, anorexia, cachexia, wasting disorders, appetite suppression, appetite enhancement, increases or decreases in satiety, modulation of body weight, and/or other eating disorders such as bulimia.
  • the novel human receptor is highly expressed in the following cardiovascular related tissues: fetal heart, heart, pericardium, heart atrium (right), heart atrium (left), heart ventricle (left), heart apex, Purkinje fibers, mterventricular septum. Expression in the above mentioned tissues demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose cardiovascular diseases. In addition, the activity ofthe novel receptor can be modulated to treat cardiovascular diseases.
  • Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
  • Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right-sided or left-sided, systolic or diastolic, independent ofthe underlying cause.
  • MI Myocardial infarction
  • Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which inadequate to meet the myocardial requirement for oxygen.
  • This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
  • Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of arrhythmias.
  • vascular diseases include primary as well as all kinds of secondary arterial hypertension (renal, endocrine, neurogenic, others).
  • the disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications.
  • Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
  • PAOD peripheral arterial occlusive disease
  • acute arterial thrombosis and embolism inflammatory vascular disorders
  • Raynaud's phenomenon Raynaud's phenomenon
  • venous disorders venous disorders.
  • novel human receptor highly expressed in skin.
  • the expression in skin demonstrates that the novel human receptor protein or its mRNA can be utilized to diagnose dermatological diseases, the activity of the novel human receptor can be modulated to treat those diseases.
  • the skin serves several functions. It is a multi-layered organ system that builds an effective protective cover and regulates body temperature, senses painful and pleasant stimuli, keeps substances from entering the body, and provides a shield from the sun's harmful effects. Skin color, texture, and folds help mark people as individuals. Thus, skin disorders or diseases often have important consequences for physical and mental health. Skin disorders include, but are not limited to the conditions described in the following.
  • Itching is a sensation that instinctively demands scratching, which may be caused by a skin condition or a systemic disease.
  • Superficial skin disorders affect the uppermost layer ofthe skin, the stratum corneum or the keratin layer, which it consists of many layers of flattened, dead cells and acts as a barrier to protect the underlying tissue from injury and infection.
  • Disorders of the superficial skin layers involve the stratum corneum and deeper layers of the epidermis. Examples of superficial skin disorders are provided in the following.
  • ichthyosis Dry skin often occurs in people past middle age, severe dry skin (ichthyosis) results from an inherited scaling disease, such as ichthyosis vulgaris or epidermolytic hyperkeratosis. Ichthyosis also results from nonhereditary disorders, such as leprosy, underactive thyroid, lymphoma, AIDS, and sarcoidosis. Keratosis pilaris is a common disorder in which dead cells shed from the upper layer of skin and form plugs that fill the openings of hair follicles. A callus is an area on the stratum corneum or keratin layer, that becomes abnormally thick in response to repeated rubbing. A corn is a pea-sized, thickened area of keratin that occurs on the feet.
  • Psoriasis is a chronic, recurring disease recognizable by silvery scaling bumps and various-sized plaques (raised patches). An abnormally high rate of growth and turnover of skin cells causes the scaling. Pityriasis rosea is a mild disease that causes scaly, rose-colored, inflamed skin. Pityriasis rosea is possibly caused by an infectious agent, although none has been identified. Lichen planus, a recurring itchy disease, starts as a rash of small discrete bumps that then combine and become rough, scaly plaques (raised patches).
  • Dermatitis is an inflammation of the upper layers of the skin, causing blisters, redness, swelling, oozing, scabbing, scaling, and usually itching.
  • Forms of dermatitis are contact dermatitis, or chronic dermatitis of the hands and feet, e.g., Pompholyx.
  • Further examples of dermatitic disorders are atopic dermatitis, seborrheic dermatitis, nummular dermatitis, generalized exfoliative dermatitis, stasis dermatitis, or localized scratch dermatitis (lichen simplex chronicus, neurodermatitis).
  • Other skin disorders are caused by inflammation. The skin can break out in a variety of rashes, sores, and blisters. Some skin eruptions can even be life threatening. Drug rashes are side effects of medications, mainly allergic reactions to medications.
  • Toxic epidermal necrolysis is a life-threatening skin disease in which the top layer of the skin peels off in sheets. This condition can be caused by a reaction to a drug or by some other serious disease.
  • Erythema multiforme often caused by Herpes simplex, is a disorder characterized by patches of red, raised skin that often look like targets and usually are distributed symmetrically over the body.
  • Erythema nodosum is an inflammatory disorder that produces tender red bumps (nodules) under the skin, most often over the shins but occasionally on the arms and other areas.
  • Granuloma annulare is a chronic skin condition of unknown cause in which small, firm, raised bumps form a ring with normal or slightly sunken skin in the center.
  • Some skin disorders are characterized as blistering diseases.
  • Pemphigus is an uncommon, sometimes fatal, disease in which blisters (bullae) of varying sizes break out on the skin, the lining of the mouth, and other mucous membranes.
  • Bullous pemphigoid is an autoimmune disease that causes blistering.
  • Dermatitis herpetiform is an autoimmune disease in which clusters of intensely itchy, small blisters and hive-like swellings break out and persist.
  • proteins in wheat, rye, barley, and oat products activate the immune system, which attacks parts ofthe skin and somehow causes the rash and itching.
  • Sweating disorders also belong to skin disorders. Prickly heat is an itchy skin rash caused by trapped sweat. Excessive sweating (hyperhidrosis) may affect the entire surface of the skin, but often it is limited to the palms, soles, armpits, or groin. The affected area is often pink or bluish white, and in severe cases the skin may be cracked, scaly, and soft, especially on the feet. Skin disorders can affect the sebaceous glands. The sebaceous glands, which secrete oil onto the skin, lie in the dermis, the skin layer just below the surface layer (epidermis). Sebaceous gland disorders include acne, rosacea, perioral dermatitis, and sebaceous cysts.
  • Acne is a common skin condition in which the skin pores become clogged, leading to pimples and inflamed, infected abscesses (collections of pus). Acne tends to develop in teenagers. Acne is further subdivided in superficial acne or deep acne. Rosacea is a persistent skin disorder that produces redness, tiny pimples, and broken blood vessels, usually on the central area of the face. Perioral dermatitis is a red, often bumpy rash around the mouth and on the chin. A sebaceous cyst (keratinous cyst) is a slow-growing bump containing dead skin, skin excretions, and other skin particles. These cysts may be small and can appear anywhere.
  • Hair disorders also are skin disorders. Hair disorders include excessive hairiness, baldness, and ingrown beard hairs.
  • the skin can be infected by bacteria.
  • Bacterial skin infections can range in seriousness from minor acne to a life-threatening condition, such as staphylococcal scalded skin syndrome.
  • the most common bacterial skin infections are caused by Staphylococcus and Streptococcus.
  • Risk factors for skin infections are for example diabetes, AIDS or skin lesions.
  • Impetigo is a skin infection, caused by Staphylococcus or Streptococcus, leading to the formation of small pus-filled blisters (pustules).
  • Folliculitis is an inflammation of the hair follicles caused by infection with Staphylococcus. The infection damages the hairs, which can be easily pulled out.
  • Boils are large, tender, swollen, raised areas caused by staphylococcal infection around hair follicles.
  • Carbuncles are clusters of boils that result in extensive sloughing of skin and scar formation. Carbuncles develop and heal more slowly than single boils and may lead to fever and fatigue.
  • Erysipelas is a skin infection caused by Streptococcus. A shiny, red, slightly swollen, tender rash develops, often with small blisters. Lymph nodes around the infected area may become enlarged and painful. Cellulitis is a spreading infection in, and sometimes beneath, the deep layers of the skin. Cellulitis most often results from a streptococcal infection or a staphylococcal infection. However, many other bacteria can also cause cellulitis. Paronychia is an infection around the edge of a fingernail or toenail. Paronychia can be caused by many different bacteria, including
  • Staphylococcal scalded skin syndrome is a widespread skin infection that can lead to toxic shock syndrome, in which the skin peels off as though burned.
  • Certain types of staphylococci produce a toxic substance that causes the top layer of skin (epidermis) to split from the rest of the skin.
  • Erythrasma is an infection of the top layers of the skin by the bacterium Corynebacterium minutissimum.
  • Skin infections are often caused by fungi. Fungi that infect the skin (dermatophytes) live only in the dead, topmost layer (stratum corneum) and do not penetrate deeper.
  • Ringworm is a fungal skin infection caused by several different fungi and generally classified by its location on the body. Examples are Athlete's foot (foot ringworm, caused by either Trichophyton or Epidermophyton), jock itch (groin ringworm, can be caused by a variety of fungi and yeasts), scalp ringworm, caused by Trichophyton or Microsporum), nail ringworm and body ringworm (caused by Trichophyton).
  • Candidiasis is an infection by the yeast Candida.
  • Candida usually infects the skin and mucous membranes, such as the lining of the mouth and vagina. Rarely, it invades deeper tissues as well as the blood, causing life-threatening systemic candidiasis.
  • the following types of Candida infections can be distinguished: Infections in skinfolds (intertriginous infections), vaginal and penile Candida infections (vulvovaginitis), thrush, Perleche (candida infection at the corners of the mouth), candidal paronychia (candida growing in the nail beds, produces painful swelling and pus). Tinea versicolor is a fungal infection that causes white to light brown patches on the skin.
  • the skin can also be affected by parasites, mainly tiny insects or worms.
  • Scabies is a mite infestation that produces tiny reddish pimples and severe itching. Scabies is caused by the itch mite Sarcoptes scabiei. Lice infestation (pediculosis) causes intense itching and can affect almost any area ofthe skin. Head lice and pubic lice are two different species.
  • Creeping eruption (cutaneous larva migrans) is a hookworm infection transmitted from warm, moist soil to exposed skin. The infection is caused by a hookworm that normally inhabits dogs and cats.
  • Warts are caused by the papillomavirus
  • cold sores are caused by the Herpes simplex virus.
  • Another important group of viruses that infect the skin belongs to the poxvirus family. Chickenpox remains a common childhood infection.
  • a poxvirus also causes molluscum contagiosum, which is an infection of the skin by a poxvirus that causes skin-colored, smooth, waxy bumps.
  • Sunlight can cause severe skin damage. Sunburn results from an overexposure to ultraviolet B (UVB) rays. Some sunburned people develop a fever, chills, and weakness, and those with very bad sunburns even may go into shock—low blood pressure, and fainting. People who are in the sun a lot have an increased risk of skin cancers, including squamous cell carcinoma, basal cell carcinoma, and to some degree, malignant melanoma. Drugs, among other causes, can cause skin photo- sensitivity reactions which can occur after only a few minutes of sun exposure. These reactions include redness, peeling, hives, blisters, and thickened, scaling patches (photosensitivity). Some skin disorders are characterized as pigment disorders.
  • Albinism is a rare, inherited disorder in which no melanin is formed.
  • Vitiligo is a condition in which a loss of melanocytes results in smooth, whitish patches of skin, which may occur after unusual physical trauma and tends to occur with certain other diseases, including Addison's disease, diabetes, pernicious anemia, and thyroid disease.
  • Tinea versicolor is a fungal infection of the skin that sometimes results in hyperpigmentation. Melasma appears on the face (usually the forehead, cheeks, temples, and jaws) as a roughly symmetric group of dark brown patches of pigmentation that are often clearly delineated.
  • Skin growths which are abnormal accumulations of different types of cells, may be present at birth or develop later.
  • Noncancerous (benign) growth and cancerous (malignant) growth types are distinguished.
  • Moles (nevi) are small, usually dark, skin growths that develop from pigment-producing cells in the skin (melanocytes). Most moles are harmless. However, noncancerous moles can develop into malignant melanoma.
  • Skin tags are soft, small, flesh-colored or slightly darker skin flaps that appear mostly on the neck, in the armpits, or in the groin. Lipomas are soft deposits of fatty material that grow under the skin, causing round or oval lumps.
  • Angiomas are collections of abnormally dense blood or lymph vessels that are usually located in and below the skin and that cause red or purple discolorations. Examples of angiomas are port-wine stains, strawberry marks, cavernous hemangiomas, spider angiomas, and lymphangiomas.
  • Pyogenic granulomas are scarlet, brown, or blue-black slightly raised areas caused by increased growth of capillaries (the smallest blood vessels) and swelling of the surrounding tissue.
  • Seborrheic keratoses (sometimes called seborrheic warts) are flesh-colored, brown, or black growths that can appear anywhere on the skin. Dermatofibromas are small, red-to-brown bumps (nodules) that result from an accumulation of fibroblasts, the cells that populate the soft tissue under the skin.
  • Keratoacanthomas are round, firm, usually flesh-colored growths that have an unusual central crater containing a pasty material.
  • Keloids are smooth, shiny, slightly pink, often dome-shaped, proliferative growths of fibrous tissue that form over areas of injury or over surgical wounds.
  • Skin cancer is the most common form of cancer, but most types of skin cancers are curable.
  • Basal cell carcinoma is a cancer that originates in the lowest layer of the epidermis.
  • Squamous cell carcinoma is cancer that originates in the middle layer of the epidermis.
  • Bowen's disease is a form of squamous cell carcinoma that's confined to the epidermis and hasn't yet invaded the underlying dermis.
  • Melanoma is a cancer that originates in the pigment-producing cells of the skin (melanocytes).
  • Kaposi's sarcoma is a cancer that originates in the blood vessels, usually of the skin.
  • Paget's disease is a rare type of skin cancer that looks like an inflamed, reddened patch of skin (dermatitis); it originates in glands in or under the skin.
  • the novel human receptor is highly expressed in the following tissues of the endocrinological system: adrenal gland, thyroid, pancreas.
  • the expression in the above mentioned tissues demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose of endocrinological disorders.
  • the activity of the novel human receptor can be modulated to treat endocrinological disorders.
  • the endocrine system consists of a group of organs whose main function is to produce and secrete hormones directly into the bloodstream.
  • the major organs ofthe endocrine system are the hypothalamus, the pituitary gland, thyroid gland, the parathyroid glands, the islets of the pancreas, the adrenal glands, the testes, and the ovaries.
  • the hypothalamus secretes several hormones that stimulate the pituitary. Some trigger the release of pituitary hormones, while others suppress the release of pituitary hormones.
  • the pituitary gland coordinates many functions of the other endocrine glands, but some pituitary hormones have direct effects.
  • the insulin-secreting cells of the pancreas respond to glucose and fatty acids.
  • Parathyroid cells respond to calcium and phosphate.
  • the adrenal medulla (part ofthe adrenal gland) responds to direct stimulation by the parasympathetic nervous system
  • hormone in the blood can become abnormally high or low, disrupting body functions.
  • Many disorders are caused by malfunction of the endocrine system or hormones. Examples of such disorders are presented in the following.
  • Diabetes mellitus is a disorder in which blood levels of glucose are abnormally high because the body doesn't release or use insulin adequately. People with type I diabetes mellitus (insulin-dependent diabetes) produce little or no insulin at all. In type I diabetes more than 90 percent ofthe insulin-producing cells (beta cells) ofthe pancreas are permanently destroyed. The resulting insulin deficiency is severe, and to survive, a person with type I diabetes must regularly inject insulin. In type II diabetes mellitus (non-insulin-dependent diabetes) the body develops resistance to insulin effects, resulting in a relative insulin deficiency.
  • pancreas has two major functions: to secrete fluid containing digestive enzymes into the duodenum and to secrete the hormones insulin and glucagon.
  • Chronic pancreatitis is a long-standing inflammation of the pancreas.
  • An insulinoma is a rare type of pancreatic tumor that secretes insulin.
  • the symptoms of an insulinoma result from low blood glucose levels.
  • a gastrinoma is a pancreatic tumor that produces excessive levels of the hormone gastrin, which stimulates the stomach to secrete acid and enzymes, causing peptic ulcers.
  • the excess gastrin secreted by the gastrinoma causes symptoms, called the Zollinger-Ellison syndrome.
  • a glucagonoma is a tumor that produces the hormone glucagon, which raises the level of glucose in the blood and produces a distinctive rash.
  • Diabetes insipidus is a disorder in which insufficient levels of antidiuretic hormone cause excessive thirst (polydipsia) and excessive production of very dilute urine
  • the body has two adrenal glands.
  • the medulla of the adrenal glands secretes hormones such as adrenaline (epinephrine) that affect blood pressure, heart rate, sweating, and other activities also regulated by the sympathetic nervous system.
  • the cortex secretes many different hormones, including corticosteroids (cortisone-like hormones), androgens (male hormones), and mineralocorticoids, which control blood pressure and the levels of salt and potassium in the body
  • a disease characterized by underactive adrenal glands is Addison's disease (adrenocortical insufficiency).
  • Adrenal Glands Several disorders are characterized by overactive Adrenal Glands. The causes can be changes in the adrenal glands themselves or overstimulation by the pituitary gland. Examples of these diseases are listed in the following.
  • the thyroid is a small gland located under the Adam's apple. It secretes thyroid hormones, which control the metabolic rate. The thyroid gland traps iodine and processes it into thyroid hormones. The euthyroid sick syndrome is characterized by lack of conversion of the T4 form of thyroid hormone to the T3 form. Hyperthyroidism (overactive thyroid gland, production of too much hormone) may have several causes. Thyroiditis (an inflammation ofthe thyroid gland), typically leads to a phase of hyperthyroidism. The inflammation may damage the thyroid gland, so that in later stages the disease is characterized by transient or permanent underactivity
  • Toxic thyroid nodules (adenomas) often produce thyroid hormone in large quantities.
  • Toxic multinodular goiter (Plummer's disease) is a disorder in which there are many nodules. Graves' disease (toxic diffuse goiter) is believed to be caused by an antibody that stimulates the thyroid to produce too much thyroid hormone. In toxic nodular goiter, one or more nodules in the thyroid produce too much thyroid hormone and aren't under the control of thyroid-stimulating hormone.
  • Secondary hyperthyroidism may (rarely) be caused by a pituitary tumor that secretes too much thyroid-stimulating hormone, by resistance of the pituitary to thyroid hormone, which results in the pituitary gland secreting too much thyroid-stimulating hormone, or by a hydatidiform mole in women.
  • Thyroid storm is a sudden extreme overactivity of the thyroid gland is a life-threatening emergency requiring prompt treatment.
  • hypothyroidism is a condition in which the thyroid gland is underactive and produces too little thyroid hormone. Very severe hypothyroidism is called myxedema. In Hashimoto's thyroiditis (autoimmune thyroiditis) the thyroid gland is often enlarged, and hypothyroidism results because the gland's functioning areas are gradually destroyed. Rarer causes of hypothyroidism include some inherited disorders that are caused by abnormalities of the enzymes in thyroid cells. In other rare disorders, either the hypothalamus or the pituitary gland fails to secrete enough of the hormone needed to stimulate normal thyroid function. Other examples of thyroiditis are silent lymphocytic thyroiditis, Hashimoto's thyroiditis, or subacute granulomatous thyroiditis.
  • Thyroid cancer is any one of four main types of malignancy ofthe thyroid: papillary, follicular, anaplastic, or medullary.
  • the pituitary is a pea-sized gland that sits in a bony structure (sella turcica) at the base of the brain. The sella turcica protects the pituitary but allows very little room for expansion. If the pituitary enlarges, it tends to push upward, often pressing on the areas of the brain that carry signals from the eyes, possibly resulting in headaches or impaired vision.
  • the pituitary gland has two distinct parts: the anterior (front) and the posterior (back) lobes.
  • the anterior lobe produces (secretes) hormones that ultimately control the function of the thyroid gland, adrenal glands, and reproductive organs (ovaries and testes); milk production (lactation) in the breasts; and overall body growth. It also produces hormones that cause the skin to darken and that inhibit pain sensations.
  • the posterior lobe produces hormones that regulate water balance, stimulate the let-down of milk from the breasts in lactating women, and stimulate contractions ofthe uterus.
  • Examples for disorders of the pituitary gland are Empty Sella Syndrome; hypopituitarism (an underactive pituitary gland); acromegaly, which is excessive growth caused by oversecretion of growth hormone, which is almost always caused by a benign pituitary tumor (adenoma); galactorrhea, which is the production of breast milk in men or in women who aren't breastfeeding, in both sexes, the most common cause of galactorrhea is a prolactin-producing tumor (prolactinoma) in the pituitary gland.
  • prolactin-producing tumor prolactinoma
  • novel human receptor is highly expressed in the pancreas.
  • the expression in the above mentioned tissues demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose metabolic diseases.
  • the activity ofthe novel human receptor can be modulated to treat metabolic diseases.
  • Metabolic disorders are defined as conditions that result from an abnormality in any ofthe chemical or biochemical transformations and their regulating systems essential to producing energy, to regenerating cellular constituents, to eliminating unneeded products arising from these processes, and to regulate and maintain homeostasis in a mammal regardless of whether acquired or the result of a genetic transformation.
  • a single defective transformation or disturbance of its regulation may produce consequences that are narrow, involving a single body function, or broad, affecting many organs, organ systems, or the body as a whole.
  • Metabolic disorders often are caused by single defects in particular biochemical pathways, defects that are due to the deficient activity of individual enzymes or molecular receptors leading to the regulation of such enzymes. Hence, in a broader sense disturbances of the underlying genes, their products and their regulation lie well within the scope of this definition of a metabolic disease.
  • metabolic disorders may affect 1) biochemical processes and tissues ubiquitous all over the body, 2) the bone, 3) the nervous system, 4) the endocrine system, 5) the muscle including the heart, 6) the skin and nervous tissue, 7) the urogenital system, 8) the homeostasis of body systems like water and electrolytes.
  • Metabolic disorders according to 1) include, but are not limited to, obesity, amyloidosis, disturbances of the amino acid metabolism like branched chain disease, hyperaminoacidemia, hyperaminoaciduria, disturbances of the metabolism of urea, hyperammonemia, mucopolysaccharidoses ⁇ e.g., Maroteaux-Lamy syndrome, storage diseases such as glycogen storage diseases and lipid storage diseases, glycogenosis diseases such as Cori's disease, malabso ⁇ tion diseases such as intestinal carbohydrate malabso ⁇ tion, oligosaccharidase deficiency like maltase-, lactase-, or sucrase-insufficiency, disorders of the metabolism of fructose, disorders of the metabolism of galactose, galactosemia, disturbances of carbohydrate utilization such as diabetes, hypoglycemia, disturbances of pyruvate metabolism, hypolipidemia, hypolipoproteinemia, hyperlipidemia, hyperlipoproteinemia, carni
  • Metabolic disorders according to 2) include, but are not limited to, osteoporosis, osteomalacia-like osteoporosis, osteopenia, osteogenesis imperfecta, osteopetrosis, osteonecrosis, Paget's disease of bone, and hypophosphatemia.
  • Metabolic disorders according to 3) include, but are not limited to, cerebellar dysfunction, disturbances of brain metabolism such as dementia, Alzheimer's disease, Huntington's chorea, Parkinson's disease, Pick's disease, toxic encephalopathy, demyelinating neuropathies such as inflammatory neuropathy, and Guillain-Barre syndrome.
  • Metabolic disorders according to 4) include, but are not limited to, primary and secondary metabolic disorders associated with hormonal defects such as any disorder stemming from either a hyperfunction or hypofunction of some hormone-secreting endocrine gland and any combination thereof. They include Sipple's syndrome, pituitary gland dysfunction and its effects on other endocrine glands, such as the thyroid, adrenals, ovaries, and testes, acromegaly, hyper- and hypothyroidism, euthyroid goiter, euthyroid sick syndrome, thyroiditis, and thyroid cancer, over- or unde ⁇ roduction ofthe adrenal steroid hormones, adrenogenital syndrome, Cushing's syndrome, Addison's disease of the adrenal cortex, Addison's pernicious anemia, primary and secondary aldosteronism, diabetes insipidus, carcinoid syndrome, disturbances caused by the dysfunction ofthe parathyroid glands, pancreatic islet cell dysfunction, diabetes, disturbances of the endocrine system of the female
  • Metabolic disorders include, but are not limited to, muscle weakness, myotonia, Duchenne's and other muscular dystrophies, dystrophia myotonica of Steinert, mitochondrial myopathies such as disturbances of the catabolic metabolism in the muscle, carbohydrate and lipid storage myopathies, glycogenoses, myoglobinuria, malignant hyperthermia, polymyalgia rheumatica, dermatomyositis, primary myocardial disease, cardiomyopathy.
  • mitochondrial myopathies such as disturbances of the catabolic metabolism in the muscle, carbohydrate and lipid storage myopathies, glycogenoses, myoglobinuria, malignant hyperthermia, polymyalgia rheumatica, dermatomyositis, primary myocardial disease, cardiomyopathy.
  • Metabolic disorders according to 6) include, but are not limited to, disorders of the ectoderm, neurofibromatosis, scleroderma and polyarteritis, Louis-Bar syndrome, von Hippel-Lindau disease, Sturge- Weber syndrome, tuberous sclerosis, amyloidosis, po ⁇ hyria.
  • Metabolic disorders according to 7) include, but are not limited to, sexual dysfunction ofthe male and female.
  • Metabolic disorders according to 8) include, but are not limited to, confused states and seizures due to inappropriate secretion of antidiuretic hormone from the pituitary gland, Liddle's syndrome, Barrier's syndrome, Fanconi's syndrome, renal electrolyte wasting, diabetes insipidus.
  • Diabetes mellitus is a common metabolic disorder characterized by an abnormal elevation in blood glucose, alterations in lipids and abnormalities (complications) in the cardiovascular system, eye, kidney and nervous system. Diabetes is divided into two separate diseases: type 1 diabetes (juvenile onset), which results from a loss of cells which make and secrete insulin, and type 2 diabetes (adult onset), which is caused by a defect in insulin secretion and a defect in insulin action.
  • type 1 diabetes juvenile onset
  • type 2 diabetes adult onset
  • Type I diabetes is initiated by an autoimmune reaction that attacks the insulin secreting cells (beta cells) in the pancreatic islets.
  • Agents that prevent this reaction from occurring or that stop the reaction before destruction of the beta cells has been accomplished are potential therapies for this disease.
  • Other agents that induce beta cell proliferation and regeneration also are potential therapies.
  • Type II diabetes is the most common of the two diabetic conditions (6% of the population).
  • the defect in insulin secretion is an important cause of the diabetic condition and results from an inability ofthe beta cell to properly detect and respond to rises in blood glucose levels with insulin release.
  • Therapies that increase the response by the beta cell to glucose would offer an important new treatment for this disease.
  • the defect in insulin action in Type II diabetic subjects is another target for therapeutic intervention.
  • Agents that increase the activity of the insulin receptor in muscle, liver, and fat will cause a decrease in blood glucose and a normalization of plasma lipids.
  • the receptor activity can be increased by agents that directly stimulate the receptor or that increase the intracellular signals from the receptor.
  • Other therapies can directly activate the cellular end process, i.e. glucose transport or various enzyme systems, to generate an insulin-like effect and therefore a produce beneficial outcome. Because overweight subjects have a greater susceptibility to Type II diabetes, any agent that reduces body weight is a possible therapy.
  • Type I and Type II diabetes can be treated with agents that mimic insulin action or that treat diabetic complications by reducing blood glucose levels.
  • agents that reduces new blood vessel growth can be used to treat the eye complications that develop in both diseases.
  • the novel human receptor is highly expressed in the following tissues of the gastroenterological system: stomach, stomach tumor, colon, colon tumor, small intestine, ileum, rectum, liver, liver tumor, HEP G2 cells.
  • the expression in the above mentioned tissues and in particular the differential expression between diseased tissue stomach tumor and healthy tissue stomach, between diseased tissue colon tumor and healthy tissue colon, between diseased tissue liver tumor and healthy tissue liver, between diseased tissue HEP G2 cells and healthy tissue liver demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose gastroenterological disorders.
  • the activity of the novel human receptor can be modulated to treat gastroenterological disorders.
  • Gastrointestinal diseases include primary or secondary, acute or chronic diseases of the organs of the gastrointestinal tract which may be acquired or inherited, benign or malignant or metaplastic, and which may affect the organs ofthe gastrointestinal tract or the body as a whole. They include but are not limited to 1) disorders of the esophagus such as achalasia, vigoruos achalasia, dysphagia, cricopharyngeal incoordination, pre-esophageal dysphagia, diffuse esophageal spasm, globus sensation, Barrett's metaplasia, gastroesophageal reflux, 2) disorders of the stomach and duodenum such as functional dyspepsia, inflammation of the gastric mucosa, gastritis, stress gastritis, chronic erosive gastritis, atrophy of gastric glands, metaplasia of gastric tissues, gastric ulcers, duodenal ulcers, neoplasms of the stomach, 3) disorders of the pancreas
  • Liver diseases include primary or secondary, acute or chronic diseases or injury ofthe liver which may be acquired or inherited, benign or malignant, and which may affect the liver or the body as a whole. They comprise but are not limited to disorders ofthe bilirubin metabolism, jaundice, syndromes of Gilbert, Crigler-Najjar, Dubin- Johnson, and Rotor; intrahepatic cholestasis, hepatomegaly, portal hypertension, ascites,
  • the novel human receptor is highly expressed in the following cancer tissues: stomach tumor, colon tumor, liver tumor, HEP G2 cells, Jurkat (T-cells), lung tumor, uterus tumor, ovary tumor, MDA MB 231 cells (breast tumor), prostate, kidney tumor.
  • tissue stomach tumor and healthy tissue stomach demonstrates that the differential expression between diseased tissue stomach tumor and healthy tissue stomach, between diseased tissue colon tumor and healthy tissue colon, between diseased tissue liver tumor and healthy tissue liver, between diseased tissue HEP G2 cells and healthy tissue liver, between diseased tissue Jurkat (T-cells) and healthy tissue leukocytes (peripheral blood), between diseased tissue lung tumor and healthy tissue lung, between diseased tissue uterus tumor and healthy tissue uterus, between diseased tissue ovary tumor and healthy tissue ovary, between diseased tissue MDA MB 231 cells (breast tumor) and healthy tissue breast, between diseased tissue kidney tumor and healthy tissue kidney demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose cancer.
  • the activity of the novel human Secretin-type GPCR can be modulated to treat cancer.
  • Cancer disorders within the scope of the invention comprise any disease of an organ or tissue in mammals characterized by poorly controlled or uncontrolled multiplication of normal or abnormal cells in that tissue and its effect on the body as a whole.
  • Cancer diseases within the scope of the invention comprise benign neoplasms, dysplasias, hype ⁇ lasias as well as neoplasms showing metastatic growth or any other transformations, e.g., leukoplakias, which often precede a breakout of cancer.
  • Cells and tissues are cancerous when they grow more rapidly than normal cells, displacing or spreading into the surrounding healthy tissue or any other tissues ofthe body described as metastatic growth, assume abnormal shapes and sizes, show changes in their nucleocytoplasmatic ratio, nuclear polychromasia, and finally may cease.
  • Cancerous cells and tissues may affect the body as a whole when causing paraneoplastic syndromes or if cancer occurs within a vital organ or tissue, normal function will be impaired or halted, with possible fatal results.
  • the ultimate involvement of a vital organ by cancer, either primary or metastatic, may lead to the death ofthe mammal affected. Cancer tends to spread, and the extent of its spread is usually related to an individual's chances of surviving the disease.
  • Cancers are generally said to be in one of tliree stages of growth: early, or localized, when a tumor is still confined to the tissue of origin, or primary site; direct extension, where cancer cells from the tumour have invaded adjacent tissue or have spread only to regional lymph nodes; or metastasis, in which cancer cells have migrated to distant parts of the body from the primary site, via the blood or lymph systems, and have established secondary sites of infection.
  • Cancer is said to be malignant because of its tendency to cause death if not treated. Benign tumors usually do not cause death, although they may if they interfere with a normal body function by virtue of their location, size, or paraneoplastic side effects. Hence, benign tumors fall under the definition of cancer within the scope of the invention as well.
  • cancer cells divide at a higher rate than do normal cells, but the distinction between the growth of cancerous and normal tissues is not so much the rapidity of cell division in the former as it is the partial or complete loss of growth restraint in cancer cells and their failure to differentiate into a useful, limited tissue of the type that characterizes the functional equilibrium of growth of normal tissue.
  • Cancer tissues may express certain molecular receptors and probably are influenced by the host's susceptibility and immunity and it is known that certain cancers of the breast and prostate, for example, are considered dependent on specific hormones for their existence.
  • cancer under the scope of the invention is not limited to simple benign neoplasia but includes any other benign and malign neoplasia, such as
  • carcinoma 1) carcinoma, 2) sarcoma, 3) carcinosarcoma, 4) cancers of the blood-forming tissues, 5) tumors of nerve tissues including the brain, and 6) cancer of skin cells.
  • Carcinoma occurs in epithelial tissues, which cover the outer body (the skin) and line mucous membranes and the inner cavitary structures of organs e.g. such as the breast, lung, the respiratory and gastrointestinal tracts, the endocrine glands, and the genitourinary system.
  • Ductal or glandular elements may persist in epithelial tumors, as in adenocarcinomas, e.g., thyroid adenocarcinoma, gastric adenocarcinoma, uterine adenocarcinoma.
  • Cancers of the pavement-cell epithelium of the skin and of certain mucous membranes may be termed epidermoid or squamous-cell carcinomas of the respective tissues and are within the scope of the definition of cancer as well.
  • Sarcomas develop in connective tissues, including fibrous tissues, adipose (fat) tissues, muscle, blood vessels, bone, and cartilage such as osteogenic sarcoma, liposarcoma, fibrosarcoma, and synovial sarcoma.
  • Carcinosarcoma is cancer that develops in both epithelial and connective tissue.
  • Cancer disease within the scope of this definition may be primary or secondary, whereby primary indicates that the cancer originated in the tissue where it is found rather than was established as a secondary site through metastasis from another lesion.
  • Cancers and tumor diseases within the scope of this definition may be benign or malign and may affect all anatomical structures of the body of a mammal.
  • XII the prostate, XIII) the pancreas, such as ductal carcinoma of the pancreas; XIV) the lymphatic tissue such as lymphomas and other tumors of lymphoid origin, XV) the skin, XVI) cancers and tumor diseases of all anatomical structures belonging to the respiratory systems including thoracal muscles and linings, XVII) primary or secondary cancer ofthe lymph nodes, XVIII) the tongue and ofthe bony structures of the hard palate or sinuses, XVTV) the mouth, cheeks, neck and salivary glands, XX) the blood vessels including the heart and their linings, XXI) the smooth or skeletal muscles and their ligaments and linings, XXII) the peripheral, the autonomous, the central nervous system including the cerebellum, and XXIII) the adipose tissue.
  • the lymphatic tissue such as lymphomas and other tumors of lymphoid origin
  • XV the skin
  • the novel human receptor is highly expressed in the following tissues of the hematological system: Jurkat (T-cells), thymus, bone marrow CD34+ cells, cord blood CD34+ cells.
  • the expression in the above mentioned tissues and in particular the differential expression between diseased tissue Jurkat (T-cells) and healthy tissue leukocytes (peripheral blood) demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose hematological diseases. Additionally the activity ofthe novel human receptor can be modulated to treat hematological disorders.
  • Hemoglobin in red blood cells is the key component for transporting oxygen from the lungs to the tissues.
  • the level of hemoglobin has fallen below 12g/L. Therefore the oxygen carrying capacity of blood is reduced.
  • Common reasons for anemia include acute or chronic blood loss, insufficient levels of erythropoietin synthesis in the kidneys (e.g. in dialysis patients) or insufficient output of red blood cells from bone marrow after chemotherapy or HIV infection etc..
  • Current therapy of anemia is aimed at increasing the hematocrit either by transfusion or by stimulating erythropoiesis with agents such as erythropoietin. The treatment goal is to restore hemoglobin levels above 12g/L.
  • Neutropenia is an abnormally low white blood cell count which causes an increased incidence of infections.
  • causes of neutropenia include: drug-induced (e.g., following cancer chemotherapy), increased destruction of neutrophils (e.g., immune-mediated) or decreased bone marrow function (e.g., familial neutropenia).
  • neutropenia following cancer chemotherapy is currently treated with growth factors such as G-CSF or GM- CSF that stimulate granulopoiesis. The treatment goal is to raise the neutrophil count in order to reduce the susceptibility to infection.
  • Thrombocytopenia is a disorder where the number of platelets is inappropriately low. Since platelets play an essential role in thrombus formation to limit blood loss following vessel injury, insufficient platelet levels may lead to abnormal bleeding. There are many causes of thrombocytopenia including drug-induced thrombocytopenia (e.g., following cancer chemotherapy) and immune thromboytopenia (due to increased degradation of platelets). Platelet transfusions or IL-11 can be used to restore platelet levels in order to reduce the bleeding risk.
  • Aplastic anemia is a life-threatening hematologic disorder characterized by absent or markedly diminished hematopoietic precursors in the bone marrow and resulting in neutropenia, anemia and thrombocytopenia.
  • a large number of agents can cause aplastic anemia (drugs, chemicals and toxins) radiation and certain infections can also induce aplastic anemia. More frequently, aplastic anemia occurs as an unpredictable idiosyncratic reaction to drugs such as anti-inflammatory agents, antibiotics, and antiepileptic drugs.
  • Aplastic anemia typically develops weeks or month during drug administration or delayed after drug administration has been discontinued.
  • aplastic anemia Several congenital and familiar forms of aplastic anemia have been described, including Fanconi's anemia, Shwachman-Diamond syndrome, familiar aplastic anemia, and aplasia associated with dyskeratosis congenita or amega- karyocytic thrompocytopenia.
  • Fanconi's anemia Shwachman-Diamond syndrome
  • familiar aplastic anemia and aplasia associated with dyskeratosis congenita or amega- karyocytic thrompocytopenia.
  • Neurological disorders including Fanconi's anemia, Shwachman-Diamond syndrome, familiar aplastic anemia, and aplasia associated with dyskeratosis congenita or amega- karyocytic thrompocytopenia.
  • the novel human receptor is highly expressed in the following brain tissues: fetal brain, brain, Alzheimer brain, cerebellum (right), cerebellum (left), cerebral cortex, Alzheimer cerebral cortex, frontal lobe, Alzheimer brain frontal lobe, occipital lobe, parietal lobe, temporal lobe, precentral gyrus, vennis cerebelli, pons, substantia nigra, co ⁇ us callosum, hippocampus, thalamus, spinal cord.
  • the expression in brain tissues and in particular the differential expression between diseased tissue Alzheimer brain and healthy tissue brain, between diseased tissue Alzheimer cerebral cortex and healthy tissue cerebral cortex, between diseased tissue Alzheimer brain frontal lobe and healthy tissue frontal lobe demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose nervous system diseases.
  • the activity of the novel human receptor can be modulated to treat nervous system diseases.
  • Neurological disorders include disorders of the central nervous system as well as disorders of the peripheral nervous system. Neurological disorders include, but are not limited to, brain injuries, cerebrovascular diseases and their consequences, Parkinson's disease, corticobasal degeneration, motor neuron disease (including ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post-traumatic brain injury, and small-vessel cerebrovascular disease.
  • Dementias such as Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia and Parkinsonism linked to chromosome 17, frontotemporal dementias (including Pick's disease), progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob dementia, HIV dementia, schizophrenia with dementia, and Korsakoffs psychosis, also are neurological disorders.
  • cognitive-related disorders such as mild cognitive impairment, age-associated memory impairment, age-related cognitive decline, vascular cognitive impairment, attention deficit disorders, attention deficit hyperactivity disorders, and memory disturbances in children with learning disabilities also are considered to be neurological disorders.
  • Pain within the meaning of the invention, is also considered to be a neurological disorder. Pain can be associated with CNS disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • CNS disorders such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • Non-central neuropathic pain includes that associated with post mastectomy pain, phantom feeling, reflex sympathetic dystrophy (RSD), trigeminal neuralgiaradioculopathy, post-surgical pain,
  • HIV/ AIDS related pain cancer pain
  • metabolic neuropathies e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease
  • paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-he ⁇ etic neuralgia. Pain is also associated with peripheral nerve damage, central pain (e.g., due to cerebral ischemia) and various chronic pain (e.g., lumbago, back pain (low back pain), inflammatory and/or rheumatic pain.
  • Headache pain for example, migraine with aura, migraine without aura, and other migraine disorders
  • episodic and chronic tension-type headache tension-type like headache, cluster headache, and chronic paroxysmal hemicrania
  • Visceral pain such as pancreatits, intestinal cystitis, dysmenorrhea, irritable Bowel syndrome, Crohn's disease, biliary colic, ureteral colic, myocardial infarction and pain syndromes of the pelvic cavity, e.g., vulvodynia, orchialgia, urethral syndrome and protatodynia also is a neurological disorder.
  • disorders of the nervous system are acute pain, for example postoperative pain, and pain after trauma.
  • the novel human receptor is highly expressed in the following tissues of the respiratory system: fetal lung, fetal lung fibroblast IMR-90 cells, fetal lung fibroblast MRC-5 cells, lung right upper lobe, lung tumor, trachea.
  • the expression in the above mentioned tissues and in particular the differential expression between diseased tissue fetal lung fibroblast IMR-90 cells and healthy tissue fetal lung, between diseased tissue fetal lung fibroblast MRC-5 cells and healthy tissue fetal lung, between diseased tissue lung tumor and healthy tissue lung demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose of respiratory diseases.
  • the activity of the novel human receptor can be modulated to treat those diseases.
  • allergens typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an
  • IgE-dependent or T cell-dependent hypersensitivity reaction can be local or systemic and typically occur within minutes of allergen exposure in individuals who have previously been sensitized to an allergen.
  • the hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions.
  • Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.
  • Asthma is thought to arise as a result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening ofthe walls ofthe airways that leads to a narrowing ofthe airways, 2) airway hyperresponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation.
  • Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE.
  • effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder.
  • Other resident cells such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology. While the airway obstruction of asthma, presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to irreversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
  • Glycophorin A Cho and Sharom, Cell. Immunol. 145, 223-39, 1992
  • cyclosporin Alexander et al, Lancet 339, 324-28, 1992
  • a nonapeptide fragment of IL-2 Zav'yalov et al, Immunol. Lett. 31, 285-88, 1992
  • cyclosporin is used as a immuno- suppressant after organ transplantation.
  • COPD chronic obstructive pulmonary (or airways) disease
  • COPD chronic obstructive pulmonary (or airways) disease
  • COPD chronic obstructive pulmonary (or airways) disease
  • Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung.
  • Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years.
  • airflow obstruction is usually progressive and is only partially reversible. By far the most important risk factor for development of COPD is cigarette smoking, although the disease does occur in non-smokers.
  • the inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8 + lymphocytes.
  • Inhaled irritants such as cigarette smoke, activate macrophages that are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors.
  • chemokines e.g., interleukin-8
  • chemotactic factors act to increase the neutro- phil/monocyte trafficking from the blood into the lung tissue and airways.
  • Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species.
  • Matrix degradation and emphysema along with airway wall thickening, surfactant dysfunction, and mucus hypersecretion, all are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
  • the novel human receptor is highly expressed in the following tissues of the reproductive system: uterus tumor, ovary, ovary tumor, breast, MDA MB 231 cells (breast tumor).
  • the expression in the above mentioned tissues and in particular the differential expression between diseased tissue uterus tumor and healthy tissue uterus, between diseased tissue ovary tumor and healthy tissue ovary, between diseased tissue MDA MB 231 cells (breast tumor) and healthy tissue breast demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose of reproductive disorders. Additionally the activity of the novel human receptor can be modulated to treat reproductive disorders.
  • Disorders of the male reproductive system include but are not limited to balanoposthitis, balanitis xerotica obliterans, phimosis, paraphimosis, erythroplasia of Queyrat, skin cancer of the penis, Bowen's and Paget's diseases, syphilis, he ⁇ es simplex infections, genital warts, molluscum contagiosum, priapism, peyronie's disease, benign prostatic hype ⁇ lasia (BPH), prostate cancer, prostatitis, testicular cancer, testicular torsion, inguinal hernia, epididymo-orchitis, mumps, hydroceles, spermatoceles, or varicoceles.
  • Impotence may results from vascular impairment, neurologic disorders, drags, abnormalities ofthe penis, or psychological problems.
  • disorders of the female reproductive include premature menopause, pelvic pain, vaginitis, vulvitis, vulvovaginitis, pelvic inflammatory disease, fibroids, menstrual disorders (premenstrual syndrome (PMS), dysmenorrhea, amenorrhea, primary amenorrhea, secondary amenorrhea, menorrhagia, hypomenorrhea, poly- menorrhea, oligomenorrhea, metrorrhagia, menometrorrhagia, Postmenopausal bleeding), bleeding caused by a physical disorder, dysfunctional uterine bleeding, polycystic ovary syndrome (Stein-Leventhal syndrome), endometriosis, cancer of the uterus, cancer of the cervix, cancer of the ovaries, cancer of the vulva, cancer of the vagina, cancer ofthe fallopian tubes, and hydatidiform mole.
  • PMS menstrual syndrome
  • Infertility may be caused by problems with sperm, ovulation, the fallopian tubes, and the cervix as well as unidentified factors.
  • Complications of pregnancy include miscarriage and stillbirth, ectopic pregnancy, anemia, Rh incompatibility, problems with the placenta, excessive vomiting, preeclampsia, eclampsia, and skin rashes (e.g. he ⁇ es gestationis, urticaria of pregnancy) as well as preterm labor and premature rupture ofthe membranes.
  • Breast disorders may be noncancerous (benign) or cancerous (malignant).
  • breast disorders are but are not limited to breast pain, cysts, fibrocystic breast disease, fibrous lumps, nipple discharge, breast infection, breast cancer (ductal carcinoma, lobular carcinoma, medullary carcinoma, tubular carcinoma, and inflammatory breast cancer), Paget's disease ofthe nipple or Cystosarcoma phyllodes.
  • the novel human receptor is highly expressed in the following urological tissues: prostate, prostate BPH, bladder, fetal kidney, kidney, kidney tumor, HEK 293 cells.
  • tissue prostate BPH and in particular the differential expression between diseased tissue prostate BPH and healthy tissue prostate, between diseased tissue kidney tumor and healthy tissue kidney demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose urological disorders.
  • the activity of the novel human receptor can be modulated to treat urological disorders.
  • Genitourinary disorders include benign and malign disorders of the organs constituting the genitourinary system of female and male, renal diseases such as acute or chronic renal failure, immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulo- pathies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hype ⁇ lasia (BPH), neurogenic bladder syndrome, urinary incontinence such as urge-, stress-, or overflow incontinence, pelvic pain, and erectile dysfunction.
  • renal diseases such as acute or chronic renal failure
  • immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulo- pathies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hype ⁇ lasia (BPH), neurogenic bladder syndrome, urinary incontinence such
  • Urinary incontinence is the involuntary loss of urine. Urge urinary incontinence
  • UUI is one of the most common types of UI together with stress urinary incontinence (SUI), which is usually caused by a defect in the urethral closure mechanism.
  • UUI is often associated with neurological disorders or diseases causing neuronal damages such as dementia, Parkinson's disease, multiple sclerosis, stroke and diabetes, although it also occurs in individuals with no such disorders.
  • One of the usual causes of UUI is overactive bladder (OAB) which is a medical condition referring to the symptoms of frequency and urgency derived from abnormal contractions and instability ofthe detrusor muscle.
  • OAB overactive bladder
  • Benign prostatic hype ⁇ lasia is the benign nodular hype ⁇ lasia of the periurethral prostate gland commonly seen in men over the age of 50. The overgrowth occurs in the central area of the prostate called the transition zone, which wraps around the urethra. BPH causes variable degrees of bladder outlet obstruction resulting in progressive lower urinary tract syndromes (LUTS) characterized by urinary frequency, urgency, and nocturia due to incomplete emptying and rapid refilling of the bladder. The actual cause of BPH is unknown but may involve age- related alterations in balance of steroidal sex hormones.
  • LUTS progressive lower urinary tract syndromes
  • the selective alphal-adrenoceptor antagonists such as prazosin, indoramin and tamsulosin are used as an adjunct in the symptomatic treatment of urinary obstruction caused by BPH, although they do not affect on the underlying cause of BPH.
  • BPH increased sympathetic tone exacerbates the degree of obstruction ofthe urethra tlirough contraction of prostatic and urethral smooth muscle.
  • These compounds inhibit sympathetic activity, thereby relaxing the smooth muscle of the urinary tract.
  • Uroselective alpha 1 -antagonists and alphal -antagonists with high tissue selectivity for lower urinary tract smooth muscle that do not provoke hypotensive side-effects should be developed for the treatment.
  • 5alpha-reductase inhibitors such as fmasteride are prescribed for BPH. These agents selectively inhibit 5alpha-reductase, which mediates conversion of testosterone to dihydrotestosterone, thereby reducing plasma dihydrotestosterone levels and thus prostate growth.
  • the 5alpha-reductase inhibitors do not bind to androgen receptors and do not affect testosterone levels nor do they possess feminizing side effects.
  • Androgen receptor antagonists are used for the treatment of prostatic hype ⁇ lasia due to excessive action or production of testosterone.
  • Various antiandrogens are under investigation for BPH including chlormadione derivatives with no estrogenic activity, orally active aromatase inhibitors, luteinizing hormone-releasing hormone (LHRH) analogues.
  • This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human secretin- type GPCR (latrophilin) polypeptide binding molecule
  • an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
  • a reagent which affects secretin-type GPCR (latrophilin) activity can be administered to a human cell, either in vitro or in vivo, to reduce secretin-type GPCR (latrophilin) activity.
  • the reagent preferably binds to an expression product of a human secretin- type GPCR (latrophilin) gene. If the expression product is a protein, the reagent is preferably an antibody.
  • an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
  • the reagent is delivered using a liposome.
  • the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours.
  • a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
  • the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
  • a liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
  • the transfection efficiency of a liposome is about 0.5 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 cells, more preferably about 1.0 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 6 cells, and even more preferably about 2.0 ⁇ g of DNA per 16 nmol of liposome delivered to about 10 6 cells.
  • a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
  • Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
  • a liposome comprises a compound capable of targeting the lipo- some to a particular cell type, such as a cell-specific ligand exposed on the outer surface ofthe liposome.
  • a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151).
  • a reagent such as an antisense oligonucleotide or ribozyme
  • from about 0.1 ⁇ g to about 10 ⁇ g of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988);
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases functional activity relative to the functional activity which occurs in the absence ofthe therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in
  • LD 50 the dose lethal to 50% of the population
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 50 /ED 5 o.
  • compositions that exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity ofthe patient, and the route of administration.
  • Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.
  • Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drag combination(s), reaction sensitivities, and tolerance/response to therapy.
  • Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
  • Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
  • polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g/kg, about 50 ⁇ g to about 5 mg/kg, about 100 ⁇ g to about 500 ⁇ g/kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
  • effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
  • the reagent is preferably an antisense oligonucleotide or a ribozyme.
  • Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a human secretin-type GPCR (latrophilin) gene or the activity of a secretin-type GPCR (latrophilin) polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
  • the effectiveness of the mechanism chosen to decrease the level of expression of a human secretin-type GPCR (latrophilin) gene or the activity of a human secretin-type GPCR (latrophilin) polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to secretin- type GPCR (latrophilin)-specific mRNA, quantitative RT-PCR, immunologic detection of a human secretin-type GPCR (latrophilin) polypeptide, or measurement of functional activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
  • Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act syner-gistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • Any ofthe therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans. Diagnostic methods
  • Human secretin-type GPCR also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the protein. For example, differences can be determined between the cDNA or genomic sequence encoding secretin-type GPCR (latrophilin) in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent ofthe disease.
  • Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
  • cloned DNA segments can be employed as probes to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
  • DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures ⁇ see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl.
  • the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
  • Altered levels of secretin-type GPCR also can be detected in various tissues.
  • Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
  • the polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4-secretin-type GPCR (latrophilin) polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and centrifuged at 1000 ⁇ m for 5 minutes at 4 °C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4 °C. The pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO 4 , 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 % BSA, 2 ⁇ g/ml aprotinin,
  • Optimal membrane suspension dilutions defined as the protein concentration required to bind less than 10 % of the added radioligand, are added to 96-well polypropylene microtiter plates containing 125 I-labeled ligand, i.e. secretin, non-labeled peptides, and binding buffer to a final volume of 250 ⁇ l.
  • membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125 I-labeled ligand. Binding reaction mixtures are incubated for one hour at 30 °C. The reaction is stopped by filtration tlirough GF/B filters treated with 0.5%) polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program.
  • Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide.
  • Human embryonic kidney 293 cells transfected with a polynucleotide which expresses human secretin-type GPCR (latrophilin) are scraped from a culture flask into 5 ml of Tris HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 ⁇ m for 5 minutes at 4 °C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4 °C.
  • the pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO 4 , 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 %> BSA, 2 ⁇ g/ml aprotinin, 0.5 mg/ml leupeptin, and 10 ⁇ g/ml phosphoramidon.
  • Optimal membrane suspension dilutions defined as the protein concentration required to bind less than 10 %> of the added radioligand, are added to 96-well polypropylene microtiter plates containing 125 I-labeled ligand or test compound, non-labeled peptides, and binding buffer to a final volume of 250 ⁇ l.
  • membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125 I-labeled ligand or test compound (specific activity 2200 Ci/mmol).
  • concentrations 0.1 nM to 4 nM
  • 125 I-labeled ligand or test compound specific activity 2200 Ci/mmol.
  • the binding affinities of different test compounds are determined in equilibrium competition binding assays, using 0.1 nM 125 I-peptide in the presence of twelve different concentrations of each test compound.
  • Binding reaction mixtures are incubated for one hour at 30 °C.
  • the reaction is stopped by filtration through GF/B filters treated with 0.5% polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program.
  • Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide. Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard.
  • a test compound which increases the radioactivity of membrane protein by at least 15% relative to radioactivity of membrane protein which was not incubated with a test compound is identified as a compound which binds to a human secretin-type GPCR (latrophilin) polypeptide.
  • EXAMPLE 3 Effect of a test compound on human secretin-type GPCR (latrophilin) -mediated cyclic AMP formation
  • Receptor-mediated inhibition of cAMP formation can be assayed in host cells which express human secretin-type GPCR (latrophilin).
  • Cells are plated in 96-well plates and incubated in Dulbecco's phosphate buffered saline (PBS) supplemented with 10 mM HEPES, 5 mM theophylline, 2 ⁇ g/ml aprotinin, 0.5 mg/ml leupeptin, and 10 ⁇ g/ml phosphoramidon for 20 minutes at 37 °C in 5%> CO2.
  • a test compound is added and incubated for an additional 10 minutes at 37 °C.
  • the medium is aspirated, and the reaction is stopped by the addition of 100 mM HCl.
  • the plates are stored at 4 °C for 15 minutes.
  • cAMP content in the stopping solution is measured by radioimmunoassay.
  • Radioactivity is quantified using a gamma counter equipped with data reduction software.
  • a test compound which decreases radioactivity of the contents of a well relative to radioactivity ofthe contents of a well in the absence of the test compound is identified as a potential inhibitor of cAMP formation.
  • a test compound which increases radioactivity of the contents of a well relative to radioactivity of the contents of a well in the absence of the test compound is identified as a potential enhancer of cAMP formation.
  • Intracellular free calcium concentration can be measured by microspectrofluorometry using the fluorescent indicator dye Fura-2/AM (Bush et al, J. Neurochem. 57, 562-
  • Stably transfected cells are seeded onto a 35 mm culture dish containing a glass coverslip insert. Cells are washed with HBS , incubated with a test compound, and loaded with 100 ⁇ l of Fura-2/AM (10 ⁇ M) for 20-40 minutes. After washing with HBS to remove the Fura-2/AM solution, cells are equilibrated in HBS for 10-20 minutes. Cells are then visualized under the 40X objective of a Leitz Fluovert FS microscope.
  • Fluorescence emission is determined at 510 nM, with excitation wavelengths alternating between 340 nM and 380 nM.
  • Raw fluorescence data are converted to calcium concentrations using standard calcium concentration curves and software analysis techniques.
  • Cells which stably express human secretin-type GPCR (latrophilin) cDNA are plated in 96-well plates and grown to confluence. The day before the assay, the growth medium is changed to 100 ⁇ l of medium containing 1% serum and 0.5 ⁇ Ci H- myinositol. The plates are incubated overnight in a CO 2 incubator (5% CO 2 at 37
  • the medium is removed and replaced by 200 ⁇ l of PBS containing 10 mM LiCl, and the cells are equilibrated with the new medium for 20 minutes. During this interval, cells also are equilibrated with antagonist, added as a 10 ⁇ l aliquot of a 20-fold concentrated solution in PBS.
  • the H-inositol phosphate accumulation from inositol phospholipid metabolism is started by adding 10 ⁇ ml of a solution containing a test compound. To the first well 10 ⁇ l are added to measure basal accumulation. Eleven different concentrations of test compound are assayed in the following 11 wells of each plate row. All assays are performed in duplicate by repeating the same additions in two consecutive plate rows. The plates are incubated in a CO 2 incubator for one hour. The reaction is terminated by adding 15 ⁇ l of 50% v/v trichloroacetic acid (TCA), followed by a 40 minute incubation at 4 °C. After neutralizing TCA with 40 ⁇ l of 1 M Tris, the content ofthe wells is transferred to a Multiscreen HV filter plate (Millipore) containing Dowex
  • the filter plates are prepared by adding 200 ⁇ l of Dowex AG1-X8 suspension (50% v/v, wate ⁇ resin) to each well. The filter plates are placed on a vacuum manifold to wash or elute the resin bed. Each well is washed 2 times with 200 ⁇ l of water, followed by 2 x 200 ⁇ l of 5 mM sodium tetraborate/60 mM ammonium formate.
  • the 3 H-IPs are eluted into empty 96-well plates with 200 ⁇ l of 1.2 M ammonium formate/0.1 formic acid.
  • the content of the wells is added to 3 ml of scintillation cocktail, and radioactivity is determined by liquid scintillation counting.
  • Binding assays are carried out in a binding buffer containing 50 mM HEPES, pH 7.4, 0.5% BSA, and 5 mM MgCl 2 .
  • GPCR (latrophilin) polypeptides is carried out as follows in 96 well microtiter plates
  • Radioligand is diluted in binding buffer+ PMSF/Baci to the desired cpm per 50 ⁇ l, then 50 ⁇ l aliquots are added to the wells. For non-specific binding samples, 5 ⁇ l of 40 ⁇ M cold ligand also is added per well. Binding is initiated by adding 150 ⁇ l per well of membrane diluted to the desired concentration (10-30 ⁇ g membrane protein/well) in binding buffer+
  • membrane pellets are resuspended in 200 ⁇ l per microtiter plate well of ice-cold binding buffer without BSA. Then 5 ⁇ l per well of 4 mM N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOS, Pierce) in DMSO is added and mixed. The samples are held on ice and
  • Radiolabeled proteins are visualized by autoradiography ofthe dried gels with Kodak XAR film and DuPont image intensifier screens.
  • Membrane solubilization is carried out in buffer containing 25 mM Tris , pH 8, 10% glycerol (w/v) and 0.2 mM CaCl 2 (solubilization buffer).
  • the highly soluble detergents including Triton X-100, deoxycholate, deoxycholate:lysolecithin, CHAPS, and zwittergent are made up in solubilization buffer at 10%) concentrations and stored as frozen aliquots. Lysolecithin is made up fresh because of insolubility upon freeze-thawing and digitonin is made fresh at lower concentrations due to its more limited solubility.
  • washed pellets after the binding step are resuspended free of visible particles by pipetting and vortexing in solubilization buffer at 100,000 x g for 30 minutes. The supernatants are removed and held on ice and the pellets are discarded.
  • the intact R:L complex can be assayed by four different methods. All are carried out on ice or in a cold room at 4-10 °C).
  • Binding of biotinyl-receptor to GH 4 CI membranes is carried out as described above. Incubations are for 1 hour at room temperature. In the standard purification protocol, the binding incubations contain 10 nM Bio-S29. 12S I ligand is added as a tracer at levels of 5,000-100,000 cpm per mg of membrane protein. Control incubations contain 10 ⁇ M cold ligand to saturate the receptor with non-biotinylated ligand.
  • Solubilization of receptor igand complex also is carried out as described above, with 0.15% deoxycholate ysolecithin in solubilization buffer containing 0.2 mM MgCl 2 , to obtain 100,000 x g supernatants containing solubilized R:L complex.
  • SA-agarose Chemical Co.; "SA-agarose”
  • solubilization buffer is added to the solubilized membranes as 1/30 of the final volume. This mixture is incubated with constant stirring by end-over-end rotation for 4-5 hours at 4-10 °C. Then the mixture is applied to a column and the non-bound material is washed through. Binding of radioligand to SA-agarose is determined by comparing cpm in the 100,000 x g supernatant with that in the column effluent after adso ⁇ tion to SA-agarose.
  • Eluates from the streptavidin column are incubated overnight (12-15 hours) with immobilized wheat germ agglutinin (WGA agarose, Vector Labs) to adsorb the receptor via interaction of covalently bound carbohydrate with the WGA lectin.
  • the ratio (vol/vol) of WGA-agarose to streptavidin column eluate is generally 1:400. A range from 1:1000 to 1:200 also can be used.
  • the resin is pelleted by centrifugation, the supernatant is removed and saved, and the resin is washed 3 times (about 2 minutes each) in buffer containing 50 mM HEPES, pH 8, 5 mM MgCl 2j and 0.15% deoxycholate:lysolecithin.
  • the resin is extracted three times by repeated mixing (vortex mixer on low speed) over a 15-30 minute period on ice, with 3 resin columns each time, of 10 mM N-N'-N"-triacetylchitotriose in the same HEPES buffer used to wash the resin. After each elution step, the resin is centrifuged down and the supernatant is carefully removed, free of WGA-agarose pellets. The three, pooled eluates contain the final, purified receptor.
  • the material non-bound to WGA contain G protein subunits specifically eluted from the streptavidin column, as well as non-specific contaminants. All these fractions are stored frozen at -90 °C
  • the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human secretin-type GPCR (latrophilin) polypeptides in yeast.
  • the secretin-type GPCR (latrophilin)-encoding DNA sequence is derived from SEQ ID NO:l. Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its
  • DNA sequence is ligated into pPICZB.
  • This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter.
  • the resulting pPICZ/md-His6 vector is used to transform the yeast.
  • the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea.
  • the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation ofthe polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human secretin-type GPCR (latrophilin) polypeptide is obtained.
  • Purified secretin-type GPCR (latrophilin) polypeptides comprising a glutathione-S- transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • Human secretin-type GPCR (latrophilin) polypeptides comprise the amino acid sequence shown in SEQ ID NO:2.
  • the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
  • the buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a human secretin-type GPCR (latrophilin) polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human secretin-type GPCR (latrophilin) polypeptide.
  • test compound is administered to a culture of human cells transfected with a secretin-type GPCR (latrophilin) expression construct and incubated at 37 °C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled secretin-type GPCR (latrophilin)-specific probe at 65 ° C in Express-hyb (CLONTECH).
  • the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO:l.
  • a test compound that decreases the secretin-type GPCR (latrophilin)-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of secretin- type GPCR (latrophilin) gene expression.
  • the qualitative expression pattern of secretin-type GPCR (latrophilin) in various tissues is determined by Reverse Transcription-Polymerase Chain Reaction (RT- PCR).
  • secretin-type GPCR (latrophilin) is involved in the disease process of diabetes
  • the following whole body panel is screened to show predominant or relatively high expression: subcutaneous and mesenteric adipose tissue, adrenal gland, bone marrow, brain, colon, fetal brain, heart, hypothalamus, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, thyroid, trachea, and uterus.
  • Human islet cells and an islet cell library also are tested.
  • the expression of secretin-type GPCR (latrophilin) in cells derived from normal individuals with the expression of cells derived from diabetic individuals is compared.
  • secretin-type GPCR (latrophilin) is involved in the disease process of obesity
  • expression is determined in the following tissues: subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle small intestine, spleen, stomach, testes, thymus, thyroid trachea, and uterus.
  • Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et al, BioTechnology
  • the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in direct proportion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
  • RNAs labeled "from autopsy” were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
  • RNA Fifty ⁇ g of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l RNase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; lOmM MgCl 2 ; 50 mM NaCl; and 1 mM DTT.
  • RNA is extracted once with 1 volume of pheno chloro- form:isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
  • RNA from the autoptic tissues Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectro- photometric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is 200ng/ ⁇ L. Reverse transcription is carried out with 2.5 ⁇ M of random hexamer primers.
  • TaqMan quantitative analysis Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy-tetra- methyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
  • FAM 6-carboxy-fluorescein
  • TAMRA 6-carboxy-tetra- methyl-rhodamine
  • Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents
  • PDAR Poly Applied Biosystems, CA
  • the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 ⁇ l.
  • the experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA).
  • fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
  • Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle-treated control group.
  • Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hyperinsulinemic and insulin resistant.
  • the animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group.
  • Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group.
  • Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load.
  • compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice.
  • an intravenous glucose load (0.4g/kg) is given, blood is collected one minute later.
  • Plasma insulin levels are determined.
  • Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined.
  • Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load.
  • test compounds which regulate secretin-type GPCR latrophilin
  • latrophilin are administered by different routes (p.o., i.p., s.c, or i.v.) to overnight fasted normal rats or mice.
  • an intravenous glucose load 0.4g/kg
  • Plasma insulin levels are determined.
  • Test compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • mice When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60, and 90 minutes and plasma glucose levels determined. Test compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • mice Effects on plasma cholesterol levels including HDL cholesterol are typically assessed in humanized apo-AI transgenic mice. Modulation of human target proteins can be determined in corresponding transgenic mice (e.g., CETP transgenic mice). Tri- glyceride lowering is usually evaluated in ob/ob mice or Zucker rats. Animals are fed with normal diets or modified diets (e.g., enriched by 0.5 % cholesterol 20% coconut oil). Standard protocols consist of oral applications once daily for 7 to 10 days at doses ranging from 0,1 to 100 mg/kg. The compounds are dissolved ⁇ e.g., in
  • Plasma cholesterol and triglyceride levels are determined with standardized clinical diagnostic kits (e.g., INFINITYTM cholesterol reagent and INFINITYTM triglyceride reagent; Sigma, St. Louis).
  • HDL cholesterol is determined after phosphotungstic acid precipitation of non-HDL lipoproteins or FPLC gel filtration with post-column derivatization of cholesterol using the reagents mentioned above.
  • Plasma levels of human apolipoprotein- Al in relevant humanized transgenic mice are measured by immunoturbidimetry (Sigma).
  • mice Male Wistar rats weighing 300-350 g (Harlan Winkelmann, Borchen, Germany) are anesthetized with thiopental "Nycomed” (Nycomed, Kunststoff, Germany) 100 mg kg-1 i.p. A tracheotomy is performed, and catheters are inserted into the femoral artery for blood pressure and heart rate measurements (Gould pressure transducer and recorder, model RS 3400) and into the femoral vein for substance administration. The animals are ventilated with room air and their body temperature is controlled. Test compounds are administered orally or intravenously.
  • Female conscious SHR (Moellegaard/Denmark, 220 - 290 g) are equipped with implantable radiotelemetry, and a data aquisition system (Data Sciences, St. Paul, MN, USA), comprising a chronically implantable transducer/transmitter unit equipped with a fluid-filled catheter is used.
  • the transmitter is implanted into the peritoneal cavity, and the sensing catheter is inserted into the descending aorta.
  • the animals of control groups only receive the vehicle. Before treatment, mean blood pressure and heart rate of treated and untreated control groups are measured.
  • a parasympathetic blockade is achieved by intermittent injections of atropine (0.1 mg per animal) (AtropinsulfatR, Eifelfango, Bad Neuenahr, Germany). After intubation the animals are artificially ventilated at constant volume (EngstromR 300, Engstr ⁇ m, Sweden) with room air enriched with 30% oxygen to maintain an end-tidal CO2 concentration of about 5% (NormocapR, Datex, Finland).
  • a tip catheter for recording of left ventricular pressure is inserted into the ventricle via the carotid artery (PC350, Millar Instruments, Houston, TX, USA), a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1, Telos Medical, Upland, CA, USA for recording of arterial blood pressure, two venous catheters are inserted into either femoral vein and one additional catheter into a forearm vein for application of the anaesthetic and drags, respectively, and an oxymetry catheter for recording of oxygen saturation is inserted into the coronary sinus via the jugular vein (Schwarzer IVH4, M ⁇ nchen, Germany).
  • LCX left coronary artery
  • LCX left coronary artery
  • an electromagnetic flow probe Gould Statham, Oxnard, CA, USA
  • Arterial blood pressure, electrocardiogram (lead II), left ventricular pressure, first derivative of left ventricular pressure (dP/dt), heart rate, coronary blood flow, and oxygen saturation in the coronary sinus are continuously recorded on a pen recorder (Brash, Gould, Cleveland, OH, USA).
  • the maximum of dP/dt is used as measure of left ventricular contractility (dP/dtmax).
  • test compound is intra- venously applied as bolus injections. Care is taken that all measured cardiovascular parameters have returned to control level before injection of the next dose.
  • Each dose of the test compound is tested at least three times in different animals. The order of injection ofthe different doses is randomized in each animal.
  • the pu ⁇ ose of this protocol is to determine the effect of chronic administration of an unknown compound on body weight and food and water consumption in obese Zucker fa/fa rats.
  • Obese Zucker fa/fa rats are frequently used in the determination of compound efficacy in the reduction of body weight.
  • This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans (Al-Barazanji et al, Obes. Res. 8, 317-23, 2000; Assimacopoulos-Jeannet et al, Am. J. Physiol. 260 (2 Pt 2):R278-83, 1991; Dryden et al, Horm. Metab. Res.
  • Animals are orally gavaged (2ml/kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/compound. At this time, body weight, food and water consumption are measured. On the final day, animals are euthanized using CO 2 inhalation.
  • the pu ⁇ ose of this protocol is to determine the effect of chronic administration of an unknown compound on body weight of mice made obese by exposure to a 45% kcal/g high fat diet during more than 10 weeks.
  • the body weight of mice selected for the studies is higher than three standard deviations from the weight of a control group of mice fed standard low fat (5-6% fat) mouse chow.
  • Diet-induced obese (DIO) animals are frequently used in the determination of compound efficacy in the reduction of body weight (Brown et al, Br. J. Pharmacol. 132, 1898-1904, 2001; Guerre-Millom et al, J. Biol. Chem. 275 (22), 16638-42, 2000; Han et al, Int. J. Obes.
  • Mice are kept in standard animal rooms under controlled temperature and humidity and a 12/12 light dark cycle. Water and food are continuously available. Mice are single housed in shoeboxes. Animals are sham dosed with study vehicle for at least four days before the recording of two-days baseline measurement of body weight and 24 hr food and water consumption. Mice are assigned to one of 6-8 treatment groups based upon their body weight on baseline. The groups are set up so that the mean and standard error of the mean of body weight were similar.
  • Animals are orally gavaged (5ml/kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/compound. At this time, body weight, food and water consumption are measured. Data is analyzed using appropriate statistics following the research design. On the final day, animals are euthanized using CO 2 inhalation.
  • the pu ⁇ ose of this protocol is to determine the effect of a single dose of an unknown compound on food consumption of lean overnight fasted rats.
  • the fasted-refed rat model is frequently used in the field of obesity to identify compounds with potential for anorectic effects.
  • This animal model has been successfully used in the identi- fication and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans.
  • the efficacy test The rats are fasted overnight during the dark phase (total of approx. 16-18 hrs). The animal is dosed orally with his assigned treatment (2mg/ml). One hour after dosing, pre-weighed food jars are returned to the cage. Food intake is recorded 30, 60, 90, 180, 240 minutes post food return. At each time point, spillage is returned to the food jar and then the food jars are weighed. The amount of food consumed is determined for each time point. Difference between treatment group is determined using appropriate statistical analysis. Blavet et al, Gen Pharmacology 13, 293-97, 1982; Grignaschi et al, Br. J. Pharmacol. 127, 1190-94, 1999;
  • the cell line used for testing is the human colon cancer cell line HCT116.
  • Cells are cultured in RPMI-1640 with 10-15% fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37 °C in a 95% air/5%CO 2 atmosphere.
  • Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems
  • Model 380B DNA synthesizer using phosphoroamidite chemistry A sequence of 24 bases complementary to the nucleotides at position 1 to 24 of SEQ ID NO:l is used as the test oligonucleotide. As a control, another (random) sequence is used: 5' -TCA ACT GAC TAG ATG TAC ATG GAC-3'. Following assembly and deprotection, oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate buffered saline at the desired concentration. Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligo- nucleotides are added to the culture medium at a concentration of 10 ⁇ M once per day for seven days.
  • test oligonucleotide for seven days results in significantly reduced expression of human methyltransferase as determined by Western blotting. This effect is not observed with the control oligonucleotide.
  • the number of cells in the cultures is counted using an automatic cell counter. The number of cells in cultures treated with the test oligonucleotide (expressed as 100%) is compared with the number of cells in cultures treated with the control oligonucleotide. The number of cells in cultures treated with the test oligonucleotide is not more than 30% of control, indicating that the inhibition of human methyltransferase has an anti-proliferative effect on cancer cells.
  • This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus.
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c).
  • test compound p.o., i.p., i.v., i.m., or s.c
  • Plasma is assayed for levels ofthe hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level ofthe hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m. into mice at a dosage of a biologic stimulus (i.e., LHRH may be injected i.m. into mice at a dosage of a biologic stimulus (i.e., LHRH may be injected i.m. into mice at a dosage of
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
  • specific readout assay protocol these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetermined duration (i.e., 1 week).
  • animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded.
  • Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent.
  • Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle-treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value ⁇ 0.05 compared to the vehicle control group. Hollow- Fiber Proliferation Assay
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol.
  • Cell proliferation is determined by measuring a marker of cell number (i.e., MTT or LDH). The cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
  • Hydron pellets with or without growth factors or cells are implanted into a micropocket surgically created in the rodent cornea.
  • Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet).
  • Corneas are harvested at 7 days post implantation immediately following intracardiac infusion of colloidal carbon and are fixed in 10%> formalin. Readout is qualitative scoring and/or image analysis. Qualitative scores are compared by Rank Sum test.
  • Image analysis data is evaluated by measuring the area of neovascularization (in pixels) and group averages are compared by Student's t-test (2 tail). Significance is p
  • ⁇ 0.05 as compared to the growth factor or cells only group.
  • Matrigel containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at prede- termined time point(s) and prepared for readout. Readout is an ELISA-based assay for hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an F- test, with significance determined at p ⁇ 0.05 as compared to the vehicle control group.
  • Tumor cells or fragments are implanted subcutaneously on Day 0.
  • Vehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1 , prior to the ability to measure the tumor burden.
  • Body weights and tumor measurements are recorded 2-3 times weekly. Mean net body and tumor weights are calculated for each data collection day.
  • Anti- tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan- Meier curves from the times for individual tumors to attain the evaluation size. Significance is p ⁇ 0.05.
  • Tumor cells are injected intraperitoneally or intracranially on Day 0.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting on Day 1. Observations of morbidity and/or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long- term survivors is indicated separately. Survival times are used to generate Kaplan- Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
  • Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • Tumor cells or fragments, of mammary adenocarcinoma origin are implanted directly into a surgically exposed and reflected mammary fat pad in rodents.
  • the fat pad is placed back in its original position and the surgical site is closed.
  • Hormones may also be administered to the rodents to support the growth of the tumors.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size.
  • Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • this model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells or fragments, of prostatic adenocarcinoma origin are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents.
  • the prostate is externalized tlirough an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles.
  • the successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed.
  • Hormones may also be administered to the rodents to support the growth of the tumors.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule.
  • Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in tliree dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
  • Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the lungs), or measuring the target organ weight (i.e., the regional lymph nodes). The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells of pulmonary origin may be implanted intrabronchially by making an incision through the skin and exposing the trachea.
  • the trachea is pierced with the beveled end of a 25 gauge needle and the tumor cells are inoculated into the main bronchus using a flat-ended 27 gauge needle with a 90° bend.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination ofthe study by counting the number of visible foci per target organ (i.e., the contralateral lung), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a 27 or 30 gauge needle. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in tliree dimensions using either a caliper or an ocular micrometer attached to a dissecting scope. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t- test to compare tumor sizes in the treated and control groups at the end of treatment.
  • Significance is p ⁇ 0.05 as compared to the control group.
  • This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
  • Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the liver), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined.
  • Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment for both of these endpoints.
  • Tumor cells are injected into the tail vein, portal vein, or the left ventricle ofthe heart in experimental (forced) lung, liver, and bone metastasis studies, respectively.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c according to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
  • Mononuclear cells from fresh blood were separated by FicoU Paque® (1.077 density, Amersham-Pharmacia) density gradient centrifugation, and CD34+ cells were purified by immunomagnetic separation system (MiniMACS, Miltenyi Biotec), according to the manufacture's instructions (Direct CD34 Progenitor Cell Isolation Kit, Miltenyi Biotec). The percentage of CD34+ cells were generally from 90-95%).
  • l-2xl0 4 CD34 + cells were plated in triplicate in 24-well plates with 1ml Iscoves modified Dulbecco medium (IMDM) (Invitrogen) containing 10% fetal bovine serum (FCS, Invitrogen), 1% Glutamine (Invitrogen) supplemented with SCF (25ng/ml) (PeproTech), different concentration of Erythropoietin (O.OlU/ml - IU/ml) (Erypo® FS 4000, Cilag) with or without compounds. Control cells were incubated with 0.1- 0.2% DMSO instead of compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO 2 . After 9 to 14 days cells were harvested, counted and stained with phycoerythrin (PE)-conjugated mAb against Glycophorin A (Pharmingen) to analyze differentiation.
  • IMDM Iscoves modified Dulbecco medium
  • lxl 0 5 Cord Blood CD34 + cells/ml were cultured in IMDM containing 15% BIT-9500 (Cell Systems®), supplemented with IL-3 (lOng/ml), IL-6 (lOng/ml) and SCF
  • CD34+ cells/ml were cultured in IMDM containing 15% BIT- 9500 supplemented with IL-3 (lOng/ml), IL-6 (lOng/ml) and SCF (25ng/ml) and incubated at 37°C in a fully humidified atmosphere with 5% CO 2 . 3 and 5 days after initiation of culture an equal volume of fresh medium supplemented with 2X cytokines were added. On day 6 to 7 cells were stained with PE-conjugated mAb against CD36 (Pharmingen) and CD36+ cells were purified using anti-PE microbeads and Mini MACS system (Miltenyi Biotec) according to the manufacture's instructions.
  • CD36+ cells were plated in triplicate 24well plates with 1ml IMDM containing 10% FCS, 1% Glutamine supplemented with SCF (25ng/ml), different concentration of Erythropoietin (O.OlU/ml - IU/ml) with or without compounds.
  • Control cells were incubated with 0.1-0.2% DMSO instead of compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO 2 . After 6 to 8 days cells were harvested and counted to analyze proliferation.
  • CD34+ cells isolated from peripheral blood, cord blood or from bone marrow were pre-incubated in quadruplicate in 24-well plates in 1ml medium (StemSpan) with 15% FCS, SCF (20 ng/ml) and GM-CSF (2,5 ng/ml) for 6 to 7 days at 37°C and 5.5% CO2. Then compounds (0.1.1 or 10 ⁇ M in DMSO) with or without G-CSF (0.25 ng/ml; Neupogen ®) were added and incubated for another 6 to 7 days.
  • the number of the early myelopoietic CD15+/CDl lb- cells and the number of the late myelopoietic CD15+/CDllb+ cells were determined by cell count (proliferation) and FACS (fluorescent associated cell sorting) analysis (differentiation) at day 13-14.
  • CD34+ cells isolated from peripheral blood, cord blood or from bone marrow were incubated in quadruplicate 24-well plates in 1 ml serum-free medium with 2%> BSA , SCF (20 ng/ml) and compounds ( 0.1,1 or 10 ⁇ M in DMSO) with or without TPO (0-lOng/ml) for 12 to 13 days at 37°C and 5% CO 2 .
  • the number of the megakaryoid CD41+ cells (scatter profile) were determined by FACS analysis.
  • mice were used for compound testing.
  • other species e.g. rats, hamsters or guinea pigs have been used in addition.
  • repeated dosage is required for detection of changes in peripheral blood parameters.
  • blood samples were drawn for analysis of red and white blood cell counts as well as platelet counts using an automated blood analyzer.
  • erythropoiesis was assessed by manual hematocrit and reticulocyte count determination. For specific analysis of leukocyte differentiation fluorescent associated cell sorting (FACS) was used.
  • FACS leukocyte differentiation fluorescent associated cell sorting
  • Immunocompetent Balb/c mice were treated with compounds at different doses (based on pharmacokinetic data) once/day or bid per-orally or parenterally for up to 4 days.
  • the WBC white blood cells count
  • the neutrophil count were monitored by FACS (CDllb+ ; scatter properties).
  • Immunocompromised Balb/c were generated by intravenous treatment with 5-FU (100 mg/kg ip). 24 hours later the mice were treated with the test compound at different doses (based on pharmacokinetic data) once/day or bid per-orally or parenterally for up to 7 to 13 days.
  • Peripheral blood counts (WBC, RBC, PLT) have been determined after retroorbital plexus puncture at days 5,7,11 and 14.
  • WBC, RBC, PLT Peripheral blood counts
  • the expression of specific differentiation markers on stem and progenitor cells e.g. CD34, CD33, CD38, GDI lb
  • scatter properties were investigated.
  • Thrombopoietic compounds at different doses were administered orally or parenterally following chemotherapy (Carboplatin, 100 mg/kg ip) immunocompromised mice. After repeated administration (once/day or bid for five to seven days) peripheral blood platelets (automated blood analyzer) have been determined after retroorbital plexus puncture at day 5, 7, 11, and 14.
  • Acute pain is measured on a hot plate mainly in rats.
  • Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to
  • the other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a hind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5%> formalin or 10 to 100 ⁇ g capsaicin is injected into one hind paw ofthe experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, Lev., s.c, intradermal, transdermal) prior to formalin or capsaicin administration.
  • application routes i.v., i.p., p.o., i.t, Lev., s.c, intradermal, transdermal
  • Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia.
  • the first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve.
  • the second variant is the tight ligation of about the half of the diameter of the common sciatic nerve.
  • a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% spinal nerve only.
  • the fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
  • the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia.
  • Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc-Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey System, Somedic Sales AB, Horby, Sweden).
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10 °C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity.
  • a further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb.
  • Chronic pain in general is assessed by registering the circadanian rhythms in activity (Surjo and
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Inflammatory Pain Inflammatory Pain is induced mainly in rats by injection of 0.75 mg carrageenan or complete Freund's adjuvant into one hind paw. The animals develop an edema with mechanical allodynia as well as thermal hyperalgesia.
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal
  • Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal
  • 6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic nigrostriatal and striatopallidal pathways is the central pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
  • MFB medium forebrain bundle
  • mice Male Wistar rats (Harlan Winkelmann, Germany), weighing 200+250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques.
  • DA nigrostriatal pathway 4 ⁇ l of 0.01% ascorbic acid-saline containing 8 ⁇ g of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 ⁇ l/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
  • Stepping Test Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol. In brief, the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface.
  • Balance Test Balance adjustments following postural challenge are also measured during the stepping test sessions.
  • the rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score
  • test 3 is given for no reaction of movement.
  • the test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
  • Staircase Test (Paw Reaching).
  • a modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement.
  • Plexiglass test boxes with a central platform and a removable staircase on each side are used.
  • the apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use.
  • For each test the animals are left in the test boxes for 15 min.
  • the double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side.
  • MPTP mesencephalic dopaminergic
  • DAergic mesencephalic dopaminergic
  • TH tyrosine hydroxylase
  • mice are perfused transcardially with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% > paraformaldehyde (Merck) in PBS for 15 min.
  • the brains are removed and placed in 4% paraformaldehyde for 24 h at 4 °C. For dehydration they are then transferred to a 20% sucrose (Merck) solution in 0.1 M PBS at 4 °C until they sink.
  • the brains are frozen in methylbutan at -20 °C for 2 min and stored at -70 °C.
  • sledge microtome (mod. 3800-Frigocut, Leica) 25 ⁇ m sections are taken from the genu of the co ⁇ us callosum (AP 1.7 mm) to the hippocampus (AP 21.8 mm) and from AP 24.16 to AP 26.72. Forty-six sections are cut and stored in assorters in 0.25 M Tris buffer (pH 7.4) for immunohistochemistry.
  • TH free-floating tyrosine hydroxylase
  • DAB Diaminobenzidine tetrahydrochloride
  • Rotarod Test We use a modification of the procedure described by Rozas and Labandeira-Garcia (1997), with a CR-1 Rotamex system (Columbus Instruments, Columbus, OH) comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit.
  • the rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse.
  • the system software allows preprogramming of session protocols with varying rotational speeds (0-80 ⁇ m). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod.
  • the system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded.
  • the system also allows a weak current to be passed through the base grid, to aid training.
  • the object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents.
  • a rat is placed in an open field, in which two identical objects are present.
  • the rats inspects both objects during the first trial of the object recognition task.
  • a second trial after a retention interval of for example 24 hours, one ofthe two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field.
  • the inspection time at each ofthe objects is registered.
  • the basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
  • Administration of the putative cognition enhancer prior to the first trial predominantly allows assessment of the effects on acquisition, and eventually on consolidation processes.
  • Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
  • the passive avoidance task assesses memory performance in rats and mice.
  • the inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment.
  • Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours. In the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec.
  • the rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
  • the guillotine door between the compartments is lowered as soon as the rat has entered the dark compartment with its four paws, and a scrambled 1 mA footshock is administered for 2 sec.
  • the rat is removed from the apparatus and put back into its home cage.
  • the procedure during the retention session is identical to that ofthe habituation sessions.
  • the step-through latency that is the first latency of entering the dark compartment (in sec.) during the retention session is an index of the memory performance of the animal; the longer the latency to enter the dark compartment, the better the retention is.
  • the Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice.
  • the performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank.
  • Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence ofthe experimenter, and by a radio on a shelf that is playing softly.
  • the animals receive four trials during five daily acquisition sessions.
  • a trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized.
  • the escape platform is always in the same position.
  • a trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds.
  • an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds.
  • the probe trial all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
  • mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits are used.
  • the T-maze spontaneous alternation task assesses the spatial memory performance in mice.
  • the start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter. A mouse is put into the start arm at the beginning of training. The guillotine door is closed. In the first trial, the 'forced trial', either the left or right goal arm is blocked by lowering the guillotine door.
  • the mouse After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door. Then, the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
  • the percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials (in s) is analyzed.
  • Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start ofthe training session. Scopolamine reduced the per-cent alternations to chance level, or below.
  • a cognition enhancer which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
  • mice are injected with a single intravenous injection of 10 ⁇ g of 145-2C11
  • test compound is administered intraperitoneally 60 min prior to the anti-CD3 mAb injection. Blood is collected 90 minutes after the antibody injection. Serum is obtained by centrifugation at 3000 r.p.m. for 10 min. IL-2 and IL-4 levels in the serum are determined by an ELISA.
  • mice are injected intravenously with 0.8 mg of purified goat anti-mouse IgD antibody or PBS (defined as day 0). Compound is administered intraperitoneally from day 0 to day 6. On day 7 blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for 10 min. Serum total levels of IgE are determined by YAMASA's ELISA kit and their lg subtypes are done by an lg ELISA KIT (Rougier Biotech's, Montreal, Canada).
  • mice are injected intraperitoneally with LPS (200 ⁇ g/mouse). Compound is administered intraperitoneally 1 hr before the LPS injection. Blood is collected at 90 min post-LPS injection and plasma is obtained. TNF- ⁇ concentration in the sample is determined using an ELISA kit.
  • mice are injected intradermally with a 2.5 ml of air on days -6 and -3 to prepare ai ⁇ ouch.
  • compound On day 0 compound is administered intraperitoneally 60 min before eotaxin injection (3 ⁇ g/mouse, i.d.).
  • IL-5 300 ng/mouse
  • leukocytes in exudate is collected and the number of total cells is counted.
  • the differential cell counts in the exudate are performed by staining with May-Grunwald Gimsa solution.
  • D10.G4.1 cells (1 x 10 7 cells/mouse) containing 2 mg of conalbumin in saline is administered i.v. to AKR mice. After 6 hr blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for lOmin. IL-4 and IL-5 level in serum are determined by ELISA kits. Compound is administered intraperitoneally at -4 and +1 hr after these cells injection.
  • PCA Passive cutaneous anaphylaxis
  • the rats are killed, and the skin ofthe back is removed. Evans blue dye in the skin is extracted in formamide overnight at 63°C. Then an absorbance at 620 nm is measured to obtain the optical density ofthe leaked dye.
  • Percent inhibition of PCA with a compound is calculated as follows:
  • % inhibition ⁇ (mean vehicle value - sample value)/(mean vehicle value - mean control value) ⁇ x 100
  • mice are exposed to the smoke from 2 unfiltered cigarettes per day for 6 days per week for 14 weeks. Non-smoking, age-matched animals are used as controls. Animals are orally dosed with test compound or vehicle 1 hour before and 7 hours after smoke exposure. This twice-daily dosing regime is continued throughout the smoke exposure period. On day 7 of the weekly exposure, animals are given only 1 dose of test compound and are not exposed to cigarette smoke.
  • mice After the smoke exposure period, the mice are killed, their lungs inflated with phosphate-buffered formalin via their trachea, and then the lungs and heart are removed en bloc and fixed at 4°C for 48 hours. The lungs are then prepared for paraffin wax sectioning, and 4 mm sections are cut and mounted on glass slides. Sections are then stained with haematoxylin and eosin. Mo ⁇ hometric analysis of lung sections is done by calculation of the Linear Mean Intercept (LMI) parameter using a semi-automated computer image analysis system. Each slide (1 per mouse) contains several sections originating from multiple lobes. Twelve non-overlapping areas (each area covering 1.53 x 10-3 cm 2 ) are randomly selected for LMI analysis.
  • LMI Linear Mean Intercept
  • the 12 areas cover a minimum of two lobes per slide.
  • Non-parenchymal components airways, blood vessels
  • the mean intercept length is calculated for each mouse.
  • Development of emphysema is seen as an increase in LMI.
  • the potency of a test compound is evaluated by comparison of the tobacco smoke induced increase in LMI in animals dosed with either the test compound or just the vehicle used for administration of the compound.
  • test compounds The potency of test compounds is evaluated by measuring the inhibition of elastolysis induced by human alveolar macrophages.
  • the cells are isolated from broncho- alveolar lavage samples taken from non-smokers, disease-free smokers, and smokers with COPD. Macrophage suspensions are added to test wells coated with tritiated elastin and incubated at 37°C for 3h to allow adherence of the cells. The wells are then carefully washed to remove non-adherent cells and fresh medium is added to each well. The cells are incubated at 37°C for up to 72 hours in the presence or absence of test compound. Every 24 hours the medium in each well is removed for analysis and replaced by fresh medium.
  • Radioactivity released into the medium is measured by liquid scintillation counting and the rate of elastin degradation is calculated.
  • the potency of a test compound is evaluated by comparing the rate of elastolysis measured with cells incubated in the presence or absence of the compound.
  • Wistar rats (200-250 g / Charles River Japan) are anesthetized intraperitoneally with ketamine. The abdomen is opened through a midline incision and the bladder and the proximal urethra are exposed. A constant degree of urethral obstruction is produced by tying a ligature around the urethra and a catheter with an outer diameter of 1 mm. The abdominal well is closed and the animals allowed to recover.
  • the rats are anesthetized with ketamine, and the ligature around the urethra is carefully removed to normalize the outlet resistance and enable repetitive micturition.
  • a polyethylene catheter is implanted in the bladder tlirough the dome, and exteriorized at the scapular level. Animals are then allowed to recover for at least 48 hours.
  • Cytometric investigation is performed without anesthesia two days after bladder catheter implantation in control and obstracted animals.
  • the bladder catheter was connected via a T-tube to a strain gauge and a microinjection pump.
  • the conscious rats are held under partial restraint in a restraining device.
  • Warmed saline is infused into the bladder at a rate of 3 ml/hr for control and obstracted animals.
  • the rate of infusion is increased from 3 to 10 ml/hr to obtain similar interval times between micturitions in obstracted and control rats.
  • Overactivity of the obstracted bladders is assessed by measuring the cystometric parameters such as basal pressure, peak micturition pressure, threshold pressure, micturition interval, amplitude and frequency of spontaneous activity and micturition slope. Lluel et al, J. Urol 160, 2253-57, 1998.
  • test compound is dissolved in an appropriate vehicle, such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v), is administered intravenously through the catheter.
  • an appropriate vehicle such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v
  • An organ bath assay is employed to measure the agonist-induced contraction of prostate for assessing the biological activity of test compounds ⁇ i.e., drug candidates).
  • Male Wistar rats (200-250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole prostate is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112mM NaCl, 5.9mM KCl, 1.2mM MgCl 2 , 1.2mM NaH 2 PO 4 , 2mM CaCl 2 , 2.5mM NaHCO , 12mM glucose).
  • Ventricle prostate lobes were dissected into several strips depending on the size of prostate. Prostate strips are equilibrated for 60 min in organ bath chambers before any stimulation.
  • Isometric tension is recorded under an appropriate load. Contractile response to adrenergic agonists or electric field stimulation is determined several times until reproducible responses are obtained. Test compounds are pre-incubated prior to the agonistic or electric stimulation. The ratio of each contraction to the negative control is calculated and the effect of the test compounds on the prostate contraction is evaluated.
  • An organ bath assay is employed to measure the agonist-induced contraction of urinary bladder for assessing the biological activity of test compounds ⁇ i.e., drug candidates).
  • Male Wistar rats (200-250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole urinary bladder is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112mM NaCl, 5.9mM KCl, 1.2mM MgCl 2 , 1.2mM NaH 2 PO 4 , 2mM CaCl 2 , 2.5mM NaHCO 3 , 12mM glucose).
  • Isometric tension is recorded under an appropriate load using longitudinal strips of rat detrusor muscle. Bladder strips are equilibrated for 60 minutes before each stimulation. Contractile response to 80 mM KCl is determined at 15 minute intervals until reproducible responses are obtained. The response to KCl is used as an internal standard to evaluate the effect of test compounds.
  • test compounds are investigated by incubating the strips with compounds for 30 minutes prior to stimulation with an appropriate agonist or electrical stimulation.
  • One of the preparations made from the same animal serves as a control, while others are used for evaluating test compounds.
  • the ratio of each contraction to the internal standard e.g., a KCl-induced contraction
  • the effects ofthe test compounds on the contraction are evaluated.
  • Rats are anesthetized by intraperitoneal administration of urethane (Sigma) at 1.25 g/kg.
  • the abdomen is opened tlirough a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder tlirough the dome.
  • a polyethylene catheter BECTON DICKINSON, PE50
  • saline Otsuka
  • Rats are anesthetized by intramuscular administration of ketamine (75 mg/kg) and xylazine (15 mg/kg).
  • the abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder tlirough the dome.
  • the catheter is tunneled through subcutis of the animal by needle (14G) to neck.
  • the inguinal region is incised, and a polyethylene catheter (BECTON DICKINSON, PE50) filled with saline (Otsuka) is inserted into a femoral vein.
  • the catheter is tunneled through subcutis ofthe animal by needle to neck.
  • the bladder catheter is connected via T-tube to a pressure transducer (Viggo-Spectramed Pte Ltd, DT-XXAD) and a microinjection pump (TERUMO). Saline is infused at room temperature into the bladder at a rate of
  • Intravesicular pressure is recorded continuously on a chart pen recorder (Yokogawa). At least three reproducible micturition cycles are recorded before a test compound administration.
  • test compounds (4) Administration of test compounds.
  • a test compound dissolved in the mixture of ethanol, Tween 80 (ICN Biomedicals Inc.) and saline (1 : 1 : 8, v/v/v) is administered intravenously through the catheter.
  • Total cellular RNA was isolated from cells by one of two standard methods: 1) guanidine isothiocyanate/cesium chloride density gradient centrifugation [ Kellogg et al. (1990)]; or with the Tri-Reagent protocol according to the manufacturer's specifications (Molecular Research Center, Inc., Cincinatti, Ohio). Total RNA prepared by the Tri-reagent protocol was treated with DNAse I to remove genomic DNA contamination.
  • RNA from each cell or tissue source was first reverse transcribed. Eighty-five ⁇ g of total RNA was reverse transcribed using 1 ⁇ mole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U RnaseQut (Invitrogen, Groningen, Netherlands) in a final volume of 680 ⁇ l.
  • the first strand synthesis buffer and Omniscript reverse transcriptase (2 u/ ⁇ l) were obtained from (Qiagen, Hilden, Germany). The reaction was incubated at 37° C for 90 minutes and cooled on ice. The volume was adjusted to 6800 ⁇ l with water, yielding a final concentration of 12.5 ng/ ⁇ l of starting RNA.
  • Primerl ggatcctgatgaaccaccac The reverse primer sequence was Primer2 ggataccaccaccaccaatcagg.
  • the following reagents were prepared in a total of 25 ⁇ l : lx TaqMan buffer A, 5.5 mM MgCl 2 , 200 nM of dATP, dCTP, dGTP, and dUTP, 0.025 U/ ⁇ l AmpliTaq GoldTM, 0.01 U/ ⁇ l AmpErase, and Probel tccaccaagaccaatgctcagattt, forward and reverse primers each at 200 nM, 200 nM , FAM/TAMRA-labeled probe, and 5 ⁇ 1 of template cDNA.
  • Thermal cycling parameters were 2 min at 50° C, followed by 10 min at 95° C, followed by 40 cycles of melting at 95° C for 15 sec and annealing/extending at 60°
  • the CT (threshold cycle) value is calculated as described in the "Quantitative detennination of nucleic acids" section.
  • the CF-value (factor for threshold cycle correction) is calculated as follows:
  • PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
  • CT H O - values were calculated as described in the "Quantitative determination of nucleic acids" section.
  • CF C DNA-n (correction factor for cDNA n) CTpannei-mean value - CTHK G - ⁇ - mean value 6.
  • CT C DNA-n (CT value ofthe tested gene for the cDNA n) + CF C DNA- ⁇ (correction factor for cDNA n) CT CO ⁇ - CDNA - ⁇ (corrected CT value for a gene on cDNA n)
  • the following tissues were tested: fetal heart, heart, pericardium, heart atrium
  • cerebellum (right), cerebellum (left), cerebral cortex, Alzheimer cerebral cortex, frontal lobe, Alzheimer brain frontal lobe, occipital lobe, parietal lobe, temporal lobe, precentral gyras, postcentral gyras, tonsilla cerebelli , vermis cerebelli, pons, substantia nigra, cerebral meninges, cerebral peduncles, co ⁇ us callosum, hippocampus, thalamus, dorsal root ganglia, spinal cord, neuroblastoma SK N MC cells, neuroblastoma
  • Purkinje fibers 5634 interventricular septum 11666 fetal aorta 218 aorta 271 artery 36 coronary artery 372 pulmonary artery 16 carotid artery 87 mesenteric artery 286 vein 17 pulmonic valve 1510 coronary artery smooth muscle 3692 primary cells
  • fetal lung 18820 fetal lung fibroblast IMR-90 cells 9541 fetal lung fibroblast MRC-5 cells 5221 lung 1563 lung right upper lobe 2539 lung right mid lobe 1278 lung right lower lobe 1965 lung lupus disease 484 lung tumor 19484 lung COPD 729 trachea 9281
  • HeLa cells 3350 placenta 3984 uterus 11037 uterus tumor 29328 ovary 139509 ovary tumor 12503 breast 48309 breast tumor 4871 MDA MB 231 cells (breast 14462 tumor) mammary gland 8023
  • Alpha-Latrotoxin and its receptors neurexins and CIRL/latrophilins.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Reagents that regulate human secretin-type GPCR (latrophilin) and reagents which bind to human secretin-type GPCR (latrophilin) gene products can play a role in preventing, ameliorating, or correcting dysfunctions or diseases including, but not limited to, obesity, cardiovascular disorders, dermatological disorders, endocrine and hormonal disorders, metabolic disorders, including diabetes, cancer, gastrointestinal and liver disorders, hematological disorders, neurological disorders, respiratory disorders, reproductive disorders, and genitourinary disorders.

Description

REGULATION OF HUMAN SECRETIN-TYPE GPCR (LATROPHILIN)
This application incorporates by reference copending provisional application Serial No. 60/404,142 filed August 19, 2002 and Serial No. 60/474,951 filed on June 3, 2003.
FIELD OF THE INVENTION
The invention relates to the regulation of human secretin-type GPCR (latrophilin).
BACKGROUND OF THE INVENTION
Many medically significant biological processes are mediated by signal transduction pathways that involve G-proteins (Lefkowitz, Nature 351, 353-354, 1991). The family of G-protein coupled receptors (GPCR) includes receptors for hormones, neurotransmitters, growth factors, and viruses. Specific examples of GPCRs include receptors for such diverse agents as dopamine, calcitonin, adrenergic hormones, endoftielin, cAMP, adenosine, acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1, rhodopsins, odorants, cytomegalovirus, G-proteins themselves, effector proteins such as phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator protems such as protein kinase A and protein kinase C.
GPCRs possess seven conserved membrane-spanning domains connecting at least eight divergent hydrophilic loops. GPCRs (also known as 7TM receptors) have been characterized as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. Most GPCRs have single conserved cysteine residues in each of the first two extracellular loops, which form disulfide bonds that are believed to stabilize functional protein structure. The seven transmembrane regions are designated as TM1, TM2, TM3,
TM4, TM5, TM6, and TM7. TM3 has been implicated in signal transduction. Phosphorylation and lipidation (palmitylation or farnesylation) of cysteine residues can influence signal transduction of some GPCRs. Most GPCRs contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus. For several GPCRs, such as the β-adrenergic receptor, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization.
For some receptors, the ligand binding sites of GPCRs are believed to comprise hydrophilic sockets formed by several GPCR transmembrane domains. The hydrophilic sockets are surrounded by hydrophobic residues of the GPCRs. The hydrophilic side of each GPCR transmembrane helix is postulated to face inward and form a polar ligand binding site. TM3 has been implicated in several GPCRs as having a ligand binding site, such as the TM3 aspartate residue. TM5 serines, a TM6 asparagine, and TM6 or TM7 phenylalanines or tyrosines also are implicated in ligand binding.
GPCRs are coupled inside the cell by heterotrimeric G-proteins to various intracellular enzymes, ion channels, and transporters (see Johnson et al., Endoc. Rev. 10, 317-331, 1989). Different G-protein alpha-subunits preferentially stimulate particular effectors to modulate various biological functions in a cell. Phosphorylation of cytoplasmic residues of GPCRs is an important mechanism for the regulation of some GPCRs. For example, in one form of signal transduction, the effect of hormone binding is the activation inside the cell of the enzyme, adenylate cyclase. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP. GTP also influences hormone binding. A G-protein connects the hormone receptor to adenylate cyclase. G-protein exchanges GTP for bound GDP when activated by a hormone receptor. The GTP-carrying form then binds to activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form. Thus, the G-protein serves a dual role, as an mtermediate that relays the signal from receptor to effector, and as a clock that controls the duration ofthe signal. Over the past 15 years, nearly 350 therapeutic agents targeting GPCRs receptors have been successfully introduced onto the market. This indicates that these receptors have an established, proven history as therapeutic targets. Clearly, there is an on- going need for identification and characterization of further GPCRs which can play a role in preventing, ameliorating, or correcting dysfunctions or diseases including, but not limited to, infections such as bacterial, fungal, protozoan, and viral infections, particularly those caused by HIV viruses, pain, cancers, anorexia, bulimia, asthma, Parkinson's diseases, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, several mental retardation, and dyskinesias, such as Huntington's disease and Tourett's syndrome.
Latrophilin (Alpha-Latrotoxin Receptor)
Alpha-latrotoxin (ALX), a neurotoxic protein contained in black widow spider venom, stimulates a robust release of neurotransmitters and the subsequent degeneration ofthe affected nerve terminals. This effect is mediated by ALX binding to a G protein-coupled receptor called latrophilin (Ichtchenko et al., J. Biol. Chem. 274, 5491-98, 1999; Rahman et al, Philos. Trans. R. Soc. Lond. B Biol. Sci. 28, 39- 86, 1999). Because of the dramatic effect of ALX on exocytosis, there is a need in the art to identify additional members of the latrophilin receptor family whose activity can be regulated to provide therapeutic effects.
Secretin
Secretin, a hormone from the duodenum, is a heptacosipeptide of the formula: H-His-Ser-Asp-Gly-Thr-Phe-Thr-Ser-Glu-Leu-Ser-Arg-Leu-Arg-Asp-Ser-Ala-Arg-L eu-Gln-Arg-Leu-Leu-Gln-Gly-Leu-Val-NH . Secretin stimulates the pancreatic secretion of water and bicarbonate. U.S. Patent No. 4,098,779. In the stomach, secretin stimulates pepsin secretion, stimulates the pyloric sphincter, inhibits gastrin-stimulated acid secretion, inhibits food-stimulated gastrin release, and inhibits motility. Rayford et al, New England Journal of Medicine, May 13, 1976 (1093-2000); U.S. Patent No. 4,086,220; U.S. Patent No. 4,711,847. For these reasons, secretin promises to be a good medicament for gastrointestinal disorders, such as, for example, for lesions in the gastrointestinal tract. Secretin also stimulates cyclic AMP formation in the brain. Fremeau et al, J. Neurochem. 46, 1947-55, 1986.
Secretin exerts its effects through a type II GPCR. Shetzline et al, J. Biol. Chem. 273, 6756-62, 1998; Chow, Biochem. Biophys. Res. Commun. 212, 204-11, 1995; Ishihara et al, EMBO J. 10, 1635-41, 1991; Jiang & Ulrich, Biochem. Biophys. Res. Commun. 207, 883-90, 1995; Patel et al, Mol. Pharmacol. 47, 467-73; Vilardaga et al, Mol. Pharmacol. 45, 1022-28, 1994. Secretin receptor gene expression has been shown to be upregulated in rat cholangiocytes after bile duct ligation. Alpini et al, Am. J. Physiol. 266, G922-28, 1994.
There is a need in the art to identify related GPCRs, which can be regulated to provide therapeutic effects.
It is an object ofthe invention to provide reagents and methods of regulating a human secretin-type GPCR (latrophilin). This and other objects of the invention are provided by one or more ofthe embodiments described below.
BRIEF DESCRIPTION OF THE FIGURES
Fig. 1 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin) Polypeptide (SEQ ID NO:l). Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of Fig.l
(SEQ ID NO:2). Fig. 3 shows the DNA-sequence encoding the secretin-type GPCR (Latrophilin)
Polypeptide of Fig. 2 (SEQ ID NO:3). Fig. 4 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
Polypeptide (SEQ ID NO:4). Fig. 5 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
Polypeptide (SEQ ID NO:5). Fig. 6 shows • the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
Polypeptide (SEQ ID NO:6). Fig. 7 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin) Polypeptide (SEQ ID NO:7).
Fig. 8 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
Polypeptide (SEQ ID NO:8). Fig. 9 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
Polypeptide (SEQ ID NO:9). Fig. 10 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
Polypeptide (SEQ ID NO: 10). Fig. 11 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
Polypeptide (SEQ ID NO: 11). Fig. 12 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin) Polypeptide (SEQ ID NO: 12).
Fig. 13 shows the DNA-sequence encoding a secretin-type GPCR (Latrophilin)
Polypeptide (SEQ ID NO:13).
DETAILED DESCRIPTION OF THE INVENTION
The invention relates to an isolated polynucleotide from the group consisting of:
a) a polynucleotide encoding a Secretin-type GPCR (Latrophilin) polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 95% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
b) a polynucleotide comprising the sequence of SEQ ID NO: 1 ;
c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b) and encodes a Secretin-type GPCR (Latrophilin) polypeptide;
d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code and encodes a Secretin-type GPCR (Latrophilin) polypeptide; and
e) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a Secretin-type
GPCR (Latrophilin) polypeptide.
The protein of the invention is a novel human secretin-type GPCR (latrophilin). Human secretin-type GPCR (latrophilin) comprises the amino acid sequence shown in SEQ ID NO:2. A coding sequence for human secretin-type GPCR (latrophilin) is shown in SEQ ID NO:l. This sequence is located on chromosome 4pl5.2. Related mouse ESTs (SEQ ID NOS:4-13) are expressed in neuroblastoma cells, retino- blastoma, teratocarcinoma, adenocarcinoma cell line, renal cell adenocarcinoma, melanotic melanoma, glioblastoma primitive neuroectoderm, and amygdala.
The protein of SEQ ID NO:2 is a 7 transmembrane receptor (secretin family) region, latrophilin/CL-1-like GPS (GPCR proteolysis site) domain and hormone receptor domain regions are identified. The hormone receptor domain has a weak score but the four conserved cysteines, that probably form disulphide bridges, are present. The disulfide bridge domain is found in a variety of hormone receptors. Additionally,
SEQ ID NO:2 has an immunoglobulin domain on its N-terminus. Human secretin-type GPCR (latrophilin) ofthe invention is expected to be useful for the same purposes as previously identified secretin-type (latrophilin) GPCRs. Human secretin-type GPCR (latrophilin) is believed to be useful in therapeutic methods to treat disorders such as obesity, cardiovascular disorders, dermatological disorders, endocrine and hormonal disorders, metabolic disorders, including diabetes, cancer, hematological disorders, gastrointestinal and liver disorders, neurological disorders, respiratory disorders, reproductive disorders, and genitourinary disorders. Human secretin-type GPCR (latrophilin) also can be used to screen for human secretin-type GPCR (latrophilin) activators and inhibitors.
One embodiment of the present invention is an expression vector containing any polynucleotide ofthe present invention.
Yet another embodiment of the present invention is a host cell containing any expression vector of he present invention.
Still another embodiment ofthe present invention is a substantially purified Secretin- type GPCR (Latrophilin) polypeptide encoded by any polynucleotide of the present invention.
Even another embodiment of the present invention is a method of producing a Secretin-type GPCR (Latrophilin) polypeptide of the present invention, wherein the method comprises the following steps:
a. culturing the host cells of the present invention under conditions suitable for the expression ofthe Secretin-type GPCR (Latrophilin) polypeptide; and b. recovering the Secretin-type GPCR (Latrophilin) polypeptide from the host cell culture. Yet another embodiment of the present invention is a method for detecting a polynucleotide encoding a Secretin-type GPCR (Latrophilin) polypeptide in a biological sample comprising the following steps:
a. hybridizing any polynucleotide of the present invention to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and b. detecting said hybridization complex.
Still another embodiment of the present invention is a method for detecting a poly- nucleotide of the present invention or a Secretin-type GPCR (Latropliilin) polypeptide ofthe present invention comprising the steps of:
a. contacting a biological sample with a reagent which specifically interacts with the polynucleotide or the Secretin-type GPCR (Latrophilin) polypeptide and b. detecting the interaction
Even another embodiment of the present invention is a diagnostic kit for conducting any method ofthe present invention.
Yet another embodiment ofthe present invention is a method of screening for agents which decrease the activity of a Secretin-type GPCR (Latrophilin), comprising the steps of:
a. contacting a test compound with a Secretin-type GPCR (Latrophilin) polypeptide encoded by any polynucleotide of the present invention; b. detecting binding of the test compound to the Secretin-type GPCR (Latrophilin) polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a Secretin-type GPCR (Latrophilin). Still another embodiment ofthe present invention is a method of screening for agents which regulate the activity of a Secretin-type GPCR (Latrophilin), comprising the steps of:
a. contacting a test compound with a Secretin-type GPCR (Latrophilin) polypeptide encoded by any polynucleotide ofthe present invention; and b. detecting a Secretin-type GPCR (Latrophilin) activity of the polypeptide, wherein a test compound which increases the Secretin-type GPCR (Latrophilin) activity is identified as a potential therapeutic agent for increasing the activity ofthe Secretin-type GPCR (Latrophilin), and wherein a test compound which decreases the Secretin-type GPCR (Latrophilin) activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity ofthe Secretin-type GPCR (Latrophilin).
Even another embodiment of the present invention is a method of screening for agents which decrease the activity of a Secretin-type GPCR (Latrophilin), comprising the step of:
contacting a test compound with any polynucleotide of the present invention and detecting binding of the test compound to the polynucleotide, wherein a test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of Secretin-type GPCR (Latrophilin).
Yet another embodiment ofthe present invention is a method of reducing the activity of a Secretin-type GPCR (Latrophilin), comprising the step of:
contacting a cell with a reagent which specifically binds to any polynucleotide ofthe present invention or any Secretin-type GPCR (Latrophilin) polypeptide ofthe present invention, whereby the activity of Secretin-type GPCR (Latrophilin) is reduced. Still another embodiment of the present invention is a reagent that modulates the activity of a Secretin-type GPCR (Latrophilin) polypeptide or a polynucleotide wherein said reagent is identified by any methods ofthe present invention.
Even another embodiment of the present invention is a pharmaceutical composition, comprising:
an expression vector of the present invention or a reagent of the present invention and a pharmaceutically acceptable carrier.
Yet another embodiment ofthe present invention is the use of an expression vector of the present invention or a reagent ofthe present invention for modulating the activity of a Secretin-type GPCR (Latrophilin) in a disease, preferably obesity, a cardiovascular disorder, a dermatological disorder, an endocrine and hormonal disorder, a metabolic disorder, including diabetes, cancer, a gastrointestinal and liver disorder, a hematological disorder, a neurological disorder, a respiratory disorder, a reproductive disorder or a genitourinary disorder.
The invention thus provides a human secretin-type GPCR (latrophilin) that can be used to identify test compounds that may act, for example, as activators or inhibitors.
Human secretin-type GPCR (latrophilin) and fragments thereof also are useful in raising specific antibodies that can block the protein's functional activity.
Polypeptides
Human secretin-type GPCR (latrophilin) polypeptides according to the invention comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 500, 600, 700, 800, 900, 1000, or 1076 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO. -2 or a biologically active variant thereof, as defined below. A secretin-type GPCR
(latrophilin) polypeptide ofthe invention therefore can be a portion of a secretin-type GPCR (latrophilin) protein, a full-length secretin-type GPCR (latrophilin) protein, or a fusion protein comprising all or a portion of a secretin-type GPCR (latrophilin) protem.
Biologically active variants
Human secretin-type GPCR (latrophilin) polypeptide variants which are biologically active, e.g., retain an enzymatic activity, also are human secretin-type GPCR (latrophilin) polypeptides. Preferably, naturally or non-naturally occurring human secretin-type GPCR (latrophilin) polypeptide variants have amino acid sequences which are at least about 95, 96, or 98% identical to the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof. Percent identity between a putative human secretin-type GPCR (latrophilin) polypeptide variant and an amino acid sequence of SEQ ID NO:2 is determined by conventional methods. See, for example, Altschul et al, Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl Acad.
Sci. USA 59:10915 (1992). Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of Henikoff & Henikoff, 1992.
Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences. The "FASTA" similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant. The FASTA algorithm is described by Pearson & Lipman, Proc. Nat'l Acad. Sci. USA 55:2444(1988), and by Pearson, Meth.
Enzymol. 183:63 (1990). Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e.g., SEQ ID NO: 2) and a test sequence that have either the highest density of identities (if the ktup variable is 1) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions. The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score. If there are several regions with scores greater than the "cutoff value (calculated by a predetermined formula based upon the length of the sequence the ktup value), then the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman- Wunsch- Sellers algorithm (Needleman & Wunsch, J Mol. Biol.48:444 (1970); Sellers, SIAM J. Appl. Math.26:l l (1974)), which allows for amino acid insertions and deletions. Preferred parameters for FASTA analysis are: ktup=l, gap opening penalty=10, gap extension penalty= , and substitution matrix=:BLOSUM62. These parameters can be introduced into a FASTA program by modifying the scoring matrix file ("SMATRIX"), as explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 (1990).
FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
"% identity" of a first sequence towards a second sequence, within the meaning ofthe invention, means the % identity which is calculated as follows: First the optimal global alignment between the two sequences is determined with the CLUSTALW algorithm [Thomson JD, Higgins DG, Gibson TJ. 1994. ClustalW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22:
4673-4680], Version 1.8, applying the following command line syntax: . /ciustai
-infile=. /infile. xt -outρut= -outorder=aligne ~pwmatrix=gonnet
-p dnamatrix=clustalw -pwgapopen=10.0 -pwgapext=0.1 -matrix=gonnet -gapopen=10.0 -gapext=0.05 -gapdist=8 -hgapresidues=GPSNDQERK
-maxdiv=40. Implementations of the CLUSTAL W algorithm are readily available at numerous sites on the internet, including, e.g., http://www.ebi.ac.ulc. Thereafter, the number of matches in the alignment is determined by counting the number of identical nucleotides (or amino acid residues) in aligned positions. Finally, the total number of matches is divided by the number of nucleotides (or amino acid residues) of he longer of the two sequences, and multiplied by 100 to yield the % identity of the first sequence towards the second sequence.
Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a human secretin-type GPCR (latrophilin) polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
The invention additionally, encompasses secretin-type GPCR (latrophilin) polypeptides that are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications can be carried out by known techniques including, but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH , acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc. Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression. The secretin-type GPCR (latrophilin) polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation ofthe protein.
The invention also provides chemically modified derivatives of secretin-type GPCR
(latrophilin) polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337). The chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol, and the like. The polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
Whether an amino acid change or a polypeptide modification results in a biologically active secretin-type GPCR (latrophilin) polypeptide can readily be determined by assaying for functional activity, as described for example, in the specific examples, below.
Fusion proteins
Fusion proteins are useful for generating antibodies against secretin-type GPCR (latrophilin) polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a human secretin-type GPCR (latrophilin) polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
A human secretin-type GPCR (latrophilin) polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond. The first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 500, 600, 700, 800, 900, 1000, or 1076 contiguous amino acids of SEQ ID NO:2 or of a biologically active variant, such as those described above. The first polypeptide segment also can comprise full-length secretin-type GPCR (latrophilin) protein.
The second polypeptide segment can be a full-length protein or a protein fragment. Proteins commonly used in fusion protein construction include β-galactosidase, β- glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Additionally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV- G tags, and thioredoxin (Trx) tags. Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4
DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. A fusion protein also can be engineered to contain a cleavage site located between the secretin-type GPCR (latrophilin) polypeptide-encoding sequence and the heterologous protein sequence, so that the secretin-type GPCR (latrophilin) polypeptide can be cleaved and purified away from the heterologous moiety.
A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology. Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO:l in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art. Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WT), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA- KITS).
Identification of species homologs
Species homologs of human secretin-type GPCR (latrophilin) polypeptide can be obtained using secretin-type GPCR (latrophilin) polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of secretin-type GPCR (latrophilin) polypeptide, and expressing the cDNAs as is known in the art.
Polynucleotides
A human secretin-type GPCR (latrophilin) polynucleotide can be single- or double- stranded and comprises a coding sequence or the complement of a coding sequence for a secretin-type GPCR (latrophilin) polypeptide. A coding sequence for human secretin-type GPCR (latrophilin) is shown in SEQ ID NO:l.
Degenerate nucleotide sequences encoding human secretin-type GPCR (latrophilin) polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO:l or its complement also are secretin-type GPCR (latrophilin) polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2. Complementary DNA (cDNA) molecules, species homologs, and variants of secretin-type GPCR (latrophilin) polynucleotides that encode biologically active secretin-type GPCR (latrophilin) polypeptides also are secretin-type GPCR (latrophilin) polynucleotides. Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID
NO:l or its complement also are secretin-type GPCR (latrophilin) polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
Identification of polynucleotide variants and homologs
Variants and homologs of the secretin-type GPCR (latrophilin) polynucleotides described above also are secretin-type GPCR (latrophilin) polynucleotides. Typically, homologous secretin-type GPCR (latrophilin) polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known secretin- type GPCR (latrophilin) polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions~2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50 °C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each— homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
Species homologs of the secretin-type GPCR (latrophilin) polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of secretin-type GPCR (latrophilin) polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the Tm of a double-stranded DNA decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81, 123 (1973). Variants of human secretin-type GPCR (latrophilin) polynucleotides or secretin-type GPCR (latrophilin) polynucleotides of other species can therefore be identified by hybridizing a putative homologous secretin-type GPCR (latrophilin) polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:l or the complement thereof to form a test hybrid. The melting temperature ofthe test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
Nucleotide sequences which hybridize to secretin-type GPCR (latrophilin) polynucleotides or their complements following stringent hybridization and/or wash conditions also are secretin-type GPCR (latrophilin) polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20 °C below the calculated Tm of the hybrid under study. The Tm of a hybrid between a secretin-type GPCR (latrophilin) polynucleotide having a nucleotide sequence shown in SEQ ID
NO:l or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
Tm = 81.5 °C - 16.6(log10[Na+]) + 0.41(%G + C) - 0.63(%formamide) - 600/1), where = the length ofthe hybrid in basepairs.
Stringent wash conditions include, for example, 4X SSC at 65 °C, or 50% formamide, 4X SSC at 42 °C, or 0.5X SSC, 0.1% SDS at 65 °C. Highly stringent wash conditions include, for example, 0.2X SSC at 65 °C. Preparation of polynucleotides
A human secretin-type GPCR (latrophilin) polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated secretin-type GPCR
(latrophilin) polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise secretin-type GPCR (latrophilin) nucleotide sequences. Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90%) free of other molecules.
Human secretin-type GPCR (latrophilin) cDNA molecules can be made with standard molecular biology techniques, using secretin-type GPCR (latrophilin) mRNA as a template. Human secretin-type GPCR (latrophilin) cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
Alternatively, synthetic chemistry techniques can be used to synthesize secretin-type GPCR (latrophilin) polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a human secretin- type GPCR (latrophilin) polypeptide having, for example, an amino acid sequence shown in SEQ ID NO:2 or a biologically active variant thereof. Extending polynucleotides
The partial sequence disclosed herein can be used to identify the corresponding full- length gene from which it was derived. The partial sequence can be nick-translated or end-labeled with 32P using polynucleotide kinase using labeling methods known to those with skill in the art (BASIC METHODS IN MOLECULAR BIOLOGY, Davis et al, eds., Elsevier Press, N.Y., 1986). A lambda library prepared from human tissue can be directly screened with the labeled sequences of interest or the library can be converted en masse to pBluescript (Stratagene Cloning Systems, La Jolla, Calif. 92037) to facilitate bacterial colony screening (see Sambrook et al, MOLECULAR
CLONING: A LABORATORY MANUAL, Cold Spring Harbor Laboratory Press (1989, pg. 1.20).
Both methods are well known in the art. Briefly, filters with bacterial colonies containing the library in pBluescript or bacterial lawns containing lambda plaques are denatured, and the DNA is fixed to the filters. The filters are hybridized with the labeled probe using hybridization conditions described by Davis et al, 1986. The partial sequences, cloned into lambda or pBluescript, can be used as positive controls to assess background binding and to adjust the hybridization and washing stringencies necessary for accurate clone identification. The resulting auto- radiograms are compared to duplicate plates of colonies or plaques; each exposed spot corresponds to a positive colony or plaque. The colonies or plaques are selected, expanded and the DNA is isolated from the colonies for further analysis and sequencing.
Positive cDNA clones are analyzed to determine the amount of additional sequence they contain using PCR with one primer from the partial sequence and the other primer from the vector. Clones with a larger vector-insert PCR product than the original partial sequence are analyzed by restriction digestion and DNA sequencing to determine whether they contain an insert ofthe same size or similar as the mRNA size determined from Northern blot Analysis. Once one or more overlapping cDNA clones are identified, the complete sequence of the clones can be determined, for example after exonuclease III digestion (McCombie et al, Methods 3, 33-40, 1991). A series of deletion clones are generated, each of which is sequenced. The resulting overlapping sequences are assembled into a single contiguous sequence of high redundancy (usually three to five overlapping sequences at each nucleotide position), resulting in a highly accurate final sequence.
Various PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements. For example, restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988). Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Plymouth, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72 °C. The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
Another method which can be used is capture PCR, which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods Applic. 1, 111-119, 1991). In this method, multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment ofthe DNA molecule before performing PCR.
Another method which can be used to retrieve unknown sequences is that of Parker et al, Nucleic Acids Res. 19, 3055-3060, 1991). Additionally, PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA (CLONTECH, Palo Alto, Calif.). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to include larger cDNAs. Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.
Commercially available capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products. For example, capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) that are laser activated, and detection of the emitted wavelengths by a charge coupled device camera. Output/light intensity can be converted to electrical signal using appropriate software {e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled. Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA that might be present in limited amounts in a particular sample. Obtaining Polypeptides
Human secretin-type GPCR (latrophilin) polypeptides can be obtained, for example, by purification from human cells, by expression of secretin-type GPCR (latrophilin) polynucleotides, or by direct chemical synthesis.
Protein purification
Human secretin-type GPCR (latrophilin) polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with secretin-type GPCR (latrophilin) polynucleotides. A purified secretin-type GPCR (latrophilin) polypeptide is separated from other compounds that normally associate with the secretin-type GPCR (latrophilin) polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
Human secretin-type GPCR (latrophilin) polypeptide can be conveniently isolated as a complex with its associated G protein, as described in the specific examples, below. A preparation of purified secretin-type GPCR (latrophilin) polypeptides is at least 80%) pure; preferably, the preparations are 90%), 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS- polyacrylamide gel electrophoresis.
Expression of polynucleotides
To express a human secretin-type GPCR (latrophilin) polynucleotide, the poly- nucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well lαiown to those skilled in the art can be used to construct expression vectors containing sequences encoding secretin-type GPCR (latrophilin) polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in
Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
A variety of expression vector/host systems can be utilized to contain and express sequences encoding a human secretin-type GPCR (latrophilin) polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors {e.g., baculovirus), plant cell systems transformed with virus expression vectors {e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus,
TMV) or with bacterial expression vectors {e.g., Ti or pBR322 plasmids), or animal cell systems.
The control elements or regulatory sequences are those non-translated regions of the vector ~ enhancers, promoters, 5' and 3' untranslated regions — which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the
BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life
Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells
{e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses {e.g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a human secretin-type GPCR (latrophilin) polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
Bacterial and yeast expression systems
In bacterial systems, a number of expression vectors can be selected depending upon the use intended for the secretin-type GPCR (latrophilin) polypeptide. For example, when a large quantity of a human secretin-type GPCR (latrophilin) polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene). In a BLUESCRIPT vector, a sequence encoding the secretin-type GPCR (latrophilin) polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of β-galactosidase so that a hybrid protein is produced. pIN vectors (Van Heeke & Schuster, J. Biol. Chem. 264, 5503-5509, 1989) or pGEX vectors (Promega, Madison, Wis.) also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used. For reviews, see Ausubel et al. (1989) and Grant et al, Methods Enzymol. 153, 516-544, 1987. Plant and insect expression systems
If plant expression vectors are used, the expression of sequences encoding secretin- type GPCR (latrophilin) polypeptides can be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671-1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Probl Cell Differ. 17, 85-105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews {e.g., Hobbs or Murray, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).
An insect system also can be used to express a human secretin-type GPCR (latrophilin) polypeptide. For example, in one such system Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding secretin- type GPCR (latrophilin) polypeptides can be cloned into a non-essential region ofthe virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of secretin-type GPCR (latrophilin) polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which secretin-type GPCR (latrophilin) polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
Mammalian expression systems
A number of viral-based expression systems can be used to express secretin-type
GPCR (latrophilin) polypeptides in mammalian host cells. For example, if an adenovirus is used as an expression vector, sequences encoding secretin-type GPCR (latrophilin) polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region ofthe viral genome can be used to obtain a viable virus which is capable of expressing a human secretin-type GPCR (latrophilin) polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984). If desired, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.
Human artificial chromosomes (HACs) also can be used to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6M to 10M are constructed and delivered to cells via conventional delivery methods {e.g., liposomes, polycationic amino polymers, or vesicles).
Specific initiation signals also can be used to achieve more efficient translation of sequences encoding secretin-type GPCR (latrophilin) polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a human secretin-type GPCR (latrophilin) polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al, Results Probl. Cell Differ. 20, 125-162, 1994). Host cells
A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed secretin-type GPCR (latrophilin) poly- peptide in the desired fashion. Such modifications ofthe polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function. Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities {e.g. , CHO, HeLa, MDCK, HEK293, and
WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing ofthe foreign protein.
Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express secretin-type GPCR (latrophilin) polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the intro- duction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced secretin-type GPCR (latrophilin) sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.
Any number of selection systems can be used to recover transformed cell lines.
These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosylτransferase (Lowy et al, Cell 22, 817-23, 1980) genes that can be employed in tk~ or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci. 77, 3567-70, 1980), npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol. 150, 1-14, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988). Visible markers such as anthocyanins, β-glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995).
Detecting expression
Although the presence of marker gene expression suggests that the secretin-type GPCR (latrophilin) polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a human secretin-type GPCR (latrophilin) polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a secretin-type GPCR (latrophilin) polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a secretin-type GPCR (latrophilin) polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression ofthe secretin-type GPCR (latrophilin) polynucleotide.
Alternatively, host cells which contain a human secretin-type GPCR (latrophilin) polynucleotide and which express a human secretin-type GPCR (latrophilin) poly- peptide can be identified by a variety of procedures known to those of skill in the art.
These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques that include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein. For example, the presence of a polynucleotide sequence encoding a secretin-type GPCR (latrophilin) polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a human secretin-type GPCR (latrophilin) polypeptide. Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a secretin-type GPCR (latrophilin) polypeptide to detect transformants which contain a secretin-type GPCR (latrophilin) polynucleotide.
A variety of protocols for detecting and measuring the expression of a human secretin-type GPCR (latrophilin) polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a human secretin-type GPCR (latrophilin) polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et al, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn.,
1990) and Maddox et al, J. Exp. Med. 158, 1211-1216, 1983).
A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding secretin-type GPCR (latrophilin) polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, sequences encoding a human secretin-type GPCR (latrophilin) polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
Expression and purification of polypeptides
Host cells transformed with nucleotide sequences encoding a human secretin-type
GPCR (latrophilin) polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode secretin-type GPCR
(latrophilin) polypeptides can be designed to contain signal sequences which direct secretion of soluble secretin-type GPCR (latrophilin) polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound secretin-type GPCR (latrophilin) polypeptide.
As discussed above, other constructions can be used to join a sequence encoding a human secretin-type GPCR (latrophilin) polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the secretin-type GPCR (latrophilin) polypeptide also can be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing a human secretin-type GPCR (latrophilin) polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobilized metal ion affinity chromatography, as described in Porath et al, Prot. Exp. Purif. 3, 263-281, 1992), while the enterokinase cleavage site provides a means for purifying the secretin-type GPCR (latrophilin) polypeptide from the fusion protein. Vectors that contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441-453, 1993.
Chemical synthesis
Sequences encoding a human secretin-type GPCR (latrophilin) polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al Nucl. Acids Res. Symp. Ser. 225-232, 1980). Alternatively, a human secretin-type GPCR
(latrophilin) polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Optionally, fragments of secretin-type GPCR (latrophilin) polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.
The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography {e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983). The composition of a synthetic secretin-type GPCR (latrophilin) polypeptide can be confirmed by amino acid analysis or sequencing {e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the secretin-type GPCR (latrophilin) polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
As will be understood by those of skill in the art, it may be advantageous to produce secretin-type GPCR (latrophilin) polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter secretin-type GPCR (latrophilin) polypeptide- encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
Antibodies
Any type of antibody known in the art can be generated to bind specifically to an epitope of a human secretin-type GPCR (latrophilin) polypeptide. "Antibody" as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab')2, and Fv, which are capable of binding an epitope of a human secretin-type GPCR (latrophilin) polypeptide. Typically, at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope. However, epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids. An antibody which specifically binds to an epitope of a human secretin-type GPCR (latrophilin) polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
Typically, an antibody which specifically binds to a human secretin-type GPCR (latrophilin) polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immuno- chemical assay. Preferably, antibodies which specifically bind to secretin-type
GPCR (latrophilin) polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a human secretin-type GPCR (latrophilin) polypeptide from solution.
Human secretin-type GPCR (latrophilin) polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, a human secretin-type GPCR (latrophilin) polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyro- globulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels {e.g., aluminum hydroxide), and surface active substances {e.g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG {bacilli Calmette-Guerin) and Corynebacterium parvum are especially useful. Monoclonal antibodies which specifically bind to a human secretin-type GPCR (latrophilin) polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al, Nature 256,
495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al, Proc. Natl. Acad. Sci. 80, 2026-2030, 1983; Cole et al, Mol. Cell Biol. 62, 109-120, 1984).
In addition, techniques developed for the production of "chimeric antibodies," the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al, Proc. Natl. Acad. Sci. 81, 6851-6855, 1984; Neuberger et al, Nature 312, 604-608, 1984; Takeda et al, Nature 314, 452-454, 1985). Monoclonal and other antibodies also can be "humanized" to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions. Alternatively, humanized antibodies can be produced using recombinant methods, as described in GB2188638B. Antibodies that specifically bind to a human secretin-type GPCR (latrophilin) polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies that specifically bind to secretin-type GPCR (latrophilin) polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).
Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J.
Cancer Prev. 5, 507-11). Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, J. Biol. Chem. 269, 199-206.
A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J Immunol. Meth. 165, 81-91).
Antibodies which specifically bind to secretin-type GPCR (latrophilin) polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).
Other types of antibodies can be constructed and used therapeutically in methods of the invention. For example, chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared. Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a human secretin-type GPCR (latrophilin) polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt con- centration.
Antisense oligonucleotides
Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of secretin-type GPCR (latrophilin) gene products in the cell.
Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a com- bination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.
Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.
Modifications of secretin-type GPCR (latrophilin) gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the secretin-type GPCR (latrophilin) gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature {e.g., Gee et al, in Huber & Carr, MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y., 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
Precise complementarity is not required for successful complex formation between an antisense oligonucleotide and the complementary sequence of a human secretin- type GPCR (latrophilin) polynucleotide. Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a secretin-type GPCR (latrophilin) polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent secretin-type GPCR (latrophilin) nucleotides, can provide sufficient targeting specificity for secretin-type GPCR (latrophilin) mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length. Non-complementary intervening sequences are preferably 1, 2,
3, or 4 nucleotides in length. One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular secretin-type GPCR (latrophilin) polynucleotide sequence.
Antisense oligonucleotides can be modified without affecting their ability to hybridize to a human secretin-type GPCR (latrophilin) polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3', 5 '-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide. These modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawai et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem. Rev. 90, 543-584, 1990; Uhlmann et al, Tetrahedron. Lett.
215, 3539-3542, 1987.
Ribozymes
Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236,
1532-1539; 1987; Cech, røx Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art {e.g., Haseloff et al, U.S. Patent 5,641,673). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
The coding sequence of a human secretin-type GPCR (latrophilin) polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the secretin-type GPCR (latrophilin) polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art {see Haseloff et al. Nature 334, 585-591, 1988). For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201). Specific ribozyme cleavage sites within a human secretin-type GPCR (latrophilin) RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate secretin-type GPCR (latrophilin) RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity ofthe hybridization sequence for the target. The hybridizing and cleavage regions ofthe ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease secretin-type GPCR (latrophilin) expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome ofthe cells, as is known in the art. A ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
As taught in Haseloff et al, U.S. Patent 5,641,673, ribozymes can be engineered so that ribozyme expression will occur in response to factors that induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. Differentially expressed genes
Described herein are methods for the identification of genes whose products interact with human secretin-type GPCR (latrophilin). Such genes may represent genes that are differentially expressed in disorders including, but not limited to, obesity, gastrointestinal and liver disorders, cardiovascular disorders, dermatological disorders, endocrine and hormonal disorders, metabolic disorders, including diabetes, cancer, hematological disorders, neurological disorders, respiratory disorders, reproductive disorders, and genitourinary disorders. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human secretin-type GPCR (latrophilin) gene or gene product may itself be tested for differential expression.
The degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques. Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
To identify differentially expressed genes total RNA or, preferably, mRNA is isolated from tissues of interest. For example, RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc.
New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311).
The differential expression information may itself suggest relevant methods for the treatment of disorders involving the human secretin-type GPCR (latrophilin). For example, treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human secretin-type GPCR
(latrophilin). The differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human secretin-type GPCR (latrophilin) gene or gene product are up-regulated or down-regulated.
Screening methods
The invention provides assays for screening test compounds that bind to or modulate the activity of a human secretin-type GPCR (latrophilin) polypeptide or a human secretin-type GPCR (latrophilin) polynucleotide. A test compound preferably binds to a human secretin-type GPCR (latrophilin) polypeptide or polynucleotide. More preferably, a test compound decreases or increases functional activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence ofthe test compound. Test compounds
Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The com- pounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
Methods for the synthesis of molecular libraries are well known in the art {see, for example, DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al, J. Med. Chem. 37, 2678, 1994; Cho et al, Science 261, 1303, 1993; Carell et al, Angew. Chem. Int. Ed. Engl.
33, 2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al, J. Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in solution {see, e.g., Houghten, BioTechniques 13, 412-421, 1992), or on beads (Lam, Nature 354, 82-84, 1991), chips (Fodor, Nature 364, 555-556, 1993), bacteria or spores (Ladner, U.S. Patent 5,223,409), plasmids (Cull et al, Proc. Natl. Acad. Sci. U.S.A.
89, 1865-1869, 1992), or phage (Scott & Smith, Science 249, 386-390, 1990; Devlin, Science 249, 404-406, 1990); Cwirla et al, Proc. Natl. Acad. Sci. 97, 6378-6382, 1990; Felici, J Mol. Biol. 222, 301-310, 1991; and Ladner, U.S. Patent 5,223,409). High through-put screening
Test compounds can be screened for the ability to bind to secretin-type GPCR (latrophilin) polypeptides or polynucleotides or to affect secretin-type GPCR (latrophilin) activity or secretin-type GPCR (latrophilin) gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates. The wells ofthe microtiter plates typically require assay volumes that range from 50 to 500 μl. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
Alternatively, "free format assays," or assays that have no physical barrier between samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by
Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994). The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
Another example of a free format assay is described by Chelsky, "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in
Philadelphia, Pa. (Nov. 7-10, 1995). Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change. Yet another example is described by Salmon et al., Molecular Diversity 2, 57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.
Another high throughput screening method is described in Beutel et al, U.S. Patent 5,976,813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support. When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together.
Binding assays
For binding assays, the test compound is preferably a small molecule that binds to the secretin-type GPCR (latrophilin) polypeptide, such that normal biological activity is prevented. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules.
In binding assays, either the test compound or the secretin-type GPCR (latrophilin) polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound that is bound to the secretin-type GPCR (latrophilin) polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
Alternatively, binding of a test compound to a human secretin-type GPCR
(latrophilin) polypeptide can be determined without labeling either of the interactants. For example, a microphysiometer can be used to detect binding of a test compound with a human secretin-type GPCR (latrophilin) polypeptide. A microphysiometer (e.g., Cytosensor™) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a human secretin-type GPCR (latrophilin) polypeptide (McConnell et al, Science 257, 1906-1912, 1992).
Determining the ability of a test compound to bind to a human secretin-type GPCR (latrophilin) polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705,
1995). BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants {e.g., BIAcore™). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
In yet another aspect of the invention, a human secretin-type GPCR (latrophilin) polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al, BioTechniques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent
W094/ 10300), to identify other proteins which bind to or interact with the secretin- type GPCR (latrophilin) polypeptide and modulate its activity.
The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct, polynucleotide encoding a human secretin-type GPCR (latrophilin) polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor {e.g., GAL-4). In the other construct a DNA sequence that encodes an unidentified protein ("prey" or "sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact in vivo to form an protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene {e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression ofthe reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the secretin-type GPCR (latrophilin) polypeptide.
It may be desirable to immobilize either the secretin-type GPCR (latrophilin) polypeptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the secretin-type GPCR (latrophilin) polypeptide (or polynucleotide) or the test compound can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a human secretin-type GPCR (latrophilin) polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
In one embodiment, the secretin-type GPCR (latrophilin) polypeptide is a fusion protein comprising a domain that allows the secretin-type GPCR (latrophilin) polypeptide to be bound to a solid support. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed secretin-type GPCR (latrophilin) polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
Other techniques for immobilizing proteins or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either a human secretin-type GPCR (latrophilin) polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated secretin-type GPCR (latrophilin) polypeptides (or polynucleotides) or test com- pounds can be prepared from biotin-NHS(N- hydroxysuccinimide) using techniques well known in the art {e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to a secretin-type GPCR (latrophilin) polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site can be derivatized to the wells of the plate.
Unbound target or protein can be trapped in the wells by antibody conjugation.
Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies which specifically bind to the secretin-type GPCR (latrophilin) polypeptide or test compound and SDS gel electrophoresis under non-reducing conditions.
Screening for test compounds which bind to a human secretin-type GPCR (latrophilin) polypeptide or polynucleotide also can be carried out in an intact cell.
Any cell which comprises a secretin-type GPCR (latrophilin) polypeptide or poly- nucleotide can be used in a cell-based assay system. A secretin-type GPCR (latrophilin) polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a secretin-type GPCR (latrophilin) polypeptide or polynucleotide is determined as described above.
Functional activity
Test compounds can be tested for the ability to increase or decrease the functional activity of a human secretin-type GPCR (latrophilin) polypeptide. Functional activity can be measured, for example, as described in the specific examples, below.
Functional assays can be carried out after contacting either a purified secretin-type GPCR (latrophilin) polypeptide, a cell membrane preparation, or an intact cell with a test compound. A test compound that decreases functional activity of a human secretin-type GPCR (latrophilin) polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100%o is identified as a potential therapeutic agent for decreasing secretin-type GPCR (latrophilin) activity. A test compound which increases functional activity of a human secretin-type GPCR (latrophilin) polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human secretin- type GPCR (latrophilin) activity.
Gene expression
In another embodiment, test compounds that increase or decrease secretin-type GPCR (latrophilin) gene expression are identified. A secretin-type GPCR (latrophilin) polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the secretin-type GPCR (latrophilin) poly- nucleotide is determined. The level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer ofthe mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
The level of secretin-type GPCR (latrophilin) mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a human secretin-type GPCR (latrophilin) polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a human secretin-type GPCR (latrophilin) polypeptide.
Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell that expresses a human secretin-type GPCR (latrophilin) polynucleotide can be used in a cell-based assay system. The secretin-type GPCR (latrophilin) polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
Pharmaceutical compositions
The invention also provides pharmaceutical compositions that can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the in- vention can comprise, for example, a human secretin-type GPCR (latrophilin) polypeptide, secretin-type GPCR (latrophilin) polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a secretin-type GPCR (latrophilin) polypeptide, or mimetics, activators, or inhibitors of a human secretin- type GPCR (latrophilin) polypeptide activity. The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxy- propylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i. e. , dosage.
Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances that increase the viscosity ofthe suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms. In other cases, the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2%> sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
Therapeutic indications and methods
Human secretin-type GPCR (latrophilin) can be regulated to treat obesity, cardiovascular disorders, dermatological disorders, endocrine and hormonal disorders, metabolic disorders, including diabetes, cancer, hematological disorders, gastrointestinal and liver disorders, neurological disorders, respiratory disorders, reproductive disorders, and genitourinary disorders. Obesity
Obesity and overweight are defined as an excess of body fat relative to lean body mass. An increase in caloric intake or a decrease in energy expenditure or both can bring about this imbalance leading to surplus energy being stored as fat. Obesity is associated with important medical morbidities and an increase in mortality. The causes of obesity are poorly understood and may be due to genetic factors, environmental factors or a combination ofthe two to cause a positive energy balance. In contrast, anorexia and cachexia are characterized by an imbalance in energy intake versus energy expenditure leading to a negative energy balance and weight loss.
Agents that either increase energy expenditure and/or decrease energy intake, absorption or storage would be useful for treating obesity, overweight, and associated comorbidities. Agents that either increase energy intake and/or decrease energy expenditure or increase the amount of lean tissue would be useful for treating cachexia, anorexia and wasting disorders.
This gene, translated proteins and agents which modulate this gene or portions ofthe gene or its products are useful for treating obesity, overweight, anorexia, cachexia, wasting disorders, appetite suppression, appetite enhancement, increases or decreases in satiety, modulation of body weight, and/or other eating disorders such as bulimia.
Also this gene, translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyperlipidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hirsutism, stress incontinence, and depression. Cardiovascular disorders
The novel human receptor is highly expressed in the following cardiovascular related tissues: fetal heart, heart, pericardium, heart atrium (right), heart atrium (left), heart ventricle (left), heart apex, Purkinje fibers, mterventricular septum. Expression in the above mentioned tissues demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose cardiovascular diseases. In addition, the activity ofthe novel receptor can be modulated to treat cardiovascular diseases.
Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right-sided or left-sided, systolic or diastolic, independent ofthe underlying cause.
Myocardial infarction (MI) is generally caused by an abrupt decrease in coronary blood flow that follows a thrombotic occlusion of a coronary artery previously narrowed by arteriosclerosis. MI prophylaxis (primary and secondary prevention) is included, as well as the acute treatment of MI and the prevention of complications.
Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which inadequate to meet the myocardial requirement for oxygen. This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia. Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of arrhythmias.
Vascular diseases include primary as well as all kinds of secondary arterial hypertension (renal, endocrine, neurogenic, others). The disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications. Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
Dermatological disorders
The novel human receptor highly expressed in skin. The expression in skin demonstrates that the novel human receptor protein or its mRNA can be utilized to diagnose dermatological diseases, the activity of the novel human receptor can be modulated to treat those diseases.
The skin serves several functions. It is a multi-layered organ system that builds an effective protective cover and regulates body temperature, senses painful and pleasant stimuli, keeps substances from entering the body, and provides a shield from the sun's harmful effects. Skin color, texture, and folds help mark people as individuals. Thus, skin disorders or diseases often have important consequences for physical and mental health. Skin disorders include, but are not limited to the conditions described in the following.
Itching (pruritus) is a sensation that instinctively demands scratching, which may be caused by a skin condition or a systemic disease. Superficial skin disorders affect the uppermost layer ofthe skin, the stratum corneum or the keratin layer, which it consists of many layers of flattened, dead cells and acts as a barrier to protect the underlying tissue from injury and infection. Disorders of the superficial skin layers involve the stratum corneum and deeper layers of the epidermis. Examples of superficial skin disorders are provided in the following.
Dry skin often occurs in people past middle age, severe dry skin (ichthyosis) results from an inherited scaling disease, such as ichthyosis vulgaris or epidermolytic hyperkeratosis. Ichthyosis also results from nonhereditary disorders, such as leprosy, underactive thyroid, lymphoma, AIDS, and sarcoidosis. Keratosis pilaris is a common disorder in which dead cells shed from the upper layer of skin and form plugs that fill the openings of hair follicles. A callus is an area on the stratum corneum or keratin layer, that becomes abnormally thick in response to repeated rubbing. A corn is a pea-sized, thickened area of keratin that occurs on the feet.
Psoriasis is a chronic, recurring disease recognizable by silvery scaling bumps and various-sized plaques (raised patches). An abnormally high rate of growth and turnover of skin cells causes the scaling. Pityriasis rosea is a mild disease that causes scaly, rose-colored, inflamed skin. Pityriasis rosea is possibly caused by an infectious agent, although none has been identified. Lichen planus, a recurring itchy disease, starts as a rash of small discrete bumps that then combine and become rough, scaly plaques (raised patches).
Dermatitis (eczema) is an inflammation of the upper layers of the skin, causing blisters, redness, swelling, oozing, scabbing, scaling, and usually itching. Forms of dermatitis are contact dermatitis, or chronic dermatitis of the hands and feet, e.g., Pompholyx. Further examples of dermatitic disorders are atopic dermatitis, seborrheic dermatitis, nummular dermatitis, generalized exfoliative dermatitis, stasis dermatitis, or localized scratch dermatitis (lichen simplex chronicus, neurodermatitis). Other skin disorders are caused by inflammation. The skin can break out in a variety of rashes, sores, and blisters. Some skin eruptions can even be life threatening. Drug rashes are side effects of medications, mainly allergic reactions to medications.
Toxic epidermal necrolysis is a life-threatening skin disease in which the top layer of the skin peels off in sheets. This condition can be caused by a reaction to a drug or by some other serious disease.
Erythema multiforme, often caused by Herpes simplex, is a disorder characterized by patches of red, raised skin that often look like targets and usually are distributed symmetrically over the body. Erythema nodosum is an inflammatory disorder that produces tender red bumps (nodules) under the skin, most often over the shins but occasionally on the arms and other areas. Granuloma annulare is a chronic skin condition of unknown cause in which small, firm, raised bumps form a ring with normal or slightly sunken skin in the center.
Some skin disorders are characterized as blistering diseases. Three autoimmune diseases— pemphigus, bullous pemphigoid, and dermatitis herpetiformis~are among the most serious. Pemphigus is an uncommon, sometimes fatal, disease in which blisters (bullae) of varying sizes break out on the skin, the lining of the mouth, and other mucous membranes. Bullous pemphigoid is an autoimmune disease that causes blistering. Dermatitis herpetiform is an autoimmune disease in which clusters of intensely itchy, small blisters and hive-like swellings break out and persist. In people with the disease, proteins in wheat, rye, barley, and oat products activate the immune system, which attacks parts ofthe skin and somehow causes the rash and itching.
Sweating disorders also belong to skin disorders. Prickly heat is an itchy skin rash caused by trapped sweat. Excessive sweating (hyperhidrosis) may affect the entire surface of the skin, but often it is limited to the palms, soles, armpits, or groin. The affected area is often pink or bluish white, and in severe cases the skin may be cracked, scaly, and soft, especially on the feet. Skin disorders can affect the sebaceous glands. The sebaceous glands, which secrete oil onto the skin, lie in the dermis, the skin layer just below the surface layer (epidermis). Sebaceous gland disorders include acne, rosacea, perioral dermatitis, and sebaceous cysts.
Acne is a common skin condition in which the skin pores become clogged, leading to pimples and inflamed, infected abscesses (collections of pus). Acne tends to develop in teenagers. Acne is further subdivided in superficial acne or deep acne. Rosacea is a persistent skin disorder that produces redness, tiny pimples, and broken blood vessels, usually on the central area of the face. Perioral dermatitis is a red, often bumpy rash around the mouth and on the chin. A sebaceous cyst (keratinous cyst) is a slow-growing bump containing dead skin, skin excretions, and other skin particles. These cysts may be small and can appear anywhere.
Hair disorders also are skin disorders. Hair disorders include excessive hairiness, baldness, and ingrown beard hairs.
The skin can be infected by bacteria. Bacterial skin infections can range in seriousness from minor acne to a life-threatening condition, such as staphylococcal scalded skin syndrome. The most common bacterial skin infections are caused by Staphylococcus and Streptococcus. Risk factors for skin infections are for example diabetes, AIDS or skin lesions. Impetigo is a skin infection, caused by Staphylococcus or Streptococcus, leading to the formation of small pus-filled blisters (pustules). Folliculitis is an inflammation of the hair follicles caused by infection with Staphylococcus. The infection damages the hairs, which can be easily pulled out. Boils (furuncles) are large, tender, swollen, raised areas caused by staphylococcal infection around hair follicles. Carbuncles are clusters of boils that result in extensive sloughing of skin and scar formation. Carbuncles develop and heal more slowly than single boils and may lead to fever and fatigue.
Erysipelas is a skin infection caused by Streptococcus. A shiny, red, slightly swollen, tender rash develops, often with small blisters. Lymph nodes around the infected area may become enlarged and painful. Cellulitis is a spreading infection in, and sometimes beneath, the deep layers of the skin. Cellulitis most often results from a streptococcal infection or a staphylococcal infection. However, many other bacteria can also cause cellulitis. Paronychia is an infection around the edge of a fingernail or toenail. Paronychia can be caused by many different bacteria, including
Pseudomonas and Proteus, and by fungi, such as Candida.
Staphylococcal scalded skin syndrome is a widespread skin infection that can lead to toxic shock syndrome, in which the skin peels off as though burned. Certain types of staphylococci produce a toxic substance that causes the top layer of skin (epidermis) to split from the rest of the skin. Erythrasma is an infection of the top layers of the skin by the bacterium Corynebacterium minutissimum.
Skin infections are often caused by fungi. Fungi that infect the skin (dermatophytes) live only in the dead, topmost layer (stratum corneum) and do not penetrate deeper.
Some fungal infections cause no symptoms or produce only a small amount of irritation, scaling, and redness. Other fungal infections cause itching, swelling, blisters, and severe scaling. Ringworm is a fungal skin infection caused by several different fungi and generally classified by its location on the body. Examples are Athlete's foot (foot ringworm, caused by either Trichophyton or Epidermophyton), jock itch (groin ringworm, can be caused by a variety of fungi and yeasts), scalp ringworm, caused by Trichophyton or Microsporum), nail ringworm and body ringworm (caused by Trichophyton).
Candidiasis (yeast infection, moniliasis) is an infection by the yeast Candida.
Candida usually infects the skin and mucous membranes, such as the lining of the mouth and vagina. Rarely, it invades deeper tissues as well as the blood, causing life-threatening systemic candidiasis. The following types of Candida infections can be distinguished: Infections in skinfolds (intertriginous infections), vaginal and penile Candida infections (vulvovaginitis), thrush, Perleche (candida infection at the corners of the mouth), candidal paronychia (candida growing in the nail beds, produces painful swelling and pus). Tinea versicolor is a fungal infection that causes white to light brown patches on the skin.
The skin can also be affected by parasites, mainly tiny insects or worms. Scabies is a mite infestation that produces tiny reddish pimples and severe itching. Scabies is caused by the itch mite Sarcoptes scabiei. Lice infestation (pediculosis) causes intense itching and can affect almost any area ofthe skin. Head lice and pubic lice are two different species.
Creeping eruption (cutaneous larva migrans) is a hookworm infection transmitted from warm, moist soil to exposed skin. The infection is caused by a hookworm that normally inhabits dogs and cats.
Many types of viruses invade the skin. The medically important once cause warts and cold sores (fever blisters) on the lip. Warts are caused by the papillomavirus, and cold sores are caused by the Herpes simplex virus. Another important group of viruses that infect the skin belongs to the poxvirus family. Chickenpox remains a common childhood infection. A poxvirus also causes molluscum contagiosum, which is an infection of the skin by a poxvirus that causes skin-colored, smooth, waxy bumps.
Sunlight can cause severe skin damage. Sunburn results from an overexposure to ultraviolet B (UVB) rays. Some sunburned people develop a fever, chills, and weakness, and those with very bad sunburns even may go into shock—low blood pressure, and fainting. People who are in the sun a lot have an increased risk of skin cancers, including squamous cell carcinoma, basal cell carcinoma, and to some degree, malignant melanoma. Drugs, among other causes, can cause skin photo- sensitivity reactions which can occur after only a few minutes of sun exposure. These reactions include redness, peeling, hives, blisters, and thickened, scaling patches (photosensitivity). Some skin disorders are characterized as pigment disorders. Albinism is a rare, inherited disorder in which no melanin is formed. Vitiligo is a condition in which a loss of melanocytes results in smooth, whitish patches of skin, which may occur after unusual physical trauma and tends to occur with certain other diseases, including Addison's disease, diabetes, pernicious anemia, and thyroid disease. Tinea versicolor is a fungal infection of the skin that sometimes results in hyperpigmentation. Melasma appears on the face (usually the forehead, cheeks, temples, and jaws) as a roughly symmetric group of dark brown patches of pigmentation that are often clearly delineated.
Skin growths, which are abnormal accumulations of different types of cells, may be present at birth or develop later. Noncancerous (benign) growth and cancerous (malignant) growth types are distinguished. Moles (nevi) are small, usually dark, skin growths that develop from pigment-producing cells in the skin (melanocytes). Most moles are harmless. However, noncancerous moles can develop into malignant melanoma. Skin tags are soft, small, flesh-colored or slightly darker skin flaps that appear mostly on the neck, in the armpits, or in the groin. Lipomas are soft deposits of fatty material that grow under the skin, causing round or oval lumps. Angiomas are collections of abnormally dense blood or lymph vessels that are usually located in and below the skin and that cause red or purple discolorations. Examples of angiomas are port-wine stains, strawberry marks, cavernous hemangiomas, spider angiomas, and lymphangiomas.
Pyogenic granulomas are scarlet, brown, or blue-black slightly raised areas caused by increased growth of capillaries (the smallest blood vessels) and swelling of the surrounding tissue. Seborrheic keratoses (sometimes called seborrheic warts) are flesh-colored, brown, or black growths that can appear anywhere on the skin. Dermatofibromas are small, red-to-brown bumps (nodules) that result from an accumulation of fibroblasts, the cells that populate the soft tissue under the skin. Keratoacanthomas are round, firm, usually flesh-colored growths that have an unusual central crater containing a pasty material. Keloids are smooth, shiny, slightly pink, often dome-shaped, proliferative growths of fibrous tissue that form over areas of injury or over surgical wounds.
Skin cancer is the most common form of cancer, but most types of skin cancers are curable. Basal cell carcinoma is a cancer that originates in the lowest layer of the epidermis. Squamous cell carcinoma is cancer that originates in the middle layer of the epidermis. Bowen's disease is a form of squamous cell carcinoma that's confined to the epidermis and hasn't yet invaded the underlying dermis. Melanoma is a cancer that originates in the pigment-producing cells of the skin (melanocytes). Kaposi's sarcoma is a cancer that originates in the blood vessels, usually of the skin. Paget's disease is a rare type of skin cancer that looks like an inflamed, reddened patch of skin (dermatitis); it originates in glands in or under the skin.
Endocrine and hormonal disorders
The novel human receptor is highly expressed in the following tissues of the endocrinological system: adrenal gland, thyroid, pancreas. The expression in the above mentioned tissues demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose of endocrinological disorders. In addition, the activity of the novel human receptor can be modulated to treat endocrinological disorders.
The endocrine system consists of a group of organs whose main function is to produce and secrete hormones directly into the bloodstream. The major organs ofthe endocrine system are the hypothalamus, the pituitary gland, thyroid gland, the parathyroid glands, the islets of the pancreas, the adrenal glands, the testes, and the ovaries. The hypothalamus secretes several hormones that stimulate the pituitary. Some trigger the release of pituitary hormones, while others suppress the release of pituitary hormones. The pituitary gland coordinates many functions of the other endocrine glands, but some pituitary hormones have direct effects.
The insulin-secreting cells of the pancreas respond to glucose and fatty acids. Parathyroid cells respond to calcium and phosphate. The adrenal medulla (part ofthe adrenal gland) responds to direct stimulation by the parasympathetic nervous system When endocrine glands malfunction, hormone in the blood can become abnormally high or low, disrupting body functions. Many disorders are caused by malfunction of the endocrine system or hormones. Examples of such disorders are presented in the following.
Diabetes mellitus is a disorder in which blood levels of glucose are abnormally high because the body doesn't release or use insulin adequately. People with type I diabetes mellitus (insulin-dependent diabetes) produce little or no insulin at all. In type I diabetes more than 90 percent ofthe insulin-producing cells (beta cells) ofthe pancreas are permanently destroyed. The resulting insulin deficiency is severe, and to survive, a person with type I diabetes must regularly inject insulin. In type II diabetes mellitus (non-insulin-dependent diabetes) the body develops resistance to insulin effects, resulting in a relative insulin deficiency.
The pancreas has two major functions: to secrete fluid containing digestive enzymes into the duodenum and to secrete the hormones insulin and glucagon. Chronic pancreatitis is a long-standing inflammation of the pancreas. Eventually, the insulin-secreting cells of the pancreas may be destroyed, gradually leading to diabetes. An insulinoma is a rare type of pancreatic tumor that secretes insulin. The symptoms of an insulinoma result from low blood glucose levels. A gastrinoma is a pancreatic tumor that produces excessive levels of the hormone gastrin, which stimulates the stomach to secrete acid and enzymes, causing peptic ulcers. The excess gastrin secreted by the gastrinoma causes symptoms, called the Zollinger-Ellison syndrome. A glucagonoma is a tumor that produces the hormone glucagon, which raises the level of glucose in the blood and produces a distinctive rash.
Diabetes insipidus is a disorder in which insufficient levels of antidiuretic hormone cause excessive thirst (polydipsia) and excessive production of very dilute urine
(polyuria). Diabetes insipidus results from the decreased production of antidiuretic hormone (vasopressin).
The body has two adrenal glands. The medulla of the adrenal glands secretes hormones such as adrenaline (epinephrine) that affect blood pressure, heart rate, sweating, and other activities also regulated by the sympathetic nervous system. The cortex secretes many different hormones, including corticosteroids (cortisone-like hormones), androgens (male hormones), and mineralocorticoids, which control blood pressure and the levels of salt and potassium in the body
A disease characterized by underactive adrenal glands is Addison's disease (adrenocortical insufficiency). Several disorders are characterized by overactive Adrenal Glands. The causes can be changes in the adrenal glands themselves or overstimulation by the pituitary gland. Examples of these diseases are listed in the following. Overproduction of androgenic steroids (testosterone and similar hormones, leads to virilization), oveφroduction of corticosteroids (causes could be tumors ofthe pituitary or the adrenal gland, results in Cushing's syndrome), Nelson's syndrome (developed by people who have both adrenal glands removed, characterized by an enlargement of the pituitary gland), oveφroduction of aldosterone (hyperaldosteronism), Conn's syndrome (hyperaldosterism caused by a tumor), and pheochromocytoma (a tumor that originating from the adrenal gland's chromaffm cells, causing oveφroduction of catecholamines).
The thyroid is a small gland located under the Adam's apple. It secretes thyroid hormones, which control the metabolic rate. The thyroid gland traps iodine and processes it into thyroid hormones. The euthyroid sick syndrome is characterized by lack of conversion of the T4 form of thyroid hormone to the T3 form. Hyperthyroidism (overactive thyroid gland, production of too much hormone) may have several causes. Thyroiditis (an inflammation ofthe thyroid gland), typically leads to a phase of hyperthyroidism. The inflammation may damage the thyroid gland, so that in later stages the disease is characterized by transient or permanent underactivity
(hypothyroidism). Toxic thyroid nodules (adenomas) often produce thyroid hormone in large quantities. Toxic multinodular goiter (Plummer's disease) is a disorder in which there are many nodules. Graves' disease (toxic diffuse goiter) is believed to be caused by an antibody that stimulates the thyroid to produce too much thyroid hormone. In toxic nodular goiter, one or more nodules in the thyroid produce too much thyroid hormone and aren't under the control of thyroid-stimulating hormone. Secondary hyperthyroidism may (rarely) be caused by a pituitary tumor that secretes too much thyroid-stimulating hormone, by resistance of the pituitary to thyroid hormone, which results in the pituitary gland secreting too much thyroid-stimulating hormone, or by a hydatidiform mole in women. Thyroid storm is a sudden extreme overactivity of the thyroid gland is a life-threatening emergency requiring prompt treatment.
Hypothyroidism is a condition in which the thyroid gland is underactive and produces too little thyroid hormone. Very severe hypothyroidism is called myxedema. In Hashimoto's thyroiditis (autoimmune thyroiditis) the thyroid gland is often enlarged, and hypothyroidism results because the gland's functioning areas are gradually destroyed. Rarer causes of hypothyroidism include some inherited disorders that are caused by abnormalities of the enzymes in thyroid cells. In other rare disorders, either the hypothalamus or the pituitary gland fails to secrete enough of the hormone needed to stimulate normal thyroid function. Other examples of thyroiditis are silent lymphocytic thyroiditis, Hashimoto's thyroiditis, or subacute granulomatous thyroiditis. Thyroid cancer is any one of four main types of malignancy ofthe thyroid: papillary, follicular, anaplastic, or medullary. The pituitary is a pea-sized gland that sits in a bony structure (sella turcica) at the base of the brain. The sella turcica protects the pituitary but allows very little room for expansion. If the pituitary enlarges, it tends to push upward, often pressing on the areas of the brain that carry signals from the eyes, possibly resulting in headaches or impaired vision. The pituitary gland has two distinct parts: the anterior (front) and the posterior (back) lobes. The anterior lobe produces (secretes) hormones that ultimately control the function of the thyroid gland, adrenal glands, and reproductive organs (ovaries and testes); milk production (lactation) in the breasts; and overall body growth. It also produces hormones that cause the skin to darken and that inhibit pain sensations. The posterior lobe produces hormones that regulate water balance, stimulate the let-down of milk from the breasts in lactating women, and stimulate contractions ofthe uterus.
Examples for disorders of the pituitary gland are Empty Sella Syndrome; hypopituitarism (an underactive pituitary gland); acromegaly, which is excessive growth caused by oversecretion of growth hormone, which is almost always caused by a benign pituitary tumor (adenoma); galactorrhea, which is the production of breast milk in men or in women who aren't breastfeeding, in both sexes, the most common cause of galactorrhea is a prolactin-producing tumor (prolactinoma) in the pituitary gland.
Metabolic disorders
The novel human receptor is highly expressed in the pancreas. The expression in the above mentioned tissues demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose metabolic diseases. In addition, the activity ofthe novel human receptor can be modulated to treat metabolic diseases.
Metabolic disorders are defined as conditions that result from an abnormality in any ofthe chemical or biochemical transformations and their regulating systems essential to producing energy, to regenerating cellular constituents, to eliminating unneeded products arising from these processes, and to regulate and maintain homeostasis in a mammal regardless of whether acquired or the result of a genetic transformation. Depending on which metabolic pathway is involved, a single defective transformation or disturbance of its regulation may produce consequences that are narrow, involving a single body function, or broad, affecting many organs, organ systems, or the body as a whole. Diseases resulting from abnormalities related to the fine and coarse mechanisms that affect each individual transformation, its rate and direction, or the availability of substrates like amino acids, fatty acids, carbohydrates, minerals, cofactors, hormones, regardless whether they are inborn or acquired, are well within the scope of the definition of a metabolic disease according to this application.
Metabolic disorders often are caused by single defects in particular biochemical pathways, defects that are due to the deficient activity of individual enzymes or molecular receptors leading to the regulation of such enzymes. Hence, in a broader sense disturbances of the underlying genes, their products and their regulation lie well within the scope of this definition of a metabolic disease. For example, metabolic disorders may affect 1) biochemical processes and tissues ubiquitous all over the body, 2) the bone, 3) the nervous system, 4) the endocrine system, 5) the muscle including the heart, 6) the skin and nervous tissue, 7) the urogenital system, 8) the homeostasis of body systems like water and electrolytes.
Metabolic disorders according to 1) include, but are not limited to, obesity, amyloidosis, disturbances of the amino acid metabolism like branched chain disease, hyperaminoacidemia, hyperaminoaciduria, disturbances of the metabolism of urea, hyperammonemia, mucopolysaccharidoses {e.g., Maroteaux-Lamy syndrome, storage diseases such as glycogen storage diseases and lipid storage diseases, glycogenosis diseases such as Cori's disease, malabsoφtion diseases such as intestinal carbohydrate malabsoφtion, oligosaccharidase deficiency like maltase-, lactase-, or sucrase-insufficiency, disorders of the metabolism of fructose, disorders of the metabolism of galactose, galactosemia, disturbances of carbohydrate utilization such as diabetes, hypoglycemia, disturbances of pyruvate metabolism, hypolipidemia, hypolipoproteinemia, hyperlipidemia, hyperlipoproteinemia, carnitine or carnitine acyltransferase deficiency, disturbances of the poφhyrin metabolism, poφhyrias, disturbances of the purine metabolism, lysosomal diseases, and metabolic disorders of nerves and nervous systems such as gangliosidoses, sphingolipidoses, sulfatidoses, leucodystrophies, and Lesch-Nyhan syndrome.
Metabolic disorders according to 2) include, but are not limited to, osteoporosis, osteomalacia-like osteoporosis, osteopenia, osteogenesis imperfecta, osteopetrosis, osteonecrosis, Paget's disease of bone, and hypophosphatemia.
Metabolic disorders according to 3) include, but are not limited to, cerebellar dysfunction, disturbances of brain metabolism such as dementia, Alzheimer's disease, Huntington's chorea, Parkinson's disease, Pick's disease, toxic encephalopathy, demyelinating neuropathies such as inflammatory neuropathy, and Guillain-Barre syndrome.
Metabolic disorders according to 4) include, but are not limited to, primary and secondary metabolic disorders associated with hormonal defects such as any disorder stemming from either a hyperfunction or hypofunction of some hormone-secreting endocrine gland and any combination thereof. They include Sipple's syndrome, pituitary gland dysfunction and its effects on other endocrine glands, such as the thyroid, adrenals, ovaries, and testes, acromegaly, hyper- and hypothyroidism, euthyroid goiter, euthyroid sick syndrome, thyroiditis, and thyroid cancer, over- or undeφroduction ofthe adrenal steroid hormones, adrenogenital syndrome, Cushing's syndrome, Addison's disease of the adrenal cortex, Addison's pernicious anemia, primary and secondary aldosteronism, diabetes insipidus, carcinoid syndrome, disturbances caused by the dysfunction ofthe parathyroid glands, pancreatic islet cell dysfunction, diabetes, disturbances of the endocrine system of the female such as estrogen deficiency, and resistant ovary syndrome. Metabolic disorders according to 5) include, but are not limited to, muscle weakness, myotonia, Duchenne's and other muscular dystrophies, dystrophia myotonica of Steinert, mitochondrial myopathies such as disturbances of the catabolic metabolism in the muscle, carbohydrate and lipid storage myopathies, glycogenoses, myoglobinuria, malignant hyperthermia, polymyalgia rheumatica, dermatomyositis, primary myocardial disease, cardiomyopathy.
Metabolic disorders according to 6) include, but are not limited to, disorders of the ectoderm, neurofibromatosis, scleroderma and polyarteritis, Louis-Bar syndrome, von Hippel-Lindau disease, Sturge- Weber syndrome, tuberous sclerosis, amyloidosis, poφhyria.
Metabolic disorders according to 7) include, but are not limited to, sexual dysfunction ofthe male and female.
Metabolic disorders according to 8) include, but are not limited to, confused states and seizures due to inappropriate secretion of antidiuretic hormone from the pituitary gland, Liddle's syndrome, Barrier's syndrome, Fanconi's syndrome, renal electrolyte wasting, diabetes insipidus.
Diabetes
Diabetes mellitus is a common metabolic disorder characterized by an abnormal elevation in blood glucose, alterations in lipids and abnormalities (complications) in the cardiovascular system, eye, kidney and nervous system. Diabetes is divided into two separate diseases: type 1 diabetes (juvenile onset), which results from a loss of cells which make and secrete insulin, and type 2 diabetes (adult onset), which is caused by a defect in insulin secretion and a defect in insulin action.
Type I diabetes is initiated by an autoimmune reaction that attacks the insulin secreting cells (beta cells) in the pancreatic islets. Agents that prevent this reaction from occurring or that stop the reaction before destruction of the beta cells has been accomplished are potential therapies for this disease. Other agents that induce beta cell proliferation and regeneration also are potential therapies.
Type II diabetes is the most common of the two diabetic conditions (6% of the population). The defect in insulin secretion is an important cause of the diabetic condition and results from an inability ofthe beta cell to properly detect and respond to rises in blood glucose levels with insulin release. Therapies that increase the response by the beta cell to glucose would offer an important new treatment for this disease.
The defect in insulin action in Type II diabetic subjects is another target for therapeutic intervention. Agents that increase the activity of the insulin receptor in muscle, liver, and fat will cause a decrease in blood glucose and a normalization of plasma lipids. The receptor activity can be increased by agents that directly stimulate the receptor or that increase the intracellular signals from the receptor. Other therapies can directly activate the cellular end process, i.e. glucose transport or various enzyme systems, to generate an insulin-like effect and therefore a produce beneficial outcome. Because overweight subjects have a greater susceptibility to Type II diabetes, any agent that reduces body weight is a possible therapy.
Both Type I and Type II diabetes can be treated with agents that mimic insulin action or that treat diabetic complications by reducing blood glucose levels. Likewise, agents that reduces new blood vessel growth can be used to treat the eye complications that develop in both diseases.
Gastrointestinal and liver disorders
The novel human receptor is highly expressed in the following tissues of the gastroenterological system: stomach, stomach tumor, colon, colon tumor, small intestine, ileum, rectum, liver, liver tumor, HEP G2 cells. The expression in the above mentioned tissues and in particular the differential expression between diseased tissue stomach tumor and healthy tissue stomach, between diseased tissue colon tumor and healthy tissue colon, between diseased tissue liver tumor and healthy tissue liver, between diseased tissue HEP G2 cells and healthy tissue liver demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose gastroenterological disorders. In addition, the activity of the novel human receptor can be modulated to treat gastroenterological disorders.
Gastrointestinal diseases include primary or secondary, acute or chronic diseases of the organs of the gastrointestinal tract which may be acquired or inherited, benign or malignant or metaplastic, and which may affect the organs ofthe gastrointestinal tract or the body as a whole. They include but are not limited to 1) disorders of the esophagus such as achalasia, vigoruos achalasia, dysphagia, cricopharyngeal incoordination, pre-esophageal dysphagia, diffuse esophageal spasm, globus sensation, Barrett's metaplasia, gastroesophageal reflux, 2) disorders of the stomach and duodenum such as functional dyspepsia, inflammation of the gastric mucosa, gastritis, stress gastritis, chronic erosive gastritis, atrophy of gastric glands, metaplasia of gastric tissues, gastric ulcers, duodenal ulcers, neoplasms of the stomach, 3) disorders of the pancreas such as acute or chronic pancreatitis, insuffi- ciency ofthe exocrinic or endocrinic tissues of the pancreas such as steatorrhea, diabetes, neoplasms of the exocrine or endocrine pancreas such as 3.1) multiple endocrine neoplasia syndrome, ductal adenocarcinoma, cystadenocarcinoma, islet cell tumors, insulinoma, gastrinoma, carcinoid tumors, glucagonoma, Zollinger-Ellison syndrome, Vipoma syndrome, malabsoφtion syndrome, 4) disorders of the bowel such as chronic inflammatory diseases of the bowel, Crohn's disease, ileus, diarrhea and constipation, colonic inertia, megacolon, malabsoφtion syndrome, ulcerative colitis, 4.1) functional bowel disorders such as irritable bowel syndrome, 4.2) neoplasms of the bowel such as familial polyposis, adenocarcinoma, primary malignant lymphoma, carcinoid tumors, Kaposi's sarcoma, polyps, cancer of the colon and rectum. Liver diseases include primary or secondary, acute or chronic diseases or injury ofthe liver which may be acquired or inherited, benign or malignant, and which may affect the liver or the body as a whole. They comprise but are not limited to disorders ofthe bilirubin metabolism, jaundice, syndromes of Gilbert, Crigler-Najjar, Dubin- Johnson, and Rotor; intrahepatic cholestasis, hepatomegaly, portal hypertension, ascites,
Budd-Chiari syndrome, portal-systemic encephalopathy, fatty liver, steatosis, Reye's syndrome, liver diseases due to alcohol, alcoholic hepatitis or cirrhosis, fibrosis and cirrhosis, fibrosis and cirrhosis of the liver due to inborn errors of metabolism or exogenous substances, storage diseases, syndromes of Gaucher and Zellweger, Wilson's disease, acute or chronic hepatitis, viral hepatitis and its variants, inflammatory conditions of the liver due to viruses, bacteria, fungi, protozoa, helminths; drug induced disorders of the liver, chronic liver diseases such as primary sclerosing cholangitis, alphal-antitrypsin-deficiency, primary biliary cirrhosis, postoperative liver disorders such as postoperative intrahepatic cholestasis, hepatic granulomas, vascular liver disorders associated with systemic disease, benign or malignant neoplasms ofthe liver, disturbance of liver metabolism in the new-born or prematurely born.
Cancer
The novel human receptor is highly expressed in the following cancer tissues: stomach tumor, colon tumor, liver tumor, HEP G2 cells, Jurkat (T-cells), lung tumor, uterus tumor, ovary tumor, MDA MB 231 cells (breast tumor), prostate, kidney tumor. The expression in the above mentioned tissues and in particular the differential expression between diseased tissue stomach tumor and healthy tissue stomach, between diseased tissue colon tumor and healthy tissue colon, between diseased tissue liver tumor and healthy tissue liver, between diseased tissue HEP G2 cells and healthy tissue liver, between diseased tissue Jurkat (T-cells) and healthy tissue leukocytes (peripheral blood), between diseased tissue lung tumor and healthy tissue lung, between diseased tissue uterus tumor and healthy tissue uterus, between diseased tissue ovary tumor and healthy tissue ovary, between diseased tissue MDA MB 231 cells (breast tumor) and healthy tissue breast, between diseased tissue kidney tumor and healthy tissue kidney demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose cancer. In addition, the activity of the novel human Secretin-type GPCR (latrophilin) can be modulated to treat cancer.
Cancer disorders within the scope of the invention comprise any disease of an organ or tissue in mammals characterized by poorly controlled or uncontrolled multiplication of normal or abnormal cells in that tissue and its effect on the body as a whole. Cancer diseases within the scope of the invention comprise benign neoplasms, dysplasias, hypeφlasias as well as neoplasms showing metastatic growth or any other transformations, e.g., leukoplakias, which often precede a breakout of cancer. Cells and tissues are cancerous when they grow more rapidly than normal cells, displacing or spreading into the surrounding healthy tissue or any other tissues ofthe body described as metastatic growth, assume abnormal shapes and sizes, show changes in their nucleocytoplasmatic ratio, nuclear polychromasia, and finally may cease.
Cancerous cells and tissues may affect the body as a whole when causing paraneoplastic syndromes or if cancer occurs within a vital organ or tissue, normal function will be impaired or halted, with possible fatal results. The ultimate involvement of a vital organ by cancer, either primary or metastatic, may lead to the death ofthe mammal affected. Cancer tends to spread, and the extent of its spread is usually related to an individual's chances of surviving the disease. Cancers are generally said to be in one of tliree stages of growth: early, or localized, when a tumor is still confined to the tissue of origin, or primary site; direct extension, where cancer cells from the tumour have invaded adjacent tissue or have spread only to regional lymph nodes; or metastasis, in which cancer cells have migrated to distant parts of the body from the primary site, via the blood or lymph systems, and have established secondary sites of infection. Cancer is said to be malignant because of its tendency to cause death if not treated. Benign tumors usually do not cause death, although they may if they interfere with a normal body function by virtue of their location, size, or paraneoplastic side effects. Hence, benign tumors fall under the definition of cancer within the scope of the invention as well. In general, cancer cells divide at a higher rate than do normal cells, but the distinction between the growth of cancerous and normal tissues is not so much the rapidity of cell division in the former as it is the partial or complete loss of growth restraint in cancer cells and their failure to differentiate into a useful, limited tissue of the type that characterizes the functional equilibrium of growth of normal tissue.
Cancer tissues may express certain molecular receptors and probably are influenced by the host's susceptibility and immunity and it is known that certain cancers of the breast and prostate, for example, are considered dependent on specific hormones for their existence. The term "cancer" under the scope of the invention is not limited to simple benign neoplasia but includes any other benign and malign neoplasia, such as
1) carcinoma, 2) sarcoma, 3) carcinosarcoma, 4) cancers of the blood-forming tissues, 5) tumors of nerve tissues including the brain, and 6) cancer of skin cells.
Carcinoma occurs in epithelial tissues, which cover the outer body (the skin) and line mucous membranes and the inner cavitary structures of organs e.g. such as the breast, lung, the respiratory and gastrointestinal tracts, the endocrine glands, and the genitourinary system. Ductal or glandular elements may persist in epithelial tumors, as in adenocarcinomas, e.g., thyroid adenocarcinoma, gastric adenocarcinoma, uterine adenocarcinoma. Cancers of the pavement-cell epithelium of the skin and of certain mucous membranes, such as cancers of the tongue, lip, larynx, urinary bladder, uterine cervix, or penis, may be termed epidermoid or squamous-cell carcinomas of the respective tissues and are within the scope of the definition of cancer as well. Sarcomas develop in connective tissues, including fibrous tissues, adipose (fat) tissues, muscle, blood vessels, bone, and cartilage such as osteogenic sarcoma, liposarcoma, fibrosarcoma, and synovial sarcoma.
Carcinosarcoma is cancer that develops in both epithelial and connective tissue.
Cancer disease within the scope of this definition may be primary or secondary, whereby primary indicates that the cancer originated in the tissue where it is found rather than was established as a secondary site through metastasis from another lesion. Cancers and tumor diseases within the scope of this definition may be benign or malign and may affect all anatomical structures of the body of a mammal. By example, to they comprise cancers and tumor diseases of I) the bone marrow and bone marrow derived cells (leukemias), II) the endocrine and exocrine glands, such as the thyroid, parathyroid, pituitary, adrenal glands, salivary glands, and pancreas III) the breast, such as benign or malignant tumors in the mammary glands of either a male or a female, the mammary ducts, adenocarcinoma, medullary carcinoma, comedocarcinoma, Paget's disease of the nipple, inflammatory carcinoma of the young woman, IV) the lung, V) the stomach, VI) the liver and spleen, VII) the small intestine, VIII) the colon, LX) the bone and its supportive and connective tissues such as malignant or benign bone tumour, such as malignant osteogenic sarcoma, benign osteoma, cartilage tumors, malignant chondrosarcoma or benign chondroma,; bone marrow tumors such as malignant myeloma or benign eosino- philic granuloma, as well as metastatic tumors from bone tissues at other locations ofthe body; X) the mouth, throat, larynx, and the esophagus, XI) the urinary bladder and the internal and external organs and structures of the urogenital system of male and female such as the ovaries, uterus, cervix ofthe uterus, testes, and prostate gland,
XII) the prostate, XIII) the pancreas, such as ductal carcinoma of the pancreas; XIV) the lymphatic tissue such as lymphomas and other tumors of lymphoid origin, XV) the skin, XVI) cancers and tumor diseases of all anatomical structures belonging to the respiratory systems including thoracal muscles and linings, XVII) primary or secondary cancer ofthe lymph nodes, XVIII) the tongue and ofthe bony structures of the hard palate or sinuses, XVTV) the mouth, cheeks, neck and salivary glands, XX) the blood vessels including the heart and their linings, XXI) the smooth or skeletal muscles and their ligaments and linings, XXII) the peripheral, the autonomous, the central nervous system including the cerebellum, and XXIII) the adipose tissue.
Hematological disorders
The novel human receptor is highly expressed in the following tissues of the hematological system: Jurkat (T-cells), thymus, bone marrow CD34+ cells, cord blood CD34+ cells. The expression in the above mentioned tissues and in particular the differential expression between diseased tissue Jurkat (T-cells) and healthy tissue leukocytes (peripheral blood) demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose hematological diseases. Additionally the activity ofthe novel human receptor can be modulated to treat hematological disorders.
Anemia
Hemoglobin in red blood cells is the key component for transporting oxygen from the lungs to the tissues. In anemia the level of hemoglobin has fallen below 12g/L. Therefore the oxygen carrying capacity of blood is reduced. Common reasons for anemia include acute or chronic blood loss, insufficient levels of erythropoietin synthesis in the kidneys (e.g. in dialysis patients) or insufficient output of red blood cells from bone marrow after chemotherapy or HIV infection etc.. Current therapy of anemia is aimed at increasing the hematocrit either by transfusion or by stimulating erythropoiesis with agents such as erythropoietin. The treatment goal is to restore hemoglobin levels above 12g/L.
Neutropenia
Neutrophils play a key role in the defense against infections. Neutropenia is an abnormally low white blood cell count which causes an increased incidence of infections. Causes of neutropenia include: drug-induced (e.g., following cancer chemotherapy), increased destruction of neutrophils (e.g., immune-mediated) or decreased bone marrow function (e.g., familial neutropenia). Neutropenia following cancer chemotherapy is currently treated with growth factors such as G-CSF or GM- CSF that stimulate granulopoiesis. The treatment goal is to raise the neutrophil count in order to reduce the susceptibility to infection.
Thrombocytopenia
Thrombocytopenia is a disorder where the number of platelets is inappropriately low. Since platelets play an essential role in thrombus formation to limit blood loss following vessel injury, insufficient platelet levels may lead to abnormal bleeding. There are many causes of thrombocytopenia including drug-induced thrombocytopenia (e.g., following cancer chemotherapy) and immune thromboytopenia (due to increased degradation of platelets). Platelet transfusions or IL-11 can be used to restore platelet levels in order to reduce the bleeding risk.
Aplastic anemia (Pancyteponiά)
Aplastic anemia is a life-threatening hematologic disorder characterized by absent or markedly diminished hematopoietic precursors in the bone marrow and resulting in neutropenia, anemia and thrombocytopenia. A large number of agents can cause aplastic anemia (drugs, chemicals and toxins) radiation and certain infections can also induce aplastic anemia. More frequently, aplastic anemia occurs as an unpredictable idiosyncratic reaction to drugs such as anti-inflammatory agents, antibiotics, and antiepileptic drugs. Aplastic anemia typically develops weeks or month during drug administration or delayed after drug administration has been discontinued. Several congenital and familiar forms of aplastic anemia have been described, including Fanconi's anemia, Shwachman-Diamond syndrome, familiar aplastic anemia, and aplasia associated with dyskeratosis congenita or amega- karyocytic thrompocytopenia. Neurological disorders
The novel human receptor is highly expressed in the following brain tissues: fetal brain, brain, Alzheimer brain, cerebellum (right), cerebellum (left), cerebral cortex, Alzheimer cerebral cortex, frontal lobe, Alzheimer brain frontal lobe, occipital lobe, parietal lobe, temporal lobe, precentral gyrus, vennis cerebelli, pons, substantia nigra, coφus callosum, hippocampus, thalamus, spinal cord. The expression in brain tissues and in particular the differential expression between diseased tissue Alzheimer brain and healthy tissue brain, between diseased tissue Alzheimer cerebral cortex and healthy tissue cerebral cortex, between diseased tissue Alzheimer brain frontal lobe and healthy tissue frontal lobe demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose nervous system diseases. In addition, the activity of the novel human receptor can be modulated to treat nervous system diseases.
Neurological disorders include disorders of the central nervous system as well as disorders of the peripheral nervous system. Neurological disorders include, but are not limited to, brain injuries, cerebrovascular diseases and their consequences, Parkinson's disease, corticobasal degeneration, motor neuron disease (including ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post-traumatic brain injury, and small-vessel cerebrovascular disease. Dementias, such as Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia and Parkinsonism linked to chromosome 17, frontotemporal dementias (including Pick's disease), progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob dementia, HIV dementia, schizophrenia with dementia, and Korsakoffs psychosis, also are neurological disorders.
Similarly, cognitive-related disorders, such as mild cognitive impairment, age- associated memory impairment, age-related cognitive decline, vascular cognitive impairment, attention deficit disorders, attention deficit hyperactivity disorders, and memory disturbances in children with learning disabilities also are considered to be neurological disorders.
Pain, within the meaning of the invention, is also considered to be a neurological disorder. Pain can be associated with CNS disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation). Non-central neuropathic pain includes that associated with post mastectomy pain, phantom feeling, reflex sympathetic dystrophy (RSD), trigeminal neuralgiaradioculopathy, post-surgical pain,
HIV/ AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-heφetic neuralgia. Pain is also associated with peripheral nerve damage, central pain (e.g., due to cerebral ischemia) and various chronic pain (e.g., lumbago, back pain (low back pain), inflammatory and/or rheumatic pain. Headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania also are neurological disorders. Visceral pain, such as pancreatits, intestinal cystitis, dysmenorrhea, irritable Bowel syndrome, Crohn's disease, biliary colic, ureteral colic, myocardial infarction and pain syndromes of the pelvic cavity, e.g., vulvodynia, orchialgia, urethral syndrome and protatodynia also is a neurological disorder. Also considered to be disorders of the nervous system are acute pain, for example postoperative pain, and pain after trauma.
Respiratory disorders
The novel human receptor is highly expressed in the following tissues of the respiratory system: fetal lung, fetal lung fibroblast IMR-90 cells, fetal lung fibroblast MRC-5 cells, lung right upper lobe, lung tumor, trachea. The expression in the above mentioned tissues and in particular the differential expression between diseased tissue fetal lung fibroblast IMR-90 cells and healthy tissue fetal lung, between diseased tissue fetal lung fibroblast MRC-5 cells and healthy tissue fetal lung, between diseased tissue lung tumor and healthy tissue lung demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose of respiratory diseases. In addition, the activity of the novel human receptor can be modulated to treat those diseases.
Asthma
Allergy is a complex process in which environmental antigens induce clinically adverse reactions. The inducing antigens, called allergens, typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an
IgE-dependent or T cell-dependent hypersensitivity reaction. Hypersensitivity reactions can be local or systemic and typically occur within minutes of allergen exposure in individuals who have previously been sensitized to an allergen. The hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions. Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.
Asthma is thought to arise as a result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening ofthe walls ofthe airways that leads to a narrowing ofthe airways, 2) airway hyperresponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation. Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE. These effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder. Other resident cells, such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology. While the airway obstruction of asthma, presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to irreversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
Despite recent important advances in our understanding of the pathophysiology of asthma, the disease appears to be increasing in prevalence and severity (Gergen and
Weiss, Am. Rev. Respir. Dis. 146, 823-24, 1992). It is estimated that 30-40% of the population suffer with atopic allergy, and 15 > of children and 5%> of adults in the population suffer from asthma (Gergen and Weiss, 1992). Thus, an enormous burden is placed on our health care resources. However, both diagnosis and treatment of asthma are difficult. The severity of lung tissue inflammation is not easy to measure and the symptoms ofthe disease are often indistinguishable from those of respiratory infections, chronic respiratory inflammatory disorders, allergic rhinitis, or other respiratory disorders. Often, the inciting allergen cannot be determined, making removal of the causative environmental agent difficult. Current pharmacological treatments suffer their own set of disadvantages. Commonly used therapeutic agents, such as beta agonists, can act as symptom relievers to transiently improve pulmonary function, but do not affect the underlying inflammation. Agents that can reduce the underlying inflammation, such as anti-inflammatory steroids, can have major drawbacks that range from immunosuppression to bone loss (Goodman and Gilman's THE PHARMACOLOGIC BASIS OF THERAPEUTICS, Seventh Edition, MacMillan
Publishing Company, NY, USA, 1985). In addition, many of the present therapies, such as inhaled corticosteroids, are short-lasting, inconvenient to use, and must be used often on a regular basis, in some cases for life, making failure of patients to comply with the treatment a major problem and thereby reducing their effectiveness as a treatment.
Because ofthe problems associated with conventional therapies, alternative treatment strategies have been evaluated. Glycophorin A (Chu and Sharom, Cell. Immunol. 145, 223-39, 1992), cyclosporin (Alexander et al, Lancet 339, 324-28, 1992), and a nonapeptide fragment of IL-2 (Zav'yalov et al, Immunol. Lett. 31, 285-88, 1992) all inhibit interleukin-2 dependent T lymphocyte proliferation; however, they are known to have many other effects. For example, cyclosporin is used as a immuno- suppressant after organ transplantation. While these agents may represent alternatives to steroids in the treatment of asthmatics, they inhibit interleukin-2 dependent T lymphocyte proliferation and potentially critical immune functions associated with homeostasis. Other treatments that block the release or activity of mediators of bronchochonstriction, such as cromones or anti-leukotrienes, have recently been introduced for the treatment of mild asthma, but they are expensive and not effective in all patients and it is unclear whether they have any effect on the chronic changes associated with asthmatic inflammation. What is needed in the art is the identification of a treatment that can act in pathways critical to the development of asthma_that both blocks the episodic attacks of the disorder and preferentially dampens the hyperactive allergic immune response without immunocompromising the patient.
COPD
Chronic obstructive pulmonary (or airways) disease (COPD) is a condition defined physiologically as airflow obstruction that generally results from a mixture of emphysema and peripheral airway obstruction due to chronic bronchitis (Senior & Shapiro, Pulmonary Diseases and Disorders, 3d ed., New York, McGraw-Hill, 1998, pp. 659-681, 1998; Barnes, Chest 117, 10S-14S, 2000). Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung. Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years. In COPD, airflow obstruction is usually progressive and is only partially reversible. By far the most important risk factor for development of COPD is cigarette smoking, although the disease does occur in non-smokers.
Chronic inflammation of the airways is a key pathological feature of COPD (Senior & Shapiro, 1998). The inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8+ lymphocytes. Inhaled irritants, such as cigarette smoke, activate macrophages that are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors. These chemotactic factors act to increase the neutro- phil/monocyte trafficking from the blood into the lung tissue and airways. Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species. Matrix degradation and emphysema, along with airway wall thickening, surfactant dysfunction, and mucus hypersecretion, all are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
Reproductive disorders
The novel human receptor is highly expressed in the following tissues of the reproductive system: uterus tumor, ovary, ovary tumor, breast, MDA MB 231 cells (breast tumor). The expression in the above mentioned tissues and in particular the differential expression between diseased tissue uterus tumor and healthy tissue uterus, between diseased tissue ovary tumor and healthy tissue ovary, between diseased tissue MDA MB 231 cells (breast tumor) and healthy tissue breast demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose of reproductive disorders. Additionally the activity of the novel human receptor can be modulated to treat reproductive disorders. Disorders of the male reproductive system include but are not limited to balanoposthitis, balanitis xerotica obliterans, phimosis, paraphimosis, erythroplasia of Queyrat, skin cancer of the penis, Bowen's and Paget's diseases, syphilis, heφes simplex infections, genital warts, molluscum contagiosum, priapism, peyronie's disease, benign prostatic hypeφlasia (BPH), prostate cancer, prostatitis, testicular cancer, testicular torsion, inguinal hernia, epididymo-orchitis, mumps, hydroceles, spermatoceles, or varicoceles.
Impotence (erectile dysfunction) may results from vascular impairment, neurologic disorders, drags, abnormalities ofthe penis, or psychological problems.
Examples of disorders of the female reproductive include premature menopause, pelvic pain, vaginitis, vulvitis, vulvovaginitis, pelvic inflammatory disease, fibroids, menstrual disorders (premenstrual syndrome (PMS), dysmenorrhea, amenorrhea, primary amenorrhea, secondary amenorrhea, menorrhagia, hypomenorrhea, poly- menorrhea, oligomenorrhea, metrorrhagia, menometrorrhagia, Postmenopausal bleeding), bleeding caused by a physical disorder, dysfunctional uterine bleeding, polycystic ovary syndrome (Stein-Leventhal syndrome), endometriosis, cancer of the uterus, cancer of the cervix, cancer of the ovaries, cancer of the vulva, cancer of the vagina, cancer ofthe fallopian tubes, and hydatidiform mole.
Infertility may be caused by problems with sperm, ovulation, the fallopian tubes, and the cervix as well as unidentified factors.
Complications of pregnancy include miscarriage and stillbirth, ectopic pregnancy, anemia, Rh incompatibility, problems with the placenta, excessive vomiting, preeclampsia, eclampsia, and skin rashes (e.g. heφes gestationis, urticaria of pregnancy) as well as preterm labor and premature rupture ofthe membranes. Breast disorders may be noncancerous (benign) or cancerous (malignant). Examples of breast disorders are but are not limited to breast pain, cysts, fibrocystic breast disease, fibrous lumps, nipple discharge, breast infection, breast cancer (ductal carcinoma, lobular carcinoma, medullary carcinoma, tubular carcinoma, and inflammatory breast cancer), Paget's disease ofthe nipple or Cystosarcoma phyllodes.
Genitourinary disorders
The novel human receptor is highly expressed in the following urological tissues: prostate, prostate BPH, bladder, fetal kidney, kidney, kidney tumor, HEK 293 cells.
The expression in the above mentioned tissues and in particular the differential expression between diseased tissue prostate BPH and healthy tissue prostate, between diseased tissue kidney tumor and healthy tissue kidney demonstrates that the novel human receptor protein or mRNA can be utilized to diagnose urological disorders. In addition, the activity of the novel human receptor can be modulated to treat urological disorders.
Genitourinary disorders include benign and malign disorders of the organs constituting the genitourinary system of female and male, renal diseases such as acute or chronic renal failure, immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulo- pathies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hypeφlasia (BPH), neurogenic bladder syndrome, urinary incontinence such as urge-, stress-, or overflow incontinence, pelvic pain, and erectile dysfunction.
Urinary incontinence
Urinary incontinence (UI) is the involuntary loss of urine. Urge urinary incontinence
(UUI) is one of the most common types of UI together with stress urinary incontinence (SUI), which is usually caused by a defect in the urethral closure mechanism. UUI is often associated with neurological disorders or diseases causing neuronal damages such as dementia, Parkinson's disease, multiple sclerosis, stroke and diabetes, although it also occurs in individuals with no such disorders. One of the usual causes of UUI is overactive bladder (OAB) which is a medical condition referring to the symptoms of frequency and urgency derived from abnormal contractions and instability ofthe detrusor muscle.
There are several medications for urinary incontinence on the market today mainly to help treating UUI. Therapy for OAB is focused on drugs that affect peripheral neural control mechanisms or those that act directly on bladder detrusor smooth muscle contraction, with a major emphasis on development of anticholinergic agents. These agents can inhibit the parasympathetic nerves that control bladder voiding or can exert a direct spasmolytic effect on the detrusor muscle ofthe bladder. This results in a decrease in intravesicular pressure, an increase in capacity and a reduction in the frequency of bladder contraction. Orally active anticholinergic drugs such as propantheline (ProBanthine), tolterodine tartrate (Detrol) and oxybutynin (Ditropan) are the most commonly prescribed drugs. However, their most serious drawbacks are unacceptable side effects such as dry mouth, abnormal visions, constipation, and central nervous system disturbances. These side effects lead to poor compliance. Dry mouth symptoms alone are responsible for a 10% non-compliance rate with oxybutynin. The inadequacies of present therapies highlight the need for novel, efficacious, safe, orally available drugs that have fewer side effects.
Benign Prostatic Hyperplasia
Benign prostatic hypeφlasia (BPH) is the benign nodular hypeφlasia of the periurethral prostate gland commonly seen in men over the age of 50. The overgrowth occurs in the central area of the prostate called the transition zone, which wraps around the urethra. BPH causes variable degrees of bladder outlet obstruction resulting in progressive lower urinary tract syndromes (LUTS) characterized by urinary frequency, urgency, and nocturia due to incomplete emptying and rapid refilling of the bladder. The actual cause of BPH is unknown but may involve age- related alterations in balance of steroidal sex hormones.
The selective alphal-adrenoceptor antagonists, such as prazosin, indoramin and tamsulosin are used as an adjunct in the symptomatic treatment of urinary obstruction caused by BPH, although they do not affect on the underlying cause of BPH. In BPH, increased sympathetic tone exacerbates the degree of obstruction ofthe urethra tlirough contraction of prostatic and urethral smooth muscle. These compounds inhibit sympathetic activity, thereby relaxing the smooth muscle of the urinary tract. Uroselective alpha 1 -antagonists and alphal -antagonists with high tissue selectivity for lower urinary tract smooth muscle that do not provoke hypotensive side-effects should be developed for the treatment.
Drugs blocking dihydrotestosterone have been used to reduce the size ofthe prostate. 5alpha-reductase inhibitors such as fmasteride are prescribed for BPH. These agents selectively inhibit 5alpha-reductase, which mediates conversion of testosterone to dihydrotestosterone, thereby reducing plasma dihydrotestosterone levels and thus prostate growth. The 5alpha-reductase inhibitors do not bind to androgen receptors and do not affect testosterone levels nor do they possess feminizing side effects.
Androgen receptor antagonists are used for the treatment of prostatic hypeφlasia due to excessive action or production of testosterone. Various antiandrogens are under investigation for BPH including chlormadione derivatives with no estrogenic activity, orally active aromatase inhibitors, luteinizing hormone-releasing hormone (LHRH) analogues.
This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human secretin- type GPCR (latrophilin) polypeptide binding molecule) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
A reagent which affects secretin-type GPCR (latrophilin) activity can be administered to a human cell, either in vitro or in vivo, to reduce secretin-type GPCR (latrophilin) activity. The reagent preferably binds to an expression product of a human secretin- type GPCR (latrophilin) gene. If the expression product is a protein, the reagent is preferably an antibody. For treatment of human cells ex vivo, an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
In one embodiment, the reagent is delivered using a liposome. Preferably, the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours. A liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human. Preferably, the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
A liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell. Preferably, the transfection efficiency of a liposome is about 0.5 μg of DNA per 16 nmole of liposome delivered to about 10 cells, more preferably about 1.0 μg of DNA per 16 nmole of liposome delivered to about 106 cells, and even more preferably about 2.0 μg of DNA per 16 nmol of liposome delivered to about 106 cells. Preferably, a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol. Optionally, a liposome comprises a compound capable of targeting the lipo- some to a particular cell type, such as a cell-specific ligand exposed on the outer surface ofthe liposome.
Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151). Preferably, from about 0.1 μg to about 10 μg of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 μg to about 5 μg of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 μg of polynucleotides is combined with about 8 nmol liposomes.
In another embodiment, antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery. Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988);
Wu et al., J. Biol. Chem. 269, 542-46 (1994); Zenke et al, Proc. Natl. Acad. Sci. U.S.A. 87, 3655-59 (1990); Wu et al, J. Biol. Chem. 266, 338-42 (1991). Determination of a therapeutically effective dose
The determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases functional activity relative to the functional activity which occurs in the absence ofthe therapeutically effective dose.
For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
Therapeutic efficacy and toxicity, e.g., ED50 (the dose therapeutically effective in
50% of the population) and LD50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED5o.
Pharmaceutical compositions that exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity ofthe patient, and the route of administration.
The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.
Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drag combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
If the reagent is a single-chain antibody, polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun," and DEAE- or calcium phosphate-mediated transfection.
Effective in vivo dosages of an antibody are in the range of about 5 μg to about 50 μg/kg, about 50 μg to about 5 mg/kg, about 100 μg to about 500 μg/kg of patient body weight, and about 200 to about 250 μg/kg of patient body weight. For administration of polynucleotides encoding single-chain antibodies, effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA. If the expression product is mRNA, the reagent is preferably an antisense oligonucleotide or a ribozyme. Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
Preferably, a reagent reduces expression of a human secretin-type GPCR (latrophilin) gene or the activity of a secretin-type GPCR (latrophilin) polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of a human secretin-type GPCR (latrophilin) gene or the activity of a human secretin-type GPCR (latrophilin) polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to secretin- type GPCR (latrophilin)-specific mRNA, quantitative RT-PCR, immunologic detection of a human secretin-type GPCR (latrophilin) polypeptide, or measurement of functional activity.
In any of the embodiments described above, any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents can act syner-gistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
Any ofthe therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans. Diagnostic methods
Human secretin-type GPCR (latrophilin) also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the protein. For example, differences can be determined between the cDNA or genomic sequence encoding secretin-type GPCR (latrophilin) in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent ofthe disease.
Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. In addition, cloned DNA segments can be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures {see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85, 4397-4401, 1985). Thus, the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA. In addition to direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
Altered levels of secretin-type GPCR (latrophilin) also can be detected in various tissues. Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
All patents and patent applications cited in this disclosure are expressly incoφorated herein by reference. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples, which are provided for puφoses of illustration only and are not intended to limit the scope ofthe invention.
EXAMPLE 1
Detection of secretin-type GPCR (latrophilin) activity
The polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4-secretin-type GPCR (latrophilin) polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and centrifuged at 1000 φm for 5 minutes at 4 °C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4 °C. The pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO4, 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 % BSA, 2 μg/ml aprotinin,
0.5 mg/ml leupeptin, and 10 μg/ml phosphoramidon. Optimal membrane suspension dilutions, defined as the protein concentration required to bind less than 10 % of the added radioligand, are added to 96-well polypropylene microtiter plates containing 125I-labeled ligand, i.e. secretin, non-labeled peptides, and binding buffer to a final volume of 250 μl.
In equilibrium saturation binding assays, membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125I-labeled ligand. Binding reaction mixtures are incubated for one hour at 30 °C. The reaction is stopped by filtration tlirough GF/B filters treated with 0.5%) polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program.
Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide.
Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard. It is shown that the polypeptide of SEQ ID NO: 2 has a secretin-type GPCR (latrophilin) activity. EXAMPLE 2
Radioligand binding assays
Human embryonic kidney 293 cells transfected with a polynucleotide which expresses human secretin-type GPCR (latrophilin) are scraped from a culture flask into 5 ml of Tris HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 φm for 5 minutes at 4 °C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4 °C. The pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO4, 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 %> BSA, 2 μg/ml aprotinin, 0.5 mg/ml leupeptin, and 10 μg/ml phosphoramidon. Optimal membrane suspension dilutions, defined as the protein concentration required to bind less than 10 %> of the added radioligand, are added to 96-well polypropylene microtiter plates containing 125I-labeled ligand or test compound, non-labeled peptides, and binding buffer to a final volume of 250 μl.
In equilibrium saturation binding assays, membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125I-labeled ligand or test compound (specific activity 2200 Ci/mmol). The binding affinities of different test compounds are determined in equilibrium competition binding assays, using 0.1 nM 125I-peptide in the presence of twelve different concentrations of each test compound.
Binding reaction mixtures are incubated for one hour at 30 °C. The reaction is stopped by filtration through GF/B filters treated with 0.5% polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program.
Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide. Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard. A test compound which increases the radioactivity of membrane protein by at least 15% relative to radioactivity of membrane protein which was not incubated with a test compound is identified as a compound which binds to a human secretin-type GPCR (latrophilin) polypeptide.
EXAMPLE 3 Effect of a test compound on human secretin-type GPCR (latrophilin) -mediated cyclic AMP formation
Receptor-mediated inhibition of cAMP formation can be assayed in host cells which express human secretin-type GPCR (latrophilin). Cells are plated in 96-well plates and incubated in Dulbecco's phosphate buffered saline (PBS) supplemented with 10 mM HEPES, 5 mM theophylline, 2 μg/ml aprotinin, 0.5 mg/ml leupeptin, and 10 μg/ml phosphoramidon for 20 minutes at 37 °C in 5%> CO2. A test compound is added and incubated for an additional 10 minutes at 37 °C. The medium is aspirated, and the reaction is stopped by the addition of 100 mM HCl. The plates are stored at 4 °C for 15 minutes. cAMP content in the stopping solution is measured by radioimmunoassay.
Radioactivity is quantified using a gamma counter equipped with data reduction software. A test compound which decreases radioactivity of the contents of a well relative to radioactivity ofthe contents of a well in the absence of the test compound is identified as a potential inhibitor of cAMP formation. A test compound which increases radioactivity of the contents of a well relative to radioactivity of the contents of a well in the absence of the test compound is identified as a potential enhancer of cAMP formation.
EXAMPLE 4
Effect of a test compound on the mobilization of intracellular calcium
Intracellular free calcium concentration can be measured by microspectrofluorometry using the fluorescent indicator dye Fura-2/AM (Bush et al, J. Neurochem. 57, 562-
74, 1991). Stably transfected cells are seeded onto a 35 mm culture dish containing a glass coverslip insert. Cells are washed with HBS , incubated with a test compound, and loaded with 100 μl of Fura-2/AM (10 μM) for 20-40 minutes. After washing with HBS to remove the Fura-2/AM solution, cells are equilibrated in HBS for 10-20 minutes. Cells are then visualized under the 40X objective of a Leitz Fluovert FS microscope.
Fluorescence emission is determined at 510 nM, with excitation wavelengths alternating between 340 nM and 380 nM. Raw fluorescence data are converted to calcium concentrations using standard calcium concentration curves and software analysis techniques. A test compound which increases the fluorescence by at least
15%) relative to fluorescence in the absence of a test compound is identified as a compound which mobilizes intracellular calcium.
EXAMPLE 5 Effect of a test compound on phosphoinositide metabolism
Cells which stably express human secretin-type GPCR (latrophilin) cDNA are plated in 96-well plates and grown to confluence. The day before the assay, the growth medium is changed to 100 μl of medium containing 1% serum and 0.5 μCi H- myinositol. The plates are incubated overnight in a CO2 incubator (5% CO2 at 37
°C). Immediately before the assay, the medium is removed and replaced by 200 μl of PBS containing 10 mM LiCl, and the cells are equilibrated with the new medium for 20 minutes. During this interval, cells also are equilibrated with antagonist, added as a 10 μl aliquot of a 20-fold concentrated solution in PBS.
The H-inositol phosphate accumulation from inositol phospholipid metabolism is started by adding 10 μml of a solution containing a test compound. To the first well 10 μl are added to measure basal accumulation. Eleven different concentrations of test compound are assayed in the following 11 wells of each plate row. All assays are performed in duplicate by repeating the same additions in two consecutive plate rows. The plates are incubated in a CO2 incubator for one hour. The reaction is terminated by adding 15 μl of 50% v/v trichloroacetic acid (TCA), followed by a 40 minute incubation at 4 °C. After neutralizing TCA with 40 μl of 1 M Tris, the content ofthe wells is transferred to a Multiscreen HV filter plate (Millipore) containing Dowex
AG1-X8 (200-400 mesh, formate form). The filter plates are prepared by adding 200 μl of Dowex AG1-X8 suspension (50% v/v, wateπresin) to each well. The filter plates are placed on a vacuum manifold to wash or elute the resin bed. Each well is washed 2 times with 200 μl of water, followed by 2 x 200 μl of 5 mM sodium tetraborate/60 mM ammonium formate.
The 3H-IPs are eluted into empty 96-well plates with 200 μl of 1.2 M ammonium formate/0.1 formic acid. The content of the wells is added to 3 ml of scintillation cocktail, and radioactivity is determined by liquid scintillation counting.
EXAMPLE 6
Receptor Binding Methods
Standard Binding Assays. Binding assays are carried out in a binding buffer containing 50 mM HEPES, pH 7.4, 0.5% BSA, and 5 mM MgCl2. The standard assay for radioligand binding to membrane fragments comprising secretin-type
GPCR (latrophilin) polypeptides is carried out as follows in 96 well microtiter plates
(e.g., Dynatech Immulon II Removawell plates). Radioligand is diluted in binding buffer+ PMSF/Baci to the desired cpm per 50 μl, then 50 μl aliquots are added to the wells. For non-specific binding samples, 5 μl of 40 μM cold ligand also is added per well. Binding is initiated by adding 150 μl per well of membrane diluted to the desired concentration (10-30 μg membrane protein/well) in binding buffer+
PMSF/Baci. Plates are then covered with Linbro mylar plate sealers (Flow Labs) and placed on a Dynatech Microshaker II. Binding is allowed to proceed at room temperature for 1-2 hours and is stopped by centrifuging the plate for 15 minutes at 2,000 x g. The supernatants are decanted, and the membrane pellets are washed once by addition of 200 μl of ice cold binding buffer, brief shaking, and recentrifugation. The individual wells are placed in 12 x 75 mm tubes and counted in an LKB Gammamaster counter (78% efficiency). Specific binding by this method is identical to that measured when free ligand is removed by rapid (3-5 seconds) filtration and washing on polyethyleneimine-coated glass fiber filters.
Three variations ofthe standard binding assay are also used.
1. Competitive radioligand binding assays with a concentration range of cold ligand vs. 125 I-labeled ligand are carried out as described above with one modification. All dilutions of ligands being assayed are made in 40X PMSF/Baci to a concentration 40X the final concentration in the assay. Samples of peptide (5 μl each) are then added per microtiter well. Membranes and radioligand are diluted in binding buffer without protease inhibitors. Radioligand is added and mixed with cold ligand, and then binding is initiated by addition of membranes.
2. Chemical cross-linking of radioligand with receptor is done after a binding step identical to the standard assay. However, the wash step is done with binding buffer minus BSA to reduce the possibility of non-specific cross-linking of radioligand with BSA. The cross-linking step is carried out as described below.
3. Larger scale binding assays to obtain membrane pellets for studies on solubilization of receptor: ligand complex and for receptor purification are also carried out. These are identical to the standard assays except that (a) binding is carried out in polypropylene tubes in volumes from 1-250 ml, (b) concentration of membrane protein is always 0.5 mg/ml, and (c) for receptor purification, BSA concentration in the binding buffer is reduced to 0.25%, and the wash step is done with binding buffer without BSA, which reduces BSA contamination ofthe purified receptor.
EXAMPLE 7 Chemical Cross-Linking of Radioligand to Receptor
After a radioligand binding step as described above, membrane pellets are resuspended in 200 μl per microtiter plate well of ice-cold binding buffer without BSA. Then 5 μl per well of 4 mM N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOS, Pierce) in DMSO is added and mixed. The samples are held on ice and
UV-irradiated for 10 minutes with a Mineralight R-52G lamp (UVP Inc., San Gabriel, Calif.) at a distance of 5-10 cm. Then the samples are transferred to Eppendorf microfuge tubes, the membranes pelleted by centrifugation, supernatants removed, and membranes solubilized in Laemmli SDS sample buffer for polyacrylamide gel electrophoresis (PAGE). PAGE is carried out as described below.
Radiolabeled proteins are visualized by autoradiography ofthe dried gels with Kodak XAR film and DuPont image intensifier screens.
EXAMPLE 8 Membrane Solubilization
Membrane solubilization is carried out in buffer containing 25 mM Tris , pH 8, 10% glycerol (w/v) and 0.2 mM CaCl2 (solubilization buffer). The highly soluble detergents including Triton X-100, deoxycholate, deoxycholate:lysolecithin, CHAPS, and zwittergent are made up in solubilization buffer at 10%) concentrations and stored as frozen aliquots. Lysolecithin is made up fresh because of insolubility upon freeze-thawing and digitonin is made fresh at lower concentrations due to its more limited solubility.
To solubilize membranes, washed pellets after the binding step are resuspended free of visible particles by pipetting and vortexing in solubilization buffer at 100,000 x g for 30 minutes. The supernatants are removed and held on ice and the pellets are discarded.
EXAMPLE 9 Assay of Solubϊlized Receptors
After binding of 125I ligands and solubilization of the membranes with detergent, the intact R:L complex can be assayed by four different methods. All are carried out on ice or in a cold room at 4-10 °C).
1. Column chromatography (Knuhtsen et al, Biochem. J. 254, 641-647, 1988). Sephadex G-50 columns (8 x 250 mm) are equilibrated with solubilization buffer containing detergent at the concentration used to solubilize membranes and 1 mg/ml bovine serum albumin. Samples of solubilized membranes (0.2-0.5 ml) are applied to the columns and eluted at a flow rate of about
0.7 ml/minute. Samples (0.18 ml) are collected. Radioactivity is determined in a gamma counter. Void volumes of the columns are determined by the elution volume of blue dextran. Radioactivity eluting in the void volume is considered bound to protein. Radioactivity eluting later, at the same volume as free 125I ligands, is considered non-bound.
2. Polyethyleneglycol precipitation (Cuatrecasas, Proc. Natl. Acad. Sci. USA 69, 318-322, 1972). For a 100 μl sample of solubilized membranes in a 12 x 75 mm polypropylene tube, 0.5 ml of 1% (w/v) bovine gamma globulin (Sigma) in 0.1 M sodium phosphate buffer is added, followed by 0.5 ml of
25% (w/v) polyethyleneglycol (Sigma) and mixing. The mixture is held on ice for 15 minutes. Then 3 ml of 0.1 M sodium phosphate, pH 7.4, is added per sample. The samples are rapidly (1-3 seconds) filtered over Whatman GF/B glass fiber filters and washed with 4 ml of the phosphate buffer. PEG- precipitated receptor : 125 1-ligand complex is determined by gamma counting ofthe filters. 3. GFB/PEI filter binding (Brans et al, Analytical Biochem. 132, 74-81, 1983). Whatman GF/B glass fiber filters are soaked in 0.3% polyethyleneimine (PEI, Sigma) for 3 hours. Samples of solubilized membranes (25-100 μl) are replaced in 12 x 75 mm polypropylene tubes. Then 4 ml of solubilization buffer without detergent is added per sample and the samples are immediately filtered through the GFB/PEI filters (1-3 seconds) and washed with 4 ml of solubilization buffer. CPM of receptor : 125 I-ligand complex adsorbed to filters are determined by gamma counting.PAR.4. Charcoal/Dextran (Paul and Said, Peptides 7[Suppl. 7,147-149, 1986). Dextran T70 (0.5 g,
Pharmacia) is dissolved in 1 liter of water, then 5 g of activated charcoal (Norit A, alkaline; Fisher Scientific) is added. The suspension is stirred for 10 minutes at room temperature and then stored at 4 °C. until use. To measure R:L complex, 4 parts by volume of charcoal/dextran suspension are added to 1 part by volume of solubilized membrane. The samples are mixed and held on ice for 2 minutes and then centrifuged for 2 minutes at 11,000 x g in a Beckman microfuge. Free radioligand is adsorbed charcoal/dextran and is discarded with the pellet. Receptor : I-ligand complexes remain in the supernatant and are determined by gamma counting.
EXAMPLE 10 Receptor Purification
Binding of biotinyl-receptor to GH4 CI membranes is carried out as described above. Incubations are for 1 hour at room temperature. In the standard purification protocol, the binding incubations contain 10 nM Bio-S29. 12SI ligand is added as a tracer at levels of 5,000-100,000 cpm per mg of membrane protein. Control incubations contain 10 μM cold ligand to saturate the receptor with non-biotinylated ligand. Solubilization of receptor igand complex also is carried out as described above, with 0.15% deoxycholate ysolecithin in solubilization buffer containing 0.2 mM MgCl2, to obtain 100,000 x g supernatants containing solubilized R:L complex.
Immobilized streptavidin (streptavidin cross-linked to 6% beaded agarose, Pierce
Chemical Co.; "SA-agarose") is washed in solubilization buffer and added to the solubilized membranes as 1/30 of the final volume. This mixture is incubated with constant stirring by end-over-end rotation for 4-5 hours at 4-10 °C. Then the mixture is applied to a column and the non-bound material is washed through. Binding of radioligand to SA-agarose is determined by comparing cpm in the 100,000 x g supernatant with that in the column effluent after adsoφtion to SA-agarose. Finally, the column is washed with 12-15 column volumes of solubilization buffer+0.15% deoxycholatedysolecithin +1/500 (vol/vol) 100 x 4pase.PAR.The streptavidin column is eluted with solubilization buffer+0.1 mM EDTA+0.1 mM EGTA+0.1 mM GTP-gamma-S (Sigma)+0.15% (wt/vol) deoxycholate:lysolecithin +1/1000 (vol/vol)
100.times.4pase. First, one column volume of elution buffer is passed through the column and flow is stopped for 20-30 minutes. Then 3-4 more column volumes of elution buffer are passed through. All the eluates are pooled.
Eluates from the streptavidin column are incubated overnight (12-15 hours) with immobilized wheat germ agglutinin (WGA agarose, Vector Labs) to adsorb the receptor via interaction of covalently bound carbohydrate with the WGA lectin. The ratio (vol/vol) of WGA-agarose to streptavidin column eluate is generally 1:400. A range from 1:1000 to 1:200 also can be used. After the binding step, the resin is pelleted by centrifugation, the supernatant is removed and saved, and the resin is washed 3 times (about 2 minutes each) in buffer containing 50 mM HEPES, pH 8, 5 mM MgCl2j and 0.15% deoxycholate:lysolecithin. To elute the WGA-bound receptor, the resin is extracted three times by repeated mixing (vortex mixer on low speed) over a 15-30 minute period on ice, with 3 resin columns each time, of 10 mM N-N'-N"-triacetylchitotriose in the same HEPES buffer used to wash the resin. After each elution step, the resin is centrifuged down and the supernatant is carefully removed, free of WGA-agarose pellets. The three, pooled eluates contain the final, purified receptor. The material non-bound to WGA contain G protein subunits specifically eluted from the streptavidin column, as well as non-specific contaminants. All these fractions are stored frozen at -90 °C
EXAMPLE 11
Expression of recombinant human secretin-type GPCR (latrophilin)
The Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human secretin-type GPCR (latrophilin) polypeptides in yeast. The secretin-type GPCR (latrophilin)-encoding DNA sequence is derived from SEQ ID NO:l. Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its
5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon. Moreover, at both termini recognition sequences for restriction endonucleases are added and after digestion of the multiple cloning site of pPICZ B with the corresponding restriction enzymes the modified
DNA sequence is ligated into pPICZB. This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.
The yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea. The bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation ofthe polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human secretin-type GPCR (latrophilin) polypeptide is obtained. EXAMPLE 12
Identification of test compounds that bind to secretin-type GPCR (latrophilin) polypeptides
Purified secretin-type GPCR (latrophilin) polypeptides comprising a glutathione-S- transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution. Human secretin-type GPCR (latrophilin) polypeptides comprise the amino acid sequence shown in SEQ ID NO:2. The test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
The buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a human secretin-type GPCR (latrophilin) polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human secretin-type GPCR (latrophilin) polypeptide.
EXAMPLE 13
Identification of a test compound which decreases secretin-type GPCR (latrophilin) gene expression
A test compound is administered to a culture of human cells transfected with a secretin-type GPCR (latrophilin) expression construct and incubated at 37 °C for 10 to 45 minutes. A culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979). Northern blots are prepared using 20 to 30 μg total RNA and hybridized with a 32P-labeled secretin-type GPCR (latrophilin)-specific probe at 65 ° C in Express-hyb (CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO:l. A test compound that decreases the secretin-type GPCR (latrophilin)-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of secretin- type GPCR (latrophilin) gene expression.
EXAMPLE 14
Tissue-specific expression of secretin-type GPCR (latrophilin)
The qualitative expression pattern of secretin-type GPCR (latrophilin) in various tissues is determined by Reverse Transcription-Polymerase Chain Reaction (RT- PCR).
Quantitative expression profiling.
To demonstrate that secretin-type GPCR (latrophilin) is involved in the disease process of diabetes, the following whole body panel is screened to show predominant or relatively high expression: subcutaneous and mesenteric adipose tissue, adrenal gland, bone marrow, brain, colon, fetal brain, heart, hypothalamus, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, thyroid, trachea, and uterus. Human islet cells and an islet cell library also are tested. As a final step, the expression of secretin-type GPCR (latrophilin) in cells derived from normal individuals with the expression of cells derived from diabetic individuals is compared.
To demonstrate that secretin-type GPCR (latrophilin) is involved in the disease process of obesity, expression is determined in the following tissues: subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle small intestine, spleen, stomach, testes, thymus, thyroid trachea, and uterus. Neuroblastoma cell lines SK-Nr-Be (2), Hr, Sk-N-As, HTB-10, IMR-32, SNSY-5Y, T3, SK-N-D2, D283, DAOY, CHP-2, U87MG, BE(2)C, T986, KANTS, MO59K, CHP234, C6 (rat), SK-N-F1, SK-PU- DW, PFSK-1, BE(2)M17, and MCIXC also are tested for secretin-type GPCR (latrophilin) expression. As a final step, the expression of secretin-type GPCR
(latrophilin) in cells derived from normal individuals with the expression of cells derived from obese individuals is compared.
Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis" firstly described in Higuchi et al, BioTechnology
10, 413-17, 1992, and Higuchi et al, BioTechnology 11, 1026-30, 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
If the amplification is performed in the presence of an internally quenched fluorescent oligonucleotide (TaqMan probe) complementary to the target sequence, the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in direct proportion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
The amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction. In this kind of experiment, the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used. All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700. RNA extraction and cDNA preparation. Total RNA from the tissues listed above are used for expression quantification. RNAs labeled "from autopsy" were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
Fifty μg of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/μl RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/μl RNase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; lOmM MgCl2; 50 mM NaCl; and 1 mM DTT.
After incubation, RNA is extracted once with 1 volume of pheno chloro- form:isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
Fifty μg of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectro- photometric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is 200ng/μL. Reverse transcription is carried out with 2.5μM of random hexamer primers.
TaqMan quantitative analysis. Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy-tetra- methyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents
(PDAR) Control Kit (PE Applied Biosystems, CA). The assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 μl.
Each of the following steps are carried out once: pre PCR, 2 minutes at 50° C, and 10 minutes at 95°C. The following steps are carried out 40 times: denaturation, 15 seconds at 95°C, annealing/extension, 1 minute at 60°C.
The experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA). At the end of the run, fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
EXAMPLE 15
Diabetes: In vivo testing of compounds/target validation Glucose Production
Over-production of glucose by the liver, due to an enhanced rate of gluconeogenesis, is the major cause of fasting hyperglycemia in diabetes. Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats or mice fed ad libitum. Rats are made diabetic with a single intravenous injection of 40 mg/kg of streptozotocin while C57BL/KsJ mice are given
40-60 mg/kg i.p. for 5 consecutive days. Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle-treated control group.
Insulin Sensitivity
Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hyperinsulinemic and insulin resistant. The animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group. Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group.
Insulin Secretion
Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load. When measuring insulin levels, compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice. At the appropriate time an intravenous glucose load (0.4g/kg) is given, blood is collected one minute later. Plasma insulin levels are determined. Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose. When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined. Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose. Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load. When measuring insulin levels, test compounds which regulate secretin-type GPCR (latrophilin) are administered by different routes (p.o., i.p., s.c, or i.v.) to overnight fasted normal rats or mice. At the appropriate time an intravenous glucose load (0.4g/kg) is given, blood is collected one minute later. Plasma insulin levels are determined. Test compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose. When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60, and 90 minutes and plasma glucose levels determined. Test compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
EXAMPLE 16
In vivo target validation
Effects on plasma cholesterol levels including HDL cholesterol are typically assessed in humanized apo-AI transgenic mice. Modulation of human target proteins can be determined in corresponding transgenic mice (e.g., CETP transgenic mice). Tri- glyceride lowering is usually evaluated in ob/ob mice or Zucker rats. Animals are fed with normal diets or modified diets (e.g., enriched by 0.5 % cholesterol 20% coconut oil). Standard protocols consist of oral applications once daily for 7 to 10 days at doses ranging from 0,1 to 100 mg/kg. The compounds are dissolved {e.g., in
Solutol/Ethanol/saline mixtures) and applied by oral gavage or intravenous injection.
Before and at the end ofthe application period, blood samples are typically drawn by retroorbital punctuation. Plasma cholesterol and triglyceride levels are determined with standardized clinical diagnostic kits (e.g., INFINITY™ cholesterol reagent and INFINITY™ triglyceride reagent; Sigma, St. Louis). HDL cholesterol is determined after phosphotungstic acid precipitation of non-HDL lipoproteins or FPLC gel filtration with post-column derivatization of cholesterol using the reagents mentioned above. Plasma levels of human apolipoprotein- Al in relevant humanized transgenic mice are measured by immunoturbidimetry (Sigma).
Long-term anti-atherosclerotic potency of drug candidates are evaluated in Apo E- knockout mice. Therefore, animals are fed a standard chow diet (4,5 % fat) or a Western diet (20 % fat) containing 1 to 100 mg/kg ofthe respective compounds for 3 to 5 month. Arterial lesions are quantified in serial cryosections ofthe proximal aorta by staining with Oil Red O and counterstaining with hematoxylin. Lesion area size is determined using an digital imaging system.
EXAMPLE 17
In vivo testing of cardiovascular effects of test compounds Hemodynamics in anesthetized rats
Male Wistar rats weighing 300-350 g (Harlan Winkelmann, Borchen, Germany) are anesthetized with thiopental "Nycomed" (Nycomed, Munich, Germany) 100 mg kg-1 i.p. A tracheotomy is performed, and catheters are inserted into the femoral artery for blood pressure and heart rate measurements (Gould pressure transducer and recorder, model RS 3400) and into the femoral vein for substance administration. The animals are ventilated with room air and their body temperature is controlled. Test compounds are administered orally or intravenously.
Hemodynamics in conscious SHR
Female conscious SHR (Moellegaard/Denmark, 220 - 290 g) are equipped with implantable radiotelemetry, and a data aquisition system (Data Sciences, St. Paul, MN, USA), comprising a chronically implantable transducer/transmitter unit equipped with a fluid-filled catheter is used. The transmitter is implanted into the peritoneal cavity, and the sensing catheter is inserted into the descending aorta. Single administration of test compounds is performed as a solution in Transcutol®/ Cremophor®/ H2O (10/20/70 = v/v/v) given orally by gavage. The animals of control groups only receive the vehicle. Before treatment, mean blood pressure and heart rate of treated and untreated control groups are measured.
Hemodynamics in anesthetized dogs
Studies are performed on anesthetized dogs of either sex (body weight between 20-30 kg). Anesthesia is initiated by slow intravenous injection of 25 mg kg-1 sodium thiopental (Trapanal®, Byk Gulden, Konstanz, Germany). The anesthesia is continued and maintained tliroughout the experiment by continuous infusion of 0.04 mg kg-1 h-1 fentanyl (Fentanyl®, Janssen, Neuss, Germany) and 0.25 mg kg-1 h 1 droperidol (DihydrobenzperidolR, Janssen, Neuss, Germany). During this anaesthesia, heart rate is as low as 35-40 bpm due to increased vagal tone. Therefore, a parasympathetic blockade is achieved by intermittent injections of atropine (0.1 mg per animal) (AtropinsulfatR, Eifelfango, Bad Neuenahr, Germany). After intubation the animals are artificially ventilated at constant volume (EngstromR 300, Engstrδm, Sweden) with room air enriched with 30% oxygen to maintain an end-tidal CO2 concentration of about 5% (NormocapR, Datex, Finland).
The following catheters are implanted for measurement of cardiovascular parameters: a tip catheter for recording of left ventricular pressure is inserted into the ventricle via the carotid artery (PC350, Millar Instruments, Houston, TX, USA), a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1, Telos Medical, Upland, CA, USA for recording of arterial blood pressure, two venous catheters are inserted into either femoral vein and one additional catheter into a forearm vein for application of the anaesthetic and drags, respectively, and an oxymetry catheter for recording of oxygen saturation is inserted into the coronary sinus via the jugular vein (Schwarzer IVH4, Mϋnchen, Germany). After a left-sided thoracotomy the ramus circumflexus of the left coronary artery (LCX) is freed from connective tissue, and an electromagnetic flow probe (Gould Statham, Oxnard, CA, USA) is applied for measurement of coronary blood flow. Arterial blood pressure, electrocardiogram (lead II), left ventricular pressure, first derivative of left ventricular pressure (dP/dt), heart rate, coronary blood flow, and oxygen saturation in the coronary sinus are continuously recorded on a pen recorder (Brash, Gould, Cleveland, OH, USA). The maximum of dP/dt is used as measure of left ventricular contractility (dP/dtmax). After completion of the instrumentation, an interval of 60 min is allowed for stabilization before the test compound is intra- venously applied as bolus injections. Care is taken that all measured cardiovascular parameters have returned to control level before injection of the next dose. Each dose of the test compound is tested at least three times in different animals. The order of injection ofthe different doses is randomized in each animal.
EXAMPLE 18
In vivo testing of compounds/target validation
Evaluation of Compound's Efficacy on the Reduction of Body Weight and Food and
Water Consumption in Obese Zucker fa/fa Rats
The puφose of this protocol is to determine the effect of chronic administration of an unknown compound on body weight and food and water consumption in obese Zucker fa/fa rats. Obese Zucker fa/fa rats are frequently used in the determination of compound efficacy in the reduction of body weight. This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans (Al-Barazanji et al, Obes. Res. 8, 317-23, 2000; Assimacopoulos-Jeannet et al, Am. J. Physiol. 260 (2 Pt 2):R278-83, 1991; Dryden et al, Horm. Metab. Res. 31 (6), 363-6, 1999; Edwards & Stevens, Pharmacol. Biochem. Behav. 47, 865-72, 1994; Grinker et al, Pharmacol. Biochem Behav. 12 (2), 265-75, 1980). A typical study includes 60-80 male Zucker fa/fa, (n=10/treatment group) with an average body weight of approximately 550g. Rats are kept in standard animal rooms under controlled temperature and humidity and a 12/12 light dark cycle. Water and food are continuously available. Rats are single housed in large rat shoeboxes containing grid floor. Animals are adapted to the grid floors and sham dosed with study vehicle for at least four days before the recording of two-days baseline measurement of body weight and 24 hr food and water consumption. Rats are assigned to one of 6-8 treatment groups based upon their body weight on baseline. The groups are set up so that the mean and standard error ofthe mean of body weight were similar.
Animals are orally gavaged (2ml/kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/compound. At this time, body weight, food and water consumption are measured. On the final day, animals are euthanized using CO2 inhalation.
Evaluation of Compound's Efficacy on the Reduction of Body Weight in Diet-Induced Obese Mice
The puφose of this protocol is to determine the effect of chronic administration of an unknown compound on body weight of mice made obese by exposure to a 45% kcal/g high fat diet during more than 10 weeks. The body weight of mice selected for the studies is higher than three standard deviations from the weight of a control group of mice fed standard low fat (5-6% fat) mouse chow. Diet-induced obese (DIO) animals are frequently used in the determination of compound efficacy in the reduction of body weight (Brown et al, Br. J. Pharmacol. 132, 1898-1904, 2001; Guerre-Millom et al, J. Biol. Chem. 275 (22), 16638-42, 2000; Han et al, Int. J. Obes. Relat. Metab. Disord. 23, 174-9, 1999; Surwit et al, Endocrinology 141 (10), 3630-37, 2000). This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans (Brown et al, Br. J. Pharmacol. 132, 1898-1904, 2001; Guerre-Millom et al, J. Biol. Chem. 275 (22), 16638-42, 2000; Han et al, Int. J. Obes. Relat. Metab. Disord. 23{2), 174-9, 1999).
A typical study includes 60-80 male C57M/J6 mice (n=10/treatment group) with an average body weight of approximately 45 g. Mice are kept in standard animal rooms under controlled temperature and humidity and a 12/12 light dark cycle. Water and food are continuously available. Mice are single housed in shoeboxes. Animals are sham dosed with study vehicle for at least four days before the recording of two-days baseline measurement of body weight and 24 hr food and water consumption. Mice are assigned to one of 6-8 treatment groups based upon their body weight on baseline. The groups are set up so that the mean and standard error of the mean of body weight were similar.
Animals are orally gavaged (5ml/kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/compound. At this time, body weight, food and water consumption are measured. Data is analyzed using appropriate statistics following the research design. On the final day, animals are euthanized using CO2 inhalation.
Evaluation of Compound's Efficacy on the Reduction of Food Intake in Lean Overnight Fasted Rats
The puφose of this protocol is to determine the effect of a single dose of an unknown compound on food consumption of lean overnight fasted rats. The fasted-refed rat model is frequently used in the field of obesity to identify compounds with potential for anorectic effects. This animal model has been successfully used in the identi- fication and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans. A typical study includes 60-80 male rats (n=10/treatment group) with an average body weight of approximately 280 g. Rats are kept in standard animal rooms under controlled temperature and humidity and a 12/12 light dark cycle. Rats are single housed in suspended cages with a mesh floor. Water and food are continuously available unless the animals are being fasted for the study.
The efficacy test: The rats are fasted overnight during the dark phase (total of approx. 16-18 hrs). The animal is dosed orally with his assigned treatment (2mg/ml). One hour after dosing, pre-weighed food jars are returned to the cage. Food intake is recorded 30, 60, 90, 180, 240 minutes post food return. At each time point, spillage is returned to the food jar and then the food jars are weighed. The amount of food consumed is determined for each time point. Difference between treatment group is determined using appropriate statistical analysis. Blavet et al, Gen Pharmacology 13, 293-97, 1982; Grignaschi et al, Br. J. Pharmacol. 127, 1190-94, 1999;
McTavish & Heel, Drug. 43, 713-33, 1992; Rowland et al, Life Science 36, 2295- 300, 1985.
EXAMPLE 19 Proliferation inhibition assay: Antisense oligonucleotides suppress the growth of cancer cell lines
The cell line used for testing is the human colon cancer cell line HCT116. Cells are cultured in RPMI-1640 with 10-15% fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37 °C in a 95% air/5%CO2 atmosphere.
Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems
Model 380B DNA synthesizer using phosphoroamidite chemistry. A sequence of 24 bases complementary to the nucleotides at position 1 to 24 of SEQ ID NO:l is used as the test oligonucleotide. As a control, another (random) sequence is used: 5' -TCA ACT GAC TAG ATG TAC ATG GAC-3'. Following assembly and deprotection, oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate buffered saline at the desired concentration. Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligo- nucleotides are added to the culture medium at a concentration of 10 μM once per day for seven days.
The addition ofthe test oligonucleotide for seven days results in significantly reduced expression of human methyltransferase as determined by Western blotting. This effect is not observed with the control oligonucleotide. After 3 to 7 days, the number of cells in the cultures is counted using an automatic cell counter. The number of cells in cultures treated with the test oligonucleotide (expressed as 100%) is compared with the number of cells in cultures treated with the control oligonucleotide. The number of cells in cultures treated with the test oligonucleotide is not more than 30% of control, indicating that the inhibition of human methyltransferase has an anti-proliferative effect on cancer cells.
EXAMPLE 20
In vivo testing of compounds/target validation Acute Mechanistic Assays
Reduction in Mitogenic Plasma Hormone Levels
This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus. Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c). At a predetermined time after administration of test compound, blood plasma is collected. Plasma is assayed for levels ofthe hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level ofthe hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m. into mice at a dosage of
30 ng/mouse to induce a burst of testosterone synthesis). The timing of plasma collection would be adjusted to coincide with the peak of the induced hormone response. Compound effects are compared to a vehicle-treated control group. An F- test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value < 0.05 compared to the vehicle control group.
Hollow Fiber Mechanism of Action Assay
Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p < 0.05 as compared to the vehicle control group.
Subacute Functional In Vivo Assays
Reduction in Mass of Hormone Dependent Tissues
This is another non-tumor assay that measures the ability of a compound to reduce the mass of a hormone dependent tissue (i.e., seminal vesicles in males and uteri in females). Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetermined duration (i.e., 1 week). At termination ofthe study, animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded. Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent. Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle-treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value < 0.05 compared to the vehicle control group. Hollow- Fiber Proliferation Assay
Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol. Cell proliferation is determined by measuring a marker of cell number (i.e., MTT or LDH). The cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p < 0.05 as compared to the vehicle control group.
Anti-angiogenesis Models
Corneal Angiogenesis
Hydron pellets with or without growth factors or cells are implanted into a micropocket surgically created in the rodent cornea. Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet).
Corneas are harvested at 7 days post implantation immediately following intracardiac infusion of colloidal carbon and are fixed in 10%> formalin. Readout is qualitative scoring and/or image analysis. Qualitative scores are compared by Rank Sum test.
Image analysis data is evaluated by measuring the area of neovascularization (in pixels) and group averages are compared by Student's t-test (2 tail). Significance is p
< 0.05 as compared to the growth factor or cells only group.
Matrigel Angiogenesis
Matrigel, containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at prede- termined time point(s) and prepared for readout. Readout is an ELISA-based assay for hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an F- test, with significance determined at p < 0.05 as compared to the vehicle control group.
Primary Antitumor Efficacy Early Therapy Models Subcutaneous Tumor
Tumor cells or fragments are implanted subcutaneously on Day 0. Vehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1 , prior to the ability to measure the tumor burden. Body weights and tumor measurements are recorded 2-3 times weekly. Mean net body and tumor weights are calculated for each data collection day. Anti- tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p < 0.05. The experiment may also be continued past the end of dosing in which case tumor measurements would continue to be recorded to monitor tumor growth delay. Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan- Meier curves from the times for individual tumors to attain the evaluation size. Significance is p < 0.05.
Intraperitoneal/Intracranial Tumor Models
Tumor cells are injected intraperitoneally or intracranially on Day 0. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting on Day 1. Observations of morbidity and/or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long- term survivors is indicated separately. Survival times are used to generate Kaplan- Meier curves. Significance is p < 0.05 by a log-rank test compared to the control group in the experiment.
Established Disease Model
Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p < 0.05 as compared to the control group. Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay. Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value< 0.05 compared to the vehicle control group.
Orthotopic Disease Models Mammary Fat Pad Assay
Tumor cells or fragments, of mammary adenocarcinoma origin, are implanted directly into a surgically exposed and reflected mammary fat pad in rodents. The fat pad is placed back in its original position and the surgical site is closed. Hormones may also be administered to the rodents to support the growth of the tumors.
Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p < 0.05 as compared to the control group.
Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay. Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value< 0.05 compared to the vehicle control group. In addition, this model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p < 0.05 compared to the control group in the experiment.
Intraprostatic Assay
Tumor cells or fragments, of prostatic adenocarcinoma origin, are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents. The prostate is externalized tlirough an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles. The successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed. Hormones may also be administered to the rodents to support the growth of the tumors. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in tliree dimensions using either a caliper or an ocular micrometer attached to a dissecting scope. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p < 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the lungs), or measuring the target organ weight (i.e., the regional lymph nodes). The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p < 0.05 compared to the control group in the experiment.
Intrabronchial Assay
Tumor cells of pulmonary origin may be implanted intrabronchially by making an incision through the skin and exposing the trachea. The trachea is pierced with the beveled end of a 25 gauge needle and the tumor cells are inoculated into the main bronchus using a flat-ended 27 gauge needle with a 90° bend. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p < 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination ofthe study by counting the number of visible foci per target organ (i.e., the contralateral lung), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p < 0.05 compared to the control group in the experiment.
Intracecal Assay
Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a 27 or 30 gauge needle. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in tliree dimensions using either a caliper or an ocular micrometer attached to a dissecting scope. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t- test to compare tumor sizes in the treated and control groups at the end of treatment.
Significance is p < 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the liver), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p < 0.05 compared to the control group in the experiment.
Secondary (Metastatic) Antitumor Efficacy Spontaneous Metastasis
Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p < 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance determined at p < 0.05 compared to the control group in the experiment for both of these endpoints.
Forced Metastasis
Tumor cells are injected into the tail vein, portal vein, or the left ventricle ofthe heart in experimental (forced) lung, liver, and bone metastasis studies, respectively.
Compounds are administered p.o., i.p., i.v., i.m., or s.c according to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p < 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance at p < 0.05 compared to the vehicle control group in the experiment for both endpoints. EXAMPLE 21
In vitro testing of compounds/target validation Isolation ofCD34 cells
Mononuclear cells from fresh blood (cord blood, peripheral blood, bone marrow) were separated by FicoU Paque® (1.077 density, Amersham-Pharmacia) density gradient centrifugation, and CD34+ cells were purified by immunomagnetic separation system (MiniMACS, Miltenyi Biotec), according to the manufacture's instructions (Direct CD34 Progenitor Cell Isolation Kit, Miltenyi Biotec). The percentage of CD34+ cells were generally from 90-95%).
Erythropoiesis/ Anemia Erythroid CD34+ Liquid Culture
l-2xl04 CD34+ cells were plated in triplicate in 24-well plates with 1ml Iscoves modified Dulbecco medium (IMDM) (Invitrogen) containing 10% fetal bovine serum (FCS, Invitrogen), 1% Glutamine (Invitrogen) supplemented with SCF (25ng/ml) (PeproTech), different concentration of Erythropoietin (O.OlU/ml - IU/ml) (Erypo® FS 4000, Cilag) with or without compounds. Control cells were incubated with 0.1- 0.2% DMSO instead of compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO2. After 9 to 14 days cells were harvested, counted and stained with phycoerythrin (PE)-conjugated mAb against Glycophorin A (Pharmingen) to analyze differentiation.
Erythroid Colony-forming assay
Five hundred CD34+ cells/ml were plated in triplicate 24-well plates with 1% methylcellulose in IMDM containing 30% FCS, 1% bovine serum albumin (BSA), 2mM L-glutamine and 10-4M 2-mercaptoethanol (Methocult H4230, Cell Systems®), IL-3 (lOng/ml ) (PeproTech) with different concentration of erythropoietin (0.0 IU/ml - IU/ml) with or without compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO2. After 9 to 14 days erythroid burst forming units (BFU-E) were counted from each of the plates. Afterwards cells were dissolved from methylcellulose with 0.1%) NaCl solution. Cells were counted and stained with phycoerythrin (PE)-conjugated mAb against Glycophorin A (Pharmingen) to analyze differentiation.
BFU-E culture
lxl 05 Cord Blood CD34+ cells/ml were cultured in IMDM containing 15% BIT-9500 (Cell Systems®), supplemented with IL-3 (lOng/ml), IL-6 (lOng/ml) and SCF
(25ng/ml) (PeproTech) and incubated at 37°C in a fully humidified atmosphere with 5% CO2. 3 and 5 days after initiation of culture an equal volume of fresh medium supplemented with 2X cytokines were added. On day 6 to 7 l-2xl04 erythroid progenitors were plated in triplicate in 24-well plates with 1ml IMDM containing 10% FCS, 1%) glutamine supplemented with SCF (25ng/ml), different concentration of erythropoietin (0.0 IU/ml - IU/ml) with or without compounds. Control cells were incubated with 0.1-0.2% DMSO instead of compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5%> CO2. After 6 to 8 days cells were harvested and counted to analyze proliferation.
CD36+ cells
lxlO5 Cord Blood CD34+ cells/ml were cultured in IMDM containing 15% BIT- 9500 supplemented with IL-3 (lOng/ml), IL-6 (lOng/ml) and SCF (25ng/ml) and incubated at 37°C in a fully humidified atmosphere with 5% CO2. 3 and 5 days after initiation of culture an equal volume of fresh medium supplemented with 2X cytokines were added. On day 6 to 7 cells were stained with PE-conjugated mAb against CD36 (Pharmingen) and CD36+ cells were purified using anti-PE microbeads and Mini MACS system (Miltenyi Biotec) according to the manufacture's instructions. l-2xl04 CD36+ cells were plated in triplicate 24well plates with 1ml IMDM containing 10% FCS, 1% Glutamine supplemented with SCF (25ng/ml), different concentration of Erythropoietin (O.OlU/ml - IU/ml) with or without compounds. Control cells were incubated with 0.1-0.2% DMSO instead of compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO2. After 6 to 8 days cells were harvested and counted to analyze proliferation.
Myelopoiesis and Thrombocytopoiesis Myeloid CD34+ Liquid Culture
5x 103 CD34+ cells isolated from peripheral blood, cord blood or from bone marrow were pre-incubated in quadruplicate in 24-well plates in 1ml medium (StemSpan) with 15% FCS, SCF (20 ng/ml) and GM-CSF (2,5 ng/ml) for 6 to 7 days at 37°C and 5.5% CO2. Then compounds (0.1.1 or 10 μM in DMSO) with or without G-CSF (0.25 ng/ml; Neupogen ®) were added and incubated for another 6 to 7 days. The number of the early myelopoietic CD15+/CDl lb- cells and the number of the late myelopoietic CD15+/CDllb+ cells were determined by cell count (proliferation) and FACS (fluorescent associated cell sorting) analysis (differentiation) at day 13-14.
Megakaryoid CD34+ Liquid Culture
5x 103 CD34+ cells isolated from peripheral blood, cord blood or from bone marrow were incubated in quadruplicate 24-well plates in 1 ml serum-free medium with 2%> BSA , SCF (20 ng/ml) and compounds ( 0.1,1 or 10 μM in DMSO) with or without TPO (0-lOng/ml) for 12 to 13 days at 37°C and 5% CO2. The number of the megakaryoid CD41+ cells (scatter profile) were determined by FACS analysis.
Megakaryocytes will be examined by microscope if necessary. In vivo testing of compounds/target validation Erythropoiesis/Anemia
Compounds which have demonstrated effects on the drug target in vitro have been administered to normal or anemic animals orally or parenterally. In most cases, mice were used for compound testing. In some cases, other species, e.g. rats, hamsters or guinea pigs have been used in addition. Usually, repeated dosage is required for detection of changes in peripheral blood parameters. During the dosage period and up to five days after the last administration blood samples were drawn for analysis of red and white blood cell counts as well as platelet counts using an automated blood analyzer. In addition, erythropoiesis was assessed by manual hematocrit and reticulocyte count determination. For specific analysis of leukocyte differentiation fluorescent associated cell sorting (FACS) was used.
Myelopoiesis and Thrombocytopoiesis
Myelopoiesis
Immunocompetent Balb/c mice were treated with compounds at different doses (based on pharmacokinetic data) once/day or bid per-orally or parenterally for up to 4 days. The WBC (white blood cells count) and the neutrophil count were monitored by FACS (CDllb+ ; scatter properties).
Immunocompromised Balb/c were generated by intravenous treatment with 5-FU (100 mg/kg ip). 24 hours later the mice were treated with the test compound at different doses (based on pharmacokinetic data) once/day or bid per-orally or parenterally for up to 7 to 13 days. Peripheral blood counts (WBC, RBC, PLT) have been determined after retroorbital plexus puncture at days 5,7,11 and 14. For more detailed investigations the development of cellularity of femural bone marrow and spleen were investigated by FACS analysis. The expression of specific differentiation markers on stem and progenitor cells (e.g. CD34, CD33, CD38, GDI lb) and scatter properties were investigated. Thrombocytopoiesis
Thrombopoietic compounds at different doses (based on pharmacokinetic data) were administered orally or parenterally following chemotherapy (Carboplatin, 100 mg/kg ip) immunocompromised mice. After repeated administration (once/day or bid for five to seven days) peripheral blood platelets (automated blood analyzer) have been determined after retroorbital plexus puncture at day 5, 7, 11, and 14.
EXAMPLE 22
In vivo testing of compounds/target validation Pain
Acute pain. Acute pain is measured on a hot plate mainly in rats. Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to
56 °C) and the latency time is measured until the animals show nocifensive behavior, such as stepping or foot licking. The other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a hind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to pain testing.
Persistent pain. Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5%> formalin or 10 to 100 μg capsaicin is injected into one hind paw ofthe experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, Lev., s.c, intradermal, transdermal) prior to formalin or capsaicin administration.
Neuropathic pain. Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia. The first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve. The second variant is the tight ligation of about the half of the diameter of the common sciatic nerve. In the next variant, a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% spinal nerve only. The fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
Postoperatively, the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc-Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey System, Somedic Sales AB, Horby, Sweden). Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10 °C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity. A further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb. Chronic pain in general is assessed by registering the circadanian rhythms in activity (Surjo and
Arndt, Universitat zu Koln, Cologne, Germany), and by scoring differences in gait (foot print patterns; FOOTPRINTS program, Klapdor et al., 1997. A low cost method to analyze footprint patterns. J. Neurosci. Methods 75, 49-54).
Compounds are tested against sham operated and vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to pain testing.
Inflammatory Pain. Inflammatory pain is induced mainly in rats by injection of 0.75 mg carrageenan or complete Freund's adjuvant into one hind paw. The animals develop an edema with mechanical allodynia as well as thermal hyperalgesia.
Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc-Life Science Instruments, Woodland Hills, SA, USA). Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy, Paw thermal stimulator, G. Ozaki, University of California, USA). For edema measurement two methods are being used. In the first method, the animals are sacrificed and the affected hindpaws sectioned and weighed. The second method comprises differences in paw volume by measuring water displacement in a plethysmometer (Ugo Basile, Comerio, Italy).
Compounds are tested against uninflamed as well as vehicle treated control groups.
Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
Diabetic neuropathic pain. Rats treated with a single intraperitoneal injection of 50 to 80 mg/kg streptozotocin develop a profound hyperglycemia and mechanical allodynia within 1 to 3 weeks. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc-Life Science Instruments, Woodland Hills, SA, USA).
Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
Parkinson 's disease
6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic nigrostriatal and striatopallidal pathways is the central pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
Male Wistar rats (Harlan Winkelmann, Germany), weighing 200+250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques.
Animals are administered pargyline on the day of surgery (Sigma, St. Louis, MO,
USA; 50 mg/kg i.p.) in order to inhibit metabolism of 6-OHDA by monoamine oxidase and desmethylimipramine HCl (Sigma; 25 mg/kg i.p.) in order to prevent uptake of 6-OHDA by noradrenergic terminals. Thirty minutes later the rats are anesthetized with sodium pentobarbital (50 mg/kg) and placed in a stereotaxic frame. In order to lesion the DA nigrostriatal pathway 4 μl of 0.01% ascorbic acid-saline containing 8 μg of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 μl/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur. Stepping Test. Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol. In brief, the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface. One paw is touching the table, and is then moved slowly sideways (5 s for 1 m), first in the forehand and then in the backhand direction. The number of adjusting steps is counted for both paws in the backliand and forehand direction of movement. The sequence of testing is right paw forehand and backhand adjusting stepping, followed by left paw forehand and backhand directions. The test is repeated three times on tliree consecutive days, after an initial training period of three days prior to the first testing. Forehand adjusted stepping reveals no consistent differences between lesioned and healthy control animals. Analysis is therefore restricted to backhand adjusted stepping.
Balance Test. Balance adjustments following postural challenge are also measured during the stepping test sessions. The rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score
3 is given for no reaction of movement. The test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
Staircase Test (Paw Reaching). A modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement. Plexiglass test boxes with a central platform and a removable staircase on each side are used. The apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use. For each test the animals are left in the test boxes for 15 min. The double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side. After each test the number of pellets eaten (successfully retrieved pellets) and the number of pellets taken (touched but dropped) for each paw and the success rate (pellets eaten/pellets taken) are counted separately. After tliree days of food deprivation (12 g per animal per day) the animals are tested for 11 days. Full analysis is conducted only for the last five days.
MPTP treatment. The neurotoxin l-methyl-4-phenyl-l,2,3,6-tetrahydropyridine
(MPTP) causes degeneration of mesencephalic dopaminergic (DAergic) neurons in rodents, non-human primates, and humans and, in so doing, reproduces many of the symptoms of Parkinson's disease. MPTP leads to a marked decrease in the levels of dopamine and its metabolites, and in the number of dopaminergic terminals in the striatum as well as severe loss ofthe tyrosine hydroxylase (TH)-immunoreactive cell bodies in the substantia nigra, pars compacta.
In order to obtain severe and long-lasting lesions, and to reduce mortality, animals receive single injections of MPTP, and are then tested for severity of lesion 7-10 days later. Successive MPTP injections are administered on days 1, 2 and 3. Animals receive application of 4 mg/kg MPTP hydrochloride (Sigma) in saline once daily. All injections are intraperitoneal (i.p.) and the MPTP stock solution is frozen between injections. Animals are decapitated on day 11.
Immunohistology. At the completion of behavioral experiments, all animals are anaesthetized with 3 ml thiopental (1 g/40 ml i.p., Tyrol Pharma). The mice are perfused transcardially with 0.01 M PBS (pH 7.4) for 2 min, followed by 4%> paraformaldehyde (Merck) in PBS for 15 min. The brains are removed and placed in 4% paraformaldehyde for 24 h at 4 °C. For dehydration they are then transferred to a 20% sucrose (Merck) solution in 0.1 M PBS at 4 °C until they sink. The brains are frozen in methylbutan at -20 °C for 2 min and stored at -70 °C. Using a sledge microtome (mod. 3800-Frigocut, Leica), 25 μm sections are taken from the genu of the coφus callosum (AP 1.7 mm) to the hippocampus (AP 21.8 mm) and from AP 24.16 to AP 26.72. Forty-six sections are cut and stored in assorters in 0.25 M Tris buffer (pH 7.4) for immunohistochemistry.
A series of sections is processed for free-floating tyrosine hydroxylase (TH) immunohistochemistry. Following three rinses in 0.1 M PBS, endogenous peroxidase activity is quenched for 10 min in 0.3%) H2O ±PBS. After rinsing in PBS, sections are preincubated in 10%) normal bovine serum (Sigma) for 5 min as blocking agent and transferred to either primary anti-rat TH rabbit antiserum (dilution 1 :2000).
Following overnight incubation at room temperature, sections for TH immuno- reactivity are rinsed in PBS (2 xlO min) and incubated in biotinylated anti-rabbit immunoglobulin G raised in goat (dilution 1:200) (Vector) for 90 min, rinsed repeatedly and transferred to Vectastain ABC (Vector) solution for 1 h. 3, .3'
-Diaminobenzidine tetrahydrochloride (DAB; Sigma) in 0.1 M PBS, supplemented with 0.005%) H2O , serves as chromogen in the subsequent visualization reaction. Sections are mounted on to gelatin-coated slides, left to dry overnight, counter-stained with hematoxylin dehydrated in ascending alcohol concentrations and cleared in butylacetate. Coverslips are mounted on entellan.
Rotarod Test. We use a modification of the procedure described by Rozas and Labandeira-Garcia (1997), with a CR-1 Rotamex system (Columbus Instruments, Columbus, OH) comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit. The rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse. The system software allows preprogramming of session protocols with varying rotational speeds (0-80 φm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod. The system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded. The system also allows a weak current to be passed through the base grid, to aid training.
Dementia
The object recognition task. The object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents. A rat is placed in an open field, in which two identical objects are present. The rats inspects both objects during the first trial of the object recognition task. In a second trial, after a retention interval of for example 24 hours, one ofthe two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field. The inspection time at each ofthe objects is registered. The basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
Administration of the putative cognition enhancer prior to the first trial predominantly allows assessment of the effects on acquisition, and eventually on consolidation processes. Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
The passive avoidance task. The passive avoidance task assesses memory performance in rats and mice. The inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment. Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours. In the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec. The rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
In the shock session the guillotine door between the compartments is lowered as soon as the rat has entered the dark compartment with its four paws, and a scrambled 1 mA footshock is administered for 2 sec. The rat is removed from the apparatus and put back into its home cage. The procedure during the retention session is identical to that ofthe habituation sessions.
The step-through latency, that is the first latency of entering the dark compartment (in sec.) during the retention session is an index of the memory performance of the animal; the longer the latency to enter the dark compartment, the better the retention is. A testing compound in given half an hour before the shock session, together with 1 mg*kg_1 scopolamine. Scopolamine impairs the memory performance during the retention session 24 hours later. If the test compound increases the enter latency compared with the scopolamine-treated controls, is likely to possess cognition enhancing potential.
The Morris water escape task. The Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice. The performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank. Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence ofthe experimenter, and by a radio on a shelf that is playing softly.
The animals receive four trials during five daily acquisition sessions. A trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized. The escape platform is always in the same position. A trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds. After the fourth trial of the fifth daily session, an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds. In the probe trial, all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
Four different measures are taken to evaluate the performance of an animal during acquisition training: escape latency, traveled distance, distance to platform, and swimming speed. The following measures are evaluated for the probe trial: time (s) in quadrants and traveled distance (cm) in the four quadrants. The probe trial provides additional information about how well an animal learned the position ofthe escape platform. If an animal spends more time and swims a longer distance in the quadrant where the platform had been positioned during the acquisition sessions than in any other quadrant, one concludes that the platform position has been learned well.
In order to assess the effects of putative cognition enhancing compounds, rats or mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits, are used. The T-maze spontaneous alternation task. The T-maze spontaneous alternation task (TeMCAT) assesses the spatial memory performance in mice. The start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter. A mouse is put into the start arm at the beginning of training. The guillotine door is closed. In the first trial, the 'forced trial', either the left or right goal arm is blocked by lowering the guillotine door. After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door. Then, the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
The percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials (in s) is analyzed. Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start ofthe training session. Scopolamine reduced the per-cent alternations to chance level, or below. A cognition enhancer, which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
EXAMPLE 23
In vivo testing of compounds/target validation
Mouse anti-CD3 induced cytokine production model
BALB/c mice are injected with a single intravenous injection of 10 μg of 145-2C11
(purified hamster anti-mouse CD3ε monoclonal antibodies, PHARMINGEN). A test compound is administered intraperitoneally 60 min prior to the anti-CD3 mAb injection. Blood is collected 90 minutes after the antibody injection. Serum is obtained by centrifugation at 3000 r.p.m. for 10 min. IL-2 and IL-4 levels in the serum are determined by an ELISA.
Mouse anti-IgD induced IgE production model
BALB/c mice are injected intravenously with 0.8 mg of purified goat anti-mouse IgD antibody or PBS (defined as day 0). Compound is administered intraperitoneally from day 0 to day 6. On day 7 blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for 10 min. Serum total levels of IgE are determined by YAMASA's ELISA kit and their lg subtypes are done by an lg ELISA KIT (Rougier Biotech's, Montreal, Canada).
Mouse LPS-induced TNF-a production model
BALB/c mice are injected intraperitoneally with LPS (200 μg/mouse). Compound is administered intraperitoneally 1 hr before the LPS injection. Blood is collected at 90 min post-LPS injection and plasma is obtained. TNF-α concentration in the sample is determined using an ELISA kit.
Mouse eotaxin-induced eosinophilia model
BALB/c mice are injected intradermally with a 2.5 ml of air on days -6 and -3 to prepare aiφouch. On day 0 compound is administered intraperitoneally 60 min before eotaxin injection (3 μg/mouse, i.d.). IL-5 (300 ng/mouse) is injected intravenously 30 min before the eotaxin injection. After 4 hr of the eotaxin injection leukocytes in exudate is collected and the number of total cells is counted. The differential cell counts in the exudate are performed by staining with May-Grunwald Gimsa solution. Mouse D10 cell transfer model
D10.G4.1 cells (1 x 107 cells/mouse) containing 2 mg of conalbumin in saline is administered i.v. to AKR mice. After 6 hr blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for lOmin. IL-4 and IL-5 level in serum are determined by ELISA kits. Compound is administered intraperitoneally at -4 and +1 hr after these cells injection.
Passive cutaneous anaphylaxis (PCA) test in rats
6 Weeks old male Wistar rats are sensitized intradermally (i.d.) on their shaved backs with 50 μl of 0.1 μg/ml mouse anti-DNP IgE monoclonal antibody (SPE-7) under a light anesthesia. After 24 hours, the rats are challenged intravenously with 1 ml of saline containing 0.6 mg DNP-BSA (30) (LSL CO., LTD) and 0.005 g of Evans blue. Compounds are injected intraperitoneally (i.p.) 0.5 hr prior to antigen injection. Rats without the sensitization, challenge, and compound treatment are used for a blank (control) and rats with sensitization, challenge and vehicle treatment are used to determine a value without inhibition. Thirty min after the challenge, the rats are killed, and the skin ofthe back is removed. Evans blue dye in the skin is extracted in formamide overnight at 63°C. Then an absorbance at 620 nm is measured to obtain the optical density ofthe leaked dye.
Percent inhibition of PCA with a compound is calculated as follows:
% inhibition = {(mean vehicle value - sample value)/(mean vehicle value - mean control value)} x 100
Anaphylactic bronchoconstriction in rats
6 Weeks old male Wistar rats are sensitized intravenously (i.v.) with 10 μg mouse anti-DNP IgE, SPE-7, and 1 days later, the rats are challenged intravenously with 0.3 ml of saline containing 1.5 mg DNP-BSA (30) under anesthesia with urethane (1000 mg/kg, i.p.) and gallamine (50 mg/kg, i.v.). The trachea is cannulated for artificial respiration (2 ml / stroke, 70 strokes / min). Pulmonary inflation pressure (PIP) is recorded through a side-arm of cannula connected to pressure transducer. Change in PIP reflects change of both resistance and compliance of the lungs. To evaluate the drugs, each drag is given i.v. 5 min before challenge.
EXAMPLE 24
Identification of test compound efficacy in an animal model of COPD
A/J mice are exposed to the smoke from 2 unfiltered cigarettes per day for 6 days per week for 14 weeks. Non-smoking, age-matched animals are used as controls. Animals are orally dosed with test compound or vehicle 1 hour before and 7 hours after smoke exposure. This twice-daily dosing regime is continued throughout the smoke exposure period. On day 7 of the weekly exposure, animals are given only 1 dose of test compound and are not exposed to cigarette smoke.
After the smoke exposure period, the mice are killed, their lungs inflated with phosphate-buffered formalin via their trachea, and then the lungs and heart are removed en bloc and fixed at 4°C for 48 hours. The lungs are then prepared for paraffin wax sectioning, and 4 mm sections are cut and mounted on glass slides. Sections are then stained with haematoxylin and eosin. Moφhometric analysis of lung sections is done by calculation of the Linear Mean Intercept (LMI) parameter using a semi-automated computer image analysis system. Each slide (1 per mouse) contains several sections originating from multiple lobes. Twelve non-overlapping areas (each area covering 1.53 x 10-3 cm2) are randomly selected for LMI analysis. The 12 areas cover a minimum of two lobes per slide. Non-parenchymal components (airways, blood vessels) are excluded from the analysis to prevent artifactual error. The mean intercept length is calculated for each mouse. Development of emphysema is seen as an increase in LMI. LMI data are expressed as the median and statistical comparisons are done using the non-parametric Mann-Witney U-test. A 'p' value of <=0.05 is considered to be statistically significant. The potency of a test compound is evaluated by comparison of the tobacco smoke induced increase in LMI in animals dosed with either the test compound or just the vehicle used for administration of the compound.
EXAMPLE 25
Identification of test compound efficacy in an in vitro functional test relevant to COPD
The potency of test compounds is evaluated by measuring the inhibition of elastolysis induced by human alveolar macrophages. The cells are isolated from broncho- alveolar lavage samples taken from non-smokers, disease-free smokers, and smokers with COPD. Macrophage suspensions are added to test wells coated with tritiated elastin and incubated at 37°C for 3h to allow adherence of the cells. The wells are then carefully washed to remove non-adherent cells and fresh medium is added to each well. The cells are incubated at 37°C for up to 72 hours in the presence or absence of test compound. Every 24 hours the medium in each well is removed for analysis and replaced by fresh medium. Radioactivity released into the medium is measured by liquid scintillation counting and the rate of elastin degradation is calculated. The potency of a test compound is evaluated by comparing the rate of elastolysis measured with cells incubated in the presence or absence of the compound.
EXAMPLE 26
Bladder outlet obstruction model
Wistar rats (200-250 g / Charles River Japan) are anesthetized intraperitoneally with ketamine. The abdomen is opened through a midline incision and the bladder and the proximal urethra are exposed. A constant degree of urethral obstruction is produced by tying a ligature around the urethra and a catheter with an outer diameter of 1 mm. The abdominal well is closed and the animals allowed to recover.
After 6 weeks, the rats are anesthetized with ketamine, and the ligature around the urethra is carefully removed to normalize the outlet resistance and enable repetitive micturition. A polyethylene catheter is implanted in the bladder tlirough the dome, and exteriorized at the scapular level. Animals are then allowed to recover for at least 48 hours.
Cytometric investigation is performed without anesthesia two days after bladder catheter implantation in control and obstracted animals. The bladder catheter was connected via a T-tube to a strain gauge and a microinjection pump. The conscious rats are held under partial restraint in a restraining device. Warmed saline is infused into the bladder at a rate of 3 ml/hr for control and obstracted animals. The rate of infusion is increased from 3 to 10 ml/hr to obtain similar interval times between micturitions in obstracted and control rats. Overactivity of the obstracted bladders is assessed by measuring the cystometric parameters such as basal pressure, peak micturition pressure, threshold pressure, micturition interval, amplitude and frequency of spontaneous activity and micturition slope. Lluel et al, J. Urol 160, 2253-57, 1998.
A test compound is dissolved in an appropriate vehicle, such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v), is administered intravenously through the catheter.
Organ bath assay for measuring agonist-induced contraction of prostate
An organ bath assay is employed to measure the agonist-induced contraction of prostate for assessing the biological activity of test compounds {i.e., drug candidates). Male Wistar rats (200-250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole prostate is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112mM NaCl, 5.9mM KCl, 1.2mM MgCl2, 1.2mM NaH2PO4, 2mM CaCl2, 2.5mM NaHCO , 12mM glucose). Ventricle prostate lobes were dissected into several strips depending on the size of prostate. Prostate strips are equilibrated for 60 min in organ bath chambers before any stimulation.
Isometric tension is recorded under an appropriate load. Contractile response to adrenergic agonists or electric field stimulation is determined several times until reproducible responses are obtained. Test compounds are pre-incubated prior to the agonistic or electric stimulation. The ratio of each contraction to the negative control is calculated and the effect of the test compounds on the prostate contraction is evaluated.
Organ bath assay for measuring agonist-induced contraction of urinary bladder
An organ bath assay is employed to measure the agonist-induced contraction of urinary bladder for assessing the biological activity of test compounds {i.e., drug candidates). Male Wistar rats (200-250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole urinary bladder is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112mM NaCl, 5.9mM KCl, 1.2mM MgCl2, 1.2mM NaH2PO4, 2mM CaCl2, 2.5mM NaHCO3, 12mM glucose).
Isometric tension is recorded under an appropriate load using longitudinal strips of rat detrusor muscle. Bladder strips are equilibrated for 60 minutes before each stimulation. Contractile response to 80 mM KCl is determined at 15 minute intervals until reproducible responses are obtained. The response to KCl is used as an internal standard to evaluate the effect of test compounds.
The effects of test compounds are investigated by incubating the strips with compounds for 30 minutes prior to stimulation with an appropriate agonist or electrical stimulation. One of the preparations made from the same animal serves as a control, while others are used for evaluating test compounds. The ratio of each contraction to the internal standard (e.g., a KCl-induced contraction) is calculated, and the effects ofthe test compounds on the contraction are evaluated.
EXAMPLE 27
In vivo testing of compounds/target validation
(1) Animals. Female Sprague-Dawley rats (200-250 g / Charles River Japan) are used.
(2) Catheter implantation. Rats are anesthetized by intraperitoneal administration of urethane (Sigma) at 1.25 g/kg. The abdomen is opened tlirough a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder tlirough the dome. In parallel, the inguinal region is incised, and a polyethylene catheter (BECTON DICKINSON, PE50) filled with saline (Otsuka) is inserted into a femoral vein.
(3) Investigation of bladder contraction. The bladder is filled via the catheter by incremental volume of saline until spontaneous bladder contractions occur. The intravesicular pressure is measured a pressure transducer and displayed continuously on a chart recorder. The activity of test compounds is assessed after intravenous administration tlirough a polyethylene cannula inserted into the femoral vein.
Measurement of bladder cystometry in conscious rats
(1) Animals. Female Sprague-Dawley rats (200-250 g / Charles River Japan) are used.
(2) Catheter implantation. Rats are anesthetized by intramuscular administration of ketamine (75 mg/kg) and xylazine (15 mg/kg). The abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder tlirough the dome. The catheter is tunneled through subcutis of the animal by needle (14G) to neck. In parallel, the inguinal region is incised, and a polyethylene catheter (BECTON DICKINSON, PE50) filled with saline (Otsuka) is inserted into a femoral vein. The catheter is tunneled through subcutis ofthe animal by needle to neck.
(3) Cystometric investigation. The bladder catheter is connected via T-tube to a pressure transducer (Viggo-Spectramed Pte Ltd, DT-XXAD) and a microinjection pump (TERUMO). Saline is infused at room temperature into the bladder at a rate of
10 ml/hr. Intravesicular pressure is recorded continuously on a chart pen recorder (Yokogawa). At least three reproducible micturition cycles are recorded before a test compound administration.
(4) Administration of test compounds. A test compound dissolved in the mixture of ethanol, Tween 80 (ICN Biomedicals Inc.) and saline (1 : 1 : 8, v/v/v) is administered intravenously through the catheter.
EXAMPLE 28 Expression profiling
Total cellular RNA was isolated from cells by one of two standard methods: 1) guanidine isothiocyanate/cesium chloride density gradient centrifugation [ Kellogg et al. (1990)]; or with the Tri-Reagent protocol according to the manufacturer's specifications (Molecular Research Center, Inc., Cincinatti, Ohio). Total RNA prepared by the Tri-reagent protocol was treated with DNAse I to remove genomic DNA contamination.
For relative quantitation of the mRNA distribution, total RNA from each cell or tissue source was first reverse transcribed. Eighty-five μg of total RNA was reverse transcribed using 1 μmole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U RnaseQut (Invitrogen, Groningen, Netherlands) in a final volume of 680 μl. The first strand synthesis buffer and Omniscript reverse transcriptase (2 u/μl) were obtained from (Qiagen, Hilden, Germany). The reaction was incubated at 37° C for 90 minutes and cooled on ice. The volume was adjusted to 6800 μl with water, yielding a final concentration of 12.5 ng/μl of starting RNA.
For relative quantitation of the distribution of mRNA in cells and tissues the Perkin Elmer ABI Prism R™ 7700 Sequence Detection system or Biorad iCycler was used according to the manufacturer's specifications and protocols. PCR reactions were set up to quantitate expression of the test gene and the housekeeping genes HPRT (hypoxanthine phosphoribosyltransferase), GAPDH (gly ceraldehyde-3 -phosphate dehydrogenase), β -actin, and others. Forward and reverse primers and probes were designed using the Perkin Elmer ABI Primer Express™ software and were synthesized by TibMolBiol (Berlin, Germany). The forward primer sequence was:
Primerl ggatcctgatgaaccaccac The reverse primer sequence was Primer2 ggataccaccaccaatcagg. Probel tccaccaagaccaatgctcagattt, labeled with FAM (carboxyfluorescein succinimidyl ester) as the reporter dye and TAMRA (carboxytetramethylrhodamine) as the quencher, was used as a probe. The following reagents were prepared in a total of 25 μl : lx TaqMan buffer A, 5.5 mM MgCl2, 200 nM of dATP, dCTP, dGTP, and dUTP, 0.025 U/μl AmpliTaq Gold™, 0.01 U/ μl AmpErase, and Probel tccaccaagaccaatgctcagattt, forward and reverse primers each at 200 nM, 200 nM , FAM/TAMRA-labeled probe, and 5 μ 1 of template cDNA. Thermal cycling parameters were 2 min at 50° C, followed by 10 min at 95° C, followed by 40 cycles of melting at 95° C for 15 sec and annealing/extending at 60°
C for 1 min. Calculation of corrected CT values
The CT (threshold cycle) value is calculated as described in the "Quantitative detennination of nucleic acids" section. The CF-value (factor for threshold cycle correction) is calculated as follows:
1. PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
2. CTH O- values (threshold cycle for housekeeping gene) were calculated as described in the "Quantitative determination of nucleic acids" section.
3. CTnKG-mean values (CT mean value of all HKG tested on one cDNAs) of all HKG for each cDNA are calculated (n = number of HKG): CTHKG-n-mean value = (CTπKGi-value + CTHKG2- alue + ... + CTκκG-n-value) I 4. CTpannei mean value (CT mean value of all HKG in all tested cDNAs) =
(CTHKGi-mean value + CTHKG2-nιean value + ...+ CTHKG-y-mean value) / y
(y = number of cDNAs) 5. CFCDNA-n (correction factor for cDNA n) = CTpannei-mean value - CTHKG-Π- mean value 6. CTCDNA-n (CT value ofthe tested gene for the cDNA n) + CFCDNA-Π (correction factor for cDNA n) = CT COΓ-CDNA-Π (corrected CT value for a gene on cDNA n)
Calculation of relative expression
Definition : highest CTcor-cDNA-n ≠ 40 is defined as CTcor-cDNA [high]
Relative Expression = 2 (CTcor-cDNA[hi^ " cτcor-cDNA-„)
The following tissues were tested: fetal heart, heart, pericardium, heart atrium
(right), heart atrium (left), heart ventricle (left), heart ventricle (right), heart apex, Purkinje fibers, interventricular septum, fetal aorta, aorta, artery, coronary artery, pulmonary artery, carotid artery, mesenteric artery, vein, pulmonic valve, coronary artery smooth muscle primary cells, HUVEC cells, skin, adrenal gland, thyroid, thyroid tumor, pancreas, pancreas liver cirrhosis, esophagus, esophagus tumor, stomach, stomach tumor, colon, colon tumor, small intestine, ileum, ileum tumor, ileum chronic inflammation, rectum, salivary gland, fetal liver, liver, liver liver cirrhosis, liver tumor, HEP G2 cells, leukocytes (peripheral blood), Jurkat (T-cells), bone marrow, erythrocytes, lymph node, thymus, thrombocytes, bone marrow stromal cells, bone marrow CD71+ cells, bone marrow CD33+ cells, bone marrow CD34+ cells, bone marrow CD 15+ cells, cord blood CD71+ cells, cord blood CD34+ cells, neutrophils cord blood, neutrophils peripheral blood, spleen, spleen liver cirrhosis, skeletal muscle, adipose, fetal brain, brain, Alzheimer brain, cerebellum, cerebellum
(right), cerebellum (left), cerebral cortex, Alzheimer cerebral cortex, frontal lobe, Alzheimer brain frontal lobe, occipital lobe, parietal lobe, temporal lobe, precentral gyras, postcentral gyras, tonsilla cerebelli , vermis cerebelli, pons, substantia nigra, cerebral meninges, cerebral peduncles, coφus callosum, hippocampus, thalamus, dorsal root ganglia, spinal cord, neuroblastoma SK N MC cells, neuroblastoma
SH SY5Y cells, neuroblastoma IMR32 cells, glial tumor H4 cells, glial tumor H4 cells + APP, HEK CNS, HEK CNS + APP, retina, fetal lung, fetal lung fibroblast IMR 90 cells, fetal lung fibroblast MRC 5 cells, lung, lung right upper lobe, lung right mid lobe, lung right lower lobe, lung lupus disease, lung tumor, lung COPD, trachea, cervix, testis, HeLa cells (cervix tumor), placenta, uterus, uterus tumor, ovary, ovary tumor, breast, breast tumor, MDA MB 231 cells (breast tumor), mammary gland, prostate, prostate BPH, bladder, ureter, penis, coφus cavernosum, fetal kidney, kidney, kidney tumor, HEK 293 cells.
The results are shown in Table 1.
Tissue Relative
Expression fetal heart 21619 heart 7181 pericardium 10885 heart atrium (right) 27939 heart atrium (left) 14972 heart ventricle (left) 5673 heart ventricle (right) 186 heart apex 11426
Purkinje fibers 5634 interventricular septum 11666 fetal aorta 218 aorta 271 artery 36 coronary artery 372 pulmonary artery 16 carotid artery 87 mesenteric artery 286 vein 17 pulmonic valve 1510 coronary artery smooth muscle 3692 primary cells
HUVEC cells 9410
skin 18179
adrenal gland 10809 thyroid 14664 thyroid tumor 4640 pancreas 9216 pancreas liver cirrhosis 6081
esophagus 771 esophagus tumor 8540 stomach 9541 stomach tumor 10735 colon 11829 colon tumor 14263 small intestine 16158 ileum 16498 ileum tumor 729 ileum chronic inflammation 331 rectum 36358 salivary gland 6081 fetal liver 5008 liver 22694 liver liver cirrhosis 4012 liver tumor 28725
HEP G2 cells 48645
leukocytes (peripheral blood) 481
Jurkat (T-cells) 4513 bone marrow 639 erythrocytes 52 lymph node 246 thymus 1399 thrombocytes 36 bone marrow stromal cells 861 bone marrow CD71+ cells 24 bone marrow CD33+ cells 17 bone marrow CD34+ cells 2435 bone marrow CD 15+ cells 1 cord blood CD71+ cells 16 cord blood CD34+ cells 11666 neutrophils cord blood 541 neutrophils peripheral blood 826 spleen 1468 spleen liver cirrhosis 391
skeletal muscle 16498 adipose 10226
fetal brain 15608 brain 6295
Alzheimer brain 10086 cerebellum 1160 cerebellum (right) 18951 cerebellum (left) 15393 cerebral cortex 20032
Alzheimer cerebral cortex 10369 frontal lobe 23170
Alzheimer brain frontal lobe 42348 occipital lobe 18951 parietal lobe 9153 temporal lobe 9878 precentral gyras 14362 postcentral gyrus 79 tonsilla cerebelli 5221 vermis cerebelli 5673 pons 28725 substantia nigra 27746 cerebral meninges 296 cerebral peduncles 2798 coφus callosum 32094 hippocampus 16384 thalamus 11268 dorsal root ganglia 76 spinal cord 12331 neuroblastoma SK-N-MC cells 5833 neuroblastoma SH-SY5Y cells 19083 neuroblastoma IMR32 cells 23988 glial tumor H4 cells 24834 glial tumor H4 cells + APP 15076
HEK CNS 14563
HEK CNS + APP 31000 retina 771
fetal lung 18820 fetal lung fibroblast IMR-90 cells 9541 fetal lung fibroblast MRC-5 cells 5221 lung 1563 lung right upper lobe 2539 lung right mid lobe 1278 lung right lower lobe 1965 lung lupus disease 484 lung tumor 19484 lung COPD 729 trachea 9281
cervix 4124 testis 8023
HeLa cells (cervix tumor) 3350 placenta 3984 uterus 11037 uterus tumor 29328 ovary 139509 ovary tumor 12503 breast 48309 breast tumor 4871 MDA MB 231 cells (breast 14462 tumor) mammary gland 8023
prostate 10587 prostate BPH 1541 bladder 5293 ureter 1911 penis 605 coφus cavernosum 300 fetal kidney 26987 kidney 8659 kidney tumor 23332
HEK 293 cells 31433
REFERENCES
Structural requirements for alpha-latrotoxin binding and alpha-lafrotoxin-stimulated secretion. A study with calcium-independent receptor of alpha-latrotoxin (CIRL) deletion mutants. J Biol Chem 1999 Feb 5;274(6):3590-6
Alpha-latrotoxin and its receptors CIRL (latrophilin) and neurexin 1 alpha mediate effects on secretion through multiple mechanisms. Biochimie 2000 May;82(5):447-
52
Alpha-Latrotoxin and its receptors: neurexins and CIRL/latrophilins. Annu Rev
Neurosci 2001;24:933-62

Claims

1. An isolated polynucleotide being selected from the group consisting of:
a. a polynucleotide encoding a secretin-type GPCR (Latrophilin) polypeptide comprising an amino acid sequence selected form the group consisting of:
i amino acid sequences which are at least about 95% identical to the amino acid sequence shown in SEQ ID NO: 2; and ii the amino acid sequence shown in SEQ ID NO: 2.
b. a polynucleotide comprising the sequence of SEQ ID NO: 1 ;
c a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b) and encodes a secretin-type GPCR (Latrophilin) polypeptide;
d. a polynucleotide the sequence of which deviates from the poly- nucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code and encodes a secretin-type GPCR (Latrophilin) polypeptide; and
e. a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a secretin-type GPCR (Latrophilin) polypeptide.
2. An expression vector containing any polynucleotide of claim 1.
3. A host cell containing the expression vector of claim 2.
4. A substantially purified secretin-type GPCR (Latrophilin) polypeptide encoded by a polynucleotide of claim 1.
5. A method for producing a secretin-type GPCR (Latrophilin) polypeptide, wherein the method comprises the following steps:
a. culturing the host cell of claim 3 under conditions suitable for the expression ofthe secretin-type GPCR (Latrophilin) polypeptide; and b. recovering the secretin-type GPCR (Latrophilin) polypeptide from the host cell culture.
6. A method for detection of a polynucleotide encoding a secretin-type GPCR (Latrophilin) polypeptide in a biological sample comprising the following steps:
a. hybridizing any polynucleotide of claim 1 to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and b. detecting said hybridization complex.
7. The method of claim 6, wherein before hybridization, the nucleic acid material ofthe biological sample is amplified.
8. A method for the detection of a polynucleotide of claim 1 or a secretin-type GPCR (Latrophilin) polypeptide of claim 4 comprising the steps of:
a. contacting a biological sample with a reagent which specifically interacts with the polynucleotide or the secretin-type GPCR (Latrophilin) polypeptide and b. detecting the interaction
9. A diagnostic kit for conducting the method of any one of claims 6 to 8.
10. A method of screening for agents which decrease the activity of a secretin- type GPCR (Latrophilin), comprising the steps of:
a. contacting a test compound with any secretin-type GPCR (Latrophilin) polypeptide encoded by any polynucleotide of claim 1; b. detecting binding of the test compound to the secretin-type GPCR
(Latrophilin) polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a secretin-type GPCR (Latrophilin).
11. A method of screening for agents which regulate the activity of a secretin-type GPCR (Latrophilin), comprising the steps of:
a. contacting a test compound with a secretin-type GPCR (Latrophilin) polypeptide encoded by any polynucleotide of claim 1 ; and b. detecting a secretin-type GPCR (Latrophilin) activity of the polypeptide, wherein a test compound which increases the secretin-type GPCR (Latrophilin) activity is identified as a potential therapeutic agent for increasing the activity of the secretin-type GPCR
(Latrophilin), and wherein a test compound which decreases the secretin-type GPCR (Latrophilin) activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the secretin-type GPCR (Latrophilin).
12. A method of screening for agents which decrease the activity of a secretin- type GPCR (Latrophilin), comprising the step of:
contacting a test compound with any polynucleotide of claim 1 and detecting binding ofthe test compound to the polynucleotide, wherein a test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of secretin-type GPCR (Latrophilin).
13. A method of reducing the activity of secretin-type GPCR (Latrophilin), comprising the step of:
contacting a cell with a reagent which specifically binds to any polynucleotide of claim 1 or any secretin-type GPCR (Latrophilin) polypeptide of claim 4, whereby the activity of secretin-type GPCR (Latrophilin) is reduced.
14. A reagent that modulates the activity of a secretin-type GPCR (Latrophilin) polypeptide or a polynucleotide wherein said reagent is identified by the method of any ofthe claim 10 to 12.
15. A pharmaceutical composition, comprising :
the expression vector of claim 2 or the reagent of claim 14 and a pharmaceutically acceptable carrier.
16. Use of the expression vector of claim 2 or the reagent of claim 14 in the preparation of a medicament for modulating the activity of a secretin-type GPCR (Latrophilin) in a disease.
17. Use of claim 16 wherein the disease is obesity, a cardiovascular disorder, a dermatological disorder, an endocrine and hormonal disorder, a metabolic disorder, including diabetes, cancer, a gastrointestinal and liver disorder, a hematological disorder, a neurological disorder, a respiratory disorder, a reproductive disorder or a genitourinary disorder.
PCT/EP2003/009157 2002-08-19 2003-08-19 Regulation of human secretin-type gpcr (latrophilin) Ceased WO2004018516A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003255459A AU2003255459A1 (en) 2002-08-19 2003-08-19 Regulation of human secretin-type gpcr (latrophilin)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US40414202P 2002-08-19 2002-08-19
US60/404,142 2002-08-19
US47495103P 2003-06-03 2003-06-03
US60/474,951 2003-06-03

Publications (1)

Publication Number Publication Date
WO2004018516A1 true WO2004018516A1 (en) 2004-03-04

Family

ID=31949856

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/009157 Ceased WO2004018516A1 (en) 2002-08-19 2003-08-19 Regulation of human secretin-type gpcr (latrophilin)

Country Status (2)

Country Link
AU (1) AU2003255459A1 (en)
WO (1) WO2004018516A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008045687A3 (en) * 2006-10-11 2008-07-03 Us Gov Health & Human Serv Methods for detecting and treating attention-deficit/hyperactivity disorder (adhd)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998039440A2 (en) * 1997-03-04 1998-09-11 New York University CALCIUM INDEPENDENT RECEPTOR OF α-LATROTOXIN, CHARACTERIZATION AND USES THEREOF
WO2001051628A2 (en) * 2000-01-14 2001-07-19 Millennium Pharmaceuticals, Inc. Genes compositions, kits, and methods for identification, assessment, prevention, and therapy of breast cancer
WO2001070969A2 (en) * 2000-03-22 2001-09-27 Bayer Aktiengesellschaft Regulation of human latrophilin-like g protein-coupled receptor
WO2001092503A2 (en) * 2000-05-30 2001-12-06 Bayer Aktiengesellschaft Regulation of human calcium-independent alpha-latro-toxin-like g protein-coupled receptor
WO2002024733A2 (en) * 2000-09-15 2002-03-28 Curagen Corporation Human polynucleotides and polypeptides encoded thereby
WO2003033652A2 (en) * 2001-10-12 2003-04-24 Amgen Inc TUMOR ENDOTHELIAL MARKER 5α MOLECULES AND USES THEREOF

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998039440A2 (en) * 1997-03-04 1998-09-11 New York University CALCIUM INDEPENDENT RECEPTOR OF α-LATROTOXIN, CHARACTERIZATION AND USES THEREOF
WO2001051628A2 (en) * 2000-01-14 2001-07-19 Millennium Pharmaceuticals, Inc. Genes compositions, kits, and methods for identification, assessment, prevention, and therapy of breast cancer
WO2001070969A2 (en) * 2000-03-22 2001-09-27 Bayer Aktiengesellschaft Regulation of human latrophilin-like g protein-coupled receptor
WO2001092503A2 (en) * 2000-05-30 2001-12-06 Bayer Aktiengesellschaft Regulation of human calcium-independent alpha-latro-toxin-like g protein-coupled receptor
WO2002024733A2 (en) * 2000-09-15 2002-03-28 Curagen Corporation Human polynucleotides and polypeptides encoded thereby
WO2003033652A2 (en) * 2001-10-12 2003-04-24 Amgen Inc TUMOR ENDOTHELIAL MARKER 5α MOLECULES AND USES THEREOF

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [online] EBI; 10 January 2002 (2002-01-10), "Human cDNA SEQ ID NO: 230", XP002264659, retrieved from EMBL Database accession no. ABA06564 *
DATABASE EMBL [online] EBI; 11 August 2003 (2003-08-11), "Nucleotide sequence of human TEM5alpha polypeptide", XP002264661, retrieved from EMBL Database accession no. ACC70358 *
DATABASE EMBL [online] EBI; 16 July 2002 (2002-07-16), "Homo sapiens cDNA FLJ38547 fis, clone HCHON2001665", XP002264658, retrieved from EMBL Database accession no. AK095866 *
DATABASE EMBL [online] EBI; 30 July 2002 (2002-07-30), "Human cDNA encoding G protein-coupled receptor-like protein NOV5a", XP002264660, retrieved from EMBL Database accession no. ABK71919 *
DATABASE EMBL [online] EBI; 7 December 2001 (2001-12-07), "Human breast cancer expressed polynucleotide 18896", XP002264657, retrieved from EMBL Database accession no. AAL26439 *
LELIANOVA V G ET AL: "ALPHA-LATROTOXIN RECEPTOR, LATROPHILIN, IS A NOVEL MEMBER OF THE SECRETIN FAMILY OF G PROTEIN-COUPLED RECEPTORS", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, US, vol. 272, no. 34, 22 August 1997 (1997-08-22), pages 21504 - 21508, XP002066460, ISSN: 0021-9258 *
MATSUSHITA H ET AL: "The latrophilin family: multiply spliced G protein-coupled receptors with differential tissue distribution", FEBS LETTERS, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 443, no. 3, 29 January 1999 (1999-01-29), pages 348 - 352, XP004259173, ISSN: 0014-5793 *
SUEDHOF T C: "Alpha-Latrotoxin and its Receptors: Neurexins and CIRL/Latrophilins", ANNUAL REVIEW OF NEUROSCIENCE, vol. 24, 2001, pages 933 - 962, XP009022972 *
SUGITA S ET AL: "ALPHA-LATROTOXIN RECEPTOR CIRL/LATROPHILIN 1 (CL1) DEFINES AN UNUSUAL FAMILY OF UBIQUITOUS G-PROTEIN-LINKED RECEPTORS", JOURNAL OF BIOLOGICAL CHEMISTRY, THE AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, INC.,, US, vol. 273, no. 49, 1998, pages 32715 - 32724, XP000946649, ISSN: 0021-9258 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008045687A3 (en) * 2006-10-11 2008-07-03 Us Gov Health & Human Serv Methods for detecting and treating attention-deficit/hyperactivity disorder (adhd)
US8003406B2 (en) 2006-10-11 2011-08-23 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for detecting attention-deficit/hyperactivity disorder

Also Published As

Publication number Publication date
AU2003255459A1 (en) 2004-03-11

Similar Documents

Publication Publication Date Title
EP1364026B1 (en) Human g protein-coupled receptor
US20050148014A1 (en) Regulation of human P2Y1-like G protein-coupled receptor
EP1335978A2 (en) Regulation of human extracellular calcium-sensing g protein-coupled receptor
WO2004031235A1 (en) Regulation of human calcium-independent alpha-latrotoxin receptor
WO2004003192A1 (en) Human receptor tyrosine kinase mertk
US20020155528A1 (en) Regulation of human CysLT2-like GPCR protein
US20030166600A1 (en) Regulation of human isotocin-like g protein-coupled receptor
WO2004018516A1 (en) Regulation of human secretin-type gpcr (latrophilin)
US20040077041A1 (en) Regulation of human follicle stimulating hormone-like g protein -coupled receptor
US20050064404A1 (en) Regulation of human serotonin-like g protein-coupled receptor
US20010041355A1 (en) Regulation of human nerve growth factor-related G protein-coupled receptor
WO2004000883A1 (en) Regulation of human growth hormone-releasing hormone receptor
WO2003051925A1 (en) Human secretin-type gpcr (latrophilin)
WO2002099107A2 (en) Regulation of human trace amine receptor ta5
US20030073115A1 (en) Regulation of human galanin receptor-like g protein coupled receptor
US20040143092A1 (en) Regulation of human dorsal root receptor-like g protein-coupled receptor
WO2001068843A1 (en) Regulation of human galanin receptor-like g protein coupled receptor
WO2002101043A2 (en) Regulation of human ta4 receptor
EP1282705A2 (en) Endothelial differentiation gene 6-like g protein coupled receptor
US20060121554A1 (en) Regulation of human RTA-like GPCR
EP1688496A2 (en) Regulation of human P2Y1-like G protein-coupled receptor
WO2003004530A1 (en) Regulation of human somatostatin receptor-like protein
WO2003068966A2 (en) REGULATION OF HUMAN Ca2+-PERMEABLE NONSELECTIVE CATION CHANNEL
US20030109482A1 (en) Regulation of human p2y8-like g protein-coupled receptor
WO2002000701A2 (en) Regulation of human gonadotropin releasing hormone receptor-like g protein-coupled receptor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP