WO2004018465A2

WO2004018465A2 - Benzonaphthyridines with pde 3/4 inhibiting activity

Info

Publication number: WO2004018465A2
Application number: PCT/EP2003/008996
Authority: WO
Inventors: Dieter Flockerzi; Ulrich Kautz; Beate Schmidt; Steffen Weinbrenner; Armin Hatzelmann; Johannes Barsig; Degenhard Marx; Hans-Peter Kley; Michael David; Dirk Rocker
Original assignee: Altana Pharma Ag
Priority date: 2002-08-17
Filing date: 2003-08-13
Publication date: 2004-03-04
Also published as: IS7729A; PL373598A1; HRP20050227A2; JP2005537313A; EP1581533A2; AU2003263216A1; RS20050117A; CA2495603A1; WO2004018465A9; WO2004018465A3; US20060113968A1

Abstract

Compounds of a certain formula (1), in which R1, R2, R3, R4 and R5 have the meanings indicated in the description, are novel effective PDE4 or PDE3/4 inhibitors.

Description

Novel benzonaphthyridines

Field of application of the invention

The invention relates to novel 6-phenylbenzonaphthyridines which are used in the pharmaceutical industry for the production of pharmaceutical compositions.

Known technical background

The international applications WO98/21208 (= USP 6,008,215), WO98/40382 (= USP 6,143,759), W099/57118 (= USP 6,306,869) and WOOO/12501 describe 6-phenylbenzonaphthyridines and their N-oxides as PDE3/4 inhibitors. In the International Patent application WO02/066476 benzonaphthyridine derivatives are described which are PDE3/4 inhibitors and have a guanidyl substituent. In the International Patent application WO01/70746 furoisoquinoline derivatives are described as PDE4 inhibitors. In the European Patent application EP 0490823 dihydroisoquinoline derivatives are described which are useful in the treatment of asthma.

Description of the invention

It has now been found that the compounds of formula 1 , which are described in more detail below and which differ from the prior-art compounds in particular by substitution on the 6-phenyl ring, have surprising and particularly advantageous properties.

the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

The invention thus relates to compounds of formula 1 ,

in which

R1 is 1-4C-alkyl,

R2 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R3 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, or in which

R2 and R3 together are a 1-2C-alkyIenedioxy group, R4 is hydrogen, halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy, R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either

R6, R7, R8 and R9 independently of one another are hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, cyano, hydroxy-2-4C-alkyl, 1-4C-alkoxy-2-4C-alkyl or R26, with the proviso that at least one of R6, R7, R8 and R9 is 1-4C-alkoxy-2-4C-alkyl, or

R6 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, hydroxy-2-4C-alkyl, 1-4C- alkoxy-2-4C-alkyl or R26,

R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, hydroxy-2-4C-alkyl, 1-4C- aikoxy-2-4C-alkyl or R26, and

R8 and R9, together and including the nitrogen atom to which both are bonded, are a piperazin-

1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydro- isoquinolin-2-yl, tetrahydro-6,7-dimethoxyisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl,

2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, 4-benzyl-piperidin-1-yl, thiomorpholin-4- yl or 1H-1,2,4-triazol-1-yl radical, or

R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, hydroxy-2-4C-alkyl, 1-4C- alkoxy-2-4C-alkyl or R26,

R8 is hydrogen, 1τ7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyi; hydroχy-2-4C-alkyl, 1-4C- alkoxy-2-4C-alkyl or R26, arid R9 is cyano, Aryll, R26, naphthyl, phenyl, phenyl substituted by R18 and/or R19, phenyl-1-4C- alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R20 and/or R21 ,

in which if R5 is a radical of the formula (b), either

R10 and R11 independently of one another are hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cy- cloalkylmethyl, hydroxy-2-4C-alkyl, 1-4C-alkoxy-2-4C-alkyl or R26, and

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pipera- zin-1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahy- droisoquinolin-2-yl, tetrahydro-6,7-dimethoxyisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol- 1-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, 4-benzyl-piperidin-1-yl, thiomorpholin-4-yl or 1H-1,2,4-triazol-1-yl radical, or

R10 and R11 , together and including the nitrogen atom to which both are bonded, are a 2,6- dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, 4-benzyl-piperidin-1-yl or thiomorpholin-4-yl radical, and

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pyrroli- din-1-yl, piperidin-1-yl, hexahydroazepin-1-yl, morpholin-4-yl, 4-(1-4C-alkyl-)-piperazin-1-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, 4-benzyl-piperidin-1-yl or thiomorpholin- 4-yl radical,

in which if R5 is a radical of the formula (c),

R14 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, hydroxy-2-4C-alkyl, 1-4C- alkoxy-2-4C-alkyl or R26, and

R15 and R16, together and with inclusion of the N-C(-)-N structure to which they are bonded are

Aryl2,

Aryll is 4-methylthiazol-2-yl, benzimidazol-2-yl, 5-nitrobenzimidazol-2-yl, 5-chlorobenzimidazol-2-yl, 5-methylbenzimidazol-2-yl, 4-methylquinazolin-2-yl, benzothiazol-2-yl, benzoxazol-2-yl or pyrimi- din-2-yl,

Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1H-imidazol-2-yl, imidazol-2-yl, 4,5-dicyano-imidazol-2-yl, 4-me- thyl-imidazol-2-yl, 4-ethyl-benzimidazol-2-yl, 4-acetyl-imidazol-2-yl, 1H-[1,2,4]triazol-3-yl, benz- imidazol-2-yl, 1-methyl-benzimidazol-2-yl, 1-ethyl-benzimidazol-2-yl, 5,6-dimethyl-benzimidazol- 2-yl, purin-8-yl, 6-amino-7-methyi-7H-purine-8-yl, 1 ,6-dimethylimidazo[4,5-b]pyridin-2-yl, 1 ,5,6- trimethylimidazo[4,5-b]pyridin-2-yl, 1 ,3-dimethyl-3,7-dihydro-1 H-purine-2,6-dione-8-yl, 7-ethyl-3- methyl-3,7-dihydro-purine-2,6-dione-8-yl, 1 ,3,7-trim^'ethyl-3,7-dihydro-purine-2,6-dione-8-yl, thia- diazolyl, 1 ,4-dihydrotetrazol-5-yl, 2H-[1,2,4]triazol-3-yl, 1 ,3-dihydrobenzimidazol-5-yl, 1H-tetrazol- 5-yi, pyrimidin-2-yl or 4,6-dimethyl-pyrimidin-2-yl, R17 is formyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, 1-4C-alkoxycarbonyl-1-4C-alkyl, 1-4C- alkylcarbonyl, hydroxy-2-4C-alkyl, 1-4C-alkoxy-2-4C-alkyl, hydroxy-2-4C-alkoxy-2-4C-alkyl, 1- 4C-alkoxy-2-4C-alkoxy-2-4C-alkyl, phenyl, phenyl substituted by R22 and/or R23, [benzo(1 ,3)dioxol]-5-ylmethyl, phenyl-1 -4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R24 and/or R25,

R18 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R19 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R20 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R21 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R22 is halogen, nitro, carboxyl, 1-4C-alkyl, 1-4C-alkylcarbonyl, trifluoromethyl or 1-4C-alkoxy,

R23 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R24 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R25 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R26 is R27(R28)N-2-4C-alkyl wherein

R27 and R28, together and including the nitrogen atom to which both are bonded, are a pyrrolidin-1-yl, piperidin-1-yl, piperazin-1-yl, 4-(1-4C-alkyl-)piperazin-1-yl, azepan-1yl, azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydroisoquinolin-2-yI, tetrahydro-6,7-dimethoxyisoquinolin-2-yl, 3,5-dimethyl- pyrazol-1-yl, pyrazol-1-yl, morpholin-4-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, 4-benzyl-piperidin-1-yl, thiomorpholin-4-yl or 1 H-1,2,4-triazoI-1-yl radical, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

1-4C-Alkyl represents a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl and, preferably, the ethyl and methyl radicals.

2-4C-Alkyl represents a straight-chain or branched alkyl radical having 2 to 4 carbon atoms. Examples which may be mentioned are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl and, preferably, the ethyl radicals.

1-4C-Alkoxy represents radicals which, in addition to the oxygen atom, contain a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, isopropoxy and, preferably, the ethoxy and methoxy radicals.

3-7C-Cycloalkoxy represents, for example, cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy and cycloheptyloxy, of which cyclopropyloxy, cyclobutyloxy and cyclopentyloxy are preferred. 3-7C-Cycloalkylmethoxy represents, for example, cyclopropylmethoxy, cyclobutylmethoxy, cyclopentyl- methoxy, cyclohexylmethoxy and cycloheptylmethoxy, of which cyclopropylmethoxy, cyclobutylmethoxy and cyclopentylmethoxy are preferred.

As 1-4C-Alkoxy which is completely or predominantly substituted by fluorine, the 2,2,3,3,3-pentafluoro- propoxy, the perfluoroethoxy, the 1,1 ,2,2-tetrafluoroethoxy, the 1 ,2,2-trifluoroethoxy, the trifluorometh- oxy, in particular the 2,2,2-trifluoroethoxy, and preferably the difluoromethoxy radicals, for example, may be mentioned. In this context, "predominantly" means that more than half of the hydrogen atoms of the 1-4C-alkoxy groups are replaced by fluorine atoms.

1-2C-Alkylenedioxy represents, for example, the methylenedioxy (-0-CH₂-0-) or the ethylenedioxy (-0-CH₂-CH₂-0-) radical.

1-7C-Alkyl represents straight-chain or branched alkyl radicals having 1 to 7 carbon atoms. Examples which may be mentioned are the heptyl, isoheptyl (5-methylhexyl), hexyl, isohexyl (4-methylpentyl), neohexyl (3,3-dimethylbutyl), pentyl, isopentyl (3-methylbutyl), neopentyl (2,2-dimethyIpropyl), butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, ethyl or methyl radical.

3-7C-Cycloalkyl represents the cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl radical.

3-7C-Cycloalkylmethyl represents a methyl radical which is substituted by one of the abovementioned 3-7C-cycloalkyl radicals. Examples which may be mentioned are the cycloalkylmethyl radicals cyclopro- pylmethyl, cyclobutylmethyl and cyclopentylmethyl.

Hydroxy-2-4C-alkyl represent a 2-4C-a!kyl radical which is substituted by a hydroxyl group. Examples which may be mentioned are the 2-hydroxyethyl and the 3-hydroxy ropyl radicals.

An example which may be mentioned for a hydroxy-2-4C-alkoxy-2-4C-alkyl radical is the (2- hydroxyethoxy)ethyl radical.

An example of a 1-4C-alkoxy-2-4C-alkoxy-2-4C-alkyl radical is the (2-methoxyethoxy)ethyl radical.

Halogen within the meaning of the invention is fluorine, chlorine or bromine.

1-4C-Alkylcarbonyl is a carbonyl group to which one of the abovementioned 1-4C-alkyl radicals is bonded. An example is the acetyl radical [CH₃C(0)-].

1-4C-Alkoxycarbonyl is a carbonyl group to which one of the abovementioned 1-4C-alkoxy radicals is bonded. Examples are the methoxycarbonyl [CH₃0-C(0)-] and the ethoxycarbonyl [CH₃CH₂0-C(0)-] radical. 1-4C-Alkoxycarbonyl-1-4C-alkyl stands for one of the abovementioned 1-4C-alkyl radicals, which is substituted by one of the abovementioned 1-4C-alkoxycarbonyl radicals. An example is the ethoxycarbonylmethyl radical [CH₃CH₂OC(0)CH2-].

1-4C-Alkoxy-2-4C-alkyl represents a 2-4C-alkyl radical, which is substituted by one of the abovementioned 1-4C-alkoxy radicals. Examples which may be mentioned are the methoxyethyl and the ethoxyethyl radical.

Phenyl-1-4C-alkyl radicals stand for one of the abovementioned 1-4C-alkyl radicals substituted by an phenyl group. Examples which may be mentioned are the phenylethyl and the benzyl radical.

R27(R28)N-2-4C-alkyl radicals stand for one of the above-mentioned 2-4C-alkyl radicals substituted by an R27(R28)N- group. Examples which may be mentioned are moφholin-4-ylethyl and the thiomorpholin-4-ylethy! radicals.

"N-oxides of these compounds" stands for any single or multiple N-oxide(s), which can be formed starting from the compounds of formula 1. Preferred are the single N-oxides at the nitrogen atom in 2-position of the benzonaphthyridine ring system.

In the formulae (a), (b) or (c) the horizontal dotted lines indicate

that R5 is bonded to the carbonyl group in formula 1 via the bond that bears the horizontal dotted line. The additional dotted lines in formula (c) indicate that there can be in the indicated positions a single or a double bond.

The substituents R4 and -C(0)R5 of the compounds of formula 1 can be attached in the ortho, meta or para position with respect to the binding position in which the 6-phenyl ring is bonded to the benzonaphthyridine ring system. Preference is given to compounds of formula 1, in which R4 is hydrogen and -C(0)R5 is attached in the meta or in the para position; most preferred is the para position.

Suitable salts of compounds of formula 1 - depending on substitution - are all acid addition salts or all salts wit j bases. The pharmacologically tolerable salts of the inorganic and organic acids and bases customarily used, in pharmacy may be particularly mentioned. Those suitable are, on the one hand, water-soluble and water-insoluble acid addition salts witlracids such as, for example, hydrochloric-acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, acetic acid, citric acid, D-gluconic acid, benzoic acid, 2-(4-hydroxybenzoyl)benzoic acid, butyric acid, sulfosalicylic acid, maleic acid, lauric acid, malic acid, fumaric acid, succinic acid, oxalic acid, tartaric acid, embonic acid, stearic acid, toluene- sulfonic acid, methanesulfonic acid or 3-hydroxy-2-naphthoic acid, where the acids are employed in salt preparation - depending on whether a mono- or polybasic acid is concerned and depending on which salt is desired - in an equimolar quantitative ratio or one differing therefrom.

On the other hand salts with bases are also suitable. Examples of salts with bases which may be mentioned are alkali metal (lithium, sodium, potassium) or calcium, aluminum, magnesium or titanium salts, where here too the bases are employed in salt preparation in an equimolar quantitative ratio or one differing therefrom.

Pharmacologically intolerable salts which can be obtained first, for example, as process products in the preparation of the compounds according to the invention on an industrial scale, are converted into pharmacologically tolerable salts by methods known to the person skilled in the art.

It is known to the person skilled in the art that the compounds according to the invention and their salts, for example when they are isolated in crystalline form, may comprise varying amounts of solvents. Accordingly, the invention also embraces all solvates and in particular all hydrates of the compounds of formula 1, and also all solvates and in particular all hydrates of the salts of the compounds of formula 1.

Compounds of formula 1 to be emphasized are those in which

R1 is 1-4C-alkyl,

R2 is 1-4C-alkoxy, 3-6C-cycloa)koxy, 3-6C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R3 is 1-4C-alkoxy, 3-6C-cycloalkoxy, 3-6C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R4 is hydrogen, halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy, R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either R6 is hydrogen,

R7 is hydrogen,

R8 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or 1-4C-alkoxy-2-4C-alkyl, and

R9 is hydrogen, 1-4C-aIkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or 1-4C-alkoxy-2-4C-alkyl, with the proviso that at least one of R8 or R9 is 1-4C-alkoxy-2-4C-alkyl, or

R6 is hydrogen,

R7 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and

2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, 4-benzyl-piperidin-1-yl or thiomorpholin-

4-yl radical, or

R6 is hydrogen,

R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,

R8 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and

R9 is cyano, Aryll, R26, naphthyl, phenyl, phenyl substituted by R18 and/or R19, phenyl-1-4C- alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R20 and/or R21,

in which if R5 is a radical of the formula (b), either

R10 and R11 independently of one another are hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pipera- zin-1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahy- droisoquinolin-2-yl, tetrahydro-6,7-dimethoxyisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol- 1-yl, 2,6-dimethyl-morpholin-4-yl, 4-benzyl-piperidin-1-yl or 2,6-dimethyl-piperidin-1-yl radical, or

R10 and R11 , together and including the nitrogen atom to which both are bonded, are a 2,6-di- methyl-morpholin-4-yl, 4-benzyl-piperidin-1-yl or 2,6-dimethyl-piperidin-1-yl radical, and R12 and R13, together and including the nitrogen atom to which both are bonded, are a pyrroli- din-1-yl, piperidin-1-yl, hexahydroazepin-1-yl, morpholin-4-yl, 4-(1-4C-alkyl-)-piperazin-1-yl, 2,6-dimethyl-morpholin-4-yl, 4-benzyl-piperidinyl or 2,6-dimethyl-piperidin-1-yl radical,

in which if R5 is a radical of the formula (c), R14 is hydrogen, and R15 and R16, together and with inclusion of the N-C(-)-N structure to which they are bonded are Aryl2,

Aryll is 4-methylthiazol-2-yl, benzimidazol-2-yl, 5-nitrobenzimidazol-2-yl, 5-chlorobenzimidazol-2-yl, 5-methylbenzimidazol-2-yl, benzothiazol-2-yl or benzoxazol-2-yl,

Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1 H-imidazol-2-yl, imidazol-2-yl, 4,5-dicyano-imidazol-2-yl, 4-me- thyl-imidazol-2-yl, 4-ethyl-benzimidazol-2-yl, 4-acetyl-imidazol-2-yi, 1H-[1,2,4]triazol-3-yl, benz- imidazol-2-yl, 1-methyl-benzimidazol-2-yl, 1-ethyl-benzimidazol-2-yl, 5,6-dimethyl-benzimidazol- 2-yl, purin-8-yl, 6-amino-7-methyl-7H-purine-8-yl, 1,6-dimethylimidazo[4,5-b]pyridin-2-yl, 1 ,5,6- trimethylimidazo[4,5-b]pyridin-2-yl, 1 ,3-dimethyl-3,7-dihydro-1 H-purine-2,6-dione-8-yl, 7-ethyl-3- methyl-3,7-dihydro-purine-2,6-dione-8-yl, 1,3,7-trimethyl-3,7-dihydro-purine-2,6-dione-8-yl or 1 H-[1 ,2,4]triazol-3-yl,

R17 is formyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, 1-4C-alkoxycarbonyl-1-4C-alkyl, 1-4C- alkylcarbonyl, hydroxyethyl, 1-2C-alkoxyethyl, hydroxy-2-4C-alkoxyethyl, 1-2C-alkoxy-2-4C- alkoxyethyl, phenyl, phenyl substituted by R22 and/or R23, [benzo(1,3)dioxol]-5-ylmethyl, phenyl-1 -4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R24 and/or R25,

R18 is halogen, nitro, 1-4C-alkyI, trifluoromethyl or 1-4C-alkoxy,

R19 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R20 is halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R21 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R22 is halogen, nitro, 1-4C-alkyl, 1-4C-alkylcarbonyl, trifluoromethyl or 1-4C-alkoxy,

R23 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R24 is halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R25 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R26 is R27(R28)N-2-4C-alkyl wherein

R27 and R28, together and including the nitrogen atom to which both are bonded, are a pyrrolidin-1-yl, piperidin-1-yl, piperazin-1-yl, 4-(1-4C-alkyl-)piperazin-1-yl, azepan-1yl, azocan-1-yl, azonan-1-yl, azecan-1-yl, morpholin-4-yl or thiomorpholin-4-yl radical, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

Compounds of formula 1 to be particularly emphasized are those in which

R1 is methyl,

R2 is 1-4C-alkoxy,

R3 is 1-4C-alkoxy,

R4 is hydrogen,

R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either

R6 is hydrogen,

R7 is hydrogen,

R8 is hydrogen or methoxy-2-4C-alkyl,

R9 is methoxy-2-4C-alkyl, or

R6 is hydrogen,

R7 is hydrogen, and

1-yl radical substituted in 4-position by R17, a tetrahydroisoquinolin-2-yl, tetrahydro-6,7- dimethoxyisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl, azocan-1-yl, azonan-1-yl, azecan-1-yl, 4-benzyl-piperidin-1-yl or thiomorpholin-4-yl radical, or

R6 is hydrogen,

R7 is hydrogen,

R8 is hydrogen, and

R9 is cyano, Aryll , morpholin-4-ylethyl, naphthyl, phenyl, phenyl-1-2C-alkyl, 3,4- dimethoxybenzyl or 3,4-dimethoxyphenylethyl,

in which if R5 is a radical of the formula (b), R10 is hydrogen, R11 is hydrogen, and

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pipera- zin-1-yl radical substituted in 4-position by R17, a tetrahydroisoquinolin-2-yl, tetrahydro-6,7- dimethoxyisoquinolin-2-yl, 4-benzyl-piperidin-1-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl, azocan-1-yl, azonan-1-yl or azecan-1-yl radical,

in which if R5 is a radical of the formula (c), R14 is hydrogen, and R15 and R16, together and with inclusion of the N-C(-)-N structure to which they are bonded are

Aryl2, Aryll is 4-methylthiazol-2-yl, benzimidazol-2-yl or benzothiazol-2-yI, Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1 H-imidazol-2-yl, imidazol-2-yl or benzimidazol-2-yl, R17 is acetyl, (2-hydroxyethoxy)ethyl, cyclohexyl, ethoxycarbonylmethyl, phenyl, [benzo(1 ,3)dioxol]-

5-ylmethyl, 2-methoxyphenyl, 3-trifluoromethylphenyl, 4-acetylphenyl or benzyl, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

Preferred compounds of formula 1 are those in which

R1 is methyl,

R2 is methoxy or ethoxy,

R3 is methoxy,

R4 is hydrogen,

R5 is a radical selected from

Particularly preferred compounds of formula 1 are

4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-

N-(1-methyl-4-oxo-4,5-dihydro-1H-imidazol-2-yl)-benzamide;

N-(1 -Amino-1 -azocan-1 -yl-methylene)-4-((4aR, 10bS)-9-ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b- hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-[1-(4-Acetyl-piperazin-1-yl)-1-amino-methylene]-4-((4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide;

N-{1-[4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-

6-yl)-phenyl]-methanoyl}-N'-((R)-1-phenyl-ethyl)-guanidine;

6-yl)-phenyl]-methanoyl}-N'-((S)-1-phenyl-ethyl)-guanidine;

N-[1 -Amino-1 -(4-benzyl-piperazin-1-yl)-methylene]-4-((4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-{1 -Amino-1 -[4-(2-methoxy-phenyl)-piperazin-1 -yl]-methylene}-4-( (4aR,10bS)-9-ethoxy-8-methoxy-2- methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-[1-(3,5-Dimethyl-pyrazol-1-yl)-1-imino-methyl]-4-((4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-{1-[4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1,2,3,4,4a,10b-hexahydro-benzo[c][1 ,6]naphthyridin-

6-yl)-phenyl]-methanoyl}-N'-naphthalen-1-yl-guanidine;

6-yl)-phenyl]-methanoyl}-N'-(4-methyl-thiazol-2-yl)-guanidine;

N-[1-(tetrahydroisoquinolin-2-yl)-1-imino-methyl]-4-((4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide;

N-(1 H-benzoimidazol-2-yl)-N'-{1 -[4-((4aR, 10bS)-9-ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b- hexahydro-benzo[c][1,6]naphthyridin-6-yl)-phenyl]-methanoyl}-guanidine;

N-{1-[4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a,10b-hexahydro-benzo[c][1 ,6]naphthyridin-

6-yl)-phenyl]-methanoyl}-N'-phenyI-guanidine;

N-(1-Amino-1-thiomorpholin-4-yl-methylene)-4-((4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-{1 -Amino-1 -[4-(3-trifluoromethyl-phenyl)-piperazin-1 -yl]-methylene}-4-( (4aR,10bS)-9-ethoxy-8- methoxy-2-methyl-1 , 2, 3,4,4a, 10b-hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide;

N-[1 -Amino-1 -(4-phenyl-piperazin-1 -yl)-methylene]-4-((4aR, 10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide;

N-{1-[4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1, 2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-

6-yl)-phenyl]-methanoyI}-N'-cyano-guanidine;

6-yl)-phenyl]-methanoyl}-N'-(2-morpholin-4-yl-ethyl)-guanidine; N-[2-(3,4-Dimethoxy-phenyl)-ethyl]-N'-{1 -[4-((4aR, 10bS)-9-ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b- hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-phenyl]-methanoyl}-guanidine;

N-(3,4-Dimethoxy-benzyl)-N'-{1 -[4-((4aR, 10bS)-9-ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b- hexahydro-benzo[c][1,6]naphthyridin~6-yl)-phenyl]-methanoyl}-guanidine;

N-[1 -Amino-1 -(4-benzyl-piperidin-1 -yl)-methylene]-4-((4aR, 10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-[1-Amino-1-(6,7-dimethoxy-3,4-dihydro-1H-isoquinolin-2-yl)-methylene]-4-((4aR,10bS)-9-ethoxy-8- methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N'-{1-[4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1,2,3,4,4a,10b-hexahydro- benzo[c][1 ,6]naphthyridin-6-yl)-phenyl]-methanoyl}-N,N-bis-(2-methoxy-ethyl)-guanidine;

N-(1 -Amino-1 -{4-[2-(2-hydroxy-ethoxy)-ethyl]-piperazin-1 -yl}-methylene)-4-((4aR, 10bS)-9-ethoxy-8- methoxy-2-methyl-1 ,2,3,4,4a,10b-hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide;

N-[1 -Amino-1 -(4-benzo[1 ,3]dioxol-5-ylmethyl-piperazin-1 -yl)-methylene]-4-((4aR, 10bS)-9-ethoxy-8- methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide;

N-[1 -Amino-1 -(4-cyclohexyl-piperazin-1-yl)-methylene]-4-((4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

[4-(1 -Amino-1 -{1-[4-((4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro- benzo[c][1 ,6]naphthyridin-6-yl)-phenyl]-methanoylimino}-methyl)-piperazin-1-yl]-acetic acid ethyl ester;

N-{1-[4-(4-Acetyl-phenyl)-piperazin-1-yl]-1-amino-methylene}-4-((4aR,10bS)-9-ethoxy-8-methoxy-2- methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide; the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

An embodiment (embodiment A) of the compounds of formula 1 are those in which

R1 is 1-4C-alkyl,

R2 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-a)koxy which is completely or predominantly substituted by fluorine, R3 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, or in which

R2 and R3 together are a 1-2C-alkylenedioxy group, R4 is hydrogen, halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy, R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either

R6 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyi, 3-7C-cycloalkylmethyl or hydroxy-2-4C-alkyl, R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or hydroxy-2-4C-alkyl, and R8 and R9, together and including the nitrogen atom to which both are bonded, are a piperazin- 1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydro- isoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dime- thyl-piperidin-1-yl, thiomorpholin-4-yl or 1 H-1,2,4-triazol-1-yl radical, or

R6 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or hydroxy-2-4C-alkyi, R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloaIkyl, 3-7C-cycloalkylmethyl or hydroxy-2-4C-alkyl, R8 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or hydroxy-2-4C-alkyl, and R9 is Aryll, naphthyl, phenyl, phenyl substituted by R18 and/or R19, phenyl-1-4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R20 and/or R21 ,

in which if R5 is a radical of the formula (b), either

R10 and R11 independently of one another are hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cy- cloalkylmethyl or hydroxy-2-4C-alkyl, and

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pipera- zin-1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydroisoquinolin-2-yl, 3,5-dimethyl-pyrazo!-1 -yl, pyrazol-1 -yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, thiomorpholin-4-yl or 1H-1 ,2,4-triazol-1-yl radical, or

R10 and R11 , together and including the nitrogen atom to which both are bonded, are a 2,6-di- methyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl or thiomorpholin-4-yl radical, and R12 and R13, together and including the nitrogen atom to which both are bonded, are a pyrroli- din-1-yl, piperidin-1-yl, hexahydroazepin-1-yl, morpholin-4-yl, 4-(1-4C-alkyl-)-piperazin-1-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl or thiomorpholin-4-yl radical,

in which if R5 is a radical of the formula (c),

R14 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or hydroxy-2-4C-alkyl, and

Aryl2, Aryll is 4-methylthiazol-2-yl, benzimidazol-2-yl, 5-nitrobenzimidazol-2-yl, 5-chiorobenzimidazol-2-yl,

5-methylbenzimidazol-2-yl, 4-methylquinazolin-2-yl, benzothiazol-2-yl, benzoxazol-2-yl or pyrimi- din-2-yl, Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1H-imidazol-2-yl, imidazol-2-yl, 4,5-dicyano-imidazol-2-yl, 4-me- thyl-imidazol-2-yl, 4-ethyl-benzimidazol-2-yl, 4-acetyl-imidazol-2-yl, 1H-[1 ,2,4]triazol-3-yl, benz- imidazol-2-yl, 1 -methyl-benzimidazol-2-yl, 1 -ethyl-benzimidazol-2-yl, 5,6-dimethyl-benzimidazol- 2-yl, purin-8-yl, 6-amino-7-methyl-7H-purine-8-yl, 1 ,6-dimethylimidazo[4,5-b]pyridin-2-yl, 1 ,5,6- trimethylimidazo[4,5-b]pyridin-2-yl, 1 ,3-dimethyl-3,7-dihydro-1 H-purine-2,6-dione-8-yl, 7-ethyl-3- methyl-3,7-dihydro-purine-2,6-dione-8-yl, 1,3,7-trimethyl-3J-dihydro-purine-2,6-dione-8-yl, thia- diazolyl, 1,4-dihydrotetrazol-5-yl, 2H-[1,2,4]triazol-3-yl, 1 ,3-dihydrobenzimidazol-5-yl, 1 H-tetrazol- 5-yl, pyrimidin-2-yl or 4,6-dimethyl-pyrimidin-2-yl,

R17 is formyl, 1-4C-alkylcarbonyl, 2-hydroxyethyl, phenyl, phenyl substituted by R22 and/or R23, phenyI-1-4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R24 and/or R25,

R18 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R19 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R20 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R21 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R22 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R23 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R24 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R25 is halogen, 1-4C-alkyl or 1-4C-alkoxy, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

Compounds of formula 1 of embodiment A to be emphasized are those in which

R1 is 1-4C-alkyl,

R2 is 1-4C-alkoxy, 3-6C-cycloalkoxy, 3-6C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R3 is 1-4C-alkoxy, 3-6C-cycloalkoxy, 3-6C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R4 is hydrogen, halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy, R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either

R6 is hydrogen, R7 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and R8 and R9, together and including the nitrogen atom to which both are bonded, are a piperazin- 1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydro- isoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl, 2,6-dimethyl-morpholin-4-yl or 2,6-dime- thyl-piperidin-1-yl radical, or

R6 is hydrogen,

R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,

R8 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and

R9 is Aryll, naphthyl, phenyl, phenyl substituted by R18 and/or R19, phenyl-1-4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R20 and/or R21 ,

in which if R5 is a radical of the formula (b), either

R10 and R11 independently of one another are hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or

3-7C-cycloalkylmethyl, and

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pipera- zin-1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahy- droisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl, 2,6-dimethyl-morpholin-4-y! or 2,6-di- methyl-piperidin-1-yl radical, or

R10 and R11, together and including the nitrogen atom to which both are bonded, are a 2,6-di- methyl-morpholin-4-yl or 2,6-dimethyl-piperidin-1-yl radical, and

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pyrroli- din-1-yl, piperidin-1-yl, hexahydroazepin-1-yl, morpholin-4-yl, 4-(1-4C-alkyl-)-piperazin-1-yl,

2,6-dimethyl-morpholin-4-yl or 2,6-dimethyl-piperidin-1-yl radical,

in which if R5 is a radical of the formula (c), R14 is hydrogen, and

R15 and R16, together and with inclusion of the N-C(-)-N structure to which they are bonded are Aryl2,

Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1 H-imidazol-2-yl, imidazol-2-yl, 4,5-dicyano-imidazol-2-yl, 4-me- thyl-imidazol-2-yl, 4-ethyl-benzimidazol-2-yl, 4-acetyl-imidazol-2-yl, 1H-[1,2,4]triazol-3-yl, benz- imidazol-2-yl, 1 -methyl-benzimidazol-2-yl, 1 -ethyl-benzimidazol-2-yl, 5,6-dimethyl-benzimidazol- 2-yl, purin-8-yl, 6-amino-7-methyl-7H-purine-8-yl, 1 ,6-dimethylimidazo[4,5-b]pyridin-2-yl, 1,5,6- trimethylimidazo[4,5-b]pyridin-2-yl, 1 ,3-dimethyl-3,7-dihydro-1 H-purine-2,6-dione-8-yl, 7-ethyl-3- methyl-3,7-dihydro-purine-2,6-dione-8-yl, 1 ,3,7-trimethyl-3,7-dihydro-purine-2,6-dione-8-yl or

1 H-[1 ,2,4]triazol-3-yl, R17 is formyl, 1-4C-alkylcarbonyl, 2-hydroxyethyl, phenyl, phenyl substituted by R22 and/or R23, phenyl-1-4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R24 and/or R25, R18 is halogen, nitro, 1-4C-alkyl or 1-4C-alkoxy, R19 is halogen, 1-4C-aikyl or 1-4C-alkoxy, R20 is halogen, nitro, 1-4C-alkyl or 1-4C-alkoxy, R21 is halogen, 1-4C-alkyl or 1-4C-aIkoxy, R22 is halogen, nitro, 1-4C-alkyl or 1-4C-alkoxy, R23 is halogen, 1-4C-alkyl or 1-4C-alkoxy, R24 is halogen, nitro, 1-4C-alkyl or 1-4C-alkoxy, R25 is halogen, 1-4C-alkyl or 1-4C-alkoxy, the salts of these compounds, as well as the enantiomers, E/Z isomers and tautomers of these compounds and their salts.

Compounds of formula 1 of embodiment A particularly to be emphasized are those in which

R1 is methyl,

R2 is 1-4C-alkoxy,

R3 is 1-4C-alkoxy,

R4 is hydrogen,

R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either

R6 is hydrogen,

R7 is hydrogen, and

1 -yl radical substituted in 4-position by R17, a tetrahydroisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1- yl, pyrazol-1-yl, azocan-1-yl, azonan-1-yl or azecan-1-yl radical, or

R6 is hydrogen,

R7 is hydrogen, and

R8 is, hydrogen or 1-4C-alkyl, and R9 is Aryll , naphthyl or phenyl-1-2C-aikyl,

in which if R5 is a radical of the formula (b),

R10 is hydrogen or 1-4C-alkyl,

R11 is hydrogen or 1-4C-alkyl, and

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pipera- zin-1-yl radical substituted in 4-position by R17, a tetrahydroisoquinolin-2-yl, 3,5-dimethyl-pyra- zol-1-yl, pyrazol-1-yl, azocan-1-yl, azonan-1-yl or azecan-1-yl radical,

in which if R5 is a radical of the formula (c),

R14 is hydrogen, and

Aryl2, Aryll is 4-methylthiazol-2-yl or benzothiazol-2-yl, Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1H-imidazol-2-yl, imidazol-2-yl, 4-methyl-imidazol-2-yl, 4-ethyl- benzimidazol-2-yl, 4-acetyl-imidazol-2-yl, benzimidazol-2-yl, 1-methyl-benzimidazol-2-yl, 1-ethyl- benzimidazol-2-yl or 5,6-dimethyl-benzimidazol-2-yl, R17 is acetyl, 2-methoxyphenyl or benzyl, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

Preferred compounds of formula 1 of embodiment A are those in which

R1 is methyl,

R2 is methoxy or ethoxy,

R3 is methoxy,

R4 is hydrogen,

R5 is N-(1-methyl-4-oxo-4,5-dihydro-1 H-imidazol-2-yl)-amino, N-(1-amino-1-azocan-1-yl-methyle- ne)-amino, N-[1-(4-acetylpiperazine-1-yl)-1-amino-methylene]-amino, N-(N'-(R)-1-phenylethyl)- guanidinyl, N-(N'-(S)-1-phenylethyl)guanidinyl, N-[1 -amino-1 -(4-benzylpiperazine-1-yl)-methyle- ne]-amino, N-[1 -amino-1 -(2-methoxy-phenyl-piperazin-1-yl)-methylene]-amino, N-[1-(3,5-dimeth- yl-pyrazoI-1 -yl)-1 -imino-methyl]-amino , N-(N'-naphthalene-1 -yl)guanidinyl, N-(N'-4-methylthia- zol-2-yl)guanidinyl or N-[1 -(tetrahydroisoquinoline-2-yl)-1 -imino-methyl]-amino, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

Another embodiment (embodiment B) of the compounds of formula 1 are those in which R1 is 1-4C-alkyl, R2 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R3 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, or in which

R2 and R3 together are a 1-2C-alkylenedioxy group, R4 is hydrogen, halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy, R5 is a radical of the formula (a)

in which either

R6, R7, R8 and R9 independently of one another are hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl,

3-7C-cycloaIkylmethyl, cyano, hydroxy-2-4C-alkyl, 1-4C-alkoxy-2-4C-alkyl or R26, with the proviso that at least one of R6, R7, R8 and R9 is 1-4C-alkoxy-2-4C-alkyl, or

R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, hydroxy-2-4C-alkyl, 1-4C- alkoxy-2-4C-alkyl or R26, and

R8 and R9, together and including the nitrogen atom to which both' are bonded, are a piperazin-

1-yl radical substituted in 4-position by R17, a tetrahydro-6,7-dimethoxyisoquinolin-2-yl or a 4- benzyl-piperidin-1-yl radical, or

R8 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, hydroxy-2-4C-alkyl, 1-4C- alkoxy-2-4C-alkyl or R26, and

R9 is cyano or R26, and

R17 is 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, 1-4C-alkoxycarbonyl-1-4C-alkyl, 1-4C-alkoxy-2-4C- alkyl, hydroxy-2-4C-alkoxy-2-4C-alkyl, 1-4C-alkoxy-2-4C-alkoxy-2-4C-alkyl, 1-4C- alkylcarbonylphenyl or [benzo(1,3)dioxol]-5-ylmethyl, R26 is R27(R28)N-2-4C-alkyl wherein

R27 and R28, together and including the nitrogen atom to which both are bonded, are a pyrrolidin-1-yl, piperidin-1-yl, piperazin-1-yl, 4-(1-4C-alkyl-)piperazin-1-yl, azepan-1yl, azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydroisoquinolin-2-yl, tetrahydro-6,7-dimethoxyisoquinolin-2-yl, 3,5-dimethyl- pyrazol-1-yl, pyrazol-1-yl, morpholin-4-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, 4-benzyl-piperidin-1-yl, thiomorphoIin-4-yl or 1 H-1 ,2,4-triazol-1-yl radical, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

Compounds of formula 1 of embodiment B to be emphasized are those in which

R1 is 1-4C-a)kyl,

R2 is 1-40-alkoxy, 3-60-cycloalkoxy, 3-60-cycloalkylmethoxy, or 1-40-alkoxy which is completely or predominantly substituted by fluorine, R3 is 1-40-alkoxy, 3-60-cycloalkoxy, 3-60-cycloalkylmethoxy, or 1-40-alkoxy which is completely or predominantly substituted by fluorine, R4 is hydrogen, halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-40-alkoxy, R5 is a radical of the formula (a)

in which either

R6 is hydrogen,

R7 is hydrogen,

R9 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or 1-4C-alkoxy-2-4C-alkyl, with the proviso that at least one of R8 or R9 is 1-4C-alkoxy-2-4C-alkyl, or

R6 is hydrogen,

R7 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and

1 -yl radical substituted in 4-position by R17, a tetrahydro-6,7-dimethoxyisoquinolin-2-yl or a

4-benzyl-piperidin-1-yl radical, or

R6 is hydrogen, R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, R8 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and R9 is cyano or R26, and

R17 is 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, 1-4C-alkoxycarbonyl-1-4C-aIkyl, 1-2C-alkoxyethyl, hydroxy-2-4C-alkoxyethyl, 1-2C-alkoxy-2-4C-alkoxyethyl, 1-4C-alkylcarbonylphenyl or

[benzo(1 ,3)dioxol]-5-ylmethyl, R26 is R27(R28)N-2-4C-alkyl wherein R27 and R28, together and including the nitrogen atom to which both are bonded, are a pyrrolidin-1-yl, piperidin-1-yl, piperazin-1-yl, 4-(1-4C-alkyl-)piperazin-1-yl, azepan-1yl, azocan-1-yl, azonan-1-yl, azecan-1-yl, morpholin-4-yl or thiomorpholin-4-yl radical, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

Compounds of formula 1 of embodiment B particularly to be emphasized are those in which

R1 is methyl,

R2 is 1-40-alkoxy,

R3 is 1-40-alkoxy,

R4 is hydrogen,

R5 is a radical of the formula (a)

in which either

R6 is hydrogen,

R7 is hydrogen,

R8 is hydrogen or methoxy-2-4C-alkyl,

R9 is methoxy-2-4C-alkyl, or

R6 is hydrogen,

R7 is hydrogen, and

1-yl radical substituted in 4-position by R17, a tetrahydro-6,7-dimethoxyisoquinolin-2-yl or a 4- benzyl-piperidin-1-yl radical, or R6 is hydrogen,

R7 is hydrogen,

R8 is hydrogen, and

R9 is cyano or morpholin-4-ylethyl, and

R17 is (2-hydroxyethoxy)ethyl, cyclohexyl, ethoxycarbonylmethyl, [benzo(1 ,3)dioxol]-5-ylmethyl or 4- acetylphenyl, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

Preferred compounds of formula 1 of embodiment B are

6-yl)-phenyl]-methanoyl}-N'-cyano-guanidine;

N-{1 -[4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1, 2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-

6-yl)-phenyl]-methanoyl}-N'-(2-morpholin-4-yl-ethyl)-guanidine;

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide;

N-[1 -Amino-1 -(6,7-dimethoxy-3,4-dihydro-1 H-isoquinolin-2-yl)-methylene]-4-((4aR, 10bS)-9-ethoxy-8- methoxy-2-methyl-1,2,3,4,4a,10b-hexahydro-benzotc][1,6]naphthyridin-6-yl)-benzamide;

N-(1-Amino-1-{4-[2-(2-hydroxy-ethoxy)-ethyl]-piperazin-1-yi}-methylene)-4-((4aR,10bS)-9-ethoxy-8- methoxy-2-methyl-1, 2, 3,4,4a, 10b-hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide;

N-[1-Amino-1-(4-benzo[1,3]dioxol-5-ylmethyl-piperazin-1-yl)-methylene]-4-((4aR,10bS)-9-ethoxy-8- methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-[1 -Amino-1 -(4-cyclohexyl-piperazin-1 -yl)-methylene]-4-((4aR, 10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

[4-(1 -Amino-1 -{1 -[4-((4aR, 10bS)-9-ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro- benzo[c][1 ,6]naphthyridin-6-yl)-phenyl]-methanoylimino}-methyl)-piperazin-1-yl]-acetic acid ethyl ester;

N-{1-[4-(4-Acetyl-phenyl)-piperazin-1-yl]-1-amino-methylene}-4-((4aR,10bS)-9-ethoxy-8-methoxy-2- methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide; the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

A special embodiment of the compounds of the present invention include those compounds of formula 1 , in which R1 is methyl, R2 is ethoxy and R3 is methoxy.

Another special embodiment of the compounds of the present invention include those compounds of formula 1 in which R1 is methyl, R2 is ethoxy, R3 is methoxy and R4 is hydrogen. Still another special embodiment of the compounds of the present invention include those compounds of formula 1 in which R1 is methyl, R2 is ethoxy, R3 is methoxy, R4 is hydrogen and the radical -C(0)-R5 is attached to the 6-phenyl-ring in para-position.

A further special embodiment of the compounds of the present invention include those compounds of formula 1 in which R1 is methyl, R2 is ethoxy, R3 is methoxy, R4 is hydrogen, the radical -C(0)-R5 is attached to the 6-phenyl-ring in para-position and R5 is a radical of formulae (a) or (b).

Still a further special embodiment of the compounds of the present invention include those compounds of formula 1 in which R1 is methyl, R2 is ethoxy, R3 is methoxy, R4 is hydrogen, the radical -C(0)-R5 is attached to the 6-phenyl-ring in para-position and R5 is a radical of formula (c).

The compounds of formula 1 are chiral compounds having chiral centers in positions 4a and 10b

Numbering: (1)

The invention therefore includes all conceivable pure diastereomers and pure enantiomers and mixtures thereof in any mixing ratio, including the racemates. Preference is given to compounds of formula 1 in which the hydrogen atoms in positions 4a and 10b are in the cis position relative to one another. The pure cis enantiomers and their mixtures in any mixing ratio and including the racemates are particularly preferred.

The most preferred compounds in this context are those compounds of formula 1, which have with respect to the positions 4a and 10b the configuration shown in formula (1*):

The enantiomers can be separated in a known manner (for example by preparing and separating corresponding diastereoisomeric compounds) or by stereoselective synthesis methods. Such separation processes and synthesis methods are described, for example, in EP 247 971 and in DE 42 17401.

The compounds according to the invention can be prepared, for example, as shown in the reaction schemes below.

Reaction scheme 1: In a first reaction step, compounds of formula 7, in which R1 , R2 and R3 have the meanings given above, are reacted with compounds of formula 6, in which R4 has the meaning given above, R is, for example, 1-4C-alkyl and X is a suitable leaving group, for example a chlorine atom. This benzoylation is carried out, for example, according to the Einhorn process, the Schotten-Baumann variant or as described in J. Chem. Soc. C, 1971, 1805-1808.

The preparation of cis/trans racemate mixtures and of pure cis racemates of compounds of formula 7 is described, for example, in USP 3,899,494, in DE-A 21 23 328 and in DE-A 16 95 782. Pure cis enantiomers of the compounds of formula 7 can be obtained, for example, by the processes disclosed in EP 0 247 971 and in DE 42 17 401.

Compounds of formula 6 are known or can be prepared by known processes such as, for example, the process shown in reaction scheme 2.

The compounds of formula 4 are obtained by cyclocondensation of the compounds of formula 5 obtained in the first reaction step.

The cyclocondensation is carried out in a manner known per se to the person skilled in the art according to Bischler-Napieralski (e.g. as described in J. Chem. Soc, 1956, 4280-4282) in the presence of a suitable condensing agent, such as, for example, polyphosphoric acid, phosphorus pentachloride, phosphorus trichloride, phosphorus pentoxide, thionyl chloride or preferably phosphorus oxytrichloride, in a suitable inert solvent, e.g. in a chlorinated hydrocarbon such as chloroform, or in a cyclic hydrocarbon such as toluene or xylene, or another inert solvent such as acetonitrile, or without a further solvent using an excess of condensing agent, preferably at elevated temperature, in particular at the boiling point of the solvent or condensing agent used.

Starting with the compounds of formula 4, the compounds of formula 1 can be obtained by different routes. On the one hand, the compounds of formula 1 can be obtained from the compounds of formula 4 by direct reaction with compounds of formula R5-H, in which R5 has the meanings given above.

Reaction scheme 1 :

Furthermore, it is possible to additionally activate the benzoic acid derivatives of formula 3 prior to the reaction with compounds of the formula R5-H, for example by forming an acid halide or acid anhydride, or by using coupling agents known to the person skilled in the art, such as, for example, N,N'-dicyclo- hexylcarbodiimide or N'-(3-dimethylaminopropyl)-N-ethylcarbodiimide (compounds of formula 2).

It is also possible to obtain compounds of formula 1 from compounds of formula 2 by initially reacting the compounds of formula 2 in which Y is, for example, a chlorine atom with suitably substituted S-alkyl-isothioureas and then, in a second step, replacing the S-alkyl group by a suitably substituted amine.

1. S-Alkylisothiourea

2. Amine

Similar reactions are described, for example in Arzneim.-Forsch. (Drug Res.) 25, No. 10, (1975), pp. 1477-1482 or in the following examples.

The preparation of compounds of the formula 4, in which R1 , R2 and R3 have the meanings given above and R is 1-4C-alkyl and of benzoic acid derivatives of formula 3, in which R1 , R2 and R3 have the meanings given above, is also described in the international application WO98/21208.

An alternative synthesis route for compounds of formula 1 is shown in reaction scheme 2.

Starting with a suitably substituted phthalic acid, isophthalic acid or terephthalic acid monoester derivative (compounds of formula 12), the acid group is initially activated, for example by forming an acid halide (compounds of formula 6). Reaction scheme 2:

The acid halide (compounds of formula 6) is then reacted with compounds of the formula R5-H, in which R5 has the meanings given above. The ester group of the resulting guanidine derivatives (compounds of formula 11) is hydrolyzed and the resulting acids (compounds of formula 10) are activated, for example by conversion into an acid halide (compounds of formula 9).

In the next reaction step, compounds of formula 7, in which R1 , R2 and R3 have the meanings given above are benzoylated with the compounds of formula 9. Again, this benzoylation is carried out, for example, by the Einhorn process, the Schotten-Baumann variant or as described in J. Chem. Soc. (C), 1971, 1805-1808.

The final cyclocondensation of the compounds of formula 8 obtained by the benzoylation affords the compounds of formula 1.

The compounds of formula 1 prepared by the processes described above can then, if desired, be converted into their salts, or salts of the compounds of formula 1 obtained can then, if desired, be converted into the free compounds. Corresponding processes are known to the person skilled in the art.

Suitably substituted phthalic acid, isophthalic acid or terephthalic acid monoester derivatives (compounds of formula 6 or 12) are either known or can be prepared by methods known to the person skilled in the art. Exemplary compounds of formula 6 which may be mentioned are methyl 4-chloro- carbonylbenzoate (preparation described in J. Amer. Chem. Soc. 79, (1957), 96 or in Bioorg. Med. Chem. Lett. 1999, 227-232) and methyl 3-chlorocarbonylbenzoate (preparation described in J. Med. Chem. 1999, 2621-2632).

It is also known to the person skilled in the art that, if a plurality of reactive centers are present in a starting material or intermediate, it may be necessary to temporarily block one or more reactive centers with protective groups so that a reaction takes place only at the desired reactive center. A detailed description of how to use a large number of proven protective groups can be found, for example, in T.W. Greene, Protective Groups in Organic Synthesis, John Wiley & Sons, 1991.

The substances according to the invention are isolated and purified in a manner known per se, for example by distilling off the solvent under reduced pressure and recrystallizing the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as, for example, column chromatography on a suitable support material.

Salts are obtained by dissolving the free compound in a suitable solvent (e.g. a ketone, such as acetone, methyl ethyl ketone or methyl isobutyl ketone, an ether, such as diethyl ether, tetrahydrofuran or dioxane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or a low-molecular- weight aliphatic alcohol, such as ethanol or isopropanol) which contains the desired acid or base, or to which the desired acid or base is then added. The salts are obtained by filtering, reprecipitating, precipitating with a nonsolvent for the addition salt or by evaporating the solvent. Salts obtained can be converted into the free compounds, which can in turn be converted into salts, by alkalization or by acidification. In this manner, pharmacologically unacceptable salts can be converted into Pharmacologically acceptable salts.

The following examples serve to illustrate the invention in greater detail without restricting it. Further compounds of formula 1 , whose preparation is not explicitly described, can also be prepared in an analogous manner or in a manner familiar per se to the person skilled in the art using customary process techniques.

In the examples, m.p. stands for melting point, h for hour(s), RT for room temperature, EF for empirical formula and MW for molecular weight. The compounds mentioned in the examples and their salts are a preferred subject of the invention.

Examples

End products

1. 4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3.4,4a.1 Ob-hexahydro-benzo n ,61- naphthyridin-6-vπ-N-(1-methyl-4-oxo-4,5-dihvdro-1H-imidazol-2-vH-benzamide

2.6 ml of diisopropyl amine are added to a suspension of 1.2 g 4-((4aR,10bS)-9-ethoxy-8-methoxy-2- methyl-1 ,2,3,4,4a, 10b-hexahydrobenzo[c][1 ,6]naphthyridin-6-yl)benzoic acid in 50 ml of acetonitrile. The reaction mixture is stirred at RT for 30 min and then 1.5 g of 0-(Benzotriazol-1-yl)-N,N,N',N'-tetrame- thyluroniumhexafluoro-phosphate (HBTU) are added, yielding a clear light-brown solution. This solution is added to a suspension of 0.41 g of creatinine in a mixture of 50 ml acetonitrile and 2.6 ml of diisopropyl amine. The reaction mixture is stirred at RT overnight and filtered. The filtrate is substantially concentrated under reduced pressure, and the highly viscous residue is partitioned between dichlorometha- ne and saturated sodium bicarbonate solution. The organic phase is washed with water, dried over sodium sulfate and concentrated. The resin-like residue is purified by silica gel chromatography, and the product fraction is separated off and concentrated. This gives 0.33 g of the title compound as solid foam.

MS: calc: C₂₇ H₃₁ N₅ 0₄( 489.58) fnd.: [M+1] 490.2

2. N-(1 -Amino-1 -azocan-1 -yl-methylene)-4-((4aR.10bSI-9-ethoxy-8-methoxy-2-methyl- 1.2.3.4.4a.10b-hexahvdro-benzorclH.61naphthyridin-6-yl)-benzamide

A suspension of 0.5 g 1-{1-[4-(4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10bhexahydro-ben- zo[c][1 ,6]naphthyridin-6-yl)-phenyl]-methanoyl}-2-methyl-isothiourea and 0.4 ml of heptamethyleneimine in a mixture of 20 ml toluene and 0.5 ml triethylamine is stirred at 80°C for 4 days. The brownish yellow suspension is concentrated in vacuo and the brown residue is dissolved in 100 ml of dichloromethan. The organic phase is washed successively with saturated aqueous NaH0O₃ (30 ml each) three times, dried over Na₂S0₄ and concentrated in vacuo to give 0.8 g of soft foam. The crude product is purified by silica gel chromatography, and the product fraction is separated off and concentrated. This gives 0.38 g of the title compound as solid foam.

MS: calc: C₃₁ H₄₁ N₅ 0₃ ( 531.70) fnd.: [M+1] 532.3

Analogously to example 2, the following title compounds are obtained when, instead of heptamethyleneimine, the respective appropriately substituted amines are used as reaction partners: 3. N-ri-(4-Acetyl-piperazin-1-vH-1-amino-methylene1-4-(I4aR.10bSI-9-ethoxy-8-methoxy-2- methyl-1 ,2,3.4.43.10b-hexahvdro-benzoMn.61naphthyridin-6-yl)-benzamide

MS: calc: C₃₀ H₃₈ N₆ O₄( 546.68) fnd.: [M+1] 547.2

4. N-11 -f4-((4aR,10bSI-9-Ethoxy-8-methoxy-2-methyl-1.2.3.4.4a,1 Ob-hexahydro-benzoMri .61- naphthyridin-6-vπ-phenvn-methanoyl)-N'- (R)-1-phenyl-ethylI-αuanidine

MS: calc: C₃₂ H₃₇ N₅ 0₃ ( 539.68) fnd.: [M+1] 540.3

5. N-H-r4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1.2.3.4.4a.10b-hexahvdro-benzorcin.61- naphthyridin-6-vπ-phenvn-methanoyl)-N'-((S)-1-phenyl-ethvπ-quanidine

MS: calc: C₃₂ H₃₇ N₅ 0₃ ( 539.68) fnd.: [M+1] 540.2

6. N-li -Amino-1 -(4-benzyl-piperazin-1 -yl)-methylene1-4-((4aR,10bS)-9-ethoxy-8-methoxy-2- methyl-1,2.3,4.4a,10b-hexahvdro-benzorciri,6lnaphthyridϊn-6-vH-benzamide

MS: calc: C₃₅ H₄₂ N₆ 0₃( 594.76) fnd.: [M+1] 595.2

7. N-f1-Amino-1-r4-(2-methoxy-phenyl)-piperazin-1-vn-methylene)-4-((4aR,10bS)-9-ethoxy-8- methoxy-2-methyl-1,2,3,4,4a,10b-hexahvdro-benzorc1f1,61naphthyridin-6-yl)-benzamide

MS: calc: C₃₅ H₄₂ N₆ 0₄ ( 610.76) fnd.: [M+1] 611.3

Analogously to example 1, the following title compounds are obtained when, instead of creatinine, the respective appropriately substituted guanidines are used as reaction partners:

8. N-ri-(3,5-Dimethyl-pyrazol-1-yl)-1-imino-methvn-4-((4aR.10bS)-9-ethoxy-8-methoxy-2-me- thyl-1,2.3,4,4a.10b-hexahvdro-benzorciri.6Inaphthyridin-6-yl)-benzamide

MS: calc: C₂₉ H₃₄ N₆ 0₃ ( 514.63) fnd.: [M+1] 515.3

9. N-(1-r4-((4aR.10bS)-9-Ethoxy-8-methoxy-2-methvi-1,2,3Λ4a,10b-hexahvdro-benzorciri.61- naphthyridin-6-vπ-phenvn-methanoyl)-N'-naphthalen-1-yl-guanidine

MS: calc: C₃₄ H₃₅ N₅ 0₃( 561.69) fnd.: [M+1] 562.2 10. N-f1-r4- (4aR.10bSI-9-Ethoxy-8-methoxy-2-methyl-1.2.3.4.4a.10b-hexahvdro-benzoMn.61- naphthyridin-6-yl)-phenvn-methanoyl)-N'-(4-methyl-thiazol-2-vπ-guanidine

MS: calc: C₂₈ H₃₂ N₆ 0₃ S ( 532.67) fnd.: [M+1] 533.2

11. N-ri-(tetrahvdroisoquinolin-2-vπ-1-imino-methvn-4-((4aR.10bS>-9-ethoxy-8-methoxy-2-me- thyl-1,2.3,4.4a,10b-hexahvdro-benzorciπ,61naphthyridin-6-yl>-benzamide

MS: calc: C₃₃ H₃₇ N₅ 0₃ ( 551.69) fnd.: [M+1] 552.4

12. N-11 H-benzoimidazol-2-vn-N'-(1 -r4-(f 4aR.10bSI-9-ethoxy-8-methoxy-2-methyl- 1.2,3.4.4a.10b-hexahvdro-benzofc1f1.61naphthyridin-6-vπ-phenvn-methanoyl>-quanidine

MS: calc: C₃₁ H₃₃ N₇ 0₃ (551.65) fnd.: [M+1] 552.8

13. N-f 1 -r4-((4aR.10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4.4a,1 Ob-hexahydro- benzorc1f1.61naphthyridin-6-vπ-phenvπ-methanoylVN'-phenyl-quanidine

MS: calc: C₃₀ H_{33 5} O₃ (511.63) fnd.: [M+1] 512.3

14. N-(1 -Amino-1 -thiomorpholin-4-yl-methylene)-4-((4aR,10bS)-9-ethoxy-8-methoxy-2- methyl-1,2.3.4.4a.10b-hexahvdro-benzorciri.6lnaphthyridin-6-yl)-benzamide

MS: calc: C₂₈ H₃₅ N₅0₃ S (521.6) fnd.: [M+1] 522.2

15. N-11 -Amino-1 -r4-(3-trif luoromethyl-phenylI-piperazin-1 -vπ-methylene)-4-((4aR,10bS>-9- ethoxy-8-methoxy-2-methyl-1.2,3,4.4a,10b-hexahvdro-benzofc1f1,61naphthyridin-6-yl)- benzamide

MS: calc: C₃₅ H₃₉ F₃ N₆ 0₃ (648.73) fnd.: [M+1] 649.6

16. N-[1 -Amino-1 -(4-phenyl-piperazin-1 -vπ-methylenel-4-((4aR.1 ObS ι-9-ethoxy-8-methoxy-2- methyl-1.2.3.4.4a.10b-hexahvdro-benzofciri.61naphthyridin-6-vπ-benzamide

MS: calc: C₃₄ H₄₀ N₆0₃ (580.74) fnd.: [M+1] 581.3 17. N-f1-I4-((4aR.10bSI-9-Ethoxy-8-methoxy-2-methyl-1.2.3.4.4a.10b-hexahvdro- benzoMf1.61naphthyridin-6-ylI-phenvn-methanoyl)-N'-cyano-quanidine

MS: calc: C₂₅ H₂₈ N₆ 0₃ (460.54) fnd.: [M+1] 461.3

18. N-f1-r4-((4aR.10bSI-9-Ethoxy-8-methoxy-2-methyl-1.2,3.4.4a.10b-hexahvdro- benzorciri.61naphthyridin-6-yl)-phenvn-methanoylV-N'-(2-morpholin-4-yl-ethyl)-quanidine

MS: calc: C₄₀ H₂₈ N₆ 0₄ (548.69) fnd.: [M+1] 549.1

19. N-r2-(3,4-Dimethoxy-phenvn-ethvπ-N'-f1-r4-((4aR.10bSI-9-ethoxy-8-methoxy-2-methyl- 1.2.3.4,4a.10b-hexahvdro-benzorcin,6lnaphthyridin-6-vn-phenvn-methanoylVquanidine

MS: calc: C₄₁ H₂₈ N₅ 0₅ (599.74) fnd.: [M+1] 600.1

20. N-(3.4-Dimethoxy-benzvπ-N'-(1-r4-((4aR,10bSI-9-ethoxy-8-methoxy-2-methyl-

1.2.3,4,4a.10b-hexahvdro-benzorciri.6lnaphthyridin-6-yl)-phenvn-methanoyl -quanidine

MS: calc: C₃₃ H₃₉ N₅ 0₅ (585.71) fnd.: [M+1] 586.1

21. N-f1-Amino-1-(4-benzyl-piperidin-1-ylI-methylene1-4-f(4aR,10bS)-9-ethoxy-8-methoxy-2- methyl-1, 2.3,4.4a.10b-hexahydro-benzorciri.61naphthyridirι-6-vπ-benzamide

MS: calc: C₃₆ H₄₃ N₅ 0₃ (593.78) fnd.: [M+1] 594.3

22. N-ri-Amino-1- 6.7-dimethoxy-3,4-dihvdro-1H-isoquinolin-2-vH-methylene1-4-((4aR.10bS)- 9-ethoxy-8-methθ3{V-2-methyl-1.2,3,4.4a.10b-hexahvdro-benzofciri.61naphthyridin-6-vπ- benzamide

MS: calc: C₃₅ H₄₁ N₅ 0₅ (611.75) fnd.: [M+1] 612.3

23. N'-(1 -l4-i (4aR.10bSI-9-Ethoxy-8-methoxy-2-methyl-1.2.3.4.4a.1 Ob-hexahvdro- benzorciri.61naphthyridin-6-vπ-phenvn-methanoyl)-N.N-bis-(2-methoxy-ethyl)-guanidine

MS: calc: C₃₀ H₄₁ N₅ 0₅ (551.69) fnd.: [M+1] 552.4 24. N-11 -Amino-1 -T4-r2-(2-hvdroxy-ethoxy)-ethvn-piperazin-1-yl)-methylene)-4-((4aR.10bSI-9- ethoxy-8-methoxy-2-methyl-1.2.3.4.4a.10b-hexahvdro-benzoMI1.61naphthyridin-6-vH- benzamide

MS: calc: C₃₂ H₄₄ N₆ 0₅ (592.74) fnd.: [M+1] 593.3

25. N-n -Amino-1 -(4-benzoM .31dioxol-5-ylmethyl-piperazϊn-1 -vD-methylene1-4-((4aR,10bSI-9- ethoxy-8-methoxy-2-methyl-1.2.3.4.4a.10b-hexahvdro-benzorciri,61naphthyridin-6-ylI- benzamide

MS: calc: C₃₆ H₄₂ N₆ 0₅ (638.77) fnd.: [M+1] 639.3

26. N-f 1 -Amino-1 -(4-cvclohexyl-piperazin-1 -yl)-methylene1-4-( (4aR.1 ObSI-g-ethoxy-8- methoxy-2-methyl-1.2.3.4.4a,10b-hexahvdro-benzo ri.61naphthyridin-6-vH-benzamide

MS: calc: 0^ H₄₆ N₆ 0₃ (586.78) fnd.: [M+1] 587.3

27. I4-(1 -Amino-1 1 -r4-((4aR,10bSI-9-ethoxy-8-methoxy-2-methvM ,2.3,4.4a,1 Ob-hexahvdro- benzorc1f1,61naphthyridin-6-vπ-phenyll-methanoviiminoVmethvπ-piperazin-1-vn-acetic acid ethyl ester

MS: calc: C₃₂ H₄₂ N₆ 0₅ (590.73) fnd.: [M+1] 591.3

28. N-f1-r4-(4-Acetyl-phenvπ-piperazin-1-vπ-1-amino-methylene -4-((4aR,10bS)-9-ethoxy-8- methoxy-2-methyl-1.2.3.4.4a.10b-hexahvdro-benzorciri.6Inaphthyridin-6-yl)-benzamide

MS: calc: C₃₆ H₄₂ N₆ 0₄ (622.77) fnd.: [M+1] 623.4

Startinq materials

A. 1-(1-r4-(4aR.10bS)-9-Ethoxy-8-methoxy-2-methvi-1.2.3.4.4a.10b-hexahvdro-benzo n.61- naphthyridin-6-yl)-phenvπ-methanoyl)-2-methyl-isothiourea

Over a period of about 5 min at RT, 12.3 g O-benzotriazol-1-yl-tetramethyluronium hexafluorophospha- te are added to a suspension of 9.86 g 4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b- hexahydro-benzo[c][1,6]naphthyridin-6-yl)benzoic acid in 250 ml of acetonitrile and 22 ml diisopropyl- ethylamine. The reaction mixture is stirred 2 h. Under nitrogen atmosphere the resulting brown solution is added over a period of about 90 min to a suspension prepared from 5.2 g S-methyl-isothiourea sulfate in 150 ml of acetonitrile and 22 ml diisopropyl-ethylamine. The brownish yellow suspension is stirred at RT overnight and then filtered. The light brown residue is washed twice with 50 ml of acetonitrile and dried under reduced pressure. The crude product is used without further purification. This gives 11 g of the title compound of m.p. 199-201 °C (slow deliquescence).

EF: C₂₅ H₃₀ N₃ 0₃S; MW: 466.61.

Optical rotation: [ ] ²° = - 85.8.1° (c = 9.67 mg/ml, methanol)

B. 4-f(4aR.10bS)-9-Ethoxy-8-methoxy-2-methyl-1.2.3.4.4a.10b-hexahvdrobenzoMf1.61naph- thyridin-6-yl)benzoic acid

The title compound is prepared as described in WO98/21208;

20

Optical rotation: [α] _D = - 109.7° (c = 1, methanol + 1.0 equivalent 0.1 N aq. sodium hydroxid)

Commercial utility

The compounds according to the invention have valuable pharmacological properties which make them commercially utilizable. As selective inhibitors of type 4 or type 3 and 4 of cyclic nucleotide phosphodiesterase (PDE4, PDE3/4), they are suitable on the one hand as bronchial therapeutics (for the treatment of airway obstructions on account of their dilating action and cilia-stimulating action but also on account of their respiratory rate- and respiratory drive-increasing action), but on the other hand especially for the treatment of disorders of inflammatory nature, e.g. of the airways (asthma prophylaxis), of the skin, of the intestine, of the eyes and of the joints, which are mediated by mediators such as interferons, members of the tumour necrosis factor family, interleukins, chemokines, colony- stimulating factors, growth factors, lipid mediators (e.g., inter alia, PAF, platelet-activating factor), bacterial factors (e.g. LPS), immunoglobulins, oxygen free radicals and related free radicals (e.g. nitrogen monoxide NO), biogenic amines (e.g. histamine, serotonin), kinins (e.g. bradykinin), neurogenic mediators (such as substance P, neurokinin), proteins such as, for example, granular contents of leukocytes (inter alia cationic proteins of eosinophils) and adherence proteins (e.g. integrins). The compounds according to the invention have smooth muscle-relaxant action, e.g. in the region of the bronchial system, of the blood circulation, and of the efferent urinary passages. Furthermore, they have cilia frequency-increasing action, for example in the bronchial system.

On account of their PDE-inhibiting properties, the compounds according to the invention can be employed as therapeutics in human and veterinary medicine, where they can be used, for example, for the treatment and prophylaxis of the following diseases: acute and chronic (in particular inflammatory and allergen-induced) respiratory disorders of various origins (bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD); disorders associated with impaired cilia function or increased demands on ciliar clearance (bronchitis, mucoviscidosis), dermatoses (especially of proliferative, inflammatory and allergic type) such as, for example, psoriasis (vulgaris), toxic and allergic contact eczema, atopic eczema, seborrheic eczema, lichen simplex, sunburn, pruritus in the anogenital area, alopecia areata, hypertrophic scars, discoid lupus erythematosus, follicular and widespread pyodermias, endogenous and exogenous acne, acne rosacea and other proliferative, inflammatory and allergic skin disorders; disorders which are based on excessive release of TNF and leukotrienes, i.e., for example, disorders of the arthritis type (rheumatoid arthritis, rheumatoid spondyiitis, osteoarthritis and other arthritic conditions), systemic lupus erythematosus, disorders of the immune system (AIDS), including AIDS- related encephalopathies, autoimmune disorders such as diabetes mellitus (type I, autoimmune diabetes), multiple sclerosis and of the type virus-, bacteria- or parasite-induced demyelinization diseases, cerebral malaria or Lyme's disease, shock symptoms [septic shock, endotoxin shock, Gram- negative sepsis, toxic shock syndrome and ARDS (adult respiratory distress syndrome)] and also generalized inflammations in the gastrointestinal region (Crohn's disease and ulcerative colitis); disorders which are based on allergic and/or chronic; faulty immunological reactions in the region of the upper airways (pharynx, nose) and of the adjacent regions (paranasal sinuses, eyes), such as, for example, allergic rhinitis/sinusitis, chronic rhinitis/sinusitis, allergic conjunctivitis and also nasal polyps; and also disorders of the central nervous system such as memory disorders and Alzheimer's disease, candidiasis, leishmaniases and leprosy.

On account of their vasorelaxant activity, the compounds according to the invention can also be used for the treatment of high blood pressure disorders of various origins such as, for example, pulmonary high blood pressure and the concomitant symptoms associated therewith, for the treatment of erectile dysfunction or colics of the kidneys and the ureters in connection with kidney stones.

On account of their cAMP-increasing action, however, they can also be used for disorders of the heart which can be treated by PDE inhibitors, such as, for example, cardiac insufficiency, and also as anti- thrombotic, platelet aggregation-inhibiting substances.

The invention further relates to a method for the treatment of mammals including humans who are suffering from one of the abovementioned diseases. The method comprises administering a therapeuti- cally effective and pharmacologically acceptable amount of one or more of the compounds according to the invention to the sick mammal.

The invention further relates to the compounds according to the invention for use in the treatment and/or prophylaxis of diseases, in particular the diseases mentioned.

The invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of the diseases mentioned.

The invention furthermore relates to pharmaceutical compositions for the treatment and/or prophylaxis of the diseases mentioned and which contain one or more of the compounds according to the invention.

A further subject of the invention is a commercial product, consisting of a customary secondary pack, a primary pack containing the pharmaceutical composition (for example an ampoule or a blister pack) and, if desired, an information leaflet, the pharmaceutical composition exhibiting antagonistic action against cyclic nucleotide phosphodiesterases of type 4 or types 3 and 4 and leading to the attenuation of the symptoms of illnesses which are connected with cyclic nucleotide phosphodiesterases of type 4 or types 3 and 4, and the suitability of the pharmaceutical composition for the prophylaxis or treatment of illnesses which are connected with cyclic nucleotide phosphodiesterases of type 4 or types 3 and 4 being indicated on the secondary pack and/or on the information leaflet of the commercial product, and the pharmaceutical composition containing one or more compounds of formula 1 according to the invention. The secondary pack, the primary pack containing the pharmaceutical composition and the information leaflet otherwise comply with what would be regarded as standard to the person skilled in the art for pharmaceutical compositions of this type: Advantageously, the substances according to the invention are also suitable for combination with other substances which bring about stimulation of cAMP, such as prostaglandins (PGE2, PGI2 and prostacy- clin) and their derivatives, direct adenylate cyclase stimulators such as forskolin and related substances, or substances indirectly stimulating adenylate cyclase, such as catecholamines and adrenergic receptor agonists, in particular beta-mimetics. In combination, on account of their cAMP degradation- inhibiting action, they in this case display a synergistic, superadditive activity. This comes to bear, for example, in their use in combination with PGE2 for the treatment of pulmonary hypertension.

The pharmaceutical compositions are prepared by processes which are known per se and familiar to the person skilled in the art. As pharmaceutical compositions, the compounds according to the invention (= active compounds) are either employed as such, or preferably in combination with suitable pharmaceutical auxiliaries and/or excipients, e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between 0.1 and 95% and where, by the appropriate choice of the auxiliaries and/or excipients, a pharmaceutical administration form (e.g. a delayed release form or an enteric form) exactly suited to the active compound and/or to the desired onset of action can be achieved.

The person skilled in the art is familiar with auxiliaries or excipients which are suitable for the desired pharmaceutical formulations on account of his/her expert knowledge. In addition to solvents, gel formers, ointment bases and other active compound excipients, for example antioxidants, dispersants, emulsifiers, preservatives, solubilizers, colorants, complexing agents or permeation promoters, can be used.

The administration of the pharmaceutical compositions according to the invention may be performed in any of the generally accepted modes of administration available in the art. Illustrative examples of suitable modes of administration include intravenous, oral, nasal, parenteral, topical, transdermal and rectal delivery. Oral delivery is preferred.

For the treatment of disorders of the respiratory tract, the compounds according to the invention are preferably also administered by inhalation in the form of an aerosol; the aerosol particles of solid, liquid or mixed composition preferably having a diameter of 0.5 to 10 μm, advantageously of 2 to 6 μm.

Aerosol generation can be carried out, for example, by pressure-driven jet atomizers or ultrasonic atomizers, but advantageously by propellant-driven metered aerosols or propellant-free administration of micronized active compounds from inhalation capsules.

Depending on the inhaler system used, in addition to the active compounds the administration forms additionally contain the required excipients, such as, for example, propellants (e.g. Frigen in the case of metered aerosols), surface-active substances, emulsifiers, stabilizers, preservatives, flavorings, fillers (e.g. lactose in the case of powder inhalers) or, if appropriate, further active compounds.

For the purposes of inhalation, a large number of apparatuses are available with which aerosols of optimum particle size can be generated and administered, using an inhalation technique which is as right as possible for the patient. In addition to the use of adaptors (spacers, expanders) and pear- shaped containers (e.g. Nebulator®, Volumatic®), and automatic devices emitting a puffer spray (Autohaler®), for metered aerosols, in particular in the case of powder inhalers, a number of technical solutions are available (e.g. Diskhaler®, Rotadisk®, Turbohaler® or the inhaler described in European Patent Application EP 0 505 321), using which an optimal administration of active compound can be achieved.

For the treatment of dermatoses, the compounds according to the invention are in particular administered in the form of those pharmaceutical compositions which are suitable for topical application. For the production of the pharmaceutical compositions, the compounds according to the invention (= active compounds) are preferably mixed with suitable pharmaceutical auxiliaries and further processed to give suitable pharmaceutical formulations. Suitable pharmaceutical formulations are, for example, powders, emulsions, suspensions, sprays, oils, ointments, fatty ointments, creams, pastes, gels or solutions.

The pharmaceutical compositions according to the invention are prepared by methods known per se. The dosage of the active compounds takes place in the order of magnitude customary for PDE inhibitors. Thus topical application forms (such as, for example, ointments) for the treatment of dermatoses contain the active compounds in a concentration of, for example, 0.1-99%. The dose for administration by inhalation is customarily between 0.1 and 3 mg per day. The customary dose in the case of systemic therapy (p.o. or i.v.) is between 0.01 and 10 mg per kilogram per day.

Bioloqical investigations

The second messenger cyclic AMP (cAMP) is known for inhibiting inflammatory cells and cells responsible for the immunological response. The PDE4 isoenzyme is widely distributed in cells associated with the initiation and spreading of inflammatory diseases (H Tenor and C Schudt, in "Phosphodiesterase Inhibitors", 21-40, "The Handbook of Immunopharmacology", Academic Press 1996); its inhibition results in the increase of the intracellular cyclic AMP concentration and thus in the inhibition of cellular activation (JE Souness et al., Immunopharmacology 47: 127-162, 2000).

The anti-inflammatory potential of PDE4 inhibitors in vivo has been described in various animal models (MMTeixeira, TIPS 18: 164-170, 1997). To examine the PDE4 inhibition on a cellular level (in vitro), a large number of proinflammatory responses can be measured. Examples are the superoxide production of neutrophilic (C Schudt et al., Arch Pharmacol 344: 682-690, 1991) or eosinophilic (A Hatzel- mann et al., Brit J Pharmacol 114: 821-831 , 1995) granulocytes, which can be measured as luminol- enhanced chemiluminescence, or the synthesis of tumor necrosis factor alpha (TNFα) in monocytes, macrophages or dendritic cells (Gantner et al., Brit J Pharmacol 121: 221-231, 1997 and Pulmonary Pharmacol Therap 12: 377-386, 1999). The immunomodulatory potential of the PDE4 inhibitors furthermore becomes apparent by inhibition of T-cell responses such as cytokine synthesis or proliferation (DM Essayan, Biochem Pharmacol 57: 965-973, 1999). PDE4 inhibition by the substances according to the invention is thus a central indicator of the suppression of inflammatory processes.

Some of the cells involved in inflammatory processes contain, in addition to PDE4, also the PDE3 isoenzyme which likewise contributes to the total cAMP metabolism of these cells. Examples are endothelial cells, mast cells, T-cells, macrophages and dendritic cells. In these cell types, the inhibitory action of PDE4 inhibitors can be enhanced by additional PDE3 inhibition. In the case of (respiratory) smooth muscle cells, inhibition of the PDE3 activity is furthermore important for (broncho)relaxation (A Hatzelmann et al., in "Phosphodiesterase Inhibitors", 147-160, "The Handbook of Immunopharmacology", Academic Press, 1996).

ethod for measuring inhibition of PDE3 and PDE4 activities

Method A:

The PDE activity was determined according to Thompson et al. (Adv Cycl Nucl Res 10: 69-92, 1979) with some modifications (Bauer and Schwabe, Naunyn-Schmiedeberg's Arch Pharmacol 311 : 193-198, 1980). The test samples contained 20 mM Tris (pH 7.4), 5 mM MgCI₂, 0.5 μM cAMP or cGMP,

[³H]cAMP or [³H]cGMP (about 30 000 cpm/sample), the PDE isoenzyme-specific additives described in greater detail below, the indicated concentrations of inhibitor and an aliquot of the enzyme solution in a total sample volume of 200 μl. Dilution series of the compounds according to the invention were prepared in DMSO and further diluted in the samples [1:100 (v/v)], to give the desired end concentration of the inhibitors at a DMSO concentration of 1% (v/v), which for its part has only a minute effect on PDE activity.

After preincubation at 37°C for 5 minutes, the reaction was started by addition of the substrate (cAMP or cGMP). The samples were incubated at 37°C for a further 15 min. The reaction was terminated by addition of 50 μl 0.2 N HCI. After cooling on ice for 10 minutes and addition of 25 μg δ'-nucleotidase (snake venom from Crotalus atrox), the mixture was again incubated at 37°C for 10 min and the samples were then applied to QAE Sephadex A-25 columns (sample volume 1 ml). The columns were eluted with 2 ml of 30 mM ammonium formate (pH 6.0). The radioactivity of the eluate was measured and corrected by the corresponding blank values (measured in the presence of denatured protein); the blank values were less than 5% of the total radioactivity. In no case did the proportion of hydrolyzed nucleotide exceed 30% of the original substrate concentration.

PDE3 (cGMP-inhibited) was investigated in homogenates of human platelets (see Schudt et al., Biochem Pharmacol 1991: 42, 153-162) using cAMP or cGMP as substrate.

PDE4 (cAMP-specific) was investigated in the cytosol of human polymorphonuclear leukocytes (PMNL) [isolated from leukocyte concentrates, see Schudt et al., Arch Pharmacol 1991 : 344, 682-690] using cAMP as substrate. The PDE3 inhibitor motapizone (1 μM) was used to suppress the PDE3 activity emanating from contaminated platelets.

The IC₅₀ values were determined from the concentration-inhibition curves by nonlinear regression. Method B:

The cDNA for PDE3A1 (GB no. U36798) was isolated in 2 steps using PCR. A 3' terminal cDNA fragment of PDE3A1 was amplified from fat cells cDNA (Clontech, Palo Alto) using primers OZ 458 (5'- AAAGTCGACTCACTGGTCTGGCTTTTGG -3') and OZ 457 (5'- GTCGACCAGGTGCCCTCGCTA - 3'). The 5' terminal cDNA fragment of PDE3A1 was amplified from Placenta cDNA (Clontech, Palo Alto) using primers OZ 455 (5'- ATGGCAGTGCCCGGCGACGCT -3') and OZ 456 (5'- GTCGACTTTGCTTTTTAGCCT -3'). The PCR products were cloned into pCR2.1-Topo (Invitrogen, Groningen, NL) under standard conditions (the manufacturer's instructions). The 3' fragment was cut out with Hindll and cloned into the Hindll site of the construct carrying the 5' fragment. The whole ORF was subcloned into pBacPakθ (Clontech, Palo Alto) using EcoRI. Aminoacid 12 is Aspartic Acid like in sequence GB no. AJ005036, aa 69 and aa 110 are respective Serine and Glycine like in both sequences GB no. AJ005036 and GB no. M91667.

The PDE4B2 (GB no. M97515) was a gift of Prof. M. Conti (Stanford University, USA). It was amplified from the original plasmid (pCMV5) via PCR with primers Rb9 (5'- GCCAGCGTGCAAATAATGAAGG - 3') and Rb10 (5'- AGAGGGGGATTATGTATCCAC -3') and cloned into the pCR-Bac vector (Invitrogen, Groningen, NL).

The recombinant baculovirus was prepared by means of homologous recombination in SF9 insect cells. The expression plasmids were cotransfected with Bac-N-Blue (Invitrogen, Groningen, NL) or Baculo-Gold DNA (Pharmingen, Hamburg) using a standard protocol (Pharmingen, Hamburg). Wt virus-free recombinant virus supernatants were selected using plaque assay methods. After that, high- titre virus supernatants were prepared by amplifying 3 times. PDEs were expressed in SF21 cells by infecting 2x10⁶ cells/ml with an MOI (multiplicity of infection) between 1 and 10 in serum-free SF900 medium (Life Technologies, Paisley, UK). The cells were cultured at 28°C for 48 - 72 hours, after which they were pelleted for 5-10 min at 1000 g and 4°C.

The SF21 insect cells were resuspended, at a concentration of approx. 10⁷ cells/ml, in ice-cold (4°C) homogenization buffer (20 mM Tris, pH 8.2, containing the following additions: 140 mM NaCI, 3.8 mM KOI, 1 mM EGTA, 1 mM MgCI₂, 10 mM β-mercaptoethanol, 2 mM benzamidine, 0.4 mM Pefablock, 10 μM leupeptin, 10 μM pepstatin A, 5 μM trypsin inhibitor) and disrupted by ultrasonication. The homogenate was then centrifuged for 10 min at 1000χg and the supernatant was stored at -80°C until subsequent use (see below). The protein content was determined by the Bradford method (BioRad, Munich) using BSA as the standard.

PDE3A1 and PDE4B2 activities were inhibited by the said compounds in a modified SPA (scintillation proximity assay) test, supplied by Amersham Biosciences (see procedural instructions "phosphodiesterase [3H]cAMP SPA enzyme assay, code TRKQ 7090"), carried out in 96-well microtitre plates (MTP's). The test volume is 100 μl and contains 20 mM Tris buffer (pH 7.4), 0.1 mg of BSA (bovine serum albumin)/ml, 5 mM Mg²⁺, 0.5 μM cAMP (including about 50,000 cpm of [3H]cAMP), 1 μl of the respective substance dilution in DMSO and sufficient recombinant PDE (1000^χg supernatant, see above) to ensure that 10-20% of the cAMP is converted under the said experimental conditions. The final concentration of DMSO in the assays (1 % v/v) does not substantially affect the activity of the PDEs investigated. After a preincubation of 5 min at 37°C, the reaction is started by adding the substrate (cAMP) and the assays are incubated for a further 15 min; after that, they are stopped by adding SPA beads (50 μl). In accordance with the manufacturer's instructions, the SPA beads had previously been resuspended in water, but were then diluted 1 :3 (v/v) in water; the diluted solution also contains 3 mM IBMX to ensure a complete PDE activity stop. After the beads have been sedimented (> 30 min), the MTP's are analyzed in commercially available luminescence detection devices. The corresponding IC₅₀ values of the compounds for the inhibition of PDE activities are determined from the concentration-effect curves by means of non-linear regression.

Results

ln Table 1 below, the inhibitory concentrations [inhibitory concentrations as -log IC₅₀ (mol/l)] according to section "Method for measuring inhibition of PDE3 and PDE4 activities" are indicated for a number of compounds according to the invention for the PDE3 and the PDE4 isoenzyme. The number of the compounds corresponds to the numbers of the examples in the section End products.

The inhibitory concentrations of the compounds 1-7 and 14-28 have been determined according to the above-described Method A. The inhibitory concentrations of the compounds 8-13 have been determined according to the above described Method B.

Table 1

Continuation of Table 1:

Claims

Patent claims

Compounds of formula 1

in which

R1 is 1-4C-alkyl,

R2 is hydroxyl, 1-40-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-40-alkoxy which is completely or predominantly substituted by fluorine, R3 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, or in which

in which if R5 is a radical of the formula (a), either

R6, R7, R8 and R9 independently of one another are hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, cyano, hydroxy-2-4C-alkyl, 1-4C-alkoxy-2-4C-alkyl or R26, with the proviso that at least one of R6, R7, R8 and R9 is 1-4C-alkoxy-2-4C-alkyl, ^■ or R6 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, hydroxy-2-4C-alkyl, 1-4C- alkoxy-2-4C-alkyI or R26,

R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, hydroxy-2-4C-a!kyl, 1-40- alkoxy-2-4C-alkyl or R26, and

1 -yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydro- isoquinolin-2-yl, tetrahydro-6,7-dimethoxyisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl,

2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, 4-benzyl-piperidin-1-yl, thiomorpholin-4- yl or 1 H-1 ,2,4-triazol-1-yl radical, or

R9 is cyano, AryH , R26, naphthyl, phenyl, phenyl substituted by R18 and/or R19, phenyl-1-4C- alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R20 and/or R21 ,

in which if R5 is a radical of the formula (b), either

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pipera- zin-1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahy- droisoquinolin-2-yl, tetrahydro-6,7-dimethoxyisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol- 1-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, 4-benzyl-piperidin-1-yl, thiomorpholin-4-yl or 1 H-1 ,2,4-triazol-1-yl radical, or

in which if R5 is a radical of the formula (c), R14 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-70-cycioalkylmethyl, hydroxy-2-4C-alkyl, 1-4C- alkoxy-2-4C-alkyl or R26, and

Aryl2,

Aryll is 4-methylthiazol-2-yl, benzimidazol-2-yl, 5-nitrobenzimidazoi-2-yl, 5-chIorobenzimidazol-2-yl, 5-methylbenzimidazol-2-yl, 4-methylquinazolin-2-yl, benzothiazol-2-yl, benzoxazol-2-yl or pyrimi- din-2-yl,

Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1 H-imidazol-2-yl, imidazol-2-yl, 4,5-dicyano-imidazol-2-yl, 4-me- thyl-imidazol-2-yl, 4-ethyl-benzimidazol-2-yl, 4-acetyl-imidazol-2-yl, 1 H-[1 ,2,4]triazol-3-yl, benz- imidazol-2-yl, 1 -methyl-benzimidazol-2-yl, 1 -ethyl-benzimidazol-2-yl, 5,6-dimethyl-benzimidazol- 2-yl, purin-8-yl, 6-amino-7-methyl-7H-purine-8-yl, 1 ,6-dimethylimidazo[4,5-b]pyridin-2-yl, 1,5,6- trimethylimidazo[4,5-b]pyridin-2-yl, 1 ,3-dimethyl-3,7-dihydro-1 H-purine-2,6-dione-8-yl, 7-ethyl-3- methyl-3,7-dihydro-purine-2,6-dione-8-yl, 1,3,7-trimethyl-3,7-dihydro-purine-2,6-dione-8-yl, thia- diazolyl, 1,4-dihydrotetrazol-5-yl, 2H-[1 ,2,4]triazol-3-yl, 1 ,3-dihydrobenzimidazol-5-yl, 1 H-tetrazol- 5-yl, pyrimidin-2-yl or 4,6-dimethyl-pyrimidin-2-yl,

R17 is formyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, 1-4C-alkoxycarbonyl-1-4C-alkyl, 1-4C- alkylcarbonyl, hydroxy-2-4C-alkyl, 1-4C-alkoxy-2-4C-alkyl, hydroxy-2-4C-alkoxy-2-4C-alkyl, 1- 4C-alkoxy-2-4C-alkoxy-2-4C-alkyl, phenyl, phenyl substituted by R22 and/or R23, [benzo(1 ,3)dioxol]-5-ylmethyl, phenyl-1-4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R24 and/or R25,

R18 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-40-alkoxy,

R19 is halogen, 1-4C-alkyl or 1-4C-aIkoxy,

R20 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R21 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R22 is halogen, nitro, carboxyl, 1-4C-alkyl, 1-4C-alkylcarbonyl, trifluoromethyl or 1-40-alkoxy,

R23 is halogen, 1-4C-alkyl or 1-40-alkoxy,

R24 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R25 is halogen, 1-4C-alkyl or 1-40-alkoxy,

R26 is R27(R28)N-2-4C-alkyl wherein

R27 and R28, together and including the nitrogen atom to which both are bonded, are a pyrrolidin-1-yl, piperidin-1-yl, piperazin-1-yl, 4-(1-4C-alkyl-)piperazin-1-yl, azepan-1yl, azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydroisoquinolin-2-yl, tetrahydro-6,7-dimethoxyisoquinolin-2-yl, 3,5-dimethyl- pyrazol-1-yl, pyrazol-1-yl, morpholin-4-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, 4-benzyl-piperidin-1-yl, thiomorpholin-4-yl or 1H-1 ,2,4-triazol-1-yl radical, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

2. Compounds of formula 1 according to claim 1 in which

R1 is 1-4C-alkyl,

R2 is 1-4C-alkoxy, 3-6C-cycloalkoxy, 3-60-cycloalkylmethoxy, or 1-40-alkoxy which is completely or predominantly substituted by fluorine, R3 is 1-40-alkoxy, 3-60-cycloalkoxy, 3-6C-cycloalkylmethoxy, or 1-40-alkoxy which is completely or predominantly substituted by fluorine, R4 is hydrogen, halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy, R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either

R6 is hydrogen,

R7 is hydrogen,

R6 is hydrogen,

R7 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and

4-yl radical, or

R6 is hydrogen,

R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,

R8 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and

in which if R5 is a radical of the formula (b), either

R10 and R11 independently of one another are hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloa!kylmethyl, and

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pipera- zin-1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahy- droisoquinolin-2-yl, tetrahydro-6,7-dimethoxyisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1 -yl, pyrazol- 1 -yl, 2,6-dimethyl-morpholin-4-yl, 4-benzyl-piperidin-1-yl or 2,6-dimethyl-piperidin-1-yl radical, or

R10 and R11 , together and including the nitrogen atom to which both are bonded, are a 2,6-di- methyi-morpholin-4-yl, 4-benzyl-piperidin-1-yl or 2,6-dimethyl-piperidin-1-yl radical, and R12 and R13, together and including the nitrogen atom to which both are bonded, are a pyrroli- din-1-yl, piperidin-1-yl, hexahydroazepin-1-yl, morpholin-4-yl, 4-(1-4C-alkyl-)-piperazin-1-yl, 2,6-dimethyl-morpholin-4-yl, 4-benzyl-piperidinyl or 2,6-dimethyl-piperidin-1-yl radical,

in which if R5 is a radical of the formula (c), R14 is hydrogen, and

Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1 H-imidazol-2-yl, imidazol-2-yl, 4,5-dicyano-imidazol-2-yl, 4-me- thyl-imidazol-2-yl, 4-ethyl-benzimidazol-2-yl, 4-acetyl-imidazol-2-yl, 1H-[1 ,2,4]triazol-3-yl, benz- imidazol-2-yl, 1 -methyl-benzimidazol-2-yl, 1 -ethyl-benzimidazol-2-yl, 5,6-dimethyl-benzimidazol- 2-yl, purin-8-yl, 6-amino-7-methyl-7H-purine-8-yl, 1 ,6-dimethylimidazo[4,5-b]pyridin-2-yl, 1 ,5,6- trimethylimidazo[4,5-b]pyridin-2-yl, 1 ,3-dimethyl-3,7-dihydro-1 H-purine-2,6-dione-8-yl, 7.-ethyl-3- methyl-3,7-dihydro-purine-2,6-dione-8-yl, 1,3,7-trimethyl-3,7-dihydro-purine-2,6-dione-8-yl or 1H-[1 ,2,4]triazol-3-yl,

R17 is formyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, 1-4C-alkoxycarbonyl-1-4C-alkyl, 1-4C- alkylcarbonyl, hydroxyethyl, 1-2C-alkoxyethyl, hydroxy-2-4C-alkoxyethyl, 1-2C-alkoxy-2-4C- alkoxyethyl, phenyl, phenyl substituted by R22 and/or R23, [benzo(1,3)dioxol]-5ylmethyl, phenyl- 1-4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R24 and/or R25,

R18 is halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-40-alkoxy,

R19 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R20 is halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R21 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R22 is halogen, nitro, 1-4C-alkyl, 1-4C-alkylcarbonyl, trifluoromethyl or 1-40-alkoxy,

R23 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R24 is halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-40-alkoxy, R25 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R26 is R27(R28)N-2-4C-alkyl wherein

3. Compounds of formula 1 according to claim 1 in which

R1 is methyl,

R2 is 1-4C-alkoxy,

R3 is 1-40-alkoxy,

R4 is hydrogen,

R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either

R6 is hydrogen,

R7 is hydrogen,

R8 is hydrogen or methoxy-2-4C-alkyl,

R9 is methoxy-2-4C-alkyl, or

R6 is hydrogen,

R7 is hydrogen, and

R6 is hydrogen, R7 is hydrogen, R8 is hydrogen, and R9 is cyano, Aryll , morpholin-4-ylethyl, naphthyl, phenyl, phenyl-1-2C-alkyl, 3,4- dimethoxybenzyl or 3,4-dimethoxyphenylethyl,

in which if R5 is a radical of the formula (c),

R14 is hydrogen, and

Aryl2, Aryll is 4-methylthiazol-2-yl, benzimidazol-2-yl or benzothiazol-2-yl, Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1H-imidazol-2-yl, imidazol-2-yl or benzimidazol-2-yl, R17 is acetyl, (2-hydroxyethoxy)ethyl, cyclohexyl, ethoxycarbonylmethyl, phenyl, [benzo(1 ,3)dioxol]-

5-ylmethyI, 2-methoxyphenyl, 3-trifluoromethylphenyl, 4-acetylphenyl or benzyl, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

4. Compounds of formula 1 according to claim 1 in which

R1 is methyl,

R2 is methoxy or ethoxy,

R3 is methoxy,

R4 is hydrogen,

R5 is a radical selected from

5. A compound of formula 1 according to claim 1 selected from

4-((4aR, 10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-

N-(1-methyl-4-oxo-4,5-dihydro-1H-imidazol-2-yl)-benzamide;

N-(1-Amino-1-azocan-1-yl-methylene)-4-((4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a,10b- hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide;

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

6-yl)-phenyl]-methanoyl}-N'-((R)-1-phenyl-ethyl)-guahidine; N-{1-[4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-

6-yl)-phenyl]-methanoyl}-N'-((S)-1-phenyl-ethyl)-guanidine;

N-[1 -Amino-1 -(4-benzyl-piperazin-1 -yl)-methylene]-4-( (4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1,6]naphthyridin-6-yl)-benzamide;

N-{1 -Amino-1 -[4-(2-methoxy-phenyl)-piperazin-1 -yl]-methylene}-4-((4aR, 10bS)-9-ethoxy-8-methoxy-2- methyl-1 , 2, 3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-{1 -[4-((4aR, 10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-

6-yl)-phenyl]-methanoyl}-N'-naphthalen-1-yl-guanidine;

N-{1-[4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1,2,3,4,4a,10b-hexahydro-benzo[c][1,6]naphthyridin-

6-yl)-phenyl]-methanoyl}-N'-(4-methyl-thiazol-2-yl)-guanidine;

1, 2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-(1 H-benzoimidazol-2-yl)-N'-{1 -[4-((4aR, 10bS)-9-ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b- hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-phenyl]-methanoyl}-guanidine;

6-yl)-phenyl]-methanoyl}-N'-phenyl-guanidine;

N-(1 -Amino-1 -thiomorpholin-4-yl-methylene)-4-( (4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-

1 , 2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-{1 -Amino-1 -[4-( 3-trifluoromethyl-phenyl)-piperazin-1 -yl]-methylene}-4-( (4aR,10bS)-9-ethoxy-8- methoxy-2-methyl-1,2,3,4,4a,10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-[1 -Amino-1 -(4-phenyl-piperazin-1 -yl)-methylene]-4-( (4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

6-yl)-phenyl]-methanoyl}-N'-cyano-guanidine;

N-{1-[4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a,10b-hexahydro-benzo[c][1,6]naphthyridin-

6-yl)-phenyl]-methanoyl}-N'-(2-morpholin-4-yl-ethyl)-guanidine;

N-[2-(3,4-Dimethoxy-phenyl)-ethyl]-N'-{1 -[4-((4aR, 10bS)-9-ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b- hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-phenyl]-methanoyl}-guanidine;

N-(3,4-Dimethoxy-benzyl)-N'-{1-[4-((4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a, 10b- hexahydro-benzo[c][1,6]naphthyridin-6-yl)-phenyl]-methanoyl}-guanidine;

1, 2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N-[1 -Amino-1 -(6,7-dimethoxy-3,4-dihydro-1H-isoquinolin-2-yl)-methylene]-4-((4aR,10bS)-9-ethoxy-8- methoxy-2-methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

N'-{1-[4-((4aR,10bS)-9-Ethoxy-8-methoxy-2-methyl-1 ,2,3,4,4a,10b-hexahydro- benzo[c][1 ,6]naphthyridin-6-yl)-phenyl]-methanoyl}-N,N-bis-(2-methoxy-ethyl)-guanidine;

N-(1 -Amino-1 -{4-[2-(2-hydroxy-ethoxy)-ethyl]-piperazin-1 -yl}-methylene)-4-((4aR, 10bS)-9-ethoxy-8- methoxy-2-methyl-1,2,3,4,4a,10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide; N-[1-Amino-1-(4-benzo[1,3]dioxol-5-ylmethyl-piperazin-1-yl)-methylene]-4-((4aR,10bS)-9-ethoxy-8- methoxy-2-methyl-1 ,2,3,4,4a,10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

1 ,2, 3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide;

[4-(1 -Amino-1 -{1-[4-((4aR,10bS)-9-ethoxy-8-methoxy-2-methyl-1, 2,3,4,4a, 10b-hexahydro- benzo[c][1 ,6]naphthyridin-6-yl)-phenyl]-methanoylimino}-methyl)-piperazin-1-yl]-acetic acid ethyl ester;

N-{1 -[4-(4-Acetyl-phenyl)-piperazin-1 -yl]-1 -amino-methylene}-4-((4aR, 10bS)-9-ethoxy-8-methoxy-2- methyl-1 ,2,3,4,4a, 10b-hexahydro-benzo[c][1 ,6]naphthyridin-6-yl)-benzamide; or a salt of this compound, a N-oxide, enantiomer, E/Z isomer or tautomer of this compound or a salt therof.

6. Compounds of formula 1 according to claim 1 in which

R1 is 1-4C-alkyl,

R2 is hydroxyl, 1-40-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-40-alkoxy which is completely or predominantly substituted by fluorine, R3 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-40-alkoxy which is completely or predominantly substituted by fluorine, or in which

R2 and R3 together are a 1-2C-alkylenedioxy group, R4 is hydrogen, halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-40-alkoxy, R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either

R6 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or hydroxy-2-4C-alkyl, R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or hydroxy-2-4C-alkyl, and R8 and R9, together and including the nitrogen atom to which both are bonded, are a piperazin- 1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydro- isoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dime- thyl-piperidin-1-yl, thiomorpholin-4-yl or 1 H-1,2,4-triazol-1-yl radical, or

R6 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or.hydroxy-2-4C-alkyl, R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylφethyl or hydroxy-2-4C-alkyl, R8 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or hydroxy-2-4C-alkyl, and R9 is Aryll, naphthyl, phenyl, phenyl substituted by R18 and/or R19, phenyl-1-4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R20 and/or R21 ,

in which if R5 is a radical of the formula (b), either

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pipera- zin-1-yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydroisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl, thiomorpholin-4-yl or 1 H-1 ,2,4-triazol-1-yl radical, or

R10 and R11, together and including the nitrogen atom to which both are bonded, are a 2,6-di- methyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl or thiomorpholin-4-yl radical, and R12 and R13, together and including the nitrogen atom to which both are bonded, are a pyrroli- din-1-yl, piperidin-1-yl, hexahydroazepin-1-yl, morpholin-4-yl, 4-(1-4C-alkyl-)-piperazin-1-yl, 2,6-dimethyl-morpholin-4-yl, 2,6-dimethyl-piperidin-1-yl or thiomorpholin-4-yl radical,

in which if R5 is a radical of the formula (c),

R14 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl or hydroxy-2-4C-alkyl, and R15 and R16, together and with inclusion of the N-C(-)-N structure to which they are bonded are Aryl2,

Aryll is 4-methylthiazol-2-yl, benzimidazol-2-yl, 5-nitrobenzimidazol-2-yl, 5-chlorobenzimidazol-2-yl, 5-methylbenzimidazol-2-yl, 4-methylquinazolin-2-yl, benzothiazol-2-yi, benzoxazol-2-yl or pyrimi- din-2-yl,

Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1H-imidazol-2-yl, imidazol-2-yl, 4,5-dicyano-imidazol-2-yl, 4-me- thyl-imidazol-2-yl, 4-ethyl-benzimidazol-2-yl, 4-acetyl-imidazol-2-yl, 1H-[1,2,4]triazol-3-yl, benz- imidazol-2-yl, 1 -methyl-benzimidazol-2-yl, 1 -ethyl-benzimidazol-2-yl, 5,6-dimethyl-benzimidazol- 2-yl, purin-8-yl, 6-amino-7-methyl-7H-purine-8-yl, 1,6-dimethylimidazo[4,5-bJpyridin-2-yl, 1,5,6- trimethylimidazo[4,5-b]pyridin-2-yl, 1 ,3-dimethyl-3,7-dihydro-1 H-purine-2,6-dione-8-yl, 7-ethyl-3- methyl-3,7-dihydro-purine-2,6-dione-8-yl, 1,3,7-trimethyl-3,7-dihydro-purine-2,6-dione-8-yl, thia- diazolyl, 1,4-dihydrotetrazol-5-yl, 2H-[1,2,4]triazol-3-yl, 1 ,3-dihydrobenzimidazol-5-yl, 1 H-tetrazol- 5-yl, pyrimidin-2-yl or 4,6-dimethyl-pyrimidin-2-yl,

R17 is formyl, 1-4C-alkylcarbonyl, 2-hydroxyethyl, phenyl, phenyl substituted by R22 and/or R23, phenyl-1-4C-alkyI or phenyl-1-4C-alkyl substituted in the phenyl moiety by R24 and/or R25,

R18 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R19 is halogen,- 1-4C-alkyl or 1-40-alkoxy, R20 is halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-40-alkoxy,

R21 halogen, 1-4C-alkyl or 1-4C-alkoxy,

R22 halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R23 halogen, 1-4C-alkyl or 1-4C-alkoxy,

R24 halogen, nitro, carboxyl, 1-4C-alkyl, trifluoromethyl or 1-4C-alkoxy,

R25 halogen, 1-4C-alkyl or 1-4C-alkoxy, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

7. Compounds of formula 1 according to claim 1 , in which

R1 is 1-4C-alkyl,

R2 is 1-40-alkoxy, 3-60-cycloalkoxy, 3-6C-cycloalkylmethoxy, or 1-40-alkoxy which is completely or predominantly substituted by fluorine, R3 is 1-4C-alkoxy, 3-60-cycloalkoxy, 3-6C-cycloalkylmethoxy, or 1-40-alkoxy which is completely or predominantly substituted by fluorine, R4 is hydrogen, halogen, nitro, 1-4C-alkyl, trifluoromethyl or 1-40-alkoxy, R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either

R6 is hydrogen,

R7 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and

1 -yl radical substituted in 4-position by R17, a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahydro- isoquinolin-2-yi, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl, 2,6-dimethyl-morpholin-4-yl or 2,6-dime- thyl-piperidin-1-yl radical, or

R6 is hydrogen,

R7 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,

R8 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, and

R9 is Aryll , naphthyl, phenyl, phenyl substituted by R18 and/or R19, phenyl-1-4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R20 and/or R21, in which if R5 is a radical of the formula (b), either

3-7C-cycloalkylmethyl, and

R12 and R13, together and including the nitrogen atom to which both are bonded, are a pipera- zin-1-yl radical substituted in 4-position by R1 , a azocan-1-yl, azonan-1-yl, azecan-1-yl, tetrahy- droisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1-yl, pyrazol-1-yl, 2,6-dimethyl-morpholin-4-yl or 2,6-di- methyl-piperidin-1-yl radical, or

R10 and R11 , together and including the nitrogen atom to which both are bonded, are a 2,6-di- methyl-morpholin-4-yl or 2,6-dimethyl-piperidin-1-yl radical, and

2,6-dimethyl-morpholin-4-yl or 2,6-dimethyl-piperidin-1-yl radical,

in which if R5 is a radical of the formula (c), R14 is hydrogen, and

Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1H-imidazol-2-yl, imidazol-2-yl, 4,5-dicyano-imidazol-2-yl, 4-me- thyl-imidazol-2-yl, 4-ethyl-benzimidazol-2-yl, 4-acetyl-imidazol-2-yl, 1H-[1,2,4]triazol-3-yl, benz- imidazol-2-yl, 1-methyl-benzimidazol-2-yl, 1-ethyl-benzimidazol-2-yl, 5,6-dimethyl-benzimidazol- 2-yl, purin-8-yl, 6-amino-7-methyl-7H-purine-8-yl, 1,6-dimethylimidazo[4,5-b]pyridin-2-yl, 1,5,6- trimethylimidazo[4,5-b]pyridin-2-yl, 1 ,3-dimethyl-3,7-dihydro-1 H-purine-2,6-dione-8-yl, 7-ethyl-3- methyl-3,7-dihydro-purine-2,6-dione-8-yl, 1,3,7-trimethyl-3,7-dihydro-purine-2,6-dione-8-yl or 1 H-[1,2,4]triazol-3-yl,

R17 is formyl, 1-4C-alkylcarbonyl, 2-hydroxyethyl, phenyl, phenyl substituted by R22 and/or R23, phenyl-1-4C-alkyl or phenyl-1-4C-alkyl substituted in the phenyl moiety by R24 and/or R25,

R18 is halogen, nitro, 1-4C-alkyl or 1-40-alkoxy,

R19 is halogen, 1 -4C-alkyl or 1 -4C-alkoxy,

R20 is halogen, nitro, 1-4C-alkyl or 1-4C-alkoxy,

R21 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R22 is halogen, nitro, 1-4C-alkyl or 1-4C-alkoxy,

R23 is halogen, 1-4C-alkyl or 1-4C-alkoxy,

R24 is halogen, nitro, 1-4C-alkyl or 1-4C-alkoxy,

R25 is halogen, 1-4C-alkyl or 1-4C-alkoxy, the salts of these compounds, as well as the enantiomers, E/Z isomers and tautomers of these compounds and their salts.

8. Compounds of formula 1 according to claim 1, in which

R1 is methyl,

R2 is 1-4C-alkoxy,

R3 is 1-4C-alkoxy,

R4 is hydrogen,

R5 is a radical of the formulae (a), (b) or (c)

in which if R5 is a radical of the formula (a), either

R6 is hydrogen,

R7 is hydrogen, and

1-yl radical substituted in 4-position by R17, a tetrahydroisoquinolin-2-yl, 3,5-dimethyl-pyrazol-1- yl, pyrazol-1-yl, azocan-1-yl, azonan-1-yl or azecan-1-yl radical, or

R6 is hydrogen,

R7 is hydrogen, and

R8 is hydrogen or 1-4C-alkyl, and

R9 is Aryll, naphthyl or phenyl-1-2C-alkyl,

in which if R5 is a radical of the formula (b),

R10 is hydrogen or 1-4C-alkyl,

R11 is hydrogen or 1-4C-alkyl, and

in which if R5 is a radical of the formula (c), R14 is hydrogen, and

Aryl2, Aryll is 4-methylthiazol-2-yl or benzothiazol-2-yl, Aryl2 is 1-methyl-4-oxo-4,5-dihydro-1 H-imidazol-2-yl, imidazol-2-yl, 4-methyl-imidazol-2-yl, 4-ethyl- benzimidazol-2-yl, 4-acetyl-imidazol-2-yl, benzimidazol-2-yl, 1-methyl-benzimidazol-2-yl, 1-ethyl- benzimidazol-2-yl or 5,6-dimethyI-benzimidazol-2-yl, R17 is acetyl, 2-methoxyphenyl or benzyl, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

9. Compounds of formula 1 according to claim 1, in which R1 is methyl,

R2 is methoxy or ethoxy,

R3 is methoxy,

R4 is hydrogen,

R5 is N-(1-methyl-4-oxo-4,5-dihydro-1H-imidazol-2-yl)-amino, N-(1 -amino-1 -azocan-1-yl-methyle- ne)-amino, N-[1 -(4-acetylpiperazine-1 -yl)-1 -amino-methylene]-amino, N-(N'-(R)-1 -phenylethyl)- guanidinyl, N-(N'-(S)-1 -phenylethyl)guanidinyl, N-[1 -amino-1 -(4-benzylpiperazine-1 -yl)-methyle- ne]-amino, N-[1 -amino-1 -(2-methoxy-phenyl-piperazin-1-yl)-methylene]-amino, N-[1-(3,5-dimeth- yl-pyrazol-1-yl)-1-imino-methyl]-amino, N-(N'-naphthalene-1-yl)guanidinyl, N-(N'-4-methylthiazol- 2-yl)guanidinyl or N-[1-(tetrahydroisoquinoline-2-yl)-1-imino-methyl]-amino, the salts of these compounds, as well as the enantiomers, E/Z isomers and tautomers of these compounds and their salts.

10. Compounds of formula 1 according to claim 1, in which the hydrogen atoms in positions 4a and 10b are in the cis position relative to one another, the salts of these compounds, as well as the N-oxides, enantiomers, E/Z isomers and tautomers of these compounds and their salts.

11. Compounds of formula 1 according to claim 1 which have with respect to the positions 4a and 10b the configuration shown in formula (1*):

12. Compounds of formula 1 according to claim 1 for treating diseases.

13. A pharmaceutical composition comprising one or more compounds of formula 1 according to claim 1 together with customary pharmaceutical auxiliaries and/or excipients.

14. The use of compounds of formula 1 according to claim 1 for producing pharmaceutical compositions for treating respiratory disorders and/or dermatoses.

15. A method for treating an illness treatable by the administration of a PDE4 inhibitor in a patient comprising administering to said patient in need thereof a therapeutically effective amount of a compound of formula 1 according to claim 1.

16. A method for treating airway disorders and/or dermatoses in a patient comprising administering to said patient a therapeutically effective amount of a compound of formula 1 according to claim 1.