WO2004018451A1 - Pyridazinone-derivatives as pde4 inhibitors - Google Patents

Pyridazinone-derivatives as pde4 inhibitors Download PDF

Info

Publication number
WO2004018451A1
WO2004018451A1 PCT/EP2003/008677 EP0308677W WO2004018451A1 WO 2004018451 A1 WO2004018451 A1 WO 2004018451A1 EP 0308677 W EP0308677 W EP 0308677W WO 2004018451 A1 WO2004018451 A1 WO 2004018451A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
phenyl
alkoxy
hydrogen
compounds
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2003/008677
Other languages
French (fr)
Other versions
WO2004018451A8 (en
Inventor
Geert Jan Sterk
Armin Hatzelmann
Johannes Barsig
Degenhard Marx
Hans-Peter Kley
Johannes A. M. Christiaans
Wiro M. P. B. Menge
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Takeda GmbH
Original Assignee
Altana Pharma AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Altana Pharma AG filed Critical Altana Pharma AG
Priority to JP2004530088A priority Critical patent/JP2005538138A/en
Priority to HR20050199A priority patent/HRP20050199A2/en
Priority to AU2003251693A priority patent/AU2003251693A1/en
Priority to US10/523,112 priority patent/US20060167001A1/en
Priority to CA002494650A priority patent/CA2494650A1/en
Priority to EP03792259A priority patent/EP1556369A1/en
Publication of WO2004018451A1 publication Critical patent/WO2004018451A1/en
Publication of WO2004018451A8 publication Critical patent/WO2004018451A8/en
Anticipated expiration legal-status Critical
Priority to IS7717A priority patent/IS7717A/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/02Nasal agents, e.g. decongestants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/08Bronchodilators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/04Antipruritics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/10Anti-acne agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/14Drugs for dermatological disorders for baldness or alopecia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • A61P27/14Decongestants or antiallergics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings

Definitions

  • the invention relates to novel pyridazinone-derivatives, which are used in the pharmaceutical industry for the production of pharmaceutical compositions.
  • the invention thus relates to compounds of formula 1
  • R1 is hydrogen or 1-4C-alkyl
  • R2 is hydrogen or 1-4C-alkyl
  • R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkyl methoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R6 is 1-4C-alkoxy, 3-5C-cycIoalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein
  • R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom,
  • R9 is 1-4C-alkyl, -S(O) 2 -R10, -S(0) 2 -(CH 2 ) n -R11 , -(CH 2 )m-S(0) 2 -R12, -C(0)R13, -C(0)-(CH 2 ) n -R14, -(CH 2 ) m -C(0)-R15, Aryh or (Aryl2)-1-4C-alkyl,
  • R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19,
  • R11 is phenyl or -N(R16)R17
  • R12 is -N(R16)R17
  • R13 is 1-4C-alkyl, hydroxycarbonyl-1-4C-alkyl, phenyl, 2,4,6-trichlorophenyl, pyridyl, 4-ethyl-piperazin- 2,3-dion-1-yl or -N(R16)R17, R14 is -N(R16)R17,
  • R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
  • R16 is hydrogen, 1-7C-alkyI, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
  • R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrrolidinyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
  • R21 is 1-4C-aIkyl, pyrid-4-yl, pyrid-4-yl methyl, 2-methoxyphenyl, 1 ,1-diphenylmethyl, dimethyl- amino-1-4C-alkyl, dimethylaminocarbonylmethyl, N-methyl-piperidin-4-yl, 4-morpholino-ethyl or tetrahydrofuran-2-ylmethyl, R18 is halogen, nitro, cyano, carboxyl, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxy which is completely or predominantly substituted by fluorine, 1-4C-alkoxycarbonyl, amino, mono-or di-
  • Aryh is pyrimidin-2-yl, thieno-[2,3-d]pyrimidin-4-yl, 1-methyl-1 H-pyrazolo-[3,4-d]pyrimidin-4-yl, thiazolyl, imidazolyl, furanyl, pyridyl, phenyl or phenyl substituted by R18 and/or R19, Aryl2 is pyridyl, phenyl, phenyl substituted by R18 and/or R19, 2-oxo-2H-chromen-7-yl or 4-(1 ,2,3-thia- diazol-4-yl)phenyl, n is an integer from 1 to
  • 1-4C-Alkyl is a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, ethyl and methyl radicals.
  • 1-7C-Alkyl is a straight-chain or branched alkyl radical having 1 to 7 carbon atoms.
  • Examples are the heptyl, isoheptyl (5-methylhexyl), hexyl, isohexyl (4-methylpentyl), neohexyl (3,3-dimethylbutyl), pentyl, isopentyl (3-methylbutyl), neopentyl (2,2-dimethylpropyl), butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, ethyl and methyl radicals.
  • 1-4C-Alkoxy is a radical which, in addition to the oxygen atom, contains a straight-chain or branched alkyl radical having 1 to 4 carbon atoms.
  • Alkoxy radicals having 1 to 4 carbon atoms which may be mentioned in this context are, for example, the butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, iso- propoxy, ethoxy and methoxy radicals.
  • 1-8C-Alkoxy is a radical which, in addition to the oxygen atom, contains a straight-chain or branched alkyl radical having 1 to 8 carbon atoms.
  • Alkoxy radicals having 1 to 8 carbon atoms which may be mentioned in this context are, for example, the octyloxy, heptyloxy, isoheptyloxy (5-methylhexyloxy), hexyloxy, isohexyloxy (4-methylpentyloxy), neohexyloxy (3,3-dimethylbutoxy), pentyioxy, isopentyloxy (3-methylbutoxy), neopentyloxy (2,2-dimethylpropoxy), butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, isopropoxy, ethoxy and methdxy radicals.
  • Halogen within the meaning of the present invention is bromine, chlorine or fluorine.
  • 3-7C-Cycloalkoxy stands for cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy or cyclo- heptyloxy, of which cyclopropyloxy, cyclobutyloxy and cyclopentyloxy are preferred.
  • 3-7C-CycloalkyImethoxy stands for cyclopropylmethoxy, cyclobutylmethoxy, cyclopentylmethoxy, cyclo- hexylmethoxy or cycloheptylmethoxy, of which cyclopropylmethoxy, cyclobutylmethoxy and cyclopentylmethoxy are preferred.
  • 3-5C-Cycloalkoxy stands for cyclopropyloxy, cyclobutyloxy and cyclopentyloxy.
  • 3-5C-Cycloalkylmethoxy stands for cyclopropylmethoxy, cyclobutylmethoxy and cyclopentylmethoxy.
  • 3-7C-Cycloalkyl stands for cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl, of which cyclo- propyl and cyclopentyl are preferred
  • 3-7C-Cycloalkylmethyl stands for cyclopropylmethyl, cyclobutyl methyl, cyclopentylmethyl, cyclohexyl- methyl or cycloheptylmethyl.
  • 1-4C-Alkoxy which is completely or predominantly substituted by fluorine is, for example, the 2,2,3,3,3-pentafluoropropoxy, the perfluoroethoxy, the 1 ,2,2-trifluoroethoxy and in particular the 1 ,1 ,2,2-tetrafluoroethoxy, the 2,2,2-trifluoroethoxy, the trifluoromethoxy and the difluoromethoxy radical, of which the difluoromethoxy radical is preferred.
  • "Predominantly" in this connection means that more than half of the hydrogen atoms of the 1-4C-alkoxy group are replaced by fluorine atoms.
  • spiro-linked 5-, 6- or 7-membered hydrocarbon rings optionally interrupted by an oxygen or sulphur atom
  • the cyclopentane, cyclohexane, cycloheptane, tetrahydrofuran, tetrahydro- pyran and the tetrahydrothiophen ring may be mentioned the cyclopentane, cyclohexane, cycloheptane, tetrahydrofuran, tetrahydro- pyran and the tetrahydrothiophen ring.
  • 1-4C-Alkoxycarbonyl is a carbonyl group to which one of the abovementioned 1-4C-alkoxy radicals is bonded.
  • Examples are the methoxycarbonyl [CH 3 0-C(0)-] and the ethoxycarbonyl [CH 3 CH 2 0-C(0) ⁇ ] radical.
  • An 1-4C ⁇ Alkylcarbonylamino radical is, for example, the propionylamino [C 3 H 7 C(0)NH-] and the acetyl- amino radical [CH 3 C(0)NH-].
  • Mono- or Di-1-4C-alkylamino radicals contain in addition to the nitrogen atom, one or two of the above- mentioned 1-4C-alkyl radicals.
  • Mono- or Di-1-4C-alkylaminocarbonyl radicals contain in addition to the carbonyl group one of the abovementioned mono- or di-1-4C-alkylamino radicals. Examples which may be mentioned are the N-methyl- the N,N-dimethyl-, the N-ethyl-, the N-propyl-, the N,N-diethyl- and the N-isopropylaminocar- bonyl radical.
  • Aryl2-1-4C-alkyl radicals stand for one of the abovementioned 1-4C-alkyl radicals substituted by an Aryl2 radical. Examples which may be mentioned are the pyrid-3-ylmethyl, pyrid-4-ylmethyl or benzyl radical.
  • Hydroxycarbonyl-1-4C-alkyl stand for one of the abovementioned 1-4C-alkyl radicals substituted by a hydroxycarbonyl (carboxyl) radical.
  • Dimethylamino-1-4C-alkyl radicals stand for one of the abovementioned 1-4C-alkyl radicals substituted by a dimethylamino radical.
  • Suitable salts for compounds of the formula 1 are all acid addition salts. Particular mention may be made of the pharmacologically tolerable inorganic and organic acids customarily used in pharmacy. Those suitable are water-soluble and water-insoluble acid addition salts with acids such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulphuric acid, acetic acid, citric acid, D-gluconic acid, benzoic acid, 2-(4-hydroxybenzoyl)benzoic acid, butyric acid, sulphosalicylic acid, maleic acid, lauric acid, malic acid, fumaric acid, succinic acid, oxalic acid, tartaric acid, embonic acid, stearic acid, toluenesulphonic acid, methanesulphonic acid or 3-hydroxy-2-naphthoic acid, the acids being employed in salt preparation - depending on whether a mono- or polybasic acid is concerned and depending on which salt is
  • the compounds of the invention as well as their salts may contain, e.g. when isolated in crystalline form, varying amounts of solvents. Included within the scope of the invention are therefore all solvates and in particular all hydrates of the compounds of formula 1 as well as all solvates and in particular all hydrates of the salts of the compounds of formula 1.
  • R1 is hydrogen
  • R2 is hydrogen or 1-4C-alkyl
  • R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine,
  • R5 is 1-4C-alkoxy
  • R6 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine,
  • R7 is methyl
  • R8 is hydrogen, or wherein
  • R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofurane or tetrahydropyran ring
  • R9 is 1 -4C-alkyl, -S(0) 2 -R10, -S(0) 2 -(CH 2 ) n -R11 , -C(0)R13, -C(0)-(CH 2 ) n -R14, -(CH 2 )m-C(0)-R15 or
  • R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19, R11 is phenyl,
  • R13 is 1-4C-alkyl, phenyl, pyridyl, 2,4,6-trichlorophenyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17
  • R14 is -N(R16)R17
  • R15 is -N(R16)R17
  • R16 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl
  • R17 is 1 -7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, or
  • R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morphoIinyl-, 1 -pyrrol id inyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
  • R21 is 1-4C-alkyl, pyrid-4-yI, 2-methoxyphenyl, 1 ,1-diphenylmethyl or N-methyl-piperidin-4-yl
  • R18 is halogen, nitro, cyano, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxy which is completely or predominantly substituted by fluorine or 1-4C-alkoxycarbonyl
  • R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy
  • Aryl2 is pyridyl, phenyl or phenyl substituted by R18 and/or R19
  • m is an integer from 1 to 2
  • n is an integer from 1 to 2
  • the salts of these compounds are pyridyl, phenyl or phenyl substituted by R18 and/or R19
  • m is an integer from 1 to 2
  • n is an integer from
  • Preferred compounds of formula 1 are those, in which
  • R1 is hydrogen
  • R2 is hydrogen or methyl
  • R3 represents a phenyl derivative of formula (a)
  • R4 is 1-2C-alkoxy
  • R5 is 1-2C-alkoxy
  • R9 is -S(O) 2 -R10, -S(0) 2 -(CH 2 ) ⁇ -R11 , -C(0)R13, -C(0)-(CH 2 ) n -R14, -(CH 2 ) m -C(0)-R15 or (Aryl2)-1- 2C-alkyl,
  • R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19,
  • R11 is phenyl
  • R13 is 1-4C-alkyl, phenyl, 2,4,6-trichlorophenyl, pyridyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17
  • R14 is -N(R16)R17
  • R15 is -N(R16)R17
  • R16 is hydrogen or 1 -4C-alkyl
  • R17 is 1-4C-alkyl, or
  • R21 is 1-4C-alkyl, pyrid-4-yl, 2-methoxyphenyl or 1 ,1-diphenylmethyl
  • R18 is halogen, cyano, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R19 is 1 -4C-alkyl or 1 -4C-alkoxy
  • Aryl2 is pyridyl or phenyl, m is 1 , n is 1 , and the salts of these compounds.
  • Particularly preferred compounds of formula 1 are those in which
  • R1 is hydrogen
  • R2 is hydrogen or methyl
  • R3 represents a phenyl derivative of formula (a)
  • R4 is methoxy
  • R5 is methoxy
  • R9 is acetyl, morpholin-4-ylcarbonyl, pyridin-3-ylmethyl, 4-ethyl-piperazin-2,3-dion-1-ylcarbonyl, 4-methylpiperazin-1-ylcarbonyl, 5-dimethylamino-naphythalene-1-sulfonyl, 2-(morpholin-4-yl)-2- oxo-ethyl, 4-methylbenzenesulfonyl, methylsulfonyl, 4-chIorobenzenesulfonyl, benzylsulfonyl, 4-methoxybenzenesulfonyl, benzenesulfonyl, 2,5-dimethoxybenzenesulfonyl,
  • 2,4,6-trichlorobenzenecarbonyl 2,4,6-trichlorobenzenecarbonyl, tert-butylaminocarbonyl, dimethylaminocarbonylmethyl, 2-(4- methyl-piperazin-1-yl)-2-oxo-ethyl, 2-(4-pyridin-4-ylpiperazin-1-yl)ethanoyl, 2-[4-(2- methoxyphenyl)piperazin-1-yl]ethanoyl or 2-[4-(1 ,1-diphenylmethyl)piperazin-1-yl]ethanoyl, and the salts of these compounds.
  • R1 is hydrogen or 1-4C-alkyl
  • R2 is hydrogen or 1-4C-alkyl
  • R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R6 is 1-4C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is 1-4C-alkyl
  • R8 is hydrogen or 1-4C-alkyl
  • R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom,
  • R9 is -S(0) 2 -R10, -S(0) 2 -(CH 2 ) n -R11 or -(CH 2 ) m -S(0) 2 -R12,
  • R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19,
  • R11 is phenyl or -N(R16)R17
  • R12 is -N(R16)R17
  • R16 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
  • R21 is 1-4C-alkyl, pyrid-4-yl, pyrid-4-ylmethyl, 2-methoxyphenyl, 1 ,1-diphenylmethyl, dimethyl- amino-1-4C-alkyl, dimethylaminocarbonylmethyl, N-methyl-piperidin-4-yl, 4-morpholino-ethyl or tetrahydrofuran-2-ylmethyl,
  • R18 is halogen, nitro, cyano, carboxyl, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxy which is completely or predominantly substituted by fluorine, 1-4C-alkoxycarbonyl, amino, mono-or di-1- 4C-alkylamino, aminocarbonyl, 1-4C-alkylcarbonylamino or mono-or di-1 ⁇ 4C-alkylaminocarbonyl,
  • R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy
  • R20 is halogen, n is an integer from 1 to 4, m is an integer from 1 to 4, and the salts of these compounds.
  • Preferred compounds of formula 1 of embodiment A are those in which
  • R1 is hydrogen
  • R2 is hydrogen or methyl
  • R3 represents a phenyl derivative of formula (a)
  • R4 is 1-2C-alkoxy
  • R5 is 1-2C-alkoxy
  • R9 is -S(0) 2 -R10 or -S(0) 2 -(CH 2 ) n -R11 ,
  • R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19,
  • R11 is phenyl
  • R16 is hydrogen or 1-4C-alkyl
  • R17 is 1-4C-alkyl
  • R18 is halogen, cyano, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R19 is 1 -4C-alkyl or 1 -4C-alkoxy
  • n is 1 , and the salts of these compounds.
  • Particularly preferred compounds of formula 1 of embodiment A are those in which
  • R1 is hydrogen
  • R2 is hydrogen or methyl
  • R3 represents a phenyl derivative of formula (a)
  • R4 is methoxy
  • R5 is methoxy
  • R9 is 5-dimethylamino-naphythalene-1-sulfonyl, 4-methylbenzenesulfonyl, methylsulfonyl, 4-chlorobenzenesuIfonyl, benzylsulfonyl, 4-methoxybenzenesulfonyl, ben ⁇ enesulfonyl, 2,5-dimethoxybenzenesulfonyl, 2-cyanobenzenesulfonyl, thiophen-2-ylsulfonyl,
  • R1 is hydrogen or 1-4C-alkyl
  • R2 is hydrogen or 1-4C-alkyl
  • R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R6 is 1-4C-aIkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein
  • R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom,
  • R9 is -C(0)R13, -C(0)-(CH 2 ) n -R14 or -(CH 2 )m-C(0)-R15,
  • R13 is 1-4C-alkyl, hydroxycarbonyl-1-4C-alkyl, phenyl, 2,4,6-trichlorophenyl, pyridyl, 4-ethyl-piperazin- 2,3-dion-1-yl or -N(R16)R17,
  • R14 is -N(R16)R17
  • R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
  • R16 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
  • R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrrolidinyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
  • R21 is 1-4C-alkyl, pyrid-4-yl, pyrid-4-ylmethyl, 2-methoxyphenyl, 1 ,1-diphenylmethyl, dimethyl- amino-1-4C-alkyl, dimethylaminocarbonylmethyl, N-methyl-piperidin-4-yl, 4-morpholino-ethyl or tetrahydrofuran-2-ylmethyl, R18 is halogen, nitro, cyano, carboxyl, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxy which is completely or predominantly substituted by fluorine, 1-4C-alkoxycarbonyl, amino, mono-or di-
  • R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy, R20 is halogen, n is an integer from 1 to 4, m is an integer from 1 to 4, and the salts of these compounds.
  • Preferred compounds of formula 1 of embodiment B are those in which
  • R1 is hydrogen
  • R2 is hydrogen or methyl
  • R3 represents a phenyl derivative of formula (a)
  • R4 is 1-2C-alkoxy
  • R5 is 1-2C-alkoxy
  • R9 is -C(0)R13, -C(0)-(CH 2 ) n -R14 or -(CH 2 ) m -C(0)-R15,
  • R13 is 1-4C-alkyl, phenyl, 2,4,6-trichlorophenyl, pyridyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17
  • R14 is -N(R16)R17
  • R15 is -N(R16)R17
  • R16 is hydrogen or 1 -4C-alkyl
  • R17 is 1-4C-alkyl, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a
  • R21 is 1-4C-alkyl, pyrid-4-yl, 2-methoxyphenyl or 1 ,1-diphenylmethyl, m is 1 , n is 1 , and the salts of these compounds.
  • Particularly preferred compounds of formula 1 of embodiment B are those in which
  • R1 is hydrogen
  • R2 is hydrogen or methyl
  • R3 represents a phenyl derivative of formula (a)
  • R4 is methoxy
  • R5 is methoxy
  • R9 is acetyl, morpholin-4-ylcarbonyl, 4-ethyl-piperazin-2,3-dion-1-ylcarbonyl, 4-methylpiperazin-1- ylcarbonyl, 2-(morpholin-4-yl)-2-oxo-ethyl, benzoyl, pyridin-3-ylcarbonyl,
  • R1 is hydrogen or 1-4C-alkyl
  • R2 is hydrogen or 1-4C-alkyl
  • R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is 1 -4C-alkoxy or 1 -4C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R6 is 1-4C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is 1-4C-alkyl
  • R8 is hydrogen or 1-4C-alkyl
  • R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom
  • R9 is hydrogen, 1-4C-alkyl, -S(O) 2 -R10, -S(0) 2 -(CH 2 ) n -R11 , -(CH 2 ) m -S(0) 2 -R12, -C(0)R13, -C(0)-(CH 2 ) n -R14, -(CH 2 ) m -C(0)-R15, Aryll or (Aryl2)-1-4C-alkyl,
  • R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19,
  • R11 is -N(R16)R17
  • R12 is -N(R16)R17
  • R13 is 1-4C-alkyl, hydroxycarbonyl-1-4C-alkyl, phenyl, pyridyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17,
  • R14 is -N(R16)R17
  • R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
  • R16 and R17 are independent from each other hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkyl- methyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrroli- dinyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
  • R21 is 1-4C-alkyI, pyrid-4-yl, pyrid-4-ylmethyl, dimethylamino ⁇ 1-4C-alkyl, dimethylaminocarbon- ylmethyl, N-methyl-piperidin-4-yl, 4-morpholino-ethyl or tetrahydrofuran-2-ylmethyl
  • R18 is halogen, nitro, cyano, carboxyl, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxycarbonyl, amino, mono-or di-1-4C-alkylamino, aminocarbonyl, 1-4C-alkylcarbonylamino or mono-or di-
  • R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy
  • R20 is halogen
  • Aryll is pyrimidin-2-yl, thieno-[2,3-d]pyrimidin-4-yl, 1-methyl-1 H-pyrazolo-[3,4-d]pyrimidin-4-yl, thiazolyl, imidazolyl, furanyl, pyridyl, phenyl or phenyl substituted by R18 and/or R19
  • Aryl2 is pyridyl, phenyl, phenyl substituted by R18 and/or R19, 2-oxo-2H-chromen-7-yl or 4-(1 ,2,3-thia- diazol-4-yl)phenyl, n is an integer from 1 to 4, m is an integer from 1 to 4, and the salts of these compounds.
  • R1 is hydrogen
  • R2 is hydrogen or 1-4C-alkyl
  • R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine,
  • R5 is 1-4C-alkoxy
  • R6 is 1-2C-alkoxy or 1 -2C-alkoxy which is completely or predominantly substituted by fluorine,
  • R7 is methyl
  • R8 is hydrogen, or wherein
  • R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofurane or tetrahydropyran ring
  • R9 is hydrogen, 1 -4C-alkyl, -S(0) 2 -R10, -C(0)R13, -(CH 2 ) m -C(0)-R15, Aryll or (Aryl2)-1 -4C-alkyl
  • R10 is 1-4C-alkyl, 5-dimethylaminonaphthaIin-l-yl or -N(R16)R17
  • R13 is 1-4C-alkyl
  • R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and
  • R1 is hydrogen
  • R2 is hydrogen or methyl
  • R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is 1-2C-alkoxy
  • R5 is 1-4C-alkoxy
  • R6 is 1-2C-alkoxy
  • R7 is methyl
  • R8 is hydrogen
  • R9 is hydrogen, -S(0) 2 -R10, -C(0)R13, -(CH 2 ) m -C(0)-R15 or (Aryl2)-1 -2C-alkyl
  • R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl or -N(R16)R17
  • R13 is 1-4C-alkyl
  • R15 is -N(R16)R17
  • R16 and R17 are independent from each other hydrogen or 1-4C-alkyl, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl ring, a 1-pipe- ridinyl ring or a 4-methyl-piperazin-1-yI ring
  • Aryl2 is pyridyl or phenyl
  • m is
  • Preferred compounds of formula 1 of embodiment C are those in which
  • R1 is hydrogen
  • R2 is methyl
  • R3 represents a phenyl derivative of formula (a)
  • R4 is methoxy
  • R5 is methoxy
  • R9 is acetyl, morpholin-4-ylcarbonyl, pyridin-3-ylmethyl, 4-ethyl-piperazin-2,3-dion-1-yl, 4-methyIpipe- razin-1-yl, 5-dimethylamino-naphythalene-1-sulfonyl or morpho!in-4-yl-2-oxo-ethyl, and the salts of these compounds.
  • a special embodiment of the compounds of the present invention include those compounds of formula 1 in which R3 represents a phenyl derivative of formula (a).
  • Another special embodiment of the compounds of the present invention include those compounds of formula 1 in which R3 represents a phenyl derivative of formula (a) and R4 and R5 have the meaning methoxy.
  • a further special embodiment of the compounds of the present invention include those compounds of formula 1 in which R1 is hydrogen, R2 is hydrogen or methyl, R3 represents a phenyl derivative of formula (a) and R4 and R5 have the meaning methoxy.
  • the compounds of formula 1 are can be chiral compounds. Chiral centers exist in the compounds of formula 1 in positions 4 and 5 of the pyridazinone ring, if R1 and/or R2 have a meaning other than hydrogen.
  • R3 represents a phenyl derivative of formula (b) there is one further chiral center in the dihydrofuran-ring, if the substituents -R7 and -CH 2 R8 are not identical.
  • the invention includes all conceivable pure diastereomers and pure enantiomers of the compounds of formula 1 , as well as all mixtures thereof independent from the ratio, including the racemates.
  • Reaction scheme 1 The compounds according to the invention can be prepared, for example, as described in Reaction scheme 1.
  • Reaction scheme 1 Reaction scheme 1 :
  • Reaction scheme 1 shows that the compounds of formula 1 can be, for example, prepared starting from 4-oxo-piperidine-1 -carboxylic acid tert-butyl ester which is reacted in a first reaction step with tert- butylcarbazate to give 4-(tert-Butoxycarbonyl-hydrazono)-piperidine-1 -carboxylic acid tert-butyl ester (starting compound A6).
  • Compound A6 is reduced with, for example, the boran tetrahydrofurane complex to give 4-(N'-tert-Butoxycarbonyl-hydrazino)-piperidine-1 -carboxylic acid tert-butyl ester (starting compound A5).
  • Treatment of compound A5 with concentrated hydrochloric acid results in the formation of piperidin-4-yl-hydrazine dihydrochloride (starting compound A1).
  • the substances according to the invention are isolated and purified in a manner known per se, e.g. by distilling off the solvent in vacuo and recrystallising the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as column chromatography on a suitable support material.
  • Salts are obtained by dissolving the free compound in a suitable solvent (for example a ketone like acetone, methylethylketone, or methylisobutylketone, an ether, like diethyl ether, tetrahydrofuran or diox- ane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or a low molecular weight aliphatic alcohol, such as ethanol, isopropanol) which contains the desired acid, or to which the desired acid is then added.
  • the salts are obtained by filtering, reprecipitating, precipitating with a non-solvent for the addition salt or by evaporating the solvent. Salts obtained can be converted by basification into the free compounds which, in turn, can be converted into salts. In this manner, pharmacologically non- tolerable salts can be converted into pharmacologically tolerable salts.
  • RT room temperature
  • h hour(s)
  • min for minute(s)
  • M. p. melting point
  • the compounds according to the invention have valuable pharmacological properties which make them commercially utilizable.
  • selective inhibitors of type 4 or type 3 and 4 of cyclic nucleotide phosphodi- esterase PDE4, PDE3/4
  • they are suitable on the one hand as bronchial therapeutics (for the treatment of airway obstructions on account of their dilating action and cilia-stimulating action but also on account of their respiratory rate- and respiratory drive-increasing action), but on the other hand especially for the treatment of disorders of inflammatory nature, e.g.
  • mediators such as interferons, members of the tumour necrosis factor family, interieukins, chemokines, colony-stimulating factors, growth factors, lipid mediators (e.g., inter alia, PAF, platelet-activating factor), bacterial factors (e.g. LPS), immunoglobulins, oxygen free radicals and related free radicals (e.g. nitrogen monoxide NO), biogenic amines (e.g. histamine, serotonin), kinins (e.g.
  • bradykinin neurogenic mediators (such as substance P, neurokinin), proteins such as, for example, granular contents of leukocytes (inter alia cationic proteins of eosinophils) and adherence proteins (e.g. integrins).
  • the compounds according to the invention have smooth muscle-relaxant action, e.g. in the region of the bronchial system, of the blood circulation, and of the efferent urinary passages. Furthermore, they have cilia frequency- increasing action, for example in the bronchial system.
  • the compounds according to the invention can be employed as therapeutics in human and veterinary medicine, where they can be used, for example, for the treatment and prophylaxis of the following diseases: acute and chronic (in particular inflammatory and allergen-induced) respiratory disorders of various origins (bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD); disorders associated with impaired cilia function or increased demands on ciliar clearance (bronchitis, mucoviscidosis), dermatoses (especially of proliferative, inflammatory and allergic type) such as, for example, psoriasis (vulgaris), toxic and allergic contact eczema, atopic eczema, seborrheic eczema, lichen simplex, sunburn, pruritus in the anogenital area, alopecia areata, hypertrophic scars, discoid lupus erythematosus, folli
  • acute and chronic respiratory disorders of various origins
  • the compounds according to the invention can also be used for the treatment of high blood pressure disorders of various origins such as, for example, pulmonary high blood pressure and the concomitant symptoms associated therewith, for the treatment of erectile dysfunction or colics of the kidneys and the ureters in connection with kidney stones.
  • PDE inhibitors such as, for example, cardiac insufficiency, and also as anti- thrombotic, platelet aggregation-inhibiting substances.
  • the invention further relates to a method for the treatment of mammals including humans who are suffering from one of the abovementioned diseases.
  • the method comprises administering a therapeutically effective and pharmacologically acceptable amount of one or more of the compounds according to the invention to the sick mammal.
  • the invention further relates to the compounds according to the invention for use in the treatment and/or prophylaxis of diseases, in particular the diseases mentioned.
  • the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of the diseases mentioned.
  • the invention furthermore relates to pharmaceutical compositions for the treatment and/or prophylaxis of the diseases mentioned and which contain one or more of the compounds according to the invention.
  • a further subject of the invention is a commercial product, consisting of a customary secondary pack, a primary pack containing the pharmaceutical composition (for example an ampoule or a blister pack) and, if desired, an information leaflet, the pharmaceutical composition exhibiting antagonistic action against cyclic nucleotide phosphodiesterases of type 4 or types 3 and 4 and leading to the attenuation of the symptoms of illnesses which are connected with cyclic nucleotide phosphodiesterases of type 4 or types 3 and 4, and the suitability of the pharmaceutical composition for the prophylaxis or treatment of illnesses which are connected with cyclic nucleotide phosphodiesterases of type 4 or types 3 and 4 being indicated on the secondary pack and/or on the information leaflet of the commercial product, and the pharmaceutical composition containing one or more compounds of formula 1 according to the invention.
  • the substances according to the invention are also suitable for combination with other substances which bring about stimulation of cAMP, such as prostaglandins (PGE2, PGI2 and prostacy- clin) and their derivatives, direct adenylate cyclase stimulators such as forskolin and related substances, or substances indirectly stimulating adenylate cyclase, such as catecholamines and adrenergic receptor agonists, in particular beta-mimetics.
  • PGE2 prostaglandins
  • PGI2 prostacy- clin
  • prostacy- clin adenylate cyclase stimulators
  • adenylate cyclase such as catecholamines and adrenergic receptor agonists, in particular beta-mimetics.
  • they in this case display a synergistic, superadditive activity. This comes to bear, for example, in their use in combination with PGE2 for the treatment of pulmonary hypertension.
  • compositions are prepared by processes which are known per se and familiar to the person skilled in the art.
  • the compounds according to the invention are either employed as such, or preferably in combination with suitable pharmaceutical auxiliaries and/or excipients, e.g. in the form of tablets, coated tablets, capsules, cap- lets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between 0.1 and 95% and where, by the appropriate choice of the auxiliaries and/or excipients, a pharmaceutical administration form (e.g. a delayed release form or an enteric form) exactly suited to the active compound and/or to the desired onset of action can be achieved.
  • suitable pharmaceutical auxiliaries and/or excipients e.g. in the form of tablets, coated tablets, capsules, cap- lets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being
  • auxiliaries or excipients which are suitable for the desired pharmaceutical formulations on account of his/her expert knowledge.
  • solvents for example antioxidants, dispersants, emulsifiers, preservatives, solubilizers, colorants, complexing agents or permeation promoters, can be used.
  • compositions according to the invention may be performed in any of the generally accepted modes of administration available in the art.
  • suitable modes of administration include intravenous, oral, nasal, parenteral, topical, transdermal and rectal delivery. Oral delivery is preferred.
  • the compounds according to the invention are preferably also administered by inhalation in the form of an aerosol; the aerosol particles of solid, liquid or mixed composition preferably having a diameter of 0.5 to 10 ⁇ m, advantageously of 2 to 6 ⁇ m.
  • Aerosol generation can be carried out, for example, by pressure-driven jet atomizers or ultrasonic atomizers, but advantageously by propellant-driven metered aerosols or propellant-free administration of micronized active compounds from inhalation capsules.
  • the administration forms additionally contain the required excipients, such as, for example, propellants (e.g. Frigen in the case of metered aerosols), surface-active substances, emulsifiers, stabilizers, preservatives, flavorings, fillers (e.g. lactose in the case of powder inhalers) or, if appropriate, further active compounds.
  • propellants e.g. Frigen in the case of metered aerosols
  • surface-active substances e.g. Frigen in the case of metered aerosols
  • emulsifiers emulsifiers
  • stabilizers emulsifiers
  • preservatives e.g., emulsifiers, stabilizers, preservatives
  • flavorings e.g. lactose in the case of powder inhalers
  • fillers e.g. lactose in the case of powder inhalers
  • the compounds according to the invention are in particular administered in the form of those pharmaceutical compositions which are suitable for topical application.
  • suitable pharmaceutical formulations are, for example, powders, emulsions, suspensions, sprays, oils, ointments, fatty ointments, creams, pastes, gels or solutions.
  • compositions according to the invention are prepared by methods known per se.
  • the dosage of the active compounds takes place in the order of magnitude customary for PDE inhibitors.
  • topical application forms (such as, for example, ointments) for the treatment of dermatoses contain the active compounds in a concentration of, for example, 0.1-99%.
  • the dose for administration by inhalation is customarily between 0.1 and 3 mg per day.
  • the customary dose in the case of systemic therapy p.o. or i.v.
  • the second messenger cyclic AMP (cAMP) is known for inhibiting inflammatory cells and cells responsible for the immunological response.
  • the PDE4 isoenzyme is widely distributed in cells associated with the initiation and spreading of inflammatory diseases (H Tenor and C Schudt, in "Phosphodiester- ase Inhibitors", 21-40, “The Handbook of Immunopharmacology", Academic Press 1996); its inhibition results in the increase of the intracellular cyclic AMP concentration and thus in the inhibition of cellular activation (JE Souness et al., Immunopharmacology 47: 127-162, 2000).
  • Examples are the superoxide production of neutrophilic (C Schudt et al., Arch Pharmacol 344: 682-690, 1991 ) or eosinophilic (A Hatzel- mann et al., Brit J Pharmacol 114: 821-831 , 1995) granulocytes, which can be measured as luminol- enhanced chemiluminescence, or the synthesis of tumor necrosis factor alpha (TNF ⁇ ) in monocytes, macrophages or dendritic cells (Gantner et al., Brit J Pharmacol 121 : 221-231 , 1997 and Pulmonary Pharmacol Therap 12: 377-386, 1999).
  • neutrophilic C Schudt et al., Arch Pharmacol 344: 682-690, 1991
  • eosinophilic A Hatzel- mann et al., Brit J Pharmacol 114: 821-831 , 1995
  • granulocytes which can be measured as luminol- enhanced chemilumin
  • the immunomodulatory potential of the PDE4 inhibitors furthermore becomes apparent by inhibition of T-cell responses such as cytokine synthesis or proliferation (DM Essayan, Biochem Pharmacol 57: 965-973, 1999).
  • PDE4 inhibition by the substances according to the invention is thus a central indicator of the suppression of inflammatory processes.
  • Some of the cells involved in inflammatory processes contain, in addition to PDE4, also the PDE3 isoenzyme which likewise contributes to the total cAMP metabolism of these cells. Examples are endothelial cells, mast cells, T-cells, macrophages and dendritic cells.
  • the inhibitory action of PDE4 inhibitors can be enhanced by additional PDE3 inhibition.
  • inhibition of the PDE3 activity is furthermore important for (broncho)relaxation (A Hatzelmann et al., in "Phosphodiesterase Inhibitors", 147-160, “The Handbook of Immunopharmacology", Academic Press, 1996).
  • the PDE activity was determined according to Thompson et al. (Adv Cycl Nucl Res 10: 69-92, 1979) with some modifications (Bauer and Schwabe, Naunyn-Schmiedeberg's Arch Pharmacol 311 : 193-198, 1980).
  • the test samples contained 20 mM Tris (pH 7.4), 5 mM MgCI 2 , 0.5 ⁇ M cAMP or cGMP, [ 3 H]cAMP or [ 3 H]cGMP (about 30 000 cpm/sample), the PDE isoenzyme-specific additives described in greater detail below, the indicated concentrations of inhibitor and an aliquot of the enzyme solution in a total sample volume of 200 ⁇ l.
  • Dilution series of the compounds according to the invention were prepared in DMSO and further diluted in the samples [1 :100 (v/v)], to give the desired end concentration of the inhibitors at a DMSO concentration of 1 % (v/v), which for its part has only a minute effect on PDE activity.
  • the reaction was started by addition of the substrate (cAMP or cGMP).
  • the samples were incubated at 37°C for a further 15 min.
  • the reaction was terminated by addition of 50 ⁇ l 0.2 N HCl.
  • 25 ⁇ g 5'-nucleotidase (snake venom from Crotalus atrox)
  • the mixture was again incubated at 37°C for 10 min and the samples were then applied to QAE Sephadex A-25 columns (sample volume 1 ml). The columns were eluted with 2 ml of 30 mM ammonium formate (pH 6.0).
  • the radioactivity of the eluate was measured and corrected by the corresponding blank values (measured in the presence of denatured protein); the blank values were less than 5% of the total radioactivity. In no case did the proportion of hydrolyzed nucleotide exceed 30% of the original substrate concentration.
  • PDE3 cGMP-inhibited was investigated in homogenates of human platelets (see Schudt et al., Bio- chem Pharmacol 1991 : 42, 153-162) using cAMP or cGMP as substrate.
  • PDE4 cAMP-specific was investigated in the cytosol of human polymorphonuclear leukocytes (PMNL) [isolated from leukocyte concentrates, see Schudt et al., Arch Pharmacol 1991 : 344, 682-690] using cAMP as substrate.
  • PMNL human polymorphonuclear leukocytes
  • the IC 50 values were determined from the concentration-inhibition curves by nonlinear regression.
  • the cDNA for PDE3A1 (GB no. U36798) was isolated in 2 steps using PCR.
  • a 3' terminal cDNA fragment of PDE3A1 was amplified from fat cells cDNA (Clontech, Palo Alto) using primers OZ 458 (5'- AAAGTCGACTCACTGGTCTGGCTTTTGG -3') and OZ 457 (5'- GTCGACCAGGTGCCCTCGCTA - 3').
  • the 5' terminal cDNA fragment of PDE3A1 was amplified from Placenta cDNA (Clontech, Palo Alto) using primers OZ 455 (5'- ATGGCAGTGCCCGGCGACGCT -3') and OZ 456 (5'- GTCGACTTTGCTTTTTAGCCT -3').
  • the PCR products were cloned into pCR2.1-Topo (Invitrogen, Groningen, NL) under standard conditions (the manufacturer's instructions).
  • the 3' fragment was cut out with Hindll and cloned into the Hindll site of the construct carrying the 5' fragment.
  • the whole ORF was subcloned into pBacPak ⁇ (Clontech, Palo Alto) using EcoRI.
  • Aminoacid 12 is Aspartic Acid like in sequence GB no. AJ005036, aa 69 and aa 110 are respective Serine and Glycine like in both sequences GB no. AJ005036 and GB no. M91667.
  • the PDE4B2 (GB no. M97515) was a gift of Prof. M. Conti (Stanford University, USA). It was amplified from the original plasmid (pCMV5) via PCR with primers Rb9 (5'- GCCAGCGTGCAAATAATGAAGG - 3') and Rb10 (5'- AGAGGGGGATTATGTATCCAC -3') and cloned into the pCR-Bac vector (Invitrogen, Groningen, NL).
  • the recombinant baculovirus was prepared by means of homologous recombination in SF9 insect cells.
  • the expression plasmids were cotransfected with Bac-N-Blue (Invitrogen, Groningen, NL) or Baculo-Gold DNA (Pharmingen, Hamburg) using a standard protocol (Pharmingen, Hamburg).
  • Wt virus-free recombinant virus supematants were selected using plaque assay methods. After that, high- titre virus supematants were prepared by amplifying 3 times.
  • PDEs were expressed in SF21 cells by infecting 2 ⁇ 10 6 cells/ml with an MOI (multiplicity of infection) between 1 and 10 in serum-free SF900 medium (Life Technologies, Paisley, UK). The cells were cultured at 28°C for 48 - 72 hours, after which they were pelleted for 5-10 min at 1000 g and 4°C.
  • the SF21 insect cells were resuspended, at a concentration of approx. 10 7 cells/ml, in ice-cold (4°C) homogenization buffer (20 mM Tris, pH 8.2, containing the following additions: 140 mM NaCI, 3.8 mM KCl, 1 mM EGTA, 1 mM MgCI 2 , 10 mM ⁇ -mercaptoethanol, 2 mM benzamidine, 0.4 mM Pefablock, 10 ⁇ M leupeptin, 10 ⁇ M pepstatin A, 5 ⁇ M trypsin inhibitor) and disrupted by ultrasonication.
  • ice-cold (4°C) homogenization buffer (20 mM Tris, pH 8.2, containing the following additions: 140 mM NaCI, 3.8 mM KCl, 1 mM EGTA, 1 mM MgCI 2 , 10 mM ⁇ -mercaptoethanol, 2 mM benzamidine, 0.4 m
  • the ho- mogenate was then centrifuged for 10 min at 1000 ⁇ g and the supernatant was stored at -80°C until subsequent use (see below).
  • the protein content was determined by the Bradford method (BioRad, Kunststoff) using BSA as the standard.
  • PDE3A1 and PDE4B2 activities were inhibited by the said compounds in a modified SPA (scintillation proximity assay) test, supplied by Amersham Biosciences (see procedural instructions "phosphodi- esterase [3H]cAMP SPA enzyme assay, code TRKQ 7090"), carried out in 96-well microtitre plates (MTP's).
  • modified SPA sintillation proximity assay
  • the test volume is 100 ⁇ l and contains 20 mM Tris buffer (pH 7.4), 0.1 mg of BSA (bovine serum albumin)/ml, 5 mM Mg 2+ , 0.5 ⁇ M cAMP (including about 50,000 cpm of [3H]cAMP), 1 ⁇ l of the respective substance dilution in DMSO and sufficient recombinant PDE (1000 ⁇ g supernatant, see above) to ensure that 10-20% of the cAMP is converted under the said experimental conditions.
  • the final concentration of DMSO in the assays (1 % v/v) does not substantially affect the activity of the PDEs investigated.
  • the reaction is started by adding the sub- strate (cAMP) and the assays are incubated for a further 15 min; after that, they are stopped by adding SPA beads (50 ⁇ l).
  • cAMP sub- strate
  • the SPA beads had previously been resuspended in water, but were then diluted 1 :3 (v/v) in water; the diluted solution also contains 3 mM IBMX to ensure a complete PDE activity stop.
  • the MTP's are analyzed in commercially available luminescence detection devices.
  • the corresponding IC 50 values of the compounds for the inhibition of PDE activities are determined from the concentration- effect curves by means of non-linear regression.
  • the inhibitory values of the compounds 1-22 and 27 have been determined according to Method A.
  • the inhibitory values of the compounds 23-26, 28 and 29-31 have been determined according to Method B.

Landscapes

  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Dermatology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Pulmonology (AREA)
  • Diabetes (AREA)
  • Ophthalmology & Optometry (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Psychiatry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • AIDS & HIV (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Otolaryngology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The compounds of a certain formula (1), in which the given substituents have the meanings as given in the description, are novel effective PDE4 or PDE3/4 inhibitors.

Description

PYRIDAZINONE-DERIVATIVES AS PDΞ4 INHIBITORS
Field of application of the invention
The invention relates to novel pyridazinone-derivatives, which are used in the pharmaceutical industry for the production of pharmaceutical compositions.
Known technical background
International Patent Applications W098/31674 (= USP 6,103,718), WO99/31071 , WO99/31090, WO99/47505 (= USP 6,255,303), WO01/19818, WO01/30766, WO01/30777, WO01/94319, WO02/064584, WO02/085885 and WO02/085906 disclose phthalazinone derivatives having PDE4 inhibitory properties. In the International Patent Application W094/12461 and in the European Patent Application EP 0 763 534 3-aryl-pyridazin-6-one and arylalkyl-diazinone derivatives are described as selective PDE4 inhibitors. International Patent Application WO93/07146 (= USP 5,716,954) discloses benzo and pyrido pyridazinone and pyridazinthione compounds with PDE4 inhibiting activity.
In the Journal of Medicinal Chemistry, Vol. 33, No. 6, 1990, pp. 1735-1741 1 ,4-Bis(3-oxo-2,3- dihydropyridazin-6-yl)benzene derivatives are described as potent phosphodiesterase inhibitors and inodilators. In the Journal of Medicinal Chemistry Vol. 45 No.12, 2002, pp. 2520-2525, 2526-2533 and in Vol. 44, No. 16, 2001 , pp. 2511-2522 and pp. 2523-2535 phthalazinone derivatives are described as selective PDE4 inhibitors.
Description of the invention
It has now been found that the pyridazinone-derivatives, which are described in greater details below, have surprising and particularly advantageous properties.
The invention thus relates to compounds of formula 1
Figure imgf000003_0001
in which
R1 is hydrogen or 1-4C-alkyl, R2 is hydrogen or 1-4C-alkyl, R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000003_0002
wherein
R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkyl methoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine,
R6 is 1-4C-alkoxy, 3-5C-cycIoalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein
R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom,
R9 is 1-4C-alkyl, -S(O)2-R10, -S(0)2-(CH2)n-R11 , -(CH2)m-S(0)2-R12, -C(0)R13, -C(0)-(CH2)n-R14, -(CH2)m-C(0)-R15, Aryh or (Aryl2)-1-4C-alkyl,
R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19,
R11 is phenyl or -N(R16)R17,
R12 is -N(R16)R17,
R13 is 1-4C-alkyl, hydroxycarbonyl-1-4C-alkyl, phenyl, 2,4,6-trichlorophenyl, pyridyl, 4-ethyl-piperazin- 2,3-dion-1-yl or -N(R16)R17, R14 is -N(R16)R17,
R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
R16 is hydrogen, 1-7C-alkyI, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
R17 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20, or
R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrrolidinyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
Figure imgf000004_0001
wherein
R21 is 1-4C-aIkyl, pyrid-4-yl, pyrid-4-yl methyl, 2-methoxyphenyl, 1 ,1-diphenylmethyl, dimethyl- amino-1-4C-alkyl, dimethylaminocarbonylmethyl, N-methyl-piperidin-4-yl, 4-morpholino-ethyl or tetrahydrofuran-2-ylmethyl, R18 is halogen, nitro, cyano, carboxyl, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxy which is completely or predominantly substituted by fluorine, 1-4C-alkoxycarbonyl, amino, mono-or di-
1-4C-alkylamino, aminocarbonyl, 1-4C-alkylcarbonylamino or mono-or di-1-4C- alkylaminocarbonyl, R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy, R20 is halogen, Aryh is pyrimidin-2-yl, thieno-[2,3-d]pyrimidin-4-yl, 1-methyl-1 H-pyrazolo-[3,4-d]pyrimidin-4-yl, thiazolyl, imidazolyl, furanyl, pyridyl, phenyl or phenyl substituted by R18 and/or R19, Aryl2 is pyridyl, phenyl, phenyl substituted by R18 and/or R19, 2-oxo-2H-chromen-7-yl or 4-(1 ,2,3-thia- diazol-4-yl)phenyl, n is an integer from 1 to 4, m is an integer from 1 to 4, and the salts of these compounds.
1-4C-Alkyl is a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, ethyl and methyl radicals.
1-7C-Alkyl is a straight-chain or branched alkyl radical having 1 to 7 carbon atoms. Examples are the heptyl, isoheptyl (5-methylhexyl), hexyl, isohexyl (4-methylpentyl), neohexyl (3,3-dimethylbutyl), pentyl, isopentyl (3-methylbutyl), neopentyl (2,2-dimethylpropyl), butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, ethyl and methyl radicals. 1-4C-Alkoxy is a radical which, in addition to the oxygen atom, contains a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Alkoxy radicals having 1 to 4 carbon atoms which may be mentioned in this context are, for example, the butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, iso- propoxy, ethoxy and methoxy radicals.
1-8C-Alkoxy is a radical which, in addition to the oxygen atom, contains a straight-chain or branched alkyl radical having 1 to 8 carbon atoms. Alkoxy radicals having 1 to 8 carbon atoms which may be mentioned in this context are, for example, the octyloxy, heptyloxy, isoheptyloxy (5-methylhexyloxy), hexyloxy, isohexyloxy (4-methylpentyloxy), neohexyloxy (3,3-dimethylbutoxy), pentyioxy, isopentyloxy (3-methylbutoxy), neopentyloxy (2,2-dimethylpropoxy), butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, isopropoxy, ethoxy and methdxy radicals.
Halogen within the meaning of the present invention is bromine, chlorine or fluorine.
3-7C-Cycloalkoxy stands for cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy or cyclo- heptyloxy, of which cyclopropyloxy, cyclobutyloxy and cyclopentyloxy are preferred.
3-7C-CycloalkyImethoxy stands for cyclopropylmethoxy, cyclobutylmethoxy, cyclopentylmethoxy, cyclo- hexylmethoxy or cycloheptylmethoxy, of which cyclopropylmethoxy, cyclobutylmethoxy and cyclopentylmethoxy are preferred.
3-5C-Cycloalkoxy stands for cyclopropyloxy, cyclobutyloxy and cyclopentyloxy.
3-5C-Cycloalkylmethoxy stands for cyclopropylmethoxy, cyclobutylmethoxy and cyclopentylmethoxy.
3-7C-Cycloalkyl stands for cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl, of which cyclo- propyl and cyclopentyl are preferred
3-7C-Cycloalkylmethyl stands for cyclopropylmethyl, cyclobutyl methyl, cyclopentylmethyl, cyclohexyl- methyl or cycloheptylmethyl.
1-4C-Alkoxy which is completely or predominantly substituted by fluorine is, for example, the 2,2,3,3,3-pentafluoropropoxy, the perfluoroethoxy, the 1 ,2,2-trifluoroethoxy and in particular the 1 ,1 ,2,2-tetrafluoroethoxy, the 2,2,2-trifluoroethoxy, the trifluoromethoxy and the difluoromethoxy radical, of which the difluoromethoxy radical is preferred. "Predominantly" in this connection means that more than half of the hydrogen atoms of the 1-4C-alkoxy group are replaced by fluorine atoms. As spiro-linked 5-, 6- or 7-membered hydrocarbon rings, optionally interrupted by an oxygen or sulphur atom, may be mentioned the cyclopentane, cyclohexane, cycloheptane, tetrahydrofuran, tetrahydro- pyran and the tetrahydrothiophen ring.
1-4C-Alkoxycarbonyl is a carbonyl group to which one of the abovementioned 1-4C-alkoxy radicals is bonded. Examples are the methoxycarbonyl [CH30-C(0)-] and the ethoxycarbonyl [CH3CH20-C(0)~] radical.
An 1-4C~Alkylcarbonylamino radical is, for example, the propionylamino [C3H7C(0)NH-] and the acetyl- amino radical [CH3C(0)NH-].
Mono- or Di-1-4C-alkylamino radicals contain in addition to the nitrogen atom, one or two of the above- mentioned 1-4C-alkyl radicals. Preferred are the di-1-4C-alkylamino radicals, especially the dimeth- ylamino, the diethylamino and the diisopropylamino radical.
Mono- or Di-1-4C-alkylaminocarbonyl radicals contain in addition to the carbonyl group one of the abovementioned mono- or di-1-4C-alkylamino radicals. Examples which may be mentioned are the N-methyl- the N,N-dimethyl-, the N-ethyl-, the N-propyl-, the N,N-diethyl- and the N-isopropylaminocar- bonyl radical.
(Aryl2)-1-4C-alkyl radicals stand for one of the abovementioned 1-4C-alkyl radicals substituted by an Aryl2 radical. Examples which may be mentioned are the pyrid-3-ylmethyl, pyrid-4-ylmethyl or benzyl radical.
Hydroxycarbonyl-1-4C-alkyl stand for one of the abovementioned 1-4C-alkyl radicals substituted by a hydroxycarbonyl (carboxyl) radical.
Dimethylamino-1-4C-alkyl radicals stand for one of the abovementioned 1-4C-alkyl radicals substituted by a dimethylamino radical.
Suitable salts for compounds of the formula 1 are all acid addition salts. Particular mention may be made of the pharmacologically tolerable inorganic and organic acids customarily used in pharmacy. Those suitable are water-soluble and water-insoluble acid addition salts with acids such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulphuric acid, acetic acid, citric acid, D-gluconic acid, benzoic acid, 2-(4-hydroxybenzoyl)benzoic acid, butyric acid, sulphosalicylic acid, maleic acid, lauric acid, malic acid, fumaric acid, succinic acid, oxalic acid, tartaric acid, embonic acid, stearic acid, toluenesulphonic acid, methanesulphonic acid or 3-hydroxy-2-naphthoic acid, the acids being employed in salt preparation - depending on whether a mono- or polybasic acid is concerned and depending on which salt is desired - in an equimolar quantitative ratio or one differing therefrom. Pharmacologically intolerable salts, which can be obtained, for example, as process products during the preparation of the compounds according to the invention on an industrial scale, are converted into pharmacologically tolerable salts by processes known to the person skilled in the art.
According to expert's knowledge the compounds of the invention as well as their salts may contain, e.g. when isolated in crystalline form, varying amounts of solvents. Included within the scope of the invention are therefore all solvates and in particular all hydrates of the compounds of formula 1 as well as all solvates and in particular all hydrates of the salts of the compounds of formula 1.
Compounds of formula 1 to be emphasized are those in which
R1 is hydrogen,
R2 is hydrogen or 1-4C-alkyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000007_0001
wherein
R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine,
R5 is 1-4C-alkoxy,
R6 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine,
R7 is methyl and
R8 is hydrogen, or wherein
R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofurane or tetrahydropyran ring, R9 is 1 -4C-alkyl, -S(0)2-R10, -S(0)2-(CH2)n-R11 , -C(0)R13, -C(0)-(CH2)n-R14, -(CH2)m-C(0)-R15 or
(Aryl2)-1-4C-alkyl, R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19, R11 is phenyl,
R13 is 1-4C-alkyl, phenyl, pyridyl, 2,4,6-trichlorophenyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17, R14 is -N(R16)R17, R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19, R16 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,
R17 is 1 -7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, or
R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morphoIinyl-, 1 -pyrrol id inyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
Figure imgf000008_0001
wherein
R21 is 1-4C-alkyl, pyrid-4-yI, 2-methoxyphenyl, 1 ,1-diphenylmethyl or N-methyl-piperidin-4-yl, R18 is halogen, nitro, cyano, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxy which is completely or predominantly substituted by fluorine or 1-4C-alkoxycarbonyl, R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy, Aryl2 is pyridyl, phenyl or phenyl substituted by R18 and/or R19, m is an integer from 1 to 2, n is an integer from 1 to 2, and the salts of these compounds.
Preferred compounds of formula 1 are those, in which
R1 is hydrogen,
R2 is hydrogen or methyl,
R3 represents a phenyl derivative of formula (a)
Figure imgf000008_0002
wherein
R4 is 1-2C-alkoxy, R5 is 1-2C-alkoxy,
R9 is -S(O)2-R10, -S(0)2-(CH2)π-R11 , -C(0)R13, -C(0)-(CH2)n-R14, -(CH2)m-C(0)-R15 or (Aryl2)-1- 2C-alkyl,
R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19,
R11 is phenyl,
R13 is 1-4C-alkyl, phenyl, 2,4,6-trichlorophenyl, pyridyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17, R14 is -N(R16)R17, R15 is -N(R16)R17, R16 is hydrogen or 1 -4C-alkyl, R17 is 1-4C-alkyl, or
R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrrolidinyl-, 1-piperidinyl- or a 1 -piperazinyl-ring of formula (c)
Figure imgf000009_0001
wherein
R21 is 1-4C-alkyl, pyrid-4-yl, 2-methoxyphenyl or 1 ,1-diphenylmethyl, R18 is halogen, cyano, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R19 is 1 -4C-alkyl or 1 -4C-alkoxy, Aryl2 is pyridyl or phenyl, m is 1 , n is 1 , and the salts of these compounds.
Particularly preferred compounds of formula 1 are those in which
R1 is hydrogen,
R2 is hydrogen or methyl,
R3 represents a phenyl derivative of formula (a)
Figure imgf000009_0002
wherein
R4 is methoxy, R5 is methoxy and
R9 is acetyl, morpholin-4-ylcarbonyl, pyridin-3-ylmethyl, 4-ethyl-piperazin-2,3-dion-1-ylcarbonyl, 4-methylpiperazin-1-ylcarbonyl, 5-dimethylamino-naphythalene-1-sulfonyl, 2-(morpholin-4-yl)-2- oxo-ethyl, 4-methylbenzenesulfonyl, methylsulfonyl, 4-chIorobenzenesulfonyl, benzylsulfonyl, 4-methoxybenzenesulfonyl, benzenesulfonyl, 2,5-dimethoxybenzenesulfonyl,
2-cyanobenzenesulfonyl, thiophen-2-ylsulfonyl, 2-fluorobenzenesulfonyl, 2-trifiuoromethoxy- benzenesulfonyl, dimethylaminosulfonyl, benzoyl, pyridin-3-ylcarbonyl,
2,4,6-trichlorobenzenecarbonyl, tert-butylaminocarbonyl, dimethylaminocarbonylmethyl, 2-(4- methyl-piperazin-1-yl)-2-oxo-ethyl, 2-(4-pyridin-4-ylpiperazin-1-yl)ethanoyl, 2-[4-(2- methoxyphenyl)piperazin-1-yl]ethanoyl or 2-[4-(1 ,1-diphenylmethyl)piperazin-1-yl]ethanoyl, and the salts of these compounds.
An embodiment (embodiment A) of the compounds of formula 1 are those in which
R1 is hydrogen or 1-4C-alkyl,
R2 is hydrogen or 1-4C-alkyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000010_0001
wherein
R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine,
R6 is 1-4C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein
R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom,
R9 is -S(0)2-R10, -S(0)2-(CH2)n-R11 or -(CH2)m-S(0)2-R12,
R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19,
R11 is phenyl or -N(R16)R17,
R12 is -N(R16)R17,
R16 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
R17 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrrolidinyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
Figure imgf000011_0001
wherein
R21 is 1-4C-alkyl, pyrid-4-yl, pyrid-4-ylmethyl, 2-methoxyphenyl, 1 ,1-diphenylmethyl, dimethyl- amino-1-4C-alkyl, dimethylaminocarbonylmethyl, N-methyl-piperidin-4-yl, 4-morpholino-ethyl or tetrahydrofuran-2-ylmethyl,
R18 is halogen, nitro, cyano, carboxyl, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxy which is completely or predominantly substituted by fluorine, 1-4C-alkoxycarbonyl, amino, mono-or di-1- 4C-alkylamino, aminocarbonyl, 1-4C-alkylcarbonylamino or mono-or di-1~4C-alkylaminocarbonyl,
R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy,
R20 is halogen, n is an integer from 1 to 4, m is an integer from 1 to 4, and the salts of these compounds.
Preferred compounds of formula 1 of embodiment A are those in which
R1 is hydrogen,
R2 is hydrogen or methyl,
R3 represents a phenyl derivative of formula (a)
Figure imgf000011_0002
wherein
R4 is 1-2C-alkoxy, R5 is 1-2C-alkoxy,
R9 is -S(0)2-R10 or -S(0)2-(CH2)n-R11 ,
R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19,
R11 is phenyl,
R16 is hydrogen or 1-4C-alkyl,
R17 is 1-4C-alkyl, R18 is halogen, cyano, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R19 is 1 -4C-alkyl or 1 -4C-alkoxy, n is 1 , and the salts of these compounds.
Particularly preferred compounds of formula 1 of embodiment A are those in which
R1 is hydrogen,
R2 is hydrogen or methyl,
R3 represents a phenyl derivative of formula (a)
Figure imgf000012_0001
wherein
R4 is methoxy, R5 is methoxy and
R9 is 5-dimethylamino-naphythalene-1-sulfonyl, 4-methylbenzenesulfonyl, methylsulfonyl, 4-chlorobenzenesuIfonyl, benzylsulfonyl, 4-methoxybenzenesulfonyl, ben∑enesulfonyl, 2,5-dimethoxybenzenesulfonyl, 2-cyanobenzenesulfonyl, thiophen-2-ylsulfonyl,
2-fluorobenzenesulfonyl, 2-tπTiuoromethoxy-benzenesulfonyl or dimethylaminosulfonyl, and the salts of these compounds.
Another embodiment (embodiment B) of the compounds of formula 1 are those in which
R1 is hydrogen or 1-4C-alkyl,
R2 is hydrogen or 1-4C-alkyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000012_0002
wherein
R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine,
R6 is 1-4C-aIkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein
R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom,
R9 is -C(0)R13, -C(0)-(CH2)n-R14 or -(CH2)m-C(0)-R15,
R13 is 1-4C-alkyl, hydroxycarbonyl-1-4C-alkyl, phenyl, 2,4,6-trichlorophenyl, pyridyl, 4-ethyl-piperazin- 2,3-dion-1-yl or -N(R16)R17,
R14 is -N(R16)R17,
R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
R16 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
R17 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20, or
R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrrolidinyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
Figure imgf000013_0001
wherein
R21 is 1-4C-alkyl, pyrid-4-yl, pyrid-4-ylmethyl, 2-methoxyphenyl, 1 ,1-diphenylmethyl, dimethyl- amino-1-4C-alkyl, dimethylaminocarbonylmethyl, N-methyl-piperidin-4-yl, 4-morpholino-ethyl or tetrahydrofuran-2-ylmethyl, R18 is halogen, nitro, cyano, carboxyl, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxy which is completely or predominantly substituted by fluorine, 1-4C-alkoxycarbonyl, amino, mono-or di-
1-4C-alkylamino, aminocarbonyl, 1-4C-alkylcarbonylamino or mono-or di-1-4C- alkylaminocarbonyl, R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy, R20 is halogen, n is an integer from 1 to 4, m is an integer from 1 to 4, and the salts of these compounds.
Preferred compounds of formula 1 of embodiment B are those in which
R1 is hydrogen,
R2 is hydrogen or methyl,
R3 represents a phenyl derivative of formula (a)
Figure imgf000014_0001
wherein
R4 is 1-2C-alkoxy,
R5 is 1-2C-alkoxy, R9 is -C(0)R13, -C(0)-(CH2)n-R14 or -(CH2)m-C(0)-R15,
R13 is 1-4C-alkyl, phenyl, 2,4,6-trichlorophenyl, pyridyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17, R14 is -N(R16)R17, R15 is -N(R16)R17, R16 is hydrogen or 1 -4C-alkyl, R17 is 1-4C-alkyl, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a
4-morpholinyl-, 1-pyrrolidinyl-, 1-piperidinyl- or a 1-piperazinyl-ring of formula (c)
Figure imgf000014_0002
wherein
R21 is 1-4C-alkyl, pyrid-4-yl, 2-methoxyphenyl or 1 ,1-diphenylmethyl, m is 1 , n is 1 , and the salts of these compounds.
Particularly preferred compounds of formula 1 of embodiment B are those in which
R1 is hydrogen,
R2 is hydrogen or methyl,
R3 represents a phenyl derivative of formula (a)
Figure imgf000015_0001
wherein
R4 is methoxy, R5 is methoxy and
R9 is acetyl, morpholin-4-ylcarbonyl, 4-ethyl-piperazin-2,3-dion-1-ylcarbonyl, 4-methylpiperazin-1- ylcarbonyl, 2-(morpholin-4-yl)-2-oxo-ethyl, benzoyl, pyridin-3-ylcarbonyl,
2,4,6-trichlorobenzenecarbonyl, tert-butylaminocarbonyl, dimethylaminocarbonylmethyl, 2-(4- methyl-piperazin-1 -yl)-2-oxo-ethyl, 2-(4-pyridin-4-ylpiperazin-1 -yl)ethanoyl, 2-[4-(2- methoxyphenyl)piperazin-1-yl]ethanoyl or 2-[4-(1 ,1-diphenyImethyl)piperazin-1-yl]ethanoyl, and the salts of these compounds.
Further compounds of formula 1 (embodiment C) are those in which
R1 is hydrogen or 1-4C-alkyl,
R2 is hydrogen or 1-4C-alkyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000015_0002
wherein
R4 is 1 -4C-alkoxy or 1 -4C-alkoxy which is completely or predominantly substituted by fluorine, R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine,
R6 is 1-4C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein
R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom, R9 is hydrogen, 1-4C-alkyl, -S(O)2-R10, -S(0)2-(CH2)n-R11 , -(CH2)m-S(0)2-R12, -C(0)R13, -C(0)-(CH2)n-R14, -(CH2)m-C(0)-R15, Aryll or (Aryl2)-1-4C-alkyl,
R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19,
R11 is -N(R16)R17,
R12 is -N(R16)R17,
R13 is 1-4C-alkyl, hydroxycarbonyl-1-4C-alkyl, phenyl, pyridyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17,
R14 is -N(R16)R17,
R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
R16 and R17 are independent from each other hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkyl- methyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrroli- dinyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
Figure imgf000016_0001
wherein
R21 is 1-4C-alkyI, pyrid-4-yl, pyrid-4-ylmethyl, dimethylamino~1-4C-alkyl, dimethylaminocarbon- ylmethyl, N-methyl-piperidin-4-yl, 4-morpholino-ethyl or tetrahydrofuran-2-ylmethyl, R18 is halogen, nitro, cyano, carboxyl, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxycarbonyl, amino, mono-or di-1-4C-alkylamino, aminocarbonyl, 1-4C-alkylcarbonylamino or mono-or di-
1-4C-alkylaminocarbonyl, R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy, R20 is halogen, Aryll is pyrimidin-2-yl, thieno-[2,3-d]pyrimidin-4-yl, 1-methyl-1 H-pyrazolo-[3,4-d]pyrimidin-4-yl, thiazolyl, imidazolyl, furanyl, pyridyl, phenyl or phenyl substituted by R18 and/or R19, Aryl2 is pyridyl, phenyl, phenyl substituted by R18 and/or R19, 2-oxo-2H-chromen-7-yl or 4-(1 ,2,3-thia- diazol-4-yl)phenyl, n is an integer from 1 to 4, m is an integer from 1 to 4, and the salts of these compounds.
Compounds of formula 1 of embodiment C to be emphasized are those in which
R1 is hydrogen,
R2 is hydrogen or 1-4C-alkyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000017_0001
wherein
R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine,
R5 is 1-4C-alkoxy,
R6 is 1-2C-alkoxy or 1 -2C-alkoxy which is completely or predominantly substituted by fluorine,
R7 is methyl and
R8 is hydrogen, or wherein
R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofurane or tetrahydropyran ring, R9 is hydrogen, 1 -4C-alkyl, -S(0)2-R10, -C(0)R13, -(CH2)m-C(0)-R15, Aryll or (Aryl2)-1 -4C-alkyl, R10 is 1-4C-alkyl, 5-dimethylaminonaphthaIin-l-yl or -N(R16)R17, R13 is 1-4C-alkyl, phenyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17, R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19 and/or R20, R16 and R17 are independent from each other hydrogen, 1-7C-alkyl, 3-7C-cycloalkyI, 3-7C-cycloalkyl- methyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrroli- dinyl-, 1-piperidinyl-, 1 -hexahydroazepino- or a 4-methyl-piperazin-1-yl-ring, R18 is halogen, nitro, cyano, 1-4C-alkyI, trifluoromethyl, 1-4C-alkoxy or 1-4C-alkoxycarbonyl, R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy, R20 is halogen, Aryll is pyrimidin-2-yl, thieno-[2,3-d]pyrimidin-4-yl, 1-methyl-1 H-pyrazolo-[3,4-d]pyrimidin-4-yl, pyridyl, phenyl or phenyl substituted by R18 and/or R19, AryI2 is pyridyl, phenyl, phenyl substituted by R18 and/or R19, 2-oxo-2H-chromen-7-yI or 4-(1 ,2,3-thia- diazol-4-yl)phenyI, m is an integer from 1 to 2, and the salts of these compounds.
Compounds of formula 1 of embodiment C particularly to be emphasized are those in which
R1 is hydrogen,
R2 is hydrogen or methyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000018_0001
wherein
R4 is 1-2C-alkoxy,
R5 is 1-4C-alkoxy,
R6 is 1-2C-alkoxy,
R7 is methyl and
R8 is hydrogen, R9 is hydrogen, -S(0)2-R10, -C(0)R13, -(CH2)m-C(0)-R15 or (Aryl2)-1 -2C-alkyl, R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl or -N(R16)R17, R13 is 1-4C-alkyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17, R15 is -N(R16)R17, R16 and R17 are independent from each other hydrogen or 1-4C-alkyl, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl ring, a 1-pipe- ridinyl ring or a 4-methyl-piperazin-1-yI ring, Aryl2 is pyridyl or phenyl, m is 1 , and the salts of these compounds.
Preferred compounds of formula 1 of embodiment C are those in which
R1 is hydrogen,
R2 is methyl,
R3 represents a phenyl derivative of formula (a)
Figure imgf000018_0002
wherein
R4 is methoxy, R5 is methoxy and R9 is acetyl, morpholin-4-ylcarbonyl, pyridin-3-ylmethyl, 4-ethyl-piperazin-2,3-dion-1-yl, 4-methyIpipe- razin-1-yl, 5-dimethylamino-naphythalene-1-sulfonyl or morpho!in-4-yl-2-oxo-ethyl, and the salts of these compounds.
A special embodiment of the compounds of the present invention include those compounds of formula 1 in which R3 represents a phenyl derivative of formula (a).
Another special embodiment of the compounds of the present invention include those compounds of formula 1 in which R3 represents a phenyl derivative of formula (a) and R4 and R5 have the meaning methoxy.
A further special embodiment of the compounds of the present invention include those compounds of formula 1 in which R1 is hydrogen, R2 is hydrogen or methyl, R3 represents a phenyl derivative of formula (a) and R4 and R5 have the meaning methoxy.
The compounds of formula 1 are can be chiral compounds. Chiral centers exist in the compounds of formula 1 in positions 4 and 5 of the pyridazinone ring, if R1 and/or R2 have a meaning other than hydrogen. In case R3 represents a phenyl derivative of formula (b) there is one further chiral center in the dihydrofuran-ring, if the substituents -R7 and -CH2R8 are not identical. However, preferred are in this connection those compounds, in which the substituents -R7 and -CH2R8 are identical or together and with inclusion of the two carbon atoms to which they are bonded form a spiro-connected 5-, 6- or 7- membered hydrocarbon ring.
Numbering:
Figure imgf000019_0001
The invention includes all conceivable pure diastereomers and pure enantiomers of the compounds of formula 1 , as well as all mixtures thereof independent from the ratio, including the racemates.
The compounds according to the invention can be prepared, for example, as described in Reaction scheme 1. Reaction scheme 1 :
Figure imgf000020_0001
R1 R2 R6 R7 R8
A4 H H MeO Me H
Figure imgf000020_0002
4 - 10
Reaction scheme 1 shows that the compounds of formula 1 can be, for example, prepared starting from 4-oxo-piperidine-1 -carboxylic acid tert-butyl ester which is reacted in a first reaction step with tert- butylcarbazate to give 4-(tert-Butoxycarbonyl-hydrazono)-piperidine-1 -carboxylic acid tert-butyl ester (starting compound A6). Compound A6 is reduced with, for example, the boran tetrahydrofurane complex to give 4-(N'-tert-Butoxycarbonyl-hydrazino)-piperidine-1 -carboxylic acid tert-butyl ester (starting compound A5). Treatment of compound A5 with concentrated hydrochloric acid results in the formation of piperidin-4-yl-hydrazine dihydrochloride (starting compound A1).
The reaction of piperidin-4-yl-hydrazine dihydrochloride with phenyl-4-oxo-butyric acids of formulae 3a or 3b leads to the piperidino derivatives of formula 2.
These are reacted in the final reaction step with compounds of formula R9-X, wherein X represents a suitable leaving group, preferably a chlorine atom, to give the compounds of formula 1.
Suitably, the conversions are carried out analogous to methods which are familiar per se to the person skilled in the art, for example, in the manner which is described in the following examples.
The preparation of the phenyl-4-oxo-butyric acids of formulae 3a or 3b is known to the person skilled in the art (see for example Starting compounds and Intermediates).
The preparation of compounds of formula R9-X is also known to the person skilled in the art.
The substances according to the invention are isolated and purified in a manner known per se, e.g. by distilling off the solvent in vacuo and recrystallising the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as column chromatography on a suitable support material.
Salts are obtained by dissolving the free compound in a suitable solvent (for example a ketone like acetone, methylethylketone, or methylisobutylketone, an ether, like diethyl ether, tetrahydrofuran or diox- ane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or a low molecular weight aliphatic alcohol, such as ethanol, isopropanol) which contains the desired acid, or to which the desired acid is then added. The salts are obtained by filtering, reprecipitating, precipitating with a non-solvent for the addition salt or by evaporating the solvent. Salts obtained can be converted by basification into the free compounds which, in turn, can be converted into salts. In this manner, pharmacologically non- tolerable salts can be converted into pharmacologically tolerable salts.
The following examples illustrate the invention in greater detail, without restricting it. As well, further compounds of formula 1 , of which the preparation is explicitly not described, can be prepared in an analogous way or in a way which is known by a person skilled in the art using customary preparation methods.
The compounds, which are mentioned in the examples as well as their salts are preferred compounds of the invention. In the examples, RT stands for room temperature, h for hour(s), min for minute(s) and M. p. for melting point. Examples
Final products
1. 6-(3.4-Dimethoxy-phenvπ-5-methyl-2-piperidin-4-yl-4.5-dihvdro-2H-pyridazin-3-one hydrochloride
A mixture of 50 mmol of starting compound A1 , 50 mmol of starting compound A2 and 100 mmol of triethylamine in 100 ml of 1-propanol is refluxed for 18 h and subsequently evaporated. The residue is partitioned between dichloromethane and aqueous sodium carbonate. The dichloromethane solution is dried over magnesium sulfate. Addition of a saturated solution of hydrochloric acid in diethyl ether causes precipitation of the title compound. M. p. 91-95°C
2. 6- 3.4-Dimethoxy-phenyl.-2-piperidin-4-yl-4.5-dihvdro-2H-pyridazin-3-one hydrochloride
Prepared as described for compound 1 from starting compounds A1 and A3. M. p. 227-229°C
3. 6-(7-Methoxy-2.2-dimethyl-2.3-di vdro-benzofuran-4-vH-2-piperidin-4-yl-4.5-dihydro-2H- pyridazin-3-one hydrochloride
Prepared as described for compound 1 from starting compounds A1 and A4. M. p. 280°C (with decomposition)
4. 2-(1-Acetyl-piperidin-4-vπ-6-(3.4-dimethoxy-phenvπ-5-methyl-4.5-dihvdro-2H-pyridazin-3- one
To a solution of 5 mmol of compound 1 and 20 mmol of triethylamine in 50 ml of dichloromethane, 10 mmol of acetic anhydride is added and the resulting mixture is stirred at RT. After 60 min the solution is washed subsequently with diluted hydrochloric acid and aqueous sodium carbonate. The solution is dried over magnesium sulfate and evaporated. The residue is crystallized from diethyl ether. M. p. 149- 152°C
5. 6-(3.4-Dimethoxy-phenvπ-5-methyl-2-ri-(1-morpholin-4-yl-methanovπ-piperidin-4-vn-4.5- dihvdro-2H-pyridazin-3-one
Prepared from compound 1 and morpholine-4-carbonyl chloride as described for compound 4. M. p. 137-138°C 6. 6-(3.4-Dimethoxy-phenvn-5-methyl-2-(1-pyridin-3-ylmethyl-piperidin-4-yl)-4.5-dihvdro-2H- pyridazin-3-one dihydrochloride
A mixture of 5 mmol of compound 1 , 7 mmol of 3-chloromethyl-pyridine hydrochloride and 20 mmol of potassium carbonate in 20 ml of dimethylformamide is stirred at RT for 18 h. After addition of 150 ml of water, the mixture is extracted with diethyl ether. The ether solution is dried over magnesium sulfate and evaporated. The residue is purified by chromatography (elution with a mixture of ethyl acetate and methanol, 3:1). Addition of a saturated solution of hydrochloric acid in ether to the purified fractions causes precipitation of the title compound. M. p. 241-244°C
7. 1-(1-f4-r3-(3.4-Dimethoxy-phenvπ-6-oxo-5.6-dihydro-4H-pyridazin-1-vn-piperidin-1-yl>-me- thanoyl.-4-ethyl-piperazine-2,3-dione
Prepared from compound 2 and 4-ethyl-2,3-dioxo-piperazine-1-carbonyl chloride as described for compound 4. M. p. 201 -203°C
8. β-O^-Dimethoxy-phenvπ-Σ-fl-ri^-methyl-piperazin-l-vπ-methanovπ-piperidin^-yl .S- dihvdro-2H-pyridazin-3-one hydrochloride
Prepared from compound 2 and 4-methyl-piperazine-1 -carbonyl chloride as described for compound 4. After evaporating the dichloromethane solution, the residue is dissolved in ethyl acetate and addition of a saturated solution of hydrochloric acid in ether causes precipitation of the title compound. Recrystalli- sation is performed from a mixture of methanol and ethyl acetate. M. p. 151-154°C
9. β-(3.4-Dimethoxy-phenvπ-2-f1-(5-dimethylamino-naphthalene-1-sulfonyl)-piperidin-4-vn- 4.5-dihvdro-2-pyridazin-3-one
Prepared from compound 2 and 5-dimethylamino-naphthalene-1-sulfonyl chloride as described for compound 4. M. p. 191-193°C
10. 6-(3.4-Dimethoxy-phenvπ-2-ri-(2-morpholin-4-yl-2-oxo-ethvπ-piperidin-4-vn-4.5-dihvdro-2- pyridazin-3-one hydrochloride
Prepared from compound 2 and 2-chloro-1-morpholin-4-yl-ethanone as described for compound 6. M. p. 145-148°C
11. 6-(3.4-Dimethoxy-phenvπ-2-ri-(toluene-4-sulfonvπ-piperidin-4-vπ-4.5-dihvdro-2H- pyridazin-3-one
Prepared from 4-toluenesulfonyl chloride and compound 1 as described for compound 4. M. p. 179-184°C
12. 6-(3,4-Dimethoxy-phenvπ-2-(1-methanesulfonyl-piperidin-4-yl)-4.5-dihvdro-2H-pyridazin- 3-one
Prepared from methylsulfonyl chloride and compound 1 as described for compound 4. M. p. 164-166 °C
13. 2-ri-(4-Chloro-benzenesulfonyl)-piperidin-4-vn-6-(3.4-di ethoxy-phenvπ-4,5-dihydro-2H- pyridazin-3-one
Prepared from 4-chloro-benzenesulfonyl chloride and compound 1 as described for compound 4. M. p. 185-186 °C
14. 6-(3.4-Dimethoxy-phenyl)-2-(1-phenylmethanesulfonyl-piperidin-4-vπ-4.5-dihvdro-2H- pyridazin-3-one
Prepared from phenylmethanesulfonyl chloride and compound 1 as described for compound 4. M. p. 114°C
15. 6-(3.4-Dimethoxy-phenyl)-2-ri-(4-methoxy-benzenesulfonv0-piperidin-4-yll-4.5-dihvdro- 2H-pyridazin-3-one
Prepared from 4-methoxy-benzenesulfonyl chloride and compound 1 as described for compound 4. M. p. 197-198 °C
16. 2-(1-Benzenesulfonyl-piperidin-4-vπ-6-(3.4-dimethoxy-phenyl)-4,5-dihvdro-2H-pyridazin- 3-one
Prepared from benzenesulfonyl chloride and compound 1 as described for compound 4. M. p. 188-190 °C
17. 2-ri-(2.5-Dimethoxy-benzenesulfonvπ-piperidin-4-vn-6-(3,4-dimethoxy-phenyl)-4,5- dihvdro-2H-pyridazin-3-one
Prepared from 2,5-Dimethoxy-benzenesulfonyl chloride and compound 1 as described for compound 4. M. p. 184-185 °C 18. 2-f4-r3-(3.4-Dimethoxy-phenyl)-6-oxo-5.6-dihvdro-4H-pyridazin-1-vπ-piperidine-1- sulfonvD-benzonitrile
Prepared from 2-cyano-benzenesulfonyl chloride and compound 1 as described for compound 4. M. p. 158-160 °C
19. 6-(3.4-Dimethoxy-phenvπ-2-ri-(thiophene-2-sulfonvπ-piperidin-4-vn-4.5-dihydro-2H- pyridazin-3-one
Prepared from 2-thiophene sulfonyl chloride and compound 1 as described for compound 4. M. p. 178-179 °C
20. 6-(3.4-Dimethoxy-phenyl)-2-ri-(2-fluoro-benzenesulfonv0-piperidin-4-vn-4.5-dihvdro-2H- pyridazin-3-one
Prepared from 2-fluoro-benzenesulfonyl chloride and compound 1 as described for compound 4. M. p. 198-199 °C
21. 6-(3.4-Dimethoxy-phenyl)-2-ri-(2-trifluoromethoxy-benzenesulfonvπ-piperidin-4-vn-4.5- dihvdro-2H-pyridazin-3-one
Prepared from 2-trifluoromethoxy-benzenesulfonyl chloride and compound 1 as described for compound 4. M. p. 118-119 °C
22. 4-F3-(3.4-Dimethoxy-phenvπ-6-oxo-5.6-dihvdro-4H-pyridazin-1-vn-piperidine-1-sulfonic acid dimethylamide
Prepared from dimethylsulfamoyl chloride and compound 1 as described for compound 4. M. p. 103-106 °C
23. 6-(3.4-Dimethoxy-phenyl)-2-ri-(1-Phenyl-methanoyl)-piperidin-4-vn-4.5-dihvdro-2H- pyridazin-3-one
Prepared from benzoyl chloride and compound 1 as described for compound 4. M. p. 152-154 °C
24. 6-(3.4-Dimethoxy-phenvπ-2-ri-(1-PVridin-3-yl-methanovπ-piperidin-4-vn-4.5-dihvdro-2H- pyridazin-3-one
Prepared from nicotinoyl chloride and compound 1 as described for compound 4. M. p. 162-164 °C
25. 6-(3,4-Dimethoxy-phenv0-2-f1-f1-(2,4,6-trichloro-phenvπ-methanovn-piperidin-4-yl)-4.5- dihydro-2H-pyridazin-3-one
Prepared from 2,4,6-trichlorobenzoyl chloride and compound 1 as described for compound 4. M. p. 156-159 °C
26. 4-f3-(3.4-Dimethoxy-phenvπ-6-oxo-5.6-dihvdro-4H-pyridazin-1-vn-piperidine-1-carboxylic acid tert-butylamide
Prepared from tert-butyl isocyanate and compound 1 as described for compound 4. M. p. 76-78 °C
27. 2-f4-r3-(3.4-Dimethoxy-phenvπ-6-oxo-5.6-dihvdro-4H-pyridazin-1-vn-piperidin-1-ylVN.N- dimethylacetamide hydrochloride
Prepared from 2-chloro-N,N-dimethylacetamide and compound 1 as described for compound 6. M. p. 121-122 °C
28. 6-(3.4-Dimethoxy-phenvπ-2-f1-r2-(4-methyl-piperazin-1-yl)-2-oxo-ethvπ-piperidin-4-yl'.-4.5- dihydro-2H-pyridazin-3-one dihydrochloride
Prepared from 2-chloro-1-(4-methyl-piperazin-1-yl)-ethanone hydrochloride and compound 1 as described for compound 6. M. p. 194-199 °C
29. e-tS^-Dimethoxy-phenvπ-Σ-fl-r∑^-pyridin^-yl-piperazin-l-vD-ethanovn-piperidin^-yl1.- 4.5-dihvdro-2H-pyridazin-3-one dihydrochloride
Prepared from 1-Pyridin-4-yl-piperazine and starting compound A7 as described for compound 6. M. p. 98-99 °C
30. 6-(3,4-Dimethoxy-phenyl)-2-(1-f2-r4-(2-methoxy-phenvπ-piperazin-1-vn-ethanoyl>- piperidin-4-yl.-4,5-dihvdro-2H-pyridazin-3-one dihydrochloride
Prepared from 1-(2-methoxy-phenyl)-piperazine and compound A7 as described for compound 6. M. p. 109-110 °C 31. 6-(3.4-Dimethoxy-phenvπ-2-(1-f2-r4-(1.1-diphenyl-methyl)-piperazin-1-vπ-ethanoyl'.- piperidin-4-yl.-4.5-dihvdro-2H-pyridazin-3-one dihydrochloride
Prepared from 1-(1 ,1-diphenyl-methyl)-piperazine and compound A7 as described for compound 6. M. p. 126-127 °C
Starting Compounds and Intermediates
A1. Piperidin-4-yl-hvdrazine dihydrochloride
A mixture of 0.1 mole of 4-(N'-tert-Butoxycarbonyl-hydrazino)-piperidine-1-carboxylic acid tert-butyl ester (starting compound A5) and 150 ml of concentrated hydrochloric acid is heated at 90°C for 60 min after which the clear solution is evaporated. The residue is washed with tetrahydrofurane, filtered off and dried under vacuum. M. p. 256-259°C
A2. 4-(3,4-Dimethoxy-phenyl.-3-methyl-4-oxo-butyric acid
Prepared according to Haworth and Woodcock; J. Chem. Soc. 1938, 809-811
A3. 4-(3,4-Dimethoxy-phenyl.-4-oxo-butyric acid
Prepared according to M.S.Y. Khan and Anees A. Siddiqui; Indian J. Chem. Section B, 2000, 39, 614- 619
A4. 4-(7-Methoxy-2.2-dimethyl-2.3-dihvdro-benzofuran-4-yl.-4-oxo-butyric acid
Prepared analogously to (cis)-2-(2,3-Dihydro-7-methoxybenzofuran-2-spiro-1 '-cyclopentane-4-carbon- yl)-1 ,2,3,6-tetrahydrobenzoic acid as described in WO99/31090 starting from 4-bromo-7-methoxy-2,2- dimethyl-2,3-dihydro-benzofuran and succinic anhydride. M. p. 125-126°C
A5. 4-(N'-tert-Butoxycarbonyl-hvdrazino.-piperidine-1 -carboxylic acid tert-butyl ester
150 ml of a solution of borohydride in tertahydrofurane (1.0 mol/l) is slowly added to a solution of 0.12 mole of 4-(tert-Butoxycarbonyl-hydrazono)-piperidine-1 -carboxylic acid tert-butyl ester (starting compound A6) in 100 ml of dry tetrahydrofurane. After complete addition, the mixture is stirred for another 30 min after which a 100 ml of water is added to destroy the excess of borohydride. Subsequently the tetrahydrofurane is evaporated and the resulting aqeous solution is extracted with diethyl ether. After drying the solvent over magnesium sulfate, the ether is evaporated. M. p.112-115°C
A6. 4-.tert-Butoxycarbonyl-hvdrazono.-piperidine-1 -carboxylic acid tert-butyl ester
A mixture of 0.15 mole of 4-oxo-piperidine-1 -carboxylic acid tert-butyl ester and 0.15 mole of tert- butylcarbazate in 250 ml of hexane is stirred for 18 h at RT. The precipitate is filtered off and dried under vacuum. M. p. 172-174°C A7. 2-ri-(2-Chloro-ethanovh-pϊperidin-4-vπ-6-(3.4-dimethoxy-phenvπ-4.5-dihvdro-2H- pyridazin-3-one
A solution of 20 mmol of chloroacetyl chloride in 50 ml of dichloromethane is added slowly to a solution of 15 mmol of compound 1 and 40 mmol of triethylamine in 150 ml of dichloromethane at 0°C. After complete addition, the mixture is washed successively with diluted hydrochloric acid and with aqueous sodium carbonate, dried over magnesium sulfate and evaporated. The compound is crystallized from ethyl acetate. M. p. 116-117 °C
Commercial utility
The compounds according to the invention have valuable pharmacological properties which make them commercially utilizable. As selective inhibitors of type 4 or type 3 and 4 of cyclic nucleotide phosphodi- esterase (PDE4, PDE3/4), they are suitable on the one hand as bronchial therapeutics (for the treatment of airway obstructions on account of their dilating action and cilia-stimulating action but also on account of their respiratory rate- and respiratory drive-increasing action), but on the other hand especially for the treatment of disorders of inflammatory nature, e.g. of the airways (asthma prophylaxis), of the skin, of the intestine, of the eyes and of the joints, which are mediated by mediators such as interferons, members of the tumour necrosis factor family, interieukins, chemokines, colony-stimulating factors, growth factors, lipid mediators (e.g., inter alia, PAF, platelet-activating factor), bacterial factors (e.g. LPS), immunoglobulins, oxygen free radicals and related free radicals (e.g. nitrogen monoxide NO), biogenic amines (e.g. histamine, serotonin), kinins (e.g. bradykinin), neurogenic mediators (such as substance P, neurokinin), proteins such as, for example, granular contents of leukocytes (inter alia cationic proteins of eosinophils) and adherence proteins (e.g. integrins). The compounds according to the invention have smooth muscle-relaxant action, e.g. in the region of the bronchial system, of the blood circulation, and of the efferent urinary passages. Furthermore, they have cilia frequency- increasing action, for example in the bronchial system.
On account of their PDE-inhibiting properties, the compounds according to the invention can be employed as therapeutics in human and veterinary medicine, where they can be used, for example, for the treatment and prophylaxis of the following diseases: acute and chronic (in particular inflammatory and allergen-induced) respiratory disorders of various origins (bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD); disorders associated with impaired cilia function or increased demands on ciliar clearance (bronchitis, mucoviscidosis), dermatoses (especially of proliferative, inflammatory and allergic type) such as, for example, psoriasis (vulgaris), toxic and allergic contact eczema, atopic eczema, seborrheic eczema, lichen simplex, sunburn, pruritus in the anogenital area, alopecia areata, hypertrophic scars, discoid lupus erythematosus, follicular and widespread pyodermias, endogenous and exogenous acne, acne rosacea and other proliferative, inflammatory and allergic skin disorders; disorders which are based on excessive release of TNF and leukotrienes, i.e., for example, disorders of the arthritis type (rheumatoid arthritis, rheumatoid spondylitis, osteoarthritis and other arthritic conditions), systemic lupus erythematosus, disorders of the immune system (AIDS), including AIDS-related encephalopathies, autoimmune disorders such as diabetes mellitus (type I, autoimmune diabetes), multiple sclerosis and of the type virus-, bacteria- or parasite-induced demyelinization diseases, cerebral malaria or Lyme's disease, shock symptoms [septic shock, endotoxin shock, Gram-negative sepsis, toxic shock syndrome and ARDS (adult respiratory distress syndrome)] and also generalized inflammations in the gastrointestinal region (Crohn's disease and ulcerative colitis); disorders which are based on allergic and/or chronic, faulty immunological reactions in the region of the upper airways (pharynx, nose) and of the adjacent regions (paranasal sinuses, eyes), such as, for example, allergic rhinitis/sinusitis, chronic rhinitis/sinusitis, allergic conjunctivitis and also nasal polyps; and also disorders of the central nervous system such as memory disorders and Alzheimer's disease, candidiasis, leish- maniases and leprosy.
On account of their vasorelaxant activity, the compounds according to the invention can also be used for the treatment of high blood pressure disorders of various origins such as, for example, pulmonary high blood pressure and the concomitant symptoms associated therewith, for the treatment of erectile dysfunction or colics of the kidneys and the ureters in connection with kidney stones.
On account of their cAMP-increasing action, however, they can also be used for disorders of the heart which can be treated by PDE inhibitors, such as, for example, cardiac insufficiency, and also as anti- thrombotic, platelet aggregation-inhibiting substances.
The invention further relates to a method for the treatment of mammals including humans who are suffering from one of the abovementioned diseases. The method comprises administering a therapeutically effective and pharmacologically acceptable amount of one or more of the compounds according to the invention to the sick mammal.
The invention further relates to the compounds according to the invention for use in the treatment and/or prophylaxis of diseases, in particular the diseases mentioned.
The invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of the diseases mentioned.
The invention furthermore relates to pharmaceutical compositions for the treatment and/or prophylaxis of the diseases mentioned and which contain one or more of the compounds according to the invention.
A further subject of the invention is a commercial product, consisting of a customary secondary pack, a primary pack containing the pharmaceutical composition (for example an ampoule or a blister pack) and, if desired, an information leaflet, the pharmaceutical composition exhibiting antagonistic action against cyclic nucleotide phosphodiesterases of type 4 or types 3 and 4 and leading to the attenuation of the symptoms of illnesses which are connected with cyclic nucleotide phosphodiesterases of type 4 or types 3 and 4, and the suitability of the pharmaceutical composition for the prophylaxis or treatment of illnesses which are connected with cyclic nucleotide phosphodiesterases of type 4 or types 3 and 4 being indicated on the secondary pack and/or on the information leaflet of the commercial product, and the pharmaceutical composition containing one or more compounds of formula 1 according to the invention. The secondary pack, the primary pack containing the pharmaceutical composition and the information leaflet otherwise comply with what would be regarded as standard to the person skilled in the art for pharmaceutical compositions of this type. Advantageously, the substances according to the invention are also suitable for combination with other substances which bring about stimulation of cAMP, such as prostaglandins (PGE2, PGI2 and prostacy- clin) and their derivatives, direct adenylate cyclase stimulators such as forskolin and related substances, or substances indirectly stimulating adenylate cyclase, such as catecholamines and adrenergic receptor agonists, in particular beta-mimetics. In combination, on account of their cAMP degradation- inhibiting action, they in this case display a synergistic, superadditive activity. This comes to bear, for example, in their use in combination with PGE2 for the treatment of pulmonary hypertension.
The pharmaceutical compositions are prepared by processes which are known per se and familiar to the person skilled in the art. As pharmaceutical compositions, the compounds according to the invention (= active compounds) are either employed as such, or preferably in combination with suitable pharmaceutical auxiliaries and/or excipients, e.g. in the form of tablets, coated tablets, capsules, cap- lets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between 0.1 and 95% and where, by the appropriate choice of the auxiliaries and/or excipients, a pharmaceutical administration form (e.g. a delayed release form or an enteric form) exactly suited to the active compound and/or to the desired onset of action can be achieved.
The person skilled in the art is familiar with auxiliaries or excipients which are suitable for the desired pharmaceutical formulations on account of his/her expert knowledge. In addition to solvents, gel formers, ointment bases and other active compound excipients, for example antioxidants, dispersants, emulsifiers, preservatives, solubilizers, colorants, complexing agents or permeation promoters, can be used.
The administration of the pharmaceutical compositions according to the invention may be performed in any of the generally accepted modes of administration available in the art. Illustrative examples of suitable modes of administration include intravenous, oral, nasal, parenteral, topical, transdermal and rectal delivery. Oral delivery is preferred.
For the treatment of disorders of the respiratory tract, the compounds according to the invention are preferably also administered by inhalation in the form of an aerosol; the aerosol particles of solid, liquid or mixed composition preferably having a diameter of 0.5 to 10 μm, advantageously of 2 to 6 μm.
Aerosol generation can be carried out, for example, by pressure-driven jet atomizers or ultrasonic atomizers, but advantageously by propellant-driven metered aerosols or propellant-free administration of micronized active compounds from inhalation capsules.
Depending on the inhaler system used, in addition to the active compounds the administration forms additionally contain the required excipients, such as, for example, propellants (e.g. Frigen in the case of metered aerosols), surface-active substances, emulsifiers, stabilizers, preservatives, flavorings, fillers (e.g. lactose in the case of powder inhalers) or, if appropriate, further active compounds.
For the purposes of inhalation, a large number of apparatuses are available with which aerosols of optimum particle size can be generated and administered, using an inhalation technique which is as right as possible for the patient. In addition to the use of adaptors (spacers, expanders) and pear-shaped containers (e.g. Nebulator®, Volumatic®), and automatic devices emitting a puffer spray (Autohaler®), for metered aerosols, in particular in the case of powder inhalers, a number of technical solutions are available (e.g. Diskhaler®, Rotadisk®, Turbohaler® or the inhaler described in European Patent Application EP 0 505 321), using which an optimal administration of active compound can be achieved.
For the treatment of dermatoses, the compounds according to the invention are in particular administered in the form of those pharmaceutical compositions which are suitable for topical application. For the production of the pharmaceutical compositions, the compounds according to the invention (= active compounds) are preferably mixed with suitable pharmaceutical auxiliaries and further processed to give suitable pharmaceutical formulations. Suitable pharmaceutical formulations are, for example, powders, emulsions, suspensions, sprays, oils, ointments, fatty ointments, creams, pastes, gels or solutions.
The pharmaceutical compositions according to the invention are prepared by methods known per se. The dosage of the active compounds takes place in the order of magnitude customary for PDE inhibitors. Thus topical application forms (such as, for example, ointments) for the treatment of dermatoses contain the active compounds in a concentration of, for example, 0.1-99%. The dose for administration by inhalation is customarily between 0.1 and 3 mg per day. The customary dose in the case of systemic therapy (p.o. or i.v.) is between 0.01 and 10 mg per kilogram per day.
Bioloqical investigations
The second messenger cyclic AMP (cAMP) is known for inhibiting inflammatory cells and cells responsible for the immunological response. The PDE4 isoenzyme is widely distributed in cells associated with the initiation and spreading of inflammatory diseases (H Tenor and C Schudt, in "Phosphodiester- ase Inhibitors", 21-40, "The Handbook of Immunopharmacology", Academic Press 1996); its inhibition results in the increase of the intracellular cyclic AMP concentration and thus in the inhibition of cellular activation (JE Souness et al., Immunopharmacology 47: 127-162, 2000).
The anti-inflammatory potential of PDE4 inhibitors in vivo has been described in various animal models (MMTeixeira, TIPS 18: 164-170, 1997). To examine the PDE4 inhibition on a cellular level (in vitro), a large number of proinflammatory responses can be measured. Examples are the superoxide production of neutrophilic (C Schudt et al., Arch Pharmacol 344: 682-690, 1991 ) or eosinophilic (A Hatzel- mann et al., Brit J Pharmacol 114: 821-831 , 1995) granulocytes, which can be measured as luminol- enhanced chemiluminescence, or the synthesis of tumor necrosis factor alpha (TNFα) in monocytes, macrophages or dendritic cells (Gantner et al., Brit J Pharmacol 121 : 221-231 , 1997 and Pulmonary Pharmacol Therap 12: 377-386, 1999). The immunomodulatory potential of the PDE4 inhibitors furthermore becomes apparent by inhibition of T-cell responses such as cytokine synthesis or proliferation (DM Essayan, Biochem Pharmacol 57: 965-973, 1999). PDE4 inhibition by the substances according to the invention is thus a central indicator of the suppression of inflammatory processes.
Some of the cells involved in inflammatory processes contain, in addition to PDE4, also the PDE3 isoenzyme which likewise contributes to the total cAMP metabolism of these cells. Examples are endothelial cells, mast cells, T-cells, macrophages and dendritic cells. In these cell types, the inhibitory action of PDE4 inhibitors can be enhanced by additional PDE3 inhibition. In the case of (respiratory) smooth muscle cells, inhibition of the PDE3 activity is furthermore important for (broncho)relaxation (A Hatzelmann et al., in "Phosphodiesterase Inhibitors", 147-160, "The Handbook of Immunopharmacology", Academic Press, 1996).
Method for measuring inhibition of PDE3 and PDE4 activities
Method A:
The PDE activity was determined according to Thompson et al. (Adv Cycl Nucl Res 10: 69-92, 1979) with some modifications (Bauer and Schwabe, Naunyn-Schmiedeberg's Arch Pharmacol 311 : 193-198, 1980). The test samples contained 20 mM Tris (pH 7.4), 5 mM MgCI2, 0.5 μM cAMP or cGMP, [3H]cAMP or [3H]cGMP (about 30 000 cpm/sample), the PDE isoenzyme-specific additives described in greater detail below, the indicated concentrations of inhibitor and an aliquot of the enzyme solution in a total sample volume of 200 μl. Dilution series of the compounds according to the invention were prepared in DMSO and further diluted in the samples [1 :100 (v/v)], to give the desired end concentration of the inhibitors at a DMSO concentration of 1 % (v/v), which for its part has only a minute effect on PDE activity.
After preincubation at 37°C for 5 minutes, the reaction was started by addition of the substrate (cAMP or cGMP). The samples were incubated at 37°C for a further 15 min. The reaction was terminated by addition of 50 μl 0.2 N HCl. After cooling on ice for 10 minutes and addition of 25 μg 5'-nucleotidase (snake venom from Crotalus atrox), the mixture was again incubated at 37°C for 10 min and the samples were then applied to QAE Sephadex A-25 columns (sample volume 1 ml). The columns were eluted with 2 ml of 30 mM ammonium formate (pH 6.0). The radioactivity of the eluate was measured and corrected by the corresponding blank values (measured in the presence of denatured protein); the blank values were less than 5% of the total radioactivity. In no case did the proportion of hydrolyzed nucleotide exceed 30% of the original substrate concentration.
PDE3 (cGMP-inhibited) was investigated in homogenates of human platelets (see Schudt et al., Bio- chem Pharmacol 1991 : 42, 153-162) using cAMP or cGMP as substrate.
PDE4 (cAMP-specific) was investigated in the cytosol of human polymorphonuclear leukocytes (PMNL) [isolated from leukocyte concentrates, see Schudt et al., Arch Pharmacol 1991 : 344, 682-690] using cAMP as substrate. The PDE3 inhibitor motapizone (1 μM) was used to suppress the PDE3 activity emanating from contaminated platelets.
The IC50 values were determined from the concentration-inhibition curves by nonlinear regression.
Method B:
The cDNA for PDE3A1 (GB no. U36798) was isolated in 2 steps using PCR. A 3' terminal cDNA fragment of PDE3A1 was amplified from fat cells cDNA (Clontech, Palo Alto) using primers OZ 458 (5'- AAAGTCGACTCACTGGTCTGGCTTTTGG -3') and OZ 457 (5'- GTCGACCAGGTGCCCTCGCTA - 3'). The 5' terminal cDNA fragment of PDE3A1 was amplified from Placenta cDNA (Clontech, Palo Alto) using primers OZ 455 (5'- ATGGCAGTGCCCGGCGACGCT -3') and OZ 456 (5'- GTCGACTTTGCTTTTTAGCCT -3'). The PCR products were cloned into pCR2.1-Topo (Invitrogen, Groningen, NL) under standard conditions (the manufacturer's instructions). The 3' fragment was cut out with Hindll and cloned into the Hindll site of the construct carrying the 5' fragment. The whole ORF was subcloned into pBacPakθ (Clontech, Palo Alto) using EcoRI. Aminoacid 12 is Aspartic Acid like in sequence GB no. AJ005036, aa 69 and aa 110 are respective Serine and Glycine like in both sequences GB no. AJ005036 and GB no. M91667.
The PDE4B2 (GB no. M97515) was a gift of Prof. M. Conti (Stanford University, USA). It was amplified from the original plasmid (pCMV5) via PCR with primers Rb9 (5'- GCCAGCGTGCAAATAATGAAGG - 3') and Rb10 (5'- AGAGGGGGATTATGTATCCAC -3') and cloned into the pCR-Bac vector (Invitrogen, Groningen, NL).
The recombinant baculovirus was prepared by means of homologous recombination in SF9 insect cells. The expression plasmids were cotransfected with Bac-N-Blue (Invitrogen, Groningen, NL) or Baculo-Gold DNA (Pharmingen, Hamburg) using a standard protocol (Pharmingen, Hamburg). Wt virus-free recombinant virus supematants were selected using plaque assay methods. After that, high- titre virus supematants were prepared by amplifying 3 times. PDEs were expressed in SF21 cells by infecting 2χ106 cells/ml with an MOI (multiplicity of infection) between 1 and 10 in serum-free SF900 medium (Life Technologies, Paisley, UK). The cells were cultured at 28°C for 48 - 72 hours, after which they were pelleted for 5-10 min at 1000 g and 4°C.
The SF21 insect cells were resuspended, at a concentration of approx. 107 cells/ml, in ice-cold (4°C) homogenization buffer (20 mM Tris, pH 8.2, containing the following additions: 140 mM NaCI, 3.8 mM KCl, 1 mM EGTA, 1 mM MgCI2, 10 mM β-mercaptoethanol, 2 mM benzamidine, 0.4 mM Pefablock, 10 μM leupeptin, 10 μM pepstatin A, 5 μM trypsin inhibitor) and disrupted by ultrasonication. The ho- mogenate was then centrifuged for 10 min at 1000χg and the supernatant was stored at -80°C until subsequent use (see below). The protein content was determined by the Bradford method (BioRad, Munich) using BSA as the standard.
PDE3A1 and PDE4B2 activities were inhibited by the said compounds in a modified SPA (scintillation proximity assay) test, supplied by Amersham Biosciences (see procedural instructions "phosphodi- esterase [3H]cAMP SPA enzyme assay, code TRKQ 7090"), carried out in 96-well microtitre plates (MTP's). The test volume is 100 μl and contains 20 mM Tris buffer (pH 7.4), 0.1 mg of BSA (bovine serum albumin)/ml, 5 mM Mg2+, 0.5 μM cAMP (including about 50,000 cpm of [3H]cAMP), 1 μl of the respective substance dilution in DMSO and sufficient recombinant PDE (1000χg supernatant, see above) to ensure that 10-20% of the cAMP is converted under the said experimental conditions. The final concentration of DMSO in the assays (1 % v/v) does not substantially affect the activity of the PDEs investigated. After a preincubation of 5 min at 37°C, the reaction is started by adding the sub- strate (cAMP) and the assays are incubated for a further 15 min; after that, they are stopped by adding SPA beads (50 μl). In accordance with the manufacturer's instructions, the SPA beads had previously been resuspended in water, but were then diluted 1 :3 (v/v) in water; the diluted solution also contains 3 mM IBMX to ensure a complete PDE activity stop. After the beads have been sedimented (> 30 min), the MTP's are analyzed in commercially available luminescence detection devices. The corresponding IC50 values of the compounds for the inhibition of PDE activities are determined from the concentration- effect curves by means of non-linear regression.
The inhibitory values determined for the compounds according to the invention follow from the following Table 1 , in which the numbers of the compounds correspond to the numbers of the examples.
The inhibitory values of the compounds 1-22 and 27 have been determined according to Method A. The inhibitory values of the compounds 23-26, 28 and 29-31 have been determined according to Method B.
Table 1
Inhibition of PDE4 and PDE3 acitivity [measured as -loglC50 (mol/l)]
Figure imgf000038_0001

Claims

Patent claims
1. Compounds of formula 1
Figure imgf000039_0001
in which
R1 is hydrogen or 1-4C-alkyl,
R2 is hydrogen or 1-4C-alkyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000039_0002
wherein
R4 is 1-4C-alkoxy or 1-4C-aIkoxy which is completely or predominantly substituted by fluorine, R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycIoalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine,
R6 is 1-4C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-aIkoxy which is completely or predominantly substituted by fluorine, R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein
R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom,
R9 is 1-4C-alkyl, -S(O)2-R10, -S(0)2-(CH2)n-R11 , -(CH2)m-S(0)2-R12, -C(0)R13, -C(0)-(CH2)n-R14, -(CH2)m-C(0)-R15, Aryll or (Aryl2)-1-4C-aikyl,
R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19, R11 is phenyl or -N(R16)R17,
R12 is -N(R16)R17,
R13 is 1-4C-alkyl, hydroxycarbonyl-1-4C-alkyl, phenyl, 2,4,6-trichlorophenyl, pyridyl, 4-ethyl-piperazin- 2,3-dion-1 -yl or -N(R16)R17,
R14 is -N(R16)R17,
R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
R16 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkyImethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
R17 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkylmethyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20, or
R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrrolidinyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
Figure imgf000040_0001
wherein
R21 is 1-4C-alkyl, pyrid-4-yl, pyrid-4-ylmethyl, 2-methoxyphenyl, 1 ,1-diphenylmethyl, dimethyl- amino-1-4C-alkyl, dimethylaminocarbonylmethyl, N-methyl-piperidin-4-yl, 4-morphoIino-ethyl or tetrahydrofuran-2-ylmethyl, R18 is halogen, nitro, cyano, carboxyl, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxy which is completely or predominantly substituted by fluorine, 1-4C-alkoxycarbonyl, amino, mono-or di-1-
4C-alkylamino, aminocarbonyl, 1-4C-alkylcarbonylamino or mono-or di-1-4C-alkylaminocarbonyl, R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy, R20 is halogen, Aryll is pyrimidin-2-yl, thieno-[2,3-d]pyrimidin-4-yl, 1-methyl-1 H-pyrazolo-[3,4-d]pyrimidin-4-yl, thiazolyl, imidazolyl, furanyl, pyridyl, phenyl or phenyl substituted by R18 and/or R19, Aryl2 is pyridyl, phenyl, phenyl substituted by R18 and/or R19, 2-oxo-2H-chromen-7-yl or 4-(1 ,2,3-thia- diazol-4-yl)phenyl, n is an integer from 1 to 4, m is an integer from 1 to 4, and the salts of these compounds.
2. Compounds of formula 1 according to claim 1 in which
R1 is hydrogen,
R2 is hydrogen or 1-4C-alkyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000041_0001
wherein
R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine,
R5 is 1-4C-alkoxy,
R6 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine,
R7 is methyl and
R8 is hydrogen, or wherein
R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofurane or tetrahydropyran ring,
R9 is 1-4C-alkyl, -S(O)2-R10, -S(0)2-(CH2)n-R11 , -C(0)R13, -C(0)-(CH2)n-R14, -(CH2)m-C(0)-R15 or (Aryl2)-1-4C-alkyl,
R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19,
R11 is phenyl,
R13 is 1-4C-alkyl, phenyl, pyridyl, 2,4,6-trichlorophenyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17,
R14 is -N(R16)R17,
R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19,
R16 is hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkyl methyl,
R17 is 1 -7C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalky!methyl, or
R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrrolidinyl-, 1-piperidinyl-, 1 -hexahydroazepino- or a 1 -piperazinyl-ring of formula (c)
Figure imgf000041_0002
wherein
R21 is 1-4C-alkyl, pyrid-4-yl, 2-methoxyphenyl, 1 ,1-diphenylmethyl or N-methyl-piperidin-4-yl, R18 is halogen, nitro, cyano, 1-4C-alkyl, trifluoromethyl, 1-4C-aIkoxy, 1-4C-alkoxy which is completely or predominantly substituted by fluorine or 1-4C-alkoxycarbonyl, R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy, Aryl2 is pyridyl, phenyl or phenyl substituted by R18 and/or R19, m is an integer from 1 to 2, n is an integer from 1 to 2, and the salts of these compounds.
3. Compounds of formula 1 according to claim 1 in which
R1 is hydrogen,
R2 is hydrogen or methyl,
R3 represents a phenyl derivative of formula (a)
Figure imgf000042_0001
wherein
R4 is 1-2C-alkoxy, R5 is 1-2C-alkoxy,
R9 is -S(O)2-R10, -S(0)2-(CH2)n-R11 , -C(0)R13, -C(0)-(CH2)n-R1 , -(CH2)m-C(0)-R15 or (Aryl2)-1-2C-alkyl,
R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, thiophenyl, phenyl or phenyl substituted by R18 and/or R19,
R11 is phenyl,
R13 is 1-4C-alkyl, phenyl, 2,4,6-trichlorophenyl, pyridyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17,
R14 is -N(R16)R17,
R15 is -N(R16)R17,
R16 is hydrogen or 1-4C-alkyl,
R17 is 1 -4C-alkyl, or
R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrrolidinyl-, 1-piperidinyl- or a 1-piperazinyl-ring of formula (c)
Figure imgf000042_0002
wherein R21 is 1-4C-alkyl, pyrid-4-yl, 2-methoxyphenyl or 1 ,1-diphenylmethyl, R18 is halogen, cyano, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine, R19 is 1 -4C-alkyl or 1 -4C-alkoxy, Aryl2 is pyridyl or phenyl, m is 1 , n is 1 , and the salts of these compounds.
4. Compounds of formula 1 according to claim 1 in which
R1 is hydrogen,
R2 is hydrogen or methyl,
R3 represents a phenyl derivative of formula (a)
Figure imgf000043_0001
wherein
R4 is methoxy, R5 is methoxy and
R9 is acetyl, morpholin-4-ylcarbonyl, pyridin-3-ylmethyl, 4-ethyl-piperazin-2,3-dion-1-ylcarbonyI, 4-methylpiperazin-1-ylcarbonyl, 5-dimethylamino-naphythalene-1-sulfonyl, 2-(morpholin-4-yl)-2- oxo-ethyl, 4-methylbenzenesulfonyl, methylsulfonyl, 4-chlorobenzenesulfonyl, benzylsulfonyl, 4-methoxybenzenesulfonyl, benzenesulfonyl, 2,5-dimethoxybenzenesulfonyl,
2-cyanobenzenesulfonyl, thiophen-2-ylsulfonyl, 2-fluorobenzenesulfonyl, 2-trifluoromethoxy- benzenesulfonyl, dimethylaminosulfonyl, benzoyl, pyridin-3-ylcarbonyl,
2,4,6-trichlorobenzenecarbonyl, tert-butylaminocarbonyl, dimethylaminocarbonylmethyl, 2-(4- methyl-piperazin-1-yl)-2-oxo-ethyl, 2-(4-pyridin-4-ylpiperazin-1-yl)ethanoyl, 2-[4-(2- methoxyphenyl)piperazin-1-yl]ethanoyl or 2-[4-(1 ,1-diphenylmethyl)piperazin-1-yl]ethanoyl, and the salts of these compounds.
5. Compounds of formula 1
Figure imgf000044_0001
in which
R1 is hydrogen or 1-4C-alkyl,
R2 is hydrogen or 1-4C-alkyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000044_0002
wherein
R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine,
R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine,
R6 is 1-4C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine,
R7 is 1-4C-alkyl and
R8 is hydrogen or 1-4C-alkyl, or wherein
R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom, R9 is hydrogen, 1-4C-alkyl, -S(O)2-R10, -S(0)2-(CH2)n-R11 , -(CH2)m-S(0)2-R12, -C(0)R13,
-C(0)-(CH2)n-R14, -(CH2)m-C(0)-R15, Aryll or (Aryl2)-1-4C-alkyl, R10 is 1-4C-alkyI, 5-dimethylaminonaphthalin-1-yl, -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19, R11 is -N(R16)R17, R12 is -N(R16)R17, R13 is 1-4C-alkyl, hydroxycarbonyl-1-4C-alkyI, phenyl, pyridyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17,
R14 is -N(R16)R17,
R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19 and/or R20,
R16 and R17 are independent from each other hydrogen, 1-7C-alkyl, 3-7C-cycloalkyI, 3-7C-cycloalkyl- methyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrroIi- dinyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 1-piperazinyl-ring of formula (c)
Figure imgf000045_0001
wherein
R21 is 1-4C-alkyl, pyrid-4-yl, pyrid-4-ylmethyl, dimethylamino-1-4C-alkyl, dimethylaminocarbon- ylmethyl, N-methyl-piperidin-4-yl, 4-morpholino-ethyl or tetrahydrofuran-2-ylmethyl, R18 is halogen, nitro, cyano, carboxyl, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy, 1-4C-alkoxycarbonyl, amino, mono-or di-1-4C-alkylamino, aminocarbonyl, 1-4C-alkylcarbonylamino or mono-or di-
1-4C-alkylaminocarbonyl, R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy, R20 is halogen, Aryll is pyrimidin-2-yl, thieno-[2,3-d]pyrimidin-4-yl, 1-methyl-1 H-pyrazolo-[3,4-d]pyrimidin-4-yl, thiazolyl, imidazolyl, furanyl, pyridyl, phenyl or phenyl substituted by R18 and/or R19, Aryl2 is pyridyl, phenyl, phenyl substituted by R18 and/or R19, 2-oxo-2H-chromen-7-yl or 4-(1 ,2,3-thia- diazol-4-yl)phenyl, n is an integer from 1 to 4, m is an integer from 1 to 4, and the salts of these compounds.
6. Compounds of formula 1 according to claim 5, in which
R1 is hydrogen,
R2 is hydrogen or 1-4C-alkyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000045_0002
wherein
R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine,
R5 is 1-4C-alkoxy,
R6 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine,
R7 is methyl and
R8 is hydrogen, or wherein
R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofurane or tetrahydropyran ring, R9 is hydrogen, 1-4C-alkyl, -S(O)2-R10, -C(0)R13, -(CH2)m-C(0)-R15, Aryll or (Aryl2)-1-4C-alkyl, R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl or -N(R16)R17, R13 is 1-4C-alkyl, phenyl, 4-ethyl-piperazin-2,3-dion-1-yl or -N(R16)R17, R15 is -N(R16)R17, phenyl or phenyl substituted by R18 and/or R19 and/or R20, R16 and R17 are independent from each other hydrogen, 1-7C-alkyl, 3-7C-cycloalkyl, 3-7C-cycloalkyl~ methyl, phenyl or phenyl substituted by R18 and/or R19 and/or R20, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl-, 1-pyrroli- dinyl-, 1-piperidinyl-, 1-hexahydroazepino- or a 4-methyl-piperazin-1-yl-ring, R18 is halogen, nitro, cyano, 1-4C-alkyl, trifluoromethyl, 1-4C-alkoxy or 1-4C-alkoxycarbonyl, R19 is halogen, amino, nitro, 1-4C-alkyl or 1-4C-alkoxy, R20 is halogen, Aryll is pyrimidin-2-yl, thieno-[2,3-d]pyrimidin-4-yl, 1-methyl-1 H-pyrazolo-[3,4-d]pyrimidin-4-yl, pyridyl, phenyl or phenyl substituted by R18 and/or R19, Aryl2 is pyridyl, phenyl, phenyl substituted by R18 and/or R19, 2-oxo-2H-chromen-7-yl or 4-(1 ,2,3-thia- diazol-4-yl)phenyl, m is an integer from 1 to 2, and the salts of these compounds.
7. Compounds of formula 1 according to claim 5, in which
R1 is hydrogen,
R2 is hydrogen or methyl,
R3 represents a phenyl derivative of formulae (a) or (b)
Figure imgf000046_0001
wherein
R4 is 1-2C-alkoxy,
R5 is 1-4C-alkoxy,
R6 is 1-2C-alkoxy,
R7 is methyl and
R8 is hydrogen, R9 is hydrogen, -S(0)2-R10, -C(0)R13, -(CH2)m-C(0)-R15 or (Aryl2)-1 -2C-alkyl, R10 is 1-4C-alkyl, 5-dimethylaminonaphthalin-1-yl or -N(R16)R17, R13 is 1 -4C-alkyl, 4-ethyl-piperazin-2,3-dion-1 -yl or -N(R16)R17, R15 is -N(R16)R17, R16 and R17 are independent from each other hydrogen or 1-4C-alkyl, or R16 and R17 together and with inclusion of the nitrogen atom to which they are bonded, form a 4-morpholinyl ring, a 1-pipe- ridinyl ring or a 4-methyl-piperazin-1-yl ring, Aryl2 is pyridyl or phenyl, m is 1 , and the salts of these compounds.
8. Compounds of formula 1 according to claim 5, in which
R1 is hydrogen,
R2 is methyl,
R3 represents a phenyl derivative of formula (a)
Figure imgf000047_0001
wherein
R4 is methoxy,
R5 is methoxy and R9 is acetyl, morpholin-4-ylcarbonyl, pyridin-3-yl methyl, 4-ethyl-piperazin-2,3-dion-1-yl, 4-methylpipe- razin-1-yl, 5-dimethylamino-naphythalene-1-sulfonyl or morpholin-4-yl-2-oxo-ethyl, and the salts of these compounds.
9. Compounds of formula 1 according to claim 1 or 5 for the treatment of diseases.
10. Pharmaceutical compositions containing one or more compounds of formula 1 according to claim 1 or 5 together with the usual pharmaceutical auxiliaries and/or carrier materials.
11. Use of compounds of formula 1 according to claim 1 or 5 for the preparation of pharmaceutical compositions for the treatment of airway disorders.
12. A method for treating an illness treatable by the administration of a PDE4 inhibitor in a patient comprising administering to said patient in need thereof a therapeutically effective amount of a compound of formula 1 as claimed in claim 1 or 5.
13. A method for treating airway disorders in a patient comprising administering to said patient a therapeutically effective amount of a compound of formula 1 as claimed in claim 1 or 5.
PCT/EP2003/008677 2002-08-10 2003-08-06 Pyridazinone-derivatives as pde4 inhibitors Ceased WO2004018451A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
JP2004530088A JP2005538138A (en) 2002-08-10 2003-08-06 Pyridazinone derivatives as PDE4 inhibitors
HR20050199A HRP20050199A2 (en) 2002-08-10 2003-08-06 NEW PIRIDAZINON DERIVATIVES
AU2003251693A AU2003251693A1 (en) 2002-08-10 2003-08-06 Pyridazinone-derivatives as pde4 inhibitors
US10/523,112 US20060167001A1 (en) 2002-08-10 2003-08-06 Pyridazinone-derivatives as pde4 inhibitors
CA002494650A CA2494650A1 (en) 2002-08-10 2003-08-06 Pyridazinone-derivatives as pde4 inhibitors
EP03792259A EP1556369A1 (en) 2002-08-10 2003-08-06 Pyridazinone-derivatives as pde4 inhibitors
IS7717A IS7717A (en) 2002-08-10 2005-02-28 Pyridazinone derivatives as PDF4 inhibitors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP02017976.8 2002-08-10
EP02017976 2002-08-10

Publications (2)

Publication Number Publication Date
WO2004018451A1 true WO2004018451A1 (en) 2004-03-04
WO2004018451A8 WO2004018451A8 (en) 2004-05-06

Family

ID=31896826

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/008677 Ceased WO2004018451A1 (en) 2002-08-10 2003-08-06 Pyridazinone-derivatives as pde4 inhibitors

Country Status (9)

Country Link
US (1) US20060167001A1 (en)
EP (1) EP1556369A1 (en)
JP (1) JP2005538138A (en)
AU (1) AU2003251693A1 (en)
CA (1) CA2494650A1 (en)
HR (1) HRP20050199A2 (en)
IS (1) IS7717A (en)
PL (1) PL373146A1 (en)
WO (1) WO2004018451A1 (en)

Cited By (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006056471A1 (en) 2004-11-29 2006-06-01 Novartis Ag 5-hydroxy-benzothiazole derivatives having beta-2-adrenorecptor agonist activity
US7179810B2 (en) 2001-02-15 2007-02-20 Altana Pharma Ag Phthalazinone-piperidino-derivatives as PDE4 inhibitors
WO2007071400A1 (en) 2005-12-22 2007-06-28 Novartis Ag Pyrazine derivatives as epithelial sodium channel blocker
WO2007121920A2 (en) 2006-04-21 2007-11-01 Novartis Ag Purine derivatives for use as adenosin a2a receptor agonists
WO2008037477A1 (en) 2006-09-29 2008-04-03 Novartis Ag Pyrazolopyrimidines as p13k lipid kinase inhibitors
WO2008052734A1 (en) 2006-10-30 2008-05-08 Novartis Ag Heterocyclic compounds as antiinflammatory agents
WO2008138939A1 (en) * 2007-05-16 2008-11-20 Nycomed Gmbh Pyrazolone derivatives as pde4 inhibitors
US7494990B2 (en) 2004-02-04 2009-02-24 Nycomed Gmbh 2-(piperidin-4-yl)-4,5-dihydro-2H-pyridazin-3-one derivatives as PDE4 inhibitors
WO2009087224A1 (en) 2008-01-11 2009-07-16 Novartis Ag Pyrimidines as kinase inhibitors
WO2009150137A2 (en) 2008-06-10 2009-12-17 Novartis Ag Organic compounds
EP2206499A1 (en) 2004-11-02 2010-07-14 Novartis AG Quinuclidine derivatives and their use as muscarinic m3 receptor antagonists
WO2010088335A1 (en) 2009-01-29 2010-08-05 Novartis Ag Substituted benzimidazoles for the treatment of astrocytomas
EP2253612A1 (en) 2005-04-14 2010-11-24 Novartis AG Organic compounds
EP2270008A1 (en) 2005-05-20 2011-01-05 Novartis AG 1,3-dihydro-imidazo[4,5-c]quinolin-2-ones as lipid kinase and/or pi3 kinases inhibitors
EP2279777A2 (en) 2007-01-10 2011-02-02 Irm Llc Compounds and compositions as channel activating protease inhibitors
EP2281819A1 (en) 2004-01-21 2011-02-09 Novartis AG Benzimidazolyl or benzoxazolyl derivatives
WO2011015652A1 (en) 2009-08-07 2011-02-10 Novartis Ag 3-heteroarylmethyl-imidazo[1,2-b]pyridazin-6-yl derivatives as c-met tyrosine kinase modulators
WO2011018454A1 (en) 2009-08-12 2011-02-17 Novartis Ag Heterocyclic hydrazone compounds and their uses to treat cancer and inflammation
EP2286813A2 (en) 2006-01-31 2011-02-23 Novartis AG Use of naphthyridine derivatives as medicaments
WO2011022439A1 (en) 2009-08-17 2011-02-24 Intellikine, Inc. Heterocyclic compounds and uses thereof
WO2011020861A1 (en) 2009-08-20 2011-02-24 Novartis Ag Heterocyclic oxime compounds
EP2292619A1 (en) 2004-10-22 2011-03-09 Novartis AG Purine derivatives for use as adenonsin A-2A receptor agonists
WO2011050325A1 (en) 2009-10-22 2011-04-28 Vertex Pharmaceuticals Incorporated Compositions for treatment of cystic fibrosis and other chronic diseases
EP2332933A1 (en) 2007-05-07 2011-06-15 Novartis AG Epithelial sodium channel (ENaC) inhibitors
WO2011113894A1 (en) 2010-03-19 2011-09-22 Novartis Ag Pyridine and pyrazine derivative for the treatment of cf
WO2012034091A1 (en) 2010-09-09 2012-03-15 Irm Llc Imidazo [1, 2] pyridazin compounds and compositions as trk inhibitors
WO2012034095A1 (en) 2010-09-09 2012-03-15 Irm Llc Compounds and compositions as trk inhibitors
WO2012035158A1 (en) 2010-09-17 2012-03-22 Novartis Ag Pyrazine derivatives as enac blockers
EP2444120A1 (en) 2007-12-10 2012-04-25 Novartis AG Spirocyclic amiloride analogues as ENac blockers
WO2012107500A1 (en) 2011-02-10 2012-08-16 Novartis Ag [1, 2, 4] triazolo [4, 3 -b] pyridazine compounds as inhibitors of the c-met tyrosine kinase
WO2012116237A2 (en) 2011-02-23 2012-08-30 Intellikine, Llc Heterocyclic compounds and uses thereof
WO2012116217A1 (en) 2011-02-25 2012-08-30 Irm Llc Compounds and compositions as trk inhibitors
EP2532677A1 (en) 2005-10-21 2012-12-12 Novartis AG Human antibodies against il13 and therapeutic uses
WO2012171900A1 (en) 2011-06-17 2012-12-20 Nycomed Gmbh Novel phthalazinone-pyrrolopyrimidinecarboxamide derivatives
WO2013030802A1 (en) 2011-09-01 2013-03-07 Novartis Ag Bicyclic heterocycle derivatives for the treatment of pulmonary arterial hypertension
WO2013038362A1 (en) 2011-09-15 2013-03-21 Novartis Ag 6 - substituted 3 - (quinolin- 6 - ylthio) - [1,2,4] triazolo [4, 3 -a] pyradines as tyrosine kinase
WO2013038390A1 (en) 2011-09-16 2013-03-21 Novartis Ag N-substituted heterocyclyl carboxamides
WO2013038378A1 (en) 2011-09-16 2013-03-21 Novartis Ag Pyridine amide derivatives
WO2013038381A1 (en) 2011-09-16 2013-03-21 Novartis Ag Pyridine/pyrazine amide derivatives
WO2013038373A1 (en) 2011-09-16 2013-03-21 Novartis Ag Pyridine amide derivatives
WO2013038386A1 (en) 2011-09-16 2013-03-21 Novartis Ag Heterocyclic compounds for the treatment of cystic fibrosis
WO2013140319A1 (en) 2012-03-19 2013-09-26 Novartis Ag Crystalline form of a succinate salt
WO2013149581A1 (en) 2012-04-03 2013-10-10 Novartis Ag Combination products with tyrosine kinase inhibitors and their use
US8609848B2 (en) 2008-11-14 2013-12-17 Takeda Gmbh Pyrazolone-derivatives and their use as PDE-4 inhibitors
WO2014132220A1 (en) 2013-03-01 2014-09-04 Novartis Ag Solid forms of bicyclic heterocyclic derivatives as pdgf receptor mediators
WO2014151147A1 (en) 2013-03-15 2014-09-25 Intellikine, Llc Combination of kinase inhibitors and uses thereof
WO2015084804A1 (en) 2013-12-03 2015-06-11 Novartis Ag Combination of mdm2 inhibitor and braf inhibitor and their use
WO2015162456A1 (en) 2014-04-24 2015-10-29 Novartis Ag Amino pyridine derivatives as phosphatidylinositol 3-kinase inhibitors
WO2015162459A1 (en) 2014-04-24 2015-10-29 Novartis Ag Amino pyrazine derivatives as phosphatidylinositol 3-kinase inhibitors
WO2015162461A1 (en) 2014-04-24 2015-10-29 Novartis Ag Pyrazine derivatives as phosphatidylinositol 3-kinase inhibitors
US9174994B2 (en) 2011-11-23 2015-11-03 Intellikine, Llc Enhanced treatment regimens using mTor inhibitors
WO2016011956A1 (en) 2014-07-25 2016-01-28 Novartis Ag Combination therapy
WO2016016822A1 (en) 2014-07-31 2016-02-04 Novartis Ag Combination therapy
EP3603634A1 (en) 2004-05-18 2020-02-05 Novartis AG Pharmaceutical composition containing glycopyrrolate and a beta2 adrenoceptor agonist
WO2020250116A1 (en) 2019-06-10 2020-12-17 Novartis Ag Pyridine and pyrazine derivative for the treatment of cf, copd, and bronchiectasis
WO2021038426A1 (en) 2019-08-28 2021-03-04 Novartis Ag Substituted 1,3-phenyl heteroaryl derivatives and their use in the treatment of disease

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080227790A1 (en) * 2004-02-04 2008-09-18 Altana Pharma Ag Pyridazinone Derivatives and their Use as Pde4 Inhibitors
WO2013106547A1 (en) 2012-01-10 2013-07-18 President And Fellows Of Harvard College Beta-cell replication promoting compounds and methods of their use

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992006963A1 (en) * 1990-10-16 1992-04-30 Byk Gulden Lomberg Chemische Fabrik Gmbh Arylpyridazinones
EP0763534A1 (en) * 1995-09-14 1997-03-19 MERCK PATENT GmbH Arylalkyl-diazinone derivatives as phosphodiesterase IV inhibitors
WO1999031090A1 (en) * 1997-12-15 1999-06-24 Byk Gulden Lomberg Chemische Fabrik Gmbh Dihydrobenzofurans
WO2001094319A1 (en) * 2000-06-05 2001-12-13 Altana Pharma Ag Compounds effective as beta-2-adrenoreceptor agonists as well as pde4-inhibitors

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5716954A (en) * 1991-10-09 1998-02-10 Syntex U.S.A. Inc. Benzopyridazinone and pyridopyridazinone compounds
BR9806752A (en) * 1997-01-15 2000-03-14 Byk Gulden Lomberg Chem Fab Phthalazinones.
SI1070056T1 (en) * 1998-03-14 2004-12-31 Altana Pharma Ag Phthalazinone pde iii/iv inhibitors
HUP0203487A2 (en) * 1999-10-25 2003-02-28 Byk Gulden Lomberg Chemische Fabrik Gmbh Tetrahydrothiopyran-phthalazinone derivatives as pde4 inhibitors and pharmaceutical compositions containing them
WO2001030766A1 (en) * 1999-10-25 2001-05-03 Byk Gulden Lomberg Chemische Fabrik Gmbh Phthalazinone derivatives as pde 4 inhibitors
CZ20032491A3 (en) * 2001-02-15 2004-01-14 Altana Pharma Ag Phthalazinone piperidine derivatives
EP1385848A2 (en) * 2001-04-25 2004-02-04 ALTANA Pharma AG Phtalazinones derivatives useful as pde4/7 inhibitors
BR0209076A (en) * 2001-04-25 2004-08-10 Altana Pharma Ag Piperazine derivatives and their use as a pde4 inhibitor

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992006963A1 (en) * 1990-10-16 1992-04-30 Byk Gulden Lomberg Chemische Fabrik Gmbh Arylpyridazinones
EP0763534A1 (en) * 1995-09-14 1997-03-19 MERCK PATENT GmbH Arylalkyl-diazinone derivatives as phosphodiesterase IV inhibitors
WO1999031090A1 (en) * 1997-12-15 1999-06-24 Byk Gulden Lomberg Chemische Fabrik Gmbh Dihydrobenzofurans
WO2001094319A1 (en) * 2000-06-05 2001-12-13 Altana Pharma Ag Compounds effective as beta-2-adrenoreceptor agonists as well as pde4-inhibitors

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
EDDY SOTELO ET AL.: "Pyridazines. Part 25: Efficient and Selective.......", TETRAHEDRON LETTERS., vol. 42, 2001, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM., NL, pages 8633 - 8636, XP004321511, ISSN: 0040-4039 *
MARGARETHA VAN DER MEY ET AL.: "Novel Selective PDE4 Inhibitors. 1. Synthesis, Structure-Activity Relationships, and Molecular Modelling of 4-(3,4-Dimethoxyphenyl)-2H-phthalazin-1-ones and Analogues", JOURNAL OF MEDICINAL CHEMISTRY., vol. 44, no. 16, 2001, AMERICAN CHEMICAL SOCIETY. WASHINGTON., US, pages 2511 - 2522, XP002222950, ISSN: 0022-2623 *
MARGARETHA VAN DER MEY ET AL.: "Novel Selective PDE4 Inhibitors.2. Synthesis and Structure-Activity Relationships of 4-Aryl-Substituted cis Tetra- and cis Hexahydrophthalazinones", JOURNAL OF MEDICINAL CHEMISTRY., vol. 44, no. 16, 2001, AMERICAN CHEMICAL SOCIETY. WASHINGTON., US, pages 2523 - 2535, XP002222951, ISSN: 0022-2623 *
WILLIAM J. COATES ET AL.: "1,4-Bis(3-0x0-2,3-dihydropyridazin-6-yl)benzene Analogues: Potent phosphodiesterase Inhibitors and Inodilators", JOURNAL OF MEDICINAL CHEMISTRY., vol. 33, no. 6, 1990, AMERICAN CHEMICAL SOCIETY. WASHINGTON., US, pages 1735 - 1741, XP002119282, ISSN: 0022-2623 *

Cited By (80)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7179810B2 (en) 2001-02-15 2007-02-20 Altana Pharma Ag Phthalazinone-piperidino-derivatives as PDE4 inhibitors
US7531540B2 (en) 2001-02-15 2009-05-12 Nycomed Gmbh Phthalazinone-piperidino-derivatives as PDE4 inhibitors
EP2281819A1 (en) 2004-01-21 2011-02-09 Novartis AG Benzimidazolyl or benzoxazolyl derivatives
AU2005210042B2 (en) * 2004-02-04 2011-04-21 Takeda Gmbh 2-(piperidin-4-yl) -4, 5-dihydro-2H-pyridazin-3-one derivatives as PDE4 inhibitors
US7820669B2 (en) 2004-02-04 2010-10-26 Nycomed Gmbh 2-(piperidin-4-yl)-4,5-dihydro-2H-pyridazin-3-one derivatives as PDE4 inhibitors
US7494990B2 (en) 2004-02-04 2009-02-24 Nycomed Gmbh 2-(piperidin-4-yl)-4,5-dihydro-2H-pyridazin-3-one derivatives as PDE4 inhibitors
EP3603634A1 (en) 2004-05-18 2020-02-05 Novartis AG Pharmaceutical composition containing glycopyrrolate and a beta2 adrenoceptor agonist
EP2292619A1 (en) 2004-10-22 2011-03-09 Novartis AG Purine derivatives for use as adenonsin A-2A receptor agonists
EP2206499A1 (en) 2004-11-02 2010-07-14 Novartis AG Quinuclidine derivatives and their use as muscarinic m3 receptor antagonists
EP2305659A1 (en) 2004-11-29 2011-04-06 Novartis AG 5-hydroxy-benzothiazole derivatives having beta-2-adrenoreceptor agonist activity
WO2006056471A1 (en) 2004-11-29 2006-06-01 Novartis Ag 5-hydroxy-benzothiazole derivatives having beta-2-adrenorecptor agonist activity
EP2253612A1 (en) 2005-04-14 2010-11-24 Novartis AG Organic compounds
EP2292617A1 (en) 2005-05-20 2011-03-09 Novartis AG 1,3-dihydro-imidazo[4,5-c]quinolin-2-ones as lipid kinase and/or pi3 kinase inhibitors
EP2270008A1 (en) 2005-05-20 2011-01-05 Novartis AG 1,3-dihydro-imidazo[4,5-c]quinolin-2-ones as lipid kinase and/or pi3 kinases inhibitors
EP2532677A1 (en) 2005-10-21 2012-12-12 Novartis AG Human antibodies against il13 and therapeutic uses
EP2532679A1 (en) 2005-10-21 2012-12-12 Novartis AG Human antibodies against il13 and therapeutic uses
WO2007071400A1 (en) 2005-12-22 2007-06-28 Novartis Ag Pyrazine derivatives as epithelial sodium channel blocker
EP2286813A2 (en) 2006-01-31 2011-02-23 Novartis AG Use of naphthyridine derivatives as medicaments
EP2322525A1 (en) 2006-04-21 2011-05-18 Novartis AG Purine derivatives for use as adenosin A2A receptor agonists
WO2007121920A2 (en) 2006-04-21 2007-11-01 Novartis Ag Purine derivatives for use as adenosin a2a receptor agonists
WO2008037477A1 (en) 2006-09-29 2008-04-03 Novartis Ag Pyrazolopyrimidines as p13k lipid kinase inhibitors
WO2008052734A1 (en) 2006-10-30 2008-05-08 Novartis Ag Heterocyclic compounds as antiinflammatory agents
EP2279777A2 (en) 2007-01-10 2011-02-02 Irm Llc Compounds and compositions as channel activating protease inhibitors
EP2332933A1 (en) 2007-05-07 2011-06-15 Novartis AG Epithelial sodium channel (ENaC) inhibitors
US9090597B2 (en) 2007-05-16 2015-07-28 Takeda Gmbh Pyrazolone derivatives as PDE4 inhibitors
US8304436B2 (en) 2007-05-16 2012-11-06 Nycomed Gmbh Pyrazolone derivatives as PDE4 inhibitors
CN103463086B (en) * 2007-05-16 2015-10-21 塔科达有限责任公司 Pyrazolone derivatives as PDE4 inhibitors
EP2508520A1 (en) 2007-05-16 2012-10-10 Nycomed GmbH Pyrazolone-derivatives as PDE4 inhibitors
WO2008138939A1 (en) * 2007-05-16 2008-11-20 Nycomed Gmbh Pyrazolone derivatives as pde4 inhibitors
EP2402330A1 (en) 2007-05-16 2012-01-04 Nycomed GmbH Pyrazolone-derivatives as PDE4 inhibitors
US8865745B2 (en) 2007-05-16 2014-10-21 Takeda Gmbh Pyrazolone derivatives as PDE4 inhibitors
EA018984B1 (en) * 2007-05-16 2013-12-30 Никомед Гмбх Pyrazolone derivatives as pde4 inhibitors
CN101657441B (en) * 2007-05-16 2013-09-11 塔科达有限责任公司 Pyrazolone derivatives as PDE4 inhibitors
EP2444120A1 (en) 2007-12-10 2012-04-25 Novartis AG Spirocyclic amiloride analogues as ENac blockers
EP2520574A1 (en) 2007-12-10 2012-11-07 Novartis AG Amiloride analogues substituted on the cyclic guanidine moiety as ENaC blockers for treating respiratory diseases
WO2009087224A1 (en) 2008-01-11 2009-07-16 Novartis Ag Pyrimidines as kinase inhibitors
WO2009150137A2 (en) 2008-06-10 2009-12-17 Novartis Ag Organic compounds
US8609848B2 (en) 2008-11-14 2013-12-17 Takeda Gmbh Pyrazolone-derivatives and their use as PDE-4 inhibitors
US9340522B2 (en) 2008-11-14 2016-05-17 Takeda Gmbh Pyrazolone-derivatives and their use as PDE-4 inhibitors
WO2010088335A1 (en) 2009-01-29 2010-08-05 Novartis Ag Substituted benzimidazoles for the treatment of astrocytomas
WO2011015652A1 (en) 2009-08-07 2011-02-10 Novartis Ag 3-heteroarylmethyl-imidazo[1,2-b]pyridazin-6-yl derivatives as c-met tyrosine kinase modulators
WO2011018454A1 (en) 2009-08-12 2011-02-17 Novartis Ag Heterocyclic hydrazone compounds and their uses to treat cancer and inflammation
WO2011022439A1 (en) 2009-08-17 2011-02-24 Intellikine, Inc. Heterocyclic compounds and uses thereof
WO2011020861A1 (en) 2009-08-20 2011-02-24 Novartis Ag Heterocyclic oxime compounds
EP2813227A1 (en) 2009-10-22 2014-12-17 Vertex Pharmaceuticals Incorporated Compositions for treatment of cystic fibrosis and other chronic diseases
WO2011050325A1 (en) 2009-10-22 2011-04-28 Vertex Pharmaceuticals Incorporated Compositions for treatment of cystic fibrosis and other chronic diseases
EP2845593A1 (en) 2010-03-19 2015-03-11 Novartis AG Pyridine and pyrazine derivative for the treatment of chronic obstructive pulmonary disease
WO2011113894A1 (en) 2010-03-19 2011-09-22 Novartis Ag Pyridine and pyrazine derivative for the treatment of cf
WO2012034091A1 (en) 2010-09-09 2012-03-15 Irm Llc Imidazo [1, 2] pyridazin compounds and compositions as trk inhibitors
WO2012034095A1 (en) 2010-09-09 2012-03-15 Irm Llc Compounds and compositions as trk inhibitors
WO2012035158A1 (en) 2010-09-17 2012-03-22 Novartis Ag Pyrazine derivatives as enac blockers
WO2012107500A1 (en) 2011-02-10 2012-08-16 Novartis Ag [1, 2, 4] triazolo [4, 3 -b] pyridazine compounds as inhibitors of the c-met tyrosine kinase
US9127000B2 (en) 2011-02-23 2015-09-08 Intellikine, LLC. Heterocyclic compounds and uses thereof
WO2012116237A2 (en) 2011-02-23 2012-08-30 Intellikine, Llc Heterocyclic compounds and uses thereof
WO2012116217A1 (en) 2011-02-25 2012-08-30 Irm Llc Compounds and compositions as trk inhibitors
CN103582644B (en) * 2011-06-17 2016-07-20 塔科达有限责任公司 Phthalazinone-Pyrrolopyrimidine Carboxamide Derivatives
EA023713B1 (en) * 2011-06-17 2016-07-29 Такеда Гмбх DERIVATIVES OF PHTHALASINONPYRROLOPYRIMIDINCARBOXAMID
CN103582644A (en) * 2011-06-17 2014-02-12 塔科达有限责任公司 New Phthalazinone-Pyrrolopyrimidine Carboxamide Derivatives
WO2012171900A1 (en) 2011-06-17 2012-12-20 Nycomed Gmbh Novel phthalazinone-pyrrolopyrimidinecarboxamide derivatives
WO2013030802A1 (en) 2011-09-01 2013-03-07 Novartis Ag Bicyclic heterocycle derivatives for the treatment of pulmonary arterial hypertension
WO2013038362A1 (en) 2011-09-15 2013-03-21 Novartis Ag 6 - substituted 3 - (quinolin- 6 - ylthio) - [1,2,4] triazolo [4, 3 -a] pyradines as tyrosine kinase
WO2013038386A1 (en) 2011-09-16 2013-03-21 Novartis Ag Heterocyclic compounds for the treatment of cystic fibrosis
WO2013038373A1 (en) 2011-09-16 2013-03-21 Novartis Ag Pyridine amide derivatives
WO2013038390A1 (en) 2011-09-16 2013-03-21 Novartis Ag N-substituted heterocyclyl carboxamides
WO2013038378A1 (en) 2011-09-16 2013-03-21 Novartis Ag Pyridine amide derivatives
WO2013038381A1 (en) 2011-09-16 2013-03-21 Novartis Ag Pyridine/pyrazine amide derivatives
US9174994B2 (en) 2011-11-23 2015-11-03 Intellikine, Llc Enhanced treatment regimens using mTor inhibitors
US9669032B2 (en) 2011-11-23 2017-06-06 Intellikine Llc Enhanced treatment regimens using mTOR inhibitors
WO2013140319A1 (en) 2012-03-19 2013-09-26 Novartis Ag Crystalline form of a succinate salt
WO2013149581A1 (en) 2012-04-03 2013-10-10 Novartis Ag Combination products with tyrosine kinase inhibitors and their use
WO2014132220A1 (en) 2013-03-01 2014-09-04 Novartis Ag Solid forms of bicyclic heterocyclic derivatives as pdgf receptor mediators
WO2014151147A1 (en) 2013-03-15 2014-09-25 Intellikine, Llc Combination of kinase inhibitors and uses thereof
WO2015084804A1 (en) 2013-12-03 2015-06-11 Novartis Ag Combination of mdm2 inhibitor and braf inhibitor and their use
WO2015162461A1 (en) 2014-04-24 2015-10-29 Novartis Ag Pyrazine derivatives as phosphatidylinositol 3-kinase inhibitors
WO2015162456A1 (en) 2014-04-24 2015-10-29 Novartis Ag Amino pyridine derivatives as phosphatidylinositol 3-kinase inhibitors
WO2015162459A1 (en) 2014-04-24 2015-10-29 Novartis Ag Amino pyrazine derivatives as phosphatidylinositol 3-kinase inhibitors
WO2016011956A1 (en) 2014-07-25 2016-01-28 Novartis Ag Combination therapy
WO2016016822A1 (en) 2014-07-31 2016-02-04 Novartis Ag Combination therapy
WO2020250116A1 (en) 2019-06-10 2020-12-17 Novartis Ag Pyridine and pyrazine derivative for the treatment of cf, copd, and bronchiectasis
WO2021038426A1 (en) 2019-08-28 2021-03-04 Novartis Ag Substituted 1,3-phenyl heteroaryl derivatives and their use in the treatment of disease

Also Published As

Publication number Publication date
PL373146A1 (en) 2005-08-22
IS7717A (en) 2005-02-28
AU2003251693A1 (en) 2004-03-11
CA2494650A1 (en) 2004-03-04
US20060167001A1 (en) 2006-07-27
WO2004018451A8 (en) 2004-05-06
JP2005538138A (en) 2005-12-15
HRP20050199A2 (en) 2006-04-30
EP1556369A1 (en) 2005-07-27

Similar Documents

Publication Publication Date Title
US20060167001A1 (en) Pyridazinone-derivatives as pde4 inhibitors
CA2438520C (en) Phthalazinone-piperidino-derivatives as pde4 inhibitors
US7186710B2 (en) Phthalazinones
AU2003263216A1 (en) Benzonaphthyridines with PDE 3/4 inhibiting activity
AU2003260376A1 (en) Piperidine-pyridazones and phthalazones as pde4 inhibitors
AU2002234634A1 (en) Phthalayinone-piperidino-derivatives as PDE4 inhibitors
AU2002317733A1 (en) Phthalazinones derivatives useful as PDE4/7 inhibitors
AU2002315311B2 (en) Piperazino-derivatives and their use as PDE4 inhibitor
US7820669B2 (en) 2-(piperidin-4-yl)-4,5-dihydro-2H-pyridazin-3-one derivatives as PDE4 inhibitors
AU2002315311A1 (en) Piperazino-derivatives and their use as PDE4 inhibitor
EP1720854A1 (en) Phthalzinone derivatives as pde4 inhibitors
US20080227790A1 (en) Pyridazinone Derivatives and their Use as Pde4 Inhibitors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AU BA BR CA CN CO DZ EC GE HR ID IL IN IS JP KR LT LV MA MK MX NO NZ PH PL SG TN UA US VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR

121 Ep: the epo has been informed by wipo that ep was designated in this application
CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: IN PCT GAZETTE 10/2004 REPLACE "(72) INVENTORS " BY "(72) INVENTORS (FOR ALL DESIGNATED STATES EXCEPT CA, PH, US)"

WWE Wipo information: entry into national phase

Ref document number: 2494650

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2006167001

Country of ref document: US

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 10523112

Country of ref document: US

Ref document number: 373146

Country of ref document: PL

WWE Wipo information: entry into national phase

Ref document number: P-2005/0111

Country of ref document: YU

WWE Wipo information: entry into national phase

Ref document number: 2004530088

Country of ref document: JP

Ref document number: 2003792259

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: P20050199A

Country of ref document: HR

WWE Wipo information: entry into national phase

Ref document number: 2003251693

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2003792259

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 10523112

Country of ref document: US

WWW Wipo information: withdrawn in national office

Ref document number: 2003792259

Country of ref document: EP