WO2004016795A1 - Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods - Google Patents

Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods Download PDF

Info

Publication number
WO2004016795A1
WO2004016795A1 PCT/EP2003/008834 EP0308834W WO2004016795A1 WO 2004016795 A1 WO2004016795 A1 WO 2004016795A1 EP 0308834 W EP0308834 W EP 0308834W WO 2004016795 A1 WO2004016795 A1 WO 2004016795A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
protein
binding domain
fusion protein
gal4bd
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2003/008834
Other languages
French (fr)
Inventor
Alain Nicolas
Ana Pecina-Lopez
Alberto Pascual
Kathleen Smith
Christine Mezard
Minoo Rassoulzadegan
Michèle VEDEL
Valérie BORDE
Norio Uematsu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Institut National de la Recherche Agronomique INRA
Institut National de la Sante et de la Recherche Medicale INSERM
Institut Curie
Original Assignee
Centre National de la Recherche Scientifique CNRS
Institut National de la Recherche Agronomique INRA
Institut National de la Sante et de la Recherche Medicale INSERM
Institut Curie
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS, Institut National de la Recherche Agronomique INRA, Institut National de la Sante et de la Recherche Medicale INSERM, Institut Curie filed Critical Centre National de la Recherche Scientifique CNRS
Priority to AU2003255401A priority Critical patent/AU2003255401A1/en
Priority to DE60317676T priority patent/DE60317676T2/en
Priority to EP03787756A priority patent/EP1523564B1/en
Priority to CA2492932A priority patent/CA2492932C/en
Priority to JP2004528455A priority patent/JP4439398B2/en
Publication of WO2004016795A1 publication Critical patent/WO2004016795A1/en
Priority to US11/037,295 priority patent/US7279334B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90Isomerases (5.)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the rates of meiotic recombination between paternal and maternal chromosomes vary by several orders of magnitude at different chromosomal loci.
  • meiotic recombination is initiated by programmed DNA double- strand breaks (DSBs), a process that requires at least 15 proteins including Spo11 , a widely conserved protein that likely catalyzes cleavage.
  • the present invention pertains to methods and kits to increase the rate of meiotic recombination in a cell and, more specifically, to induce targeted meiotic recombination. This invention is based on the fact that it is possible to target the initiation of meiotic recombination to a target site, by expressing in the cell a chimeric protein comprising a DNA binding domain operabiy linked to the Spo11 protein.
  • meiotic recombination rates vary by several orders of magnitude along chromosomes. Recent studies of S. cerevisiae strongly suggest that most of this variation is related to the frequencies of initiating events (Baudat and Nicolas, 1997), but why it is relatively frequent at some loci (hotspots) and relatively infrequent at others (coldspots) remain unexplained. In S.
  • DSBs DNA double-strand breaks
  • Numerous studies have shown that natural DSB sites are not evenly distributed and that cleavage frequencies vary 10-100-fold from site to site (Baudat and Nicolas, 1997; Gerton et al., 2000). The factors that determine whether a specific region or site is prone to DSB formation (and hence, recombination) are not completely understood, but they are known to act both locally and globally. Locally, gene organization and chromatin structure appear to be of paramount, and related, importance. Typically, most natural DSB sites are in promoter-containing regions (Baudat and Nicolas, 1997).
  • transcription factors-dependent but not transcription-dependent
  • transcription factor independent hotspots
  • a consideration of the chromosomal variation in DSB frequencies must also take into account the influence of fra ⁇ s-acting factors.
  • a large number of genes are required for DSB formation, including SP011, MEI4, MER1, MER2/REC107, MRE2/NAM8, MRE11, RAD50, REC102, REC103/SKI8, REC104, REC114 and XRS2, but in most cases, their molecular roles are unknown. Null mutants for all of the above genes fail to carry out meiotic recombination and produce inviable spores.
  • MEK1/MRE4 encodes a kinase that regulates the activities of the RED1 and HOP1 products, which are structural components of meiotic chromosomes.
  • SP011 encodes a protein that shares sequence similarity with the smaller subunit (Top ⁇ A) of the type II topoisomerase of the archaebacterium Sulfobolus shibatae (Bergerat et al., 1997). Spoi l remains covalently linked to the 5'-strand termini of DSB fragments in mutants (e.g.
  • rad ⁇ OS that are defective for the 5' to 3' nucleolytic processing of DSB ends that normally precedes repair (Keeney et al., 1997), indicating that it is the catalytic component of the meiotic DSB cleavage activity.
  • Gal4BD The inventors have fused Spo11 to the DNA-binding domain of the Gal4 protein (Gal4BD), creating a Gal4BD-Spo11 fusion protein.
  • the Gal4 protein is one of the best characterized transcriptional activators in S. cerevisiae and is required for the expression of genes involved in galactose catabolism.
  • the protein binds to a consensus upstream activator sequence (UASGAL) through its N-terminal domain and stimulates transcription via its C-terminal activation domain.
  • USGAL consensus upstream activator sequence
  • CGGNnCCG consensus 17-base pair sequence at UASGAL sites
  • One object of the present invention is a method for increasing recombination between homologous chromosomes in a dividing cell, comprising the steps of expressing a DBD-Spo11 protein (wherein DBD is a DNA binding domain), in a dividing cell.
  • the invention also pertains to a method for performing a targeted recombination between two or more polymorphisms carried by a same chromosome in a cell, having said fusion protein expressed in a dividing cell and wherein the binding domain recognises a DNA sequence situated between or near said polymorphisms. If necessary, a DNA sequence recognized by said DNA binding domain operably linked to Spo l can be introduced into the cell genome, by standard techniques.
  • the dividing cell might be a mitotic or a meiotic cell.
  • the cell can comprise artificial chromosomes carrying one or more sequence(s) recognized by the DNA binding domain operably linked to the Spo11 protein.
  • nucleic acid encoding the DBD-Spo11 fusion protein is stably integrated into the cell genome.
  • Another aspect of the present invention is a method for inducing meiotic recombination in artificial chromosomes in a cell, comprising the introduction into a meiotic cell of a nucleic acid encoding a DBD-Spo11 fusion protein, wherein the DNA binding domain recognises at least one sequence of said artificial chromosome.
  • the cell is a yeast
  • the artificial chromosome is a YAC consisting of yeast or non-yeast DNA having one or more sites with a CGGN-nCGG sequence
  • the fusion protein is a Gal4BD-Spo11 fusion protein.
  • the invention also concerns a method for generating variants of an organism, comprising the steps of inducing a meiotic recombination using a DBD-Spo11 fusion protein expressed in a meiotic cell, and having the meiotic recombination occur at a higher rate and/or at different loci of the homologous chromosomes of the meiotic cells.
  • This method can further comprise a step of screening said variants for the presence of two or more characters.
  • the present invention encompasses a method for analysing the genome of an organism, comprising the steps of generating variants of said organism, by performing the above method, performing a genetic analysis and a phenotypic analysis of certain characters of said variants, and analysing the genome of said organism.
  • All the methods according to the invention can be performed in any kind of eukaryotic cells and organisms, such as fungi, plants, and animals.
  • An other aspect of the present invention is a kit for performing the methods described above, containing a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said fusion protein is capable of inducing meiotic recombination in formerly cold regions.
  • a kit can further comprise a nucleic acid carrying a target sequence recognized by said DNA binding domain operably linked to a Spoi l protein.
  • the nucleic acids of the kit according to the invention can be comprised in a vector, which can be any kind of vector, such as, for example, plasmids or any kind of replicative DNAs, complexed with transfecting agents if necessary, or phages, or virus.
  • a vector which can be any kind of vector, such as, for example, plasmids or any kind of replicative DNAs, complexed with transfecting agents if necessary, or phages, or virus.
  • the invention also pertains to a eukaryotic cell expressing a fusion protein comprising a DNA binding domain operably linked to a Spo11 protein, wherein said fusion protein is capable of inducing meiotic recombination in formerly cold regions of the genome of said eukaryotic cell.
  • This eukaryotic cell can be for example a fungus, a plant cell, a mammalian cell, or an insect cell.
  • Another aspect of the present invention concerns nucleic acids encoding a fusion protein comprising a DNA binding domain operably linked thereto, wherein said Spoi l protein is, for example, the AtSpo11 protein from Arabidopsis thaliana or the murine Spo11 protein.
  • DSB formation in the YCR046c promoter (1 ), the YCR047c-YCR048w promoter (2), and the YCR048w ORF (3) are represented as a histogram.
  • C DSB formation at the ARG4 locus. DNA was digested with S ⁇ aBI and probed with an ARG4 internal fragment. The asterisk indicates a cross hybridizing band.
  • D DSB formation at the CYS3 locus. DNA was digested with HindlW and probed with a FUN36 internal fragment.
  • Genomic DNA was prepared from SP011 (ORD1181) and GAL4BD-SP011 (ORD5807) diploids and analysed as described in Figure 2. UASGAL sequences are indicated as boxes.
  • A DSB formation at the GAL2 locus. DNA was digested with Xba ⁇ -Nco ⁇ and probed with a GAL2 internal fragment.
  • B DSB formation at the GAL1,7,10 locus. DNA was digested with C/al->Aafll and probed with a GAL1 internal fragment.
  • FIG. 4 Recombination is stimulated at the GAL2 locus in a GAL4BD-SP011 strain
  • A DSB formation at the GAL2 locus in a RAD50 strain (ORD5806). Genomic DNA was digested with Xba ⁇ -Nco ⁇ and probed with a GAL2 internal fragment. Arrow at left shows DSBs at the GAL2 UASGAL site in an isogenic rad ⁇ OS strain (ORD 5807); the bar at right indicates the extent of the "smear" of DSB fragments.
  • B Segregation of the GAL2 and gal2-Bsp alleles among progeny of a GAL4BD-SP011 diploid (ORD6626).
  • the GAL2 locus is located in a cold region
  • the meiotic DSBs are detected with shorter bands.
  • the intrinsic DSBs and the UAS site-dependent DSBs sites are indicated by plain and dotted arrows, respectively.
  • DSBs and the UAS site-dependent DSBs sites are indicated by plain and dotted arrows, respectively.
  • the sequence of the IME1 promoter is underlined, the sequence encoding the GAL4 binding domain is in bold, and the sequence encoding the Spoi l portion of the Gal4BD-Spo11 fusion protein is in italics.
  • FIG. 10 Sequence of the PREC S - Gal4BD-Spo11 construct.
  • the sequence of the REC8 promoter is underlined, the sequence encoding the Gal4 binding domain is in bold, and the sequence encoding the Spoi l portion of the Gal4BD-Spo11 fusion protein is in italics.
  • the sequence of the ADH1 promoter is underlined, the sequence encoding the QQR binding domain is in bold, and the sequence encoding the Spo11 portion of the QQR-Spo11 fusion protein is in italics.
  • FIG. 12 Sequence of the PADHI- Gal4BB - Red 04 construct. The sequence of the ADH1 promoter is underlined, the sequence encoding the Gal4 binding domain is in bold, and the sequence encoding the Red 04 portion of the Gal4BD-Rec104 fusion protein is in italics.
  • Figure 13 Sequence of the PAISPOH- Gal4BD - AtSpol 1 -1 construct.
  • the sequence of the AtSP011 promoter is underlined, the sequence encoding the Gal4 binding domain is in bold, and the sequence encoding the AtSpol 1 portion of the Gal4BD-AtSpo11-1 fusion protein is in italics.
  • a fusion protein is a chimeric protein comprising at least two moieties originating from different sources. It is usually the product of a fusion gene comprising coding sequences originating from different sources, wherein said coding sequences are in frame.
  • the present invention involves fusion proteins comprising a DNA binding domain operably linked to a Spoi l protein.
  • the DNA binding domain or DBD
  • the DNA binding domain is any domain of any protein, which has the property to bind to DNA, whether this binding is sequence-specific or not.
  • examples of non-specific DBDs are the topisomerases like Topol and Topoll and strand-exchange proteins such as Rad 51
  • examples of sequence-specific DBDs are the Gal4 DBD (thereafter noted Gal4BD), the QQR (Smith, Bibikova et al, 2000) or the lexA repressor.
  • Gal4 DBD the Gal4 DBD
  • QQR Smith, Bibikova et al, 2000
  • lexA repressor the lexA repressor
  • the sequence of an example of Gal4BD-Spo11 protein is given in Figures 9 and 10, and the sequence of an example of QQR-Spo11 is shown in Figure 11.
  • the second moiety of the fusion proteins according to the invention is a Spo11 protein.
  • This term designates the protein product of the SP011 gene identified in S. cerevisiae (Esposito and Esposito, 1969), but also the ortholog proteins of Spoi l , i.e., the products of ortholog genes of the SP011 gene, being understood that ortholog genes are homologous genes that are found in two different taxa and are performing the same function in each taxon.
  • Spo11 proteins are the AtSpol 1 of Arabidipsis thaliana (Grelon et al, 2001 ), and the murine mSpo11 , the sequence of which is described in (Baudat and Keeney, 2000).
  • the second moiety of the fusion proteins can be a protein different from Spoi l , which is a partner of Spoi l involved in the formation of DSBs and which is capable of recruiting Spo11.
  • Recruiting is meant the fact that the DBD-partner fusion protein will form a complex with Spo11 , which will lead to the formation of DSBs at the site targeted by the DBD.
  • partners will designate a partner of Spoil which is capable of recruiting Spoi l .
  • proteins which can be used as second moiety in the fusion proteins according to the invention are cited in the review articles by Keeney (2001 ) and by Smith and Nicolas (1998).
  • the two moieties of the fusion proteins involved in the present invention - the DBD and Spoi l or one of its partners - are "operably linked", which means that the fusion protein retains the ability of binding to the DNA through the DBD moiety (in a sequence-specific manner if the DBD is sequence-specific), and retains also the initial functions of Spoi l (generating double strand breaks).
  • the DBD moiety can be located at the N-terminal or at the C-terminal extremity of the fusion.
  • two DBDs can be fused to Spo11 , one at each extremity of the protein.
  • the present invention provides a novel way of substantially increase the frequency of homologous recombination during meiosis and to target this recombination by a simple modification of the Spoi l protein.
  • Previous reports have described the use of site-specific nucleases such as l-Scel, HO or VDE to locally stimulate meiotic homologous recombination.
  • the present method of adding a heterologous DNA binding domain to Spoi l provides an alternative strategy with distinct features and practical advantages.
  • this approach exploits naturally occurring chromosomal sites of low complexity, thereby multiplying the number of potential targets without requiring the prior introduction of a specific sequence nor the deletion of the resident SP011 gene. Also, cleavage remains under normal physiological control with respect to cis and trans acting determinants, and as a consequence, DSBs are repaired by the homologous recombination pathway, allowing for the production of viable gametes and recovery of novel recombinants.
  • the present invention pertains to a method for increasing recombination between homologous chromosomes in a dividing cell, comprising the steps of: (i) introducing into said cell, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, and
  • the above method can further comprise, before step (ii), a step of introducing into said cell's genome, a DNA sequence recognized by said DNA binding domain operably linked to a Spo11 protein.
  • a step of introducing into said cell's genome a DNA sequence recognized by said DNA binding domain operably linked to a Spo11 protein.
  • the introduction of a number of such sequences will increase the rate of homologous recombination in the cell.
  • these sequences can be introduced at certain locations, thereby enabling a targeting of recombination, as described in more details below.
  • the above method can be performed by introducing a nucleic acid encoding a fusion protein between a DNA binding domain and a partner of Spoi l involved in the formation of DSBs and which is capable of recruiting Spoi l .
  • the proteins which can be used according to this specific embodiment of the application can be selected, for example, among the proteins cited in the review articles by Keeney (2001 ) and by Smith and Nicolas (1998), and more specifically in the group comprising REC102, REC103/SKI8, REC104, REC114, MEI4, MRE2/NAM8, MER2/REC107, MRE11 , RAD50, XRS2/NBS1 in mammals, HOP1 , RED1 , SAE2/COM1 , MER1 and MEK1.
  • This embodiment of the invention is illustrated by a Gal4BD-Rec104 protein, in example 1.10.
  • the term "Spoi l" in fusion proteins is hence to be understood as either a Spo11 protein itself, or a partner of Spo11 capable of recruiting Spo11.
  • This method can be performed within a cell that comprises artificial chromosomes carrying one or more sequence(s) recognized by said DNA binding domain operably linked to the Spo11 protein. Indeed, as explained in Example 5, artificial chromosomes do not always recombine during meiosis, which leads to problems of segregation, and therefore to the loss of these chromosomes in some daughter cells.
  • the nucleic acid introduced into the cell in step (i), encoding the DBD-Spo11 fusion protein can be stably integrated into the cell genome.
  • this nucleic acid can remain episomal, whether in a transient or in a stable episome.
  • a transient episome is a DNA molecule which remains outside the cell genome and will not always be transmitted to the daughter cells during cell divisions. It can be, for example, and depending on the host cells, a plasmid or an adenoviral vector genome.
  • a stable episome is one which will be replicated and transmitted to daughter cells, such as, for example, a replicon carrying the oriP-EBNA-1 system from Epstein-Barr virus.
  • the inventors have demonstrated that targeted meiotic double-strand breaks can be induced by Gal4BD-Spo11 encoded by a plasmid introduced into the cell, without altering the resident SP011 gene.
  • the sequence encoding the DBD-Spo11 (or partner) protein is under the control of a promoter, which can be a constitutive promoter (for example, the promoter of ADH1), or a meiosis-specific promoter such as the SP011 promoter or an heterologous promoter, for example the IME1 promoter (Guttmann-Raviv et al, 2001 ) or the REC8 promoter (as described in Example1.9).
  • a promoter which can be a constitutive promoter (for example, the promoter of ADH1), or a meiosis-specific promoter such as the SP011 promoter or an heterologous promoter, for example the IME1 promoter (Guttmann-Raviv et al, 2001 ) or the REC8 promoter (as described in Example1.9).
  • the cell is a yeast and the nucleic acid introduced into it in step (i) encodes a Gal4BD-Spo11 fusion protein.
  • the present invention also concerns a method for performing a targeted recombination between two or more polymorphisms carried by a same chromosome in a cell, comprising the steps of: (i) introducing into said cell, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said DNA binding domain recognizes a sequence situated between said two or more polymorphisms, and
  • a method for targeting a gene conversion in a cell i.e., a local transfer of one or several polymorphism(s), resulting in unidirectional acquisition of said polymorphism by a chromosome, is also part of the invention. Indeed, the present invention enables the obtention of different haplotypes by gene conversion as well as by crossing-over. This later method comprises the following steps:
  • nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said DNA binding domain recognises a sequence situated near the polymorphism(s) to be transferred, and
  • these methods can be particularly useful to study interactions between genes which usually segregate together, in particular genes that are located in a DNA region which does not comprise any hotspot. If necessary, these methods can further comprise before step (ii), a step of introducing into said cell's genome, between or near said polymorphism(s), a DNA sequence recognized by the DNA binding domain operably linked to a Spoi l protein.
  • the cell can comprise artificial chromosomes carrying one or more sequence(s) recognized by the DBD operably linked to the Spo11 protein.
  • this method helps targeting homologous recombination at specific locations along the artificial chromosomes.
  • the cell is a yeast
  • the Spo11 moiety comes from S. cerevisiae.
  • the so-called Spoi l moiety can also be a partner of
  • Spoi l which is capable of recruiting Spoi l , such as, for example,
  • the DBD is the Gal4BD.
  • the cell division performed in step (ii) is a meiosis.
  • Some cells such as yeast, can initiate a meiosis and then return to a mitosis, by a process called "return to growth", or RTG.
  • the method can be performed by inducing recombination at an early step of meiosis, and then have the cells return to growth.
  • meiosis-specific promoters such as the promoter of SP011 or heterologous promoters like the IME1 or the REC8 promoters, will favourably drive the expression of the DBD-Spo11 fusion protein.
  • Another aspect of the present invention is a method for inducing meiotic recombination in artificial chromosomes in a cell, comprising the steps of :
  • artificial chromosomes do not necessarily recombine during meosis, thereby incurring segregation troubles. This is a major drawback limiting the use of artificial chromosomes.
  • the term "artificial chromosome” not only designates fully artificial chromosomes (such as YACs), but also homeologous and heterologous chromosomes from other strains.
  • YACs fully artificial chromosomes
  • heterologous and heterologous chromosomes fail to recombine during meosis.
  • the present invention opens new interesting prospects, in particular in industries involving yeast.
  • yeast are often hybrid strains, since the skilled artisan tries to combine in the same strain several advantageous characters from different wild-type strains. The selection of optimal strains is not easy, especially because these strains are unable to sporulate, for the reason mentioned above.
  • the method of the invention generally helps recombine haplotypes in a cell.
  • the recombinations obtained by this method can be allelic, when they occur between the same positions on homologous chromosomes, or ectopic, when they happen between regions that are only locally homologous.
  • the method enables to create translocations between the chromosomes. Consequently, the method according to the invention, by enabling recombination between the different chromosomes in cells during cell division, could no doubt increase the performance of the yeast strains mentioned above and, more generally, of any kind of strains used in the industry.
  • the artificial chromosome is a YAC having one or more sites with a
  • the fusion protein is a Gal4BD-Spo11 fusion protein.
  • the recombination of artificial chromosomes can also lead to a wider use of this tool in protein synthesis in cultures of eukaryotic cells, for example in the pharmaceutical field.
  • the present invention also concerns a method for generating variants of an organism, comprising the steps of :
  • step (iii) generating variants of said organism with the cell obtained in step (ii).
  • variant should be understood broadly, and designates an organism which presents at least one phenotypic or genotypic difference having regard to its parent(s). Variants resulting from recombination between homologous chromosomes will result from reassociation of genetic polymorphisms, defined by the DNA sequence, occurring between or within genes. More generally, a variant here designates an organism, the haplotype of which is different from the haplotype(s) of its parent(s).
  • Spoi l is homologous to an archebacterial topoisomerase (Bergerat, de Massy, 1997).
  • the methods according to the present invention are preferably performed in eukaryotic cells. These cells can be for example selected from the group consisting of a fungus, a plant cell, a mammalian cell, and an insect cell.
  • the experimental part described below illustrates examples of such cells, with S. cerevisiae for the fungi, A thaliana for the plants, mouse for the mammalians, and Drosophila for the insects. All the same, in the above method for generating variants of an organism, this organism can be selected from the group consisting of a fungus, a plant, a non human mammal, and an insect.
  • the method for generating variants of an organism can further comprise a step of screening the obtained variants for the presence of two or more characters.
  • This method by increasing the recombination rate and/or by inducing targeted meiotic recombination, enables the rapid obtaining of variants combining different characters from the parent cells. Hence, it can decrease drastically the amount of individuals that must be screened to find one presenting a certain combination of alleles.
  • variants obtainable by the method of the invention can be used in experimental models for screening the effect of a compound of any kind, for example in the course of the development of drugs, or for obtaining an appropriate host cell suitable for a recombinant gene expression.
  • the present invention also pertains to a kit for performing the methods described above, containing a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said fusion protein is capable of inducing double strand breaks in formerly cold regions.
  • Spo11 can have the sequence of a Spo11 protein from a cell selected from the group of a fungus, a plant cell, a mammalian cell, and an insect cell.
  • examples of such sequences are spoil from S. cerevisiae (yeast), Atspo11 from A. thaliana (plant), the murine spoil (mammal), and spoil from Drosophila (insect).
  • the kit of the invention can further comprise a nucleic acid carrying a target sequence recognized by said DNA binding domain operably linked to a Spo11 protein.
  • This target sequence can be comprise in any kind of vector, for example in a cloning vector comprising a high number of restriction sites, so that constructs to insert this target sequence in the desired locus of the desired chromosome is facilitated.
  • the nucleic acid comprising the DBD-spo11 sequence can also be comprised in a vector.
  • the methods of the invention can be performed without integrating the DBD-spo11 gene into the cell genome. Therefore, and depending on the type of cells, a large variety of vectors are appropriate, such as plasmids, replicative DNAs, nuclic acids complexed with any kind of transfecting agents, phages, and viruses.
  • Different viruses can be used as vectors to introduce the nucleic acid comprising the DBD-spo11 sequence into mammalian cells, some of which will integrate into the cell genome (such as retroviruses for example), whereas some will not (ex. : adenoviruses).
  • Also part of the present invention is an eukaryotic cell expressing a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said fusion protein is capable of inducing double strand breaks in formerly cold regions of the genome of said eukaryotic cell.
  • the phrase "cold region”, in this context designates cold regions for meiotic recombination.
  • the DBD-SP011 gene is under the control of a promoter, which can be meiosis-specific or not.
  • the cell according to the invention can also be engineered so that the expression of meiosis-specific proteins is modified, as explained in Example 6.
  • This cell can be for example a fungus, a plant cell, a mammalian cell, or an insect cell.
  • Yet another aspect of the present invention concerns nucleic acids encoding a fusion protein comprising a Spoi l moiety and a DNA binding domain operably linked thereto, wherein said Spo11 protein is, for example, the AtSpol 1 protein from Arabidopsis thaliana or the murine
  • the SP011 ORF was generated by PCR and introduced as a BamWUPstl fragment downstream of the sequence encoding the Gal4 DNA binding domain (Gal4BD) in the two-hybrid vector pAS2 ⁇ (Fromont-Racine, Rain et al. 1997).
  • the in-frame N-terminal fusion of Gal4BD to Spo11 and the complete ORF were verified by sequencing.
  • the kanMX ⁇ drug resistance cassette (Wach, 1996) was inserted into a unique Nru ⁇ site, and the 2 ⁇ replication origin was removed by replacing a ⁇ pml- ⁇ st/36l fragment with the corresponding fragment from pRS304 (Sikorski and Hieter, 1989) producing pAP1.
  • the GAL2 locus was amplified from genomic DNA and a subclone containing the promoter region and the first 655 bp of the GAL2 ORF was mutagenized with the QuikChange site-directed mutagenesis kit (Stratagene). This frameshift mutation generates a BspHI restriction site and gives rise to a truncated protein of 66 amino acids. The relevant fragment was sequenced to confirm the mutation and finally subcloned into pRS306 (Sikorski and Hieter, 1989), producing plCM99.
  • yeast strains are isogenic derivatives of SK1 (Kane and Roth, 1974). They were obtained by transformation or crossing and their relevant genotypes are shown in Table I.
  • Xbal-digested pAP1 was integrated at the trpl locus by transformation using the lithium acetate/polyethylene glycol method (Ausubel et al., 1988).
  • G418 (200 ⁇ g/ml) resistant transformants were selected and checked for tryptophan prototrophy. Correct targeting was verified by Southern analysis.
  • the gal2-BspHI mutation was introduced at the GAL2 locus by the two-step replacement procedure using URA3 as a selectable marker (Ausubel et al., 1988).
  • plCM99 was linearized at the unique BglU site in the GAL2 ORF, and targeting was verified by PCR and Southern analysis. Retention of the desired point mutation among 5-fluoroorotate-resistant pop-out clones was confirmed by BspHI restriction analysis of amplified GAL2 fragments.
  • genomic DNA was prepared from sporulating cells and subjected to Southern analysis. Parental and DSB bands were visualized with a Phosphorimager and quantified with the use of ImageQuant software (Molecular Dynamics) as described (Vedel and Nicolas, 1999). Northern analysis was performed as described (Smith et al., 2001). Whole cell extracts were prepared and analyzed by western blotting with an anti-Gal4(DBD) antibody (Santa Cruz Biotechnology) using standard procedures (Ausubel et al., 1988).
  • DBD anti-Gal4(DBD) antibody
  • Promoter IME1-GAL4BD-SPQ11 construct plasmid named PAP111
  • the pAP11 plasmid was constructed by deletion of the Sad- Sad fragment (position 1891-3330) of pAP1 (Pecina et al., 2002).
  • the pBS deltal plasmid containing the 1216 bp Xhol fragment of pAP11 was subcloned into the pBS deltaO plasmid previously derived by deletion of the Smal-Hincll fragment of pBlueScript.
  • the IME1 promoter was isolated from plasmid p2053 (Guttmann-Raviv et al., 2001 ) by cuting with Sphl, followed by Klenow treatment and cutting with Hindlll. This fragment was inserted into the pBS deltal vector cut by EcoRV and Hindlll.
  • IME1 promoter -containing region of pBSdelta11 was cleaved by Xhol and subcloned into the Xho1 site of pAP11 to create plasmid pAP111.
  • Promoter REC8-GAL4BD-SPQ11 construct plasmid named PAP118
  • the 1471 bp Sacl-BamHI fragment of plasmid pAP11 was subcloned into the pBS deltaO plasmid to create plasmid pBS delta2.
  • the REC8 promoter was amplified from genomic DNA of the S. cerevisiae strain ORD7254-25D (SK1 background) with two primers, REC8 UP (5'- CGATATCTATACATTACCAATCCTTCCT -3'), and REC8 LO (5'- CAAGCTTTGCAGAATATTTGTAATATT -3') and cloned into pGEM T-easy (Promega) and sequenced.
  • Promoter ADH1-QQR-SPQ11 construct plasmid named pAP119
  • the QQR fragment was amplified from plasmid DNA of pET15bi
  • the amplified fragment was cloned into the pGEM T-easy vector (Promega) and sequenced. Then, the QQR fragment was subcloned into the pBS delta2 vector cleaved with Hindlll and Mscl to create plasmid pBS delta29. Finally, the Sacl-BamHI fragment from the pBS delta29 (containing the QQR sequence) was inserted into the plasmid pAP11 cleaved by Sacl-BamHI. It creates the plasmid pAP119.
  • Promoter ADH1- GAL4BD-REC104 construct plasmid named pXP3
  • the REC104 coding region was amplified by PCR from the S. cerevisiae strain ORD7254-25D (SK1 background) with two primers, REC104UP (5'- GAGATGGCCATGGAGGCCATGTCCATCGAGGAGGAAGAT-3'), and REC104LO (5'- GGATCCCCGGGGCTCAGGGACTACTAAACTGAAA-3'
  • REC104UP 5'- GAGATGGCCATGGAGGCCATGTCCATCGAGGAGGAAGAT-3'
  • REC104LO 5'- GGATCCCCGGGGCTCAGGGACTACTAAACTGAAA-3'
  • the amplified fragment was cloned into the pCR2.1 vector and verified. Then, the REC104 fragment was subcloned into the pASIN integrative vector cleaved by Sfil and Xma1. It creates the plasmid pXP3.
  • the pASIN plasmid (promoter ADH1-GAL4BD, AmpR, TRP1) derives from pAS2 ⁇ (Fromont-Racine, Rain et al., 1997) by removal of the 2 micron replication origin.
  • cphs-qal4bd-meiw68 plasmid The cDNA of mei-W68 (drosophila ortholog of Spoi l ) was isolated from the plasmid pAH69 (Kim McKim and Aki Hayashi-Hagihara, 1998).
  • 3' meiW68 5'-ggtgaaacttcctccgcggac-3' - Cloning of Mscl-Sacll fragment from pGEMT-easy (mei5,) into pAPAPI : It creates plasmid pAPAP2.
  • This plasmid contains the fusion protein Gal4BD-meiW68 under ADH1 promoter into a replicative plasmid with Amp and TRP1 markers.
  • pXP3 was linearized with Xbal and used for the transformation of ORD7254-25D ( ⁇ , ura3, Ieu2, trpl , his4). Transformation was carried out with litium acetate method and the cells were spread onto a tryptophan- depleted plate. The transformed cells were verified with Southern blot analysis. The transformed cells were crossed, sporulated and segregants mated to create the ORD7770 strain.
  • pAP111 was linearized with Bsu36l and used for the transformation of ORD7254-25D ( ⁇ , ura3, Ieu2, trpl, his4).
  • Transformation was carried out with litium acetate method and the cells were spread onto a tryptophan-depleted plate. The transformed cells were verified with Southern blot analysis. The transformed cells were crossed, sporulated and segregants mated to create the ORD8016 strain. pAP118 was linearized with Xbal and used for the transformation of ORD7254-25D ( ⁇ , ura3, Ieu2, trpl , his4). Transformation was carried out with litium acetate method and the cells were spread onto a tryptophan- depleted plate. The transformed cells were verified with Southern blot analysis. The transformed cells were crossed, sporulated and segregants mated to create the ORD8050 strain.
  • the supematants were removed to new eppendorf tubes and 500 ⁇ l of isopropanol was added to precipitate nucleic acid. Precipitated nucleic acid was washed with 70% of ethanol and RNase A was treated for 1 hour at 37°C. The DNA was precipitated with ethanol and finally resuspended in sterile water.
  • Example 1 Targeted stimulation of meiotic recombination in Saccharomvces cerevisiae 1.1.
  • the Gal4BD-Spo11 fusion protein is expressed in meiosis
  • Gal4BD amino acids 1-147
  • ORD8050 a /a ura3/ura3, trp 1 ::pAP118/trp 1 ::pAP118, Ieu2/leu2, arg4 /+, his4 /+, spo 11 ::URA3/spo 11 ::URA3, rad ⁇ OS ::LEU2/rad ⁇ OS ::LEU2
  • SP011 mRNA begins to accumulate after transfer of cells to sporulation medium and decreases after 7h, by which time ascospore formation has begun ( Figure 1B).
  • GAL4BD-SP011 mRNA is detected in both vegetative and meiotic cells, but like SP011 mRNA, it decreases at later timepoints (6-7 h).
  • Gal4BD-Spo11 complements the sporulation defect of a spoil ⁇ strain
  • Diploid spoil A cells can sporulate but produce inviable progeny because chromosomes segregate abnormally when meiotic recombination is not initiated.
  • the inventors examined whether the Gal4BD-Spo11 protein could complement the sporulation defects of a spoil A diploid. Like wild type SP011 (ORD5740) and spo77.il (ORD5805) strains, a GAL4BD- SP011 spoi l A diploid (ORD5806) sporulates efficiently (approximately 80%), giving rise primarily to four-spored asci. Tetrad analysis shows that, as expected, none of the spores produced by spoil A diploids germinates (0/512).
  • the Gal4BD-Spo11 fusion protein restores full viability to spoil A spores (531/552, 96%), the same as observed for progeny of the SPO77 " diploid (505/526, 96%).
  • High spore viability was similarly found for a diploid that contains both GAL4BD-SP011 and SP011 (ORD5817).
  • Gal4BD-Spo11 promotes DSB formation at natural sites
  • Gal4BD-Spo11 promotes DSB formation near consensus Gal4 DNA binding sites
  • Gal4 binding sites the inventors examined several loci containing UASGAL sites that have been implicated in galactose catabolism.
  • the GAL2 promoter region contains four CCG(N)nGGC sequences (verified by sequencing the GAL2 promoter of ORD6632), two of which are constitutively bound by Gal4 in vivo (Huibregtse et al.; 1993).
  • DSBs are barely detectable at the GAL2 locus, indicating that this region is not a frequent natural DSB site.
  • a GAL4BD-SP011 strain prominent DSBs can be observed in the GAL2 promoter near or at the UASGAL sites ( Figure 3A).
  • Gal4BD-Spo11 fusion protein is solely responsible for the appearance of these new DSBs.
  • spoil A strains expressing the Gal4BD- spo11Y135F fusion protein, in which the Spoi l catalytic tyrosine residue is replaced with a catalytically inert phenylalanine residue (Bergerat et al., 1997), do not exhibit meiotic DSBs either in the YCR043c-YCR048w region or at the GAL2 locus.
  • Gal4BD-Spo11 fusion strongly stimulates recombination at the GAL2 locus
  • Gal4BD-Spo11 -promoted DSBs can also initiate recombination at other loci : tetrad analysis confirmed that the levels of meiotic gene conversion at the ARG4 natural hotspot are similar in SP011 and GAL4BD-SP011 diploids. These results show that the DSBs formed in the GAL2 promoter in GAL4BD-SP011 strains are recombinogenic and behave like Spoi l -induced breaks.
  • Gal4BD-Spo11 promotes cleavage within a large region that is normally cold for DSB formation
  • Gal4BD-Spo11 activity to a large interval of approximately 20 kb centered on GAL2 (between the YLR072w and YLR084c ORFs on chromosome XII) that contains eight intergenic promoter-containing regions ( Figure 5A).
  • Figure 5A The analysis of Gal4BD-Spo11 activity to a large interval of approximately 20 kb centered on GAL2 (between the YLR072w and YLR084c ORFs on chromosome XII) that contains eight intergenic promoter-containing regions.
  • Figure 5A The analysis of Gal4BD-Spo11 activity to a large interval of approximately 20 kb centered on GAL2 (between the YLR072w and YLR084c ORFs on chromosome XII) that contains eight intergenic promoter-containing regions.
  • the GAL2 promoter region is the only site at which a DSB can be detected. Since there are no other Gal4 consensus sequences in this
  • cleavage at GAL2 does not promote the nearby formation of other DSBs.
  • Southern blot analysis indicates that red 02, rec103/ski8, red 04, red 14, mei4, mer2/rec107, mre2/nam8, mre11, rad ⁇ O and xrs2 null mutants, in either the SPO77 or GAL4BD-SP011 background, do not exhibit meiotic DSBs in the YCR043c-YCR048w interval or at GAL2 ( Figure 6), whereas the redl, mre4/mek1, hopl and merl, null mutants exhibit reduced but still detectable levels of DSBs.
  • the redl mutation reduces the frequency of Gal4BD-Spo11 promoted DSBs by about 3-fold, the mre4/mek1 and hopl mutations confer a 10-fold reduction, and the merl mutation almost completely eliminates DSB formation.
  • the mre4/mek1 mutation has no effect in either SP011 or GAL4BD- SP011 strains, and the redl, merl and hopl mutations have increasingly repressive effects in both strains.
  • the differental effects of each of these mutations on chromosome III and at GAL2 may reflect locus-specific variation. Overall, since all of these genes, which are either essential or important for DSB formation in SP011 strains are similarly required in GAL4BD-SP011 strains, it can be concluded that they do not assist Spol 1 in target site selection.
  • the B-type cyclins CLB ⁇ and CLB6 are required for meiotic replication and for meiotic DSB formation.
  • Gal4BD- Spo11 -promoted DSBs also depend on Clb5 and Clb6 activity, DSB formation was assayed in clb ⁇ and clb ⁇ clb ⁇ diploids containing the GAL4BD-SP011 construct (ORD6534 and ORD6551 , respectively).
  • the GAL4BD-SP011 construct was put under the control of the IME1 promoter (Guttmann-Raviv etal, 2001 ), which is expressed very early during the meiosis, or under the control of the REC8 promoter, which is expressed early in meiosis.
  • the obtained sequences for the promoter- GAL4BD-SP011 constructs are shown in figures 9 and 10, respectively.
  • Figure 7 shows that both of these constructs induce DSB formation at UAS sites, either in the YCR048w region (Fig 7A) or in the GAL2 region (Fig. 7B).
  • Red 04 is a protein required to induce DSBs in yeast. Its coding sequence was cloned in the same open reading frame as the Gal4BD sequence, to generate the sequence of a Gal4BD-Rec104 fusion protein, which was put under the control of the constitutive ADH1 promoter. The resulting sequence is shown in Figure 12.
  • Figure 8 illustrates the fact that the presence of the GAL4BD- REC104 construct in yeast induces double stranded breaks at UAS sites, hence demonstrating that GAL4BD-REC104 could recruit Spoi l at these sites.
  • the resident GAL4 sequence has been deleted from the yeast genome in which a GAL4BD-SP011 construct has been introduced. As compared with yeast still harbouring GAL4BD coding sequence, the number of DSBs induced at UAS sites was higher. This was probably due to the absence of competition at UAS sites between the Gal4BD-Spo11 protein and the resident Gal protein.
  • Example 2 Targeted stimulation of meiotic recombination in plants
  • the cDNA encoding the AtSPO11-1 protein (Grelon, Vezon et al.
  • the DNA fragment coding the Gal4 DNA binding domain has been amplified by PCR from the pAPI plasmid using the two oligonucleotides CM1 5' gaCTGCAgaaagagATGAAGCTACTGTCTTCTAT 3' and CM2 5' CGGGGCCTCCATGGCCATAAA 3'.
  • This PCR fragment corresponding to the ATG-A/col fragment of GAL4BD (455 bp), has been cloned in pCR- Bluntll-Topo leading to the plasmid pVeCM15 and sequenced.
  • pVeCM20 contains a PsM site followed by -8 to -1 bases of AtSP011-1, the GAL4BD followed in fusion by the complete cDNA of AtSP011-1 (1089 bp).
  • AtSP011-1 promoter (Gene bank AP000375) isolated by Mathilde Grelon has been amplified by PCR using the 2 oligonucleotides CM3 5' ccatctctttcTGCAGtcaaaactgaaaatg 3' and CM4
  • the promoter hence corresponds to the -2266 to -1 bases of the At promoter, with an insertion of 11 nucleotides just in 5' of the Psf1 cloning site.
  • the Apa1-Spe1 fragment from pVeCM25 has been cloned in pCambia 1380 (commercialized by Cambia, Australia), between the Apa1 and Spe1 sites leading to the plasmid pVeCM26.
  • pVeCM26 has been introduced by transformation in the C58C1pMP90 Agrobacterium strain. This strain has been used to transform the DYK209 Arabidopsis thaliana line (Grelon et al., 2001) heterozygous for the Atspol 1-1-1 mutation.
  • the transformed plants T1 have been selected in vitro on hygromycin, transferred to soil and analysed by PCR.
  • One plant, AtpVeCM26.9, homozygous for the Atspol 1-1-1 mutation and containing the AtSP011-1 promoter.GAL4BD-AtSP011-1 cDNA transgene had some siliquas longer than the ones usually seen for a homozygous Atspol 1-1-1 plant.
  • AtpVeCM26.9 In the progeny of this AtpVeCM26.9 plant selected on hygromycin, transferred on soil and genotyped by PCR, 9 plants homozygous for the Atspol 1-1-1 mutation and containing the AtSP011-1 promoter: GAL4BD-AtSP011 -1 cDNA transgene had an average of 3,7 ⁇ 0,7 seeds per silique which is approximately two times more than the number of seeds per siliqua detected in a plant homozygous for the Atspol 1-1-1 mutation (Grelon et al., 2001).
  • the P A tspou- GAL4BD - AtSPO11-1 construct was done again, using a different protocol, which led to the sequence shown in Figure 13.
  • the transformation of Arabidopsis thaliana was then performed as described above.
  • the stimulation of meiotic recombination is then determined by analysis of microsatellite markers that exist upstream and downstream of the natural targets for GAL4BD that exist in the Arabidopsis genome (more than 40 with the more stringent consensus sequence, and up to several hundreds with the most degenerated, i.e., only the 3 bp on each side of the UAS), in homozygous mutants and wild-type strains.
  • a cell line exhibiting two resistance gene as markers, separated by one GAL4BD recognition sequence, is also constructed, in order to study the crossing-over between these two markers.
  • Example 3 Induction of site-directed and/or increased meiotic recombination in mice
  • the Sycpl gene coding for the murine synaptonemal complex, is expressed in both zygotene and pachytene phases of the meiosis (Sage, Martin et al. 1999). Therefore, it can be used to express a SP011 gene in meiosis early stages.
  • the expression of the Gal4BD-mSpo11 fusion protein in early stage of meiosis has three advantages : it enables the targeting of meiotic recombination at new sites and help to follow-up the impact of initiating recombination on associated chromosome changes and on the mouse development.
  • the Gal4BD-mSP011 chimerical DNA is placed under the control of the region upstream the Sycpl coding sequence or another promoter fragment functional in early meiosis, in a bacterial plasmid.
  • a sequence coding for a Gal4BD-mSpo11 fusion protein, wherein mSpo11 protein is the murine Spoi l protein, is constructed by placing the Gal4BD coding sequence in phase with the murine cDNA SP011 sequence described by Metzler-Guillemain C. and B. de Massy (2000).
  • the Gal4BD fragment of pAP1 is amplified by PCR using primers APG4up (5'GAGATTAATTAAGGCCATATGAAGCTACTGTCTTCTATCGAA) and APG4LO (5 ⁇ ATCCTGTTAACAATGCTTTT), and cloned into the pGEM-T Easy (Promega) and sequenced, creating pAP15 containing a ⁇ /cfel site overlapping the ATG translation start site of the Gal4BD sequence.
  • pAP15 is cleaved by Pacl-Hpal and the fragment containing the 5' Gal4BD ( ⁇ /del containing site) sequence is cloned into the pAP1 vector, cleaved by Pacl-Hpal to remove the pADH1 promoter, creating the plasmid pAP16.
  • pA16 is cleaved by Pac ⁇ -Sac ⁇ to remove the KanMX marker (G418 resistance), blunted and religated to create pAP17.
  • the BamH ⁇ -Pst ⁇ fragment of pAP17 containing the S. cerevisiae Spoi l fragment is then substituted by the Bglll-Pstl fragment of pCMV ⁇ (Clontech) containing a SV40 polyadenylation site to create plasmid pAP3.
  • the EcoRI fragment of plasmid pGEM-tSPOHs, containing the mouse SP011 cDNA, is then amplified by PCR with primers to add flanking Sf/ ' l and Xmal restriction sites and cloned into the pGEM-t Easy vector (Promega), creating plasmid pAP19 and sequenced.
  • the Sfi ⁇ -Xma ⁇ fragment of pAP19 containing the pSycpl promoter (Taq ⁇ -EcoR ⁇ fragment) followed by the Gal4BD fragment (EcoPI- Sf/ ' l), is fused to the mouse SP011 cDNA (Sfi ⁇ -Xma ⁇ fragment) and terminated by the polyA fragment (Xma ⁇ -Pstl), creating a modular cassette for convenient exchange of the various components, carried by a vector allowing multiplication in bacteria.
  • This pGal4BD-mSpo11 plasmid is linearized and introduced by micro-injection in a mouse egg. Mice are then selected by genomic DNA analysis with a probe specific for the Sycpl 7Gal4BD-mSpo11 transgene. Independent Sycpl /Gal4BD-mSpo11 transgenic families are then established though cross breedings with normal and characterized mice.
  • the meiotic functionality of the transgene expresion is then determined in the wild-type and mutant mice inactivated for the mSPO11 gene (Baudat, Manova et al. 2000) by observation of the effect on the fertility of the animals and monitoring meiotic recombination frequencies between polymorphic markers in the progeny, the gametes or in a preparation of meiotic cells by Southern blot or PCR techniques, probing a chromosomal region containing a consensus recognition site for the Gal4 protein.
  • This target site is either a natural or transgenic sequence carrying one or more copies of the GAL4 UAS motif.
  • Example 4 improvement of homologous recombination in Drosophila
  • Drosophila offers many advantages as an experimental organism. However, in comparison with yeast and mouse, two other widely used eukaryotic model systems, Drosophila suffers from an inability to perform homologous recombination between introduced DNA and the corresponding chromosomal loci. The ability to specifically modify the genomes of yeast and mouse provides a quick an easy way to generate or rescue mutations in genes for which a DNA clone or sequence is available. Recently, Rong and Golic have developed a new technique for targeted homologous recombination, using the intron restriction enzyme l-Scel as an inductor of double strand break in linear molecules of DNA generated from flip recombinase excision of DNA (Rong and Golic 2000).
  • the Gal4BD-Spo11 fusion protein described in Example 1 , can be used instead of l-Scel enzyme in order to develop a new approach to generate "knock outs" in Drosophila, and to improve the efficiency of the targeted homologous recombination.
  • the sequence coding for Gal4BD-Spo11 has been inserted in an expression vector for the Drosophila (P(Casper-hs), Pirrotta 1988).
  • the Gal4BD-Spo11 sequence is placed under the control of a heat shock promoter. Five different insertions of this transposable have been obtained in Drosophila.
  • the Drosophila strain used in these experiments is Canton- Special (CS) y 1 .
  • the methods to assay the effect of Gal4- Spo11 are the rescue of mei-W68 phenotype and the rescue of y 1 (normal body color).
  • Example 5 Stimulation of meiotic recombination between poorly recombining chromosomes Efficient genetic recombination between homologous chromosomes requires the formation of an initiating lesion such as a DNA double-strand break formed by the Spoi l protein as exemplified in Example 1. Thus, chromosomes devoid of Spol 1 target sites will poorly recombine.
  • the Gal4Bd-Spo11 fusion protein, described in Example 1 can be used to stimulate the initiation of recombination at natural or artificially introduced Gal4 binding sites along any natural or artificial (YACs) chromosomes consisting of yeast or non-yeast DNA. Similarly, recombination might be stimulated between yeast linear plasmids with bacteriophage ⁇ DNA backbones that poorly recombine.
  • Efficient genetic recombination also requires near-perfect homology between the participating molecules.
  • homeologous chromosomes variably recombine in meiosis and as a consequence of the reduced level of crossing-over, gametes viability decreases and the proportion of aneuploid products increase consistently with defects in meiosis I or II non-disjunction of the homeologs.
  • Homeologous chromosomes V of Saccharomyces cerevisiae and Saccharomyces carlbergensis virtually do not recombine in meiosis, but artificially created short regions of homology were found to induce meiotic crossing-over, probably by facilitation of heteroduplex intermediate formation initiated at adjacent sites.
  • the Gal4BD-Spo11 fusion protein described in Example 1 , can be used to stimulate the initiation of recombination at natural or artificially introduced Gal4 binding sites along any natural or artificial (YACs) chromosomes consisting of yeast or non- yeast homeologous DNA.
  • YACs natural or artificial
  • Example 6 Stimulation of homologous recombination in mitotic cells
  • B-type cyclins CLB5 and CLB6 control the initiation of recombination and synaptonemal complex formation in yeast meiosis. Curr. Biol. 11 , 88-97.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The Invention pertains to methods, kits, molecules and cells to increase the rate or recombination and/or target recombination in dividing cells. In a particular aspect, the invention concerns methods and kits to induce targeted meiotic recombination.

Description

METHODS FOR INDUCING TARGETED STIMULATION OF ME1OTIC RECOMBINATION AND KITS FOR PERFORMING SAID METHODS
FIELD OF THE INVENTION
In all eukaryotes, the rates of meiotic recombination between paternal and maternal chromosomes vary by several orders of magnitude at different chromosomal loci. In Saccharomyces cerevisiae and in other organisms, meiotic recombination is initiated by programmed DNA double- strand breaks (DSBs), a process that requires at least 15 proteins including Spo11 , a widely conserved protein that likely catalyzes cleavage. The present invention pertains to methods and kits to increase the rate of meiotic recombination in a cell and, more specifically, to induce targeted meiotic recombination. This invention is based on the fact that it is possible to target the initiation of meiotic recombination to a target site, by expressing in the cell a chimeric protein comprising a DNA binding domain operabiy linked to the Spo11 protein.
BACKGROUND AND PRIOR ART
In sexually reproducing organisms, the halving of the DNA content of a diploid germ line cell during the meiotic cell cycle allows the production of haploid gametes. During this process, recombination plays a dual role : it shuffles information along the lengths of homologous chromosomes, creating genetic diversity that is transmitted to progeny, and it ensures the proper segregation of homologs to opposite poles during the first of the two meiotic divisions. About a century ago, de Vries-predicted that exchanges take place between homologous maternal and paternal chromosomes during hereditary transmission. Soon thereafter in 1905, Bateson-discovered partial linkage between the petal color and pollen shape characters in Sweet Pea. These and successive discoveries in the emerging field of recombination led to the notion of genetic distances, as measured by the frequency of exchange (crossing-over) between linked markers, and to the development of linkage maps. In 1913, Sturtevant wrote "Of course, there is no knowing whether or not these distances as drawn represent the actual relative spacial distances apart of the factors". Since the advent of the molecular era, this prescient insight has been extensively verified by quantitative comparisons of genetic and physical distances. For all organisms, including the yeast Saccharomyces cerevisiae, Arabidopsis thaliana, Drosophila melanogaster, Mus musculus, and man, meiotic recombination rates (expressed as cM/kb) vary by several orders of magnitude along chromosomes. Recent studies of S. cerevisiae strongly suggest that most of this variation is related to the frequencies of initiating events (Baudat and Nicolas, 1997), but why it is relatively frequent at some loci (hotspots) and relatively infrequent at others (coldspots) remain unexplained. In S. cerevisiae, meiotic recombination results from the formation and repair of programmed DNA double-strand breaks (DSBs) (for review, see for example: Smith and Nicolas, 1998). Numerous studies have shown that natural DSB sites are not evenly distributed and that cleavage frequencies vary 10-100-fold from site to site (Baudat and Nicolas, 1997; Gerton et al., 2000). The factors that determine whether a specific region or site is prone to DSB formation (and hence, recombination) are not completely understood, but they are known to act both locally and globally. Locally, gene organization and chromatin structure appear to be of paramount, and related, importance. Typically, most natural DSB sites are in promoter-containing regions (Baudat and Nicolas, 1997). At the HIS4 locus, two types of recombination hotspots have been distinguished, α (transcription factors-dependent but not transcription-dependent) and β (transcription factor independent) hotspots (reviewed by Petes, 2001). More notably, all known DSB sites are located in regions that are sensitive to DNase I or micrococcal nuclease (MNase I) in both mitotic and meiotic cells, suggesting that an open chromatin configuration is necessary for cleavage (Ohta et al., 1994; Wu and Lichten, 1994). However, local chromatin accessibility cannot be the sole arbiter of DSB site selectivity, because not all nuclease-hypersensitive sites are DSB sites. Global determinants also control the distribution of DSBs. Both the fine mapping of DSB sites on yeast chromosome III and the genome- wide mapping of DSB sites have confirmed the existence of large subchromosomal domains hot or cold for DSB formation (Baudat and Nicolas, 1997; Gerton et al., 2000). The molecular basis of these DSB- proficient or -refractory domains has not been elucidated, but the finding that a recombination-proficient reporter inserted at various sites along chromosome III adopts local properties with respect to DNasel sensitivity and frequencies of DSB formation and recombination demonstrates that domain-level controls are superimposed on local determinants (Borde et al., 1999). That is, a hot region can be made cold, but thus far the converse has not been observed: cold regions typically remain cold.
A consideration of the chromosomal variation in DSB frequencies must also take into account the influence of fraπs-acting factors. A large number of genes are required for DSB formation, including SP011, MEI4, MER1, MER2/REC107, MRE2/NAM8, MRE11, RAD50, REC102, REC103/SKI8, REC104, REC114 and XRS2, but in most cases, their molecular roles are unknown. Null mutants for all of the above genes fail to carry out meiotic recombination and produce inviable spores. Three other meiosis-specific genes are required for full levels of DSBs: MEK1/MRE4 encodes a kinase that regulates the activities of the RED1 and HOP1 products, which are structural components of meiotic chromosomes. SP011 encodes a protein that shares sequence similarity with the smaller subunit (TopβA) of the type II topoisomerase of the archaebacterium Sulfobolus shibatae (Bergerat et al., 1997). Spoi l remains covalently linked to the 5'-strand termini of DSB fragments in mutants (e.g. radδOS) that are defective for the 5' to 3' nucleolytic processing of DSB ends that normally precedes repair (Keeney et al., 1997), indicating that it is the catalytic component of the meiotic DSB cleavage activity. These and further molecular and genetic studies in fungi and higher eukaryotes have demonstrated that Spo11 orthologs are likely universally required for meiotic recombination, strongly suggesting that DSBs initiate meiotic recombination in most if not all eukaryotes. The use of site-directed mutagenesis to identify regions of Spoi l that contribute to strand cleavage and DNA binding has demonstrated the functional significance of structural motifs conserved throughout the Spo11/Top6A family (Bergerat et al., 1997; Diaz et al., 2002). Interestingly, variations in the level and distribution of DSBs at the his4::LEU2 hotspot in some spoil mutants suggests that Spo11 is not only involved in the cleavage activity but also contributes to the choice of site for DSB formation, at least locally (Diaz et al., 2002).
SUMMARY OF THE INVENTION
The inventors have fused Spo11 to the DNA-binding domain of the Gal4 protein (Gal4BD), creating a Gal4BD-Spo11 fusion protein. The Gal4 protein is one of the best characterized transcriptional activators in S. cerevisiae and is required for the expression of genes involved in galactose catabolism. The protein binds to a consensus upstream activator sequence (UASGAL) through its N-terminal domain and stimulates transcription via its C-terminal activation domain. In vitro and in vivo "footprint" analyses have defined a consensus 17-base pair sequence at UASGAL sites (CGGNnCCG) as sufficient for Gal4 binding. The inventors have then demonstrated, as explained in the examples, that this fusion protein could stimulate recombination in formerly cold regions, which led to the present invention. One object of the present invention is a method for increasing recombination between homologous chromosomes in a dividing cell, comprising the steps of expressing a DBD-Spo11 protein (wherein DBD is a DNA binding domain), in a dividing cell. The invention also pertains to a method for performing a targeted recombination between two or more polymorphisms carried by a same chromosome in a cell, having said fusion protein expressed in a dividing cell and wherein the binding domain recognises a DNA sequence situated between or near said polymorphisms. If necessary, a DNA sequence recognized by said DNA binding domain operably linked to Spo l can be introduced into the cell genome, by standard techniques.
In the methods of the invention, the dividing cell might be a mitotic or a meiotic cell. In these methods, the cell can comprise artificial chromosomes carrying one or more sequence(s) recognized by the DNA binding domain operably linked to the Spo11 protein.
If necessary, the nucleic acid encoding the DBD-Spo11 fusion protein is stably integrated into the cell genome. Another aspect of the present invention is a method for inducing meiotic recombination in artificial chromosomes in a cell, comprising the introduction into a meiotic cell of a nucleic acid encoding a DBD-Spo11 fusion protein, wherein the DNA binding domain recognises at least one sequence of said artificial chromosome. According to one implementation of this method, the cell is a yeast, the artificial chromosome is a YAC consisting of yeast or non-yeast DNA having one or more sites with a CGGN-nCGG sequence, and the fusion protein is a Gal4BD-Spo11 fusion protein. The invention also concerns a method for generating variants of an organism, comprising the steps of inducing a meiotic recombination using a DBD-Spo11 fusion protein expressed in a meiotic cell, and having the meiotic recombination occur at a higher rate and/or at different loci of the homologous chromosomes of the meiotic cells.
This method can further comprise a step of screening said variants for the presence of two or more characters.
In the same way, the present invention encompasses a method for analysing the genome of an organism, comprising the steps of generating variants of said organism, by performing the above method, performing a genetic analysis and a phenotypic analysis of certain characters of said variants, and analysing the genome of said organism.
All the methods according to the invention can be performed in any kind of eukaryotic cells and organisms, such as fungi, plants, and animals.
An other aspect of the present invention is a kit for performing the methods described above, containing a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said fusion protein is capable of inducing meiotic recombination in formerly cold regions. Such a kit can further comprise a nucleic acid carrying a target sequence recognized by said DNA binding domain operably linked to a Spoi l protein.
The nucleic acids of the kit according to the invention can be comprised in a vector, which can be any kind of vector, such as, for example, plasmids or any kind of replicative DNAs, complexed with transfecting agents if necessary, or phages, or virus.
The invention also pertains to a eukaryotic cell expressing a fusion protein comprising a DNA binding domain operably linked to a Spo11 protein, wherein said fusion protein is capable of inducing meiotic recombination in formerly cold regions of the genome of said eukaryotic cell.
This eukaryotic cell can be for example a fungus, a plant cell, a mammalian cell, or an insect cell. Another aspect of the present invention concerns nucleic acids encoding a fusion protein comprising a DNA binding domain operably linked thereto, wherein said Spoi l protein is, for example, the AtSpo11 protein from Arabidopsis thaliana or the murine Spo11 protein.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Structure and expression of GAL4BD-SP011
(A) The plasmid pAP1 containing the GAL4BD-SP011 fusion under the control of the ADH1 promoter (pADH1) and terminator (tADH1) was constructed as described in Experimental Procedures. The amino acid residues derived from the Gal4BD and Spoi l proteins are indicated above and below, respectively. (B) For Northern analysis, total RNA was prepared from SP011 (ORD5740) and GAL4BD-SP011 (ORD5806) cells during vegetative growth (Y) or at different times after transfer to sporulation medium and hybridized with a SP011 probe. Blots were rehybridized with an ACT1 probe to provide a basis of comparison. (C) Quantification of the levels of SP011 (circles) and GAL4BD-SP011 (squares) transcript with respect to the level of ACT1 mRNA over the course of meiosis. (D) The Gal4BD-Spo11 protein was detected by Western blot analysis using an anti-Gal4(DBD) antibody. The same amount of protein being loaded on each lane, the fusion protein is present at the same level in ORD5806 cells throughout the meiotic cycle. No signal was detected for spoil A diploids (ORD5805) in meiosis.
Figure 2. Meiotic DSB formation at the natural YCR043c-YCR048w, ARG4 and CYS3 hotspots in SP011 and GAL4BD-SP011 diploids Genomic DNA was prepared from SP011 (ORD1181) and GAL4BD-SP011 (ORD5807) diploids taken at the indicated time after transfer to sporulation medium and DSBs were detected by Southern analysis. These strains are homozygous for the rad50S::URA3 allele, which permits DSB formation but prevents resection and repair (Alani et al., 1990). At the right of each gel a map of the region shows ORFs (open arrows indicate transcriptional sense), DSB sites (arrows), and the positions of the probes.
(A) DSB formation in the YCR043c-YCR048w region. DNA was digested with Ase\ and probed with a YCR048w internal fragment. Putative
Gal4 consensus binding sequences in the YCR048w ORF are shown as black bars. (B) Quantification of prominent DSBs in the SP011 and
GAL4BD-SP011 cells shown in Figure 2A. The sums of the frequencies of
DSB formation in the YCR046c promoter (1 ), the YCR047c-YCR048w promoter (2), and the YCR048w ORF (3) are represented as a histogram.
These sums account for > 99% of the total DSBs detected in the YCR043c-
YCR048w region. (C) DSB formation at the ARG4 locus. DNA was digested with SπaBI and probed with an ARG4 internal fragment. The asterisk indicates a cross hybridizing band. (D) DSB formation at the CYS3 locus. DNA was digested with HindlW and probed with a FUN36 internal fragment.
Figure 3. GAL4BD-SP01 f-promoted DSBs at loci with UASGAL sequences
Genomic DNA was prepared from SP011 (ORD1181) and GAL4BD-SP011 (ORD5807) diploids and analysed as described in Figure 2. UASGAL sequences are indicated as boxes. (A) DSB formation at the GAL2 locus. DNA was digested with Xba\-Nco\ and probed with a GAL2 internal fragment. (B) DSB formation at the GAL1,7,10 locus. DNA was digested with C/al->Aafll and probed with a GAL1 internal fragment.
Figure 4. Recombination is stimulated at the GAL2 locus in a GAL4BD-SP011 strain (A) DSB formation at the GAL2 locus in a RAD50 strain (ORD5806). Genomic DNA was digested with Xba\-Nco\ and probed with a GAL2 internal fragment. Arrow at left shows DSBs at the GAL2 UASGAL site in an isogenic radδOS strain (ORD 5807); the bar at right indicates the extent of the "smear" of DSB fragments. (B) Segregation of the GAL2 and gal2-Bsp alleles among progeny of a GAL4BD-SP011 diploid (ORD6626). Tetrads were dissected on YPD and colonies were replica plated to YPGal. The gal2-Bsp allele confers a slow growth phenotype. Gene conversions (3+:1- and 1 +:3-) and mendelian (2+:2-) segregation patterns can be seen in this example. (C) Meiotic gene conversion frequencies at the GAL2 locus in GAL4BD-SP011 (ORD6626) and SP011 (ORD6632) diploids heterozygous for the GAL2 and gal2-Bsp alleles.
Figure 5. The GAL2 locus is located in a cold region
Southern blot analysis of DSB formation in a 20 kb interval centered on the GAL2 locus. Meiotic DNA from SP011 (ORD1181 ) and GAL4BD-SP011 (ORD5807) diploids was digested with the indicated restriction enzymes and probed with a GAL2 internal fragment. The schematic shows the transcriptional senses of genes and relevant restriction sites. Arrows indicate DSB sites. Figure 6. Genetic requirements for DSB formation in SP011 and GAL4BD-SP011 strains
Southern blot analyses were carried out as in Figures 2 and 3 to measure meiotic DSB frequencies (z axis) at the GAL2 locus, YCR048w ORF and YCR048w promoter (y axis) in diploids carrying the SP011 or GAL4BD-SP011 constructs (black or white bars, respectively), in wild-type and mutant (as indicated on the x axis) backgrounds. The genotypes of all strains assayed are listed in Table I. DSB frequencies were determined at 8 or 10 hr after transfer to sporulation medium. Figure 7. Meiotic DSBs formation at the YCR048W (Fig. 7A) and GAL2 (Fig. 7B) regions.
The meiotic DSBs are detected with shorter bands. The intrinsic DSBs and the UAS site-dependent DSBs sites are indicated by plain and dotted arrows, respectively. Both of the constructs, by which the Gal4BD- Spo11 fusion protein is expressed extremely early (IME1 promoter) and early (REC8 promoter) during the prophase of meiosis, allow to target DSBs at UAS sites.
Figure 8. Meiotic DSBs formation at the YCR048W and GAL2 regions. The meiotic DSBs are detected with shorter bands. The intrinsic
DSBs and the UAS site-dependent DSBs sites are indicated by plain and dotted arrows, respectively. The construct, by which the Gal4BD-Rec104 fusion protein is expressed constitutively, allow to target DSBs at UAS sites. Figure 9. Sequence of the PIMEI- Gal4BD-Spo11 construct.
The sequence of the IME1 promoter is underlined, the sequence encoding the GAL4 binding domain is in bold, and the sequence encoding the Spoi l portion of the Gal4BD-Spo11 fusion protein is in italics.
Figure 10. Sequence of the PRECS- Gal4BD-Spo11 construct. The sequence of the REC8 promoter is underlined, the sequence encoding the Gal4 binding domain is in bold, and the sequence encoding the Spoi l portion of the Gal4BD-Spo11 fusion protein is in italics.
Figure 11. Sequence of the PADm-QQR-Spo11 construct.
The sequence of the ADH1 promoter is underlined, the sequence encoding the QQR binding domain is in bold, and the sequence encoding the Spo11 portion of the QQR-Spo11 fusion protein is in italics.
Figure 12. Sequence of the PADHI- Gal4BB - Red 04 construct. The sequence of the ADH1 promoter is underlined, the sequence encoding the Gal4 binding domain is in bold, and the sequence encoding the Red 04 portion of the Gal4BD-Rec104 fusion protein is in italics. Figure 13. Sequence of the PAISPOH- Gal4BD - AtSpol 1 -1 construct.
The sequence of the AtSP011 promoter is underlined, the sequence encoding the Gal4 binding domain is in bold, and the sequence encoding the AtSpol 1 portion of the Gal4BD-AtSpo11-1 fusion protein is in italics.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Throughout this application, several words are employed, the meaning of which should be understood according to the following definitions :
A fusion protein is a chimeric protein comprising at least two moieties originating from different sources. It is usually the product of a fusion gene comprising coding sequences originating from different sources, wherein said coding sequences are in frame.
The present invention involves fusion proteins comprising a DNA binding domain operably linked to a Spoi l protein. In these fusions, the DNA binding domain, or DBD, is any domain of any protein, which has the property to bind to DNA, whether this binding is sequence-specific or not. Examples of non-specific DBDs are the topisomerases like Topol and Topoll and strand-exchange proteins such as Rad 51 , and examples of sequence-specific DBDs are the Gal4 DBD (thereafter noted Gal4BD), the QQR (Smith, Bibikova et al, 2000) or the lexA repressor. Of course, these examples are purely indicative, and other DBDs can be used to perform the invention. The sequence of an example of Gal4BD-Spo11 protein is given in Figures 9 and 10, and the sequence of an example of QQR-Spo11 is shown in Figure 11. The second moiety of the fusion proteins according to the invention is a Spo11 protein. This term designates the protein product of the SP011 gene identified in S. cerevisiae (Esposito and Esposito, 1969), but also the ortholog proteins of Spoi l , i.e., the products of ortholog genes of the SP011 gene, being understood that ortholog genes are homologous genes that are found in two different taxa and are performing the same function in each taxon. Other examples of Spo11 proteins are the AtSpol 1 of Arabidipsis thaliana (Grelon et al, 2001 ), and the murine mSpo11 , the sequence of which is described in (Baudat and Keeney, 2000). Alternatively, the second moiety of the fusion proteins can be a protein different from Spoi l , which is a partner of Spoi l involved in the formation of DSBs and which is capable of recruiting Spo11. By "recruiting" is meant the fact that the DBD-partner fusion protein will form a complex with Spo11 , which will lead to the formation of DSBs at the site targeted by the DBD. The term "partner" used below will designate a partner of Spoil which is capable of recruiting Spoi l . Examples of proteins which can be used as second moiety in the fusion proteins according to the invention are cited in the review articles by Keeney (2001 ) and by Smith and Nicolas (1998). The two moieties of the fusion proteins involved in the present invention - the DBD and Spoi l or one of its partners - are "operably linked", which means that the fusion protein retains the ability of binding to the DNA through the DBD moiety (in a sequence-specific manner if the DBD is sequence-specific), and retains also the initial functions of Spoi l (generating double strand breaks). Depending of the DBD and the Spo11 , the DBD moiety can be located at the N-terminal or at the C-terminal extremity of the fusion. Alternatively, two DBDs (possibly different ones) can be fused to Spo11 , one at each extremity of the protein.
Other definitions will appear in the following detailed description of preferred embodiments. Interestingly, as described in the Examples, the present invention provides a novel way of substantially increase the frequency of homologous recombination during meiosis and to target this recombination by a simple modification of the Spoi l protein. Previous reports have described the use of site-specific nucleases such as l-Scel, HO or VDE to locally stimulate meiotic homologous recombination. The present method of adding a heterologous DNA binding domain to Spoi l provides an alternative strategy with distinct features and practical advantages. For example, this approach exploits naturally occurring chromosomal sites of low complexity, thereby multiplying the number of potential targets without requiring the prior introduction of a specific sequence nor the deletion of the resident SP011 gene. Also, cleavage remains under normal physiological control with respect to cis and trans acting determinants, and as a consequence, DSBs are repaired by the homologous recombination pathway, allowing for the production of viable gametes and recovery of novel recombinants.
The present invention pertains to a method for increasing recombination between homologous chromosomes in a dividing cell, comprising the steps of: (i) introducing into said cell, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, and
(ii) having the cell divide, so that the recombination between homologous chromosomes in said cell is increased. Indeed, as described below in Example 1 , the inventors have evidenced that a Gal4BD-Spo11 protein could induce double stranded breaks in natural hotspots and, in addition, at the level of Gal4BD consensus sequences, even if they are located in cold regions of the genome. If necessary, the above method can further comprise, before step (ii), a step of introducing into said cell's genome, a DNA sequence recognized by said DNA binding domain operably linked to a Spo11 protein. The introduction of a number of such sequences will increase the rate of homologous recombination in the cell. Moreover, these sequences can be introduced at certain locations, thereby enabling a targeting of recombination, as described in more details below.
Alternatively, the above method can be performed by introducing a nucleic acid encoding a fusion protein between a DNA binding domain and a partner of Spoi l involved in the formation of DSBs and which is capable of recruiting Spoi l . As already mentioned above, the proteins which can be used according to this specific embodiment of the application can be selected, for example, among the proteins cited in the review articles by Keeney (2001 ) and by Smith and Nicolas (1998), and more specifically in the group comprising REC102, REC103/SKI8, REC104, REC114, MEI4, MRE2/NAM8, MER2/REC107, MRE11 , RAD50, XRS2/NBS1 in mammals, HOP1 , RED1 , SAE2/COM1 , MER1 and MEK1. This embodiment of the invention is illustrated by a Gal4BD-Rec104 protein, in example 1.10. Throughout the text below, the term "Spoi l" in fusion proteins is hence to be understood as either a Spo11 protein itself, or a partner of Spo11 capable of recruiting Spo11. This method can be performed within a cell that comprises artificial chromosomes carrying one or more sequence(s) recognized by said DNA binding domain operably linked to the Spo11 protein. Indeed, as explained in Example 5, artificial chromosomes do not always recombine during meiosis, which leads to problems of segregation, and therefore to the loss of these chromosomes in some daughter cells.
In the method described above, the nucleic acid introduced into the cell in step (i), encoding the DBD-Spo11 fusion protein, can be stably integrated into the cell genome. Alternatively, this nucleic acid can remain episomal, whether in a transient or in a stable episome. A transient episome is a DNA molecule which remains outside the cell genome and will not always be transmitted to the daughter cells during cell divisions. It can be, for example, and depending on the host cells, a plasmid or an adenoviral vector genome. A stable episome is one which will be replicated and transmitted to daughter cells, such as, for example, a replicon carrying the oriP-EBNA-1 system from Epstein-Barr virus. Importantly, the inventors have demonstrated that targeted meiotic double-strand breaks can be induced by Gal4BD-Spo11 encoded by a plasmid introduced into the cell, without altering the resident SP011 gene.
In the nucleic acids introduced in the cells according to the invention, the sequence encoding the DBD-Spo11 (or partner) protein is under the control of a promoter, which can be a constitutive promoter (for example, the promoter of ADH1), or a meiosis-specific promoter such as the SP011 promoter or an heterologous promoter, for example the IME1 promoter (Guttmann-Raviv et al, 2001 ) or the REC8 promoter (as described in Example1.9).
In a specific embodiment of the above method, which is illustrated in Example 1 , the cell is a yeast and the nucleic acid introduced into it in step (i) encodes a Gal4BD-Spo11 fusion protein.
Interestingly, the inventors have shown that deleting the resident GAL4 sequence from the yeast genome leads to an increase of GAL4BD- Spo11 mediated DSBs at UAS sites (example 1.11).
The present invention also concerns a method for performing a targeted recombination between two or more polymorphisms carried by a same chromosome in a cell, comprising the steps of: (i) introducing into said cell, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said DNA binding domain recognizes a sequence situated between said two or more polymorphisms, and
(ii) having the cell divide, so that the recombination between said two or more polymorphisms in said cell occurs. A method for targeting a gene conversion in a cell, i.e., a local transfer of one or several polymorphism(s), resulting in unidirectional acquisition of said polymorphism by a chromosome, is also part of the invention. Indeed, the present invention enables the obtention of different haplotypes by gene conversion as well as by crossing-over. This later method comprises the following steps:
(i) introducing into the cell, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said DNA binding domain recognises a sequence situated near the polymorphism(s) to be transferred, and
(ii) having the cell divide, so that the gene conversion occurs.
These methods can be particularly useful to study interactions between genes which usually segregate together, in particular genes that are located in a DNA region which does not comprise any hotspot. If necessary, these methods can further comprise before step (ii), a step of introducing into said cell's genome, between or near said polymorphism(s), a DNA sequence recognized by the DNA binding domain operably linked to a Spoi l protein.
In the method for performing a targeted recombination according to the invention, the cell can comprise artificial chromosomes carrying one or more sequence(s) recognized by the DBD operably linked to the Spo11 protein. Hence, this method helps targeting homologous recombination at specific locations along the artificial chromosomes.
In a preferred embodiment of the above methods, the cell is a yeast, and the Spo11 moiety comes from S. cerevisiae. Alternatively and as described above, the so-called Spoi l moiety can also be a partner of
Spoi l which is capable of recruiting Spoi l , such as, for example,
REC104. Optionally, the DBD is the Gal4BD.
In a preferred embodiment of the methods of the invention, the cell division performed in step (ii) is a meiosis. Some cells, such as yeast, can initiate a meiosis and then return to a mitosis, by a process called "return to growth", or RTG. In such cells, the method can be performed by inducing recombination at an early step of meiosis, and then have the cells return to growth. In this embodiment of the invention, meiosis-specific promoters such as the promoter of SP011 or heterologous promoters like the IME1 or the REC8 promoters, will favourably drive the expression of the DBD-Spo11 fusion protein.
Another aspect of the present invention is a method for inducing meiotic recombination in artificial chromosomes in a cell, comprising the steps of :
(i) introducing into said cell, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said DNA binding domain recognizes one or more sequence(s) carried by said artificial chromosome, and (ii) having the cell divide, so that the meiotic recombination occurs between artificial chromosomes.
As mentioned above, artificial chromosomes do not necessarily recombine during meosis, thereby incurring segregation troubles. This is a major drawback limiting the use of artificial chromosomes. In this specification, the term "artificial chromosome" not only designates fully artificial chromosomes (such as YACs), but also homeologous and heterologous chromosomes from other strains. For example in yeast, it is possible to obtain hybrid strains comprising chromosomes originating from different wild type strains. Such chromosomes, when they have a relatively high percentage of identity, are said "homeologous", whereas chromosomes being less close in sequence are "heterologous". In hybrid yeast, heterologous and, to a less extent, homeologous chromosomes fail to recombine during meosis.
By enabling meiotic recombination between artificial chromosomes in a cell, the present invention opens new interesting prospects, in particular in industries involving yeast. For example, in the brewery field, yeast are often hybrid strains, since the skilled artisan tries to combine in the same strain several advantageous characters from different wild-type strains. The selection of optimal strains is not easy, especially because these strains are unable to sporulate, for the reason mentioned above.
The method of the invention generally helps recombine haplotypes in a cell. The recombinations obtained by this method can be allelic, when they occur between the same positions on homologous chromosomes, or ectopic, when they happen between regions that are only locally homologous. Hence, the method enables to create translocations between the chromosomes. Consequently, the method according to the invention, by enabling recombination between the different chromosomes in cells during cell division, could no doubt increase the performance of the yeast strains mentioned above and, more generally, of any kind of strains used in the industry. Interestingly, as mentioned above, it is possible to induce the recombination at an early step of meiosis, and then let the cell come back to mitosis, by the RTG process.
In a specific embodiment of the method for inducing recombination in artificial chromosomes, wherein the cell is a yeast, the artificial chromosome is a YAC having one or more sites with a
CGGNnCGG sequence, and the fusion protein is a Gal4BD-Spo11 fusion protein.
The recombination of artificial chromosomes can also lead to a wider use of this tool in protein synthesis in cultures of eukaryotic cells, for example in the pharmaceutical field.
The present invention also concerns a method for generating variants of an organism, comprising the steps of :
(i) introducing into a cell of said organism, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said DNA binding domain recognizes one or more sequence(s) carried by said cell's genome;
(ii) having said cell perform a meiosis, so that meiotic recombination occurs between homologous chromosomes of said cell, at a higher rate and/or at different loci than in a natural meiosis of said organism; and
(iii) generating variants of said organism with the cell obtained in step (ii).
In this method, the term "variant" should be understood broadly, and designates an organism which presents at least one phenotypic or genotypic difference having regard to its parent(s). Variants resulting from recombination between homologous chromosomes will result from reassociation of genetic polymorphisms, defined by the DNA sequence, occurring between or within genes. More generally, a variant here designates an organism, the haplotype of which is different from the haplotype(s) of its parent(s).
As previously described, Spoi l is homologous to an archebacterial topoisomerase (Bergerat, de Massy, 1997). However, the methods according to the present invention are preferably performed in eukaryotic cells. These cells can be for example selected from the group consisting of a fungus, a plant cell, a mammalian cell, and an insect cell. The experimental part described below illustrates examples of such cells, with S. cerevisiae for the fungi, A thaliana for the plants, mouse for the mammalians, and Drosophila for the insects. All the same, in the above method for generating variants of an organism, this organism can be selected from the group consisting of a fungus, a plant, a non human mammal, and an insect.
The method for generating variants of an organism, according to the invention, can further comprise a step of screening the obtained variants for the presence of two or more characters. This method, by increasing the recombination rate and/or by inducing targeted meiotic recombination, enables the rapid obtaining of variants combining different characters from the parent cells. Hence, it can decrease drastically the amount of individuals that must be screened to find one presenting a certain combination of alleles.
The above-described method leads to another aspect of the present invention, which is a method for analysing the genome of an organism, comprising the steps of :
(i) generating variants of said organism, according to the method of the invention;
(ii) performing a genetic analysis and a phenotypic analysis of certain characters of said variants; and (iii) analysing the genome of said organism.
Indeed, the rapid obtaining of a larger number of variants undoubtedly facilitates establishing correlation between genotypes and phenotypes, since the amount of organisms (for example, mice) that must be screened to find some with the desired allele(s) is reduced.
The variants obtainable by the method of the invention can be used in experimental models for screening the effect of a compound of any kind, for example in the course of the development of drugs, or for obtaining an appropriate host cell suitable for a recombinant gene expression.
The present invention also pertains to a kit for performing the methods described above, containing a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said fusion protein is capable of inducing double strand breaks in formerly cold regions.
In this kit, Spo11 can have the sequence of a Spo11 protein from a cell selected from the group of a fungus, a plant cell, a mammalian cell, and an insect cell. Examples of such sequences are spoil from S. cerevisiae (yeast), Atspo11 from A. thaliana (plant), the murine spoil (mammal), and spoil from Drosophila (insect). Of course, these examples are not restrictive, and any spoil ortholog gene from any other organism can be used. The kit of the invention can further comprise a nucleic acid carrying a target sequence recognized by said DNA binding domain operably linked to a Spo11 protein. This target sequence can be comprise in any kind of vector, for example in a cloning vector comprising a high number of restriction sites, so that constructs to insert this target sequence in the desired locus of the desired chromosome is facilitated.
The nucleic acid comprising the DBD-spo11 sequence can also be comprised in a vector. As mentioned above, the methods of the invention can be performed without integrating the DBD-spo11 gene into the cell genome. Therefore, and depending on the type of cells, a large variety of vectors are appropriate, such as plasmids, replicative DNAs, nuclic acids complexed with any kind of transfecting agents, phages, and viruses. Different viruses can be used as vectors to introduce the nucleic acid comprising the DBD-spo11 sequence into mammalian cells, some of which will integrate into the cell genome (such as retroviruses for example), whereas some will not (ex. : adenoviruses).
Also part of the present invention is an eukaryotic cell expressing a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said fusion protein is capable of inducing double strand breaks in formerly cold regions of the genome of said eukaryotic cell. Of course, the phrase "cold region", in this context, designates cold regions for meiotic recombination. In this cell, the DBD-SP011 gene is under the control of a promoter, which can be meiosis-specific or not. The cell according to the invention can also be engineered so that the expression of meiosis-specific proteins is modified, as explained in Example 6. This cell can be for example a fungus, a plant cell, a mammalian cell, or an insect cell.
Yet another aspect of the present invention concerns nucleic acids encoding a fusion protein comprising a Spoi l moiety and a DNA binding domain operably linked thereto, wherein said Spo11 protein is, for example, the AtSpol 1 protein from Arabidopsis thaliana or the murine
Spoi l protein.
EXAMPLES
The following examples can be performed using the experimental procedures described below:
Experimental Procedures
Plasmid Construction
To create the integrative plasmid pAP1 , which encodes the Gal4BD-Spo11 fusion, the SP011 ORF was generated by PCR and introduced as a BamWUPstl fragment downstream of the sequence encoding the Gal4 DNA binding domain (Gal4BD) in the two-hybrid vector pAS2ΔΔ (Fromont-Racine, Rain et al. 1997). The in-frame N-terminal fusion of Gal4BD to Spo11 and the complete ORF were verified by sequencing. The kanMXΛ drug resistance cassette (Wach, 1996) was inserted into a unique Nru\ site, and the 2μ replication origin was removed by replacing a βpml-βst/36l fragment with the corresponding fragment from pRS304 (Sikorski and Hieter, 1989) producing pAP1. To create plCM99, the GAL2 locus was amplified from genomic DNA and a subclone containing the promoter region and the first 655 bp of the GAL2 ORF was mutagenized with the QuikChange site-directed mutagenesis kit (Stratagene). This frameshift mutation generates a BspHI restriction site and gives rise to a truncated protein of 66 amino acids. The relevant fragment was sequenced to confirm the mutation and finally subcloned into pRS306 (Sikorski and Hieter, 1989), producing plCM99.
Yeast Strains
All yeast strains are isogenic derivatives of SK1 (Kane and Roth, 1974). They were obtained by transformation or crossing and their relevant genotypes are shown in Table I. Xbal-digested pAP1 was integrated at the trpl locus by transformation using the lithium acetate/polyethylene glycol method (Ausubel et al., 1988). G418 (200 μg/ml) resistant transformants were selected and checked for tryptophan prototrophy. Correct targeting was verified by Southern analysis. The gal2-BspHI mutation was introduced at the GAL2 locus by the two-step replacement procedure using URA3 as a selectable marker (Ausubel et al., 1988). For transformation, plCM99 was linearized at the unique BglU site in the GAL2 ORF, and targeting was verified by PCR and Southern analysis. Retention of the desired point mutation among 5-fluoroorotate-resistant pop-out clones was confirmed by BspHI restriction analysis of amplified GAL2 fragments.
Media and Genetic Techniques
Standard media (YPD) and SD (0.67% yeast nitrogen base without amino acids, 2% glucose), supplemented when necessary with appropriate nutrients (Sherman et al., 1983), were used for vegetative growth. Meiotic cultures were prepared as described (Alani et al., 1990). Complete galactose medium YPGal, in which glucose was replaced by galactose (20 g/l), allowed segregation of the ga/2-βspHI allele to be monitored. Spore viabilities were determined by dissecting four-spored asci produced in sporulation medium after 48 h.
Molecular Techniques
For detection and quantification of DSBs, genomic DNA was prepared from sporulating cells and subjected to Southern analysis. Parental and DSB bands were visualized with a Phosphorimager and quantified with the use of ImageQuant software (Molecular Dynamics) as described (Vedel and Nicolas, 1999). Northern analysis was performed as described (Smith et al., 2001). Whole cell extracts were prepared and analyzed by western blotting with an anti-Gal4(DBD) antibody (Santa Cruz Biotechnology) using standard procedures (Ausubel et al., 1988).
Description of plasmid constructs
Promoter IME1-GAL4BD-SPQ11 construct : plasmid named PAP111
The pAP11 plasmid was constructed by deletion of the Sad- Sad fragment (position 1891-3330) of pAP1 (Pecina et al., 2002). The pBS deltal plasmid containing the 1216 bp Xhol fragment of pAP11 was subcloned into the pBS deltaO plasmid previously derived by deletion of the Smal-Hincll fragment of pBlueScript. The IME1 promoter was isolated from plasmid p2053 (Guttmann-Raviv et al., 2001 ) by cuting with Sphl, followed by Klenow treatment and cutting with Hindlll. This fragment was inserted into the pBS deltal vector cut by EcoRV and Hindlll. It creates plasmid pBS deltal 1. Then IME1 promoter -containing region of pBSdelta11 was cleaved by Xhol and subcloned into the Xho1 site of pAP11 to create plasmid pAP111.
Promoter REC8-GAL4BD-SPQ11 construct: plasmid named PAP118
The 1471 bp Sacl-BamHI fragment of plasmid pAP11 was subcloned into the pBS deltaO plasmid to create plasmid pBS delta2. The REC8 promoter was amplified from genomic DNA of the S. cerevisiae strain ORD7254-25D (SK1 background) with two primers, REC8 UP (5'- CGATATCTATACATTACCAATCCTTCCT -3'), and REC8 LO (5'- CAAGCTTTGCAGAATATTTGTAATATT -3') and cloned into pGEM T-easy (Promega) and sequenced. Then the EcoRV-Hindlll fragment (containing the REC8 promoter) was subcloned into the pBSdelta2 plasmid also cleaved by EcoRV-Hindlll. It creates the plasmid pBS delta28. Finally, the Sacl-BamHI fragment (containing the REC8 promoter) of pBS delta28 was subcloned into the pAP11 plasmid cleaved at Sacl-BamHI sites to create the plasmid pAP118.
Promoter ADH1-QQR-SPQ11 construct : plasmid named pAP119 The QQR fragment was amplified from plasmid DNA of pET15bi
QQR(Lo) FN (provided by Dr. Dana Carroll, University of Utah, USA, Smith,
Bibikova et al, 2000) with two primers, QQR UP (5'-
AAGCTTATGGAAAAACTGCGGA -3'), and QQR LO (5'-
TGGCCATAAATTCCGGACTAGTTGCTTCTTAT -3'). The amplified fragment was cloned into the pGEM T-easy vector (Promega) and sequenced. Then, the QQR fragment was subcloned into the pBS delta2 vector cleaved with Hindlll and Mscl to create plasmid pBS delta29. Finally, the Sacl-BamHI fragment from the pBS delta29 (containing the QQR sequence) was inserted into the plasmid pAP11 cleaved by Sacl-BamHI. It creates the plasmid pAP119.
Promoter ADH1- GAL4BD-REC104 construct : plasmid named pXP3
The REC104 coding region was amplified by PCR from the S. cerevisiae strain ORD7254-25D (SK1 background) with two primers, REC104UP (5'- GAGATGGCCATGGAGGCCATGTCCATCGAGGAGGAAGAT-3'), and REC104LO (5'- GGATCCCCGGGGCTCAGGGACTACTAAACTGAAA-3' The amplified fragment was cloned into the pCR2.1 vector and verified. Then, the REC104 fragment was subcloned into the pASIN integrative vector cleaved by Sfil and Xma1. It creates the plasmid pXP3. The pASIN plasmid (promoter ADH1-GAL4BD, AmpR, TRP1) derives from pAS2ΔΔ (Fromont-Racine, Rain et al., 1997) by removal of the 2 micron replication origin.
cphs-qal4bd-meiw68 plasmid The cDNA of mei-W68 (drosophila ortholog of Spoi l ) was isolated from the plasmid pAH69 (Kim McKim and Aki Hayashi-Hagihara, 1998).
- Cloning of Xmnl-Dral from pAH69 into pAS2 ΔΔ digested by Smal. It creates plasmid pAPAPL
- PCR amplification and cloning of a mei-W68 fragment into pGemT-easy: pGEMT-easy(mei5,). Primers:
5'meiW68: 5'-ggaatggccacaatggatgaattttcgg-3'
3' meiW68: 5'-ggtgaaacttcctccgcggac-3' - Cloning of Mscl-Sacll fragment from pGEMT-easy (mei5,) into pAPAPI : It creates plasmid pAPAP2. This plasmid contains the fusion protein Gal4BD-meiW68 under ADH1 promoter into a replicative plasmid with Amp and TRP1 markers.
- Cloning of Bsgl-Sall from pAPAP2 into the drosphila vector pCasper-hs (Hpal) containing the HsP70 promoter. It creates the cphs- gal4bd-meiw68 plasmid.
Integration of the constructs and Strains pXP3 was linearized with Xbal and used for the transformation of ORD7254-25D (α, ura3, Ieu2, trpl , his4). Transformation was carried out with litium acetate method and the cells were spread onto a tryptophan- depleted plate. The transformed cells were verified with Southern blot analysis. The transformed cells were crossed, sporulated and segregants mated to create the ORD7770 strain. pAP111 was linearized with Bsu36l and used for the transformation of ORD7254-25D (α, ura3, Ieu2, trpl, his4). Transformation was carried out with litium acetate method and the cells were spread onto a tryptophan-depleted plate. The transformed cells were verified with Southern blot analysis. The transformed cells were crossed, sporulated and segregants mated to create the ORD8016 strain. pAP118 was linearized with Xbal and used for the transformation of ORD7254-25D (α, ura3, Ieu2, trpl , his4). Transformation was carried out with litium acetate method and the cells were spread onto a tryptophan- depleted plate. The transformed cells were verified with Southern blot analysis. The transformed cells were crossed, sporulated and segregants mated to create the ORD8050 strain.
Isolation of DNA and detection of DSBs Ten millilitres of meiotic cultures were harvested at each time point and washed once with sterile water. Spheroplast was produced by incubation with Zymolyase 20T (Chemical Credential, ICN) for 30 min at 30 °C. The spheroplast was lysated in the 500 μl of lysate solution (50mM EDTA, 200ng/ml proteinase K, 0.4% SDS) for 30 min at 65 °C. Then, 200 μl of 5M potassium acetate was added and incubated for more than 1 hour on ice. After centrifugation for 15 min with the speed of 13000 rpm, the supematants were removed to new eppendorf tubes and 500 μl of isopropanol was added to precipitate nucleic acid. Precipitated nucleic acid was washed with 70% of ethanol and RNase A was treated for 1 hour at 37°C. The DNA was precipitated with ethanol and finally resuspended in sterile water.
About 1 μg of DNA was digested with Asel for the detection of the DSBs at the YCR048W region and with Xbal for the GAL2(YLR081W) region. These samples were subjected to electrophoreisis on a 1 % agarose gel and blotted onto a nylon membrane (Hybond-N; Amarsham®). For the detection of DSBs at the YCR048W and GAL2 region, YCR048W and GAL2 open reading frame DNAs were used as probes, respectively.
Example 1 : Targeted stimulation of meiotic recombination in Saccharomvces cerevisiae 1.1. The Gal4BD-Spo11 fusion protein is expressed in meiosis
A fusion encoding the DNA-binding domain of Gal4 (Gal4BD, amino acids 1-147) with the N-terminus of the full length S. cerevisiae
Spoi l protein was placed under the control of the constitutive ADH1 promoter (Figure 1A) and integrated at the TRP1 locus in a spoil A strain.
Homozygous diploids were derived by genetic crosses (Table I).
STRAIN RELEVANT GENOTYPE
ORD 1181 a/a rad50S::URA3/"
ORD5740 a/ arg4-nsp/arg4-bg LEU2/leu2
ORD5805 a/ spo 11Δ::URA3/" arg4-bg/arg4-rV NUC1/nuc1A::LEU2 Ieu2/"
ORD5806 a/α trp1::GAL4BD-SP011-TRP1-KanMX/" spoil A::URA3/" arg4-bg/arg4-rV nuc1A::LEU2/" Ieu2/"
ORD5807 a/α trp1::G4BD-SP011-TRP1-KanMX/" spol 1A::URA3f radδOS::URA3/" arg4-bg/" NUC1/nuc1A::LEU2 leu2/"
ORD5817 a/α trp1::GAL4BD-SP011-TRP1-KanMX/" arg4-bg/ARG4 Ieu2/"
ORD5821 a/α rec102A::URA3/" rad50S::LEU2/" Ieu2/"
ORD5828 a/α trp1::GAL4BD-SP011-TRP1-KanMX/" spo11A::URA3/" mre4::URA3/" rad50S::LEU2/" arg4-bg/arg4-rV Ieu2/"
ORD5845 a/α mre4::URA3/" rad50S::LEU2/" arg4-bg/ARG4 Ieu2/"
ORD5846 a/α mre2::URA3/" radδOS::LEU2/" leu2/"
ORD5849 a/α trpl ::GAL4BD-SP011-TRP1-KanMX/" spo 11 Δ::URA3/" mre2::URA3/" rad50S::LEU2/" arg4-rV/" Ieu2/"
ORD5851 a/α trp1::GAL4BD-SP011-TRP1-KanMX/" spoil A::URA3/" rec104A::LEU2/" radδOS::URA3/" arg4-bgf Ieu2/"
ORD5857 a/α rec104A::LEU2/" radδOS::URA3/" Ieu2/"
ORD5859 a/α trp1::GAL4BD-SP011-TRP1-KanMX/" spoil Δ::URA3/" rec102Δ::URA3/" radδOS:;LEU2/" arg4-rV/ARG4 Ieu2/"
ORD5879 a/α trpl ::GAL4BD-SP011-TRP1-KanMX/" spol 1 Δ::URA3/" rec103::KanMX/" radδOS::URA3/" arg4-bg/ARG4 Ieu2/"
ORD6534 a/α trp 1::GAL4BD-SP011-TRP1-KanMX/" spo 1A::URA3/" clbδ::URA3/" clb6::TRP1/" radδOS::LEU2/" arg4-bg/" Ieu2f'
ORD6551 a/α trpl ::GAL4BD-SP011-TRP1-KanMX/" spol 1 Δ::URA3/" clbδ::URA3/" radδOS::LEU2/" arg4-bg/" Ieu2/"
ORD6591 a/α mei4::URA3/" radδOS::LEU2f' arg4-bg/ARG4 Ieu2/"
ORD6593 a/α rec103::KanMX/" rad50S::LEU2/" arg4-bg/ARG4 Ieu2/"
ORD6595 a/α red1::URA3r radδOS::LEU2/" arg4-bg/ARG4 Ieu2/"
ORD6598 a/α red 14::KanMX/" radδOS::LEU2/" arg4-bg/" Ieu2f'
STRAIN RELEVANT GENOTYPE
ORD6626 a/a trpl ::GAL4BD-SP011 -TRP 1 -Kan MX/" spoil A::URA3/"arg4-bg/ARG4 GAL2/gal2-Bsp NUC1/nudA::LEU2 Ieu2/"
ORD6632 a/α GAL2/gal2-Bsp LEU2/leu2
ORD7414 a/α mer1::LEU2/" radδOS::URA3/" arg4-rV/" Ieu2/"
ORD7419 a/α hop1::LEU2/n radδOS::URA3/" arg4-rV/" Ieu2/"
ORD7420 a/α trp1::GAL4BD-SP011-TRP1-KanMX/" spo11A::URA3/" mei4::URA3/" radδOS::LEU2/" arg4-bg/ARG4 Ieu2/"
ORD7421 a/α trpl ::GAL4BD-SP011-TRP1-KanMX/" spo11A::URA3/" red 14::KanMX/" radδOS::LEU2/" arg4-bg/ARG4 Ieu2/"
ORD7430 a/α mre 11A::KanMX/" radδOS::URA3/" arg-rV/ARG4 Ieu2/"
ORD7443 a/α trpl ::GAL4BD-SP011-TRP1-KanMX/" spo11A::URA3/" mer1::LEU2/" radδOS::URA3/" arg-rV/ARG4 leu2/"
ORD7447 a/α trp1::GAL4BD-SP011-TRP1-KanMX/" spoil A::URA3r red1::URA3/" radδOS::LEU2/" arg4-bg/" Ieu2/"
ORD7448 a/α mer2::URA3/" radδOS::LEU2/" arg4-bg/ARG4 Ieu2/"
ORD7452 a/α trp 1::GAL4BD-SP011 -TRP 1 -Kan MX/" spo 11A::URA3/" rad50A::hisG/" com1::KanMX/" arg4-nsp/ARG4 Ieu2/"
ORD7454 a/α trpl ::GAL4BD-SP011-TRP1-KanMX/" spo11Δ::URA3/" hop1::LEU2/" radδOS::URA3/" arg4-rV/ARG4 Ieu2/"
ORD7456 a/α radδOΔ::hisG/" com1::KanMX/" arg4-nsp, bg/ARG4 LEU2/leu2
ORD7459 a/α trpl ::GAL4BD-SP011 -TRP 1 -Kan MX/" spoil A::URA3f mer2::URA3/" radδOS::LEU2/" arg4-bg/ARG4 leu2T
ORD7461 a/α trp 10GAL4BD-SPO 11-TRP1-KanMX/" spo 11A::URA3/" mre 11A::KanMX/" radδOS::LEU2/" arg4-bg/" Ieu2/"
ORD7466 a/α xrs2A::LEU2/" com1::KanMX/" arg4-nsp.bg/ ARG4 Ieu2/"
ORD7468 a/α trpl ::GAL4BD-SP011-TRP1-KanMX/" spoil A::URA3/" xrs2A::LEU2/" coml:: KanMX/" arg4-nsp,bg/ARG4 Ieu2/"
ORD7770 a/α: ura3/ura3, trpl ::pXP3/trp1 ::pXP3, Ieu2/leu2, arg4 /+, his4 /+, red 04 ::LEU2/rec104 ::LEU2, radδOS ::URA3/radδ0S ::URA3
ORD8016 a/α : ura3/ura3, trp 1 ::pAP111/trp 1 ::pAP111, Ieu2/leu2, arg4 /+, his4 /+, spo 11 ::URA3/spo 11 ::URA3, radδOS ::LEU2/radδ0S ::LEU2
ORD8050 a /a : ura3/ura3, trp 1 ::pAP118/trp 1 ::pAP118, Ieu2/leu2, arg4 /+, his4 /+, spo 11 ::URA3/spo 11 ::URA3, radδOS ::LEU2/radδOS ::LEU2
Table I. Strain genotypes strains are ho::LYS2/" Iys2/" ura3/" trpl/". All strains were constructed for this work except ORD1181 (Baudat and Nicolas, 1997) and ORD5740 (Smith et al, 2001).
To verify expression, total RNA was analyzed during vegetative growth or at various times after transfer to sporulation medium and subjected to Northern blot analysis. In wild type diploids SP011 mRNA begins to accumulate after transfer of cells to sporulation medium and decreases after 7h, by which time ascospore formation has begun (Figure 1B). In contrast, GAL4BD-SP011 mRNA is detected in both vegetative and meiotic cells, but like SP011 mRNA, it decreases at later timepoints (6-7 h). Quantification of transcript levels (Figure 1 C) indicates that the fusion is highly expressed in vegetatively growing cells and that the levels of GAL4BD-SP011 mRNA are only slightly greater than the levels of SP011 mRNA during meiotic prophase (2-6 h), most likely because the ADH1 promoter is less active in meiotic than in mitotic cells whereas the SP011 promoter is strongly induced. Finally, western blot analysis shows that the fusion protein is expressed in both mitotic and meiotic GAL4BD-SP011 ceils and is of the expected size, 63.5 kDa (Figure 1 D).
1.2. Gal4BD-Spo11 complements the sporulation defect of a spoil Δ strain
Diploid spoil A cells can sporulate but produce inviable progeny because chromosomes segregate abnormally when meiotic recombination is not initiated. The inventors examined whether the Gal4BD-Spo11 protein could complement the sporulation defects of a spoil A diploid. Like wild type SP011 (ORD5740) and spo77.il (ORD5805) strains, a GAL4BD- SP011 spoi l A diploid (ORD5806) sporulates efficiently (approximately 80%), giving rise primarily to four-spored asci. Tetrad analysis shows that, as expected, none of the spores produced by spoil A diploids germinates (0/512). In contrast, the Gal4BD-Spo11 fusion protein restores full viability to spoil A spores (531/552, 96%), the same as observed for progeny of the SPO77" diploid (505/526, 96%). High spore viability was similarly found for a diploid that contains both GAL4BD-SP011 and SP011 (ORD5817). Altogether, these results demonstrate that the GAL4BD-SP011 construct is functional and that it confers no adverse effect.
1.3. Gal4BD-Spo11 promotes DSB formation at natural sites
Since spore viability depends on meiotic recombination between each of a pair of homologous chromosomes, the complementation of the spoil A defect by GAL4BD-SP011 suggested that the fusion protein might also rescue the spoil A DSB defect. To test this idea, several regions of the genome at which meiotic DSBs normally form were examined. The YCR043c-YCR048w region of chromosome III contains numerous DSB sites, including a strong hotspot in the YCR047c-048w intergenic region (Baudat and Nicolas, 1997). As shown in Figure 2A, these DSBs are formed in both SP011 and GAL4BD-SP011 meiotic cells. In the GAL4BD- SP011 strain two new DSB sites can be seen within the YCR048w coding region, which is notable since natural DSBs are generally restricted to promoter-containing regions (Figure 2A, and see below). A quantitative analysis of DSB band intensity indicates that the cumulative frequency of meiotic DSBs in this 9.6 kb chromosomal region is similar in both strains (approximately 13±2%). In most cases, the DSB frequency at a given site is also similar, although DSBs form at a lower frequency in the YCR047c/48w intergenic region in the GAL4BD-SP011 diploid than in the SP011 diploid (5±1% versus 11±1%, respectively) (Figure 2B). Interestingly, the decrease in DSB frequency at this site is locally offset by the appearance of new DSBs in the YCR048w ORF (4±1%); this redistribution is suggestive of competition between adjacent DSB sites, as previously reported for Spol 1- initiated DSBs (Wu and Lichten, 1995). Two other well characterized regions were also examined, the ARG4 (on chromosome VIII) and CYS3 (on chromosome I) loci (Vedel and Nicolas, 1999). In both cases, similar meiotic DSB profiles in SP011 and GAL4BD-SP011 cells were detected, with respect to positioning and intensity (Figure 2C and 2D). Altogether, these results demonstrate that the Gal4BD-Spo11 protein can promote DSB formation at natural sites at frequencies comparable to those promoted by wild type Spoi l , thereby explaining its ability to fully complement the inviability of spoil A spores.
1.4. Gal4BD-Spo11 promotes DSB formation near consensus Gal4 DNA binding sites
As described above, two additional DSB sites in the YCR048w coding region were observed : a strong site near the 5' end of the YCR048w ORF and a much weaker site further downstream (Figure 2A). These new sites could result from an aberration in the targeting specificity of the Spoi l protein domain per se, at least in regions such as the YCR048w locus where Spol 1 is already active, or they might reflect the fortuitous presence of Gal4 consensus binding sites. Indeed, an examination of the YCR048w sequence reveals two such sites within the ORF, at positions +295 and +1320 nt from the translational start site, respectively, which correlate with the estimated locations of the two new Gal4BD-Spo11 -specific DSBs at this locus. This observation indicates that the Gal4BD-Spo11 protein can target DSBs to specific sequences, at least in this DSB proficient domain (Baudat and Nicolas, 1997).
To determine whether the tethering of the Gal4 DNA binding domain to Spol 1 allows meiotic DSBs to be targeted to well-characterized
Gal4 binding sites, the inventors examined several loci containing UASGAL sites that have been implicated in galactose catabolism. The GAL2 promoter region contains four CCG(N)nGGC sequences (verified by sequencing the GAL2 promoter of ORD6632), two of which are constitutively bound by Gal4 in vivo (Huibregtse et al.; 1993). In a SP011 strain, DSBs are barely detectable at the GAL2 locus, indicating that this region is not a frequent natural DSB site. In contrast, in a GAL4BD-SP011 strain, prominent DSBs can be observed in the GAL2 promoter near or at the UASGAL sites (Figure 3A). Similar to what was observed for the YCR043c-YCR048w interval, DSBs appear at the GAL2 locus in GAL4BD- SP011 meiotic cells within 2 hrs of transfer of cells to sporulation medium, and their intensity increases over the course of meiosis, reaching a maximum at 8-1 Oh (Figure 3A). Quantitative analysis of several independent experiments indicates that the frequency of GAL2 DSBs in the GAL4BD-SP011 strain is approximately 12±2 %, in contrast to <0.6 % observed in the wild type strain, a 20-fold stimulation (Figure 3).
To generalize these observations, the inventors examined DSB targeting near the GAL7, GAL10 and GAL1 genes, which like GAL2 are transcriptionally induced by the Gal4 protein in the presence of galactose. At these loci, meiotic DSBs do not form in SP011 diploids but in contrast are readily detectable at or near their associated UASGAL sites in GAL4BD- SP011 diploids (Figure 3B). Quantitative analysis indicates a substantial stimulation of DSB formation, with frequencies of 4+1% for the GAL7 upstream region and 2±1% for the divergently transcribed GAL1-GAL10 intergenic region. This is notably lower than the frequency of 12±2% observed for the GAL2 promoter (Figure 3A). Altogether, these results show that the Gal4BD-Spo11 protein can target meiosis-specific DSBs to Gal4 DNA binding sites, creating novel genomic DSB sites of various strenght. Finally, it was verified with several control strains that the
Gal4BD-Spo11 fusion protein is solely responsible for the appearance of these new DSBs. First, spoil A strains expressing the Gal4BD- spo11Y135F fusion protein, in which the Spoi l catalytic tyrosine residue is replaced with a catalytically inert phenylalanine residue (Bergerat et al., 1997), do not exhibit meiotic DSBs either in the YCR043c-YCR048w region or at the GAL2 locus. Second, SP011 strains expressing the Gal4 binding domain either alone or fused to the Rpb5 protein (an RNA polymerase subunit whose function is unrelated to the initiation of recombination), and a strain expressing a pADH1 ::SP011 construct (without Gal4BD) exhibit DSBs in the YCR043c-YCR048w region but not at the GAL2 locus. Collectively, these control experiments demonstrate that the stimulation of Gal4BD-Spo11 -dependent DSBs near Gal4 binding sites requires both the Gal4BD and Spol 1 components of the chimeric protein.
1.5. The Gal4BD-Spo11 fusion strongly stimulates recombination at the GAL2 locus
The above DSB experiments were performed in radδOS strains, from which viable recombinants cannot be recovered. To determine whether the new GAL4BD-SP01 ' -promoted DSBs are recombinogenic, meiotic DSB fragments in the GAL2 region in a RADδO background were first examined to see if they are processed like Spol 1 -induced DSBs. DSBs were detected (Figure 4A) as a smear of fragments of greater mobility than the discrete radδOS band, showing that the new GAL2 DSBs undergo processing. Moreover, the transient nature of the smear (appearing by 3h and disappearing between 7-9h) suggests that these DSBs are repaired with normal kinetics.
To assess whether Gal4BD-Spo11 -dependent DSBs are repaired by homologous recombination, the frequency of meiotic gene conversion at the GAL2 locus was then measured. For this purpose, a mutant allele, gal2-Bsp, was constructed. This mutant allele contains a frame-shift at position 197 of the GAL2 ORF and derived GAL2/gal2-Bsp heterozygotes in both the SP011 and GAL4BD-SP011 backgrounds. From 218 four-spore tetrads produced by the SP011 diploid, only five conversion events were found. In contrast, for the GAL4BD-SP011 strain, 55 conversion events were observed in both directions (3:1 and 1 :3) among 212 tetrads analyzed (26%), a 10-fold increase over the level observed for the SP011 strain (Figure 4C). Gal4BD-Spo11 -promoted DSBs can also initiate recombination at other loci : tetrad analysis confirmed that the levels of meiotic gene conversion at the ARG4 natural hotspot are similar in SP011 and GAL4BD-SP011 diploids. These results show that the DSBs formed in the GAL2 promoter in GAL4BD-SP011 strains are recombinogenic and behave like Spoi l -induced breaks.
1.6. Gal4BD-Spo11 promotes cleavage within a large region that is normally cold for DSB formation
The analysis of Gal4BD-Spo11 activity to a large interval of approximately 20 kb centered on GAL2 (between the YLR072w and YLR084c ORFs on chromosome XII) that contains eight intergenic promoter-containing regions (Figure 5A). In a SP011 strain, no DSBs were observed in this interval. In a GAL4BD-SP011 strain, the GAL2 promoter region is the only site at which a DSB can be detected. Since there are no other Gal4 consensus sequences in this interval, these results underscore three important features of Gal4BD-Spo11 DSB activity. First, the stimulation of DSBs near GAL2 is specifically targeted. Second, cleavage at GAL2 does not promote the nearby formation of other DSBs. Third, in contrast to what is observed for DSBs in the YCR048w region of chromosome III, the new GAL2 DSBs occur in a naturally cold chromosomal region.
1.7. DSB formation by Gal4BD-Spo11 requires the activity of the other known DSB genes
In addition to SP011, 14 other genes are known to be required for the formation of wild type levels of DSBs at natural sites in S. cerevisiae. If one or more of their products is necessary to recruit Spol 1 to future DSB sites, the addition of the Gal4 DNA binding domain to Spol 1 might bypass this requirement, at least for DSBs at Gal4 binding sites. Southern blot analysis indicates that red 02, rec103/ski8, red 04, red 14, mei4, mer2/rec107, mre2/nam8, mre11, radδO and xrs2 null mutants, in either the SPO77 or GAL4BD-SP011 background, do not exhibit meiotic DSBs in the YCR043c-YCR048w interval or at GAL2 (Figure 6), whereas the redl, mre4/mek1, hopl and merl, null mutants exhibit reduced but still detectable levels of DSBs. Quantitatively, at the GAL2 locus, the redl mutation reduces the frequency of Gal4BD-Spo11 promoted DSBs by about 3-fold, the mre4/mek1 and hopl mutations confer a 10-fold reduction, and the merl mutation almost completely eliminates DSB formation. Somewhat differently, in the YCR047c-48w region (YCR048w promoter +ORF), the mre4/mek1 mutation has no effect in either SP011 or GAL4BD- SP011 strains, and the redl, merl and hopl mutations have increasingly repressive effects in both strains. The differental effects of each of these mutations on chromosome III and at GAL2 may reflect locus-specific variation. Overall, since all of these genes, which are either essential or important for DSB formation in SP011 strains are similarly required in GAL4BD-SP011 strains, it can be concluded that they do not assist Spol 1 in target site selection.
1.8. Gal4BD-Spo11 cleavage also requires Clb5 Clbβ activity
The B-type cyclins CLBδ and CLB6 are required for meiotic replication and for meiotic DSB formation. To determine whether Gal4BD- Spo11 -promoted DSBs also depend on Clb5 and Clb6 activity, DSB formation was assayed in clbδ and clbδ clbβ diploids containing the GAL4BD-SP011 construct (ORD6534 and ORD6551 , respectively). As indicated in Figure 6, no DSB formation was detected at either the YCR048w or the GAL2 locus in these strains, demonstrating that the addition of a heterologous DNA binding domain to Spol 1 does not bypass the requirements for Clb5 and Clb6 activity and hence does not overcome the meiotic replication defect that is relevant to DSB induction. In conjunction with the demonstrated requirement for the other DSB genes, this result indicates that the Gal4DB-Spo11 protein is subject to the same (rans-acting) genetic controls as the Spol 1 protein for DSB formation in both natural and targeted domains. 1.9. Gal4BD-Spo11 cleavage using heterologous meiosis-specific promoters
The GAL4BD-SP011 construct was put under the control of the IME1 promoter (Guttmann-Raviv etal, 2001 ), which is expressed very early during the meiosis, or under the control of the REC8 promoter, which is expressed early in meiosis. The obtained sequences for the promoter- GAL4BD-SP011 constructs are shown in figures 9 and 10, respectively. Figure 7 shows that both of these constructs induce DSB formation at UAS sites, either in the YCR048w region (Fig 7A) or in the GAL2 region (Fig. 7B).
1.10. Spoil can be recruited by another protein required for DSB formation
Red 04 is a protein required to induce DSBs in yeast. Its coding sequence was cloned in the same open reading frame as the Gal4BD sequence, to generate the sequence of a Gal4BD-Rec104 fusion protein, which was put under the control of the constitutive ADH1 promoter. The resulting sequence is shown in Figure 12.
Figure 8 illustrates the fact that the presence of the GAL4BD- REC104 construct in yeast induces double stranded breaks at UAS sites, hence demonstrating that GAL4BD-REC104 could recruit Spoi l at these sites.
7.77. Deletion of the resident GAL4 gene increases the level of UAS- specific double-stranded breaks
The resident GAL4 sequence has been deleted from the yeast genome in which a GAL4BD-SP011 construct has been introduced. As compared with yeast still harbouring GAL4BD coding sequence, the number of DSBs induced at UAS sites was higher. This was probably due to the absence of competition at UAS sites between the Gal4BD-Spo11 protein and the resident Gal protein.
Example 2 : Targeted stimulation of meiotic recombination in plants
The cDNA encoding the AtSPO11-1 protein (Grelon, Vezon et al.
2001 ) has been amplified by PCR using the 2 oligonucleotides MG133 5' GAAACTCGGGATCCATGGAGGGAAAATTC 3' and MG134
5' GGAGACTCGCTCGAGGCTCAAGGAGA 3', cloned in pCR-Bluntll-Topo (In Vitrogen) and sequenced, leading to the plasmid pVeCM2. From pVeCM2, the cDNA has been recloned between the BamHI and Spe1 sites of pBluescript KS leading to the plasmid pVeCM12. The DNA fragment coding the Gal4 DNA binding domain (GAL4BD) has been amplified by PCR from the pAPI plasmid using the two oligonucleotides CM1 5' gaCTGCAgaaagagATGAAGCTACTGTCTTCTAT 3' and CM2 5' CGGGGCCTCCATGGCCATAAA 3'. This PCR fragment, corresponding to the ATG-A/col fragment of GAL4BD (455 bp), has been cloned in pCR- Bluntll-Topo leading to the plasmid pVeCM15 and sequenced. The Psf1- Ncol DNA fragment from pVeCM15 containing Gal4BD and in 5' of its ATG 8 bases corresponding to the -8 to -1 bases upstream the AtSP011-1 ATG and the Psf1 site (CTGCAgaaagagATG), has been cloned in pVeCM12 between Psf1 and Λ/co1 sites, leading to the plasmid pVeCM20. pVeCM20 contains a PsM site followed by -8 to -1 bases of AtSP011-1, the GAL4BD followed in fusion by the complete cDNA of AtSP011-1 (1089 bp). A fragment of the AtSP011-1 promoter (Gene bank AP000375) isolated by Mathilde Grelon has been amplified by PCR using the 2 oligonucleotides CM3 5' ccatctctttcTGCAGtcaaaactgaaaaatg 3' and CM4
5' ATGGGCCCgcctttgttttatctctcctcaccgta 3', cloned in pCR-Bluntll-Topo, leading to the plasmid pVeCM14, and sequenced. The Apa -Pst fragment from pVeCM14 containing the -1352 to -8 bases of the AtSP011-1 promoter has been cloned in pVeCM20 between Apa1 and Psfl , leading to the plasmid pVeCM22. Then the Apa1-βseR1 fragment containing the - 2266 to -1324 region of AtSP011-1 has been cloned in pVeCM20 between the Apa1 and SseR1 sites leading to the plasmid pVeCM25. The Apal- Spel fragment from pVeCM25 containing the construct AtSP011-1 promoter/ GAL4BD-AtSP011 -1 cDNA has been resequenced. An insertion of 11 nucleotides (CCCATCTCTTT) was present just in 5' of the Psf1 cloning site. The promoter hence corresponds to the -2266 to -1 bases of the At promoter, with an insertion of 11 nucleotides just in 5' of the Psf1 cloning site. The Apa1-Spe1 fragment from pVeCM25 has been cloned in pCambia 1380 (commercialized by Cambia, Australia), between the Apa1 and Spe1 sites leading to the plasmid pVeCM26. pVeCM26 has been introduced by transformation in the C58C1pMP90 Agrobacterium strain. This strain has been used to transform the DYK209 Arabidopsis thaliana line (Grelon et al., 2001) heterozygous for the Atspol 1-1-1 mutation. The transformed plants T1 have been selected in vitro on hygromycin, transferred to soil and analysed by PCR. One plant, AtpVeCM26.9, homozygous for the Atspol 1-1-1 mutation and containing the AtSP011-1 promoter.GAL4BD-AtSP011-1 cDNA transgene had some siliquas longer than the ones usually seen for a homozygous Atspol 1-1-1 plant. In the progeny of this AtpVeCM26.9 plant selected on hygromycin, transferred on soil and genotyped by PCR, 9 plants homozygous for the Atspol 1-1-1 mutation and containing the AtSP011-1 promoter: GAL4BD-AtSP011 -1 cDNA transgene had an average of 3,7 ± 0,7 seeds per silique which is approximately two times more than the number of seeds per siliqua detected in a plant homozygous for the Atspol 1-1-1 mutation (Grelon et al., 2001).
In order to avoid the 11 nucleotides-insertion that had been observed as described above, the PAtspou- GAL4BD - AtSPO11-1 construct was done again, using a different protocol, which led to the sequence shown in Figure 13. The transformation of Arabidopsis thaliana was then performed as described above. The stimulation of meiotic recombination is then determined by analysis of microsatellite markers that exist upstream and downstream of the natural targets for GAL4BD that exist in the Arabidopsis genome (more than 40 with the more stringent consensus sequence, and up to several hundreds with the most degenerated, i.e., only the 3 bp on each side of the UAS), in homozygous mutants and wild-type strains.
A cell line exhibiting two resistance gene as markers, separated by one GAL4BD recognition sequence, is also constructed, in order to study the crossing-over between these two markers.
Example 3: Induction of site-directed and/or increased meiotic recombination in mice
The Sycpl gene, coding for the murine synaptonemal complex, is expressed in both zygotene and pachytene phases of the meiosis (Sage, Martin et al. 1999). Therefore, it can be used to express a SP011 gene in meiosis early stages. The expression of the Gal4BD-mSpo11 fusion protein in early stage of meiosis has three advantages : it enables the targeting of meiotic recombination at new sites and help to follow-up the impact of initiating recombination on associated chromosome changes and on the mouse development. The Gal4BD-mSP011 chimerical DNA is placed under the control of the region upstream the Sycpl coding sequence or another promoter fragment functional in early meiosis, in a bacterial plasmid.
A sequence coding for a Gal4BD-mSpo11 fusion protein, wherein mSpo11 protein is the murine Spoi l protein, is constructed by placing the Gal4BD coding sequence in phase with the murine cDNA SP011 sequence described by Metzler-Guillemain C. and B. de Massy (2000). This can be done for example by using the following multistep cloning strategy : the Gal4BD fragment of pAP1 is amplified by PCR using primers APG4up (5'GAGATTAATTAAGGCCATATGAAGCTACTGTCTTCTATCGAA) and APG4LO (5ΑATCCTGTTAACAATGCTTTT), and cloned into the pGEM-T Easy (Promega) and sequenced, creating pAP15 containing a Λ/cfel site overlapping the ATG translation start site of the Gal4BD sequence. Next, pAP15 is cleaved by Pacl-Hpal and the fragment containing the 5' Gal4BD (Λ/del containing site) sequence is cloned into the pAP1 vector, cleaved by Pacl-Hpal to remove the pADH1 promoter, creating the plasmid pAP16.
Next, pA16 is cleaved by Pac\-Sac\ to remove the KanMX marker (G418 resistance), blunted and religated to create pAP17.
The BamH\-Pst\ fragment of pAP17 containing the S. cerevisiae Spoi l fragment is then substituted by the Bglll-Pstl fragment of pCMVβ (Clontech) containing a SV40 polyadenylation site to create plasmid pAP3.
Next, the EcoR\-Sal\ blunted-filled fragment of pTAg 0,8 containing the promoter of SyCPI, is blunted-filled and cloned into the EcoRI site of pAP3, creating pAP18.
The EcoRI fragment of plasmid pGEM-tSPOHs, containing the mouse SP011 cDNA, is then amplified by PCR with primers to add flanking Sf/'l and Xmal restriction sites and cloned into the pGEM-t Easy vector (Promega), creating plasmid pAP19 and sequenced.
Finally, the Sfi\-Xma\ fragment of pAP19, containing the pSycpl promoter (Taq\-EcoR\ fragment) followed by the Gal4BD fragment (EcoPI- Sf/'l), is fused to the mouse SP011 cDNA (Sfi\-Xma\ fragment) and terminated by the polyA fragment (Xma\-Pstl), creating a modular cassette for convenient exchange of the various components, carried by a vector allowing multiplication in bacteria.
This pGal4BD-mSpo11 plasmid is linearized and introduced by micro-injection in a mouse egg. Mice are then selected by genomic DNA analysis with a probe specific for the Sycpl 7Gal4BD-mSpo11 transgene. Independent Sycpl /Gal4BD-mSpo11 transgenic families are then established though cross breedings with normal and characterized mice.
The meiotic functionality of the transgene expresion is then determined in the wild-type and mutant mice inactivated for the mSPO11 gene (Baudat, Manova et al. 2000) by observation of the effect on the fertility of the animals and monitoring meiotic recombination frequencies between polymorphic markers in the progeny, the gametes or in a preparation of meiotic cells by Southern blot or PCR techniques, probing a chromosomal region containing a consensus recognition site for the Gal4 protein. This target site is either a natural or transgenic sequence carrying one or more copies of the GAL4 UAS motif.
Example 4 : improvement of homologous recombination in Drosophila
Drosophila offers many advantages as an experimental organism. However, in comparison with yeast and mouse, two other widely used eukaryotic model systems, Drosophila suffers from an inability to perform homologous recombination between introduced DNA and the corresponding chromosomal loci. The ability to specifically modify the genomes of yeast and mouse provides a quick an easy way to generate or rescue mutations in genes for which a DNA clone or sequence is available. Recently, Rong and Golic have developed a new technique for targeted homologous recombination, using the intron restriction enzyme l-Scel as an inductor of double strand break in linear molecules of DNA generated from flip recombinase excision of DNA (Rong and Golic 2000). In this way, they rescued yellow mutation (Rong and Golic 2000) and disrupted the pugilist gene and, more recently, the acZ, GC, pδ3 and CG1130δ genes. This knock out technique has very low efficiency, and the mutation is generated in two steps.
The Gal4BD-Spo11 fusion protein, described in Example 1 , can be used instead of l-Scel enzyme in order to develop a new approach to generate "knock outs" in Drosophila, and to improve the efficiency of the targeted homologous recombination. To this aim, the sequence coding for Gal4BD-Spo11 has been inserted in an expression vector for the Drosophila (P(Casper-hs), Pirrotta 1988). In this vector, the Gal4BD-Spo11 sequence is placed under the control of a heat shock promoter. Five different insertions of this transposable have been obtained in Drosophila.
The rescue of meiW68 sterility phenotype (McKim and Hayashi- Hagihara 1998) in Spoi l homologous Drosophila is tested, with the induction of Gal4-Spo11 during the developmental time where the gametes are generated.
The l-Scel recognition sequence over the yellow gene is replaced by UAS sequences, recognized by the GAL4 binding domain
(using P elements), and gal4-meiW68 strains are constructed. The Rong and Golic yellow rescue is repeated to compare efficiencies of the two methods.
To perform these experiments, the following plasmids are used :
- Expression vector : pCasper-hs (Pirrotta 1988)
- Heat shock promoter hsP70 (Pirrotta 1988)
- Targeted p(UAS) : y-donor (Rong and Golic 2000) modified by replacement of l-Scel site by UAS sequences (five)
The Drosophila strain used in these experiments is Canton- Special (CS) y1.
As described above, the methods to assay the effect of Gal4- Spo11 are the rescue of mei-W68 phenotype and the rescue of y1 (normal body color).
Example 5: Stimulation of meiotic recombination between poorly recombining chromosomes Efficient genetic recombination between homologous chromosomes requires the formation of an initiating lesion such as a DNA double-strand break formed by the Spoi l protein as exemplified in Example 1. Thus, chromosomes devoid of Spol 1 target sites will poorly recombine. The Gal4Bd-Spo11 fusion protein, described in Example 1 , can be used to stimulate the initiation of recombination at natural or artificially introduced Gal4 binding sites along any natural or artificial (YACs) chromosomes consisting of yeast or non-yeast DNA. Similarly, recombination might be stimulated between yeast linear plasmids with bacteriophage λ DNA backbones that poorly recombine.
Efficient genetic recombination also requires near-perfect homology between the participating molecules. According to their degree of divergence, homeologous chromosomes variably recombine in meiosis and as a consequence of the reduced level of crossing-over, gametes viability decreases and the proportion of aneuploid products increase consistently with defects in meiosis I or II non-disjunction of the homeologs. Homeologous chromosomes V of Saccharomyces cerevisiae and Saccharomyces carlbergensis virtually do not recombine in meiosis, but artificially created short regions of homology were found to induce meiotic crossing-over, probably by facilitation of heteroduplex intermediate formation initiated at adjacent sites. The Gal4BD-Spo11 fusion protein, described in Example 1 , can be used to stimulate the initiation of recombination at natural or artificially introduced Gal4 binding sites along any natural or artificial (YACs) chromosomes consisting of yeast or non- yeast homeologous DNA.
Example 6: Stimulation of homologous recombination in mitotic cells
High level of homologous recombination during meiosis is induced by the formation of Spol 1-High level of homologous recombination during meiosis by the formation of Spol 1 -dependent Double-strand breaks, that also require the expression of at least 14 other proteins (called DSB genes in Example 1). Some of them are only expressed upon the induction of meiosis. Taking advantage of the novel DNA binding property of the Gal4BD-SP011 fusion protein, that allow to bypass the requirement for the trans-acting factor that brings Spol 1 to its target sites, the attempt to obtain Spoi l -dependent DNA cleavage activity in mitotic cells is achieved by expressing the additional genes required for DSB formation in mitotic cells. This can be achieved by several approaches: heterologous expression of the individual genes and/or of cDNA genomic library behind a mitotically expressed promoter, or by a mutational change of the transcription factor(s) that repress their expression in mitotically growing cells.
REFERENCES
Alani, E., Padmore, R., and Kleckner, N. (1990). Analysis of wild-type and rad50 mutants of yeast suggests an intimate relationship between meiotic chromosome synapsis and recombination. Cell 61 , 419-436.
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Strul, K. eds. (1988). Current Protocols in Molecular Biology. (New York: John Wiley & Sons, Inc.).
Baudat, F., and Nicolas, A. (1997). Clustering of meiotic double-strand breaks on yeast chromosome III. Proc. Natl. Acad. Sci. U S A 94,
5213-5218.
Baudat, F. Madova, K., Yuen, J.P., Jasin, M., and Keeney, S. (2000) Chromosome synapsis defects and sexually dimporphic meiotic progression in mice lackin Spoi l . Molecular Cell, 6: 989-998. Bergerat, A., de Massy, B., Gadelle, D., Varoutas, P.C, Nicolas, A., and Forterre, P. (1997). An atypical topoisomerase II from Archaea with implications for meiotic recombination. Nature 386, 414-417.
Beretta, G.L., Binaschi, M., Zagni, E., Capuani, L., and Capranico, G. (1999). Tethering a type IB topoisomerase to a DNA site by enzyme fusion to a heterologous site-selective DNA-binding protein domain. Cancer Res. 59, 3689-3697.
Borde, V., Wu, T.C., and Lichten, M. (1999). Use of a recombination reporter insert to define meiotic recombination domains on chromosome III of Saccharomyces cerevisiae. Mol. Cell. Biol. 19, 4832-4842.
Diaz, R.L., Alcid, A.D., Berger, J.M., and Keeney, S. (2002). Identification of residues in yeast Spoi l p critical for meiotic DNA double-strand break formation. Mol. Cell. Biol. 22, 1106-1115. Esposito, M.S. and Esposito, R.E. (1969). "The genetic control of sporulation in saccharomyces. I. The isolation of temperature- sensitive sprorulation-deficient mutants" - Genetics, 61 :79-89.
Fromont-Racine, M., J. C. Rain, et al. (1997). "Toward a functional analysis of the yeast genome through exhaustive two- hybrid screens."
Nat Genet 16(3): 277-82.
Gerton, J.L., DeRisi, J., Shroff, R., Lichten, M., Brown, P.O., and Petes, T.D. (2000). Global mapping of meiotic recombination hotspots and coldspots in the yeast Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U S A 97, 11383-11390.
Grelon, M., D. Vezon, et al. (2001). "AtSP011-1 is necessary for efficient meiotic recombination in plants." Embo J 20(3): 589-600.
Guttmann-Raviv, N., E. Boger-Nadjar, et al. (2001). "Cdc28 and Ime2 possess redundant functions in promoting entry into premeiotic DNA replication in Saccharomyces cerevisiae." Genetics 159(4):
1547-1558.
Kane, S.M., and Roth, R. (1974). Carbohydrate metabolism during ascospore development in yeast. J. Bacteriol. 118, 8-14.
Keeney, S. (2001). "Mechanism and control of meiotic recombination initiation." Curr Top Dev Biol 52: 1 -53.
Huibregtse, J.M., Good, P.D., Marczynski, G.T., Jaehning, J.A., and Engelke, D.R. (1993). Gal4 protein binding is required but not sufficient for depression andinduction of GAL2 expression. J.Biol. Chem. 268:22219-22222. Keeney, S., Giroux, C.N., and Kleckner, N. (1997). Meiosis-specific DNA double-strand breaks are catalyzed by Spol 1 , a member of a widely conserved protein family. Cell 88, 375-384. Keeney, S. (2001 ). The mechanism and control of meiotic recombination initiation. Curr. Top. Dev. Biol. 52, 1-53.
Metzler-Guillemain, C. and B. de Massy (2000). "Identification and characterization of an SP011 homolog in the mouse." Chromosoma 109(1-2): 133-8.
McKim, K. S. and A. Hayashi-Hagihara (1998). "mei-W68 in Drosophila melanogaster encodes a Spoi l homolog: evidence that the mechanism for initiating meiotic recombination is conserved." Genes Dev 12(18): 2932-42. Ohta, K., Shibata, T., and Nicolas, A. (1994). Changes in chromatin structure at recombination initiation sites during yeast meiosis. EMBO J. 13, 5754-5763.
Pecina, A., K. N. Smith, et al. (2002). "Targeted stimulation of meiotic recombination." CeH 111 (2): 173-184. Petes, T.D. (2001 ). Meiotic recombination hot spots and cold spots. Nature Reviews 2, 360-369.
Pirrotta, V. (1988). "Vectors for P-mediated transformation in Drosophila." Biotechnology 10: 437-56.
Ren, B., Robert, F., Wyrick, J., Aparicio, O., Jennings, E., Simon, I., Zeitlinger, J., Schreiber, J., Hannett, N., Kanin, E.,Volkert, T.L.,
Wilson, C.J., Bell, S.P. and Young, R.A. (2000). Genome-wide location and function of DNA binding proteins. Science 290,
2306-2309.
Rong, Y. S. and K. G. Golic (2000). "Gene targeting by homologous recombination in Drosophila." Science 288(5473): 2013-8.
Sage, J., L. Martin, et al. (1999). "Temporal and spatial control of the Sycpl gene transcription in the mouse meiosis: regulatory elements active in the male are not sufficient for expression in the female gonad." Mech Dev 80(1): 29-39.
Sherman, A., Fink, G.R., and Hicks, J. (1983). Methods in Yeast Genetics (Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press).
Sikorski, R.S., and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.
Smith, J., M. Bibikova, et al. (2000). "Requirements for double-strand cleavage by chimeric restriction enzymes with zinc finger DNA- recognition domains." Nucleic Acids Res 28(17): 3361-3369.
Smith, K. N. and A. Nicolas (1998). "Recombination at work for meiosis." Curr Qpin Genet Dev 8(2): 200-211.
Smith, K.N., Penkner, A., Ohta, K., Klein, F., and Nicolas, A. (2001 ). B-type cyclins CLB5 and CLB6 control the initiation of recombination and synaptonemal complex formation in yeast meiosis. Curr. Biol. 11 , 88-97.
Vedel, M., and Nicolas, A. (1999). CYS3, a hotspot of meiotic recombination in Saccharomyces cerevisiae: effects of heterozygosity and mismatch repair functions on gene conversion and recombination intermediates. Genetics 151 ,
1245-1259.
Wach, A. (1996). PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in Saccharomyces cerevisiae. Yeast 12, 259-265.
Wu, T.-C, and Lichten, M. (1994). Meiosis-induced double-strand break sites determined by yeast chromatin structure. Science 263, 515- Wu, T.-C, and Lichten, M. (1995). Factors that affect the location and frequency of meiosis-induced double-strand breaks in Saccharomyces cerevisiae. Genetics 140, 55-66.

Claims

What we claim is :
1. A method for increasing recombination between homologous chromosomes in a dividing cell, comprising the steps of : (i) introducing into said cell, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spol 1 protein, and (ii) having the cell divide, so that the recombination between homologous chromosomes in said cell is increased.
2. The method of claim 1 , further comprising, before step (ii), a step of introducing into said cell's genome, a DNA sequence recognized by said DNA binding domain operably linked to a Spol 1 protein.
3. The method of claim 1 or 2, wherein the cell division performed in step (ii) is a meiosis.
4. The method of claim 3, wherein in step (i), the sequence of the fusion protein is under the control of a meiosis-specific promoter.
5. The method of claim 4, wherein said meiosis-specific promoter is the IME1 promoter or the REC8 promoter.
6. The method of any of claims 1 to 5, wherein said cell is an eukaryotic cell.
7. The method of claim 6, wherein said cell is selected from the group consisting of a fungus, a plant cell, a mammalian cell, and an insect cell.
8. The method of any of claims 1 to 7, wherein said cell comprises artificial chromosomes carrying one or more sequence(s) recognized by said DNA binding domain operably linked to the Spol 1 protein.
9. The method of any of claims 1 to 8, wherein the nucleic acid introduced into the cell in step (i) is stably integrated into the cell genome.
10. The method of any of claims 1 to 9, wherein said cell is a yeast and the nucleic acid introduced into it in step (i) encodes a Gal4BD-Spo11 fusion protein.
11. A method for performing a targeted recombination between two or more polymorphisms carried by a same chromosome in a cell, comprising the steps of :
(i) introducing into said cell, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said DNA binding domain recognizes a sequence situated between said two or more polymorphisms, and
(ii) having the cell divide, so that the recombination between said two or more polymorphisms in said cell occurs.
12. The method of claim 11 , further comprising before step (ii), a step of introducing into said cell's genome, between said two or more polymorphisms, a DNA sequence recognized by said DNA binding domain operably linked to a Spol 1 protein.
13. The method of claim 11 , wherein the cell division performed in step (ii) is a meiosis.
14. The method of claim 13, wherein in step (i), the sequence of the fusion protein is under the control of a meiosis-specific promoter.
15. The method of claim 14, wherein said meiosis-specific promoter is the IME1 promoter or the REC8 promoter.
16. The method of any of claims 11 to 15, wherein said cell is an eukaryotic cell.
17. The method of claim 16, wherein said cell is selected from the group consisting of a fungus, a plant cell, a mammalian cell, and an insect cell.
18. The method of any of claims 11 to 17, wherein said cell comprises artificial chromosomes carrying one or more sequence(s) recognized by said DNA binding domain operably linked to the Spol 1 protein.
19. The method of any of claims 11 to 18, wherein said cell is a fungus and the nucleic acid introduced into it in step (i) encodes a Gal4BD-Spo11 fusion protein.
20. A method for inducing a gene conversion in a cell, comprising the steps of:
(i) introducing into said cell, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said DNA binding domain recognises a sequence situated near a polymorphism; and (ii) having the cell divide, so that the gene conversion occurs.
21. A method for inducing meiotic recombination in artificial chromosomes in a cell, comprising the steps of :
(i) introducing into said cell, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said DNA binding domain recognizes one or more sequence(s) carried by said artificial chromosome, and (ii) having the cell divide, so that the meiotic recombination occurs between homologous artificial chromosomes.
22. The method of claim 21 , wherein said cell is a yeast, said artificial chromosome is a YAC having one or more sites with a CGGN-nCGG sequence, and said fusion protein is a Gal4BD-Spo11 fusion protein.
23. A method for generating variants of an organism, comprising the steps of :
(i) introducing into a cell of said organism, a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spol 1 protein, wherein said DNA binding domain recognizes one or more sequence(s) carried by said cell's genome;
(ii) having said cell perform a meiosis, so that meiotic recombination occurs between homologous chromosomes of said cell, at a higher rate and/or at different loci than in a natural meiosis of said organism; and (iii) generating variants of said organism with the cell obtained in step (ii).
24. The method of claim 23, wherein said organism is selected from the group consisting of a fungus, a plant, a mammal, and an insect.
25. The method of claim 23 or 24, further comprising a step of screening said variants for the presence of two or more characters.
26. A method according to any of claims 1 to 25, wherein in the fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, the Spol 1 moiety is replaced by a partner of Spol 1 capable of recruiting Spoi l .
27. The method of claim 26, wherein said partner is REC104.
28. A method for analysing the genome of an organism, comprising the steps of : (i) generating variants of said organism, by performing the method of any of claims 23 to 27;
(ii) performing a genetic analysis and a phenotypic analysis of certain characters of said variants; and (iii) analysing the genome of said organism.
29. A kit for performing the method of any of claims 1 to 28, containing a nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a Spol 1 protein, wherein said fusion protein is capable of inducing double strand breaks in formerly cold regions.
30. The kit of claim 29, wherein said Spol 1 has the sequence of a Spol 1 protein from a cell selected from the group of a fungus, a plant cell, a mammalian cell, and an insect cell.
31. The kit of claim 29 or 30, further comprising a nucleic acid carrying a target sequence recognized by said DNA binding domain operably linked to a Spol 1 protein.
32. The kit of any of claims 29 to 31 , wherein said nucleic acid is comprised in a vector.
33. The kit of claim 32, wherein said vector is a plasmid, a replicative DNA, a nucleic acid complexed with transfecting agents, a phage, or a virus.
34. A kit according to any of claims 29 to 33, wherein in the nucleic acid encoding a fusion protein, the spol 1 coding sequence is replaced by the coding sequence of a partner of Spol 1 capable of recruiting Spol 1.
35. The kit of claim 34, wherein said partner is REC104.
36. A eukaryotic cell expressing a fusion protein comprising a DNA binding domain operably linked to a Spoi l protein, wherein said fusion protein is capable of inducing double strand breaks in formerly cold regions of the genome of said eukaryotic cell.
37. The eukaryotic cell of claim 36, which is a fungus, a plant cell, a mammalian cell, or an insect cell.
38. A nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a AtSpol 1 protein from Arabidopsis thaliana.
39. A nucleic acid encoding a fusion protein comprising a DNA binding domain operably linked to a murine Spol 1 protein.
PCT/EP2003/008834 2002-07-19 2003-07-18 Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods Ceased WO2004016795A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2003255401A AU2003255401A1 (en) 2002-07-19 2003-07-18 Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods
DE60317676T DE60317676T2 (en) 2002-07-19 2003-07-18 METHOD FOR THE TARGETED STIMULATION OF MEIOTIC RECOMBINATION AND REAGENT SETS TO CARRY OUT THIS METHOD
EP03787756A EP1523564B1 (en) 2002-07-19 2003-07-18 Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods
CA2492932A CA2492932C (en) 2002-07-19 2003-07-18 Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods
JP2004528455A JP4439398B2 (en) 2002-07-19 2003-07-18 Method for inducing targeted stimulation of meiotic recombination and kit for performing said method
US11/037,295 US7279334B2 (en) 2003-07-18 2005-01-19 Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10/199,762 US7273758B2 (en) 2002-07-19 2002-07-19 Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods
US10/199,762 2002-07-19

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/037,295 Continuation US7279334B2 (en) 2003-07-18 2005-01-19 Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods

Publications (1)

Publication Number Publication Date
WO2004016795A1 true WO2004016795A1 (en) 2004-02-26

Family

ID=31714197

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/008834 Ceased WO2004016795A1 (en) 2002-07-19 2003-07-18 Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods

Country Status (8)

Country Link
US (1) US7273758B2 (en)
EP (1) EP1523564B1 (en)
JP (1) JP4439398B2 (en)
AU (1) AU2003255401A1 (en)
CA (1) CA2492932C (en)
DE (1) DE60317676T2 (en)
ES (1) ES2300642T3 (en)
WO (1) WO2004016795A1 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013038376A1 (en) 2011-09-16 2013-03-21 Institut National De La Recherche Agronomique Increase in meiotic recombination in plants by inhibiting the fancm protein
WO2015001521A1 (en) 2013-07-05 2015-01-08 Institut National De La Recherche Agronomique Method for inducing targeted meiotic recombination
WO2015001467A1 (en) 2013-07-03 2015-01-08 Institut National De La Recherche Agronomique Increased meiotic recombination in plants by inhibition of the fidg protein
WO2015181647A1 (en) 2014-05-30 2015-12-03 Institut National De La Recherche Agronomique Increase in meiotic recombination in plants by inhibiting an recq4 or top3a protein of the rtr complex
EP3150626A1 (en) 2015-10-01 2017-04-05 University of Vienna Means and methods for accelerated breeding by inducing targeted stimulation of meiotic recombination
EP3472315A4 (en) * 2016-06-20 2019-11-27 Dow Agrosciences LLC METHODOLOGIES AND COMPOSITIONS FOR CREATING TARGETED RECOMBINATION AND BREAKING THE LINK BETWEEN FEATURES
WO2023247773A1 (en) 2022-06-24 2023-12-28 Meiogenix Induction of meiotic recombination using a crispr system

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5751609B2 (en) * 2010-08-24 2015-07-22 株式会社豊田中央研究所 Method for producing cells with modified properties
FR2998898A1 (en) * 2012-11-30 2014-06-06 Inst Curie PROCESS FOR IMPROVING YEAST STRAINS
EP3798302A1 (en) * 2015-01-29 2021-03-31 Meiogenix Method for inducing targeted meiotic recombinations
FR3032203B1 (en) * 2015-01-29 2021-04-23 Inst Curie METHOD FOR INDUCING TARGET MEIOTIC RECOMBINATIONS
WO2019051503A2 (en) * 2017-09-11 2019-03-14 The Regents Of The University Of California Synthetic promoters useful for expression in plant cells
CN112226456B (en) * 2019-06-28 2022-08-05 中国水稻研究所 A method for realizing chromosomal site-directed genetic recombination
CN113549682B (en) * 2021-07-14 2023-03-31 天津大学 Detection method of mitosis recombination hot spot of yeast
JPWO2024122646A1 (en) 2022-12-08 2024-06-13

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002535995A (en) * 1999-02-03 2002-10-29 ザ チルドレンズ メディカル センター コーポレイション Gene repair involving induction of double-stranded DNA breaks at chromosomal target sites

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BIBIKOVA MARINA ET AL: "Targeted chromosomal cleavage and mutagenesis in drosophila using zinc-finger nucleases", GENETICS, vol. 161, no. 3, July 2002 (2002-07-01), pages 1169 - 1175, XP002261110, ISSN: 0016-6731 *
DIAZ ROBERT L ET AL: "Identification of residues in yeast Spo11p critical for meiotic DNA double-strand break formation", MOLECULAR AND CELLULAR BIOLOGY, vol. 22, no. 4, February 2002 (2002-02-01), pages 1106 - 1115, XP002261109, ISSN: 0270-7306 *
HARTUNG F ET AL: "Molecular characterization of homologues of both subunits A (SPO11) and B of the archaebacterial topoisomerase 6 in plants", GENE, ELSEVIER BIOMEDICAL PRESS. AMSTERDAM, NL, vol. 271, no. 1, 13 June 2001 (2001-06-13), pages 81 - 86, XP004245496, ISSN: 0378-1119 *
MALKOVA ANNA ET AL: "HO endonuclease-induced recombination in yeast meiosis resembles Spo11-induced events", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 97, no. 26, 19 December 2000 (2000-12-19), December 19, 2000, pages 14500 - 14505, XP002261111, ISSN: 0027-8424 *
PECINA ANA ET AL: "Targeted stimulation of meiotic recombination", CELL, vol. 111, no. 2, 18 October 2002 (2002-10-18), pages 173 - 184, XP002261112, ISSN: 0092-8674 *
UETZ P ET AL: "A COMPREHENSIVE ANALYSIS OF PROTEIN-PROTEIN INTERACTIONS IN SACCHAROMYCES CEREVISIAE", NATURE, MACMILLAN JOURNALS LTD. LONDON, GB, vol. 403, 10 February 2000 (2000-02-10), pages 623 - 627, XP000938868, ISSN: 0028-0836 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013038376A1 (en) 2011-09-16 2013-03-21 Institut National De La Recherche Agronomique Increase in meiotic recombination in plants by inhibiting the fancm protein
WO2015001467A1 (en) 2013-07-03 2015-01-08 Institut National De La Recherche Agronomique Increased meiotic recombination in plants by inhibition of the fidg protein
WO2015001521A1 (en) 2013-07-05 2015-01-08 Institut National De La Recherche Agronomique Method for inducing targeted meiotic recombination
WO2015181647A1 (en) 2014-05-30 2015-12-03 Institut National De La Recherche Agronomique Increase in meiotic recombination in plants by inhibiting an recq4 or top3a protein of the rtr complex
EP3150626A1 (en) 2015-10-01 2017-04-05 University of Vienna Means and methods for accelerated breeding by inducing targeted stimulation of meiotic recombination
EP3472315A4 (en) * 2016-06-20 2019-11-27 Dow Agrosciences LLC METHODOLOGIES AND COMPOSITIONS FOR CREATING TARGETED RECOMBINATION AND BREAKING THE LINK BETWEEN FEATURES
US12590313B2 (en) 2016-06-20 2026-03-31 Corteva Agriscience Llc Methodologies and compositions for creating targeted recombination and breaking linkage between traits
WO2023247773A1 (en) 2022-06-24 2023-12-28 Meiogenix Induction of meiotic recombination using a crispr system

Also Published As

Publication number Publication date
CA2492932C (en) 2013-08-20
AU2003255401A1 (en) 2004-03-03
DE60317676D1 (en) 2008-01-03
US20040033494A1 (en) 2004-02-19
JP4439398B2 (en) 2010-03-24
CA2492932A1 (en) 2004-02-26
EP1523564B1 (en) 2007-11-21
US7273758B2 (en) 2007-09-25
JP2005532823A (en) 2005-11-04
ES2300642T3 (en) 2008-06-16
DE60317676T2 (en) 2008-10-30
EP1523564A1 (en) 2005-04-20
AU2003255401A8 (en) 2004-03-03

Similar Documents

Publication Publication Date Title
Peciña et al. Targeted stimulation of meiotic recombination
Ross-Macdonald et al. Mutation of a meiosis-specific MutS homolog decreases crossing over but not mismatch correction
Sikorski et al. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Watt et al. Sgs1: A eukaryotic homolog of E. coil RecQ that interacts with topoisomerase II in vivo and is required for faithful chromosome segregation
Widner et al. Evidence that the SKI antiviral system of Saccharomyces cerevisiae acts by blocking expression of viral mRNA
de los Santos et al. Red1p, a MEK1-dependent phosphoprotein that physically interacts with Hop1p during meiosis in yeast
Xu et al. NDT80, a meiosis-specific gene required for exit from pachytene in Saccharomyces cerevisiae
Clark-Adams et al. The SPT6 gene is essential for growth and is required for δ-mediated transcription in Saccharomyces cerevisiae
CA2188950C (en) Functional expression of mammalian adenylyl cyclase in yeast
AU733007B2 (en) Methods and compositions for identifying receptor effectors
EP1523564B1 (en) Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods
Rhee et al. Structure and nuclear localization signal of the SK13 antiviral protein of Saccharomyces cerevisiae
Nandabalan et al. Mutations in U1 snRNA bypass the requirement for a cell type-specific RNA splicing factor
Jiang et al. Regulation of HIS4 expression by the Saccharomyces cerevisiae SIN4 transcriptional regulator.
Fleck et al. The swi4+ gene of Schizosaccharomyces pombe encodes a homologue of mismatch repair enzymes
Horecka et al. Cloning and characterization of the Saccharomyces cerevisiae LYS7 gene: evidence for function outside of lysine biosynthesis
Mosrin et al. The RPC31 gene of Saccharomyces cerevisiae encodes a subunit of RNA polymerase C (III) with an acidic tail
Gray et al. Isolation and analysis of the yeast TEA1 gene, which encodes a zinc cluster Ty enhancer-binding protein
Kobayashi et al. Structure and Functional Analysis of the Multistress Response GeneDDR2fromSaccharomyces cerevisiae
Soushko et al. An RNA‐binding protein homologue that promotes sporulation‐specific gene expression in Saccharomyces cerevisiae
Treich et al. Determination of lysine residues affinity labeled in the active site of yeast RNA polymerase II (B) by mutagenesis
CA2400534C (en) A dominant selectable marker for gene transformation and disruption in yeasts
US7279334B2 (en) Methods for inducing targeted stimulation of meiotic recombination and kits for performing said methods
Kominami et al. Characterization of the function of the NIN1 gene product of Saccharomyces cerevisiae
US5976866A (en) Screen for inhibitors of fungal IPC synthase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2492932

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 11037295

Country of ref document: US

Ref document number: 2004528455

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2003787756

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2003787756

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 2003787756

Country of ref document: EP