HEPATITIS C VIRUS ASSAYS
RELATED APPLICATIONS
This application claims the benefit under 35 U.S.C. Section 119(e) of U.S. Provisional Patent Application No. 60/402,661 filed August 12, 2002. FIELD OF THE INVENTION
The present invention includes assays useful for identifying inhibitors of Hepatitis C virus (HCV) activity. Particularly, the present invention includes a dual HCV assay useful for high throughput screening that quantifies both the amount of HCV RNA replication inhibitory activity associated with a test compound and the amount of cytotoxicity associated with the test compound. As such, an assay of the present invention permits the determination of both inhibitory activity associated with a test compound and selectivity of that test compound in a single well. The present invention also includes a reporter assay utilizing at least one enzyme associated with HCV RNA replication. The present invention also includes a cell line useful in assays of the present invention. BACKGROUND OF THE INVENTION
Hepatitis C virus (HCV) is the major etiological agent of 90% of all cases of non-A, non-B hepatitis (Dymock, B.W. Emerging Drugs 6:13-42 (2001)). The incidence of HCV infection is becoming an increasingly severe public health concern with 2-15% individuals infected worldwide. While primary infection with HCV is often asymptomatic, most HCV infections progress to a chronic state that can persist for decades. Of those with chronic HCV infections, it is believed that about 20-50% will eventually develop chronic liver disease (e.g. cirrhosis) and 20-30% of these cases will lead to liver failure or liver cancer. As the current HCV-infected
population ages, the morbidity and mortality associated with HCV are expected to triple.
Known treatments for HCV infection include the use of interferon- (IFN), which indirectly effects HCV infection by stimulating the host antiviral response. IFN treatment is largely ineffective, however, as a sustained antiviral response is produced in less than 30% of treated patients. Further, IFN treatment induces an array of side effects of varying severity in upwards of 90% of patients (e.g. acute pancreatitis, depression, retinopathy, thyroiditis). Therapy with a combination of IFN and ribavirin has provided a slightly higher sustained response rate, but has not alleviated the IFN-induced side effects.
One research area of active interest includes the development of antiviral agents which inactivate virally encoded protein products essential for HCV viral replication. Examples of such agents include various tripeptide compounds, which act as selective HCV NS3 serine protease inhibitors. However, many of these compounds do not sufficiently inhibit HCV protease activity or do not have sufficient potency, and thus, may not provide optimal treatment of HCV-infected patients. Accordingly, there is an ongoing need for the development of HCV assays for the identification of agents effective for inactivating viral replication proteins.
Known cell-based assays for screening compounds for HCV inhibitory activity rely upon the detection of viral RNA replication using RT-PCR (Ito et al., Hepatology 34(3):566-572 (2001); Bartenschlager R. and V. Lohman, Antiviral Res. 52(1): 1-17 (2001)). Such cell-based systems often yield variable results, making reproducibility a major problem and the use of such system for the screening of compounds impractical, particularly for use in high throughput screening (HTS).
HCV assays which rely on the inhibition of viral enzymes essential for viral replication and which may be suitable for HTS are known (Bianchi et al., Analytical Biochemistry 237, 239-244 (1996); Taliani et al., Analytical Biochemistry 240, 60-67 (1996)), but such assays measure only in vitro activity. Accordingly, there exists a need for an accurate and reproducible cell-based
HCV assays which permits the screening of compounds for HCV replication inhibitory activity. The present invention is directed towards such assays.
SUMMARY OF THE INVENTION The present invention includes a cell-based HCV assay which measures the inhibitory activity of compounds on HCV RNA replication. The present invention may include a dual assay useful for high throughput screening that quantifies both: (i) the amount of HCV RNA replication inhibitory activity associated with a test compound; and (ii) the amount of cytotoxicity associated with the test compound. Desirably, both steps are conducted in a single well. Assays of the present invention permit the determination of both the inhibitory activity as well as the selectivity of a test compound in a HTS.
In one aspect, the present invention includes an assay for identifying a compound that inhibits HCV RNA replication. The assay comprising the steps of: (a) providing a cell which expresses at least one enzyme associated with HCV RNA replication; (b) contacting the cell with a test compound; (c) determining whether the test compound inhibits HCV RNA replication; and (d) determining whether the test compound is cytotoxic to the cell. The cell expressing at least one enzyme associated with HCV RNA replication may include a HCV replicon which is a polynucleotide
having the nucleic acid sequence set forth in SEQ ID NO:l and encoding a polypeptide having the amino acid sequence set forth in SEQ ID NO:2. Further, the HCV replicon may be the molecular construct set forth in Figure 1. A cell useful in the present invention has the ATTC Accession No. PTA-4583. Both steps of an assay of the present invention are desirably conducted in a single well, or may be conducted in two or more wells. The enzyme associated with HCV RNA replication may be any enzyme associated with HCV RNA replication, and is desirably a protease, such as a serine protease. The serine protease is desirably NS3 protease. The protein may also be NS4A. The step of determining whether the test compound inhibits HCV RNA replication is desirably conducted by contacting the cell with a fluorescence substrate, and the step of determining whether the test compound is cytotoxic to the cell is desirably conducted by contacting the cell with an Alamar Blue solution.
The present invention also includes compounds and pharmaceutical compositions containing such compounds identified by the inventive assay. Further, the present invention includes a method for treating hepatitis-C by administering to a mammalian species in need thereof a therapeutically effective amount of such a compound.
In another aspect, the present invention includes an assay for identifying a compound that inhibits HCV RNA replication, which comprises the steps of: (a) providing a cell which expresses at least one enzyme associated with HCV RNA replication; (b) contacting the cell with a test compound; (c) contacting the cell with a compound which permits the determination of whether the test compound inhibits HCV RNA replication; and (d) contacting the cell with an indicator solution which
permits the determination of whether the test compound is cytotoxic to the cell. The compound which permits the determination of whether the test compound inhibits HCV RNA replication is desirably a FRET peptide, and the indicator solution which permits the determination of whether the test compound is cytotoxic to the cell is desirably an Alamar Blue solution.
In another aspect, the present invention includes an assay for identifying a compound that inhibits HCV RNA replication. The assay comprises the steps of: (a) providing a cell which expresses at least one enzyme associated with HCV RNA replication, the cell comprising a HCV replicon; (b) contacting the cell with a test compound; (c) contacting the cell with a FRET peptide for determining whether the test compound inhibits HCV RNA replication; and (d) contacting the cell with an indicator solution for determining whether the test compound is cytotoxic to the cell.
In another aspect, the present invention includes a reporter assay for identifying a compound that modulates that activity of a gene of interest. The reporter assay, comprises the steps of: (a) providing an expression system, the expression system comprising (i) a cell and (ii) a construct comprising a promoter region associated with said gene of interest operably linked to an enzyme associated with HCV RNA replication; (b) contacting the expression system with a test compound; and (c) contacting the expression system with a compound capable of detecting expression of the enzyme associated with HCV RNA replication. The enzyme associated with HCV RNA replication is desirably NS3 protease, and the compound capable of detecting expression of the enzyme associated with HCV RNA replication is desirably a FRET peptide.
In another aspect, the present invention includes a cell having ATCC Accession No. PTA-4583.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the molecular construct of the HCV Replicon used in an assay of the present invention.
Figure 2 shows the nucleic acid sequence of the HCV Replicon used in an assay of the present invention.
Figure 3 shows the amino acid sequence of the HCV Replicon used in an assay of the present invention.
Figure 4 shows the 96-well layout used in an assay of the present invention. Figure 5 shows the results of Interferon Titration in the HCV Replicon cell line used in an assay of the present invention.
Figure 6A shows an EC50 comparison of typical values determined by FRET, RT-PCR or Western analysis for titration of interferon in the HCV replicon cell line. Figure 6B shows a Western immunoblot using an anti-NS3 protease serum for the determination of EC50 of -CFN-α.
Figure 7A shows the enzyme activity in each well after contact with test compounds. Figure 7B shows the cytotoxicity activity in each well after contact with test compounds.
Figure 8 shows a graphical representation of the variation within an assay of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
The present invention includes a cell-based HCV assay for measuring the ability of compounds to inhibit HCV RNA replication. An assay of the present invention desirably include a first cytotoxicity assay step which measures the conversion of an indicator solution to a fluorescent product, to determine if a test compound is cytotoxic to a cell; and a second inhibition assay step, to determine if the test compound inhibits HCV RNA replication. Desirably, an assay of the present invention includes the use of cells transfected with a HCV replicon.
The ability of the HCV replicon to replicate is highly dependent on the amounts or activity of host cell factors. Therefore, any slight toxicity may have significant effects on viral protein expression and ultimately on any assay which examines the effect of compounds on HCV replication. As such, the use of an indicator to assess cytotoxicity in an HCV replicon cell line in an assay of the present invention provides a significant advantage in the ability to address the issue of whether HCV inhibition is due to a specific compound-virus interaction or due to a subtle but toxic effect on the cellular replication machinery.
Accordingly, the present invention includes a dual assay useful for HTS that quantifies both the amount of HCV RNA replication inhibitory activity associated with a test compound, and the amount of cytotoxicity associated with that test compound. The dual assay is desirably conducted in a single well. Assays of the present invention permit for the mass screening of compounds specifically directed towards HCV replication, and permit viral RNA as well as viral proteins to be produced at levels consistently detectable using standard immunological and molecular biology methods. These consistent levels are amendable for HTS of
compounds specific for the HCV replicon since effects either toxic to the cell or specific to the replicon can be differentiated and quantitated.
In an assay of the present invention, a first cytotoxicity assay step measures the conversion of an Alamar Blue solution to a fluorescent product while a second inhibition assay step that uses a fluorescence resonance energy transfer (FRET) protease substrate specifically measures the amount of HCV NS3 protease activity present and relates that activity to HCV RNA amounts. The first cytotoxicity assay step permits the determination of selectivity of the test compound under consideration for the cells in the assay. The use of Alamar Blue solution permits the assay steps to be ran in the same well, as the Alamar Blue solution is non-lethal to the cells. An assay of the present invention has been validated and compared with quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) and western blot analysis using interferon- , a known HCV inhibitor. An assay of the present invention yielded fifty-percent effective concentration (EC50) values of 1.9, 2.9 and 5.3 units for the western, FRET and qRT-PCR assays, respectively. Assays of the present invention are amenable for HTS to identify compounds which inhibit HCV RNA replication, providing a convenient and economical assay comparable to qRT-PCR.
HCV is a plus (+) strand RNA virus which is well characterized, having a length of approximately 9.6kb and a single, long open reading frame (ORF) encoding an approximately 3000-amino acid polyprotein (Lohman et al., Science 285: 110-113 (1999), expressly incorporated by reference in its entirety). The ORF is flanked at the 5' end by a nontranslated region that functions as an internal ribosome entry site (IRES) and at the 3' end by a highly conserved sequence essential for genome
replication (Lohman, supra). The structural proteins are in the NH2-terminal region of the polyprotein and the nonstructural proteins (NS) 2 to 5B in the remainder.
In an assay of the present invention, a HCV replicon was used in a cell culture system and was made as set forth below in Materials and Methods. The HCV replicon was based on a full-length consensus genome cloned from viral RNA isolated from an infected human liver. As shown in the molecular construct set forth in Figure 1, a HCV replicon useful in an assay of the present invention includes a neomycin (neo) selectable marker protein translated from the native HCV internal ribosome entry site (IRES) element and non-structural proteins translated by the IRES from encephalomyocarditis virus (Lohman, supra). The known viral specific enzymatic activities provided by the replicon include the protease (NS3) and activator of the protease (NS4A), helicase (NS3), ATPase (NS3) and RNA dependent RNA polymersase (NS5B). Expression of neo is solely dependent on active HCV RNA replication in cells, and the viral gene products NS3 to NS5B are believed to be essential for HCV RNA replication and are the primary targets for inhibitor identification. For purposes of the present invention, viral gene products which are "associated" with HCV RNA replication include any and all viral gene products believed to be essential for HCV RNA replication.
Methods used to quantitate HCV can be applied to the replicon and include quantitative RT-PCR (qRT-PCR) for RNA levels and immunological methods for proteins such as ELISA (Rodriguez-Lopez et. al., J. Gen. Virol. 80:727-738 (1999), expressly incorporated by reference in its entirety) or Western analysis (Pietschmann et al., J. Virol. 75:1253-1264 (2001), expressly incorporated by reference in its entirety).
An assay of the present invention consists of two parts. The first part is a cytotoxicity assay step which quantitates the amount of cytotoxicity associated with a test compound, as determined by the conversion of Alamar Blue dye. The second part is an inhibition assay step which quantitates the amount of NS3 protease activity associated with the test compound. Both measurements are then compared relative to control wells. This method provides a measure of cytotoxicity for each well and an indirect measure of HCV RNA levels. Inhibition of HCV RNA replication is expected to reduce the amount of viral proteins present, including NS3 protease. As such, inhibitory activity of test compounds on HCV RNA replication is indirectly measured by quantitating NS3 protease levels using a FRET assay. The results obtained with the FRET assay have been shown to be comparable to those obtained from qRT-PCR.
The following section sets forth materials and methods used in the present invention, and which were utilized in the Example set forth hereinbelow.
Materials and Methods 1. HCV Replicon Cell Line Preparation
The HCV replicon cell line was isolated from colonies as described by Lohman et al. al. (Lohman, supra) and used for all experiments. The HCV replicon has the nucleic acid sequence set forth in Figure 2 (EMBL Accession No.: AJ242652; SEQ ID NO:l), the coding sequence of which is from 1801nt-7758nt. The coding sequence encodes the polypeptide having the sequence set forth in Figure 3 (SEQ ID NO:2).
The cell line used in the present invention has been deposited as ATCC Accession No. PTA-4583 in the American Type Culture Collection, 10801 University Boulevard, Manassas, Va. 20110-2209 U.S.A. under the terms of the Budapest Treaty on the International Recognition of Deposits of Microorganisms for Purposes of Patent Procedure and the Regulations promulgated under this Treaty. Samples of the deposited material are and will be available to industrial property offices and other persons legally entitled to receive them under the terms of the Treaty and Regulations and otherwise in compliance with the patent laws and regulations of the United States of America and all other nations or international organizations in which this application, or an application claiming priority of this application, is filed or in which any patent granted on any such application is granted.
The coding sequence of the published HCV replicon was synthesized by Operon Technologies, Inc. (Alameda, CA), and the full-length replicon was then assembled in plasmid pGem9zf(+) (Promega) using standard molecular biology techniques. The replicon consists of (i) the HCV 5' UTR fused to the first 12 amino acids of the capsid protein, (ii) the neomycin phosphotransferase gene (neo), (iii) the IRES from encephalomyocarditis virus (EMCV), and (iv) HCV NS3 to NS5B genes and the HCV3' UTR. Plasmid DNAs were linearized with Seal and RNA transcripts were synthesized in vitro using the T7 MegaScript transcription kit (Ambion) according to manufacturer's directions.
To generate cell lines, 4 x 106 Huh-7 cells (kindly provided by R. Bartenschlager and available from Health Science Research Resources Bank, Japan Health Sciences Foundation) were electroporated (GenePulser System, Bio-Rad) with 10 ug of RNA transcript and plated into 100-mm dishes. After 24h, selective media
containing 1.0 mg/ml G418 was added and media was changed every 3 to 5 days. Approximately 4 weeks after electroporation, small colonies were visible which were isolated and expanded for further analysis. These cell lines were maintained at 37°C, 5% CO2, 100% relative humidity in DMEM (Life Technologies #11965-084) with 10% heat inactivated calf serum (Sigma #F-2442), 100 U/ml of penicillin/streptomycin (Life Technologies #15140-122), Geneticin at 1 mg/ml (Life Technologies #10131-027). One of the cell lines which had approximately 3,000 copies of HCV replicon RNA/cell was used for development of the assay.
Other HCV replicons, as well as different genotypes, are suitable for use in assays of the present invention, and it is to be understood that assays of the present invention are not limited to any particular HCV replicon or cell line created therefrom. For example, in addition to the HCV replicon described above, HCV replicons suitable for use in assays of the present invention include, but are not limited to, those available from Apath, LLC. Also, it is understood that modifications of such HCV replicons may be made such that the replicon is useful in assays of the present invention.
2. RNA Detection
HCV RNA detection was conducted using RT-PCR, according to the manufacturer' s instructions, using a Gibco-BRL Platinum Quantitative RT-PCR Thermoscript One-Step Kit on a Perkin-Elmer ABI Prism Model 7700 sequence detector. The primers for TaqMan were selected for use following analysis of RNA sequences with Primer Express Software from ABI. Primers used for detection of the plus strand RNA were 13 IF - 5' GGGAGAGCCATAGTGGTCTGC 3' (SEQ -D
NO:3) and 231R - 5' CCCAAATCTCCAGGCATTGA 3' (SEQ ID NO:4) which amplify the HCV 5'UTR from nucleotides 131 to 231. The probe used for detection, 5' FAM-CGGAATTGCCAGGACGACCGG-BHQ1 3' (SEQ ID NO:5) was obtained from Biosearch Technologies. RNA's were purified from 96- wells using the RNAeasy 96 kit from Qiagen.
3. Western Analysis
Experiments were done in duplicate. Western analysis was performed according to the instructions for Amershams Chemiluminescence Immunology Kit (NEL105 Renaissance) using a Molecular Dynamics Storm 860 phosphoimager and associated software. The primary and secondary antibody dilutions were at 1 to 5,000. Antisera was generated by immunizing rabbits with purified NS3 protease made from an E. Coli expression vector encoding the first 181 amino acids of HCV la NS3 with subsequent boosts. Bleeds were tested weekly and boosts continued until a positive signal on a control western was seen. Secondary antibody was a BioRad (#170-6515) Goat anti- Rabbit IgG HRP Conjugate. The protein samples for western analysis were from the same wells used for the FRET assay and were prepared by the addition of an equal volume of 2X SDS-PAGE buffer to the FRET assay mixture, heating and loading on a
10% gel for SDS-PAGE. Interferon alpha (IFN-α) was obtained from Sigma (#1-
4276) and stored as recommended.
4. FRET Assay Preparation
To perform the HCV FRET screening assay, 96-well cell culture plates were used. The FRET peptide (Anaspec, Inc.) (Taliani et al., Anal. Biochem. 240:60-67 (1996), expressly incorporated by reference in its entirety) contains a fluorescence donor, EDANS, near one end of the peptide and an acceptor, DABCYL, near the other end. The fluorescence of the peptide is quenched by intramolecular resonance energy transfer (RET) between the donor and the acceptor, but as the NS3 protease cleaves the peptide the products are released from RET quenching and the fluorescence of the donor becomes apparent. The assay reagent was made as follows: 5X cell Luciferase cell culture lysis reagent from Promega (#E153A) diluted to IX with dH2O, NaCl added to 150 mM final, the FRET peptide diluted to 20 uM final from a 2 mM stock. Cells were trypsinized, placed into each well of a 96-well plate and allowed to attach overnight. The next day, the test compounds were added to columns 1 through 10; column 11 was media only, and column 12 contained a titration of interferon as a control
(lOOOunits for A12, B12, lOOunits for C12, D12, lOunits for E12, F12 and lunit for G12, H12). In addition, replicon cells in A12, B12 can be replaced, if desired, with naϊve Huh-7 cells as a negative background control. The plates were then placed back in the incubator. Figure 4 shows the layout for HTS of the replicon cell line in a 96- well plate. In Figure 4, labels are as followed: "Screen" denotes wells with test compound; "1-HCV" denotes control replicon wells (100% activity), "Inhibited" denotes wells containing the highest amount of control inhibitor (100% inhibition), and was used to determine background for each plate; "Titration" denotes the titration
of interferon, and was used as a sensitivity control. Units of interferon from the top of row 12 in duplicate are 1000, 100, 10, and 1.
5. FRET Assay and Cytotoxicity Assay Steps Subsequent to addition of the test compounds described above (FRET Assay
Preparation), at various times the plate was removed and Alamar Blue solution (Trek Diagnostics, #00-100) was added per well as a measure of cellular toxicity. After reading in a Cytoflour 4000 instrument (PE Biosystems), plates were rinsed with PBS and then used for FRET assay by the addition of 30 ul of the FRET peptide assay reagent described above (FRET Assay Preparation) per well. The plate was then placed into the Cytoflour 4000 instrument which had been set to 340 excite/490 emission, automatic mode for 20 cycles and the plate read in a kinetic mode. Typically, the signal to noise using an endpoint analysis after the reads was at least three-fold. Compound analysis was determined by quantification of the relative HCV replicon inhibition and the relative cytotoxicity values. To calculate cy toxicity values, the average Alamar Blue fluorescence signals from the control wells in row 11 (Figure 4) were set as 100% non-toxic. The individual signals in each of the compound test wells were then divided by the average control signal and multiplied by 100% to determine percent cytotoxicity. To calculate the HCV replicon inhibition values, an average background value FRET signal was obtained from the two wells containing the highest amount of interferon at the end of the assay period. These numbers were similar to those obtained from naϊve Huh-7 cells.
The background numbers were then subtracted from the average FRET signal obtained from the control wells in row 11 (Figure 4) and this number was used as 100% activity. The individual signals in each of the compound test wells were then divided by the averaged control values after background subtraction and multiplied by 100% to determine percent activity. EC50 values for an interferon titration were calculated as the concentration which caused a 50% reduction in HCV RNA, HCV protein amounts or FRET activity. The two numbers generated for the compound plate, percent cytoxicity and percent activity were used to determine compounds of interest for further analysis.
6. Calculation of Assay Variation
The following formula was used to calculate the variation in the FRET assay. Z' is a measure of the distance between the standard deviations for the signal versus the noise of the assay:
Z' = l-((3*asds + 3*asdb) / (as-ab))
Asds = standard deviation of the signal Asdb = standard deviation of the background As = average signal
Ab = average background signal (Zhang et al., J. Biomolecular Screening (4) 2:67-73 (1999), expressly incorporated by reference in its entirety).
Example
An assay of the present invention was prepared and conducted in the manner set forth above in Materials and Methods. The HTS assay was designed to indirectly measure RNA levels through the use of a specific NS3 protease fluorescence substrate which yields a fluorescent signal upon cleavage. To ensure that the NS3 protease substrate could only be cleaved by the NS3 protease and not by any cellular proteases present in the replicon cell lysates, the substrate was added to individual wells containing crude lysates made from either naive Huh-7 cells, HepG-2 cells or HeLa cells. The substrate was found to only yield a substantial increase in fluorescence in cells containing either the HCV replicon or in cells expressing the NS3 enzyme, indicating that the assay was specific for HCV protease.
Prior to the FRET assay step, a solution of Alamar Blue was added to the same plates in a cytotoxicity assay step, allowing direct quantification of the level of toxicity in that well. Only compounds which show no apparent toxicity but significantly decrease the amount of NS3 protease activity were further analyzed for HCV inhibitory activity.
In order to validate the FRET assay for HTS, the relationship between viral RNA levels and the amount of NS3 activity present was quantitated. One consideration of using the NS3 protease as a general indicator of RNA levels is that the ttølife of the RNA compared to the protein may be substantially different (Lohman, supra). This could result in a substantial drop in RNA levels rather quickly compared to protein amounts. To compensate for this difference, the cells were exposed to interferon alpha (IFN-α), a known HCV inhibitor (Lauer GM. and B.D.
Walker, N. Engl. J. Med. 345(l):41-52 (2001); Blight et al., Science. 290:1972-1974
(2000); Collier J. and R. Chapman, BioDrugs. 15(4):225-238 (2001), each of which is expressly incorporated by reference in its entirety), for a period of days, allowing the cells to magnify the effect and let the amount of NS3 present decrease relative to controls. The validation of the assay was accomplished by the use of quantitative RT-
PCR (qRT-PCR) for viral RNA levels, quantification of the amount of NS3 present by scanning of a Western blot for protein levels and measurement of NS3 protease activity using the FRET assay. The samples for these measurements were from 2 plates prepared the same day and treated at the same time with a titration of IFN-α. One plate was used for preparation of RNA for quantitative RT-PCR while the other plate was used for FRET. Samples from the same wells after the FRET assay were used for Western analysis. Compound plates were then used to ensure that the procedure was applicable under conditions of HTS.
The results of a FRET assay with IFN-α titration following 96 hours of incubation are shown in Figure 5 as a continuous kinetic graph. Figure 5 shows the measurement of the increase in fluorescence of the HCV FRET peptide in the HCV cell line and the effect of exposure to various interferon concentrations. The units per ml of IFN-α used for the different wells are listed to the right of the pertinent graphs. The assay is linear over a period of 40 minutes. As seen in Figure 5, in the absence of IFN-α, the FRET signal is increased with time and is linear for at least 30 minutes. A decrease in the rate of FRET activity is clearly evident in the graph with increasing IFN-α concentration. The titration was from 0.1 units to 1,000 units per milliliter
with control wells containing IFN-α dilution buffer only.
Calculations involved subtracting the final background fluorescence signal while using the control wells as 100% activity. These numbers from the linear range
are required for determination of the IFN-α EC50. Similarly, RNA levels were
measured by qRT-PCR while the amount of NS3 protein present in each well was quantitated by scanning a Western immunoblot. An EC50 was determined for all three methods by normalizing to the controls for each measurement. Figure 6A shows a comparison of typical values determined by FRET, RT-PCR or scanning of a western blot for titration of interferon in the HCV replicon cell line, and also shows values for quantification of NS3 protease specific bands (Figure 6B) by phosphorimaging. Each value in Figure 6A represents a well of a 96-well plate at a single interferon concentration relative to a control value. Data at the lowest concentration of interferon tended to contain more variation. Figure 6B shows the Western immunoblot using an anti-NS3 protease serum for the determination of EC50 of IFN-
α.
The results shown in Figure 6A indicate EC50 values (in units of IFN-α per milliliter) of 1.9 for the Western, 2.9 for the FRET and 5.3 for RT-PCR. These values are within 3-fold of one another and indicate equivalency between the assay methods. This demonstrates the utility of the FRET assay method for inhibitor titration in an assay of the present invention and provides a comparison of a HTS format to the conventional qRT-PCR method of HCV quantification.
A random compound plate was used in a method test of both the Alamar Blue assay and the FRET HCV replicon assay steps. The results are presented in Figures 7A and 7B for both the FRET and Alamar Blue assay as diagrammed in Figure 4. Figure 7A shows the percentage of activity in each well following FRET readings and
performing the calculations described above for the endpoint reading from cycle 21 of the FRET assay. In Figure 7A, lower numbers represent less activity present and indicate that the HCV replicon is inhibited. Wells F2 and G5 (underlined and enlarged) indicate that the compounds present in these wells inhibited the HCV replicon approximately 73% and 99% respectively.
Figure 7B shows Alamar Blue readings from the random compound plate expressed as a measure of cytoxicity. Wells corresponding to F2 and G5 (underlined and enlarged) indicate that compound present in F2 shows very little toxicity while compound in G5 has substantial toxicity. Comparing the results of the FRET assay with the Alamar assay it is likely that the inhibition of the HCV replicon for G5 is due to a toxic mechanism while the inhibition due to compound in F2 is not toxic in this assay, suggesting the compound may be specific for HCV.
In general, the majority of compounds did not cause a significant variation in either the FRET or Alamar Blue assay indicating acceptable results amenable to HTS. The FRET activity yielded a 12.7% standard deviation in wells containing control media (Figure 7A, column 11). In the IFN-α control samples, a clear inhibition was observed, the EC50 was close to or slightly lower than the lowest concentration of IFN-α used (Figure 7A, column 11). The Alamar Blue measurements in this plate yielded a variation of 4% for the cytotoxicity measurements in wells containing control media (Figure 7B, column 11). Approximately 18% cytotoxicity was
observed in the wells with the highest concentration of IFN-α (1000 units, Figure 7B, columns A12 and B 12), but no apparent Alamar Blue staining change was seen at lower concentrations of IFN-α. In the compound test area, two compounds showed a
noticeable reduction in FRET activity, down to 27% and 1% detectable activity, respectively, of the control level (Figure 7 A, columns F2 and G5).
Inspection of the numbers and comparison of Figures 7A and 7B indicate a toxic compound is present in well G5 due to the decrease in FRET activity along with a corresponding decrease for the Alamar assay. Well F2, however, was seen to have a noticeable decrease in FRET activity without a corresponding decrease in the Alamar Blue measurement, indicating HCV replicon inhibition without measurable toxicity for this compound. Therefore, this compound was chosen for further evaluation.
To confirm that the variation in the FRET assay would remain acceptable, 40 additional compound plates were used to quantitate the variation using a statistical analysis to measure the Z' statistic (Materials and Methods). The Z' statistic is a measure of the distance between the standard deviations for the signal versus the noise of the assay. This analysis was used since the signal to noise in the assay was usually only 3-fold which is less than the Alamar signal to noise of approximately 8- fold indicating less tolerance for variation in the assay. An assay is considered acceptable if the Z' statistic is 0.5 or greater indicating acceptable signal to noise scatter in the plates.
Forty plates were used to measure the standard deviations and the number distribution between the endpoint signal obtained for the controls and the signal obtained for the background. Figure 8 shows a graphical representation of the averaged numbers from 40 separate compound plates used in the Z' calculation. The numbers at a signal of approximately 500 are the readings from the wells containing 1000 units of interferon and are considered to have 0% FRET activity. The numbers at a signal of approximately 1500 are from wells containing buffer only and are
considered as 100% FRET activity. The Z' measurement calculates the distance as a fraction between the two number distributions in terms of the means of those distributions.
Using this calculation, a Z' of 0.62 was obtained indicating a plate to plate variation acceptable for HTS. In addition, this measurement can be used on individual plates to determine if the controls were acceptable validating the data for a particular plate.
Discussion
Assays of the present invention may be conducted in a 96-well format, as
demonstrated by the dose response curve generated by IFN-α and yields results
comparable to qRT-PCR, and are amenable to an even greater degree of miniaturization, such as a 384 or smaller based cell culture assay.
As illustrated in Figures 7 A and 7B, assays of the present invention are capable of measuring toxicity associated with a test compound as well as inhibitory activity associated with the test compound in the same well, thereby providing a method to prioritize compounds according to their inhibitory profile versus HCV as well as according to their toxicity profile. The variation associated with such assays is also statistically acceptable, as illustrated in Figure 8. The cytotoxicity assay reagents, such as Alamar Blue, are desirably easily removed and are not deleterious to the cells.
Assays of the present invention have distinct advantages when compared to qRT-PCR or other methods in that assays of the present invention may take place in- situ in a detergent based crude cell lysate, which requires no further preparation prior to performing the assays. Assays of the present invention do not involve numerous
manipulations to add or subtract reagents after addition of test compounds, and are desirably based on a viral protein which is required by the HCV replicon for replication. The FRET protease substrate peptide, which is resistant to cleavage by endogenous Huh-7 cellular proteases over the assay time period, is efficiently recognized by the replicon-based NS3 enzyme. Given that the original purpose of the substrate was to monitor the in-vitro cleavage (Taliani, supra) of this substrate by purified rather than crude enzyme, it is probable that the substrate can still be cleaved by the many different genotypes of HCV NS3, thereby providing greater utility.
The present invention also includes reporter assays. Reporter assays of the present invention include the use of a HCV protease and FRET peptide combination. The FRET substrate is relatively resistant to Huh-7, HeLa and HepG2 cellular proteases, indicating that it is very specific for HCV protease and therefore likely resistant to cellular proteases in other cell types. Placement of the HCV NS3 protease in a mammalian or bacterial expression system, or in the context of other viruses, allows the FRET assay to provide a sensitive method to use the viral protein in a wider cell repertoire. Such a reporter system is useful in a similar manner to known luciferase/beta-galactosidase systems, and are useful for the measurement of protein production, promoter strength, cell viability or other combinations. Adaptation of this method o assay is also possible with other viral proteases, provided a suitable and specific assay substrate is synthesized. The present invention also includes a cell line having ATCC Accession No. PTA-4583.
While the invention has been described in connection with specific embodiments therefore, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the
invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims. All references cited herein are expressly incorporated in their entirety.