WO2004001027A1 - Oligonucleotide inhibitors of mbd2/dna demethylase and uses thereof - Google Patents

Oligonucleotide inhibitors of mbd2/dna demethylase and uses thereof Download PDF

Info

Publication number
WO2004001027A1
WO2004001027A1 PCT/CA2003/000884 CA0300884W WO2004001027A1 WO 2004001027 A1 WO2004001027 A1 WO 2004001027A1 CA 0300884 W CA0300884 W CA 0300884W WO 2004001027 A1 WO2004001027 A1 WO 2004001027A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
ofthe
mbd2
oligonucleotide inhibitor
cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2003/000884
Other languages
French (fr)
Other versions
WO2004001027A8 (en
Inventor
Moshe Szyf
Paul Campbell
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
McGill University
Original Assignee
McGill University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by McGill University filed Critical McGill University
Priority to CA 2530108 priority Critical patent/CA2530108A1/en
Priority to US10/518,470 priority patent/US7465714B2/en
Priority to AU2003243859A priority patent/AU2003243859A1/en
Publication of WO2004001027A1 publication Critical patent/WO2004001027A1/en
Publication of WO2004001027A8 publication Critical patent/WO2004001027A8/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809Methods for determination or identification of nucleic acids involving differential detection
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/317Chemical structure of the backbone with an inverted bond, e.g. a cap structure
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/345Spatial arrangement of the modifications having at least two different backbone modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/142Toxicological screening, e.g. expression profiles which identify toxicity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention pertains to the fields of cancer therapy and in particular, to oligonucleotide inhibitors of MBD2/dMTase and their use in the treatment of cancer.
  • the epigenome is the physiological template ofthe genetic information in all eukaryotic cells [Jenuwein, T. and Allis, CD. (2001) Science 293:1074-1080].
  • the epigenome formats the genetic information by either presenting an accessible structure that can be expressed or by forming an inaccessible structure that cannot be accessed and thus is silenced.
  • the epigenome comprises two major components: a group of proteins called histones that package the DNA into either accessible or inaccessible formats called chromatin, and a coating of methyl groups that are covalently bound to the DNA molecule itself.
  • a long line of data has established that aberrations ofthe epigenome are a hallmark of all tumour cells, with one ofthe clear aberrations being global hypomethylation of DNA [Szyf, M. (1996) Pharmacol TJier 70:1-37].
  • DNA methylation is catalysed by the enzyme DNA methyltransferase and occurs via transfer of methyl groups from S-adenosyl methionine to the 5' position of cytosine residues [Adams, R.L. et al. (1984) Curr Top Microbiol Immunol 108:142-156]. This process was previously believed to be irreversible, however, a protein exhibiting demethylase activity has recently been identified. The cDNA encoding this methylated DNA binding protein has been cloned and purified [Bhattacharya, S.K. et al.
  • An object ofthe present invention is to provide small oligonucleotide MBD2/dMTase inhibitors, h accordance with one aspect ofthe present invention, there is provided an oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, wherein said oligonucleotide inhibitor, or analogue thereof, inhibits expression of a mammalian MBD2/demethylase gene.
  • an oligonucleotide inhibitor or an analogue thereof, of less than about 100 nucleotides in length comprising at least 7 consecutive nucleotides from the sequence as set forth in any one of SEQ ID NOs: 5, 6, 7, 8, 9, 10, 11 or 12.
  • a vector comprising an oligonucleotide inhibitor of MBD2/dMTase.
  • a host cell comprising an oligonucleotide inhibitor of MBD2/dMTase, or comprising a vector comprising the oligonucleotide inhibitor.
  • a pharmaceutical composition comprising an oligonucleotide inhibitor of MBD2/dMTase, or comprising a vector comprising the oligonucleotide inhibitor.
  • an oligonucleotide inhibitor of MBD2/dMTase or a vector comprising the oligonucleotide inhibitor, in the manufacture of a medicament.
  • an oligonucleotide inhibitor or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, to inhibit the growth of cancer cells in a mammal in need thereof.
  • an oligonucleotide inhibitor or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, to inhibit the proliferation of cancer cells in a mammal in need thereof.
  • an oligonucleotide inhibitor or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, in the treatment of cancer in a mammal.
  • an oligonucleotide inhibitor or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, in the prophylactic treatment of a mammal to prevent a familial cancer.
  • a method of identifying target genes for cancer therapy comprising treating a cell with one or more oligonucleotide inhibitor of a mammalian MBD2/demethylase gene, analysing gene expression in the treated cell and comparing the gene expression with gene expression in a control cell not treated with said oligonucleotide inhibitor, wherein a difference in gene expression between the treated cell and the control cell is indicative of one or more target gene.
  • Figure 1 presents an alignment ofthe nucleic acid sequences for demethylase 1 (dMTase 1 or MBD2) cDNA from human (top line; SEQ ID NO:l) and mouse (lower line; SEQ ID NO:3). The coding strand is shown. The centre line shows the consensus sequence.
  • dMTase 1 or MBD2 demethylase 1
  • Figure 2 presents an alignment ofthe amino acid sequence of demethylase 1 (dMTase 1 or MBD2) from human (top line; SEQ ID NO:2) and mouse (lower line; SEQ ID NO:4).
  • the centre line shows the consensus sequence.
  • Figure 3 depicts the nucleic acid sequences for antisense oligonucleotides Al [SEQ ID NO: 5], A2 [SEQ ID NO: 6], A3 [SEQ ID NO: 7], A4 [SEQ ID NO: 8], A5 [SEQ IIDD NO: 9], A6 [SEQ ID NO: 10], A7 [SEQ ID NO: 11] and AlO [SEQ ID NO: 12], and their positions relative to the MBD2/dMTase open reading frames.
  • Figure 4 illustrates the inhibition of MBD2/dMTase mRNA expression in non-small cell lung carcinoma cells after treatment with antisense oligonucleotide A3, A4, A5, A6 or A7, or with scrambled control oligonucleotide 1582 [SEQ ID NO: 14].
  • Figure 5 presents the results of treatment of human non-small lung cancer cells (cell- line A549) with increasing concentrations of MBD2/dMTase antisense oligonucleotides AlO and the reverse scrambled control Al 1 [SEQ ID NO: 13].
  • Figure 6 presents the results of treatment of human colorectal carcinoma cells (cell- line HCT 116) with either the MBD2/dMTase antisense oligonucleotide AlO or the reverse scrambled control Al 1.
  • Figure 7 (A) illustrates the change in tumour volume and (B) demonstrates the relative tumour mass of in vivo xenografts of the human non-small lung cancer cell- line A549 in nude mice.
  • the cell-line was treated in vitro with either antisense oligonucleotide AlO or control scrambled oligonucleotide Al 1 prior to transplantation.
  • Figure 8 illustrates (A) the change in tumour volume for a single treatment group (B) the change in tumour volume for a double treatment group, (C) the relative tumour mass and (D) the number of tumour-free animals per treatment for nude mice carrying in vivo xenografts ofthe human colorectal carcinoma cell-line HCT 116.
  • the cell-line was treated in vitro with either antisense oligonucleotide AlO or control scrambled oligonucleotide Al 1 prior to implantation.
  • Figure 9 presents the results of treatment of in vivo xenografts of the human non- small lung cancer cell-line A549 in nude mice with varying concentrations of either antisense oligonucleotide AlO or control scrambled oligonucleotide Al 1.
  • Figure 10 depicts the increase in percentage of tumour-free animals following treatment of in vivo xenografts ofthe human non-small lung cancer cell-line A549 in nude mice with antisense oligonucleotide AlO.
  • Figure 11 depicts the decrease in tumour weight following treatment of in vivo xenografts ofthe human non-small lung cancer cell-line A549 in nude mice with antisense oligonucleotide AlO.
  • Figure 12 demonstrates that antisense oligonucleotide AlO does not cause overt toxicity in nude mice.
  • Figure 13 depicts the reduction in tumour size following treatment of in vivo xenografts of (A) the human non-small lung cancer cell-line A549, and (B) the human colorectal carcinoma cell-line HCT 116, in nude mice with antisense oligonucleotide AlO.
  • Figure 14 depicts the inhibition of in vivo xenografts ofthe human colorectal carcinoma cell-line HCT116 after in vitro treatment with either antisense oligonucleotide AlO or control scrambled oligonucleotide Al 1 prior to implantation.
  • Graph shows average tumour volume and mass (in inset) +/- SEM . Stars above the bars indicate statistical significance of p ⁇ 0.05 (two-sided student t-test).
  • B shows inhibition of growth of na ⁇ ve HCT116 cells implanted into nude mice by antisense oligonucleotide AlO in a dose-dependent fashion.
  • C) and (D) show complete tumour regression in mice with xenografts of A549 and HTl 16 cells, respectively, following treatment with antisense oligonucleotide AlO.
  • Figure 15 depicts the decrease in tumour weight following treatment of in vivo xenografts ofthe human colorectal carcinoma cell line HCT116 in nude mice with antisense oligonucleotide AlO. Stars above the bars indicate statistical significance (two-sided student t-test).
  • Figure 16 depicts the growth curves of MRHF (A), A549 (B), and HCT116 (C) following treatment with AlO (open squares) or Al 1 (solid squares), or mock transfection (open circles) (averages of three replicates + SEM).
  • AlO open squares
  • Al 1 solid squares
  • mock transfection open circles
  • D demonstrates that antisense oligonucleotide AlO has no effect on cell cycle progression of A549 cells; error bars are SEM for triplicate transfections.
  • Figure 17 presents representative Northern blots measuring MBD2/dMTase expression in A549 and HCT116 cells following treatment with antisense oligonucleotide AlO or control oligonucleotide Al 1 and quantification of these blots (B).
  • (C) presents Western blots of nuclear extracts from AlO antisense versus Al 1 control treated A549 cells. Nonspecific protein staining shown below as a measure of equal protein loading.
  • the present invention provides oligonucleotide inhibitors of MBD2/dMTase.
  • the oligonucleotide inhibitors inhibit expression ofthe mbd2/dMTase gene and decrease the growth of tumour cells in vitro and in vivo.
  • the oligonucleotide inhibitors of MBD2/dMTase provided by the present invention are thus useful in anti-cancer therapy.
  • the present invention further provides for methods to identify other genes that are potential targets for cancer therapy or diagnosis using the oligonucleotide inhibitors.
  • nucleic acid sequences means a polynucleotide sequence that is identical to all or a portion of a reference polynucleotide sequence.
  • the term “complementary to” is used herein to mean that the polynucleotide sequence is identical to all or a portion ofthe complement of a reference polynucleotide sequence.
  • TAT AC corresponds to a reference sequence "TATAC” and is complementary to a reference sequence "GTATA.”
  • reference sequence is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence, or may comprise a complete cDNA or gene sequence. Generally, a reference sequence is at least 20 nucleotides in length, and often at least 50 nucleotides in length.
  • a “window of comparison”, as used herein, refers to a conceptual segment ofthe reference sequence of at least 15 contiguous nucleotide positions wherein a polynucleotide sequence maybe compared to a reference sequence of at least 15 contiguous nucleotides and wherein the portion ofthe polynucleotide sequence in the window of comparison may comprise additions or deletions (i.e. gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment ofthe two sequences.
  • Optimal alignment of sequences for aligning a comparison window may be conducted using the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math.
  • sequence identity means that two polynucleotide sequences are identical (i.e. on a nucleotide-by-nucleotide basis) over the window of comparison.
  • percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleotide (e.g. A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e. the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • substantially identical denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 50 percent sequence identity as compared to a reference sequence over the window of comparison.
  • MBD2/DNA Demethylase MBD2/dMTase
  • the oligonucleotide inhibitors according to the present invention are targeted to a mammalian MBD2/dMTase gene.
  • the sequences for MBD2/dMTase genes isolated from human and from mouse are known in the art (see, for example, International Patent Application WO99/24583 and Genbank Accession Nos NM_003927 and NM__015832 (human) and NM 010773 (mouse)) and are provided herein (MBD2/dMTase 1, SEQ ID NOs: 1, 3 and 15).
  • MBD2/dMTase gene sequences can be readily obtained by one skilled in the art, for example, by conducting BLASTN searches of GenBank or other publicly available databases using the sequences provided herein, or by standard molecular biology techniques utilising isolated cellular DNA or RNA, or commercially available cDNA libraries, and the sequences provided herein, or portions thereof, as hybridization probes.
  • the oligonucleotide inhibitors are targeted to a human MBD2/dMTase 1 gene. In another embodiment, the oligonucleotide inhibitors are targeted to the human MBD2/dMTase 1 gene shown in SEQ ID NOs: 1 or 15. hia further embodiment, the oligonucleotide inhibitors are targeted to the mouse MBD2/dMTase 1 gene [SEQ ID NO:3].
  • oligonucleotide inhibitor encompasses antisense oligonucleotides, short interfering RNA (siRNA) molecules and ribozymes.
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA), deoxyribonucleic acid (DNA), or modified versions thereof, or RNA or DNA mimetics.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions, which function similarly.
  • backbone backbone linkages
  • modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for the nucleic acid target and increased stability in the presence of nucleases.
  • the tenn also includes chimeric oligonucleotides.
  • Chimeric oligonucleotides are oligonucleotides that contain two or more chemically distinct regions; each region comprising at least one monomer unit.
  • the oligonucleotides according to the present invention can be single-stranded or they can be double- stranded.
  • a nucleoside is a base-sugar combination and a nucleotide is a nucleoside that further includes a phosphate group covalently linked to the sugar portion ofthe nucleoside.
  • the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound, with the normal linkage or backbone of RNA and DNA being a 3' to 5' phosphodiester linkage.
  • the oligonucleotide inhibitors ofthe invention include those containing modified backbones or non-natural internucleoside linkages.
  • oligonucleotides having modified backbones include both those that retain a phosphorus atom in the backbone and those that lack a phosphorus atom in the backbone.
  • modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleotides.
  • Exemplary modified oligonucleotide backbones that can be incorporated into the oligonucleotides according to the present invention include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'- alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, tliionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogues of these, and analogues having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5 -3' or 2-5' to 5'-2'.
  • Exemplary modified oligonucleotide backbones that do not include a phosphorus atom are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • Such backbones include morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulphide, sulphoxide and sulphone backbones; formacetyl and thiofonnacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulphamate backbones; methyleneimino and methylenehydrazino backbones; sulphonate and sulphonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
  • alkyl refers to monovalent alkyl groups having from 1 to 20 carbon atoms. In one embodiment ofthe present invention, the alkyl group has between 1 and 6 carbon atoms. Examples of suitable alkyl groups include, but are not limited to, methyl, ethyl, r ⁇ -propyl, ⁇ O-propyl, ra-butyl, iso-butyl, «-hexyl, and the like.
  • cycloalkyl refers to cyclic alkyl groups of from 3 to 20 carbon atoms having a single cyclic ring or multiple condensed rings.
  • suitable cycloalkyl groups include, but are not limited to, single ring structures such as cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and the like, or multiple ring structures such as adamantanyl, and the like.
  • the present invention also contemplates oligonucleotide mimetics in which both the sugar and the internucleoside linkage ofthe nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target.
  • An example of such an oligonucleotide mimetic which has been shown to have excellent hybridization properties, is a peptide nucleic acid (PNA) [Nielsen et al., Science, 254:1497-1500 (1991)].
  • PNA peptide nucleic acid
  • the sugar-backbone of an oligonucleotide is replaced with an amide-containing backbone, in particular an aminoethylglycine backbone.
  • the nucleobases are retained and are bound directly or indirectly to aza-nitrogen atoms ofthe amide portion ofthe backbone.
  • LNAs locked nucleic acids
  • the present invention also contemplates oligonucleotides comprising "locked nucleic acids” (LNAs), which are conformationally restricted oligonucleotide analogues containing a methylene bridge that connects the 2'-O of ribose with the 4'-C (see, Singh et al, Chem. Commun., 1998, 4:455-456).
  • LNA and LNA analogues display very high duplex thermal stabilities with complementary DNA and RNA, stability towards 3'-exonuclease degradation, and good solubility properties.
  • LNAs form duplexes with complementary DNA or RNA or with complementary LNA, with high thermal affinities.
  • the universality of LNA-mediated hybridization has been emphasized by the formation of exceedingly stable LNA:LNA duplexes (Koshkin et al, J. Am. Chem. Soc, 1998, 120:13252-13253).
  • LNA:LNA hybridization was shown to be the most thermally stable nucleic acid type duplex system, and the RNA-mimicking character of LNA was established at the duplex level.
  • Introduction of three LNA monomers (T or A) resulted in significantly increased melting points toward DNA complements.
  • Modified oligonucleotides according to the present invention may also contain one or more substituted sugar moieties.
  • oligonucleotides may comprise sugars with one ofthe following substituents at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and aikynyl may be substituted or unsubstituted C ⁇ to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl.
  • Examples of such groups are: O[(CH 2 ) n O] m CH 3 , O(CH 2 ) n OCH 3 , O(CH 2 ) n NH 2 , O(CH 2 ) n CH 3 , O(CH 2 ) n ONH 2 , and O(CH 2 ) n ON[(CH 2 ) n CH 3 )] 2 , where n and m are from 1 to about 10.
  • the oligonucleotides may comprise one ofthe following substituents at the 2' position: d to C 10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • Oligonucleotides may also comprise sugar mimetics such as cyclobutyl moieties in place ofthe pentofuranosyl sugar.
  • Oligonucleotides according to the present invention may also include modifications or substitutions to the nucleobase.
  • "unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C); inosine; 5- hydroxymethyl cytosine; xanthine; hypoxanthine; 2-arninoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2- ⁇ ropyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine and 2-thiocytosine; 5-halouracil and cytosine; 5-propynyl uracil and cytosine; 6-azo uracil, cytosine and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines; 5-halo particularly 5-bromo, 5- trifluoromethyl
  • nucleobases include those disclosed in U.S. Pat. No. 3,687,808; The Concise Encyclopaedia Of Polymer Science And Engineering, (1990) pp 858-859, Kroschwitz, J. I., ed. John Wiley & Sons; Englisch et al, Angewandte Chemie, Int. Ed., 30:613 (1991); and Sanghvi, Y. S., (1993) Antisense Research and Applications, pp 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press. Certain of these nucleobases are particularly useful for increasing the binding affinity ofthe oligomeric compounds ofthe invention.
  • 5- substituted pyrimidines 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propyny ⁇ uracil and 5-propynylcytosine.
  • 5- methylcy osine substitutions have been shown to increase nucleic acid duplex stability by 0.6 - 1.2°C [Sanghvi, Y. S., (1993) Antisense Research and Applications, pp 276- 278, Crooke, S. T. and Lebleu, B., ed., CRC Press, Boca Raton].
  • oligonucleotide modification included in the present invention is the chemical linkage to the oligonucleotide of one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake ofthe oligonucleotide.
  • moieties include, but are not limited to, lipid moieties such as a cholesterol moiety [Letsinger et al, Proc. Natl. Acad. Sci. USA, 86:6553-6556 (1989)], cholic acid [Manoharan et al, Bioorg. Med. Chem. Let., 4:1053-1060 (1994)], a thioether, e.g.
  • oligonucleotides that are chimeric compounds are included within the scope ofthe present invention.
  • Chimeric oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
  • An additional region ofthe oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • an oligonucleotide is "nuclease resistant" when it has either been modified such that it is not susceptible to degradation by DNA and RNA nucleases or, alternatively, has been placed in a delivery vehicle which itself protects the oligonucleotide from DNA or RNA nucleases.
  • Nuclease resistant oligonucleotides include, for example, methyl phosphonates, phosphorothioates, phosphorodithioates, phosphotriesters, and morpholino oligomers.
  • Suitable delivery vehicles for conferring nuclease resistance include, for example, liposomes.
  • the present invention further contemplates oligonucleotides that contain groups for improving the pharmacokinetic and/or pharmacodynamic properties ofthe oligonucleotide.
  • antisense oligonucleotide indicates an oligonucleotide having a nucleotide sequence that is complementary to a portion ofthe mRNA transcribed from the gene of interest.
  • the gene of interest is the gene encoding a mammalian MBD2/dMTase.
  • Antisense oligonucleotides are targeted to specific nucleic acids. "Targeting" an antisense oligonucleotide to a particular nucleic acid, in the context ofthe present invention, is amultistep process that usually begins with the identification of a nucleic acid sequence whose function is to be modulated, hi the context ofthe present invention, the target is the gene encoding a mammalian MBD2/dMTase, or the mRNA transcribed from a mammalian MBD2/dMTase gene. As described above, sequences for mammalian MBD2/dMTase genes are known in the art or are readily obtainable.
  • the targeting process also includes determination of a site, or sites, within this nucleic acid sequence for the antisense interaction to occur such that the desired effect, i.e. modulation of expression ofthe gene, will result.
  • oligonucleotides are chosen that are sufficiently complementary (i.e. hybridize with sufficient strength and specificity) to the target to give the desired result.
  • the 5' untranslated region (5'-UTR), the translation initiation (or start) codon region, the open reading frame (ORF), the translation termination (or stop) codon region and the 3' untranslated region (3'-UTR).
  • translation initiation codon and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine in eukaryotes. It is also known in the art that eukaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context ofthe present invention, “start codon” and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding MBD2/dMTase regardless ofthe sequence(s) of such codons.
  • introns As is known in the art, some eukaryotic transcripts are directly translated, however, most mammalian genes, or open reading frames (ORFs), contain one or more sequences, known as "introns," which are excised from a transcript before it is translated. The expressed (unexcised) portions ofthe ORF are referred to as “exons” and are spliced together to form an mRNA transcript (Alberts et al, (1983) Molecular Biology ofthe Cell, Garland Publishing Inc., New York, pp. 411-415). In the context ofthe present invention, both introns and exons may serve as targets for antisense.
  • an ORF may also contain one or more sites that may be targeted for antisense due to some functional significance in vivo.
  • sites include intragenic stem-loop structures (see, for example, U.S. Pat. No. 5,512,438) and, in unprocessed mRNA molecules (primary transcripts), intron/exon splice sites.
  • primary RNA transcripts can be alternatively processed in vivo depending on the splicing ofthe exons and can, therefore, give rise to alternatively spliced mRNA molecules which correspond to the same gene but differ in structure.
  • mRNA molecules possess a 5' cap region that may also serve as a target for antisense.
  • the 5' cap of a mRNA comprises an N -methylated guanosine residue joined to the 5'-most residue ofthe mRNA via a 5'-5' triphosphate linkage.
  • the 5' cap region of a mRNA is considered to include the 5' cap structure itself as well as the first approximately 50 nucleotides adjacent to the cap.
  • the antisense oligonucleotides according to the present invention can be complementary to regions of a complete MBD2/dMTase gene including the introns, to the primary mRNA transcript of a MBD2/dMTase gene or to one or more ofthe final, spliced versions ofthe mRNA from a MBD2/dMTase gene.
  • the antisense oligonucleotides in accordance with the present invention are selected from a sequence complementary to a mammalian MBD2/dMTase gene such that the sequence exhibits the least likelihood of forming duplexes, hair-pins, or of containing homooligomer / sequence repeats.
  • a sequence complementary to a mammalian MBD2/dMTase gene such that the sequence exhibits the least likelihood of forming duplexes, hair-pins, or of containing homooligomer / sequence repeats.
  • the oligonucleotide may further contain a GC clamp.
  • the oligonucleotides may also comprise a TCCC motif.
  • the presence of such a motif in an antisense oligonucleotide has been shown increase the likelihood that the mRNA:DNA duplex will undergo RNase H-mediated degradation.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. In antisense therapy, therefore, activation of RNase H results in cleavage ofthe mRNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression.
  • Antisense oligonucleotides can also be selected that are complementary to a nucleic acid sequence which constitutes a region of a MBD2/dMTase gene that is highly conserved between the MBD2/dMTase genes of two or more species. These properties can be determined, for example, using the BLASTN program (Altschul, et al, (1990) J. Mol. Biol, 215:403-10) ofthe University of Wisconsin Computer group (GCG) software (Devereux. et al, (1984) Nucleic Acids Res., 12:387-395) with the National Center for Biotechnology Information (NCBI) databases.
  • BLASTN program Altschul, et al, (1990) J. Mol. Biol, 215:403-10
  • GCG University of Wisconsin Computer group
  • NCBI National Center for Biotechnology Information
  • an antisense oligonucleotide need not have 100% identity with the complement of its target sequence in order to be effective.
  • the antisense oligonucleotides in accordance with the present invention therefore, have a sequence that is at least about 60% identical to the complement ofthe target sequence.
  • the antisense oligonucleotides have a sequence that is at least about 70% identical to the complement ofthe target sequence.
  • the antisense oligonucleotides have a sequence that is at least about 80% identical to the complement of the target sequence.
  • they have a sequence that is at least about 90% identical or at least about 95% identical to the complement ofthe target sequence.
  • Identity can be determined, for example, by using the BLASTN program ofthe University of Wisconsin Computer Group (GCG) software and allows for gaps or mismatches of several bases.
  • GCG University of Wisconsin Computer Group
  • the antisense oligonucleotides ofthe present invention h order for the antisense oligonucleotides ofthe present invention to function in inhibiting expression ofthe MBD2/dMTase gene, it is necessary that they demonstrate adequate specificity for the target sequence and do not bind to other nucleic acid sequences in the cell. Therefore, in addition to possessing an appropriate level of sequence identity to the complement ofthe target sequence, the antisense oligonucleotides ofthe present invention should not closely resemble other known sequences. The antisense oligonucleotides ofthe present invention, therefore, should be less than 50% identical to any other mammalian nucleic acid sequence.
  • the identity ofthe antisense oligonucleotides ofthe present invention to other sequences can be determined, for example, through the use ofthe BLASTN program and the NCBI databases as indicated above.
  • the antisense oligonucleotides according to the present invention typically between about 7 and about 100 nucleotides in length.
  • the antisense oligonucleotides comprise from about 7 to about 50 nucleotides, or nucleotide analogues
  • the antisense oligonucleotides comprise from about 12 to about 50 nucleotides, or nucleotide analogues
  • the antisense oligonucleotides comprise from about 7 to about 35 nucleotides, or nucleotide analogues, from about 12 to about 35 nucleotides, or nucleotide analogues, and from about 18 to about 25 nucleotides, or nucleotide analogues.
  • the antisense oligonucleotides comprise at least 7 consecutive nucleotides from a nucleic acid sequence as set forth in any one of SEQ ID NOs: 5 - 12, or an analogue thereof.
  • the antisense oligonucleotides comprise one or more phosphorothioate backbone linkages. In still another embodiment, all backbone linkages in the antisense oligonucleotide are phosphorothioate linkages. In yet another embodiment ofthe present invention, the antisense oligonucleotides are chimeric molecules comprising one or more phosphorothioate backbone linkages and one or more 2'-O-methyl modified bases. ii) Short Interfering RNA (siRNA) Molecules
  • siRNA interference mediated by short interfering double-stranded RNA molecules is known in the art to play an important role in post-transcriptional gene silencing [Zamore, Nature Struc. Biol, 8:746-750 (2001)].
  • siRNA molecules are typically 21-22 base pairs in length and are generated in nature when long double- stranded RNA molecules are cleaved by the action of an endogenous ribonuclease.
  • siRNA molecules are typically 21-22 base pairs in length and are generated in nature when long double- stranded RNA molecules are cleaved by the action of an endogenous ribonuclease.
  • the oligonucleotide inhibitors according to the present invention can be siRNA molecules which are targeted to a mammalian MBD2/dMTase gene such that the sequence ofthe siRNA corresponds to a portion ofthe MBD2/dMTase gene.
  • effective siRNA molecules are typically less than 30 base pairs in length to help prevent them triggering non-specific RNA interference pathways in the cell via the interferon response, h accordance with the present invention, the siRNA molecules are between about 15 and about 30 nucleotides in length. In one embodiment, the siRNA molecules are between about 15 and about 25 base pairs in length, hi another embodiment, they are between 19 and 22 base pairs in length.
  • the double-stranded siRNA molecules can further comprise poly-T or poly-U overhangs at the 3' and 5' ends to minimise RNase-mediated degradation ofthe molecules.
  • the siRNA molecules comprise overhangs at the 3' and 5' ends which consist of two thymidine or two uridine residues.
  • Design and construction of siRNA molecules is known in the art [see, for example, Elbashir, et al, Nature, 411:494-498 (2001); Bitko and Barik, BMC Microbiol, 1 :34 (2001)].
  • kits that provide a rapid and efficient means of constructing siRNA molecules by in vitro transcription are also commercially available (Ambion, Austin, TX; New England Biolabs, Beverly, MA) and may be used to construct the siRNA molecules according to the present invention.
  • Hi Ribozymes
  • the oligonucleotide inhibitors according to the present invention can be ribozymes that specifically target mRNA encoding a mammalian MBD2/dMTase.
  • ribozymes are RNA molecules having an enzymatic activity that enables the ribozyme to repeatedly cleave other separate RNA molecules in a nucleotide-sequence specific manner.
  • Such enzymatic RNA molecules can be targeted to virtually any mRNA transcript, and efficient cleavage can be achieved in vitro [Kim et al, Proc. Natl. Acad. Sci.
  • a ribozyme comprises two portions held in close proximity, a mRNA binding portion having a sequence complementary to the target mRNA sequence, and a catalytic portion which acts to cleave the target mRNA.
  • a ribozyme acts by first recognising and binding a target mRNA by complementary base-pairing through the target mRNA binding portion ofthe ribozyme. Once it is specifically bound to its target, the ribozyme catalyses cleavage ofthe target mRNA. Such strategic cleavage destroys the ability of a target mRNA to direct synthesis of an encoded protein. Having bound and cleaved its mRNA target, the ribozyme is released and can repeatedly bind and cleave new target mRNA molecules.
  • Hammerhead ribozymes comprise a hybridizing region which is complementary in nucleotide sequence to at least part ofthe target mRNA, and a catalytic region which is adapted to cleave the target mRNA.
  • the hybridizing region contains at least 9 nucleotides.
  • the present invention therefore contemplates the use ofthe oligonucleotide inhibitors as part ofthe hybridizing region of a hammerhead ribozyme, wherein the hybridizing region comprises at least 9 nucleotides that are complementary to a gene encoding MBD2/dMTase and is joined to an appropriate catalytic domain.
  • Ribozymes in accordance with the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes”) such as the one that occurs naturally in Tetrahymena thermophila (known as the TVS, or L-19 IVS RNA), which has been extensively described in the literature [see, Zaug, et al, Science, 224:574- 578 (1984); Zaug and Cech, Science, 231 :470-475 (1986); Zaug, et al, Nature, 324:429-433 (1986); U.S.
  • Cech-type ribozymes such as the one that occurs naturally in Tetrahymena thermophila (known as the TVS, or L-19 IVS RNA), which has been extensively described in the literature [see, Zaug, et al, Science, 224:574- 578 (1984); Zaug and Cech, Science, 231 :470-475 (1986); Zaug, et al, Nature, 3
  • Cech-type ribozymes comprise an 8 nucleotide active site which hybridizes to a target mRNA sequence with subsequent cleavage ofthe target mRNA by the ribozyme.
  • binding energy can be optimized by making ribozymes with G to I (inosine) and U to BrU (bromouracil) substitutions (or equivalent substitutions as known in the art) in the mRNA binding portion.
  • substitutions allow manipulation of the binding free-energy without altering the target recognition sequence, the length ofthe mRNA binding portion, or the enzymatic portion ofthe ribozyme.
  • the shape ofthe free-energy vs. ribozyme activity curve can be readily determined using data from standard experiments known in the art in which each base (or several bases) is modified or unmodified, and without the complication of changing the size ofthe ribozyme/substrate interaction.
  • modified bases thus permits "fine tuning" ofthe binding free energy to assure maximal ribozyme activity and is considered to be within the scope ofthe present invention.
  • replacement of such bases e.g., I for G, may permit a higher level of substrate specificity when cleavage of non-target RNA is a problem.
  • the oligonucleotide inhibitors ofthe present invention can be prepared by conventional techniques well-known to those skilled in the art.
  • the oligonucleotides can be prepared using solid-phase synthesis using commercially available equipment, such as the equipment available from Applied Biosystems Canada Inc. (Mississauga, Canada).
  • modified oligonucleotides such as phosphorothioates and alkylated derivatives, can also be readily prepared by similar methods.
  • the oligonucleotide inhibitors ofthe present invention can be prepared by enzymatic digestion and/or amplification ofthe naturally occurring MBD2/dMTase gene or mRNA, or of cDNA synthesized from the mRNA, using standard techniques known in the art.
  • the oligonucleotide inhibitors comprise RNA
  • they can be prepared by in vitro transcription methods also known in the art.
  • siRNA molecules can also be conveniently prepared using commercially available in vitro transcription kits.
  • Oligonucleotides can also be prepared using recombinant DNA techniques.
  • the present invention encompasses expression vectors comprising nucleic acid sequences that encode the oligonucleotide inhibitors and subsequent expression ofthe encoded oligonucleotides in a suitable host cell.
  • Such expression vectors can be readily constructed using procedures known in the art [see, for example, Ausubel, et al, Current Protocols in Molecular Biology, John Wiley & Sons, fric, NY. (1989 and updates)].
  • suitable vectors include, but are not limited to, plasmids, phagemids, cosmids, bacteriophages, baculovimses, retroviruses, and DNA viruses.
  • Suitable host cells include, but are not limited to, bacterial, yeast, insect, plant and mammalian cells.
  • the selected expression vector may further include regulatory elements, such as transcriptional elements, required for efficient transcription ofthe oligonucleotide sequences.
  • regulatory elements such as transcriptional elements, required for efficient transcription ofthe oligonucleotide sequences.
  • regulatory elements that can be incorporated into the vector include, but are not limited to, promoters, enhancers, terminators, and polyadenylation signals.
  • the present invention therefore, provides vectors comprising a regulatory element operatively linked to a nucleic acid sequence encoding an oligonucleotide inhibitor.
  • suitable regulatory elements is dependent on the host cell chosen for expression ofthe oligonucleotide inhibitor and that such regulatory elements may be derived from a variety of sources, including bacterial, fungal, viral, mammalian or insect genes.
  • the expression vector may additionally contain a reporter gene.
  • Suitable reporter genes include, but are not limited to, ⁇ - galactosidase, green fluorescent protein, red fluorescent protein, luciferase, and ⁇ - glucuronidase. Incorporation of a reporter gene into the expression vector allows transcription ofthe oligonucleotide to be monitored by detection of a signal generated by expression ofthe reporter gene.
  • the expression vectors can be introduced into a suitable host cell or tissue by one of a variety of methods known in the art. Such methods can be found generally described in Sambrook et al, Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, NY (2001) and Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, fric, NY (1989 and updates) and include, for example, stable or transient transfection, lipofection, electroporation, and infection with recombinant viral vectors.
  • Ribozyme inhibitors comprising the oligonucleotides according to the present invention can be readily constructed by techniques known in the art. In these molecules the oligonucleotide sequence is included in the hybridizing or mRNA binding portion ofthe ribozyme and is joined to an appropriate catalytic portion.
  • the efficacy ofthe oligonucleotide inhibitors ofthe present invention in inhibiting the expression of a mammalian MBD2/dMTase gene or the growth of cancer cells can be determined by one or a combination of a number of different methods known in the art. Exemplary methods that can be used to determine the efficacy ofthe oligonucleotide inhibitors are provided below.
  • initial determinations ofthe efficacy ofthe oligonucleotides ofthe present invention can be made using in vitro techniques.
  • the ability ofthe oligonucleotide inhibitors to inhibit expression of a MBD2/dMTase gene can be determined by introducing the oligonucleotide into a cell line that normally expresses MBD2/dMTase.
  • the amount of mRNA transcribed from the gene can then be measured by standard techniques, such as by Northern blot analysis.
  • the amount of MBD2/dMTase protein produced by the cell can be measured, for example, by Western blot analysis.
  • the specificity ofthe oligonucleotides for their mRNA target can be determined by conducting appropriate control experiments in parallel.
  • the amount of mRNA or protein produced in a cell treated with the oligonucleotide can be compared with that produced in a control, untreated cell or a cell treated with a control oligonucleotide and provides an indication of how successfully the oligonucleotide has inhibited MBD2/dMTase gene expression.
  • Appropriate controls will be dependent upon the type of oligonucleotide inhibitor being investigated and can be readily selected by one skilled in the art.
  • Examples of appropriate controls include untreated cells and cells treated with randomised or "scrambled" oligonucleotides, oligonucleotides containing a defined number of mismatches, long non-specific double-stranded RNA molecules or ribozymes incorporating a randomised oligonucleotide in its mRNA binding domain.
  • the oligonucleotide inhibitors are selected based on their ability to decrease the expression of a MBD2/dMTase gene by at least about 50% when compared to an untreated control. In one embodiment, the oligonucleotide inhibitors decrease the expression of a MBD2/dMTase gene by at least about 60%. i another embodiment, the oligonucleotide inhibitors decrease the expression of a MBD2/dMTase gene by at least about 70%. hi other embodiments, the oligonucleotide inhibitors decrease the expression of a MBD2/dMTase gene by at least about 80% and by at least 90%.
  • the ability ofthe oligonucleotide inhibitors to inhibit expression of MBD2/dMTase can be determined in vitro by assaying the total cellular activity ofthe MBD2/dMTase enzyme in the presence and absence ofthe oligonucleotide.
  • the demethylase activity ofthe MBD2/dMTase protein can be determined using a cell-based assay in which expression of a reporter gene present within the cell is dependent upon demethylation ofthe reporter gene DNA.
  • the vector CMV-GFP can be methylated in vitro and then transfected into cells, such as human embryonic kidney (HEK) cells, treated with the histone deacetylase inhibitor trichostatin A [Cervoni, N.
  • Demethylation ofthe vector DNA occurs within the cells through the action ofthe endogenous MBD2/dMTase. Whereas the methylated form of CMV-GFP is not expressed, the demethylated CMV-GFP is expressed and the resultant GFP protein can be readily detected by live fluorescence microscopy. Standard calculations using the amount of GFP produced can then be employed to determine the amount of vector DNA demethylated and thus, the activity ofthe MBD2/dMTase.
  • reporter genes and detection methods known in the art can be used in this type of assay. For example, the reporter genes red fluorescent protein or luciferase may be used.
  • the oligonucleotide inhibitors can be further tested in vitro by determining their ability to inhibit anchorage-independent growth of tumour cells.
  • Anchorage- independent growth is known in the art to be a good indicator of tumourigenicity.
  • anchorage-independent growth is assessed by plating cells from an appropriate cancer cell-line onto soft agar and determining the number of colonies formed after an appropriate incubation period. Growth of cells treated with the oligonucleotide inhibitor can then be compared with that of cells treated with an appropriate control (such as those as described above) and with that of untreated cells.
  • the oligonucleotide inhibitors decrease the anchorage-independent growth of cancer cells by at least 20%, when compared to untreated cells or cells treated with a control oligonucleotide. In one embodiment, the oligonucleotide inhibitors decrease the anchorage-independent growth of cancer cells by at least 30%. h another embodiment, the oligonucleotide inhibitors decrease the anchorage-independent growth of cancer cells by at least 40%. In other embodiments, they decrease the growth by at least 50% and at least 60%.
  • in vitro testing ofthe oligonucleotide inhibitors is conducted in a cancer cell-line that expresses high levels of MBD2/dMTase.
  • the cancer cell-line is a human cancer cell- line.
  • suitable cancer cell-lines for in vitro testing ofthe oligonucleotide inhibitors ofthe present invention include, but are not limited to, non-small cell lung carcinoma cell-lines A549 and HI 299, breast cancer cell-line MCF-7, colon cancer cell-lines CaCo, HCT116 and HT29, cervical cancer cell-line HeLa.
  • suitable cell-lines are known in the art.
  • Toxicity ofthe oligonucleotide inhibitors can also be initially assessed in vitro using standard techniques.
  • human primary fibroblasts can be treated in vitro with the oligonucleotide in the presence of a commercial lipid carrier such as lipofectamine.
  • a commercial lipid carrier such as lipofectamine.
  • Cells are then tested at different time points following treatment for their viability using a standard viability assay, such as the trypan-blue exclusion assay.
  • a standard viability assay such as the trypan-blue exclusion assay.
  • Cells are also assayed for their ability to synthesize DNA, for example, using a thymidine incorporation assay, and for changes in cell cycle dynamics, for example, using a standard cell sorting assay in conjunction with a fluorocytometer cell sorter (FACS).
  • FACS fluorocytometer cell sorter
  • oligonucleotide inhibitors to inhibit tumour growth or proliferation in vivo can be determined in an appropriate animal model
  • general, current animal models for screening anti-tumour compounds are xenograft models, in which a human tumour has been implanted into an animal.
  • xenograft models of human cancer include, but are not limited to, human solid tumour xenografts in mice, implanted by sub-cutaneous injection and used in tumour growth assays; human solid tumour isografts in mice, implanted by fat pad injection and used in tumour growth assays; experimental models of lymphoma and leukaemia in mice, used in survival assays, and experimental models of lung metastasis in mice.
  • the oligonucleotide inhibitors ofthe present invention can be administered to an appropriate xenograft animal model, for example, by bolus infusion.
  • cells can be treated ex vivo with the oligonucleotide inhibitor and then the treated cells can be injected or implanted into the animal.
  • the size ofthe tumour is then assessed over a suitable time period and compared to that in an untreated control animal, or an animal treated with a control oligonucleotide. After an appropriate period of time, the animals are sacrificed and the tissue histology, size and / or proliferation ofthe tumour assessed. At this time, analysis of MBD2/dMTase protein expression and mRNA expression may also be conducted using standard techniques as described above and elsewhere.
  • the oligonucleotide inhibitors can be tested in vivo on solid tumours using mice that are subcutaneously grafted bilaterally with 30 to 60 mg of a tumour fragment on day 0.
  • the animals bearing tumours are mixed before being subjected to the various treatments and controls, hi the case of treatment of advanced tumours, tumours are allowed to develop to the desired size, animals having insufficiently developed tumours being eliminated.
  • the selected animals are distributed at random to undergo the treatments and controls. Animals not bearing tumours may also be subjected to the same treatments as the tumour-bearing animals in order to be able to dissociate the toxic effect from the specific effect on the tumour.
  • Treatment with the oligonucleotide inhibitors generally begins from 3 to 22 days after grafting, depending on the type of tumour, and the animals are observed every day.
  • the different animal groups are weighed about 3 or 4 times a week until the maximum weight loss is attained, after which the groups are weighed at least once a week until the end ofthe trial.
  • tumours are measured about 2 or 3 times a week until the tumour reaches a predetermined size and / or weight, or until the animal dies if this occurs before the tumour reaches the pre-determined size / weight.
  • the animals are then sacrificed and the tissue histology, size and / or proliferation ofthe tumour assessed.
  • the animals are grafted with a particular number of cells, and the anti-tumour activity is detennined by the increase in the survival time ofthe treated mice relative to the controls.
  • tumour cells are typically treated with the composition ex vivo and then injected into a suitable test animal. The spread ofthe tumour cells from the site of injection is then monitored over a suitable period of time.
  • In vivo toxic effects ofthe oligonucleotides can be evaluated by measuring their effect on animal body weight during treatment and by performing haematological profiles and liver enzyme analysis after the animal has been sacrificed.
  • the oligonucleotide inhibitors ofthe present invention can be used to inhibit the growth or proliferation of tumour cells in vitro or in vivo.
  • the present invention therefore, provides for the use ofthe oligonucleotide inhibitors as anti-cancer drugs.
  • the present invention further provides a method of inhibiting the growth of tumour • cells in a subject by administering a therapeutically effective amount of one or more of oligonucleotide inhibitors.
  • the oligonucleotide inhibitors ofthe present invention can be used to treat, stabilize or prevent cancer, hi this context, the oligonucleotides may exert cytotoxic or cytostatic effects that cause a reduction in the size of a tumour, slow or prevent an increase in the size of a tumour, increase the disease-free survival time between the disappearance of a tumour and its reappearance, prevent an initial or subsequent occurrence of a tumour (e.g. metastasis), or reduce an adverse symptom associated with a tumour.
  • cytotoxic or cytostatic effects that cause a reduction in the size of a tumour, slow or prevent an increase in the size of a tumour, increase the disease-free survival time between the disappearance of a tumour and its reappearance, prevent an initial or subsequent occurrence of a tumour (e.g. metasta
  • the present invention provides for the use ofthe oligonucleotide inhibitors in prophylactic treatments to aid in the prevention of genetic cancers, such as familial colorectal cancers, breast cancers, and the like.
  • the present invention also contemplates the use ofthe oligonucleotide inhibitors as "sensitizing agents," which selectively inhibit the growth of cancer cells.
  • the oligonucleotide alone does not have a cytotoxic effect on the cell, but selectively arrests or slows the growth of cancer cells.
  • the oligonucleotide thus provides a means of weakening the cancer cells, and thereby facilitates the benefit from conventional anti-cancer therapeutics.
  • the present invention contemplates the administration to a subject of a therapeutically effective amount of one or more oligonucleotide inhibitors administered with one or more anti-cancer therapeutics.
  • the oligonucleotides can be administered before, during or after treatment with the anti-cancer therapeutic.
  • An "anti-cancer therapeutic” is a compound, composition or treatment that prevents or delays the growth and/or metastasis of cancer cells.
  • Such anti-cancer therapeutics include, but are not limited to, chemotherapeutic drug treatment, radiation, gene therapy, hormonal manipulation, immunotherapy and antisense oligonucleotide therapy.
  • chemotherapeutic drugs include, but are not limited to, bleomycin, neocarcinostatin, suramin, doxorubicin, taxol, mitomycin C and cisplatin. It is to be understood that anti-cancer therapeutics for use in the present invention also include novel compounds or treatments developed in the future.
  • cancers examples include, but are not limited to, breast carcinomas, colon carcinomas, colorectal carcinomas, neuroblastomas, and gliomas.
  • cancer refers to all types of cancer or neoplasm or malignant tumours found in mammals, including leukemias, carcinomas, melanomas and sarcomas.
  • cancers are cancer ofthe brain, breast, cervix, colon, head and neck, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus and Medulloblastoma.
  • leukaemia refers broadly to progressive, malignant diseases ofthe blood- forming organs and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukaemia is generally clinically classified on the basis of (1) the duration and character ofthe disease - acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non- increase in the number of abnormal cells in the blood-leukaemic or aleukaemic
  • Leukaemia includes, for example, acute nonlymphocytic leukaemia, chronic lymphocytic leukaemia, acute granulocytic leukaemia, chronic granulocytic leukaemia, acute promyelocytic leukaemia, adult T-cell leukaemia, aleukaemic leukaemia, a leukocythemic leukaemia, basophylic leukaemia, blast cell leukaemia, bovine leukaemia, chronic myelocytic leukaemia, leukaemia cutis, embryonal leukaemia, eosinophilic leukaemia, Gross' leukaemia, hairy-cell leukaemia, hemoblastic leukaemia, hemocytoblastic leukaemia, histiocytic leukaemia, stem cell leukaemia, acute monocytic leukaemia, leukopenic leukaemia, lymphatic leukaemia, lymphoblastic leuka
  • sarcoma generally refers to a tumour which is made up of a substance like embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance.
  • Sarcomas include chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumour sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, f ⁇ broblastic sarcoma, giant cell sar
  • melanoma is taken to mean a tumour arising from the melanocytic system ofthe skin and other organs.
  • Melanomas include, for example, acral-lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, and superficial spreading melanoma.
  • carcinoma refers to a malignant new growth made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases.
  • exemplary carcinomas include, for example, acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale adenoides, exophytic carcinoma, carcinoma ex ulcere, carcinoma fibro
  • Additional cancers encompassed by the present invention include, for example, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, breast cancer, ovarian cancer, lung cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, small-cell lung tumors, primary brain tumors, stomach cancer, colon cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, cervical cancer, endometrial cancer, adrenal cortical cancer, and prostate cancer.
  • the oligonucleotide inhibitors are used in the treatment or stabilisation of lung cancer, hi another embodiment, the oligonucleotide inhibitors are used in the treatment or stabilisation of colorectal cancer.
  • the oligonucleotide inhibitors ofthe present invention can also be used to inhibit MBD2/dMTase in vitro and in vivo for the purpose of identifying genes that are regulated by MBD2/dMTase and may be important in maintaining the transformed state of a cell.
  • genes are potential target genes for anti-cancer therapy and / or diagnosis.
  • the present invention provides methods of identifying genes which are potential targets for cancer therapy or diagnosis. Such methods involve treatment of a cell with one or more ofthe MBD2/dMTase oligonucleotide inhibitors ofthe present invention in order to inhibit expression of MBD2/dMTase followed by comparison of gene expression in the treated cell with that in a suitable control cell.
  • Suitable control cells include, for example, an untreated cell or a cell treated with a control "scrambled" oligonucleotide.
  • the first step in analysis of gene expression is isolation of RNA from the treated and control cells, which can be achieved using standard techniques.
  • Methods of analysing gene expression include, for example, Northern blotting techniques, RNase protection assays, differential display, serial analysis of gene expression (SAGE) [see U.S. Patent No. 6,383,743] and rapid analysis of gene expression (RAGE) [see Wang et al, Nucl Acids Res., 27:4609-4618 (1999)].
  • gene expression can be analysed rapidly and conveniently by differential expression analysis using a gene microarray representing a suitable number of genes from the mammal being studied.
  • Microa ⁇ ays comprise an ordered arrangement of thousands of oligonucleotide probes each representing a separate gene immobilised on a suitable support.
  • Suitable supports for microarrays include, for example, nitrocellulose, plastic, nylon and glass.
  • microarrays useful for this purpose represent between 1,000 and 40, 000 genes from the organism of interest.
  • Methods of constructing microarrays are well-known in the art [see, for example, Ausubel, et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc, NY. (1989 and updates)], hi addition, custom-made microarrays are available from many companies.
  • Pre-made microarrays are also commercially available for many organisms including, for example, GeneChip ® (Affimetrix, Santa Clara, CA), AtlasTM (BD Biosciences-CLONTECH, Palo Alto, CA), GEM Microarrays, GeneJetTM array and LifeSeq ® (Incyte Genomics, Palo Alto, CA), MICROMAXTM Human cDNA Microarray Systems (PerkinElmer Life Sciences, Boston, Mass.) and ResGenTM GeneFilters ® (Invitrogen, Huntsville, Ala.).
  • GeneChip ® Affimetrix, Santa Clara, CA
  • AtlasTM BD Biosciences-CLONTECH, Palo Alto, CA
  • GEM Microarrays GeneJetTM array and LifeSeq ® (Incyte Genomics, Palo Alto, CA), MICROMAXTM Human cDNA Microarray Systems (PerkinElmer Life Sciences, Boston, Mass.) and ResGenTM GeneFilters ®
  • RNA isolated from the treated and control cells is hybridized to the microarray under suitable conditions and a routine analysis ofthe microarray by commercially available scanners and software is conducted to identify genes whose expression is affected (i.e. either induced or suppressed) in the cells treated with the MBD2/dMTase oligonucleotide inhibitors. Suitable hybridization conditions can readily be determined by one skilled in the art using standard techniques. The induced or suppressed genes thus identified are potential target genes for cancer diagnosis and therapy.
  • the oligonucleotide inhibitors are usually administered in the form of pharmaceutical compositions or formulations.
  • Such compositions are prepared in a manner well known in the pharmaceutical art and comprise at least one active compound.
  • the pharmaceutical composition or formulation comprises the oligonucleotide inhibitor.
  • the pharmaceutical composition or formulation comprises a vector encoding the oligonucleotide inhibitor.
  • the oligonucleotide inhibitors may be incorporated into pharmaceutical compositions in the form of pharmaceutically acceptable salts.
  • pharmaceutically acceptable salt refers to salts which retain the biological effectiveness and properties ofthe oligonucleotide inhibitors ofthe present invention, and which are not biologically or otherwise undesirable.
  • the oligonucleotides are capable of forming acid and/or base addition salts by virtue ofthe presence of amino and/or carboxyl groups or groups similar thereto.
  • Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium and magnesium salts.
  • Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, such as alkyl amines, dialkyl amines, trialkyl amines, substituted alkyl amines, di(substituted alkyl) amines, tri(substituted alkyl) amines, alkenyl amines, dialkenyl amines, trialkenyl amines, substituted alkenyl amines, di(substituted alkenyl) amines, tri(substituted alkenyl) amines, cycloalkyl amines, di(cycloalkyl) amines, tri(cycloalkyl) amines, substituted cycloalkyl amines, substituted cycloalkyl amines, substituted
  • Suitable amines include, but are not limited to, isopropylamine, trimethyl amine, diethyl amine, tri(z5O-propyl) amine, tri(w-propyl) amine, ethanolamine, 2- dimethylaminoethanol, tromethamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, N-alkylglucamines, theobromine, purines, piperazine, piperidine, morpholine, N-ethylpiperidine, and the like.
  • carboxylic acid derivatives would be useful in the practice of this invention, for example, carboxylic acid amides, including carboxamides, lower alkyl carboxamides, dialkyl carboxamides, and the like.
  • Salts derived from inorganic acids include hydrochloric acid, hydrobromic acid, sulphuric acid, nitric acid, phosphoric acid, and the like.
  • Salts derived from organic acids include acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulphonic acid, ethanesulphonic acid, -toluene-sulphonic acid, salicylic acid, andthe like.
  • the oligonucleotide inhibitors of the present invention or pharmaceutical compositions comprising the oligonucleotide inhibitors may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g. by inhalation or insufflation of powders or aerosols, including by nebulizer; mtratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g. intrathecal or intraventricular, administration.
  • oligonucleotide inhibitors of the present invention may be delivered alone or in combination, and may be delivered along with a pharmaceutically acceptable vehicle. Ideally, such a vehicle would enhance the stability and/or delivery properties.
  • suitable vehicles include, but are not limited to, liposomes, microparticles or microcapsules. In various embodiments ofthe invention, the use of such vehicles may be beneficial in achieving sustained release ofthe active component.
  • the present invention also contemplates the formulation ofthe oligonucleotide inhibitors or pha ⁇ naceutical compositions comprising the oligonucleotide inhibitors into oral dosage forms such as tablets, capsules and the like.
  • the oligonucleotide inhibitors or pharmaceutical compositions comprising the oligonucleotide inhibitors can be combined with conventional carriers, such as magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatine, tragacanth, methylcellulose, sodium carboxymethyl-cellulose, low melting wax, cocoa butter and the like.
  • oligonucleotide inhibitors or pharmaceutical compositions comprising the oligonucleotide inhibitors can be encapsulated with or without other carriers. In all cases, the proportion of active ingredients in any solid and liquid composition will be at least sufficient to impart the desired activity to the individual being treated upon oral administration.
  • the present invention further contemplates parenteral injection of the oligonucleotide inhibitors or pharmaceutical compositions comprising the oligonucleotide inhibitors, in which case they are used in the form of a sterile solution containing other solutes, for example, enough saline or glucose to make the solution isotonic.
  • the oligonucleotide inhibitors or pharmaceutical compositions comprising the oligonucleotide inhibitors can be formulated into an aqueous or partially aqueous solution, which can then be utilized in the form of an aerosol.
  • the present invention also contemplates topical use ofthe oligonucleotide inhibitors or pharmaceutical compositions comprising the oligonucleotide inhibitors.
  • they can be formulated as dusting powders, creams or lotions in pharmaceutically acceptable vehicles, which are applied to affected portions ofthe skin.
  • the oligonucleotide inhibitors can be formulated as transdermal delivery devices ("patches").
  • transdermal patches can be used to provide continuous or discontinuous infusion ofthe oligonucleotide inhibitors in controlled amounts.
  • the construction and use of transdermal patches for the delivery of pharmaceutical agents is well-known in the art [see, for example, U.S. Patent 5,023,252].
  • Such patches may be constructed for continuous, pulsatile, or "on demand" delivery of pharmaceutical agents.
  • the present invention also provides for administration ofthe oligonucleotide inhibitors in the form of genetic vector constructs that are designed to direct the in vivo synthesis ofthe oligonucleotide inhibitors.
  • the nucleic acid sequence encoding the oligonucleotide inhibitor is under the control of a suitable promoter.
  • the vector construct may additionally contain other regulatory control elements known in the art. Methods of constructing and administering such genetic vector constructs for in vivo synthesis of oligonucleotide inhibitors, such as antisense oligonucleotides, are well-known in the art. For example, U.S. Patent No.
  • 6,265,167 teaches an efficient method for the introduction, expression and accumulation of antisense oligonucleotides in the cell nucleus. This method allows the antisense oligonucleotide to hybridize to the sense mRNA in the nucleus, and thereby prevents the antisense oligonucleotide being either processed or transported into the cytoplasm.
  • An alternative method of delivery involves "shotgun" delivery ofthe naked oligonucleotides across the dermal layer or directly into a region to be treated.
  • the delivery of "naked” oligonucleotides by direct injection is well-known in the art [see, for example, U.S. Patent No. 5,580,859].
  • methods of delivering oligonucleotides to a subject by coating them onto particles and accelerating the coated particles into the cells of a subject is also known in the art [see, for example, U.S. Patent Nos. 5,865,796 and 5,922,685].
  • the oligonucleotide inhibitors may be packaged in a lipid vesicle or otherwise associated with lipids prior "shotgun" delivery to the subject.
  • the dosage requirements for the oligonucleotide inhibitors ofthe present invention vary with the particular compositions employed, the route of administration, the severity ofthe symptoms presented and the particular subject being treated. Dosage requirements can be determined by standard clinical techniques, known to a worker skilled in the art. Treatment will generally be initiated with small dosages less than the optimum dose ofthe compound. Thereafter the dosage is increased until the optimum effect under the circumstances is reached. In general, the oligonucleotide inhibitors are administered at a concentration that will generally afford effective results without causing any harmful or deleterious side effects. Administration can be either as a single unit dose or, if desired, the dosage can be divided into convenient subunits that are administered at suitable times throughout the day.
  • kits containing one or more oligonucleotide inhibitors, or one or more expression vectors encoding the oligonucleotide inhibitors, in pharmaceutical compositions for use in the treatment of cancer.
  • the kits may further comprise one or more other anti-cancer therapeutics for use in combination with the oligonucleotide inhibitor(s).
  • Individual components ofthe kit would be packaged in separate containers and, associated with such containers, can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency.
  • the liquid solution can be an aqueous solution, for example a sterile aqueous solution.
  • the oligonucleotide inhibitor may be formulated into a pharmaceutically acceptable composition.
  • the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation maybe applied to an infected area ofthe subject, such as the lungs, injected into an subject, or even applied to and mixed with the other components ofthe kit.
  • kits of the invention may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement ofthe ultimate complex composition within the body ofthe subject.
  • an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.
  • kits for screening for genes whose expression is affected by an MBD2/dMTAse and which are potential target genes for cancer therapy and/or diagnosis.
  • kits comprise one or more MBD2/dMTase oligonucleotide inhibitors.
  • One or more ofthe oligonucleotides provided in the kit can incorporate a detectable label, or the kit may include reagents for labelling the oligonucleotides.
  • the kits can optionally include reagents for the isolation of RNA, reagents for the synthesis of cDNA, and / or reaction vessels.
  • One or more ofthe components ofthe kit may be lyophilised and the kit may further comprise reagents suitable for the reconstitution ofthe lyophilised components.
  • the kit can additionally contain instructions for use.
  • Oligonucleotide Sequences - Antisense DNA oligonucleotides were designed to hybridize to human MBD2 cDNAs (Al and A2 to that described in Bhattacharya, S. K., Ramchandani, S., Cervoni, N., and Szyf, M. (1999) Nature 397, 579-583 and A3- AlO to that described in Hendrich, B., and Bird, A. (1998) Mol Cell Biol 18, 6538- 6547). The sequences as follows:
  • Antisense oligonucleotides A1-A5 have a phosphorothioate (PS) backbone; A7 has a mixed phosphodiester and PS backbone, A7 also contains an inverted thymine base at the 3' end.
  • the antisense oligonucleotide AlO is a modification of oligonucleotide A7 in which a 2'O-methyl modification has been positioned on the ribose ofthe first and last 4 nucleotides.
  • Control oligonucleotide Al 1 is the reverse sequences of AlO, with oligonucleotide 1582 used as a nonspecific control for the rest ofthe experiments.
  • Oligos were selected to avoid dimers and stem loop structures as well as CpG dinucleotides (Ballas, Z. K., Krieg, A. M., Warren, T., Rasmussen, W., Davis, H. L., Waldschmidt, M., and Weiner, G. J. (2001) J Immunol 167, 4878-4886).
  • A4-A10 included the TCCC tetranucleotide motif.
  • oligonucleotides were cleared of contaminants by desalting and gel purification (A1-A6), HPLC (A7), and ion exchange HPLC (AlO, Al 1). Oligonucleotide synthesis was performed by
  • OligosEtc (A1-A7, Wilsonville, OR) and Integrated DNA Technologies (AlO, All, Coralville IA).
  • the human non-small cell lung carcinoma cell line A549 (ATCC# CCL-185), which expresses high levels of MBD2/dMTase, was treated with 200nM of either the selected antisense oligonucleotide or a scrambled control.
  • Lipofectin (6.25 ⁇ g/ml) was used as the lipid carrier. The cells were treated twice (0 and 24 h) and harvested 48 h post treatment (see protocol in B).
  • A549 non-small cell human lung carcinoma cells (ATCC# CCL-185), HCTl 16 human colon carcinoma cells (ATCC# CCL-247), MRHF human foreskin fibroblasts (Biowhittaker, Wakersville, MD) were cultured free of antibiotics in the recommended media to facilitate oligo transfection and plated at a density of
  • Antisense oligonucleotides were added to cells at a final concentration of 20, 50 or 200 nM using either 6.25 ⁇ l/ml Lipofectin for A549 cells or 4 ⁇ l/ml Lipofectamine (Invitrogen, Carlsbad CA) for HCTl 16 cells as lipid carriers.
  • the membrane was stripped and hybridized to a 32 P- labelled 18S rRNA probe as previously described (Szyf, M., Tanigawa, G., and McCarthy, P. L., Jr. (1990) Mol Cell Biol 10, 4396-4400).
  • the signals for MBD2 and 18S were quantified by densitometry and the intensity ofthe MBD2 signal was normalized to the signal obtained for 18S.
  • A549 cells were harvested after a single treatment with oligo, nuclear extracts prepared as previously described (Szyf, M., Bozovic, V., and Tanigawa, G.
  • a human non-small cell lung carcinoma cell line A549 which expresses high levels of MBD2/dMTase, was treated with increasing concentrations of either the selected antisense oligonucleotide AlO or a reverse scrambled control oligonucleotide Al 1 for 48 h.
  • An equal number of live cells were plated onto 0.33% agar with enriched medium. Colonies growing in an anchorage independent manner were counted by visual examination 3 weeks after plating to determine the anti-tumourigenic activity of the compounds. Anchorage-independent growth is an indicator of tumourigenicity. Results are shown in Figure 5.
  • A549, HCTl 16, and MRHF cells were plated at the concentration of 50,000 cells/dish. After 24 hours, cells were treated with 200 nM of control oligonucleotide All or antisense oligonucleotide AlO. Treatments were repeated after 24 h and cells were harvested 24, 48 and 72 h after the second treatment (Day 1, Day 2, Day 3, respectively). Cell viability was measured by trypan blue exclusion. Results are shown in Figure 16A - C.
  • mice Male CDl nude mice were obtained from Charles River Laboratories and used when 8-10 weeks old. Experimental procedures were carried out according to the regulations ofthe Canadian Council on Animal Care and under protocols reviewed and accepted by the McGill University Animal Care Committee.
  • EXAMPLE 5 Inhibition of Tumour Cell Growth in vivo by Oligonucleotide Inhibitors ofMBD2/dMTase
  • Male CDl nude mice were obtained from Charles River Laboratories and used when 8-10 weeks old. Experimental procedures were carried out according to the regulations ofthe Canadian Council on Animal Care and under protocols reviewed and accepted by the McGill University Animal Care Committee.
  • Tumour volumes are measured throughout the experiment to monitor the progress of tumour growth and the results are shown in Figure 9.
  • the number of tumour-free animals was also assessed and the results are shown in Figure 10.
  • the general toxic effect of antisense oligonucleotide AlO and control oligonucleotide Al 1 was evaluated by measuring the effect on animal body weight as shown in Figure 12. Following sacrifice ofthe animals at day 30, the tumours were harvested and weighed. The average weights and relative sizes ofthe excised tumours are shown in Figures 11 and 13, respectively. A significant decrease was observed in the weight and size of those tumours harvested from the mice treated with antisense oligonucleotide AlO relative to those harvested from mice treated with the control oligonucleotide.
  • EXAMPLE 6 Inhibition of Tumour Cell Growth in vivo by Oligonucleotide Inhibitors of MBD2/dMTase #2
  • mice 2.5x10 naive A549 or HCTl 16 cells were injected subcutaneously into B ALB/cAnNCrl-nuBR nude mice. Three days post implantation, when solid tumours were already visible, the mice (8 per group) were injected via tail vein 3 times per week with control oligonucleotide Al 1 or antisense oligonucleotide AlO, at doses of 2, 4, or 8 mg/kg dissolved in 100 ⁇ l sterile PBS. The mice were monitored for tumour growth 3 times per week, and tumor volume was estimated by using V— (L .
  • L is the length and the width of a xenograft (Bandyopadhyay, A., Lopez-Casillas, F., Malik, S. N., Montiel, J. L., Mendoza, V., Yang, J., and Sun, L. Z. (2002) Cancer Res 62, 4690-4695) and observed for cachexia, lethargy, lesions and other signs of toxicity.
  • the mice were sacrificed after 24 or 29 d by exsanguination and their blood was analyzed for liver and kidney function as well as hemocyotology. A549 cells were more sensitive to systemic antisense treatment than in vitro treatment.
  • Antisense oligonucleotide AlO also reduced tumour growth of HCTl 16 colon cancer cells in nude mice ( Figure 14B - experimental as described above for A549 cells). HCTl 16 cells appeared to be extremely sensitive to reductions in MBD2 as indicated by the complete regression of tumours in some mice at each dose concentration ( Figure 14D). Maximal effect on HCT 116 was achieved at a dose of 8mg/kg. Numbers of tumour-free mice for 2, 4, and 8 mg/kg groups were 5/8, 7/8, 8/8 for AlO, and 1/8, 1/6 and 1/8 for Al 1 treatments. Two mice in the Al 1 4 mg/kg group died of cachexia, perhaps due to tumour burden. None ofthe antisense treated mice implanted with HCTl 16 cells died before sacrifice. A dose dependent reduction in tumour mass with AlO antisense treatment was observed when the tumour mass was determined following sacrifice ofthe animals ( Figures 15 and 13B).
  • RBC red blood cells
  • WBC white blood cells
  • AST aspartate aminotransferase
  • ALT -alanine aminotransferase.
  • Errors are SEM for 14-16 mice per group.
  • Hemoglobin (g/1) 152.88 ⁇ 4.3 154.75 ⁇ 3.3 156.81 ⁇ 3.2 149.46 ⁇ 2.0 153.02 ⁇ 1.6 154.81 ⁇ 3.1
  • the assay is based on the fact that in vitro methylation of vector CMV-GFP followed by transfection into HEK cells treated with the histone deacetylase inhibitor trichostatin A, results in demethylation ofthe vector DNA by endogenous demethylase [Cervoni, N. & Szyf, M., (2001) J Biol Chem., 276:40778 - 40787].
  • the methylated form of CMV-GFP is not expressed by the cells, whereas the demethylated form is expressed and the GFP protein is readily detected by live fluorescence microscopy.
  • HEK cells treated with trichostatin A and transfected with vector CMV-GFP are grown in 96 well plates and are treated with oligonucleotide inhibitors of
  • MBD2/dMTase 96 hours after initiation of treatment, the level of inhibition is determined by counting fluorescence-expressing cells by microscopy as previously described.
  • the assay can be conducted rapidly by reading the fluorescence ofthe expressed GFP using a fluorometer with a 96 well plate reader.
  • Affymetrix huGene FITM arrays (Affymetrix, Santa Clara, CA) are used for expression profiling.
  • RNA is prepared from cells treated with MBD2/dMTase oligonucleotide inhibitors and from control cells as described above.
  • cDNA is synthesised from the isolated ⁇ oly(A)+ mRNA using Superscript Choice kit (GBCO/BRL).
  • cRNA is prepared in an in vitro transcription reaction in the presence of biotin- 11 -CTP and biotin- 16-CTP using T7 polymerase (Megascript kit, Ambion). Arrays are hybridised with the biotinylated in vitro transcription products for 16 hours at 45°C using the manufacturer's hybridization buffer.
  • a two-step protocol is used to detect hybridization intensity, consisting of primary incubation of arrays with a streptavidin- phycoerythrin conjugate followed by a labelling step with a goat anti-streptavidin antibody (Vector).
  • the array chips are then scanned and the digitised image data is processed with the GeneCliipTM software (Affymetrix) to identify genes that are up- or downregulated in response to treatment with the oligonucleotide inhibitors.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Oligonucleotide inhibitors that inhibit expression of a mammalian MBD2/DNA demethylase (MBD2/dMTase) are provided. The oligonucleotide inhibitors can be used to inhibit the growth or proliferation of tumour cells in vitro and in vivo. The use of the oligonucleotide inhibitors in the treatment of cancer and methods of identifying potential target genes for cancer therapy or diagnosis using the oligonucleotide inhibitors are also provided.

Description

OLIGONUCLEOTIDE INHIBITORS OF MBD2/DNA DEMETHYLASE AND USES THEREOF
FIELD OF THE INVENTION
The present invention pertains to the fields of cancer therapy and in particular, to oligonucleotide inhibitors of MBD2/dMTase and their use in the treatment of cancer.
BACKGROUND
The epigenome is the physiological template ofthe genetic information in all eukaryotic cells [Jenuwein, T. and Allis, CD. (2001) Science 293:1074-1080]. The epigenome formats the genetic information by either presenting an accessible structure that can be expressed or by forming an inaccessible structure that cannot be accessed and thus is silenced. The epigenome comprises two major components: a group of proteins called histones that package the DNA into either accessible or inaccessible formats called chromatin, and a coating of methyl groups that are covalently bound to the DNA molecule itself. A long line of data has established that aberrations ofthe epigenome are a hallmark of all tumour cells, with one ofthe clear aberrations being global hypomethylation of DNA [Szyf, M. (1996) Pharmacol TJier 70:1-37].
DNA methylation is catalysed by the enzyme DNA methyltransferase and occurs via transfer of methyl groups from S-adenosyl methionine to the 5' position of cytosine residues [Adams, R.L. et al. (1984) Curr Top Microbiol Immunol 108:142-156]. This process was previously believed to be irreversible, however, a protein exhibiting demethylase activity has recently been identified. The cDNA encoding this methylated DNA binding protein has been cloned and purified [Bhattacharya, S.K. et al. (1999) Nature 397:579-583], and the encoded DNA demethylase, also referred to as MBD2, has been shown to exhibit an activity that can reverse the DNA methylation reaction and hence act as a bonaβde demethylase [Ramchandani, S. et al. (1999) Proc Natl Acad Sci USA 96:6107-6112; Scanlan, MJ. et al. (1998) IntJ Cancer 76:652-658]. A possible role for DNA demethylase in cancer has been suggested. For example, a nonbiased screen for highly enriched antigens in humans with colorectal cancer uncovered a cDNA identical to that encoding the demethylase protein [Vilain, A. et al. (1999) FEBSLett 460:231-234]. hi addition, a recent study of demethylase mRNA expression in various breast cancer cell lines demonstrated a correlation between the level of genome hypomethylation, aberrant chromosomes and expression ofthe cDNA encoding demethylase [Hattori, M. et al. (2001) JIntMedRes 29:204-213]. Similarly, a correlation between malignancy, expression of MBD2/demethylase and demethylation in ovarian cancer has been demonstrated [Hattori, M. et al. (2001) Cancer Lett 169: 155-164; Kanai, Y. et al. (1999) Biochem Biophys Res Commun 264:962-966].
Expression of a reverse-oriented full-length ιnbd2/dMTaso cDNA in human embryonic kidney (HEK) cells has been shown to inhibit anchorage-independent growth of these cells in vitro [International Patent Application No. WO 99/24583]. However, such a large expression construct has limited use in vivo due to such factors as rapid degradation ofthe expressed transcript by nucleases and poor bioavailability.
This background information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention.
SUMMARY OF THE INVENTION
An object ofthe present invention is to provide small oligonucleotide MBD2/dMTase inhibitors, h accordance with one aspect ofthe present invention, there is provided an oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, wherein said oligonucleotide inhibitor, or analogue thereof, inhibits expression of a mammalian MBD2/demethylase gene.
hi accordance with another aspect ofthe present invention, there is provided an oligonucleotide inhibitor, or an analogue thereof, of less than about 100 nucleotides in length comprising at least 7 consecutive nucleotides from the sequence as set forth in any one of SEQ ID NOs: 5, 6, 7, 8, 9, 10, 11 or 12.
accordance with another aspect ofthe present invention, there is provided a vector comprising an oligonucleotide inhibitor of MBD2/dMTase.
h accordance with another aspect ofthe present invention, there is provided a host cell comprising an oligonucleotide inhibitor of MBD2/dMTase, or comprising a vector comprising the oligonucleotide inhibitor.
i accordance with a further aspect ofthe present invention, there is provided a pharmaceutical composition comprising an oligonucleotide inhibitor of MBD2/dMTase, or comprising a vector comprising the oligonucleotide inhibitor.
In accordance with still another aspect ofthe present invention, there is provided a use of an oligonucleotide inhibitor of MBD2/dMTase, or a vector comprising the oligonucleotide inhibitor, in the manufacture of a medicament.
In accordance with still another aspect ofthe present invention, there is provided a use of an oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, to inhibit the growth of cancer cells in a mammal in need thereof.
In accordance with still another aspect ofthe present invention, there is provided a use of an oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, to inhibit the proliferation of cancer cells in a mammal in need thereof.
In accordance with still another aspect ofthe present invention, there is provided a use of an oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, in the treatment of cancer in a mammal.
h accordance with still another aspect ofthe present invention, there is provided a use of an oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, in the prophylactic treatment of a mammal to prevent a familial cancer.
accordance with still another aspect ofthe present invention, there is provided a method of identifying target genes for cancer therapy comprising treating a cell with one or more oligonucleotide inhibitor of a mammalian MBD2/demethylase gene, analysing gene expression in the treated cell and comparing the gene expression with gene expression in a control cell not treated with said oligonucleotide inhibitor, wherein a difference in gene expression between the treated cell and the control cell is indicative of one or more target gene.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 presents an alignment ofthe nucleic acid sequences for demethylase 1 (dMTase 1 or MBD2) cDNA from human (top line; SEQ ID NO:l) and mouse (lower line; SEQ ID NO:3). The coding strand is shown. The centre line shows the consensus sequence.
Figure 2 presents an alignment ofthe amino acid sequence of demethylase 1 (dMTase 1 or MBD2) from human (top line; SEQ ID NO:2) and mouse (lower line; SEQ ID NO:4). The centre line shows the consensus sequence.
Figure 3 depicts the nucleic acid sequences for antisense oligonucleotides Al [SEQ ID NO: 5], A2 [SEQ ID NO: 6], A3 [SEQ ID NO: 7], A4 [SEQ ID NO: 8], A5 [SEQ IIDD NO: 9], A6 [SEQ ID NO: 10], A7 [SEQ ID NO: 11] and AlO [SEQ ID NO: 12], and their positions relative to the MBD2/dMTase open reading frames.
Figure 4 illustrates the inhibition of MBD2/dMTase mRNA expression in non-small cell lung carcinoma cells after treatment with antisense oligonucleotide A3, A4, A5, A6 or A7, or with scrambled control oligonucleotide 1582 [SEQ ID NO: 14].
Figure 5 presents the results of treatment of human non-small lung cancer cells (cell- line A549) with increasing concentrations of MBD2/dMTase antisense oligonucleotides AlO and the reverse scrambled control Al 1 [SEQ ID NO: 13]. Figure 6 presents the results of treatment of human colorectal carcinoma cells (cell- line HCT 116) with either the MBD2/dMTase antisense oligonucleotide AlO or the reverse scrambled control Al 1.
Figure 7 (A) illustrates the change in tumour volume and (B) demonstrates the relative tumour mass of in vivo xenografts of the human non-small lung cancer cell- line A549 in nude mice. The cell-line was treated in vitro with either antisense oligonucleotide AlO or control scrambled oligonucleotide Al 1 prior to transplantation.
Figure 8 illustrates (A) the change in tumour volume for a single treatment group (B) the change in tumour volume for a double treatment group, (C) the relative tumour mass and (D) the number of tumour-free animals per treatment for nude mice carrying in vivo xenografts ofthe human colorectal carcinoma cell-line HCT 116. The cell-line was treated in vitro with either antisense oligonucleotide AlO or control scrambled oligonucleotide Al 1 prior to implantation.
Figure 9 presents the results of treatment of in vivo xenografts of the human non- small lung cancer cell-line A549 in nude mice with varying concentrations of either antisense oligonucleotide AlO or control scrambled oligonucleotide Al 1.
Figure 10 depicts the increase in percentage of tumour-free animals following treatment of in vivo xenografts ofthe human non-small lung cancer cell-line A549 in nude mice with antisense oligonucleotide AlO.
Figure 11 depicts the decrease in tumour weight following treatment of in vivo xenografts ofthe human non-small lung cancer cell-line A549 in nude mice with antisense oligonucleotide AlO.
Figure 12 demonstrates that antisense oligonucleotide AlO does not cause overt toxicity in nude mice.
Figure 13 depicts the reduction in tumour size following treatment of in vivo xenografts of (A) the human non-small lung cancer cell-line A549, and (B) the human colorectal carcinoma cell-line HCT 116, in nude mice with antisense oligonucleotide AlO.
Figure 14 (A) depicts the inhibition of in vivo xenografts ofthe human colorectal carcinoma cell-line HCT116 after in vitro treatment with either antisense oligonucleotide AlO or control scrambled oligonucleotide Al 1 prior to implantation. Graph shows average tumour volume and mass (in inset) +/- SEM . Stars above the bars indicate statistical significance of p<0.05 (two-sided student t-test). (B) shows inhibition of growth of naϊve HCT116 cells implanted into nude mice by antisense oligonucleotide AlO in a dose-dependent fashion. (C) and (D) show complete tumour regression in mice with xenografts of A549 and HTl 16 cells, respectively, following treatment with antisense oligonucleotide AlO.
Figure 15 depicts the decrease in tumour weight following treatment of in vivo xenografts ofthe human colorectal carcinoma cell line HCT116 in nude mice with antisense oligonucleotide AlO. Stars above the bars indicate statistical significance (two-sided student t-test).
Figure 16 depicts the growth curves of MRHF (A), A549 (B), and HCT116 (C) following treatment with AlO (open squares) or Al 1 (solid squares), or mock transfection (open circles) (averages of three replicates + SEM). (D) demonstrates that antisense oligonucleotide AlO has no effect on cell cycle progression of A549 cells; error bars are SEM for triplicate transfections.
Figure 17 (A) presents representative Northern blots measuring MBD2/dMTase expression in A549 and HCT116 cells following treatment with antisense oligonucleotide AlO or control oligonucleotide Al 1 and quantification of these blots (B). (C) presents Western blots of nuclear extracts from AlO antisense versus Al 1 control treated A549 cells. Nonspecific protein staining shown below as a measure of equal protein loading.
DETAILED DESCRIPTION OF THE INVENTION The present invention provides oligonucleotide inhibitors of MBD2/dMTase. The oligonucleotide inhibitors inhibit expression ofthe mbd2/dMTase gene and decrease the growth of tumour cells in vitro and in vivo. The oligonucleotide inhibitors of MBD2/dMTase provided by the present invention are thus useful in anti-cancer therapy.
Inhibition of MBD2/dMTase affects the expression of other genes that may be involved in the growth and or proliferation of tumour cells, Therefore, the present invention further provides for methods to identify other genes that are potential targets for cancer therapy or diagnosis using the oligonucleotide inhibitors.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
The term "corresponds to" as used herein with reference to nucleic acid sequences means a polynucleotide sequence that is identical to all or a portion of a reference polynucleotide sequence. In contradistinction, the term "complementary to" is used herein to mean that the polynucleotide sequence is identical to all or a portion ofthe complement of a reference polynucleotide sequence. For illustration, the nucleotide sequence "TAT AC" corresponds to a reference sequence "TATAC" and is complementary to a reference sequence "GTATA."
The following terms are used herein to describe the sequence relationships between two or more polynucleotides: "reference sequence," "window of comparison," "sequence identity," "percentage of sequence identity," and "substantial identity." A "reference sequence" is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence, or may comprise a complete cDNA or gene sequence. Generally, a reference sequence is at least 20 nucleotides in length, and often at least 50 nucleotides in length. A "window of comparison", as used herein, refers to a conceptual segment ofthe reference sequence of at least 15 contiguous nucleotide positions wherein a polynucleotide sequence maybe compared to a reference sequence of at least 15 contiguous nucleotides and wherein the portion ofthe polynucleotide sequence in the window of comparison may comprise additions or deletions (i.e. gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment ofthe two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted using the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482, the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, the search for similarity method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. (U.S.A.) 85:2444, or computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 573 Science Dr., Madison, WI), or by inspection. The best alignment (i. e. resulting in the highest percentage of identity over the comparison window) generated by the various methods is then selected.
The term "sequence identity" means that two polynucleotide sequences are identical (i.e. on a nucleotide-by-nucleotide basis) over the window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleotide (e.g. A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e. the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
The term "substantial identity" as used herein denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 50 percent sequence identity as compared to a reference sequence over the window of comparison. MBD2/DNA Demethylase (MBD2/dMTase)
The oligonucleotide inhibitors according to the present invention are targeted to a mammalian MBD2/dMTase gene. The sequences for MBD2/dMTase genes isolated from human and from mouse are known in the art (see, for example, International Patent Application WO99/24583 and Genbank Accession Nos NM_003927 and NM__015832 (human) and NM 010773 (mouse)) and are provided herein (MBD2/dMTase 1, SEQ ID NOs: 1, 3 and 15). Other MBD2/dMTase gene sequences can be readily obtained by one skilled in the art, for example, by conducting BLASTN searches of GenBank or other publicly available databases using the sequences provided herein, or by standard molecular biology techniques utilising isolated cellular DNA or RNA, or commercially available cDNA libraries, and the sequences provided herein, or portions thereof, as hybridization probes.
In one embodiment ofthe present invention, the oligonucleotide inhibitors are targeted to a human MBD2/dMTase 1 gene. In another embodiment, the oligonucleotide inhibitors are targeted to the human MBD2/dMTase 1 gene shown in SEQ ID NOs: 1 or 15. hia further embodiment, the oligonucleotide inhibitors are targeted to the mouse MBD2/dMTase 1 gene [SEQ ID NO:3].
Oligonucleotide Inhibitors of MBD2/dMTase
In the context ofthe present invention, the term "oligonucleotide inhibitor" encompasses antisense oligonucleotides, short interfering RNA (siRNA) molecules and ribozymes.
The term "oligonucleotide" as used herein refers to an oligomer or polymer of ribonucleic acid (RNA), deoxyribonucleic acid (DNA), or modified versions thereof, or RNA or DNA mimetics. This term, therefore, includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions, which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for the nucleic acid target and increased stability in the presence of nucleases. The tenn also includes chimeric oligonucleotides. Chimeric oligonucleotides are oligonucleotides that contain two or more chemically distinct regions; each region comprising at least one monomer unit. The oligonucleotides according to the present invention can be single-stranded or they can be double- stranded.
As is known in the art, a nucleoside is a base-sugar combination and a nucleotide is a nucleoside that further includes a phosphate group covalently linked to the sugar portion ofthe nucleoside. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound, with the normal linkage or backbone of RNA and DNA being a 3' to 5' phosphodiester linkage. The oligonucleotide inhibitors ofthe invention include those containing modified backbones or non-natural internucleoside linkages. As defined herein, oligonucleotides having modified backbones include both those that retain a phosphorus atom in the backbone and those that lack a phosphorus atom in the backbone. For the purposes ofthe present invention, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleotides.
Exemplary modified oligonucleotide backbones that can be incorporated into the oligonucleotides according to the present invention include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'- alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, tliionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogues of these, and analogues having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5 -3' or 2-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.
Exemplary modified oligonucleotide backbones that do not include a phosphorus atom are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. Such backbones include morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulphide, sulphoxide and sulphone backbones; formacetyl and thiofonnacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulphamate backbones; methyleneimino and methylenehydrazino backbones; sulphonate and sulphonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
The term "alkyl" as used herein refers to monovalent alkyl groups having from 1 to 20 carbon atoms. In one embodiment ofthe present invention, the alkyl group has between 1 and 6 carbon atoms. Examples of suitable alkyl groups include, but are not limited to, methyl, ethyl, rø-propyl, ώO-propyl, ra-butyl, iso-butyl, «-hexyl, and the like.
The term "cycloalkyl" refers to cyclic alkyl groups of from 3 to 20 carbon atoms having a single cyclic ring or multiple condensed rings. Examples of suitable cycloalkyl groups include, but are not limited to, single ring structures such as cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and the like, or multiple ring structures such as adamantanyl, and the like.
The present invention also contemplates oligonucleotide mimetics in which both the sugar and the internucleoside linkage ofthe nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target. An example of such an oligonucleotide mimetic, which has been shown to have excellent hybridization properties, is a peptide nucleic acid (PNA) [Nielsen et al., Science, 254:1497-1500 (1991)]. In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide-containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza-nitrogen atoms ofthe amide portion ofthe backbone.
The present invention also contemplates oligonucleotides comprising "locked nucleic acids" (LNAs), which are conformationally restricted oligonucleotide analogues containing a methylene bridge that connects the 2'-O of ribose with the 4'-C (see, Singh et al, Chem. Commun., 1998, 4:455-456). LNA and LNA analogues display very high duplex thermal stabilities with complementary DNA and RNA, stability towards 3'-exonuclease degradation, and good solubility properties. Synthesis ofthe LNA analogues of adenine, cytosine, guanine, 5-methylcytosine, thymine and uracil, their oligomerization, and nucleic acid recognition properties have been described (see Koshkin et al, Tetrahedron, 1998, 54:3607-3630). Studies of mis-matched sequences show that LNA obey the Watson-Crick base pairing rules with generally improved selectivity compared to the corresponding unmodified reference strands. Antisense oligonucleotides containing LNAs have been described (Wahlestedt et al, Proc. Natl. Acad. Sci. U. S. A., 2000, 97:5633-5638), which were efficacious and non-toxic, h addition, the LNA/DNA copolymers were not degraded readily in blood serum and cell extracts.
LNAs form duplexes with complementary DNA or RNA or with complementary LNA, with high thermal affinities. The universality of LNA-mediated hybridization has been emphasized by the formation of exceedingly stable LNA:LNA duplexes (Koshkin et al, J. Am. Chem. Soc, 1998, 120:13252-13253). LNA:LNA hybridization was shown to be the most thermally stable nucleic acid type duplex system, and the RNA-mimicking character of LNA was established at the duplex level. Introduction of three LNA monomers (T or A) resulted in significantly increased melting points toward DNA complements.
Synthesis of 2'-amino-LNA (Singh et al., J. Org. Chem., 1998, 63, 10035-10039) and 2'-methylamino-LNA has been described and thermal stability of their duplexes with complementary RNA and DNA strands reported. Preparation of phosphorothioate- LNA and 2'-thio-LNA have also been described (Kumar et al, Bioorg. Med. Chem. Lett, 1998, 8:2219-2222).
Modified oligonucleotides according to the present invention may also contain one or more substituted sugar moieties. For example, oligonucleotides may comprise sugars with one ofthe following substituents at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and aikynyl may be substituted or unsubstituted C\ to C10 alkyl or C2 to C10 alkenyl and alkynyl. Examples of such groups are: O[(CH2)n O]m CH3, O(CH2)n OCH3, O(CH2)n NH2, O(CH2)n CH3, O(CH2)n ONH2, and O(CH2)n ON[(CH2)n CH3)]2, where n and m are from 1 to about 10. Alternatively, the oligonucleotides may comprise one ofthe following substituents at the 2' position: d to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, CF3, OCF3, SOCH3, SO2 CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. Specific examples include 2'-O-methyl (2'-O-CH3), 2'-methoxyethoxy (2*-O-CH2 CH2 OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) [Martin et al, Helv. Chim. Ada, 78:486- 504(1995)], 2'-dimethylaminooxyethoxy (2'-O(CH2)2 ON(CH3)2 group, also known as 2'-DMAOE), 2'-aminopropoxy (2'-OCH2 CH2 CH2NH2) and 2'-fluoro (2'-F).
Similar modifications may also be made at other positions on the oligonucleotide, for example at the 3' position ofthe sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also comprise sugar mimetics such as cyclobutyl moieties in place ofthe pentofuranosyl sugar.
Oligonucleotides according to the present invention may also include modifications or substitutions to the nucleobase. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C); inosine; 5- hydroxymethyl cytosine; xanthine; hypoxanthine; 2-arninoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-ρropyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine and 2-thiocytosine; 5-halouracil and cytosine; 5-propynyl uracil and cytosine; 6-azo uracil, cytosine and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines; 5-halo particularly 5-bromo, 5- trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7- methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and 7-deazaadenine; 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808; The Concise Encyclopaedia Of Polymer Science And Engineering, (1990) pp 858-859, Kroschwitz, J. I., ed. John Wiley & Sons; Englisch et al, Angewandte Chemie, Int. Ed., 30:613 (1991); and Sanghvi, Y. S., (1993) Antisense Research and Applications, pp 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press. Certain of these nucleobases are particularly useful for increasing the binding affinity ofthe oligomeric compounds ofthe invention. These include 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyιuracil and 5-propynylcytosine. 5- methylcy osine substitutions have been shown to increase nucleic acid duplex stability by 0.6 - 1.2°C [Sanghvi, Y. S., (1993) Antisense Research and Applications, pp 276- 278, Crooke, S. T. and Lebleu, B., ed., CRC Press, Boca Raton].
Another oligonucleotide modification included in the present invention is the chemical linkage to the oligonucleotide of one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake ofthe oligonucleotide. Such moieties include, but are not limited to, lipid moieties such as a cholesterol moiety [Letsinger et al, Proc. Natl. Acad. Sci. USA, 86:6553-6556 (1989)], cholic acid [Manoharan et al, Bioorg. Med. Chem. Let., 4:1053-1060 (1994)], a thioether, e.g. hexyl-S-tritylthiol [Manoharan et al, Ann. N.Y. Acad. Sci., 660:306-309 (1992); Manoharan et al, Bioorg. Med. Chem. Lett, 3:2765-2770 (1993)], a thiocholesterol [Oberhauser et al, Nucl Acids Res., 20:533-538 (1992)], an aliphatic chain, e.g. dodecandiol or undecyl residues [Saison-Behmoaras et al., EMBOJ., 10:1111-1118 (1991); Kabanov et al, FEBSLett, 259:327-330 (1990); Svinarchuk et al, Biochimie, 75:49-54 (1993)], a phosphohpid, e.g. di-hexadecyl-rac-glycerol or triethylammom'um l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate [Manoharan et al, Tetrahedron Lett, 36:3651-3654 (1995); Shea et al, Nucl Acids Res., 18:3777-3783 (1990)], a polyamine or a polyethylene glycol chain [Manoharan et al, Nucleosides & Nucleotides, 14:969-973 (1995)], or adamantane acetic acid [Manoharan et al, Tetrahedron Lett, 36:3651-3654 (1995)], a palmityl moiety [Mishra et al, Biochim. Biophys. Acta, 1264:229-237 (1995)], or an octadecylamine or hexylamino-carbonyl- oxycholesterol moiety [Crooke et al, J. Pharmacol. Exp. Ther., 277:923-937 (1996)].
One skilled in the art will recognise that it is not necessary for all positions in a given oligonucleotide to be uniformly modified. The present invention, therefore, contemplates the incorporation of more than one ofthe aforementioned modifications into a single oligonucleotide or even at a single nucleoside within the oligonucleotide.
As indicated above, oligonucleotides that are chimeric compounds are included within the scope ofthe present invention. Chimeric oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region ofthe oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
In the context ofthe present invention, an oligonucleotide is "nuclease resistant" when it has either been modified such that it is not susceptible to degradation by DNA and RNA nucleases or, alternatively, has been placed in a delivery vehicle which itself protects the oligonucleotide from DNA or RNA nucleases. Nuclease resistant oligonucleotides include, for example, methyl phosphonates, phosphorothioates, phosphorodithioates, phosphotriesters, and morpholino oligomers. Suitable delivery vehicles for conferring nuclease resistance include, for example, liposomes.
The present invention further contemplates oligonucleotides that contain groups for improving the pharmacokinetic and/or pharmacodynamic properties ofthe oligonucleotide.
i) Antisense Oligonucleotides
The term "antisense oligonucleotide" as used herein indicates an oligonucleotide having a nucleotide sequence that is complementary to a portion ofthe mRNA transcribed from the gene of interest. In the context ofthe present invention, the gene of interest is the gene encoding a mammalian MBD2/dMTase.
Antisense oligonucleotides are targeted to specific nucleic acids. "Targeting" an antisense oligonucleotide to a particular nucleic acid, in the context ofthe present invention, is amultistep process that usually begins with the identification of a nucleic acid sequence whose function is to be modulated, hi the context ofthe present invention, the target is the gene encoding a mammalian MBD2/dMTase, or the mRNA transcribed from a mammalian MBD2/dMTase gene. As described above, sequences for mammalian MBD2/dMTase genes are known in the art or are readily obtainable. The targeting process also includes determination of a site, or sites, within this nucleic acid sequence for the antisense interaction to occur such that the desired effect, i.e. modulation of expression ofthe gene, will result. Once the target site, or sites, has been identified, oligonucleotides are chosen that are sufficiently complementary (i.e. hybridize with sufficient strength and specificity) to the target to give the desired result.
Generally, there are five regions of a gene that may be targeted for antisense modulation: the 5' untranslated region (5'-UTR), the translation initiation (or start) codon region, the open reading frame (ORF), the translation termination (or stop) codon region and the 3' untranslated region (3'-UTR).
The terms "translation initiation codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine in eukaryotes. It is also known in the art that eukaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context ofthe present invention, "start codon" and "translation initiation codon" refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding MBD2/dMTase regardless ofthe sequence(s) of such codons.
As is known in the art, some eukaryotic transcripts are directly translated, however, most mammalian genes, or open reading frames (ORFs), contain one or more sequences, known as "introns," which are excised from a transcript before it is translated. The expressed (unexcised) portions ofthe ORF are referred to as "exons" and are spliced together to form an mRNA transcript (Alberts et al, (1983) Molecular Biology ofthe Cell, Garland Publishing Inc., New York, pp. 411-415). In the context ofthe present invention, both introns and exons may serve as targets for antisense. In some instances, an ORF may also contain one or more sites that may be targeted for antisense due to some functional significance in vivo. Examples ofthe latter types of sites include intragenic stem-loop structures (see, for example, U.S. Pat. No. 5,512,438) and, in unprocessed mRNA molecules (primary transcripts), intron/exon splice sites. As is known in the art, primary RNA transcripts can be alternatively processed in vivo depending on the splicing ofthe exons and can, therefore, give rise to alternatively spliced mRNA molecules which correspond to the same gene but differ in structure. In addition, mRNA molecules possess a 5' cap region that may also serve as a target for antisense. The 5' cap of a mRNA comprises an N -methylated guanosine residue joined to the 5'-most residue ofthe mRNA via a 5'-5' triphosphate linkage. The 5' cap region of a mRNA is considered to include the 5' cap structure itself as well as the first approximately 50 nucleotides adjacent to the cap.
Thus, the antisense oligonucleotides according to the present invention can be complementary to regions of a complete MBD2/dMTase gene including the introns, to the primary mRNA transcript of a MBD2/dMTase gene or to one or more ofthe final, spliced versions ofthe mRNA from a MBD2/dMTase gene.
The antisense oligonucleotides in accordance with the present invention are selected from a sequence complementary to a mammalian MBD2/dMTase gene such that the sequence exhibits the least likelihood of forming duplexes, hair-pins, or of containing homooligomer / sequence repeats. One skilled in the art will appreciate that these properties can be determined qualitatively using various computer modelling programs, for example, the program OLIGO® Primer Analysis Software, Version 5.0 (distributed by National Biosciences, Inc., Plymouth, MN).
The oligonucleotide may further contain a GC clamp. The oligonucleotides may also comprise a TCCC motif. The presence of such a motif in an antisense oligonucleotide has been shown increase the likelihood that the mRNA:DNA duplex will undergo RNase H-mediated degradation. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. In antisense therapy, therefore, activation of RNase H results in cleavage ofthe mRNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression.
Antisense oligonucleotides can also be selected that are complementary to a nucleic acid sequence which constitutes a region of a MBD2/dMTase gene that is highly conserved between the MBD2/dMTase genes of two or more species. These properties can be determined, for example, using the BLASTN program (Altschul, et al, (1990) J. Mol. Biol, 215:403-10) ofthe University of Wisconsin Computer group (GCG) software (Devereux. et al, (1984) Nucleic Acids Res., 12:387-395) with the National Center for Biotechnology Information (NCBI) databases.
It is understood in the art that an antisense oligonucleotide need not have 100% identity with the complement of its target sequence in order to be effective. The antisense oligonucleotides in accordance with the present invention, therefore, have a sequence that is at least about 60% identical to the complement ofthe target sequence. In one embodiment ofthe present invention, the antisense oligonucleotides have a sequence that is at least about 70% identical to the complement ofthe target sequence. In another embodiment, the antisense oligonucleotides have a sequence that is at least about 80% identical to the complement of the target sequence. In other embodiments, they have a sequence that is at least about 90% identical or at least about 95% identical to the complement ofthe target sequence. Identity can be determined, for example, by using the BLASTN program ofthe University of Wisconsin Computer Group (GCG) software and allows for gaps or mismatches of several bases.
h order for the antisense oligonucleotides ofthe present invention to function in inhibiting expression ofthe MBD2/dMTase gene, it is necessary that they demonstrate adequate specificity for the target sequence and do not bind to other nucleic acid sequences in the cell. Therefore, in addition to possessing an appropriate level of sequence identity to the complement ofthe target sequence, the antisense oligonucleotides ofthe present invention should not closely resemble other known sequences. The antisense oligonucleotides ofthe present invention, therefore, should be less than 50% identical to any other mammalian nucleic acid sequence. The identity ofthe antisense oligonucleotides ofthe present invention to other sequences can be determined, for example, through the use ofthe BLASTN program and the NCBI databases as indicated above.
The antisense oligonucleotides according to the present invention typically between about 7 and about 100 nucleotides in length. In one embodiment, the antisense oligonucleotides comprise from about 7 to about 50 nucleotides, or nucleotide analogues, hi another embodiment, the antisense oligonucleotides comprise from about 12 to about 50 nucleotides, or nucleotide analogues, other embodiments the antisense oligonucleotides comprise from about 7 to about 35 nucleotides, or nucleotide analogues, from about 12 to about 35 nucleotides, or nucleotide analogues, and from about 18 to about 25 nucleotides, or nucleotide analogues.
In a further embodiment ofthe present invention, the antisense oligonucleotides comprise at least 7 consecutive nucleotides from a nucleic acid sequence as set forth in any one of SEQ ID NOs: 5 - 12, or an analogue thereof.
TABLE 1: Antisense oligonucleotides to υabάl/dMTase
Figure imgf000020_0001
In another embodiment ofthe present invention, the antisense oligonucleotides comprise one or more phosphorothioate backbone linkages. In still another embodiment, all backbone linkages in the antisense oligonucleotide are phosphorothioate linkages. In yet another embodiment ofthe present invention, the antisense oligonucleotides are chimeric molecules comprising one or more phosphorothioate backbone linkages and one or more 2'-O-methyl modified bases. ii) Short Interfering RNA (siRNA) Molecules
RNA interference mediated by short interfering double-stranded RNA molecules (siRNA) is known in the art to play an important role in post-transcriptional gene silencing [Zamore, Nature Struc. Biol, 8:746-750 (2001)]. siRNA molecules are typically 21-22 base pairs in length and are generated in nature when long double- stranded RNA molecules are cleaved by the action of an endogenous ribonuclease. Recently, it has been demonstrated that transfection of mammalian cells with synthetic siRNA molecules having a' sequence identical to a target gene leads to a reduction in the mRNA levels ofthe target gene [Elbashir, et al. Nature, 411:494-498 (2001)].
The oligonucleotide inhibitors according to the present invention can be siRNA molecules which are targeted to a mammalian MBD2/dMTase gene such that the sequence ofthe siRNA corresponds to a portion ofthe MBD2/dMTase gene. As is known in the art, effective siRNA molecules are typically less than 30 base pairs in length to help prevent them triggering non-specific RNA interference pathways in the cell via the interferon response, h accordance with the present invention, the siRNA molecules are between about 15 and about 30 nucleotides in length. In one embodiment, the siRNA molecules are between about 15 and about 25 base pairs in length, hi another embodiment, they are between 19 and 22 base pairs in length.
The double-stranded siRNA molecules can further comprise poly-T or poly-U overhangs at the 3' and 5' ends to minimise RNase-mediated degradation ofthe molecules. Thus, in another embodiment ofthe present invention, the siRNA molecules comprise overhangs at the 3' and 5' ends which consist of two thymidine or two uridine residues. Design and construction of siRNA molecules is known in the art [see, for example, Elbashir, et al, Nature, 411:494-498 (2001); Bitko and Barik, BMC Microbiol, 1 :34 (2001)]. In addition, kits that provide a rapid and efficient means of constructing siRNA molecules by in vitro transcription are also commercially available (Ambion, Austin, TX; New England Biolabs, Beverly, MA) and may be used to construct the siRNA molecules according to the present invention. Hi) Ribozymes
The oligonucleotide inhibitors according to the present invention can be ribozymes that specifically target mRNA encoding a mammalian MBD2/dMTase. As is known in the art, ribozymes are RNA molecules having an enzymatic activity that enables the ribozyme to repeatedly cleave other separate RNA molecules in a nucleotide-sequence specific manner. Such enzymatic RNA molecules can be targeted to virtually any mRNA transcript, and efficient cleavage can be achieved in vitro [Kim et al, Proc. Natl. Acad. Sci. USA, 84:8788, (1987); Haseloff and Gerlach, Nature, 334:585, (1988); Cech, JAMA, 260:3030, (1988); Jefferies etal, Nucleic Acids Res., 17:1371, (1989)].
Typically, a ribozyme comprises two portions held in close proximity, a mRNA binding portion having a sequence complementary to the target mRNA sequence, and a catalytic portion which acts to cleave the target mRNA. A ribozyme acts by first recognising and binding a target mRNA by complementary base-pairing through the target mRNA binding portion ofthe ribozyme. Once it is specifically bound to its target, the ribozyme catalyses cleavage ofthe target mRNA. Such strategic cleavage destroys the ability of a target mRNA to direct synthesis of an encoded protein. Having bound and cleaved its mRNA target, the ribozyme is released and can repeatedly bind and cleave new target mRNA molecules.
One ofthe best characterised ribozyme molecules is the 'hammerhead ribozyme." Hammerhead ribozymes comprise a hybridizing region which is complementary in nucleotide sequence to at least part ofthe target mRNA, and a catalytic region which is adapted to cleave the target mRNA. In general, the hybridizing region contains at least 9 nucleotides. The present invention therefore contemplates the use ofthe oligonucleotide inhibitors as part ofthe hybridizing region of a hammerhead ribozyme, wherein the hybridizing region comprises at least 9 nucleotides that are complementary to a gene encoding MBD2/dMTase and is joined to an appropriate catalytic domain. The construction and production of such ribozymes is well-known in the art [see, for example, Haseloff and Gerlach, Nature, 334:585-591 (1988)]. Ribozymes in accordance with the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes") such as the one that occurs naturally in Tetrahymena thermophila (known as the TVS, or L-19 IVS RNA), which has been extensively described in the literature [see, Zaug, et al, Science, 224:574- 578 (1984); Zaug and Cech, Science, 231 :470-475 (1986); Zaug, et al, Nature, 324:429-433 (1986); U.S. Patent No. 4,987,071; Been and Cech, Cell, 47:207-216 (1986)]. Cech-type ribozymes comprise an 8 nucleotide active site which hybridizes to a target mRNA sequence with subsequent cleavage ofthe target mRNA by the ribozyme.
One skilled in the art will understand that there is a narrow range of binding free- energies between a ribozyme and its substrate that will produce maximal ribozyme activity. Such binding energy can be optimized by making ribozymes with G to I (inosine) and U to BrU (bromouracil) substitutions (or equivalent substitutions as known in the art) in the mRNA binding portion. Such substitutions allow manipulation of the binding free-energy without altering the target recognition sequence, the length ofthe mRNA binding portion, or the enzymatic portion ofthe ribozyme. The shape ofthe free-energy vs. ribozyme activity curve can be readily determined using data from standard experiments known in the art in which each base (or several bases) is modified or unmodified, and without the complication of changing the size ofthe ribozyme/substrate interaction.
If necessary, such experiments can be used to indicate the most active ribozyme structure. The use of modified bases thus permits "fine tuning" ofthe binding free energy to assure maximal ribozyme activity and is considered to be within the scope ofthe present invention. In addition, replacement of such bases, e.g., I for G, may permit a higher level of substrate specificity when cleavage of non-target RNA is a problem.
Preparation ofthe Oligonucleotide Inhibitors
The oligonucleotide inhibitors ofthe present invention can be prepared by conventional techniques well-known to those skilled in the art. For example, the oligonucleotides can be prepared using solid-phase synthesis using commercially available equipment, such as the equipment available from Applied Biosystems Canada Inc. (Mississauga, Canada). As is well-known in the art, modified oligonucleotides, such as phosphorothioates and alkylated derivatives, can also be readily prepared by similar methods.
Alternatively, the oligonucleotide inhibitors ofthe present invention can be prepared by enzymatic digestion and/or amplification ofthe naturally occurring MBD2/dMTase gene or mRNA, or of cDNA synthesized from the mRNA, using standard techniques known in the art. When the oligonucleotide inhibitors comprise RNA, they can be prepared by in vitro transcription methods also known in the art. As indicated above, siRNA molecules can also be conveniently prepared using commercially available in vitro transcription kits.
Oligonucleotides can also be prepared using recombinant DNA techniques. The present invention, therefore, encompasses expression vectors comprising nucleic acid sequences that encode the oligonucleotide inhibitors and subsequent expression ofthe encoded oligonucleotides in a suitable host cell. Such expression vectors can be readily constructed using procedures known in the art [see, for example, Ausubel, et al, Current Protocols in Molecular Biology, John Wiley & Sons, fric, NY. (1989 and updates)]. Examples of suitable vectors include, but are not limited to, plasmids, phagemids, cosmids, bacteriophages, baculovimses, retroviruses, and DNA viruses. One skilled in the art will understand that selection ofthe appropriate host cell for expression ofthe antisense oligonucleotide will be dependent upon the vector chosen. Examples of suitable host cells include, but are not limited to, bacterial, yeast, insect, plant and mammalian cells.
The selected expression vector may further include regulatory elements, such as transcriptional elements, required for efficient transcription ofthe oligonucleotide sequences. Examples of regulatory elements that can be incorporated into the vector include, but are not limited to, promoters, enhancers, terminators, and polyadenylation signals. The present invention, therefore, provides vectors comprising a regulatory element operatively linked to a nucleic acid sequence encoding an oligonucleotide inhibitor. One skilled in the art will appreciate that selection of suitable regulatory elements is dependent on the host cell chosen for expression ofthe oligonucleotide inhibitor and that such regulatory elements may be derived from a variety of sources, including bacterial, fungal, viral, mammalian or insect genes.
In the context ofthe present invention, the expression vector may additionally contain a reporter gene. Suitable reporter genes include, but are not limited to, β- galactosidase, green fluorescent protein, red fluorescent protein, luciferase, and β- glucuronidase. Incorporation of a reporter gene into the expression vector allows transcription ofthe oligonucleotide to be monitored by detection of a signal generated by expression ofthe reporter gene.
In accordance with the present invention, the expression vectors can be introduced into a suitable host cell or tissue by one of a variety of methods known in the art. Such methods can be found generally described in Sambrook et al, Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, NY (2001) and Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, fric, NY (1989 and updates) and include, for example, stable or transient transfection, lipofection, electroporation, and infection with recombinant viral vectors.
Ribozyme inhibitors comprising the oligonucleotides according to the present invention can be readily constructed by techniques known in the art. In these molecules the oligonucleotide sequence is included in the hybridizing or mRNA binding portion ofthe ribozyme and is joined to an appropriate catalytic portion.
Selection of an appropriate catalytic portion is dependent on the type of ribozyme to be constructed and can be readily determined by one skilled in the art [see, for example, Haseloff and Gerlach, Nature, 334:585-591 (1988); U.S. Patent No. 4,987,071].
Efficacy ofthe Oligonucleotide Inhibitors
The efficacy ofthe oligonucleotide inhibitors ofthe present invention in inhibiting the expression of a mammalian MBD2/dMTase gene or the growth of cancer cells can be determined by one or a combination of a number of different methods known in the art. Exemplary methods that can be used to determine the efficacy ofthe oligonucleotide inhibitors are provided below.
i) ha vitro Testing
If desired, initial determinations ofthe efficacy ofthe oligonucleotides ofthe present invention can be made using in vitro techniques.
For example, the ability ofthe oligonucleotide inhibitors to inhibit expression of a MBD2/dMTase gene can be determined by introducing the oligonucleotide into a cell line that normally expresses MBD2/dMTase. The amount of mRNA transcribed from the gene can then be measured by standard techniques, such as by Northern blot analysis. Alternatively, the amount of MBD2/dMTase protein produced by the cell can be measured, for example, by Western blot analysis. The specificity ofthe oligonucleotides for their mRNA target can be determined by conducting appropriate control experiments in parallel. The amount of mRNA or protein produced in a cell treated with the oligonucleotide can be compared with that produced in a control, untreated cell or a cell treated with a control oligonucleotide and provides an indication of how successfully the oligonucleotide has inhibited MBD2/dMTase gene expression. Appropriate controls will be dependent upon the type of oligonucleotide inhibitor being investigated and can be readily selected by one skilled in the art. Examples of appropriate controls include untreated cells and cells treated with randomised or "scrambled" oligonucleotides, oligonucleotides containing a defined number of mismatches, long non-specific double-stranded RNA molecules or ribozymes incorporating a randomised oligonucleotide in its mRNA binding domain.
In accordance with the present invention, the oligonucleotide inhibitors are selected based on their ability to decrease the expression of a MBD2/dMTase gene by at least about 50% when compared to an untreated control. In one embodiment, the oligonucleotide inhibitors decrease the expression of a MBD2/dMTase gene by at least about 60%. i another embodiment, the oligonucleotide inhibitors decrease the expression of a MBD2/dMTase gene by at least about 70%. hi other embodiments, the oligonucleotide inhibitors decrease the expression of a MBD2/dMTase gene by at least about 80% and by at least 90%. Alternatively, the ability ofthe oligonucleotide inhibitors to inhibit expression of MBD2/dMTase can be determined in vitro by assaying the total cellular activity ofthe MBD2/dMTase enzyme in the presence and absence ofthe oligonucleotide. For example, the demethylase activity ofthe MBD2/dMTase protein can be determined using a cell-based assay in which expression of a reporter gene present within the cell is dependent upon demethylation ofthe reporter gene DNA. For example, the vector CMV-GFP can be methylated in vitro and then transfected into cells, such as human embryonic kidney (HEK) cells, treated with the histone deacetylase inhibitor trichostatin A [Cervoni, N. & Szyf, M., (2001) J Biol. Chem., 276:40778 - 40787]. Demethylation ofthe vector DNA occurs within the cells through the action ofthe endogenous MBD2/dMTase. Whereas the methylated form of CMV-GFP is not expressed, the demethylated CMV-GFP is expressed and the resultant GFP protein can be readily detected by live fluorescence microscopy. Standard calculations using the amount of GFP produced can then be employed to determine the amount of vector DNA demethylated and thus, the activity ofthe MBD2/dMTase. One skilled in the art will recognise that other cell lines, reporter genes and detection methods known in the art can be used in this type of assay. For example, the reporter genes red fluorescent protein or luciferase may be used.
The oligonucleotide inhibitors can be further tested in vitro by determining their ability to inhibit anchorage-independent growth of tumour cells. Anchorage- independent growth is known in the art to be a good indicator of tumourigenicity. In general, anchorage-independent growth is assessed by plating cells from an appropriate cancer cell-line onto soft agar and determining the number of colonies formed after an appropriate incubation period. Growth of cells treated with the oligonucleotide inhibitor can then be compared with that of cells treated with an appropriate control (such as those as described above) and with that of untreated cells.
In accordance with the present invention, the oligonucleotide inhibitors decrease the anchorage-independent growth of cancer cells by at least 20%, when compared to untreated cells or cells treated with a control oligonucleotide. In one embodiment, the oligonucleotide inhibitors decrease the anchorage-independent growth of cancer cells by at least 30%. h another embodiment, the oligonucleotide inhibitors decrease the anchorage-independent growth of cancer cells by at least 40%. In other embodiments, they decrease the growth by at least 50% and at least 60%.
i one embodiment ofthe present invention, in vitro testing ofthe oligonucleotide inhibitors is conducted in a cancer cell-line that expresses high levels of MBD2/dMTase. In a related embodiment the cancer cell-line is a human cancer cell- line. Examples of suitable cancer cell-lines for in vitro testing ofthe oligonucleotide inhibitors ofthe present invention include, but are not limited to, non-small cell lung carcinoma cell-lines A549 and HI 299, breast cancer cell-line MCF-7, colon cancer cell-lines CaCo, HCT116 and HT29, cervical cancer cell-line HeLa. Other examples of suitable cell-lines are known in the art.
Toxicity ofthe oligonucleotide inhibitors can also be initially assessed in vitro using standard techniques. For example, human primary fibroblasts can be treated in vitro with the oligonucleotide in the presence of a commercial lipid carrier such as lipofectamine. Cells are then tested at different time points following treatment for their viability using a standard viability assay, such as the trypan-blue exclusion assay. Cells are also assayed for their ability to synthesize DNA, for example, using a thymidine incorporation assay, and for changes in cell cycle dynamics, for example, using a standard cell sorting assay in conjunction with a fluorocytometer cell sorter (FACS).
ii) In vivo Testing
The ability ofthe oligonucleotide inhibitors to inhibit tumour growth or proliferation in vivo can be determined in an appropriate animal model, general, current animal models for screening anti-tumour compounds are xenograft models, in which a human tumour has been implanted into an animal. Examples of xenograft models of human cancer include, but are not limited to, human solid tumour xenografts in mice, implanted by sub-cutaneous injection and used in tumour growth assays; human solid tumour isografts in mice, implanted by fat pad injection and used in tumour growth assays; experimental models of lymphoma and leukaemia in mice, used in survival assays, and experimental models of lung metastasis in mice. The oligonucleotide inhibitors ofthe present invention can be administered to an appropriate xenograft animal model, for example, by bolus infusion. Alternatively, cells can be treated ex vivo with the oligonucleotide inhibitor and then the treated cells can be injected or implanted into the animal. The size ofthe tumour is then assessed over a suitable time period and compared to that in an untreated control animal, or an animal treated with a control oligonucleotide. After an appropriate period of time, the animals are sacrificed and the tissue histology, size and / or proliferation ofthe tumour assessed. At this time, analysis of MBD2/dMTase protein expression and mRNA expression may also be conducted using standard techniques as described above and elsewhere.
For example, the oligonucleotide inhibitors can be tested in vivo on solid tumours using mice that are subcutaneously grafted bilaterally with 30 to 60 mg of a tumour fragment on day 0. The animals bearing tumours are mixed before being subjected to the various treatments and controls, hi the case of treatment of advanced tumours, tumours are allowed to develop to the desired size, animals having insufficiently developed tumours being eliminated. The selected animals are distributed at random to undergo the treatments and controls. Animals not bearing tumours may also be subjected to the same treatments as the tumour-bearing animals in order to be able to dissociate the toxic effect from the specific effect on the tumour. Treatment with the oligonucleotide inhibitors generally begins from 3 to 22 days after grafting, depending on the type of tumour, and the animals are observed every day. The different animal groups are weighed about 3 or 4 times a week until the maximum weight loss is attained, after which the groups are weighed at least once a week until the end ofthe trial.
The tumours are measured about 2 or 3 times a week until the tumour reaches a predetermined size and / or weight, or until the animal dies if this occurs before the tumour reaches the pre-determined size / weight. The animals are then sacrificed and the tissue histology, size and / or proliferation ofthe tumour assessed.
For the study ofthe effect ofthe oligonucleotide inhibitors on leukaemias, the animals are grafted with a particular number of cells, and the anti-tumour activity is detennined by the increase in the survival time ofthe treated mice relative to the controls.
To study the effect ofthe oligonucleotide inhibitors ofthe present invention on tumour metastasis, tumour cells are typically treated with the composition ex vivo and then injected into a suitable test animal. The spread ofthe tumour cells from the site of injection is then monitored over a suitable period of time.
Table 2: Examples of xenograft models of human cancer
Figure imgf000030_0001
In vivo toxic effects ofthe oligonucleotides can be evaluated by measuring their effect on animal body weight during treatment and by performing haematological profiles and liver enzyme analysis after the animal has been sacrificed.
Applications i) Therapeutic Applications
The oligonucleotide inhibitors ofthe present invention can be used to inhibit the growth or proliferation of tumour cells in vitro or in vivo. The present invention, therefore, provides for the use ofthe oligonucleotide inhibitors as anti-cancer drugs.
The present invention further provides a method of inhibiting the growth of tumour • cells in a subject by administering a therapeutically effective amount of one or more of oligonucleotide inhibitors. The oligonucleotide inhibitors ofthe present invention, therefore, can be used to treat, stabilize or prevent cancer, hi this context, the oligonucleotides may exert cytotoxic or cytostatic effects that cause a reduction in the size of a tumour, slow or prevent an increase in the size of a tumour, increase the disease-free survival time between the disappearance of a tumour and its reappearance, prevent an initial or subsequent occurrence of a tumour (e.g. metastasis), or reduce an adverse symptom associated with a tumour.
The present invention provides for the use ofthe oligonucleotide inhibitors in prophylactic treatments to aid in the prevention of genetic cancers, such as familial colorectal cancers, breast cancers, and the like.
The present invention also contemplates the use ofthe oligonucleotide inhibitors as "sensitizing agents," which selectively inhibit the growth of cancer cells. In this case, the oligonucleotide alone does not have a cytotoxic effect on the cell, but selectively arrests or slows the growth of cancer cells. The oligonucleotide thus provides a means of weakening the cancer cells, and thereby facilitates the benefit from conventional anti-cancer therapeutics.
Thus, the present invention contemplates the administration to a subject of a therapeutically effective amount of one or more oligonucleotide inhibitors administered with one or more anti-cancer therapeutics. The oligonucleotides can be administered before, during or after treatment with the anti-cancer therapeutic. An "anti-cancer therapeutic" is a compound, composition or treatment that prevents or delays the growth and/or metastasis of cancer cells. Such anti-cancer therapeutics include, but are not limited to, chemotherapeutic drug treatment, radiation, gene therapy, hormonal manipulation, immunotherapy and antisense oligonucleotide therapy. Examples of useful chemotherapeutic drugs include, but are not limited to, bleomycin, neocarcinostatin, suramin, doxorubicin, taxol, mitomycin C and cisplatin. It is to be understood that anti-cancer therapeutics for use in the present invention also include novel compounds or treatments developed in the future.
Examples of cancers that can be treated, stabilized, or prevented in accordance with the present invention include, but are not limited to, breast carcinomas, colon carcinomas, colorectal carcinomas, neuroblastomas, and gliomas. As used herein, "cancer" refers to all types of cancer or neoplasm or malignant tumours found in mammals, including leukemias, carcinomas, melanomas and sarcomas. Examples of cancers are cancer ofthe brain, breast, cervix, colon, head and neck, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus and Medulloblastoma.
The term "leukaemia" refers broadly to progressive, malignant diseases ofthe blood- forming organs and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukaemia is generally clinically classified on the basis of (1) the duration and character ofthe disease - acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non- increase in the number of abnormal cells in the blood-leukaemic or aleukaemic
(subleukaemic). Leukaemia includes, for example, acute nonlymphocytic leukaemia, chronic lymphocytic leukaemia, acute granulocytic leukaemia, chronic granulocytic leukaemia, acute promyelocytic leukaemia, adult T-cell leukaemia, aleukaemic leukaemia, a leukocythemic leukaemia, basophylic leukaemia, blast cell leukaemia, bovine leukaemia, chronic myelocytic leukaemia, leukaemia cutis, embryonal leukaemia, eosinophilic leukaemia, Gross' leukaemia, hairy-cell leukaemia, hemoblastic leukaemia, hemocytoblastic leukaemia, histiocytic leukaemia, stem cell leukaemia, acute monocytic leukaemia, leukopenic leukaemia, lymphatic leukaemia, lymphoblastic leukaemia, lymphocytic leukaemia, lymphogenous leukaemia, lymphoid leukaemia, lymphosarcoma cell leukaemia, mast cell leukaemia, megakaryocytic leukaemia, micromyeloblastic leukaemia, monocytic leukaemia, myeloblastic leukaemia, myelocytic leukaemia, myeloid granulocytic leukaemia, myelomonocytic leukaemia, Naegeli leukaemia, plasma cell leukaemia, plasmacytic leukaemia, promyelocytic leukaemia, Rieder cell leukaemia, Schilling's leukaemia, stem cell leukaemia, subleukaemic leukaemia, and undifferentiated cell leukaemia.
The term "sarcoma" generally refers to a tumour which is made up of a substance like embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance. Sarcomas include chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumour sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fϊbroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented haemorrhagic sarcoma, immunoblastic sarcoma of B cells, lymphoma, immunoblastic sarcoma of T-cells, Jensen's sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma, leukosarcoma, malignant mesenchymoma sarcoma, parosteal sarcoma, reticulocytic sarcoma, Rous sarcoma, serocystic sarcoma, synovial sarcoma, and telangiectaltic sarcoma.
The term "melanoma" is taken to mean a tumour arising from the melanocytic system ofthe skin and other organs. Melanomas include, for example, acral-lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, and superficial spreading melanoma.
The term "carcinoma" refers to a malignant new growth made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases. Exemplary carcinomas include, for example, acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale adenoides, exophytic carcinoma, carcinoma ex ulcere, carcinoma fibrosum, gelatiniform carcinoma, gelatinous carcinoma, giant cell carcinoma, carcinoma gigantocellulare, glandular carcinoma, granulosa cell carcinoma, hair-matrix carcinoma, haematoid carcinoma, hepatocellular carcmoma, Hurthle cell carcinoma, hyaline carcinoma, hypemephroid carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepidermal carcinoma, intraepithelial carcinoma, Krompecher's carcinoma, Kulchitzky-cell carcinoma, large- cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lymphoepithelial carcinoma, carcinoma medullare, medullary carcinoma, melanotic carcmoma, carcinoma molle, mucinous carcinoma, carcinoma muciparum, carcinoma mucocellulare, mucoepidermoid carcinoma, carcinoma mucosum, mucous carcinoma, carcinoma myxomatodes, naspharyngeal carcinoma, oat cell carcinoma, carcinoma ossificans, osteoid carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, prickle cell carcinoma, pultaceous carcinoma, renal cell carcinoma of kidney, reserve cell carcinoma, carcinoma sarcomatodes, schneiderian carcinoma, scirrhous carcinoma, carcinoma scroti, signet-ring cell carcinoma, carcinoma simplex, small-cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, carcinoma spongiosum, squamous carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tuberous carcinoma, verrucous carcinoma, and carcinoma villosum.
Additional cancers encompassed by the present invention include, for example, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, breast cancer, ovarian cancer, lung cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, small-cell lung tumors, primary brain tumors, stomach cancer, colon cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, cervical cancer, endometrial cancer, adrenal cortical cancer, and prostate cancer.
In one embodiment ofthe present invention, the oligonucleotide inhibitors are used in the treatment or stabilisation of lung cancer, hi another embodiment, the oligonucleotide inhibitors are used in the treatment or stabilisation of colorectal cancer.
ii) Screening Applications
The oligonucleotide inhibitors ofthe present invention can also be used to inhibit MBD2/dMTase in vitro and in vivo for the purpose of identifying genes that are regulated by MBD2/dMTase and may be important in maintaining the transformed state of a cell. Such genes are potential target genes for anti-cancer therapy and / or diagnosis.
Thus the present invention provides methods of identifying genes which are potential targets for cancer therapy or diagnosis. Such methods involve treatment of a cell with one or more ofthe MBD2/dMTase oligonucleotide inhibitors ofthe present invention in order to inhibit expression of MBD2/dMTase followed by comparison of gene expression in the treated cell with that in a suitable control cell. Suitable control cells include, for example, an untreated cell or a cell treated with a control "scrambled" oligonucleotide. In general, the first step in analysis of gene expression is isolation of RNA from the treated and control cells, which can be achieved using standard techniques. Methods of analysing gene expression are well-known in the art and include, for example, Northern blotting techniques, RNase protection assays, differential display, serial analysis of gene expression (SAGE) [see U.S. Patent No. 6,383,743] and rapid analysis of gene expression (RAGE) [see Wang et al, Nucl Acids Res., 27:4609-4618 (1999)]. Alternatively, gene expression can be analysed rapidly and conveniently by differential expression analysis using a gene microarray representing a suitable number of genes from the mammal being studied. Microaπays comprise an ordered arrangement of thousands of oligonucleotide probes each representing a separate gene immobilised on a suitable support. Suitable supports for microarrays include, for example, nitrocellulose, plastic, nylon and glass. Typically microarrays useful for this purpose represent between 1,000 and 40, 000 genes from the organism of interest. Methods of constructing microarrays are well-known in the art [see, for example, Ausubel, et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc, NY. (1989 and updates)], hi addition, custom-made microarrays are available from many companies. Pre-made microarrays are also commercially available for many organisms including, for example, GeneChip® (Affimetrix, Santa Clara, CA), Atlas™ (BD Biosciences-CLONTECH, Palo Alto, CA), GEM Microarrays, GeneJet™ array and LifeSeq® (Incyte Genomics, Palo Alto, CA), MICROMAX™ Human cDNA Microarray Systems (PerkinElmer Life Sciences, Boston, Mass.) and ResGen™ GeneFilters® (Invitrogen, Huntsville, Ala.).
The RNA isolated from the treated and control cells is hybridized to the microarray under suitable conditions and a routine analysis ofthe microarray by commercially available scanners and software is conducted to identify genes whose expression is affected (i.e. either induced or suppressed) in the cells treated with the MBD2/dMTase oligonucleotide inhibitors. Suitable hybridization conditions can readily be determined by one skilled in the art using standard techniques. The induced or suppressed genes thus identified are potential target genes for cancer diagnosis and therapy.
Pharmaceutical Compositions
When employed as pharmaceuticals, the oligonucleotide inhibitors are usually administered in the form of pharmaceutical compositions or formulations. Such compositions are prepared in a manner well known in the pharmaceutical art and comprise at least one active compound. In one embodiment ofthe present invention, the pharmaceutical composition or formulation comprises the oligonucleotide inhibitor. In a related embodiment, the pharmaceutical composition or formulation comprises a vector encoding the oligonucleotide inhibitor.
In accordance with the present invention, the oligonucleotide inhibitors may be incorporated into pharmaceutical compositions in the form of pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" as used herein refers to salts which retain the biological effectiveness and properties ofthe oligonucleotide inhibitors ofthe present invention, and which are not biologically or otherwise undesirable. In many cases, the oligonucleotides are capable of forming acid and/or base addition salts by virtue ofthe presence of amino and/or carboxyl groups or groups similar thereto.
Pharmaceutically acceptable base addition salts can be prepared from inorganic and organic bases. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, such as alkyl amines, dialkyl amines, trialkyl amines, substituted alkyl amines, di(substituted alkyl) amines, tri(substituted alkyl) amines, alkenyl amines, dialkenyl amines, trialkenyl amines, substituted alkenyl amines, di(substituted alkenyl) amines, tri(substituted alkenyl) amines, cycloalkyl amines, di(cycloalkyl) amines, tri(cycloalkyl) amines, substituted cycloalkyl amines, disubstituted cycloalkyl amine, trisubstituted cycloalkyl amines, cycloalkenyl amines, di(cycloalkenyl) amines, tri(cycloalkenyl) amines, substituted cycloalkenyl amines, disubstituted cycloalkenyl amine, trisubstituted cycloalkenyl amines, aryl amines, diaryl amines, triaryl amines, heteroaryl amines, diheteroaryl amines, triheteroaryl amines, heterocyclic amines, diheterocyclic amines, triheterocyclic amines, mixed di- and tri-amines where at least two ofthe substituents on the amine are different and are selected from the group consisting of alkyl, substituted alkyl, alkenyl, substituted alkenyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, heteroaryl, heterocyclic, and the like. Amines in which two or three substituents, together with the amino nitrogen, form a heterocyclic or heteroaryl group are also suitable.
Examples of suitable amines include, but are not limited to, isopropylamine, trimethyl amine, diethyl amine, tri(z5O-propyl) amine, tri(w-propyl) amine, ethanolamine, 2- dimethylaminoethanol, tromethamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, N-alkylglucamines, theobromine, purines, piperazine, piperidine, morpholine, N-ethylpiperidine, and the like. It should also be understood that carboxylic acid derivatives would be useful in the practice of this invention, for example, carboxylic acid amides, including carboxamides, lower alkyl carboxamides, dialkyl carboxamides, and the like.
Pharmaceutically acceptable acid addition salts can be prepared from inorganic and organic acids. Salts derived from inorganic acids include hydrochloric acid, hydrobromic acid, sulphuric acid, nitric acid, phosphoric acid, and the like. Salts derived from organic acids include acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulphonic acid, ethanesulphonic acid, -toluene-sulphonic acid, salicylic acid, andthe like.
Administration ofthe Oligonucleotide Inhibitors The oligonucleotide inhibitors of the present invention or pharmaceutical compositions comprising the oligonucleotide inhibitors may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g. by inhalation or insufflation of powders or aerosols, including by nebulizer; mtratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g. intrathecal or intraventricular, administration.
The oligonucleotide inhibitors of the present invention may be delivered alone or in combination, and may be delivered along with a pharmaceutically acceptable vehicle. Ideally, such a vehicle would enhance the stability and/or delivery properties. Examples of suitable vehicles include, but are not limited to, liposomes, microparticles or microcapsules. In various embodiments ofthe invention, the use of such vehicles may be beneficial in achieving sustained release ofthe active component.
For administration to an individual for the treatment of cancer, the present invention also contemplates the formulation ofthe oligonucleotide inhibitors or phaπnaceutical compositions comprising the oligonucleotide inhibitors into oral dosage forms such as tablets, capsules and the like. For this purpose, the oligonucleotide inhibitors or pharmaceutical compositions comprising the oligonucleotide inhibitors can be combined with conventional carriers, such as magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatine, tragacanth, methylcellulose, sodium carboxymethyl-cellulose, low melting wax, cocoa butter and the like. Diluents, flavouring agents, solubilizers, lubricants, suspending agents, binders, tablet-disintegrating agents and the like can also be employed, if required. The oligonucleotide inhibitors or pharmaceutical compositions comprising the oligonucleotide inhibitors can be encapsulated with or without other carriers. In all cases, the proportion of active ingredients in any solid and liquid composition will be at least sufficient to impart the desired activity to the individual being treated upon oral administration. The present invention further contemplates parenteral injection of the oligonucleotide inhibitors or pharmaceutical compositions comprising the oligonucleotide inhibitors, in which case they are used in the form of a sterile solution containing other solutes, for example, enough saline or glucose to make the solution isotonic.
For administration by inhalation or insufflation, the oligonucleotide inhibitors or pharmaceutical compositions comprising the oligonucleotide inhibitors can be formulated into an aqueous or partially aqueous solution, which can then be utilized in the form of an aerosol. The present invention also contemplates topical use ofthe oligonucleotide inhibitors or pharmaceutical compositions comprising the oligonucleotide inhibitors. For this purpose they can be formulated as dusting powders, creams or lotions in pharmaceutically acceptable vehicles, which are applied to affected portions ofthe skin. Alternatively, the oligonucleotide inhibitors can be formulated as transdermal delivery devices ("patches"). Such transdermal patches can be used to provide continuous or discontinuous infusion ofthe oligonucleotide inhibitors in controlled amounts. The construction and use of transdermal patches for the delivery of pharmaceutical agents is well-known in the art [see, for example, U.S. Patent 5,023,252]. Such patches may be constructed for continuous, pulsatile, or "on demand" delivery of pharmaceutical agents.
The present invention also provides for administration ofthe oligonucleotide inhibitors in the form of genetic vector constructs that are designed to direct the in vivo synthesis ofthe oligonucleotide inhibitors. Within the vector construct, the nucleic acid sequence encoding the oligonucleotide inhibitor is under the control of a suitable promoter. The vector construct may additionally contain other regulatory control elements known in the art. Methods of constructing and administering such genetic vector constructs for in vivo synthesis of oligonucleotide inhibitors, such as antisense oligonucleotides, are well-known in the art. For example, U.S. Patent No. 6,265,167 teaches an efficient method for the introduction, expression and accumulation of antisense oligonucleotides in the cell nucleus. This method allows the antisense oligonucleotide to hybridize to the sense mRNA in the nucleus, and thereby prevents the antisense oligonucleotide being either processed or transported into the cytoplasm.
An alternative method of delivery involves "shotgun" delivery ofthe naked oligonucleotides across the dermal layer or directly into a region to be treated. The delivery of "naked" oligonucleotides by direct injection is well-known in the art [see, for example, U.S. Patent No. 5,580,859]. In addition, methods of delivering oligonucleotides to a subject by coating them onto particles and accelerating the coated particles into the cells of a subject is also known in the art [see, for example, U.S. Patent Nos. 5,865,796 and 5,922,685]. It is contemplated that the oligonucleotide inhibitors may be packaged in a lipid vesicle or otherwise associated with lipids prior "shotgun" delivery to the subject.
The dosage requirements for the oligonucleotide inhibitors ofthe present invention vary with the particular compositions employed, the route of administration, the severity ofthe symptoms presented and the particular subject being treated. Dosage requirements can be determined by standard clinical techniques, known to a worker skilled in the art. Treatment will generally be initiated with small dosages less than the optimum dose ofthe compound. Thereafter the dosage is increased until the optimum effect under the circumstances is reached. In general, the oligonucleotide inhibitors are administered at a concentration that will generally afford effective results without causing any harmful or deleterious side effects. Administration can be either as a single unit dose or, if desired, the dosage can be divided into convenient subunits that are administered at suitable times throughout the day.
Kits
i) Therapeutic
The present invention additionally provides for therapeutic kits containing one or more oligonucleotide inhibitors, or one or more expression vectors encoding the oligonucleotide inhibitors, in pharmaceutical compositions for use in the treatment of cancer. The kits may further comprise one or more other anti-cancer therapeutics for use in combination with the oligonucleotide inhibitor(s). Individual components ofthe kit would be packaged in separate containers and, associated with such containers, can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency.
When the components ofthe kits according to the present invention are provided in one or more liquid solutions, the liquid solution can be an aqueous solution, for example a sterile aqueous solution. For in vivo use, the oligonucleotide inhibitor may be formulated into a pharmaceutically acceptable composition. In this case the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation maybe applied to an infected area ofthe subject, such as the lungs, injected into an subject, or even applied to and mixed with the other components ofthe kit.
The components ofthe kit may also be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means. Irrespective ofthe number or type of containers, the kits of the invention also may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement ofthe ultimate complex composition within the body ofthe subject. Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.
ii) Screening
The oligonucleotide inhibitors according to the present invention can form part of a kit for screening for genes whose expression is affected by an MBD2/dMTAse and which are potential target genes for cancer therapy and/or diagnosis. Such kits comprise one or more MBD2/dMTase oligonucleotide inhibitors. One or more ofthe oligonucleotides provided in the kit can incorporate a detectable label, or the kit may include reagents for labelling the oligonucleotides. The kits can optionally include reagents for the isolation of RNA, reagents for the synthesis of cDNA, and / or reaction vessels. One or more ofthe components ofthe kit may be lyophilised and the kit may further comprise reagents suitable for the reconstitution ofthe lyophilised components. The kit can additionally contain instructions for use.
To gain a better understanding ofthe invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in any way.
EXAMPLES
Oligonucleotide Sequences - Antisense DNA oligonucleotides were designed to hybridize to human MBD2 cDNAs (Al and A2 to that described in Bhattacharya, S. K., Ramchandani, S., Cervoni, N., and Szyf, M. (1999) Nature 397, 579-583 and A3- AlO to that described in Hendrich, B., and Bird, A. (1998) Mol Cell Biol 18, 6538- 6547). The sequences as follows:
Al, 5'GGCAATCCATCCTCTTCC3' [SEQ ID NO: 5] A2, 5'CTTCCTCCTTCTTCCATC3' [SEQ ID NO: 6] A3, 5'CAACAGTATTTCCCAGGT3' [SEQ ID NO: 7] A4, 5 GTAGCCTCTTCTCCCAG3' [SEQ ID NO: 8] A5, 5ΑTCCAGCCCCCTCCCCAG3' [SEQ ID NO: 9] A6, 5'CACTCTCCCCCTCCCCCT3' [SEQ ID NO: 10] A7, 5 CAACAGTATTTCCCAGGTA3' [SEQ ID NO: 11] AlO, 5'UCAACAGTATTTCCCAGGUA3' [SEQ ID NO: 12] Al l, 5ΑUGGACCCTTTATGACAACU3' [SEQ ID NO: 13] 1582, 5'CGATTCAATCCTCACCTCTC3' [SEQ ID NO: 14].
Antisense oligonucleotides A1-A5 have a phosphorothioate (PS) backbone; A7 has a mixed phosphodiester and PS backbone, A7 also contains an inverted thymine base at the 3' end. The antisense oligonucleotide AlO is a modification of oligonucleotide A7 in which a 2'O-methyl modification has been positioned on the ribose ofthe first and last 4 nucleotides. Control oligonucleotide Al 1 is the reverse sequences of AlO, with oligonucleotide 1582 used as a nonspecific control for the rest ofthe experiments.
Oligos were selected to avoid dimers and stem loop structures as well as CpG dinucleotides (Ballas, Z. K., Krieg, A. M., Warren, T., Rasmussen, W., Davis, H. L., Waldschmidt, M., and Weiner, G. J. (2001) J Immunol 167, 4878-4886). A4-A10 included the TCCC tetranucleotide motif. After synthesis, oligonucleotides were cleared of contaminants by desalting and gel purification (A1-A6), HPLC (A7), and ion exchange HPLC (AlO, Al 1). Oligonucleotide synthesis was performed by
OligosEtc (A1-A7, Wilsonville, OR) and Integrated DNA Technologies (AlO, All, Coralville IA).
EXAMPLE 1: Inhibition ofmhάl/dMTase mRNA Expression by Antisense Oligonucleotides
A. To screen and test antisense inhibitors of MBD2/dMTase, the human non-small cell lung carcinoma cell line A549 (ATCC# CCL-185), which expresses high levels of MBD2/dMTase, was treated with 200nM of either the selected antisense oligonucleotide or a scrambled control. Lipofectin (6.25 μg/ml) was used as the lipid carrier. The cells were treated twice (0 and 24 h) and harvested 48 h post treatment (see protocol in B).
To determine whether the treatment with the antisense compound results in reduction of MBD2/dMTase levels, total mRNA was isolated from the cells and used to perform a Northern blot analysis. A 32P-labelled cDNA probe was used for hybridization. The signal obtained with the specific probe was normalized to total RNA in the lane as determined by hybridization with an 18S rRNA-specifϊc oligonucleotide probe (see protocol in B). The results for antisense oligonucleotides A3, A4, A5, A6 and A7 are shown in Figure 4, together with data for the scrambled control oligonucleotide 1582.
A549 non-small cell human lung carcinoma cells (ATCC# CCL-185), HCTl 16 human colon carcinoma cells (ATCC# CCL-247), MRHF human foreskin fibroblasts (Biowhittaker, Wakersville, MD) were cultured free of antibiotics in the recommended media to facilitate oligo transfection and plated at a density of
3xl05 per 10 cm plate 24 to 48 hours before transfection. Antisense oligonucleotides were added to cells at a final concentration of 20, 50 or 200 nM using either 6.25 μl/ml Lipofectin for A549 cells or 4 μl/ml Lipofectamine (Invitrogen, Carlsbad CA) for HCTl 16 cells as lipid carriers. Transfection was repeated after 24 hours, cells were harvested with TRIzol (Invitrogen), total RNA was prepared according to manufacturer's recommendation and was subjected to gel electrophoresis, Northern blot transfer onto Hybond-N+ membrane (Amersham pharmacia biotech) according to the manufacturer's recommendations and hybridization with a 1.3 kb MBD2b cDNA probe (Bhattacharya, S. K., Ramchandani, S., Cervoni, N, and Szyf, M. (1999) Nature 397, 579-583) in a 10 ml hybridization solution containing 7% SDS, 0.5 M sodium phosphate pH 6.8, and 1 mM EDTA at 68°C for 4 hours. Following washing and exposure to a phosphor-imaging plate, the membrane was stripped and hybridized to a 32P- labelled 18S rRNA probe as previously described (Szyf, M., Tanigawa, G., and McCarthy, P. L., Jr. (1990) Mol Cell Biol 10, 4396-4400). The signals for MBD2 and 18S were quantified by densitometry and the intensity ofthe MBD2 signal was normalized to the signal obtained for 18S. A549 cells were harvested after a single treatment with oligo, nuclear extracts prepared as previously described (Szyf, M., Bozovic, V., and Tanigawa, G. (1991) JBiol Chem 266, 10027-10030) were resolved by electrophoresis, and membranes were probed with 1 :200 dilution of a monoclonal anti-MBD2 antibody (#147, Imgenex, San Diego, CA) in 0.05M
Tris-0.2M NaCI 0.5% Tween 20 pH 7.6 solution overnight at 4°C. The blot was then reacted with a secondary anti-mouse monoclonal antibody at a 1 :20,000 dilution and the band developed with the ECL kit from Amersham pharmacia biotech. The Western blot membrane was then stained with BLOT FastStain from CHEMICON International according to the manufacturer's recommendations to verify equal loading and transfer ofthe proteins onto the membranes.
Specific and dose-dependent inhibition of target MBD2 mRNA was observed in both A549 and HCTl 16 cells treated with AlO (Figure 17A and B) in comparison with the Al 1 control. Concomitant with a reduction of MBD2 mRNA, reduction of protein was also observed in antisense but not control treated A549 cells
(Figure 17C).
EXAMPLE 2: Inhibition of Anchorage-Independent Growth of Cancer Cells by Antisense Oligonucleotides to vabάl/dMTase
A human non-small cell lung carcinoma cell line A549, which expresses high levels of MBD2/dMTase, was treated with increasing concentrations of either the selected antisense oligonucleotide AlO or a reverse scrambled control oligonucleotide Al 1 for 48 h. An equal number of live cells were plated onto 0.33% agar with enriched medium. Colonies growing in an anchorage independent manner were counted by visual examination 3 weeks after plating to determine the anti-tumourigenic activity of the compounds. Anchorage-independent growth is an indicator of tumourigenicity. Results are shown in Figure 5.
Similar experiments were conducted using the human colorectal carcinoma cell line HCTl 16. Cells were treated with either 200 nM ofthe MBD2/dMTase antisense oligonucleotide AlO or the reverse scrambled control Al 1 for 48h and were then plated onto soft agar. Colonies growing in an anchorage-independent manner were scored after 3 weeks. The results are shown in Figure 6 and indicate that the antisense oligonucleotide AlO effectively inhibits the anchorage-independent growth of HCTl 16 colorectal carcinoma.
Detailed experimental protocols for the above experiments are provided below:
To determine anchorage-independent growth on soft agar, 3000 live cells treated with a single dose of antisense or control oligos for 24 hours were seeded into soft agar and plated in triplicate in a six well plate for 21 days as previously described (Slack, A., Cervoni, N., Pinard, M., and Szyf, M. (1999) JBiol Chem 274, 10105-10112). The number of colonies (>10 cells per colony) in five random fields (40X) per well, throughout all planes ofthe triplicate wells, was counted after 21 days under microscopy.
EXAMPLE 3: In vitro Toxicity Tests
For anchorage-dependent cell growth experiments, A549, HCTl 16, and MRHF cells were plated at the concentration of 50,000 cells/dish. After 24 hours, cells were treated with 200 nM of control oligonucleotide All or antisense oligonucleotide AlO. Treatments were repeated after 24 h and cells were harvested 24, 48 and 72 h after the second treatment (Day 1, Day 2, Day 3, respectively). Cell viability was measured by trypan blue exclusion. Results are shown in Figure 16A - C.
To determine cell cycle kinetics, the cells were fixed for 18 h in 70% ethanol at 4°C, and treated with propidium iodide to label DNA (Vindelov, L. L., and Christensen, I. J. (1988) Eur JHaematol Suppl 48, 69-76). Twenty thousand cells were sorted in triplicate for DNA content in a Becton Dickinson (Franklin Lakes, NJ) FACScari cell sorter and data were acquired by the LYSIS LT program. Results are shown in Figure 16D and indicate that antisense oligonucleotide AlO does not affect cell cycle progression. EXAMPLE 4: Inhibition of Tumour Growth by ex vivo Treatment of Carcinoma Cells with Antisense Oligonucleotide Inhibitors of MBD2/dMTase
Male CDl nude mice were obtained from Charles River Laboratories and used when 8-10 weeks old. Experimental procedures were carried out according to the regulations ofthe Canadian Council on Animal Care and under protocols reviewed and accepted by the McGill University Animal Care Committee.
A. Human lung carcinoma cells (A549 cell-line) were treated with either 200 nM ofthe MBD2/dMTase antisense oligonucleotide AlO or the control oligonucleotide Al 1 for 24 h. An equal number of live cells was implanted in nude mice and tumour volume was monitored every two days. After 34 days the animals were sacrificed and the tumours were weighed. The results are shown in Figure 7A and 7B and demonstrate that tumours derived from cells that were treated once for 24h with MBD2/dMTase antisense oligonucleotide AlO had significantly lower weights than those derived from cells treated with the control oligonucleotide.
B. Human colorectal carcinoma cells (HCTl 16 cell-line) were treated in vitro with 200 nM of either MBD2/dMTase antisense oligonucleotide AlO or the control oligonucleotide Al 1 for either 24h (single treatment) or 48 h (double treatment). An equal number of live cells (10 ) were implanted into nude mice (n per group = 10). Tumour volumes were measured and graphed. Figure 8 A shows the results for the single treatment and Figure 8B shows the results for the double treatment. The tumours were harvested and weighed after 28 days and the results are shown in Figure 8C. The number of tumour-free animals per treatment are shown in Figure 8D. The results indicate that MBD2/dMTase antisense treatment effectively inhibited the ability of HCT 116 colorectal carcinoma cells to grow as tumours in a nude mouse xenograft model.
EXAMPLE 5: Inhibition of Tumour Cell Growth in vivo by Oligonucleotide Inhibitors ofMBD2/dMTase Male CDl nude mice were obtained from Charles River Laboratories and used when 8-10 weeks old. Experimental procedures were carried out according to the regulations ofthe Canadian Council on Animal Care and under protocols reviewed and accepted by the McGill University Animal Care Committee.
Tumour cells (2.5 x 106) from the human non-small cell lung carcinoma cell line A549, were injected subcutaneously in the flank ofthe animals on day 0. Antisense treatment was initiated 3 days post-implantation. Antisense oligonucleotide AlO or scrambled control oligonucleotide Al 1 were administered intravenously by bolus injection into the tail vein 3 times per week for 30 days at dosages of 2 mg/kg, 4 mg/kg or 8 mg/kg (n=8 per treatment group). Tumour volumes are monitored every 2 days.
Tumour volumes are measured throughout the experiment to monitor the progress of tumour growth and the results are shown in Figure 9. The number of tumour-free animals was also assessed and the results are shown in Figure 10. The general toxic effect of antisense oligonucleotide AlO and control oligonucleotide Al 1 was evaluated by measuring the effect on animal body weight as shown in Figure 12. Following sacrifice ofthe animals at day 30, the tumours were harvested and weighed. The average weights and relative sizes ofthe excised tumours are shown in Figures 11 and 13, respectively. A significant decrease was observed in the weight and size of those tumours harvested from the mice treated with antisense oligonucleotide AlO relative to those harvested from mice treated with the control oligonucleotide.
EXAMPLE 6: Inhibition of Tumour Cell Growth in vivo by Oligonucleotide Inhibitors of MBD2/dMTase #2
2.5x10 naive A549 or HCTl 16 cells were injected subcutaneously into B ALB/cAnNCrl-nuBR nude mice. Three days post implantation, when solid tumours were already visible, the mice (8 per group) were injected via tail vein 3 times per week with control oligonucleotide Al 1 or antisense oligonucleotide AlO, at doses of 2, 4, or 8 mg/kg dissolved in 100 μl sterile PBS. The mice were monitored for tumour growth 3 times per week, and tumor volume was estimated by using V— (L . W1) x 0.5, where L is the length and the width of a xenograft (Bandyopadhyay, A., Lopez-Casillas, F., Malik, S. N., Montiel, J. L., Mendoza, V., Yang, J., and Sun, L. Z. (2002) Cancer Res 62, 4690-4695) and observed for cachexia, lethargy, lesions and other signs of toxicity. The mice were sacrificed after 24 or 29 d by exsanguination and their blood was analyzed for liver and kidney function as well as hemocyotology. A549 cells were more sensitive to systemic antisense treatment than in vitro treatment. All 3 doses of AlO showed significant inhibitory effects on tumour growth, with complete tumour regression seen in 2 mice dosed with 8 mg/kg (Figure 14C). One mouse in this same antisense group died after 17 days postimplantation but the cause of death is unclear. Numbers of tumour-free mice for 2, 4, and 8 mg/kg groups were 5/8, 7/8, 7/8 for AlO, and 1/8, 1/8 and 0/8 for All treatments. Thus, MBD2 antisense treatment essentially eliminated the ability of A549 cells to grow as tumour xenoplants in nude mice.
Antisense oligonucleotide AlO also reduced tumour growth of HCTl 16 colon cancer cells in nude mice (Figure 14B - experimental as described above for A549 cells). HCTl 16 cells appeared to be extremely sensitive to reductions in MBD2 as indicated by the complete regression of tumours in some mice at each dose concentration (Figure 14D). Maximal effect on HCT 116 was achieved at a dose of 8mg/kg. Numbers of tumour-free mice for 2, 4, and 8 mg/kg groups were 5/8, 7/8, 8/8 for AlO, and 1/8, 1/6 and 1/8 for Al 1 treatments. Two mice in the Al 1 4 mg/kg group died of cachexia, perhaps due to tumour burden. None ofthe antisense treated mice implanted with HCTl 16 cells died before sacrifice. A dose dependent reduction in tumour mass with AlO antisense treatment was observed when the tumour mass was determined following sacrifice ofthe animals (Figures 15 and 13B).
EXAMPLE 7: In vivo Toxicity Testing
The absence of specific toxic effects on proliferating tissues in vivo was determined for antisense oligonucleotide AlO. For the experiment conducted in Example 5, animal weight was monitored throughout the experiment. The results shown in Figure 12 demonstrate that the antisense oligonucleotide had no effect on animal weight at any ofthe concentrations used in this experiment. Blood samples were obtained at sacrifice from the treated mice in Example 6 and screened for various markers of in vivo toxicity (Table 3). Throughout the various dosing concentrations, no differences were seen between AlO and All for hematological measurements, indicating that the blood cell precursors which are often sensitive to chemotherapeutic regimens were largely unaffected by serial dosing ofthe antisense oligonucleotide. Platelet numbers were, however, increased above normal levels, regardless of treatment or dose; this is probably caused by the multiple tail vein injections. Urea, creatinine, aspartate amino transferase (AST) and alanine aminotransferase (ALT), indices of liver, muscle, and kidney damage, similarly showed no negative effects from in vivo treatment. Swelling ofthe inguinal lymph nodes was a nonspecific but dose-dependent effect ofthe oligonucleotides that occurred in several mice treated with doses of 4 or 8 mg/kg.
Analysis of hematological values and serum biochemical parameters was performed by McGill University Animal Resources centre Diagnostic and research support service using standard procedures.
Table 3: In vivo Toxicity Testing for Antisense Oligonucleotide AlO
RBC - red blood cells, WBC — white blood cells, AST - aspartate aminotransferase and ALT -alanine aminotransferase. Errors are SEM for 14-16 mice per group.
2 mg/kg 4 mg/kg 8mg/kg
AlO All AlO All AlO All
Hematocrit 0.44±0.01 0.45±0.01 0.46±0.01 0.44±0.01 0.44±0.01 0.45±0.01
Hemoglobin (g/1) 152.88±4.3 154.75±3.3 156.81±3.2 149.46±2.0 153.02±1.6 154.81±3.1
RBC (1012)/1 9.07±0.2 9.11±0.3 9.32±0.2 8.78±0.2 9.14±0.1 9.43±0.3
MCV (fl) 48.88±0.5 49.56±0.4 49.44±0.6 49.69±0.3 48.41±0.3 48.19±0.4
MCH (pg) 16.85±0.2 17.02±0.2 16.87±0.2 17.06±0.2 16.83±0.2 16.47±0.3
MCHC /1 345.19±3.2 345.32±3.4 341.13±2.4 344.23±3.7 348.35±2.2 343.22±5.0
WBC (109 1) 7.19±0.6 6.04±0.7 8.23±0.5 6.28±1.0 8.04±0.7 9.23±0.7
Platelets (lθ l) 821. OO±l 19.5 662.13±81.3 630.81±89.6 796.79±84.0 608.54±86.9 591.90±64.7
Urea (mM) 7.8±0.5 7.7±0.2 8.9±1.1 7.6±0.6 8.0±0.6 9.1±0.7 2 mg/kg 4 mg/kg 8mg/kg
AlO All AlO All AlO All
Creatinine (mM) 39.4±1.2 40.8±0.8 40.5±1.3 41.0±1.2 40.3±1.4 38.5±1.5
Albumin (g/1) 37.9±0.4 38.2±0.4 37.5±0.5 38.1±0.8 37.6±0.8 36.4±0.6
A T (U/1) 82.1±19.9 83.2±18.0 113.6±33.5 79.7±19.1 92.1±27.2 93.9±24.0
AST (U/1) 216.3±31.8 165.1±25.3 256.3±79.4 237.8±72.2 297.1±90.7 282.6±60.5
EXAMPLE 8: In vitro Assay for Demethylase Activity
The assay is based on the fact that in vitro methylation of vector CMV-GFP followed by transfection into HEK cells treated with the histone deacetylase inhibitor trichostatin A, results in demethylation ofthe vector DNA by endogenous demethylase [Cervoni, N. & Szyf, M., (2001) J Biol Chem., 276:40778 - 40787]. The methylated form of CMV-GFP is not expressed by the cells, whereas the demethylated form is expressed and the GFP protein is readily detected by live fluorescence microscopy.
HEK cells treated with trichostatin A and transfected with vector CMV-GFP are grown in 96 well plates and are treated with oligonucleotide inhibitors of
MBD2/dMTase. 96 hours after initiation of treatment, the level of inhibition is determined by counting fluorescence-expressing cells by microscopy as previously described. The assay can be conducted rapidly by reading the fluorescence ofthe expressed GFP using a fluorometer with a 96 well plate reader.
EXAMPLE 9: Differential Expression Analysis of cells Treated with
MBD2/dMTase Oligonucleotide Inhibitors using Gene Arrays
Affymetrix huGene FI™ arrays (Affymetrix, Santa Clara, CA) are used for expression profiling. RNA is prepared from cells treated with MBD2/dMTase oligonucleotide inhibitors and from control cells as described above. cDNA is synthesised from the isolated ρoly(A)+ mRNA using Superscript Choice kit (GBCO/BRL). cRNA is prepared in an in vitro transcription reaction in the presence of biotin- 11 -CTP and biotin- 16-CTP using T7 polymerase (Megascript kit, Ambion). Arrays are hybridised with the biotinylated in vitro transcription products for 16 hours at 45°C using the manufacturer's hybridization buffer. A two-step protocol is used to detect hybridization intensity, consisting of primary incubation of arrays with a streptavidin- phycoerythrin conjugate followed by a labelling step with a goat anti-streptavidin antibody (Vector). The array chips are then scanned and the digitised image data is processed with the GeneCliip™ software (Affymetrix) to identify genes that are up- or downregulated in response to treatment with the oligonucleotide inhibitors.
The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope ofthe invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope ofthe following claims.

Claims

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:
1. An oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, wherein said oligonucleotide inhibitor, or analogue thereof, inhibits expression of a mammalian MBD2/demethylase gene.
2. The oligonucleotide inhibitor according to claim 1 that is an antisense oligonucleotide.
3. The oligonucleotide inhibitor according to claim 1 that is a siRNA molecule.
4. The oligonucleotide inhibitor according to claim 1 that is a ribozyme.
5. An oligonucleotide inhibitor, or an analogue thereof, of less than about 100 nucleotides in length comprising at least 7 consecutive nucleotides from the sequence as set forth in any one of SEQ DO NOs: 5, 6, 7, 8, 9, 10, 11 or 12.
6. The oligonucleotide inhibitor according to any one of claims 1 to 5 further comprising one or more phosphorothioate backbone linkages.
7. The oligonucleotide inhibitor according to any one of claims 1 to 6 further comprising one or more 2'-O-methyl modified bases.
8. A vector comprising the oligonucleotide inhibitor according to any one of claims l to 5.
9. A host cell transformed or transfected with the oligonucleotide according to any one of claims 1 to 5, or the vector according to claim 8.
10. A pharmaceutical composition comprising the oligonucleotide inhibitor according to any one of claims 1 to 7, or the vector according to claim 8.
11. A use ofthe oligonucleotide inhibitor according to any one of claims 1 to 7, or the vector according to claim 8, in the manufacture of a medicament.
12. A use of an oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, to inhibit the growth of cancer cells in a mammal in need thereof, wherein said oligonucleotide inhibitor, or analogue thereof, inhibits expression of a mammalian MBD2/demethylase gene.
13. A use of an oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, to inhibit the proliferation of cancer cells in a mammal in need thereof, wherein said oligonucleotide inhibitor, or analogue thereof, inhibits expression of a mammalian MBD2/demethylase gene.
14. A use of an oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, in the treatment of cancer in a mammal, wherein said oligonucleotide inhibitor, or analogue thereof, inhibits expression of a mammalian MBD2/demethylase gene.
15. The use according to claim 14, wherein said cancer is lung cancer or colorectal cancer.
16. A use of an oligonucleotide inhibitor, or an analogue thereof, comprising from about 7 to about 100 nucleotides complementary to a mammalian MBD2/demethylase mRNA, in the prophylactic treatment of a mammal to prevent a familial cancer, wherein said oligonucleotide inhibitor, or analogue thereof, inhibits expression of a mammalian MBD2/demethylase gene.
17. The use according to any one of claims 12 to 15, wherein said oligonucleotide inhibitor comprises at least 7 consecutive nucleotides from the sequence as set forth in any one of SEQ ID NOs: 5, 6, 7, 8, 9, 10, 11 or 12.
18. The use according to any one of claims 12 to 16, wherein said mammal is a human.
19. The use according to any one of claims 12 to 17, wherein said oligonuceotide inhibitor is used in combination with one or more anti-cancer therapeutics.
20. A method of identifying target genes for cancer therapy comprising treating a cell with one or more oligonucleotide inhibitor of a mammalian MBD2/demethylase gene, analysing gene expression in the treated cell and comparing the gene expression with gene expression in a control cell not treated with said oligonucleotide inhibitor, wherein a difference in gene expression between the treated cell and the control cell is indicative of one or more target gene.
21. The method according to claim 19, wherein analysing gene expression is conducted by microarray analysis.
PCT/CA2003/000884 2002-06-20 2003-06-20 Oligonucleotide inhibitors of mbd2/dna demethylase and uses thereof Ceased WO2004001027A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CA 2530108 CA2530108A1 (en) 2002-06-20 2003-06-20 Oligonucleotide inhibitors of mbd2/dna demethylase and uses thereof
US10/518,470 US7465714B2 (en) 2002-06-20 2003-06-20 Oligonucleotide inhibitors of MBD2/DNA demethylase and uses thereof
AU2003243859A AU2003243859A1 (en) 2002-06-20 2003-06-20 Oligonucleotide inhibitors of mbd2/dna demethylase and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US38992602P 2002-06-20 2002-06-20
US60/389,926 2002-06-20

Publications (2)

Publication Number Publication Date
WO2004001027A1 true WO2004001027A1 (en) 2003-12-31
WO2004001027A8 WO2004001027A8 (en) 2004-07-08

Family

ID=30000484

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2003/000884 Ceased WO2004001027A1 (en) 2002-06-20 2003-06-20 Oligonucleotide inhibitors of mbd2/dna demethylase and uses thereof

Country Status (4)

Country Link
US (1) US7465714B2 (en)
AU (1) AU2003243859A1 (en)
CA (1) CA2530108A1 (en)
WO (1) WO2004001027A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2108705A1 (en) * 2008-04-08 2009-10-14 Universität Duisburg-Essen Method for analysing the epigenetic status of the HtrA 1 gene in a biological sample
US20100093768A1 (en) * 2006-12-27 2010-04-15 Nelson William G Agents for Reversing Epigenetic Silencing of Genes
CN101914541A (en) * 2010-08-09 2010-12-15 华中科技大学同济医学院附属同济医院 Inhibitor for inhibiting expression of MBD2 and application thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2836831B1 (en) * 2002-03-07 2004-06-25 Centre Nat Rech Scient COMBINATION OF CHEMOTHERAPY AND ANTISENSE OF DNA DEMETHYLASE
CN104919053B (en) * 2012-12-12 2017-07-04 中央研究院 DNA 5‑methylcytosine demethylation activity of vertebrate DNA methyltransferases

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999024583A1 (en) * 1997-11-12 1999-05-20 Mcgill University Dna demethylase, therapeutic and diagnostic uses thereof
WO2003074060A2 (en) * 2002-03-07 2003-09-12 Centre National De La Recherche Scientifique (Cnrs) Dna demethylase antisense and chemotherapy combination

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5877009A (en) * 1991-08-16 1999-03-02 Trustees Of Boston University Isolated ApoA-I gene regulatory sequence elements
US5877309A (en) * 1997-08-13 1999-03-02 Isis Pharmaceuticals, Inc. Antisense oligonucleotides against JNK
US6905827B2 (en) * 2001-06-08 2005-06-14 Expression Diagnostics, Inc. Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999024583A1 (en) * 1997-11-12 1999-05-20 Mcgill University Dna demethylase, therapeutic and diagnostic uses thereof
WO2003074060A2 (en) * 2002-03-07 2003-09-12 Centre National De La Recherche Scientifique (Cnrs) Dna demethylase antisense and chemotherapy combination

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BHATTTACHARYA SK ET AL: "A mammalian protein with specific demethylase activity for mCpG DNA", NATURE, MACMILLAN JOURNALS LTD. LONDON, GB, vol. 397, 18 February 1999 (1999-02-18), pages 579 - 583, XP002097746, ISSN: 0028-0836 *
DATABASE EMBL [online] EMBL; 28 October 1998 (1998-10-28), XP002256127, retrieved from EMBL Database accession no. AF072242 *
SLACK A ET AL: "ANTISENSE MBD2 GENE THERAPY INHIBITS TUMORIGENESIS", JOURNAL OF GENE MEDICINE, WILEY,, US, vol. 4, no. 4, 17 May 2002 (2002-05-17), pages 381 - 389, XP008009438, ISSN: 1099-498X *
SZYF M: "THE DNA METHYLATION MACHINERY AS A THERAPEUTIC TARGET", CURRENT DRUG TARGETS, BENTHAM SCIENCE PUBLISHER,, US, vol. 1, no. 1, July 2000 (2000-07-01), pages 101 - 118, XP001122812, ISSN: 1389-4501 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100093768A1 (en) * 2006-12-27 2010-04-15 Nelson William G Agents for Reversing Epigenetic Silencing of Genes
US9034574B2 (en) * 2006-12-27 2015-05-19 The Johns Hopkins University Agents for reversing epigenetic silencing of genes
US10227654B2 (en) 2006-12-27 2019-03-12 The Johns Hopkins University Agents for reversing epigenetic silencing of genes
US12060615B2 (en) 2006-12-27 2024-08-13 The Johns Hopkins University Agents for reversing epigenetic silencing of genes
EP2108705A1 (en) * 2008-04-08 2009-10-14 Universität Duisburg-Essen Method for analysing the epigenetic status of the HtrA 1 gene in a biological sample
WO2009124749A1 (en) * 2008-04-08 2009-10-15 Universität Duisburg-Essen Method for analysing the epigenetic status of the htra 1 gene in a biological sample
CN101914541A (en) * 2010-08-09 2010-12-15 华中科技大学同济医学院附属同济医院 Inhibitor for inhibiting expression of MBD2 and application thereof
CN101914541B (en) * 2010-08-09 2013-03-13 华中科技大学同济医学院附属同济医院 Inhibitor for inhibiting MBD2 expression and application thereof

Also Published As

Publication number Publication date
US20060166909A1 (en) 2006-07-27
CA2530108A1 (en) 2003-12-31
AU2003243859A1 (en) 2004-01-06
US7465714B2 (en) 2008-12-16
WO2004001027A8 (en) 2004-07-08

Similar Documents

Publication Publication Date Title
CA2865468C (en) Methods of treating cancer by inhibition of dna repair proteins
US7968526B2 (en) Antisense oligonucleotides directed to ribonucleotide reductase R2 and uses thereof in the treatment of cancer
US12234459B2 (en) Methods of treating cancer and/or enhancing sensitivity to cancer treatment by increasing tumor mutation burden or tumor indels
US20070274947A1 (en) Antisense Oligonucleotides Directed to Ribonucleotide Reductase R1 and Uses Thereof in the Treatment of Cancer
US7465714B2 (en) Oligonucleotide inhibitors of MBD2/DNA demethylase and uses thereof
US20080318891A1 (en) Antisense oligonucleotides against thymidylate synthase
US20110003879A1 (en) Antisense oligonucleotides targeted to the coding region of thymidylate synthase and uses thereof
WO2017106964A1 (en) Methods of treating cancer by inhibition of dna repair proteins using antisense based therapies
US20080255066A1 (en) Antisense oligonucleotide strategies for the enhancement of cancer therapies
US20250179501A1 (en) Methods of treating cancer and/or enhancing sensitivity to cancer treatment by increasing tumor mutation burden or tumor indels
US7319145B2 (en) Methylenetetrahydrofolate reductase inhibitors and use thereof
US20060135450A1 (en) Combinations of antisense oligonucleotides directed against thymidylate synthase mrna and uses thereof
EP1337259A2 (en) Methylenetetrahydrofolate reductase inhibitors and use thereof
US20050222063A1 (en) Methylenetetrahydrofolate reductase inhibitors and use thereof
WO2004106518A1 (en) Antisense oligonucleotides directed to ribonucleotide reductase r2 and uses thereof in the treatment of cancer

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: IN PCT GAZETTE 01/2004 UNDER (74) THE ADDRESS SHOULD READ "OTTAWA, ONTARIO K1P 5P9 (CA)"

122 Ep: pct application non-entry in european phase
ENP Entry into the national phase

Ref document number: 2006166909

Country of ref document: US

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 10518470

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2530108

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 10518470

Country of ref document: US