WO2003102214A2 - Method for efficient rna interference in mammalian cells - Google Patents
Method for efficient rna interference in mammalian cells Download PDFInfo
- Publication number
- WO2003102214A2 WO2003102214A2 PCT/US2003/017178 US0317178W WO03102214A2 WO 2003102214 A2 WO2003102214 A2 WO 2003102214A2 US 0317178 W US0317178 W US 0317178W WO 03102214 A2 WO03102214 A2 WO 03102214A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sirna
- rna
- stranded rna
- double stranded
- esirna
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/26—Endoribonucleases producing 5'-phosphomonoesters (3.1.26)
- C12Y301/26003—Ribonuclease III (3.1.26.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/12—Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/30—Production chemically synthesised
Definitions
- RNAi RNA interference
- siRNA is an important component leading to gene silencing (Fire et al, Nature 391:806-811 (1998); Timmons & Fire, Nature 395:854 (1998); WO99/32619; Kennerdell & Carthew, Cell 95:1017-1026 (1998); Ngo et al, Proc. Nat'lAcad. Sci. USA 95:14687-14692 (1998); Waterhouse et al, Proc. Nat'lAcad. Sci. USA 95:13959-13964 (1998); WO99/53050; Cogoni & Macino, Nature 399:166-169 (1999); Lolimann et al, Dev. Biol.
- siRNA Small interfering RNA
- RNA interference with synthetic siRNA can be inefficient and cost intensive, especially for functional genomic studies, h the present invention, E. coli RNase III is used to cleave double-stranded RNA into esiRNA ( endoribonuclease-prepared siRNA ) that can target multiple sites within an mRNA.
- esiRNA endoribonuclease-prepared siRNA
- the invention therefore provides an RNA duplex pool that can recognize multiple sites in any particular RNA to silence gene expression.
- esiRNA mediates effective RNA interference without apparent non-specific effect in cultured mammalian cells.
- Sequence-specific interference by esiRNA and the non-specific interferon response activated by long dsRNA are independent pathways in mammalian cells. EsiRNA works by eliciting the destruction of its cognate mRNA. Because of its simplicity and potency, this approach is useful for analysis of mammalian gene functions. In addition, this approach is useful for functional genomic screens to identify genes associated with a selected phenotype, such as a disease phenotype, in order to identify genes that can be used as targets for drug discovery and diagnostic applications.
- Figure 1A-C Preparation of siRNA from dsRNA by hydrolysis with E. coli RNase III.
- Lanes 1, and 7 are dsR-457; Lanes 2, 5 and 8 are dsF-592; Lanes 3, 6 and 9 are 21 bp siRNA marked by an arrow, (c) Agarose gel analysis of purified short RNA species processed from dsF-592. Lane M, 10 bp DNA marker; Lane 1 and 2 are chemically synthesized siRNAs. Lane 3, 21-23 bp; lane 4, 24-26 bp; Lane 5, 27-30 bp.
- Figure 2A-F siRNA-mediated gene silencing in insect and mammalian cells.
- esiRNA The effect of esiRNA on R-luc (a, c) or F-luc (b, d) expression was determined in Drosophila S2 cells (a, b) and mammalian cell lines, Hela and C33A (c, d). Plasmid DNAs with or without various sized dsRNAs were cotransfected into cells, (e) Reporter plasmids, siRNAs, dsR As and short hairpin RNAs. For Firefly (F-luc) and Renilla reniformis (R-luc) luciferase genes, the diagram illustrates DNA constructs used to produce in vivo mRNA and in vitro dsRNA.
- dsRNAs The positions of dsRNAs, chemically synthesized siRNAs (CS1 and CS2), in vitro transcribed siRNAs (Tl to T6) and short hairpin RNAs (HI to H6) are indicated, (f) The variable effect of synthetic siRNAs or short hairpin RNAs on different sequences within a gene. Plasmid DNAs with or without the various indicated short RNA species were cotransfected into Hela cells. R is the F-luc esiRNA shorter than 30 bp.
- Figure 3A-F Characteristics of RNAi.
- F-luc esiRNA (21-23 bp ) was transfected into RPE cells and luciferase activities were measured at the indicated time period. When Hela cells were used, F-luc target was expressed from cotransfected plasmid DNA.
- EsiRNA silences gene expression from mRNA templates. Hela cells were transfected with 0.5 ⁇ g F-luc mRNA with or without 0.1 ⁇ g of esiRNA (21-23 bp) for either F-luc or R-luc for 3 hours and then collected for luciferase assays. Data were expressed as arbitrary luciferase units and normalized to that produced in cells transfected with mRNA-only.
- EsiRNA corresponding to the promoter region has no RNAi activity.
- Hela cells were transfected with pGL-3-control (Promega) and pRL-CMV with or without 21-23 bp esiRNA corresponding to either the CMV promoter or R-luc. Luciferase activity was measured 24 to 96 hours after cotransf ection.
- e, f Relationship between RNAi and the interf eron signaling pathway. DsF-592 and F-luc esiRNA (21-23 bp) were transfected individually or together into Hela cells to silence F- luc expression from plasmid templates. Luciferase activity was measured 24 to 48 hours after cotransfection. Data were expressed as either F-luc units (e) or relative F-luc activity (f) and then normalized to that of DNA-only transfections.
- EsiRNA induces degradation of its cognate mRNA.
- 32 P- labelled F-luc or R-luc mRNA was incubated in extracts of Hela cells with or without its cognate esiRNAs for indicated time period and then analyzed in a 4% sequence gel.
- Figure 5A-C Silencing of endogenous mammalian genes with esiRNA.
- CHC clathrin heavy chain
- Selective reduction of c-Myc expression 293 cells were transfected with buffer, c-myc esiRNA, or R-luc esiRNA. Western blotting was performed with antibodies against c-myc and actin 72 hours after transfection.
- RNAi Double-stranded RNA interference, or RNAi, has became a powerful genetic tool to selectively silence gene expression in many eukaryotes (1-2).
- the cellular RNase III enzyme Dicer cleaves the dsRNA silencing trigger into
- siRNA small interfering RNA
- siRNA avoids activation of the interferon response.
- the activated PKR inhibits general translation by phosphorylation of the translation factor eukaryotic initiation factor 2 ⁇ ( eIF2 ci), while 2'-5'-oligoadenylate synthetase causes nonspecific mRNA degradation via activation of RNase L (9).
- siRNA can mediate selective gene silencing in the mammalian system (10-11). Hairpin RNA with a short loop and 19 to 27 base pairs in the stem also selectively silences expression of genes that are homologous to the sequence in the double-stranded stem (12-13). Mammalian cells can convert short hairpin RNA into siRNA to mediate selective gene silencing (12-13). Although many mammalian cells can also convert long dsRNA into siRNA, long dsRNA is incapable of triggering RNAi in these cells (7). The inability of long dsRNA to elicit RNAi in the vertebrate system has been generally attributed to non-specific activation of the interferon response (7-8). However, the relationship between the interferon signaling pathway and RNA interference has not been definitely addressed.
- siRNA provides a promising tool to assess the consequences of suppressing gene expression in cultured mammalian cells
- RNAi with synthetic siRNA is limited because siRNAs to different sequences within a gene have dramatically varied inhibitory ability (14-15). Therefore, each mRNA must be screened for an efficient siRNA, a laborious and costly process.
- processing of long dsRNAs should generate a great variety of siRNAs capable of interacting with multiple sites on target mRNAs, increasing the chance that at least one siRNA will pair with its target sequence.
- the power of siRNA as a genetic tool in the mammalian system could be greatly enhanced by using siRNA processed from dsRNA.
- Dicer is involved in the dsRNA cleavage in vivo, using Dicer to prepare siRNA in vitro may be problematic because dsRNA cleavage by Dicer is very inefficient, particularly for short dsRNAs (3, 16).
- E. coli RNase III RNase III, ⁇ C3.1.24
- These end structures of siRNA are reported to be important for RNAi activity (18).
- large amounts of soluble recombinant E. coli RNase III protein can be obtained (17).
- siRNAs and siRNA libraries in vitro. Exhaustive cleavage of dsRNA by E. coli RNase III leads to duplex products averaging 12 - 15 bp in length (17). These short dsRNA are unable to trigger an RNAi response in mammalian cells (6).
- siRNA of appropriate length performed limited RNase III digestion of dsRNA was performed, efficiently generating 20 - 25 bp siRNA.
- siRNAs recapitulated the potent and sequence-specific gene silencing by long dsRNA in Drosphila S2 cells. More importantly, they also mediated effective RNAi without non-specific effects in mammalian cells. SiRNA produced by the method successfully inhibited various endogenous genes in different mammalian cell lines. Because it is relatively quick and simple, this method is useful in utilizing siRNA for analysis of gene functions in cultured mammalian cells.
- a “target gene” refers to any gene suitable for regulation of expression, including both endogenous chromosomal genes and transgenes, as well as episomal or extrachromosomal genes, mitochondrial genes, chloroplastic genes, viral genes, bacterial genes, animal genes, plant genes, protozoal genes and fungal genes.
- siRNA refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when the siRNA expressed in the same cell as the gene or target gene.
- siRNA thus refers to the double stranded RNA formed by the complementary strands.
- the complementary portions of the siRNA that hybridize to form the double stranded molecule typically have substantial or complete identity.
- an siRNA refers to a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA.
- the sequence of the siRNA can correspond to the full length target gene, or a subsequence thereof.
- the siRNA is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length, preferable about preferably about 20-30 base nucleotides, preferably about 20-25 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
- "Inverted repeat” refers to a nucleic acid sequence comprising a sense and an antisense element positioned so that they are able to form a double stranded siRNA when the repeat is transcribed.
- the inverted repeat may optionally include a linker or a heterologous sequence such as a self-cleaving ribozyme between the two elements of the repeat.
- the elements of the inverted repeat have a length sufficient to form a double stranded RNA.
- each element of the inverted repeat is about 15 to about 100 nucleotides in length, preferably about 20-30 base nucleotides, preferably about 20-25 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
- “Substantial identity” refers to a sequence that hybridizes to a reference sequence under stringent conditions, or to a sequence that has a specified percent identity over a specified region of a reference sequence.
- stringent hybridization conditions refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays” (1993). Generally, stringent conditions are selected to be about 5-10°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength pH.
- T m thermal melting point
- the T m is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T m , 50% of the probes are occupied at equilibrium).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- a positive signal is at least two times background, preferably 10 times background hybridization.
- Exemplary stringent hybridization conditions can be as following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42°C, or, 5x SSC, 1% SDS, incubating at 65°C, with wash in 0.2x SSC, and 0.1% SDS at 65°C.
- a temperature of about 36°C is typical for low stringency amplification, although annealing temperatures may vary between about 32°C and 48°C depending on primer length.
- a temperature of about 62°C is typical, although high stringency annealing temperatures can range from about 50°C to about 65°C, depending on the primer length and specificity.
- Typical cycle conditions for both high and low stringency amplifications include a denaturation phase of 90°C - 95°C for 30 sec - 2 min., an annealing phase lasting 30 sec. - 2 min., and an extension phase of about 72°C for 1 - 2 min. Protocols and guidelines for low and high stringency amplification reactions are provided, e.g., in Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y.),
- Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions.
- Exemplary "moderately stringent hybridization conditions" include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in IX SSC at 45°C. A positive hybridization is at least twice background.
- Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency. Additional guidelines for determining hybridization parameters are provided in numerous reference, e.g., and Current Protocols in Molecular Biology, ed. Ausubel, et al
- substantially identical or “substantial identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., at least about 60%, preferably 65%, 70%, 75%, preferably 80%>, 85%, 90%, or 95% identity over a specified region), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
- This definition when the context indicates, also refers analogously to the complement of a sequence.
- the substantial identity exists over a region that is at least about 6-7 amino acids or 25 nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
- sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol.
- BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention.
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).
- This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence.
- T is referred to as the neighborhood word score threshold (Altschul et al, supra).
- a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat 'I. Acad. Sci. USA 90:5873-5787 (1993)).
- BLAST algorithm One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
- inhibitor expression of a target gene refers to the ability of a siRNA of the invention to initiate gene silencing of the target gene.
- samples or assays of the organism of interest or cells in culture expressing a particular construct are compared to control samples lacking expression of the construct.
- Control samples (lacking construct expression) are assigned a relative value of 100%. Inhibition of expression of a target gene is achieved when the test value relative to the control is about 90%, preferably 50%, more preferably 25-0%.
- Suitable assays include, e.g., examination of protein or mRNA levels using techniques known to those of skill in the art such as dot blots, northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, as well as phenotypic assays known to those of skill in the art.
- a "label” or a “detectable moiety” is a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means.
- useful labels include 32 P, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), digoxigenin, biotin, luciferase, CAT, beta galactosidase, GFP, or haptens and proteins which can be made detectable, e.g., by incorporating a radiolabel into the peptide or used to detect antibodies specifically reactive with the peptide.
- Bio sample includes tissue; cultured cells, e.g., primary cultures, explants, and transformed cells; cellular extracts, e.g., from cultured cells or tissue, cytoplasmic extracts, nuclear extracts; blood, etc.
- Biological samples include sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histologic purposes.
- a biological sample, including cultured cells is typically obtained from a eukaryotic organism, most preferably a mammal such as a primate, e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or * fish.
- Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in single- or double-stranded form.
- the term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
- PNAs peptide-nucleic acids
- nucleic acid is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.
- a particular nucleic acid sequence also implicitly encompasses "splice variants.”
- a particular protein encoded by a nucleic acid implicitly encompasses any protein encoded by a splice variant of that nucleic acid.
- "Splice variants,” as the name suggests, are products of alternative splicing of a gene. After transcription, an initial nucleic acid transcript may be spliced such that different (alternate) nucleic acid splice products encode different polypeptides.
- Mechanisms for the production of splice variants vary, but include alternate splicing of exons. Alternate polypeptides derived from the same nucleic acid by read-through transcription are also encompassed by this definition. Any products of a splicing reaction, including recombinant forms of the splice products, are included in this definition.
- amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
- Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, ⁇ -carboxyglutamate, and O-phosphoserine.
- Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
- Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
- Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
- Constantly modified variants applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
- nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
- each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
- TGG which is ordinarily the only codon for tryptophan
- amino acid sequences one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
- the following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginme (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Naline (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
- recombinant when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
- recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
- heterologous when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature.
- the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source.
- a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
- RNA population can be used to provide long precursor RNAs, or long precursor RNAs that have substantial or complete identity to a selected target sequence can be used to make the esiRNA of the invention.
- the RNAs can be isolated from cells or tissue, synthesized, and/or cloned according to methods well known to those of skill in the art.
- the RNA can be a mixed population (obtained from cells or tissue, transcribed from cDNA, subtrated, selected etc.), or can represent a single target sequence.
- RNA can be naturally occurring, e.g., isolated from tissue or cell samples, or synthesized in vitro, e.g., using T7 or SP6 polymerase and PCR products or a cloned cDNA. Both selected target RNAs and RNA populations can be synthesized in vitro.
- the complement is also transcribed in vitro and hybridized to form a ds RNA.
- the RNA complements are also provided (to form dsRNA for digestion by E. coli RNAse III), e.g., by transcribing cDNAs corresponding to the RNA population, or by using RNA polymerases.
- the precursor RNAs are then hybridized to form double stranded RNAs for RNAse II digestion.
- the ds RNAs are then digested in vitro with E. coli RNAse III (either recombinant or naturally occurring) to the methods described herein.
- Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, J Bad. 132:349-351 (1977); Clark- Curtiss & Curtiss, Methods in Enzymology 101 :347-362 (Wu et al, eds, 1983). Any of the well-known procedures for introducing foreign nucleotide sequences into host cells may be used.
- nucleic acids include the use of naked nucleic acids, viral transduction, calcium phosphate transfection, polybrene, protoplast fusion, electroporation, biolistics, liposomes, microinjection, plasma vectors, viral vectors and any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA, RNA (either naturally occurring or synthetic) or other foreign genetic material into a host cell (see, e.g., Sambrook et al, supra). It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing an esiRNA into the host cell.
- E. coli RNase III To prepare a heterogeneous siRNA population that could potentially target multiple sites per mRNA molecule for inhibition, we used E. coli RNase III to digest long dsRNAs representing the mRNA targets. We overexpressed E. coli RNase III as a GST fusion protein in E. coli and purified it to homogeneity (Fig. la). To make a 592 bp dsRNA (dsF-592) corresponding to the firefly luciferase (F-luc ) and a 457 bp dsRNA (dsR-457) of Renilla luciferase (R- luc), we performed in vitro transcription from PCR products that had appended phage promoters at each ends (Fig. 2e).
- RNAs corresponding to approximately 21-23, 24-26, and 27-30 bp Fig. lc.
- siRNA prepared by RNase III digestion as esiRNA (endoribonuclease-prepared siRNA).
- RNAi activity of long dsRNA with its esiRNA is consistent with the presumption that siRNA is the bone fide mediator of the RNAi reaction.
- esiRNA is a specific gene silencer in mammalian cells.
- 21 -23 bp esiRNA of R-luc caused 85-90% inhibition of relative R-luc expression in both Hela and C33A cells (Fig. 2c).
- esiRNAs of F-luc inhibited 90-95% of relative F-luc expression (Fig. 2d). This reciprocal effect indicates that the short RNA duplexes acted in a sequence-specific manner without affecting expression from the non- complementary templates.
- siRNAs and short hairpin RNAs for F-luc only three showed reasonable RNAi activity (Fig. 2f).
- the synthetic siRNAs or hairpin RNAs recognized only one sequence element, whereas esiRNAs covered comprehensive sequence elements of the target mRNA. Thus, esiRNA likely increases the chance that at least one siRNA can pair with and lead to destruction of its target.
- siRNAs are more potent inhibitors than antisense RNAs (Fig. 2f, 3a).
- RNAi reaction we determined the duration of F-luc esiR A-mediated inhibition of chromatin templates in the above hTERT-RPEl cells. We observed 50% to 65% inhibition of F-luc activity at 8 hours after transfection, suggesting that silencing was established rapidly. Silencing reached the maximum 5 to 6 days after transfection and then declined (Fig. 3b). When plasmid DNA was used to express targets for inhibition in Hela cells, we observed that the inhibition could last 2 weeks if high esiRNA doses were used. Low doses of esiRNA caused less potent inhibition that was sustained for several days (Fig. 3b).
- esiRNA-mediated inhibition was at least partially dependent on esiRNA dose with either episomal or chromatin templates.
- the rapidity and longevity of esiRNA-mediated inhibition suggests that esiRNAs could be used to inactivate genes whose protein products are relatively stable. E. EsiRNA elicits mRNA decay
- RNAi in C. elegance and Drosophila A key feature of RNAi in C. elegance and Drosophila is that it exerts its effect by eliciting the destruction of targeted mRNA (1).
- siRNAs also act post-transcriptionally in the mammalian system, we asked if esiRNA could directly inhibit expression from its cognate mRNA.
- esiRNA could directly inhibit expression from its cognate mRNA.
- cotransfected esiRNAs for F-luc but not R-luc caused 15-fold inhibition of F-luc activity, suggesting that siRNA-mediated gene silencing is directed at mRNA in mammalian cells (Fig.
- esiRNA inhibited relative F-luc activity equally with or without cotransfected dsF-592, suggesting that activation of non-specific interferon response has no effect on the potency of specific RNAi inhibition (Fig. 3f).
- inactivation of the interferon response suffices to activate specific gene silencing of long dsRNA.
- mouse embryonic f ibroblast cells lacking either PKR or both PKR and RNase L were defective in both non-specific and specific gene silencing triggered by dsF-592, although siRNA-mediated RNAi could be detected ( data not shown ).
- sequence-specific RNA interference mediated by siRNA is independent of dsRNA-triggered non-specific gene silencing.
- LCa clathrin light chain a
- esiRNA could be used to inhibit genes whose mRNA and protein products are low in abundance and relatively unstable.
- the level of c-myc protein was reduced by about 70% (Fig. 5b).
- Inhibition was sequence-specific because actin expression was not affected and unrelated R-luc esiRNA failed to reduce c-myc expression.
- Cdkl and Cdk2 cyclin-dependent kinase
- the RNase III/ esiRNA protocol was also used to specifically reduce expression of chaperon p23).
- RNAs produced by hydrolysis with E. coli RNase III can specifically silence gene expression in cultured mammalian cells, in a manner similar to that observed with synthetic siRNA.
- esiRNA protocol presents several advantages. Because esiRNA can potentially target multiple sites within an mRNA, the requirement of screening efficient siRNA for individual genes is eliminated. Targeting of multiple sites would also be important in efforts to reduce viral replication because it can restrict the emergence of siRNA-resistant strains produced by base pair mismatches.
- the protocol is technically simple and quick, and it is effective on a wide range of proteins in different mammalian cell lines. Large-scale functional genomic studies with dsRNA have already been successful in C.
- RNAi with esiRNA could be easily adapted for analysis of gene functions at the genome scale in cultured mammalian cells.
- a reverse genetics approach with esiRNA could be particularly useful to identify genes essential for viability because it is difficult to make stable mutants for those genes.
- Cancer cells are genetically different from their normal cell counterparts, often having undergone at least a half-dozen mutations (24).
- EsiRNA could be used to search genes whose downregulation specifically kills tumor cells with primary defect, a synthetic lethal approach that simultaneously identifies and validates appropriate new drug targets.
- the E. coli RNase III coding sequence was amplified with PCR from the bacterial strain DH5 ⁇ genomic DNA with the upstream primer cgc gga tec aac ccc ate gta att aat egg ctt ca and downstream primer gac gtc cga cga tgg caa t, and cloned into Bam HI and Sma I of pGEX-2T (Pharmacia).
- the bacterial strain BL21(DE3) carrying the expression vector was grown at 37°C to an OD 6 oo of 0.5 and induced with 1 mM IPTG for 2 hours.
- GST-RNase III was purified with glutathione-agarose beads according to the manufacture's instruction (Pharmacia), dialyzed against 20 mM TrisHCL, 0.5 mM EDTA, 5 mM MgCL2, 1 mM DTT, 140 mM NaCL, 2.7 mM KCL, 30% glycerol, pH 7.9 over night, and kept at -20 °C. Approximately 1 mg of RNase III was purified from 1 liter of culture. There was no significant loss of enzyme activity after 6 month of storage.
- siRNAs CSl and CS2 were synthesized chemically (Dharmacon). SiRNAs, Tl to T6, and short RNA hairpins, HI to H6, were synthesized using the MEGAshortscriptTM kit (Ambion) from oligo DNA templates carrying a phage T7 promoter at one end. All siRNAs were 21 nucleotide long and had 2-nucleotide 3' overhangs. All short hairpin RNAs had a 24 bp stem with a UCU loop and an extra GGG A at 5' end for efficient transcription in vitro. Other RNA strands were individually synthesized using the MEG AscriptTM kit (Ambion) from PCR-derived linear templates carrying a phage T7 promoter at both ends. dsRNA was formed by annealing as described previously (16).
- the ends of the dsR-457 RNAs corresponded to 1200-1656 in pRL- CMV (Promega).
- the F-luc RNAs corresponded to the following position in pEGFPLuc (Clontech): dsF-592, 1455-2046; CSl, 1520-1538; CS2, 1900-1918; Tl, 603-621; T2, 624-642; T3, 2448-2466; T4, 2994-3012; T5, 3013-3031; T6, 3049-3067; HI, 989-1012; H2, 1520-1543; H3, 2529-2552; H4, 2601-2624; H5, 2906-2929; H6, 2947-2970.
- Templates for LCa and Cdkl dsRNA represented the full coding sequences of their genes.
- Templates for the 681 bp c-myc dsRNA were amplified with forward primer gactcaacgttagcttcaccaaca and reverse primer ggactccgtcgaggagagcaga. All these primers had appended 18 base phage promoters.
- RNA duplexes short RNAs of appropriate sizes were eluted from gel slices by soaking in 1 M (NHt ⁇ AC at 37 °C over night and recovered by ethanol precipitation. The precipitate was dissolved in TE buffer at 1.0 ⁇ g/ ⁇ l.
- dsRNAs were digested with 0.2 ug of RNase III for one hour at 21 °C and reactions were loaded onto QIAquick spin columns after being supplemented with 5 volume of PN buffer (QIAquick nucleotide removal kit, Qiagen).
- PN buffer QIAquick nucleotide removal kit, Qiagen.
- Flowthrough usually contained RNA from 15 to 25 base paires, which was precipitated by ethanol and dissolved in TE buffer. The concentration of esiRNA was determined by UV2 ⁇ o.
- hTERT-RPEl retinal pigment epithelial
- hTERT-RPEl cells were permanently transfected with a F-luc expression construct to express firefly luciferase from chromatin templates and were grown in DEME/F12 medium.
- Drosophila S2 cells were grown in Schneider medium. All medium was from Life Technology and supplemented with 10 % FBS (vol/vol). Mammalian cells were cultured at 37 °C, S2 cells at room temperature.
- transf ections utilized one ⁇ g of DNA per well in 0.5 ml transfection medium (0.5 ⁇ g pEGFPLuc, 0.1 ⁇ g pRL-SV40, and 0.4 ⁇ g pUC19, and 47 nM esiRNA). Data were expressed as mean ratio of relative Luc activities (F-luc/ R-luc or R-luc/ F-luc) and normalized to that in cells transfected with DNA only. Error bars equal +/- one standard deviation.
- esiRNA was transfected into each well of a 6- well plate using lipof ectamine 2000 for 3 hours and then changed to the fresh medium. Luciferase activity was measured as described previously ( 16 ). Protein concentrations were measured by Bradford assays (Biorad ). To silence endogenous gene expression, cells were cotransfected with 1 ⁇ g esiRNA using lipofectamine 2000.
- RNAi For in vitro RNAi, 10 ⁇ l of extracts were incubated for indicated times at 37 C with 100 nM esiRNA in a 20 ⁇ l of reaction containing 20 mM Hepes pH 7.0, 1 mM MgOAC, 100 mM K 2 (OAC ), 5 mM DTT, 500 uM NTP and 2 units of RNasin (Pr omega).
- 100 nM esiRNA in a 20 ⁇ l of reaction containing 20 mM Hepes pH 7.0, 1 mM MgOAC, 100 mM K 2 (OAC ), 5 mM DTT, 500 uM NTP and 2 units of RNasin (Pr omega).
- clathrin light chain and heavy chain cells extracts were prepared as described previously (21, 25).
- c-myc, Cdkl and Cdk2 transfected cells grown in 6-well plates were harvested in PBS buffer containing 1 % NP-40 and mixed with an equal volume of SDS sample buffer. Equal amounts of total protein were separated on 12.5% polyacrylamide gels and transferred to nitrocellulose. Standard immunostaining was carried out using ECL (Amersham Pharmacia). Rabbit serum which recognizes both LCa and LCb, and monoclonal TD.l against clathrin heavy chain were described previously (21, 25 ).
- Anti-c-Myc antibody, N262, and antibodies for Cyclin A and Cdk2 are from Santa Cruz biotechnology, anti-actin antibody from Sigma.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE60331321T DE60331321D1 (en) | 2002-05-31 | 2003-05-29 | METHOD FOR EFFECTIVE RNA INTERFERENCE IN MAMMALIAN CELLS |
AT03756319T ATE458064T1 (en) | 2002-05-31 | 2003-05-29 | METHOD FOR EFFECTIVE RNA INTERFERENCE IN MAMMAL CELLS |
JP2004510450A JP2005536195A (en) | 2002-05-31 | 2003-05-29 | Method for efficient RNA interference in mammalian cells |
CA2486658A CA2486658C (en) | 2002-05-31 | 2003-05-29 | Method for efficient rna interference in mammalian cells |
AU2003253618A AU2003253618B2 (en) | 2002-05-31 | 2003-05-29 | Method for efficient RNA interference in mammalian cells |
EP03756319A EP1537227B1 (en) | 2002-05-31 | 2003-05-29 | Method for efficient rna interference in mammalian cells |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US38501102P | 2002-05-31 | 2002-05-31 | |
US60/385,011 | 2002-05-31 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2003102214A2 true WO2003102214A2 (en) | 2003-12-11 |
WO2003102214A3 WO2003102214A3 (en) | 2005-02-17 |
Family
ID=29712121
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2003/017178 WO2003102214A2 (en) | 2002-05-31 | 2003-05-29 | Method for efficient rna interference in mammalian cells |
Country Status (8)
Country | Link |
---|---|
US (1) | US8119610B2 (en) |
EP (1) | EP1537227B1 (en) |
JP (1) | JP2005536195A (en) |
AT (1) | ATE458064T1 (en) |
AU (1) | AU2003253618B2 (en) |
CA (1) | CA2486658C (en) |
DE (1) | DE60331321D1 (en) |
WO (1) | WO2003102214A2 (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1532271A2 (en) * | 2002-06-12 | 2005-05-25 | Ambion, Inc. | Methods and compositions relating to polypeptides with rnase iii domains that mediate rna interference |
US9777275B2 (en) | 2002-02-01 | 2017-10-03 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
US10106793B2 (en) | 2002-02-01 | 2018-10-23 | Life Technologies Corporation | Double-stranded oligonucleotides |
Families Citing this family (34)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003064621A2 (en) | 2002-02-01 | 2003-08-07 | Ambion, Inc. | HIGH POTENCY siRNAS FOR REDUCING THE EXPRESSION OF TARGET GENES |
WO2003076592A2 (en) * | 2002-03-06 | 2003-09-18 | Rigel Pharmaceuticals, Inc. | Novel method for delivery and intracellular synthesis of sirna molecules |
US20040248094A1 (en) * | 2002-06-12 | 2004-12-09 | Ford Lance P. | Methods and compositions relating to labeled RNA molecules that reduce gene expression |
US20100075423A1 (en) * | 2002-06-12 | 2010-03-25 | Life Technologies Corporation | Methods and compositions relating to polypeptides with rnase iii domains that mediate rna interference |
JP4339852B2 (en) * | 2002-08-12 | 2009-10-07 | ニュー・イングランド・バイオラブズ・インコーポレイティッド | Methods and compositions for gene silencing |
CA2554818A1 (en) | 2004-02-09 | 2005-08-25 | Thomas Jefferson University | Diagnosis and treatment of cancers with microrna located in or near cancer-associated chromosomal features |
AU2005222965B8 (en) * | 2004-03-15 | 2010-07-01 | City Of Hope | Methods and compositions for the specific inhibition of gene expression by double-stranded RNA |
US20050267300A1 (en) | 2004-04-05 | 2005-12-01 | Muthiah Manoharan | Processes and reagents for oligonucleotide synthesis and purification |
US7626014B2 (en) | 2004-04-27 | 2009-12-01 | Alnylam Pharmaceuticals | Single-stranded and double-stranded oligonucleotides comprising a 2-arylpropyl moiety |
US7674778B2 (en) * | 2004-04-30 | 2010-03-09 | Alnylam Pharmaceuticals | Oligonucleotides comprising a conjugate group linked through a C5-modified pyrimidine |
AU2005327517B2 (en) * | 2004-06-30 | 2011-05-26 | Alnylam Pharmaceuticals, Inc. | Oligonucleotides comprising a non-phosphate backbone linkage |
WO2006093526A2 (en) | 2004-07-21 | 2006-09-08 | Alnylam Pharmaceuticals, Inc. | Oligonucleotides comprising a modified or non-natural nucleobase |
EP1913011B1 (en) | 2004-08-04 | 2016-11-02 | Alnylam Pharmaceuticals Inc. | Oligonucleotides comprising a ligand tethered to a modified or non-natural nucleobase |
SI2567976T1 (en) | 2005-03-23 | 2017-11-30 | Genmab A/S | Antibodies against CD38 for treatment of multiple myeloma |
ES2527592T3 (en) | 2006-01-05 | 2015-01-27 | The Ohio State University Research Foundation | MicroRNA based methods for the diagnosis of colon cancer |
EP2502630B1 (en) | 2006-01-05 | 2015-03-11 | The Ohio State University Research Foundation | MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer |
AU2007205257B2 (en) | 2006-01-05 | 2013-07-25 | The Ohio State University Research Foundation | MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors |
EP2522749A1 (en) | 2006-03-02 | 2012-11-14 | The Ohio State University | MicroRNA expression profile associated with pancreatic cancer |
AU2007227423B2 (en) | 2006-03-20 | 2013-11-07 | The Ohio State University Research Foundation | MicroRNA fingerprints during human megakaryocytopoiesis |
AU2007272947B2 (en) | 2006-07-13 | 2013-06-06 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Micro-RNA-based methods and compositions for the diagnosis and treatment of colon cancer-related diseases |
WO2008115387A2 (en) * | 2007-03-15 | 2008-09-25 | University Hospitals Of Cleveland | Screening, diagnosing, treating and prognosis of pathophysiologic states by rna regulation |
WO2009012263A2 (en) * | 2007-07-18 | 2009-01-22 | The Trustees Of Columbia University In The City Of New York | Tissue-specific micrornas and compositions and uses thereof |
CN101809169B (en) | 2007-07-31 | 2013-07-17 | 俄亥俄州立大学研究基金会 | Methods for reverting methylation by targeting DNMT3A and DNMT3B |
US8465918B2 (en) | 2007-08-03 | 2013-06-18 | The Ohio State University Research Foundation | Ultraconserved regions encoding ncRNAs |
CA2926831A1 (en) | 2007-08-22 | 2009-02-26 | The Ohio State University Research Foundation | Methods and compositions for inducing deregulation of epha7 and erk phosphorylation in human acute leukemias |
CA2698771A1 (en) | 2007-09-06 | 2009-03-12 | The Ohio State University Research Foundation | Microrna signatures in human ovarian cancer |
WO2009049129A1 (en) | 2007-10-11 | 2009-04-16 | The Ohio State University Research Foundation | Methods and compositions for the diagnosis and treatment of esphageal adenocarcinomas |
WO2012164058A1 (en) | 2011-06-01 | 2012-12-06 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for adjusting expression of mitochondrial genome by microrna |
JP2014530612A (en) | 2011-10-14 | 2014-11-20 | ジ・オハイオ・ステート・ユニバーシティ | Methods and materials for ovarian cancer |
US20140288156A1 (en) | 2011-10-27 | 2014-09-25 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Methods for the treatment and diagnosis of atherosclerosis |
EP2836219A1 (en) | 2012-04-10 | 2015-02-18 | INSERM - Institut National de la Santé et de la Recherche Médicale | Methods for the treatment of nonalcoholic steatohepatitis |
WO2013153139A1 (en) | 2012-04-11 | 2013-10-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the treatment and diagnosis of acute leukemia |
EP3079727A1 (en) | 2013-12-12 | 2016-10-19 | INSERM - Institut National de la Santé et de la Recherche Médicale | Methods for the prevention and treatment of diabetic cardiomyopathy using mir-424/322 |
US20220211741A1 (en) | 2019-04-18 | 2022-07-07 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the treatment and prognosis of cancer |
Family Cites Families (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6737512B2 (en) * | 1996-06-06 | 2004-05-18 | Isis Pharmaceuticals, Inc. | Human RNase III and compositions and uses thereof |
EP1272630A2 (en) * | 2000-03-16 | 2003-01-08 | Genetica, Inc. | Methods and compositions for rna interference |
US20030114410A1 (en) * | 2000-08-08 | 2003-06-19 | Technion Research And Development Foundation Ltd. | Pharmaceutical compositions and methods useful for modulating angiogenesis and inhibiting metastasis and tumor fibrosis |
US6329203B1 (en) * | 2000-09-08 | 2001-12-11 | Isis Pharmaceuticals, Inc. | Antisense modulation of glioma-associated oncogene-1 expression |
US7067322B2 (en) * | 2001-07-10 | 2006-06-27 | Wisconsin Alumni Research Foundation | Fusion protein arrays on metal substrates for surface plasmon resonance imaging |
AU2003243541A1 (en) * | 2002-06-12 | 2003-12-31 | Ambion, Inc. | Methods and compositions relating to labeled rna molecules that reduce gene expression |
JP4339852B2 (en) * | 2002-08-12 | 2009-10-07 | ニュー・イングランド・バイオラブズ・インコーポレイティッド | Methods and compositions for gene silencing |
WO2005072272A2 (en) * | 2004-01-23 | 2005-08-11 | New England Biolabs, Inc. | Compositions and methods for generating short double-stranded rna using mutated rnase iii |
-
2003
- 2003-05-29 AU AU2003253618A patent/AU2003253618B2/en not_active Expired
- 2003-05-29 WO PCT/US2003/017178 patent/WO2003102214A2/en active Search and Examination
- 2003-05-29 JP JP2004510450A patent/JP2005536195A/en active Pending
- 2003-05-29 EP EP03756319A patent/EP1537227B1/en not_active Expired - Lifetime
- 2003-05-29 AT AT03756319T patent/ATE458064T1/en not_active IP Right Cessation
- 2003-05-29 CA CA2486658A patent/CA2486658C/en not_active Expired - Lifetime
- 2003-05-29 DE DE60331321T patent/DE60331321D1/en not_active Expired - Lifetime
- 2003-05-29 US US10/448,612 patent/US8119610B2/en active Active
Non-Patent Citations (4)
Title |
---|
CONRAD; RAUHET, INT. JOURNAL. OF BIOCHEM. AND CELL BIOL, vol. 34, no. 2, February 2002 (2002-02-01), pages 116 - 129 |
ELBASHIR ET AL., NATURE, vol. 411, no. 6836, 2001, pages 494 - 498 |
SIJEN ET AL., CELL, vol. 107, 16 November 2001 (2001-11-16), pages 465 - 476 |
TIMMONS ET AL., GENE, vol. 263, no. 12, 24 January 2001 (2001-01-24), pages 103 - 112 |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9777275B2 (en) | 2002-02-01 | 2017-10-03 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
US9796978B1 (en) | 2002-02-01 | 2017-10-24 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
US10036025B2 (en) | 2002-02-01 | 2018-07-31 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
US10106793B2 (en) | 2002-02-01 | 2018-10-23 | Life Technologies Corporation | Double-stranded oligonucleotides |
US10196640B1 (en) | 2002-02-01 | 2019-02-05 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
US10626398B2 (en) | 2002-02-01 | 2020-04-21 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
EP1532271A2 (en) * | 2002-06-12 | 2005-05-25 | Ambion, Inc. | Methods and compositions relating to polypeptides with rnase iii domains that mediate rna interference |
EP1532271A4 (en) * | 2002-06-12 | 2006-10-18 | Ambion Inc | Methods and compositions relating to polypeptides with rnase iii domains that mediate rna interference |
Also Published As
Publication number | Publication date |
---|---|
DE60331321D1 (en) | 2010-04-01 |
US8119610B2 (en) | 2012-02-21 |
AU2003253618A1 (en) | 2003-12-19 |
EP1537227A4 (en) | 2007-09-26 |
AU2003253618B2 (en) | 2007-11-15 |
ATE458064T1 (en) | 2010-03-15 |
CA2486658C (en) | 2014-07-29 |
US20040014113A1 (en) | 2004-01-22 |
JP2005536195A (en) | 2005-12-02 |
EP1537227B1 (en) | 2010-02-17 |
WO2003102214A3 (en) | 2005-02-17 |
EP1537227A2 (en) | 2005-06-08 |
CA2486658A1 (en) | 2003-12-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2003253618B2 (en) | Method for efficient RNA interference in mammalian cells | |
Holen et al. | Positional effects of short interfering RNAs targeting the human coagulation trigger Tissue Factor | |
Gan et al. | Specific interference with gene expression and gene function mediated by long dsRNA in neural cells | |
Yang et al. | Short RNA duplexes produced by hydrolysis with Escherichia coli RNase III mediate effective RNA interference in mammalian cells | |
Langlois et al. | Cytoplasmic and nuclear retained DMPK mRNAs are targets for RNA interference in myotonic dystrophy cells | |
US8137910B2 (en) | Method of regulating gene expression | |
WO2004046320A2 (en) | METHODS AND COMPOSITIONS FOR REDUCING TARGET GENE EXPRESSION USING COCKTAILS OF siRNAS OR CONSTRUCTS EXPRESSING siRNAS | |
IL161100A (en) | Nucleic acid molecules as regulators of developmental timing, recombinant expression vectors comprising the same and compositions comprising them | |
Kühn et al. | The nuclear poly (A) binding protein of mammals, but not of fission yeast, participates in mRNA polyadenylation | |
Gardiner et al. | A conserved motif of vertebrate Y RNAs essential for chromosomal DNA replication | |
Seyhan et al. | Complete, gene-specific siRNA libraries: production and expression in mammalian cells | |
WO2003091433A1 (en) | EXPRESSION SYSTEMS FOR STEM LOOP RNA MOLECULE HAVING RNAi EFFECT | |
US7695964B2 (en) | Compositions and methods for generating short double-stranded RNA using mutated RNAse III | |
WO2006130976A1 (en) | Interfering rnas, methods for their production, and use | |
Chen et al. | Vector-based siRNA delivery strategies for high-throughput screening of novel target genes | |
EP2841577B1 (en) | High complexity sirna pools | |
KR101480523B1 (en) | siRNA for Inhibiting Endogenous rpS3 Expression | |
Lee et al. | Roles for Drosophila cap1 2′-O-ribose methyltransferase in the small RNA silencing pathway associated with Argonaute 2 | |
Lamarcq et al. | Large-scale, high-throughput validation of short hairpin RNA sequences for RNA interference | |
EP1783219A1 (en) | Method of searching for novel drug discovery targets | |
US20050233994A1 (en) | Methods and vectors for expressing siRNA | |
CN115491377A (en) | Nucleotide sequence for inducing RNA interference, reducing and eliminating virus pollution in cells and application | |
Tseng et al. | LARP3, LARP7, and MePCE are Involved in the Early Stage of Human Telomerase RNA Biogenesis | |
WO2005111219A1 (en) | METHODS AND VECTORS FOR EXPRESSING siRNA | |
Kunath | Transgenic RNA interference to investigate gene function in the mouse |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2486658 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2003253618 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2004510450 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2003756319 Country of ref document: EP |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWP | Wipo information: published in national office |
Ref document number: 2003756319 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2003253618 Country of ref document: AU Date of ref document: 20030529 Kind code of ref document: B |