WO2003100099A1 - Parallel stranded duplexes of deoxyribonucleic acid and methods of use - Google Patents

Parallel stranded duplexes of deoxyribonucleic acid and methods of use Download PDF

Info

Publication number
WO2003100099A1
WO2003100099A1 PCT/US2003/016520 US0316520W WO03100099A1 WO 2003100099 A1 WO2003100099 A1 WO 2003100099A1 US 0316520 W US0316520 W US 0316520W WO 03100099 A1 WO03100099 A1 WO 03100099A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sequence
triplex
haiφin
polypyrimidine
Prior art date
Application number
PCT/US2003/016520
Other languages
French (fr)
Inventor
Ramon Eritja
Ramon G. Garcia
Original Assignee
Cygene, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cygene, Inc. filed Critical Cygene, Inc.
Priority to AU2003241620A priority Critical patent/AU2003241620A1/en
Priority to EP03731370A priority patent/EP1507873A4/en
Priority to JP2004507539A priority patent/JP2005527219A/en
Publication of WO2003100099A1 publication Critical patent/WO2003100099A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6839Triple helix formation or other higher order conformations in hybridisation assays
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means

Definitions

  • COMPUTER READABLE FORM AND SEQUENCE LISTING Applicants state that the content of the sequence listing information recorded in computer readable form (CRF) as filed with this utility patent application is identical to the written paper sequence listing as filed with this utility patent application and contains no new matter as required by 37 CFR 1.821 (e-g) and 1.825 (b) and (d).
  • This invention relates to a novel triplex comprising a polypyrimidine sequence, a linker, and a polypurine sequence that is complementary to and parallel to the polypyrimidine sequence, and wherein the polypurine sequence comprises at least one 8- aminopurine, and a polypyrimidine target sequence that is complementary to and antiparallel to the polypurine sequence.
  • Methods for preparing and using the triplex are also provided.
  • DNA can form a large range of helical structures including duplexes, triplexes, and tetraplexes.
  • the right-handed B-type duplex is the most common structure of DNA, but even now, decades after the discovery of the B-DNA,.new double helical conformations of DNA are being described.
  • DNA has great flexibility and exhibits a large polymorphism depending on sequence, chemical modifications, or alterations in the DNA environment.
  • DNA duplexes including the well-known B and A forms, are antiparallel (i.e., one strand runs 5' ⁇ 3' and the other 3' ⁇ 5'), but parallel arrangements have been found in both hairpins and linear DNAs. Sequences with propensity to form parallel DNAs have been found in specific chromosome regions, and could have an evolutionary role. Moreover, certain types of parallel-stranded DNA can be excellent templates for the formation of triplexes. This is very useful for biotechnological purposes, including anti gene (targeting of genetic DNA by an artificial oligonucleotide) and antisense (targeting of natural messenger RNA by an artificial oligonucleotide) therapies.
  • Parallel DNA duplexes were first found in the crystal structure of a very short, mismatched DNA sequence intercalated by proflavine. Low resolution data of parallel- stranded duplex were found for longer pieces of RNA of sequence poly [d(A-U)], where the 2-position of adenines was modified by addition of bulky groups.
  • the first structural model of polymeric parallel-stranded duplex DNA was derived by Pattabiraman, who on the basis of theoretical calculations designed a model for the parallel pairing of poly[d(A-T)] duplexes based on the reverse Watson-Crick motif. This model has been confirmed by low and high resolution experimental techniques on d(A-T) rich sequences.
  • the parallel-stranded duplex model early described by Pattabiraman and further refined by NMR data shows a general structure not far from the canonical antiparallel B- type helix.
  • the bases are mostly perpendicular to the helix axis, there are two equivalent grooves, sugar units present puckerings in the South region, and the A T pairings are reverse Watson-Crick ( Figure 1).
  • the rWC double helix is less stable than comparable antiparallel helices, but it can be found in hairpins and linear DNAs designed to hinder the formation of the antiparallel d(A-T) helix.
  • the presence of a few d(G C) steps in the rWC double helix might be tolerated, but it destabilizes the duplex.
  • duplex stability can be also enhanced by DNA -binding drugs such as benzopyridoindole derivatives.
  • DNA -binding drugs such as benzopyridoindole derivatives.
  • H-based parallel duplexes can be more stable than the canonical B-type antiparallel duplex under certain conditions.
  • Oligonucleotides bind in a sequence-specific manner to homopurine- homopyrimidine sequences of duplex and single-stranded DNA and RNA to form triplexes.
  • Nucleic acid triplexes have wide applications in diagnosis, gene analysis and therapy, namely the extraction and purification of specific nucleotide sequences, control of gene expression, mapping of genomic DNA, induction of mutations in genomic DNA, detection of mutations in homopurine DNA sequences, site-directed mutagenesis, triplex- mediated inhibition of viral DNA integration, non-enzymatic ligation of double-helical DNA and quantification of polymerase chain reactions.
  • One of the main drawbacks of these applications is the low stability of triple helices especially in neutral conditions, and when the homopurine-homopyrimidine tracks have interruptions.
  • a large effort has been made to design modified oligonucleotides and thus enhance triple helix stability in homopolymers and triplexes with interruptions in the homopurine-homopyrimidine tracks.
  • Successful modifications of the nucleobases include molecules such as 5-methylcytidine, 5-methyl-2,6(lH,3H)- pyrimidinedione, and 2'-O-methylpseudoisocytidine.
  • Triplexes are typically formed by adding a triplex-forming oligonucleotide (TFO) to a duplex DNA.
  • TFO triplex-forming oligonucleotide
  • an alternative approach is based on the use of parallel- stranded duplexes. Accordingly, purine residues are linked to a pyrimidine chain of inverted polarity by 3 -3' or 5'-5' internucleotide junctions.
  • Such parallel-stranded DNA hairpins have been synthesized and bind single-stranded DNA and RNA-targets by triplex formation, similar to the foldback all-pyrimidine hairpins that are known by those skilled in the art.
  • this invention provides 8-amino derivatives to stabilize parallel duplexes that can be then used as templates for the formation of triple helices of DNA or DNA-RNA-DNA, that have a large impact in biotechnological and pharmaceutical research.
  • a triplex comprising a hai ⁇ in comprising at least one first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein at least one of the polypurine sequence is complementary to and parallel to the first polypyrimidine sequence, and the polypurine sequence comprising at least one 8-aminopurine; and at least one polypyrimidine target sequence, wherein at least one of the polypyrimidine target sequence is complementary to and antiparallel to the polypurine sequence, wherein the polypyrimidine target sequence and the hairpin are bound to each other.
  • the triplex includes wherein the polypyrimidine target sequence comprises at least one purine interruption.
  • the triplex includes wherein the polypurine sequence of the hairpin comprises at least one pyrimidine interruption. In yet another embodiment of this invention, the triplex includes wherein the first polypyrimidine sequence of the hai ⁇ in comprises at least one purine interruption or an abasic interruption or an abasic model compound interruption.
  • the triplex as described herein, includes the linker that is at least one of a hexaethylene glycol, a tetrathymine, CTTTG, or GGAGG.
  • the triplex includes wherein the 8- aminopurine comprises 8-aminoguanine.
  • the triplex includes wherein the 8-aminopurine comprises 8-aminoadenine.
  • the triplex includes where the 8-aminopurine comprises 8-aminohypoxanthine.
  • Another embodiment of this invention provides a method for preparing a hai ⁇ in containing at least one 8-aminopurine comprising preparing a pyrimidine strand; binding a linker to the 3' end of the pyrimidine strand; preparing a purine strand comprising at least one 8-aminopurine; and preparing the hai ⁇ in by binding the 3' end of the purine strand to the linker.
  • a method for preparing a hai ⁇ in containing at least one 8-aminopurine comprising preparing a purine strand comprising at least one 8-aminopurine; binding a linker to the 5' end of the purine strand; preparing a pyrimidine strand; and preparing the hai ⁇ in by binding the 5' end of the pyrimidine strand to the linker.
  • Another embodiment of this invention includes a hai ⁇ in comprising at least one first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein at least one of the polypurine sequence comprises at least one 8-aminopurine and wherein the polypurine sequence is complementary to and parallel to the first polypyrimidine sequence.
  • the present invention also provides a method for stabilizing a triplex comprising obtaining a triplex comprising a hai ⁇ in, wherein the hai ⁇ in comprises at least a first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein the polypurine sequence comprises at least one 8-aminopurine, and contacting the triplex with a sodium chloride solution or a solution containing magnesium or derivatives thereof.
  • a triplex comprising a hai ⁇ in comprising at least one first polypyrimidine sequence, at least one linker, and at least one first polypurine sequence wherein the polypurine sequence is complementary to and antiparallel to the first polypyrimidine sequence, and the first polypurine sequence comprising at least one 8-aminopurine, and a target sequence wherein the target sequence is arranged in Hoogsteen orientation with respect to the hai ⁇ in.
  • an oligonucleotide duplex comprising two complementary oligonucleotide strands arranged in an anti-parallel Hoogsteen configuration.
  • the present invention also provides a method for stabilizing Hoogsteen duplexes comprising procuring a Hoogsteen duplex comprising at least one purine and stabilizing the Hoogsteen duplex by substituting at least one 8-aminopurine for at least one of the purine.
  • a method for targeting a single- stranded oligonucleotide comprising selecting a region on a single-stranded oligonucleotide, the region having either a first polypurine sequence target or a first polypyrimidine sequence target, preparing a hai ⁇ in wherein the hai ⁇ in comprises a second polypyrimidine sequence and a second polypurine sequence, wherein the second polypurine sequence comprises at least one 8-aminopurine and is complementary to the second polypyrimidine sequence, and targeting the region on the single-stranded oligonucleotide by contacting the hai ⁇ in with the first polypurine sequence target or the first polypyrimidine sequence target.
  • this method includes wherein the single-stranded oligonucleotide is selected from the group consisting of cDNA, mRNA, tRNA, and rRNA.
  • Another embodiment of the present invention provides a method for targeting DNA comprising selecting a region on DNA, the region having either a first polypurine sequence target or a first polypyrimidine sequence target, preparing a hai ⁇ in wherein the hai ⁇ in comprises a second polypyrimidine sequence and a second polypurine sequence, wherein the second polypurine sequence comprises at least one 8-aminopurine and is complementary to the second polypyrimidine sequence, and targeting the region on the DNA by contacting the hai ⁇ in with the first polypurine sequence target or the first polypyrimidine sequence target.
  • FIGURE 1 is a schematic representation of the Watson-Crick, reverse Watson-Crick, and Hoogsteen A»T pairings.
  • FIGURE 2 shows the thermodynamic cycle used to compute the stabilization of parallel- stranded duplexes induced by the introduction of 8-amino derivatives.
  • FIGURE 3 shows the MD-averaged structures of the Hoogsteen duplexes obtained in the A and B trajectories. The conformation of the Hoogsteen duplex in a B-type triplex is displayed for comparison.
  • FIGURE 4 shows the final structures obtained in the three trajectories of the reverse Watson-Crick duplex.
  • the structure generated from the experimental NMR structure (reference f in Table 1) is displayed for comparison.
  • FIGURE 5 sets forth a classical molecular interaction potentials (cMIP; top) and solvation maps (bottom) for the canonical antiparallel duplex (left) and Hoogsteen parallel-stranded duplex (right).
  • cMIP contours correspond to interaction energy of -5 to 5 kcal/mol (O + was used as a probe).
  • Solvation contours correspond to a density of 2 g/mL.
  • cMIPand solvation maps were determined averaging over the A and B trajectories simultaneously.
  • FIGURE 6 is a representation of protonated and wobble Hoogsteen 8AG-C dimers.
  • FIGURE 7 sets forth sequences of parallel-stranded hai ⁇ ins carrying 8-aminopurines of this invention: A , 8-aminoadenine; G , 8-aminoguanine; I N , 8-aminohypoxanthine; and a (EG) ⁇ hexaethylene glycol linker. Two anti-parallel duplexes used as control are also displayed.
  • FIGURE 8 shows the dependence of Tm with pH for R-22 (SEQ ID NO: 1, SEQ ID NO: 2) , B-22 (SEQ ID NO: 1, SEQ ID NO: 2), and two antiparallel duplexes Dl (SEQ ID NO: 1, SEQ ID NO: 2) and D2 (SEQ ID NO:l, SEQ ID NO: 9).
  • FIGURE 9 shows: (A) CD spectra of ha ⁇ pins B-22 (SEQ ID NO: 1, SEQ ID NO:2), B- 22A(SEQ ID NO:3, SEQ ID NO:2), B-22G (SEQ ID NO:4, SEQ ID NO:2), B-AT (SEQ ID NO: 6, SEQ ID NO:7), and an antiparallel duplex formed by B-22A control (SEQ ID NO:3, SEQ ID NO:8) (B-22 hai ⁇ in where the sequence of the pyrimidine strand is random) and a suitable single-stranded oligonucleotide (SI 1WC) (SEQ ID NO: 16), and (B) CD spectra of B22A control (SEQ ID NO:3, SEQ ID NO:8) alone and after addition of the antiparallel complementary pyrimidine strand (0.1 M sodium phosphate pH 6.0, 50 mM NaCl, 10 mM MgCl 2 ).
  • FIGURE 11 shows the base pairing scheme of G: 8aminoG:C and T:8-aminoA:T.
  • FIGURE 12 shows gel-shift analysis performed with sn-GA (SEQ ID NO: 14) and s M - GT (SEQ ID NO: 15), h 26 (SEQ ID NO: 11), h 26 -3AG (SEQ ID NO: 12) and h 26 -3AA (SEQ ID NO: 13).
  • FIGURE 13 shows gel-shift analysis performed with hai ⁇ in RE-2AG (SEQ ID NO: 4, SEQ ID NO: 14) and its polypyrimidine target WC-11 mer (SEQ ID NO: 16).
  • FIGURE 14 shows a scheme of binding a polypyrimidine single-stranded nucleic acid with hai ⁇ ins of the present invention.
  • Lower part base-pairing schemes of triads containing 8-aminopurines.
  • FIGURE 15 shows sequences of parallel-stranded hai ⁇ ins carrying 8-aminopurines of this invention: A N : 8-aminoadenine; G : 8-aminoguanine; I : 8-aminohypoxanthine; and (EG) 6 : hexaethylenglycol linker, and GTTTC, GGAGG and TTTT linkers. Also shown is a hai ⁇ in of this invention containing an abasic model compound.
  • FIGURE 16 sets forth root mean square deviations (RMSd in A) between the trajectories of the parallel Hoogsteen (Ho) and antiparallel Watson-Crick (WC) duplexes and their respective MD-averaged structures (top), and between the same trajectories and the MD- averaged structures of both duplexes in the antiparallel triplex (bottom). Bases at both ends were removed for RMSd calculations.
  • RMSd in A root mean square deviations
  • FIGURE 17 shows binding of SEQ ID NO: 1, SEQ ID NO: 2) R-22A (SEQ ID NO: 3, SEQ ID NO: 2) and R-22G (SEQ ID NO:4, SEQ ID NO: 2) to WC-11 mer (SEQ ID NO: 16) (citric-phosphate buffer pH 6 of 100 mM Na + ionic strength).
  • Radiolabelled DNA target (10 nmol) was incubated at room temperature with 2-200 equivalents of cold hai ⁇ ins R-22 (SEQ ID NO: 1, SEQ ID NO: 2), R-22A (SEQ ID NO: 3, SEQ ID NO: 2)and R-22G (SEQ ID NO: 4, SEQ ID NO: 2)and the mixtures were analyzed by 15% native polyacrylamide gel electrophoresis at room temperature.
  • FIGURE 18 shows binding of hai ⁇ in R-22G (SEQ ID NO: 4, SEQ ID NO: 2) to single- stranded target T ⁇ (SEQ ID NO: 32) at pH 5.0.
  • the 32 P-labelled oligonucleotide was the target T 3 ⁇ (SEQ ID NO: 32) and increasing (2x, 20x, 200x) amounts of cold B-22G were added.
  • the 32 P-labelled oligonucleotide was the hai ⁇ in R-22G (SEQ ID NO: 4, SEQ ID NO: 2)and increasing (2x, 20x, 200x) amounts of cold T 3 ) (SEQ ID NO: 32) were added.
  • Incubation time 1 hr at room temperature.
  • FIGURE 19 shows the CD spectra of hai ⁇ ins B-22 (SEQ ID NO: 1, SEQ ID NO: 2), B- 22G (SEQ ID NO: 4, SEQ ID NO: 2) and B-22A(SEQ ID NO: 3, SEQ ID NO: 2) alone and together with their pyrimidine target WC-1 lmer (SEQ ID NO: 16) (50 mM naCl, 10 mM MgCl , 0.1M sodium phosphate pH 6).
  • Figure 21 shows melting temperatures of triplexes formed by hai ⁇ ins B-22 A (SEQ ID NO:3, SEQ ID NO:2) and B-22G (SEQ ID NO: 4, SEQ ID NO:2) at various salt concentrations.
  • Figure 22 shows the binding of hai ⁇ in R-22G (SEQ ID NO: 4, SEQ ID NO:2) to single and double-stranded targets by gel-shift experiments.
  • Figure 23 shows the melting experiment on the triplex formed by B-22G (SEQ ID NO: 4, SEQ ID NO:2) and WC-1 lmer (SEQ ID NO: 16) followed by CD.
  • Figure 24 shows Hoogsteen base pairs and parallel-stranded DNA.
  • the present invention provides a triplex comprising a hai ⁇ in comprising at least one polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein the polypurine sequence is complementary to and parallel to the polypyrimidine sequence, and wherein the polypurine sequence comprises at least one 8-aminopurine, and a polypyrimidine target sequence complementary to and antiparallel to the polypurine sequence.
  • the polypyrimidine target sequence and the hai ⁇ in are bound to each other.
  • the triplex includes wherein the polypyrimidine target sequence comprises at least one purine interruption.
  • the triplex includes wherein the polypurine sequence of the hai ⁇ in comprises at least one pyrimidine interruption.
  • the triplex as described herein includes wherein the first polypyrimidine sequence of the hai ⁇ in comprises at least one purine interruption or an abasic interruption or an abasic model compound interruption.
  • a method for preparing a hai ⁇ in containing at least one 8-aminopurine of this invention comprises preparing a pyrimidine strand, binding a linker to the 3' end of the pyrimidine strand, preparing a purine strand comprising at least one 8-aminopurine, and preparing the hai ⁇ in by binding the 3' end of the purine strand to the linker.
  • the method for preparing a hai ⁇ in containing at least one 8-aminopurine comprises preparing a purine strand comprising at least one 8-aminopurine, binding a linker to the 5' end of the purine strand, preparing a pyrimidine strand, and preparing the hai ⁇ in by binding the 5' end of the pyrimidine strand to the linker.
  • This invention includes the hai ⁇ in as described herein comprising at least one first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein at least one of the polypurine sequence comprises at least one 8-aminopurine and wherein the polypurine sequence is complementary to and parallel to the first polypyrimidine sequence.
  • Another embodiment of this invention provides a triplex comprising a hai ⁇ in comprising at least one first polypyrimidine sequence, at least one linker, and at least one first polypurine sequence wherein the polypurine sequence is complementary to and antiparallel to the first polypyrimidine sequence, and the first polypurine sequence comprising at least one 8-aminopurine, and a target sequence wherein the target sequence is arranged in Hoogsteen orientation with respect to the hai ⁇ in.
  • the triplex includes wherein the target sequence comprises G and T bases or G and A bases.
  • a triplex comprising a hai ⁇ in comprising a polypyrimidine sequence, a linker, and a polypurine sequence, wherein the polypurine sequence is complementary to and parallel to the polypyrimidine sequence, wherein the polypurine sequence comprises at least one 8-aminopurine, and a polypyrimidine target sequence wherein the polypyrimidine target sequence is complementary to and antiparallel to the polypurine sequence.
  • oligonucleotides containing 8-aminopurines replace natural purines in triplexes.
  • hai ⁇ ins carrying 8-aminopurines such as for example but not limited to, 8-aminoadenine, 8-aminoguanine and 8- aminohypoxanthine connected head-to-head to the Hoogsteen pyrimidine strand (Fig. 14).
  • Hai ⁇ ins carrying 8-aminopurines form stable Hoogsteen parallel-stranded structures.
  • these modified hai ⁇ ins of this invention bind to the Watson- Crick pyrimidine strand via a triple helix with greater affinity than hai ⁇ ins containing only natural bases, especially in neutral conditions.
  • the effect of pH, salt concentration and loop structure on triplex stability are also analyzed herein.
  • parallel- stranded hai ⁇ ins of this invention are shown to form triplexes with a base interruption in the polypyrimidine target sequence.
  • the increased stability of the triple helix at neutral conditions and the possibility to cope with the interruptions in the polypyrimidine target sequences create new applications based on triple helix formation such as structural studies, DNA-based diagnostic tools, antigene and antisense therapies.
  • Geometrical analysis of the trajectories was performed using exclusively the central 9-mer duplex.
  • the two trajectories of the H-based duplexes were averaged to obtain a better (10 ns) representation of the duplex.
  • Analysis of possible molecular interactions of DNA was carried out using the CMIP program (CMIP computer program, made available by the University of Barcelona, Barcelona, Spain), and structural analysis of the trajectories performed.
  • Thermodynamic integration technique coupled to molecular dynamics simulations was used to analyze the effect of replacing 2'- deoxyadenosine, 2'-deoxyguanosine, and 2'-deoxyinosine by their 8-amino derivatives on the stability of the d(5 , -GAAGGAGGAGA-3') d(5 , -CTTCCTCCTCT-3') (SEQ ID NO: 1, SEQ ID NO: 2) parallel-stranded duplex.
  • mutations were performed between 8-amino-2'-deoxyadenosine and 2'-deoxyadenosine (8AA ⁇ A), 8 amino-2'-deoxguanosine and 2'-deoxyguanosine (8AG ⁇ G), and 8-amino- 2'-deoxyinosine and 2'-deoxyinosine (8AI ⁇ I) in both duplex and single-stranded oligonucleotides.
  • the change in stabilization free energy due to the 8AX ⁇ X mutation is determined using standard thermodynamic cycles as known by those skilled in the art. ( Figure 2).
  • Oligonucleotides were prepared on an automatic DNA synthesizer using standard and reversed 2-cyanoethyl phosphoramidites and the corresponding phosphoramidites of the 8-aminopurines.
  • the phosphoramidite of protected 8-amino-2'-deoxyinosine was dissolved in dry dichloromethane to make a 0.1 M solution.
  • the rest of the phosphoramidites were dissolved in dry acetonitrile (0.1 M solution).
  • the phosphoramidite of the hexaethylene glycol linker was obtained from commercial sources known in the art.
  • the purine part carrying the modified 8-aminopurines was assembled using standard phosphoramidites for the natural bases and the 8-aminopurine phosphoramidites.
  • B-22A SEQ ID NO: 3, SEQ ID NO: 2)
  • B-22G SEQ ID NO: 4, SEQ ID NO: 2)
  • B-22AG SEQ ID NO: 5, SEQ ID NO: 2)
  • B-AT SEQ ID NO: 6, SEQ ID NO: 7
  • B-22A control SEQ ID NO: 3, SEQ ID NO: 8
  • the purine part was assembled first, followed by the hexaethylene glycol linker.
  • oligonucleotide supports were treated with 32% aqueous ammonia at 55 °C for 16 h (hour) except for oligonucleotides having 8-aminoguanine. In this case a 0.1 M 2-mercaptoethanol solution in 32% aqueous ammonia was used and the treatment was extended to 24 h (hour) at 55 °C (Centigrade). Ammonia solutions were concentrated to dryness and the products were purified by reverse-phase HPLC.
  • Circular Dichroism (CD). Oligonucleotides were dissolved in 100 mM phosphate buffer pH 6.0, 50 mM sodium chloride, and 10 mM magnesium chloride. The equimolar concentration of each strand was 4-5 ⁇ M. The solutions were heated at 90°C, allowed to come slowly to room temperature, and stored at 4 °C until CD measurement was performed. The CD spectra were recorded on a Jasco J-720 spectropolarimeter attached to a Neslab RP-100 circulating water bath in 1 cm path length quartz cylindric cells. Spectra were recorded at room temperature using a 10 nm/min scan speed, a spectral bandwidth of 1 nm, and a time constant of 4 s.
  • CD melting curves were recorded at 280 nm using a heating rate of 20 °C/h and a scan speed of 100 nm/ min. All the spectra were subtracted with the buffer blank, normalized to facilitate comparisons, and noise-reduced using Microcal Origin 5.0 software.'
  • the rmsd between the two trajectories and the starting model in simulation H B is 1.4 and 1.8 A in simulations HB and H A , respectively.
  • the rmsd is slightly larger with respect to the Hoogsteen strands of the starting model in simulation H A (an A-type triplex): 2.0 A (H A ) and 2.1 A (H B ).
  • the stability of the H-based simulations allows analysis of the structure of a H- based parallel-stranded duplex.
  • the helix is similar to the structure of Hoogsteen strands in a DNA triplex.
  • the average twist is 31°, and the rise is 3.4 A.
  • the bases are generally pe ⁇ endicular to the helix axis.
  • the sugars are in the South and South-East regions, having an average phase angle of 124°, as found experimentally for rWC parallel-stranded duplexes and triplexes.
  • CMIP molecular interaction potential maps
  • the H duplex is very well hydrated, as shown in the solvation contours represented in Figure 5.
  • the largest apparent density of water is found in the minor groove, which is wide enough to allow the insertion of a chain of ordered waters.
  • the apparent water densities around the H duplex and the reference antiparallel helix are very similar, thus confirming the findings obtained from CMIP calculations.
  • the antiparallel H duplex is a new structure which shares many characteristics with DNA triplexes, but that also exhibits a series of unique molecular recognition characteristics derived mainly from the existence of two very different grooves.
  • the H duplex is stabilized by around 2.7 kcal/mol by the A ⁇ 8AA mutation (Table 2), a value similar to that found previously using less rigorous simulation protocols for poly d(A-T-T) triplex.
  • the mutation G ⁇ 8AG in a d(G-C) + motif increases the stability of the H duplex by around 1 kcal/mol.
  • the first group of oligomers are parallel-stranded hai ⁇ ins connected through their 3' ends with an hexaethylene glycol linker [(EG) 6 J.
  • Two adenines are substituted by two 8-aminoadenines (A ⁇ ) in the oligonucleotide R-22A (SEQ ID NO: 3, SEQ ID NO: 2) the oligonucleotide R-22G (SEQ ID NO: 4, SEQ ID NO: 2) two guanines are substituted by two 8-aminoguanines (G N ), and in the oligonucleotide R-22I (SEQ ID NO: 5, SEQ ID NO: 2) two guanines are substituted by two 8-aminohypoxanthines (I N ).
  • the oligonucleotide (R-22) (SEQ ID NO: 1, SEQ ID NO: 2) contains only the natural bases without modification.
  • the second group of oligomers B-22 (SEQ ID NO: 1, SEQ ID NO: 2) B-22A (SEQ ID NO: 3, SEQ ID NO: 2) B-22G (SEQ ID NO: 4, SEQ ID NO: 2) is similar in composition to those in the previous oligomers, but the polypurine and the polypyrimidine parts are connected through their 5' ends with an hexaethylene glycol linker [(EG) 6 ].
  • an oligomer having two 8-aminoguanines and two 8- aminoadenines was prepared (B-22AG) (SEQ ID NO: 34, SEQ ID NO: 2) to test whether the stabilizing properties of both 8-aminopurines are additive.
  • a parallel-stranded hai ⁇ in that has only d(A-T) base pairs (B-AT) (SEQ ID NO: 6, SEQ ID NO: 7) was prepared.
  • a control hai ⁇ in (B-22A control) (SEQ ID NO: 3, SEQ ID NO: 8) with the same purine sequence as B22A (SEQ ID NO: 3, SEQ ID NO: 2) but a noncomplementary pyrimidine sequence was also prepared.
  • Oligonucleotide sequences containing 8-aminopurines were prepared using phosphoramidite chemistry on an automatic DNA synthesizer.
  • the parallel-stranded oligomers were prepared using protocols known by those skilled in the art.
  • the phosphoramidites of 8-aminoadenine, 8-aminoguanine, and 8-aminohypoxanthine were prepared using protocols known by those skilled in the art.
  • substitution of two A's by two 8AAs stabilizes the parallel-stranded structure as seen by the higher melting temperatures at pH 4.6 and 6.0 ( ⁇ T m 16-18°C) and the observation of a transition at pH 6.5.
  • the substitution of two G's by two 8AGs raises the melting temperatures of the hai ⁇ ins even higher.
  • the differences in melting temperatures with respect to B-22 (SEQ ID NO: 1, SEQ ID NO: 2) are between 21 and 25 °C. It is also possible to observe a transition at about pH 7.0 and 6.5.
  • the substitution of two G's by two 8AIs stabilizes the parallel-stranded structure, but this stabilization is of small intensity ( ⁇ T m 6-9 °C at pH 4.6-6.0).
  • hai ⁇ ins having 8AG and 8AI are not decreasing so quickly at neutral pH. This indicates that these hai ⁇ ins are not as dependent as the other hai ⁇ ins to protonation of C probably due to the extra hydrogen bond between the 8-amino group of the 8- aminopurines and the 2-keto group of C.
  • the 8-amino group destabilizes the Watson-Crick pairing for G and I and is expected then to destabilize the reverse Watson-Crick pairing. Accordingly, the stabilization in the duplex structure found experimentally can be understood only considering that the hai ⁇ ins studied here have a Hoogsteen and not a reverse Watson- Crick secondary structure. Note also that the change in stability of the duplex induced by the G ⁇ 8AG or A ⁇ 8AA substitutions also argue strongly against the existence of significant amounts of a 7-mer antiparallel duplex.
  • FIG. 9A shows the CD spectra of hai ⁇ ins B-22, (S ⁇ Q ID NO: 1, S ⁇ Q ID NO: 2), B-22A (S ⁇ Q ID NO: 3, S ⁇ Q ID NO: 2) and B-22G (S ⁇ Q ID NO: 4, S ⁇ Q ID NO: 2) and the parallel-stranded hai ⁇ in with d(A-T) base pairs (B-AT (S ⁇ Q ID NO: 6, S ⁇ Q ID NO: 7)).
  • B-22A control (SEQ ID NO: 3, SEQ ID NO: 8) does not have structure, but it generates an antiparallel duplex if a suitable single-stranded oligonucleotidic strand (SI 1WC) (SEQ ID NO: 16) is added (B-22A control + SI 1WC) (SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 16).
  • SI 1WC single-stranded oligonucleotidic strand
  • the CD spectra of the hai ⁇ in B-AT (SEQ ID NO: 6, SEQ ID NO: 7) has a strong minimum at 248 nm, a smaller minimum at 206 n , and two maxima at 218 and 280 nm. This spectrum is similar to that known in the art for A-T rich parallel-stranded DNA that is considered a model for reverse Watson- Crick pairing.
  • the CD spectra of B-22 (SEQ ID NO: 1, SEQ ID NO: 2) B-22A (SEQ ID NO: 3, SEQ ID NO: 2) and B-22G (SEQ ID NO:4, SEQ ID NO: 2) have a strong maximum between 270 and 290 nm and two minima: one at 242 nm and a second, more intense minima at around 212 nm.
  • the minimum around 212 and the maximum around 280 are more intense in the hai ⁇ ins containing 8-aminopurines (B-22A (SEQ ID NO: 3, SEQ ID NO: 2) and B-22G(SEQ ID NO: 4, SEQ ID NO: 2)).
  • This type of spectra is characteristic of DNA triplexes.
  • CD spectra demonstrate that the hai ⁇ ins of this invention, which contain a mixture of A(8AA)-T and G(8AG/8AI)-C steps have a Hoogsteen-type structure and are not reverse Watson-Crick parallel or Watson-Crick antiparallel duplexes.
  • the signals around 10 ppm correspond to amino protons of cytosines forming Hoogsteen base pairs. Most probably, the resonances around 13 ppm are due to imino protons of Hoogsteen thymines. Since the chemical shifts of the exchangeable protons in reversed Watson-Crick base pairs are very similar to those observed in canonical antiparallel duplexes, this kind of base pairing can be ruled out. Finally, it is worth noting that most of the features of the exchangeable proton spectra can be still observed at neutral pH, suggesting a notable stability of the parallel duplex at neutral pH.
  • 8-aminopurine derivatives are able to largely increase the stability of DNA hai ⁇ ins containing almost the same number of d(A-T) and d(G-C) duplexes, which are designed to have a parallel a ⁇ angement. This increase in stability is accurately represented by state of the art MD and MD/TI calculations when a Hoogsteen-type secondary structure is assumed for the hai ⁇ ins.
  • the present invention provides a new method for the stabilization of parallel-stranded H-type duplexes.
  • the introduction of at least one 8-aminopurine derivative makes stable H duplexes under pH or temperature conditions where the helices will be otherwise unstable.
  • These structures act as templates for the formation of DNA-DNA-DNA and DNA-RNA-DNA triplexes in physiological conditions, which is helpful for biotechnological pu ⁇ oses, as well as for antigene and antisense therapies.
  • 8-aminoguanine shall stabilize Purine : Pyrimidine : Purine (type II) triplex if Hoogsteen strand is formed by G and A and both 8-aminoguanine and 8-aminoadenine may stabilize type II triplex if Hoogsteen strand is formed by G and T. In both cases 8-aminopurine shall occupy the Watson-Crick purine position.
  • Type II triplexes is independent of pH. For these reasons they are generally used for triplex applications at physiological pH.
  • the following oligonucleotides were prepared:
  • h 26 5' GAAGGAGGAGA-TTTT-TCTCCTCCTTC 3' (SEQ ID NO: 11)
  • h 26 -3AG 5'GAAGG N AGG N AG
  • N A-TTTT-TCTCCTCCTTC 3' SEQ ID NO: 12
  • h 26 -3AA 5' GAA N GGA N GGA N GA-TTTT-TCTCCTCCTTC 3' (SEQ ID NO: 13)
  • sn-GA 5' AGAGGAGGAAG 3' (SEQ ID NO: 14)
  • S ⁇ -GT 5' TGTGGTGGTTG 3' (SEQ ID NO: 15)
  • RE-2AG 5' GAAGG N AGG N AGA-(EG) 6 -AGAGGAGGAAG 3' (SEQ ID NO: 4, SEQ ID NO: 4, SEQ ID NO:
  • Oligonucleotides sn-GA (SEQ ID NO: 14) and s, ⁇ -GT (SEQ ID NO: 15) were mixed with h 26 derivatives (h 26 , (SEQ ID NO: 11), h 26 -3AG (SEQ ID NO: 12) and h 26 - 3AA (SEQ ID NO: 13) in 10 mM sodium cacodilate, 50 mM magnesium chloride and 0.1 mM EDTA pH 7.3.
  • the resulting mixtures were annealed and analyzed on (15%) polyacrylamide gel electrophoresis under native conditions (90 mM Tris-Borate, 50 mM MgCl 2 , pH 8.0).
  • triplex stabilization properties of 8-aminoguanine were analyzed using the model system described by Pilch et al. (Pilch, D.S., Levenson, C, Schafer, R.H. (1991) Biochemistry, Vol. 30, pages 6081-6087), inco ⁇ orated by reference herein.
  • Triplexes formed by d(C 3 T 4 C 3 ).2[d(G 3 A 4 G 3 )] (SEQ ID NO: 17, SEQ ID NO: 18) and d(C 3 T 4 C 3 ).2[d(GG N G N A 4 G N G N G)] (SEQ ID NO: 17, SEQ ID NO: 19) were analyzed by melting experiments. Results are shown in Table 5.
  • Table 5 Thermodynamic parameters of the triplex and the duplex. Data obtained in lOmM sodium cacodylate, 50 mM MgCl 2 and 0.1 mM EDTA at pH 7.3.
  • ⁇ G 25 refers to the standard free energy change at 25 °C.
  • 8-aminoguanine stabilizes purine: pyrimidine: purine triplex. These triplexes are formed at physiological pH. 8-Aminoadenine stabilizes type II triplexes if Hoogsteen strand is made out of G and T bases. Hai ⁇ ins carrying 8- aminoguanines bind polypyrimidine targets by triplex formation and triplexes are stable at physiological pH.
  • Oligonucleotides were prepared on an automatic Applied Biosystems 392 DNA synthesizer.
  • the parallel-stranded hai ⁇ ins were prepared using methods known by those skilled in the art.
  • 5'-5' Hai ⁇ ins (R-22 derivatives) were prepared in three steps.
  • First, the pyrimidine part was prepared using reversed C and T phosphoramidites and reversed C-support (linked to the support through the 5' end).
  • a linker such as for example but not limited to, a hexaethyleneglycol linker, was added using a commercially available phosphoramidite.
  • the purine part carrying the modified 8-aminopurines was assembled using standard phosphoramidites for the natural bases and the 8- aminopurine phosphoramidites.
  • the phosphoramidites of 8-aminoadenine, 8- aminoguanine and 8-aminohypoxanthine were prepared using methods known by those skilled in the art.
  • 3 '-3' hai ⁇ ins B-22 derivatives
  • a similar approach was used for the preparation of 3 '-3' hai ⁇ ins (B-22 derivatives).
  • the purine part was assembled first, followed by the hexaethyleneglycol.
  • the pyrimidine part was the last to be assembled using reversed phosphoramidites.
  • phosphoramidite of protected 8-amino-2'-deoxyinosine was dissolved in dry dichloromethane to yield a 0.1 M solution.
  • the remaining phosphoramidites were dissolved in dry acetonitrile (0.1 M solution).
  • Oligonucleotides containing natural bases were prepared using commercially available chemicals and following standard protocols. After the assembly of the sequences, oligonucleotide- supports were treated with 32% aqueous ammonia at 55 °C for 16 h (hour) except for oligonucleotides bearing 8-aminoguanine. In this case, a 0.1 M 2-mercaptoethanol solution in 32% aqueous ammonia was used and the treatment was extended to 24 h at 55 °C.
  • HPLC solutions were concentrated to dryness and the products were purified by reversed-phase HPLC. Oligonucleotides were synthesized on a 0.2 ⁇ mol scale and with the last DMT group at the 5' end (DMT on protocol) to facilitate reversed-phase purification. All purified products presented a major peak, which was collected. Yields (OD units at 260 nm after HPLC purification, 0.2 ⁇ mol) were between 5-10 OD.
  • HPLC conditions HPLC solutions were as follows. Solvent A: 5% ACN in 100 mM triethylammonium acetate pH 6.5 solvent B: 70% ACN in 100 mM triethylammonium acetate pH 6.5. Columns: PRP-1 (Hamilton), 250 x 10 mm. Flow rate: 3ml/min. A 30 min linear gradient from 10-80% B (DMT on) or a 30 min linear gradient from 0-50% B (DMT off).
  • UV abso ⁇ tion spectra and melting experiments were recorded in 1 cm path-length cells using a spectrophotometer, with a temperature controller and a programmed temperature increase rate of 0.5 °C /min. Melts were run on duplex concentration of 4 ⁇ M at 260 nm. The samples used for the thermodynamic studies were prepared in a similar way, but melting experiments were recorded at 260 nm and using 0.1, 0.5 and 1 cm path-length cells.
  • Either the target oligonucleotides or the hai ⁇ ins were radioactively labeled at the 5' end by T4 polynucleotide kinase and [ ⁇ - 32 P]-ATP with 35-50 ⁇ mol of the oligonucleotide dissolved in 20 ⁇ l of kinase buffer. After incubation at 37 °C for 45 min (minutes), the solution was heated to 70 C for 10 min to denature the enzyme and the solution was cooled to room temperature. 60 ⁇ l of 50 mM potassium acetate in ethanol was added to the solution and the mixture was left at -20 °C for at least 3 h.
  • the mixture was centrifuged at 4 °C for 45 min (14000 ⁇ m) and the supernatant was removed.
  • the pellet was washed with 60 ⁇ l of 80% ethanol and centrifuged for 20 min at 4 °C. The supernatant was removed and the pellet was dissolved in 0.2 ml of water.
  • the radiolabelled target was incubated with the hai ⁇ ins in 0.1 M sodium phosphate/citric acid buffer of pH ranging from 5.5 to 7.0 at room temperature for 30-60 min.
  • the hai ⁇ ins were added in increasing amounts from 2 to 200 molar equivalents.
  • the mixtures were analysed by 15% polyacrylamide gel electrophoresis at room temperature using the same buffer as for the incubation: 0.1 M sodium phosphate/citric acid buffer of pH ranging from 5.5 to 7.0.
  • the formation of the triplex was monitored by the appearance of a radioactive band with less mobility than the band corresponding to the target alone.
  • Oligonucleotides were dissolved in 100 mM phosphate buffer pH 6.0, 50 mM sodium chloride and 10 mM magnesium chloride. The equimolar concentration of each strand was 4-5 ⁇ M. The solutions were heated to about 90°C, allowed to cool slowly to room temperature and stored at about 4 °C until CD was measured. The CD spectra were recorded on a Jasco J-720 spectropolarimeter attached to a Neslab RP-100 circulating water bath in 1 cm path-length quartz cylindrical cells. Spectra were recorded at room temperature using a 10 nm/min scan speed, a spectral band width of 1 nm and a time constant of 4 s.
  • CD melting curves were recorded at 280 nm using a heating rate of 20°C/h and a scan speed of 100 nm/min. Al the spectra were subtracted with the buffer blank, normalized to facilitate comparisons and noise-reduced using Microcal Origin 5.0 software.
  • the binding properties of hai ⁇ ins carrying 8-aminoadenine (A N ), 8- aminoguanine (G ) and 8-aminohypoxanthine (I ) connected head-to-head to the Hoogsteen pyrimidine strand were studied.
  • the sequences of the oligonucleotides are shown in Figure 15.
  • the target DNA sequence comprises a triplex characterized by Xodo et al..
  • the polypyrimidine Hoogsteen strand was linked to the Watson-Crick polypurine strand.
  • the first group of hai ⁇ ins (R-22 (SEQ ID NO: 1, SEQ ID NO: 2) R-22A (SEQ ID NO: 3, SEQ ID NO: 2) R-22G (SEQ ID NO: 4, SEQ ID NO: 2) R-22I (SEQ ID NO: 5, SEQ ID NO: 2) are parallel-stranded and connected through their 3' ends with a hexaethyleneglycol linker [(EG) 6 ]. They contain 22 bases and two purines replaced by the corresponding 8-aminopurines.
  • hai ⁇ in R-22A (SEQ ID NO: 3, SEQ ID NO: 2) two adenines are replaced by two 8-aminoadenines (A ); in hai ⁇ in R-22G (SEQ ID NO: 4, SEQ ID NO: 2)two guanines are replaced by two 8-aminoguanines (G ) and in hai ⁇ in R-22I (SEQ ID NO: 5, SEQ ID NO: 2), two guanines are substituted by two 8- aminohypoxanthines (I N ).
  • Hai ⁇ in R-22 (SEQ ID NO: 1, SEQ ID NO: 2) is a control sequence that contains only the natural bases without modification. The number of modified bases in each hai ⁇ in was selected to optimize stability with a minimum number of modified bases, as described elsewhere.
  • the second group of hai ⁇ ins B-22 (SEQ ID NO: 1, SEQ ID NO: 2) B-22 A (SEQ ID NO: 3, SEQ ID NO: 2) B-22G (SEQ ID NO: 4, SEQ ID NO: 2) have a similar composition but the polypurine and the polypyrimidine parts are connected through their 5' ends with a hexaethyleneglycol linker [(EG) 6 ].
  • a hai ⁇ in bearing two 8- aminoguanines and two 8-aminoadenines was prepared (B-22AG (SEQ ID NO: 34, SEQ ID NO: 2) to test whether the stabilizing properties of the two 8-aminopurines are additive.
  • a control oligonucleotide (B-22A control (SEQ ID NO: 3, SEQ ID NO: 8)) with the same sequence in the polypurine part as B-22A (SEQ ID NO: 3, SEQ ID NO: 2) but a random polypyrimidine sequence was prepared.
  • the oligomers B- 22AMMT (SEQ ID NO: 21, SEQ ID NO: 22), B-22AMMC (SEQ ID NO: 21, SEQ ID NO: 2), B-22AMMG (SEQ ID NO: 21 , SEQ ID NO: 23), B-22AMMA (SEQ ID NO: 21 , SEQ ID NO: 24), B-22AMMpd (SEQ ID NO: 21), B-22AMMCA (SEQ ID NO: 25, SEQ ID NO: 2), B-22AMMTA (SEQ ID NO: 25, SEQ ID NO: 22), B-22AMMGA (SEQ ID NO: 25, SEQ ID NO: 23), B-22AMMAA (SEQ ID NO: 25, SEQ ID NO: 24) and B- 22AMMpdA (SEQ ID NO: 25) were prepared to study the effect of an interruption on the stability of the triple helix.
  • a pyrimidine (C or T) is located in the middle position of the purine part, and each of the natural bases and an abasic site model compound (propanediol, pd) are located in the corresponding position at the Hoogsteen strand.
  • a third group of oligomers (B-22ALT1 (SEQ ID NO: 3, SEQ ID NO: 26), B- 22ALT2 (SEQ ID NO: 27, SEQ ID NO: 2), B-22ALGA (SEQ ID NO: 28, SEQ ID NO: 2), B-22ALTG (SEQ ID NO: 29, SEQ ID NO: 2) and B-22N) have the same nucleotide sequence as B-22A but the loop between the polypurine and polypyrimidine parts is made out of nucleotides (-TTTT-, -GGAGG-, -CTTTG-) instead of the hexaethyleneglycol bridge.
  • the relative stability of triple helices formed by R-22 hai ⁇ in derivatives and the polypyrimidine target sequence was measured spectrophotometrically at various pHs (pH 4.5-7.0). In almost all cases, one single transition was observed with a hyperchromicity around 25% at acidic pH and 20% at neutral pH. The melting curve was assigned to the transition from triple helix to random coil. Exceptionally, the melting curve of the triplex R-22I: WC-1 lmer (SEQ ID NO: 5, SEQ ID NO: 2, SEQ ID NO: 16) at about pH 5.5 and 6 showed two pH-dependent transitions.
  • hai ⁇ ins linked by 3 '-3' bonds R-22 derivatives
  • hai ⁇ ins linked by 5 '-5' bonds B-22 derivatives
  • the relative stability of triple helices formed by the B-22 oligonucleotide derivatives and the polypyrimidine target sequence (WC-1 lmer) SEQ ID NO: 16 was measured. As described herein, one single transition was observed with a hyperchromicity around 25%, which was assigned to the melting of the triple helix.
  • Replacement of A by 8-aminoadenine (A N ) and guanine by 8- aminoguanine (G N ) in triple helix greatly stabilized the triple helix (Table 7).
  • the role of the Hoogsteen strand was further investigated.
  • This oligonucleotide (named B-22A control (SEQ ID NO: 3, SEQ ID NO: 8)) can only form Watson-Crick interactions with the target sequence (WC-1 lmer (SEQ ID NO: 16)).
  • Sodium chloride had a slight stabilization effect (from about 49 °C (without NaCl) to 51 °C (1 M NaCl)).
  • Low concentrations of MgCl 2 stabilize the triplex, e.g. the melting temperature of triplexes B-22G: WC-1 lmer (SEQ ID NO: 4, SEQ ID NO: 2, SEQ ID NO: 16) and B-22A: WC-1 lmer increased by 5 degrees from no MgCl 2 to 10 mM MgCl 2 . From lOmM to 50 mM MgCl 2 , the increase in melting temperature is nil or lower than one degree.
  • the presence of magnesium is employed for enhancing the stability of the triplex, including wherein the concentration of magnesium is more preferably lOmM.
  • Spermine does not generally affect the stability of triplexes.
  • oligomers have the complementary base at the Watson-Crick position opposite to the interruption and a T, C, G, A or pd on the Hoogsteen strand opposite to the interruption. Melting curves were obtained at pH 6.0, 0.1 M sodium phosphate, 1 M NaCl.
  • the binding of the new hai ⁇ in to its new target is very selective as revealed by the marked decrease in the Tm of the triplex B-22AMMC (SEQ ID NO: 21, SEQ ID NO: 2) with the old target (33 °C B-22AMMC: WC-1 lmer (SEQ ID NO: 21, SEQ ID NO: 2, SEQ ID NO: 16) versus 47 °C B-22AMMC: s, ,-MMG (SEQ ID NO: 21, SEQ ID NO: 2, SEQ ID NO: 30).
  • the GGAGG and CTTTG loops were in the same orientation as the purine strand (B-22ALGA (SEQ ID NO: 28, SEQ ID NO: 2) and B-22ALTG (SEQ ID NO: 29, SEQ ID NO: 2).
  • the melting curves of triplexes formed by hai ⁇ ins and target WC-1 lmer (SEQ ID NO: 16) were obtained at pH 6.0, 0.1 M sodium phosphate, 1 M NaCl. Melting temperatures are set forth below.
  • nucleotide loops Use of nucleotide loops is more preferable for the stability of the triplex. Best results were obtained with the reversed TTTT linker (hai ⁇ in B-22 ALT 1 (SEQ ID NO: 3, SEQ ID NO: 26), ⁇ Tm 6 °C), followed by the TTTT linker (hai ⁇ in B-22ALT2 (SEQ ID NO: 27, SEQ ID NO: 2), ⁇ Tm 4 °C) and the GGAGG and CTTTG linkers (hai ⁇ in B- 22ALGA (SEQ ID NO:28, SEQ ID NO: 2), B-22ALTG (SEQ ID NO: 29, SEQ ID NO: 2), ⁇ Tm 3°C).
  • the binding of T to the Hoogsteen A-T (or A N -T) dimer is less than 1 kcal/mol worse than the binding to A and the binding of C to the protonated Hoogsteen dimer G-C (or G N -C) is 2-3 kcal/mol better than the binding to an isolated G.
  • the presence of 8-aminopurines might slightly decrease in the intensity of Watson-Crick interactions, but without affecting the formation of triplexes from Hoogsteen duplexes, as reported elsewhere. Calculations suggest that a pre-organized Hoogsteen duplex gives rise to a triplex. However, the isolated Hoogsteen duplex may not be sufficiently pre-organized.
  • the magnitude of the pre-organization work can be estimated by the mean root mean square deviation (RMSd) between the structures sampled during the trajectories of the isolated duplex and the average structure of the duplex in the triplex structure.
  • RMSd mean root mean square deviation
  • Figure 16 displays the RMSd between the trajectories of both Watson-Crick and Hoogsteen duplexes and the average structures of both duplexes when inco ⁇ orated inside the triplex (average structure obtained by analysis of the MD trajectory of the triplex).
  • the RMSd between the free Hoogsteen and the triplex-preorganized Hoogsteen duplex is only around 1 A, near the thermal noise of the simulation, as revealed by the fact that the RMSd between the trajectories of the isolated duplexes (Hoogsteen or Watson-Crick) and the corresponding MD-averaged structures is about 0.8 A.
  • the RMSd between the free Watson-Crick duplex and the triplex-preorganized Watson-Crick duplex is about 2 A. MD simulations strongly suggest that the free parallel Hoogsteen duplex is better pre-organized to form a triplex than the Watson-Crick antiparallel duplex.
  • the ⁇ G for the triplex dissociation was -58 kJ/mol for the unmodified triplex, - 76 kJ/mol for the triplexes carrying two A N and -88 kJ/mol for the triplex carrying two G N . Comparison between these values gives a difference in ⁇ G of approximately 17 kJ/mol for two A ⁇ A N substitutions (7.5 kJ/mol, 2.0 Kcal/mol per substitution). For the triplex carrying G N , the difference in ⁇ G is 30 kJ/mol (15 kJ/mol, 3.6 Kcal/mol per substitution). Compared with other base analogues, these are among the highest triplex stabilization properties reported for a modified base, although we measured the stability of Hoogsteen and Watson-Crick base pairs jointly.
  • Gel-shift assays are among the highest triplex stabilization properties reported for a modified base, although we measured the stability of Hoogsteen and Watson-Crick base pairs jointly.
  • hai ⁇ ins The binding of hai ⁇ ins to their targets was also analyzed by gel-shift experiments.
  • the target was labeled radioactively with [7- Pj-ATP and polynucleotide kinase and increasing amounts of the hai ⁇ ins were added.
  • the mixtures were analyzed by polyacrylamide gel electrophoresis. The formation of the triplex was monitored by the appearance of a radioactive band with less mobility than the band corresponding to the target alone (Fig. 17).
  • Figure 17 shows the binding of hai ⁇ ins (SEQ ID NO: 1, SEQ ID NO: 2) R-22A (SEQ ID NO: 3, SEQ ID NO: 2) and R-22G (SEQ ID NO: 4, SEQ ID NO: 2) to the single-stranded target WC-11 mer ( 5 TCTCCTCCTTC 3' ) (SEQ ID NO: 16).
  • hai ⁇ ins SEQ ID NO: 1, SEQ ID NO: 2)
  • R-22A SEQ ID NO: 3, SEQ ID NO: 2
  • R-22G SEQ ID NO: 4
  • SEQ ID NO: 2 single-stranded target WC-11 mer
  • hai ⁇ in carrying G also showed better binding properties than the hai ⁇ in carrying A N , in agreement with melting experiments. Moreover, binding is more efficient at pH 5.0 than at pH 7.0.
  • hai ⁇ in B-22A control SEQ ID NO: 3, SEQ ID NO: 8 which had a non-functional Hoogsteen strand, with its target WC-1 lmer (SEQ ID NO: 16) gave a low mobility band, but at concentrations 100 fold higher than hai ⁇ in B-22A (SEQ ID NO: 3, SEQ ID NO: 2). All these data indicate that the lower mobility bands detected with hai ⁇ ins correspond to the triplex.
  • hai ⁇ in R-22G SEQ ID NO: 4, SEQ ID NO: 2
  • a double-stranded target formed by the WC-1 lmer 5 TCTCCTCCTTC 3
  • SEQ ID NO: 16 labeled and its complementary purine strand
  • Figure 22 When the labeled oligonucleotide is the target pyrimidine strand (WC-11 mer) (SEQ ID NO: 16) a new radioactive band with lower mobility appear in both single and double- stranded targets, revealing the formation of the triplex.
  • the labeled oligonucleotide is the purine strand, no new band is observed, indicating that hai ⁇ ins only bind to the target pyrimidine strand.
  • the double-stranded DNA target had 31 base pairs containing an 11 base pyrimidine track complementary to the hai ⁇ ins described in this study at the middle of the molecule:
  • CD circular dichroism
  • B-22A WC-1 lmer (SEQ ID NO: 3, SEQ ID NO: 2, SEQ ID NO: 16), 56.5°C for triplex
  • B-22G WC-1 lmer (SEQ ID NO:4, SEQ ID NO: 2, SEQ ID NO: 16) in 50 mM NaCl, lOmM MgCl 2> 0.1 M sodium phosphate pH 6.0). (See Figure 23).
  • the lines of the exchangeable protons in this triplex are much narrower than in the isolated B-22 A hai ⁇ in (SEQ ID NO:3, SEQ ID NO: 2).
  • the line-broadening in the parallel Hoogsteen hai ⁇ in may be due to a conformational or solvent exchange. This dynamic effect is not observed upon triplex formation.
  • the present invention shows that the hai ⁇ ins of this invention bind specific single-stranded polypyrimidine targets via triplex formation.
  • the binding of these hai ⁇ ins is stronger when they contain 8-aminopurines.
  • 8-Aminoguanine showed the strongest stabilizing effect, followed by 8- aminoadenine.
  • 8-Aminohypoxanthine is more efficient than unmodified hai ⁇ in only at neutral pH.
  • the stability of the triplex of this invention formed by hai ⁇ ins carrying 8- aminopurines is pH-dependent but the interaction of the modified hai ⁇ ins with their target is so strong that triplexes are observed even at neutral pH on a short model sequence such as for example having about 11 bases.
  • Both 8-aminoadenine and 8- aminoguanine have an additive effect on the stability of the triplex.
  • the loop that connects the homopurine sequence with the homopyrimidine sequence may also have an additional stabilizing effect if it is made of nucleotides.
  • the modified hai ⁇ ins may be redesigned to cope with small interruptions in the polypyrimidine target sequence. This offers great potential for applications in the triplex field, especially for single-stranded targets, e.g. in antisense field and RNA detection.
  • the use of 8-aminopurines is also compatible with most of the developments described in the triplex field so we believe that 8-aminopurines will improve any existing methodology based on triplex formation.
  • Table 6 Melting temperatures* (C) for the triplex formed by R-22 derivatives and WC- Ilmer.
  • Watson-Crick base pair is indicated with a dot, oogsteen par s indicated with a dash
  • SEQ ID NO. 16 SEQ ID NO. 31 AGA H GGA N XGAAG ⁇ N 3 ' AGA N GGA N XGAAG
  • Table 12 Thermodynamic parameters for triplex to random coil transitions in sodium acetate 100 mM (pH 6.0), 50 mM NaCl, 10 mM MgCl 2 from the slope of the plot 1/Tm versus In

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A triplex comprising a hairpin having at least one polypirimidine sequence linked to a complementary polypurine wherein the polypurine sequence is at least one 8-aminoprurine such as 8-aminoadenine, 8-aminoguanine and 8-aminohypoxanthine, and at least one polypyrimidine target sequence that that is complementary and antiparallel to the polypurine sequence. The polypurine sequence binds the polypyrimidine target sequence by forming a triplex helix. Methods for preparing the hairpins and for stabilizing thentriplex are provided. Methods for targeting single-stranded oligonucleotides and DNA is described using the hairpins and triplexes of this invention.

Description

Parallel Stranded Duplexes Of Deoxyribonucleic Acid And Methods Of Use
BENEFIT OF PRIOR PROVISIONAL APPLICATION This utility patent application claims the benefit of priority of co-pending U.S. Provisional Patent Application Serial No. 60/383,292, filed May 24, 2002,entitled "Parallel Stranded Duplexes Of Deoxyribonucleic Acid And Methods Of Use" having the same named applicants as inventors, namely, Ramon Eritja and Ramon G. Garcia. The entire contents of U.S. Provisional Patent Application Serial No. 60/383,292 is incorporated by reference into this utility patent application.
COMPUTER READABLE FORM AND SEQUENCE LISTING Applicants state that the content of the sequence listing information recorded in computer readable form (CRF) as filed with this utility patent application is identical to the written paper sequence listing as filed with this utility patent application and contains no new matter as required by 37 CFR 1.821 (e-g) and 1.825 (b) and (d).
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to a novel triplex comprising a polypyrimidine sequence, a linker, and a polypurine sequence that is complementary to and parallel to the polypyrimidine sequence, and wherein the polypurine sequence comprises at least one 8- aminopurine, and a polypyrimidine target sequence that is complementary to and antiparallel to the polypurine sequence. Methods for preparing and using the triplex are also provided.
2. Description of the Background Art
DNA can form a large range of helical structures including duplexes, triplexes, and tetraplexes. The right-handed B-type duplex is the most common structure of DNA, but even now, decades after the discovery of the B-DNA,.new double helical conformations of DNA are being described. Thus, those skilled in the art appreciate that DNA has great flexibility and exhibits a large polymorphism depending on sequence, chemical modifications, or alterations in the DNA environment.
Most DNA duplexes, including the well-known B and A forms, are antiparallel (i.e., one strand runs 5' → 3' and the other 3'→ 5'), but parallel arrangements have been found in both hairpins and linear DNAs. Sequences with propensity to form parallel DNAs have been found in specific chromosome regions, and could have an evolutionary role. Moreover, certain types of parallel-stranded DNA can be excellent templates for the formation of triplexes. This is very useful for biotechnological purposes, including anti gene (targeting of genetic DNA by an artificial oligonucleotide) and antisense (targeting of natural messenger RNA by an artificial oligonucleotide) therapies.
Parallel DNA duplexes were first found in the crystal structure of a very short, mismatched DNA sequence intercalated by proflavine. Low resolution data of parallel- stranded duplex were found for longer pieces of RNA of sequence poly [d(A-U)], where the 2-position of adenines was modified by addition of bulky groups. The first structural model of polymeric parallel-stranded duplex DNA was derived by Pattabiraman, who on the basis of theoretical calculations designed a model for the parallel pairing of poly[d(A-T)] duplexes based on the reverse Watson-Crick motif. This model has been confirmed by low and high resolution experimental techniques on d(A-T) rich sequences.
The parallel-stranded duplex model early described by Pattabiraman and further refined by NMR data shows a general structure not far from the canonical antiparallel B- type helix. The bases are mostly perpendicular to the helix axis, there are two equivalent grooves, sugar units present puckerings in the South region, and the A T pairings are reverse Watson-Crick (Figure 1). This structure— the parallel reverse Watson-Crick (rWC) duplex —is the most stable conformation for parallel-stranded helices rich in d(A-T) pairs, as demonstrated by Jovin and others using a variety of thermodynamic and spectroscopic techniques. The rWC double helix is less stable than comparable antiparallel helices, but it can be found in hairpins and linear DNAs designed to hinder the formation of the antiparallel d(A-T) helix. The presence of a few d(G C) steps in the rWC double helix might be tolerated, but it destabilizes the duplex.
An alternative structure for parallel-stranded duplexes based on the Hoogsteen (H) recognition mode is also possible (Figure 1). This would lead to a double helix (not yet described from a structural point of view) which might act as a template for triplex formation. Parallel-stranded DNA duplexes based on the H pairing occur in duplexes where purines are modified at position 2, which prevents both Watson-Crick and reverse Watson-Crick pairings, or in duplexes rich in d(G C) (or d(G G)) pairs. These latter duplexes can exist at neutral pH, but they are especially stable at low pH owing to the need to protonate the Hoogsteen cytosine (Figure 1). The stability of the duplex can be also enhanced by DNA -binding drugs such as benzopyridoindole derivatives. Finally, as shown by Lavelle and Fresco and others, H-based parallel duplexes can be more stable than the canonical B-type antiparallel duplex under certain conditions.
Oligonucleotides bind in a sequence-specific manner to homopurine- homopyrimidine sequences of duplex and single-stranded DNA and RNA to form triplexes. Nucleic acid triplexes have wide applications in diagnosis, gene analysis and therapy, namely the extraction and purification of specific nucleotide sequences, control of gene expression, mapping of genomic DNA, induction of mutations in genomic DNA, detection of mutations in homopurine DNA sequences, site-directed mutagenesis, triplex- mediated inhibition of viral DNA integration, non-enzymatic ligation of double-helical DNA and quantification of polymerase chain reactions.
One of the main drawbacks of these applications is the low stability of triple helices especially in neutral conditions, and when the homopurine-homopyrimidine tracks have interruptions. A large effort has been made to design modified oligonucleotides and thus enhance triple helix stability in homopolymers and triplexes with interruptions in the homopurine-homopyrimidine tracks. Successful modifications of the nucleobases include molecules such as 5-methylcytidine, 5-methyl-2,6(lH,3H)- pyrimidinedione, and 2'-O-methylpseudoisocytidine.
Triplexes are typically formed by adding a triplex-forming oligonucleotide (TFO) to a duplex DNA. However, an alternative approach is based on the use of parallel- stranded duplexes. Accordingly, purine residues are linked to a pyrimidine chain of inverted polarity by 3 -3' or 5'-5' internucleotide junctions. Such parallel-stranded DNA hairpins have been synthesized and bind single-stranded DNA and RNA-targets by triplex formation, similar to the foldback all-pyrimidine hairpins that are known by those skilled in the art.
It will be appreciated by those skilled in the art that the structure of parallel- stranded DNAs is quite flexible and can change from H to rWC motifs depending on sequence, pH, and the presence of drugs. Low pH and high content of d(G C) pairs favor the H-based structure, while the rWC helix is favored in d(A-T) rich sequences and at neutral or basic pH.
SUMMARY OF THE INVENTION
In this invention the structure of parallel-stranded duplexes in mixed d(A-T) and d(G-C) sequences using state-of-the-art theoretical calculations and spectroscopic techniques were analyzed. This invention provides 8-amino derivatives to stabilize parallel duplexes that can be then used as templates for the formation of triple helices of DNA or DNA-RNA-DNA, that have a large impact in biotechnological and pharmaceutical research.
In one embodiment of this invention, a triplex is provided comprising a haiφin comprising at least one first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein at least one of the polypurine sequence is complementary to and parallel to the first polypyrimidine sequence, and the polypurine sequence comprising at least one 8-aminopurine; and at least one polypyrimidine target sequence, wherein at least one of the polypyrimidine target sequence is complementary to and antiparallel to the polypurine sequence, wherein the polypyrimidine target sequence and the hairpin are bound to each other. In a preferred embodiment of this invention, the triplex includes wherein the polypyrimidine target sequence comprises at least one purine interruption. In another embodiment of this invention, the triplex includes wherein the polypurine sequence of the hairpin comprises at least one pyrimidine interruption. In yet another embodiment of this invention, the triplex includes wherein the first polypyrimidine sequence of the haiφin comprises at least one purine interruption or an abasic interruption or an abasic model compound interruption. The triplex, as described herein, includes the linker that is at least one of a hexaethylene glycol, a tetrathymine, CTTTG, or GGAGG.
In a preferred embodiment of this invention, the triplex includes wherein the 8- aminopurine comprises 8-aminoguanine.
In another preferred embodiment of this invention, the triplex includes wherein the 8-aminopurine comprises 8-aminoadenine.
In another preferred embodiment of this invention, the triplex includes where the 8-aminopurine comprises 8-aminohypoxanthine.
Another embodiment of this invention provides a method for preparing a haiφin containing at least one 8-aminopurine comprising preparing a pyrimidine strand; binding a linker to the 3' end of the pyrimidine strand; preparing a purine strand comprising at least one 8-aminopurine; and preparing the haiφin by binding the 3' end of the purine strand to the linker.
In another embodiment of this invention, a method for preparing a haiφin containing at least one 8-aminopurine is provided comprising preparing a purine strand comprising at least one 8-aminopurine; binding a linker to the 5' end of the purine strand; preparing a pyrimidine strand; and preparing the haiφin by binding the 5' end of the pyrimidine strand to the linker.
Another embodiment of this invention includes a haiφin comprising at least one first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein at least one of the polypurine sequence comprises at least one 8-aminopurine and wherein the polypurine sequence is complementary to and parallel to the first polypyrimidine sequence.
The present invention also provides a method for stabilizing a triplex comprising obtaining a triplex comprising a haiφin, wherein the haiφin comprises at least a first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein the polypurine sequence comprises at least one 8-aminopurine, and contacting the triplex with a sodium chloride solution or a solution containing magnesium or derivatives thereof.
In another embodiment of this invention, a triplex is provided comprising a haiφin comprising at least one first polypyrimidine sequence, at least one linker, and at least one first polypurine sequence wherein the polypurine sequence is complementary to and antiparallel to the first polypyrimidine sequence, and the first polypurine sequence comprising at least one 8-aminopurine, and a target sequence wherein the target sequence is arranged in Hoogsteen orientation with respect to the haiφin.
In another embodiment of this invention, an oligonucleotide duplex is provided comprising two complementary oligonucleotide strands arranged in an anti-parallel Hoogsteen configuration.
The present invention also provides a method for stabilizing Hoogsteen duplexes comprising procuring a Hoogsteen duplex comprising at least one purine and stabilizing the Hoogsteen duplex by substituting at least one 8-aminopurine for at least one of the purine.
In yet another embodiment of this invention, a method for targeting a single- stranded oligonucleotide is provided comprising selecting a region on a single-stranded oligonucleotide, the region having either a first polypurine sequence target or a first polypyrimidine sequence target, preparing a haiφin wherein the haiφin comprises a second polypyrimidine sequence and a second polypurine sequence, wherein the second polypurine sequence comprises at least one 8-aminopurine and is complementary to the second polypyrimidine sequence, and targeting the region on the single-stranded oligonucleotide by contacting the haiφin with the first polypurine sequence target or the first polypyrimidine sequence target. In a preferred embodiment, this method includes wherein the single-stranded oligonucleotide is selected from the group consisting of cDNA, mRNA, tRNA, and rRNA.
Another embodiment of the present invention provides a method for targeting DNA comprising selecting a region on DNA, the region having either a first polypurine sequence target or a first polypyrimidine sequence target, preparing a haiφin wherein the haiφin comprises a second polypyrimidine sequence and a second polypurine sequence, wherein the second polypurine sequence comprises at least one 8-aminopurine and is complementary to the second polypyrimidine sequence, and targeting the region on the DNA by contacting the haiφin with the first polypurine sequence target or the first polypyrimidine sequence target.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 is a schematic representation of the Watson-Crick, reverse Watson-Crick, and Hoogsteen A»T pairings.
FIGURE 2 shows the thermodynamic cycle used to compute the stabilization of parallel- stranded duplexes induced by the introduction of 8-amino derivatives. FIGURE 3 shows the MD-averaged structures of the Hoogsteen duplexes obtained in the A and B trajectories. The conformation of the Hoogsteen duplex in a B-type triplex is displayed for comparison.
FIGURE 4 shows the final structures obtained in the three trajectories of the reverse Watson-Crick duplex. The structure generated from the experimental NMR structure (reference f in Table 1) is displayed for comparison.
FIGURE 5 sets forth a classical molecular interaction potentials (cMIP; top) and solvation maps (bottom) for the canonical antiparallel duplex (left) and Hoogsteen parallel-stranded duplex (right). cMIP contours correspond to interaction energy of -5 to 5 kcal/mol (O+ was used as a probe). Solvation contours correspond to a density of 2 g/mL. For parallel duplexes cMIPand solvation maps were determined averaging over the A and B trajectories simultaneously.
FIGURE 6 is a representation of protonated and wobble Hoogsteen 8AG-C dimers.
FIGURE 7 sets forth sequences of parallel-stranded haiφins carrying 8-aminopurines of this invention: A , 8-aminoadenine; G , 8-aminoguanine; IN, 8-aminohypoxanthine; and a (EG)ό hexaethylene glycol linker. Two anti-parallel duplexes used as control are also displayed. FIGURE 8 shows the dependence of Tm with pH for R-22 (SEQ ID NO: 1, SEQ ID NO: 2) , B-22 (SEQ ID NO: 1, SEQ ID NO: 2), and two antiparallel duplexes Dl (SEQ ID NO: 1, SEQ ID NO: 2) and D2 (SEQ ID NO:l, SEQ ID NO: 9).
FIGURE 9 shows: (A) CD spectra of haπpins B-22 (SEQ ID NO: 1, SEQ ID NO:2), B- 22A(SEQ ID NO:3, SEQ ID NO:2), B-22G (SEQ ID NO:4, SEQ ID NO:2), B-AT (SEQ ID NO: 6, SEQ ID NO:7), and an antiparallel duplex formed by B-22A control (SEQ ID NO:3, SEQ ID NO:8) (B-22 haiφin where the sequence of the pyrimidine strand is random) and a suitable single-stranded oligonucleotide (SI 1WC) (SEQ ID NO: 16), and (B) CD spectra of B22A control (SEQ ID NO:3, SEQ ID NO:8) alone and after addition of the antiparallel complementary pyrimidine strand (0.1 M sodium phosphate pH 6.0, 50 mM NaCl, 10 mM MgCl2).
FIGURE 10 shows the exchangeable proton region of the NMR spectra of: d(3'- AGANGGANGGAAG-5'-(EG)6-5'-CTTCCTCCTCT-3') at T = 50 °C.
FIGURE 11 shows the base pairing scheme of G: 8aminoG:C and T:8-aminoA:T.
FIGURE 12 shows gel-shift analysis performed with sn-GA (SEQ ID NO: 14) and sM- GT (SEQ ID NO: 15), h26(SEQ ID NO: 11), h26-3AG (SEQ ID NO: 12) and h26-3AA (SEQ ID NO: 13). FIGURE 13 shows gel-shift analysis performed with haiφin RE-2AG (SEQ ID NO: 4, SEQ ID NO: 14) and its polypyrimidine target WC-11 mer (SEQ ID NO: 16).
FIGURE 14 shows a scheme of binding a polypyrimidine single-stranded nucleic acid with haiφins of the present invention. Lower part: base-pairing schemes of triads containing 8-aminopurines.
FIGURE 15 shows sequences of parallel-stranded haiφins carrying 8-aminopurines of this invention: AN: 8-aminoadenine; G : 8-aminoguanine; I : 8-aminohypoxanthine; and (EG)6 : hexaethylenglycol linker, and GTTTC, GGAGG and TTTT linkers. Also shown is a haiφin of this invention containing an abasic model compound.
FIGURE 16 sets forth root mean square deviations (RMSd in A) between the trajectories of the parallel Hoogsteen (Ho) and antiparallel Watson-Crick (WC) duplexes and their respective MD-averaged structures (top), and between the same trajectories and the MD- averaged structures of both duplexes in the antiparallel triplex (bottom). Bases at both ends were removed for RMSd calculations.
FIGURE 17 shows binding of SEQ ID NO: 1, SEQ ID NO: 2) R-22A (SEQ ID NO: 3, SEQ ID NO: 2) and R-22G (SEQ ID NO:4, SEQ ID NO: 2) to WC-11 mer (SEQ ID NO: 16) (citric-phosphate buffer pH 6 of 100 mM Na+ ionic strength). Radiolabelled DNA target (10 nmol) was incubated at room temperature with 2-200 equivalents of cold haiφins R-22 (SEQ ID NO: 1, SEQ ID NO: 2), R-22A (SEQ ID NO: 3, SEQ ID NO: 2)and R-22G (SEQ ID NO: 4, SEQ ID NO: 2)and the mixtures were analyzed by 15% native polyacrylamide gel electrophoresis at room temperature.
FIGURE 18 shows binding of haiφin R-22G (SEQ ID NO: 4, SEQ ID NO: 2) to single- stranded target T ι (SEQ ID NO: 32) at pH 5.0. Left Side: The 32P-labelled oligonucleotide was the target T3ι (SEQ ID NO: 32) and increasing (2x, 20x, 200x) amounts of cold B-22G were added. Right side: The 32P-labelled oligonucleotide was the haiφin R-22G (SEQ ID NO: 4, SEQ ID NO: 2)and increasing (2x, 20x, 200x) amounts of cold T3 ) (SEQ ID NO: 32) were added. Incubation time 1 hr at room temperature.
FIGURE 19 shows the CD spectra of haiφins B-22 (SEQ ID NO: 1, SEQ ID NO: 2), B- 22G (SEQ ID NO: 4, SEQ ID NO: 2) and B-22A(SEQ ID NO: 3, SEQ ID NO: 2) alone and together with their pyrimidine target WC-1 lmer (SEQ ID NO: 16) (50 mM naCl, 10 mM MgCl , 0.1M sodium phosphate pH 6).
FIGURE 20 shows the exchangeable proton region of the NMR spectra of triplex formed by B22A: d(3'-AGANGGANGGAAG-5'-(EG)6-5'-CTTCCTCCTCT-3') (SEQ ID NO: 3, SEQ ID NO: 2)and WC-11 mer (3' -CTTCCTCCTCT-5') (SEQ ID NO: 16) at T=5°C.
Figure 21 shows melting temperatures of triplexes formed by haiφins B-22 A (SEQ ID NO:3, SEQ ID NO:2) and B-22G (SEQ ID NO: 4, SEQ ID NO:2) at various salt concentrations.
Figure 22 shows the binding of haiφin R-22G (SEQ ID NO: 4, SEQ ID NO:2) to single and double-stranded targets by gel-shift experiments.
Figure 23 shows the melting experiment on the triplex formed by B-22G (SEQ ID NO: 4, SEQ ID NO:2) and WC-1 lmer (SEQ ID NO: 16) followed by CD.
Figure 24 shows Hoogsteen base pairs and parallel-stranded DNA.
DETAILED DESCRIPTION OF THE INVENTION The present invention provides a triplex comprising a haiφin comprising at least one polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein the polypurine sequence is complementary to and parallel to the polypyrimidine sequence, and wherein the polypurine sequence comprises at least one 8-aminopurine, and a polypyrimidine target sequence complementary to and antiparallel to the polypurine sequence. The polypyrimidine target sequence and the haiφin are bound to each other. The triplex includes wherein the polypyrimidine target sequence comprises at least one purine interruption. In another embodiment of this invention, the triplex includes wherein the polypurine sequence of the haiφin comprises at least one pyrimidine interruption. In another embodiment, the triplex as described herein includes wherein the first polypyrimidine sequence of the haiφin comprises at least one purine interruption or an abasic interruption or an abasic model compound interruption.
A method for preparing a haiφin containing at least one 8-aminopurine of this invention comprises preparing a pyrimidine strand, binding a linker to the 3' end of the pyrimidine strand, preparing a purine strand comprising at least one 8-aminopurine, and preparing the haiφin by binding the 3' end of the purine strand to the linker. In another embodiment the method for preparing a haiφin containing at least one 8-aminopurine comprises preparing a purine strand comprising at least one 8-aminopurine, binding a linker to the 5' end of the purine strand, preparing a pyrimidine strand, and preparing the haiφin by binding the 5' end of the pyrimidine strand to the linker.
This invention includes the haiφin as described herein comprising at least one first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein at least one of the polypurine sequence comprises at least one 8-aminopurine and wherein the polypurine sequence is complementary to and parallel to the first polypyrimidine sequence.
Another embodiment of this invention provides a triplex comprising a haiφin comprising at least one first polypyrimidine sequence, at least one linker, and at least one first polypurine sequence wherein the polypurine sequence is complementary to and antiparallel to the first polypyrimidine sequence, and the first polypurine sequence comprising at least one 8-aminopurine, and a target sequence wherein the target sequence is arranged in Hoogsteen orientation with respect to the haiφin. In a preferred embodiment of this invention the triplex includes wherein the target sequence comprises G and T bases or G and A bases.
In a preferred embodiment of this invention, a triplex is provided comprising a haiφin comprising a polypyrimidine sequence, a linker, and a polypurine sequence, wherein the polypurine sequence is complementary to and parallel to the polypyrimidine sequence, wherein the polypurine sequence comprises at least one 8-aminopurine, and a polypyrimidine target sequence wherein the polypyrimidine target sequence is complementary to and antiparallel to the polypurine sequence. In the present invention, oligonucleotides containing 8-aminopurines replace natural purines in triplexes. The introduction of an amino group at position 8 of adenine and guanine increases the stability of the triple helix owing to the combined effect of the gain in one Hoogsteen purine-pyrimidine H-bond (Fig. 14) and to the ability of the amino group to be integrated into the "spine of hydration" located in the minor-Major groove of the triplex structure. The preparation and binding properties of oligonucleotides containing 8-aminopurines are known by those skilled in the art. However, natural oligonucleotides containing 8- aminopurines cannot be directly used for the specific binding of double-stranded DNA sequences, since the modified bases are purines that are in the target sequence and not in the Hoogsteen strand used for specific recognition of double-stranded DNA in usual triplex strategies.
We describe the binding properties of haiφins carrying 8-aminopurines, such as for example but not limited to, 8-aminoadenine, 8-aminoguanine and 8- aminohypoxanthine connected head-to-head to the Hoogsteen pyrimidine strand (Fig. 14). Haiφins carrying 8-aminopurines form stable Hoogsteen parallel-stranded structures. We show that these modified haiφins of this invention bind to the Watson- Crick pyrimidine strand via a triple helix with greater affinity than haiφins containing only natural bases, especially in neutral conditions. The effect of pH, salt concentration and loop structure on triplex stability are also analyzed herein. Moreover, parallel- stranded haiφins of this invention are shown to form triplexes with a base interruption in the polypyrimidine target sequence. The increased stability of the triple helix at neutral conditions and the possibility to cope with the interruptions in the polypyrimidine target sequences create new applications based on triple helix formation such as structural studies, DNA-based diagnostic tools, antigene and antisense therapies.
Methods
Molecular Dynamics (MD) Simulations. We analyzed the stability of a 11 -mer parallel DNA duplex with generally the same content of d(G C) and d(A-T) pairs ~d(5'- GAAGGAGGAGA-3') d(5'-CTTC-CTCCTCT-3') (SEQ ID NO: 1, SEQ ID NO: 2) - in water at room temperature when the base pairing corresponds to both rWC and H motifs. Two and three starting models were considered for H and rWC duplexes, respectively (Table 1). The two starting models for H duplex were obtained by removing the pyrimidine Watson-Crick strand of a A- and B-type triplex (simulations
Table 1. Summary of Starting Structures and Simulation Times Used for MD Analysis of Parallel-stranded Duplexes2
pairing scheme starting structure length of simuln (ns)
Hoogsteen modeled from B-type triplex6 5
Hoogsteen modeled from A-type triplex6 5 rev Watson-Crick modeled from NMR data 2b rev Watson-Crick modeled from theoretical model8 1 rev Watson-Crickc from an MD model8 5
Watson-Crickd from canonical model11 5
aIn all cases structures were modeled by substitution of the original sequence by the studied one prior to the optimization and equilibration process. In the case of rWC pairs the structures were modeled to show a double hydrogen-bond scheme. Simulation was stopped at that time because the structure of the helix was severely distorted. cThe original rWC d(A-T) Pattabiraman structure was equilibrated for 1 ns using MD; the sequence was then modified to that of interest, then reoptimized, and reequilibrated. "Antiparallel duplex. eShields, G,; Laughton, C.A.; Orozco, M. J. Am. Chem. Soc. 1997, 117, 7463; Soliva, R.; Laughton, C.A.; Luque, F.J.; Orozco, M. J. Am. Chem. Soc. 1998, 120, 11226; Shields, G.; Laughton, C.A.; Orozco, M. J. Am. Chem. Soc. 1998, 120, 5895. fYang, X.L.; Sugiyama, H.; Ikeda, S.; Saito, I.; Wang, A.H. Biophys. J. 1998, 75, 1163. gPattabiraman, N. Biopolymers 1986, 25, 1603. hArnott, S.; Hukins, D.W.L. Biochem. Biophys. Res. Commun. 1912, 47, 1504. All publications cited in this table are incoφorated by reference herein. HA and HB). The three starting models for rWC duplex correspond to (i) the NMR model, (ii) the canonical model reported by Pattabiraman and (iii) an equilibrated MD rWC d(A-T) duplex (see Table 1). These starting structures lead to simulations rWCi rWC2, and rWC , respectively. For comparison puφoses an antiparallel B-type duplex of the same sequence was generated using canonical structural parameters. In all cases the duplex was immersed in a box containing 2200-2700 water molecules and sodium ions were added to neutralize the system. Based on previous results Hoogsteen cytosines were protonated. The hydrated duplexes were then optimized, fhermalized, and equilibrated for 130 ps. All the systems were then subjected to 1-5 ns (nanosecond) of unrestrained MD simulation at constant pressure (1 atm) and temperature (298 degrees K) using periodic boundary conditions and the particle-mesh Ewald method known by those skilled in the art to account for long-range electrostatic effects. SHAKE (J. Comput. Phys. 1977, Vol. 23, pg. 327) was used to maintain all the bonds at their equilibrium distances, which allowed us the use of a 2 fs time step for integration. AMBER- 98/TIP3P (J. Am. Chem. Soc, 1995, Vol. 117, page 5179) and previously developed parameters for protonated cytosines and 8-aminopurines were used.
Geometrical analysis of the trajectories was performed using exclusively the central 9-mer duplex. The two trajectories of the H-based duplexes were averaged to obtain a better (10 ns) representation of the duplex. Analysis of possible molecular interactions of DNA was carried out using the CMIP program (CMIP computer program, made available by the University of Barcelona, Barcelona, Spain), and structural analysis of the trajectories performed.
Free Energy Calculations. Thermodynamic integration technique coupled to molecular dynamics simulations (MD/TI) was used to analyze the effect of replacing 2'- deoxyadenosine, 2'-deoxyguanosine, and 2'-deoxyinosine by their 8-amino derivatives on the stability of the d(5,-GAAGGAGGAGA-3') d(5,-CTTCCTCCTCT-3') (SEQ ID NO: 1, SEQ ID NO: 2) parallel-stranded duplex. In this embodiment of the present invention, mutations were performed between 8-amino-2'-deoxyadenosine and 2'-deoxyadenosine (8AA→ A), 8 amino-2'-deoxguanosine and 2'-deoxyguanosine (8AG→ G), and 8-amino- 2'-deoxyinosine and 2'-deoxyinosine (8AI→ I) in both duplex and single-stranded oligonucleotides. The change in stabilization free energy due to the 8AX→ X mutation is determined using standard thermodynamic cycles as known by those skilled in the art. (Figure 2).
MD/TI simulations were done considering only the H duplex due to the instability of the rWC duplex. The starting system in these calculations was defined as that obtained at the third nanosecond of the MD simulation duplex corresponding to the B trajectory of the H duplex. The 8-amino derivatives were then modeled at position 5 (8AG and 8AI) or 6 (8AA) of the purine strand, and the resulting structures were further equilibrated for 0.5 ns to avoid any bias in the calculations. Two additional simulations were performed considering the d(G C)/d(I-C) pair at position 5 shows a wobble neutral pairing, d(G-C)w/d(I C)w, instead of the normal protonated pair, d(G C)+/d(I C) . In this case one extra sodium ion was added to the modeled system, which was then further equilibrated for ins. The single strands were modeled as 5-mer oligonucleotides of sequences 5'- AGGAG-3', 5'-AG/AG-3', and 5'-GG GG-3'.
Mutations were performed using 21 double- wide windows of 10 and 20 ps each, leading to trajectories of 420 or 820 ps. Free energy estimates were obtained using the first and second halves of each window, which allows two independent estimates of the free energy change for every simulation. The values presented here correspond then to the average of four independent estimates, for estimating the statistical uncertainty of the averages. All other technical details of MD/TI simulations are identical to those of MD calculations. Simulations presented here correspond to more than 30 ns of unrestrained MD simulations of 11-mer H duplexes in water.
All MD and MD/TI simulations were carried out using the AMBER-5.1 computer program. All simulations were done in the supercomputers of the Centre de Supercomputacio de Catalunya (CESCA).
Preparation of Oligomers Containing 8-Aminopurines. Oligonucleotides were prepared on an automatic DNA synthesizer using standard and reversed 2-cyanoethyl phosphoramidites and the corresponding phosphoramidites of the 8-aminopurines. The phosphoramidite of protected 8-amino-2'-deoxyinosine was dissolved in dry dichloromethane to make a 0.1 M solution. The rest of the phosphoramidites were dissolved in dry acetonitrile (0.1 M solution). The phosphoramidite of the hexaethylene glycol linker was obtained from commercial sources known in the art. The preparation of 3'-3' linked haiφins (R-22 (SEQ ID NO: 1, SEQ ID NO: 2) R-22A (SEQ ID NO: 3, SEQ ID NO: 2) R-22G (SEQ ID NO: 4, SEQ ID NO: 2) and R-22G (SEQ ID NO: 5, SEQ ID NO: 2) was performed in three parts: First was the preparation of the pyrimidine part, using reversed C and T phosphoramidites and reversed C support (linked to the support through the 5' end). Next, after the assembly of the pyrimidine part, a hexaethylene glycol linker was added using a commercially available phosphoramidite known by those skilled in the art. Finally, the purine part carrying the modified 8-aminopurines was assembled using standard phosphoramidites for the natural bases and the 8-aminopurine phosphoramidites. For the preparation of 5'<5' linked haiφins B-22 (SEQ ID NO: 1, SEQ ID NO: 2) B-22A (SEQ ID NO: 3, SEQ ID NO: 2) B-22G (SEQ ID NO: 4, SEQ ID NO: 2) B-22AG (SEQ ID NO: 5, SEQ ID NO: 2) B-AT (SEQ ID NO: 6, SEQ ID NO: 7), and B-22A control (SEQ ID NO: 3, SEQ ID NO: 8) a similar approach was used. In this case, the purine part was assembled first, followed by the hexaethylene glycol linker. The pyrimidine part was the last part to be assembled using reversed phosphoramidites. Complementary oligonucleotides containing natural bases were also prepared using commercially available chemicals and following standard protocols known by those skilled in the art. After the assembly of the sequences, oligonucleotide supports were treated with 32% aqueous ammonia at 55 °C for 16 h (hour) except for oligonucleotides having 8-aminoguanine. In this case a 0.1 M 2-mercaptoethanol solution in 32% aqueous ammonia was used and the treatment was extended to 24 h (hour) at 55 °C (Centigrade). Ammonia solutions were concentrated to dryness and the products were purified by reverse-phase HPLC. Oligonucleotides were synthesized on a 0.2 μmol scale and with the last DMT group at the 5' end (DMT on protocol) to help reverse-phase purification. All purified products presented a major peak, which was collected. Yields (OD units at 260 nm after HPLC purification, 0.2 μmol) were between 6 and 10 OD. HPLC conditions: HPLC solutions are as follows. Solvent A, 5% ACN in 100 mM triethylammonium acetate (pH 6.5); and solvent B, 70% ACN in 100 mM triethylammonium acetate pH 6.5. Columns: PRP-1 (Hamilton), 250 x 10 mm. Flow rate 3 mL/min. A 30 min linear gradient from 10 to 80% B (DMT on), or a 30 min linear gradient from 0 to 50% B (DMT off). Melting Experiments. Melting experiments were performed as follows: Solutions of the haiφins and duplexes were dissolved in 1 M NaCl, 100 M phosphate/citric acid buffer. The solutions were heated to 90 °C, and then allowed to cool slowly to room temperature, and then samples were kept in the refrigerator overnight. UV absoφtion spectra and melting experiments (absorbance vs temperature) were recorded in 1 cm path length cells using a spectrophotometer, which has a temperature controller with a programmed temperature increase of 0.5 °C/min. Melts were run on duplex concentration of 3-4 μM at 260 nm.
Circular Dichroism (CD). Oligonucleotides were dissolved in 100 mM phosphate buffer pH 6.0, 50 mM sodium chloride, and 10 mM magnesium chloride. The equimolar concentration of each strand was 4-5 μM. The solutions were heated at 90°C, allowed to come slowly to room temperature, and stored at 4 °C until CD measurement was performed. The CD spectra were recorded on a Jasco J-720 spectropolarimeter attached to a Neslab RP-100 circulating water bath in 1 cm path length quartz cylindric cells. Spectra were recorded at room temperature using a 10 nm/min scan speed, a spectral bandwidth of 1 nm, and a time constant of 4 s. CD melting curves were recorded at 280 nm using a heating rate of 20 °C/h and a scan speed of 100 nm/ min. All the spectra were subtracted with the buffer blank, normalized to facilitate comparisons, and noise-reduced using Microcal Origin 5.0 software.'
NMR Spectroscopy. A sample of the oligonucleotide d(3'-AGNGGNGGAAG-5'- (EG)6-5'-CTTCCTCCTCT-3') (N = 8-amino-A) (SEQ ID NO: 3, SEQ ID NO. 2) for NMR experiments was prepared in 250 pL of 9:1 H20/D20, 25 mM sodium phosphate buffer, and 100 mM NaCl. The pH was adjusted by adding small amounts of concentrated HC1. The final oligonucleotide concentration was around 1 mM. Spectra were acquired in a Bruker AMX spectrometer operating at 600 MHz, and processed with the UXNMR software. Water suppression was performed by using a jump-and-return pulse sequence with a null excitation in the water signal. All experiments were performed at 5 °C.
Molecular Dynamics Simulations. MD simulations of H duplexes show stable trajectories along the 5 ns simulation time (Figure 3), as noted in the average root-mean- square deviation (rmsd) between the trajectories and the respective MD-averaged conformations (1.4 and 1.5 A for simulations HA and HB, respectively). The only noticeable distortions are a slight bend at the d(G C) end and the existence of partial fraying events at the d(A T) end. Similar features occured in the control antiparallel helix. It is also worth noting that the existence of two consecutive protonated pairs d(G C)+ did not introduce large structural alterations in the helix.
The two simulations, which started from different H-based duplex models, are reasonably converged and sample similar regions of the conformational space. This is noted in the rmsd between each trajectory and the MD-averaged conformation of the other: 1.9 A (B trajectory with respect to the average structure in simulation HA) and 2.1 A (A trajectory with respect to the average structure in simulation HB). Both trajectories sample conformational regions close to those typical of Hoogsteen strands in a triplex DNA (Figure 3). It will be appreciated by those persons skilled in the art that the MD simulations suggest that the structure of the Hoogsteen strands of a triplex is not largely distorted when the pyrimidine Watson-Crick strand is removed. Thus, the rmsd between the two trajectories and the starting model in simulation HB (taken directly from a B-type triplex DNA) is 1.4 and 1.8 A in simulations HB and HA, respectively. The rmsd is slightly larger with respect to the Hoogsteen strands of the starting model in simulation HA (an A-type triplex): 2.0 A (HA) and 2.1 A (HB).
In contrast to these results, the simulations of rWC duplexes starting from the high-resolution NMR or the canonical model (simulations rW and rWC2) diverge very quickly. All the efforts to reinforce the equilibration of the system and the pairing between bases fail to provide stable structures (rmsd from canonical structure 3.4-3.9 A at the end of the simulations). Beside the fact that many interstrand hydrogen bonds and stacking interactions are preserved along the simulation, the geometries are heavily distorted in less than 1 ns (see Figure 4), and the helical nature of the structures is then completely lost. The third simulation (rWC ), which started from a model derived from a previously 1 ns equilibrated trajectory of a d(A-T) rWC duplex, was stable for a longer period, but the helix was also largely distorted (rmsd 3.2 A) after the 5 ns simulation time (Figure 4). While not wishing to be bound by a particular theory, analysis of the trajectories suggests that the amino repulsion between G and C is the main factor that causes the helix destabilization, despite our efforts to reduce the amino repulsion by promoting a wobble d(G C) pairing.
The MD simulations suggest that the rWC duplex is not stable. On the contrary, the H-based conformation seems stable during all the simulation time. Therefore, the results support the existence of H-based motifs for parallel-stranded duplexes in DNAs with similar population of d(A-T) and d(G C) pairs, and that the rWC helix is not stable when there is a high content of d(G C) pairs.
The stability of the H-based simulations allows analysis of the structure of a H- based parallel-stranded duplex. As noted above, the helix is similar to the structure of Hoogsteen strands in a DNA triplex. The average twist is 31°, and the rise is 3.4 A. The bases are generally peφendicular to the helix axis. The sugars are in the South and South-East regions, having an average phase angle of 124°, as found experimentally for rWC parallel-stranded duplexes and triplexes. There is a narrow groove (denoted "minor" in the following) corresponding to the minor part of the major groove in DNA triplexes, and a wide groove (denoted here "major") corresponding to both the minor groove and the major part of the major groove of a DNA triplex (Figure 3). The shortest P-P average distance along the two grooves is around 9 (±0.6) and 25 (±2) A for the "minor" and "major" grooves. There are then major differences with rWC duplexes, where two equivalent grooves were found.
The classical molecular interaction potential maps (CMIP; Figure 5) allowed us to trace the regions where the DNA has a strong propensity to interact with small cationic probes. As expected from our previous studies on DNA triplexes, the "minor" groove is the most active region for interactions. The ability of the H duplex to interact the cationic probes is not different from that of a B-type antiparallel duplex with the same sequence, despite the fact that all Hoogsteen cytosines are protonated in the H duplex. It is clear that the short P--P distance in H duplexes creates a strong negative potential in the vicinities of the Hoogsteen cytosines, thus screening their positive charge.
The H duplex is very well hydrated, as shown in the solvation contours represented in Figure 5. The largest apparent density of water is found in the minor groove, which is wide enough to allow the insertion of a chain of ordered waters. There are also regions of large (more than 2 g/mL) water density in the vicinities of the phosphate groups in the major groove. Interestingly, the apparent water densities around the H duplex and the reference antiparallel helix are very similar, thus confirming the findings obtained from CMIP calculations.
The antiparallel H duplex is a new structure which shares many characteristics with DNA triplexes, but that also exhibits a series of unique molecular recognition characteristics derived mainly from the existence of two very different grooves.
Free Energy Calculations. The design, synthesis, and evaluation of a series of 8- amino derivatives of purine bases are known by those skilled in the art. These molecules strongly stabilize the DNA triplex, which was related, among other factors, to an extra hydrogen bond between the 8-amino group of the purine and the carbonyl group of Hoogsteen cytosines or thymines. We also found that the 8-amino group promotes a strong destabilization of the Watson-Crick pairing, at least for d(G-C) and d(I-C) pairs. Accordingly, we could expect that the presence of 8-amino groups should destabilize the rWC duplex, increasing the stability of the H duplex. It is worth noting that the stability of the H duplex is crucial for the use of parallel-stranded duplexes as templates for triplex formation. MD/TI calculations were performed only in the H duplex because the instability of the rWC duplex precludes any TI calculation. As found in previous simulations for related systems, the mutation profiles are smooth, without any apparent discontinuity, which could signal the existence of hysteresis. The standard errors in free energy estimates are 0.2-0.3 kcal/mol, thus indicating a good convergence in the results (Table 2).
The H duplex is stabilized by around 2.7 kcal/mol by the A→ 8AA mutation (Table 2), a value similar to that found previously using less rigorous simulation protocols for poly d(A-T-T) triplex. The mutation G→ 8AG in a d(G-C)+ motif increases the stability of the H duplex by around 1 kcal/mol.
Table 2. MD/TI Estimates of Stabilization (ΔΔGstab and Standard Errors in kcal/mol) of Parallel-Stranded Duplexes Induced by 8-Amino Derivatives3 mutation complementary pyrimidine ΔΔGstab kcal/mol
G→ 8AG C+ -1.4 ± 0.2
G→ 8AG C -3.1± 0.3
I→ 8AI C+ -0.9± 0.3
I→ 8AI C -3.2± 0.3
A→ 8AA T -2.7± 0.3
a For d(G-C) and d(I-C) motifs the simulation was performed considering two ionization states of the Hoogsteen cytosine. Calculations were carried out always using the sequence d(GAAGXAGGAG), (SEQ ID NO: 10) where X is the base which is mutated.
(Table 2), while the I→ 8A1 mutation in the d(I-C)+ motif increases the stability by around 1.4 kcal/mol (Table 2). These two latter values also agree with previous estimates in DNA triplexes.
Results noted herein clearly point out a strong stabilization of the H duplex upon introduction of 8-aminopurines and suggest that these molecules can help stabilize haiφins based on the parallel H duplex. We were, however, concerned by the fact that the G→ 8AG mutation stabilizes the H duplex less than the A→ 8AA mutation, since this finding, which agrees with previous calculations in triplexes, does not agree with melting experiments on H haiφins (see below). While not wishing to be bound by a particular theory, this suggests that when 8 AG (or 8AI) is present, the Hoogsteen recognition might not necessarily be the d(8AG-C)+ motif, but can be a wobble pair d(8AG-C)w (see Figure 6). Because the d(G/I C)+ → d(8AG/8AI C)w mutation is technically very difficult owing to the annihilation of a net charge, we investigated by means of indirect evidence the potential role of d(8AG-C)w motifs by doing the mutations G→ 8AG and I→ 8AI in the presence of a neutral cytosine in the complementary Hoogsteen position (the rest of the Hoogsteen cytosines were protonated). The results (see Table 2) suggest that the presence of 8-amino derivatives strongly stabilizes (3.1 and 3.2 kcal/mol for I and G, respectively) the wobble pairing. Note that this free energy difference is 0.5 kcal/mol larger than that found in the A→ 8AA mutation and more that 2 kcal/mol larger than the stabilization due to the same mutation when the Hoogsteen cytosine is protonated. According to these results, it is believed that the presence of 8AG and 8AI favors the existence of neutral Hoogsteen motifs instead of the protonated ones (see below). This could be due to the fact that the 8-amino is a hydrogen-bond donor which interacts better with a neutral molecule than with a cation.
Structure of the Oligonucleotide Derivatives. To check MD and MD/TI-derived hypothesis, several parallel-stranded DNA haiφins carrying 8-aminoadenine (8AA=AN), 8-aminoguanine (8AG=GN), and 8-aminohypoxanthine N (8AI=I ) were prepared. The sequences of the oligonucleotides are shown in Figure 7.
The first group of oligomers are parallel-stranded haiφins connected through their 3' ends with an hexaethylene glycol linker [(EG)6J. Two adenines are substituted by two 8-aminoadenines (AΝ) in the oligonucleotide R-22A (SEQ ID NO: 3, SEQ ID NO: 2) the oligonucleotide R-22G (SEQ ID NO: 4, SEQ ID NO: 2) two guanines are substituted by two 8-aminoguanines (GN), and in the oligonucleotide R-22I (SEQ ID NO: 5, SEQ ID NO: 2) two guanines are substituted by two 8-aminohypoxanthines (IN). The oligonucleotide (R-22) (SEQ ID NO: 1, SEQ ID NO: 2) contains only the natural bases without modification.
Table 3. Melting Temperatures a (°C) for the Parallel-Stranded Haiφins Having 3'-
3' Linkages haiφin pH 4.6 pH5.5 pH6.0 pH6.5 pH7.0
R-22*l 46 34 25
R-22A*2 64 50 43 28
R-22G*3 68 55 50 40 39
R-22P4 52 42 34 25 23
Inl M NaCl, 100 mM sodium phosphate/citric acid buffer. * 1 (SEQ ID NO: 1 , SEQ ID NO: 2) *2 (SEQ ID NO: 3, SEQ ID NO: 2) *3 (SEQ ID NO: 4, SEQ ID NO: 2) *4 (SEQ ID NO: 5, SEQ ID NO: 2)
The second group of oligomers B-22 (SEQ ID NO: 1, SEQ ID NO: 2) B-22A (SEQ ID NO: 3, SEQ ID NO: 2) B-22G (SEQ ID NO: 4, SEQ ID NO: 2) is similar in composition to those in the previous oligomers, but the polypurine and the polypyrimidine parts are connected through their 5' ends with an hexaethylene glycol linker [(EG)6]. In addition, an oligomer having two 8-aminoguanines and two 8- aminoadenines was prepared (B-22AG) (SEQ ID NO: 34, SEQ ID NO: 2) to test whether the stabilizing properties of both 8-aminopurines are additive. A parallel-stranded haiφin that has only d(A-T) base pairs (B-AT) (SEQ ID NO: 6, SEQ ID NO: 7) was prepared. Finally, a control haiφin (B-22A control) (SEQ ID NO: 3, SEQ ID NO: 8) with the same purine sequence as B22A (SEQ ID NO: 3, SEQ ID NO: 2) but a noncomplementary pyrimidine sequence was also prepared.
Oligonucleotide sequences containing 8-aminopurines were prepared using phosphoramidite chemistry on an automatic DNA synthesizer. The parallel-stranded oligomers were prepared using protocols known by those skilled in the art. The phosphoramidites of 8-aminoadenine, 8-aminoguanine, and 8-aminohypoxanthine were prepared using protocols known by those skilled in the art.
Melting Experiments. The relative stability of parallel-stranded haiφins was measured spectrophotometrically at different pHs (pH 4.6-7.0). In most cases one single transition was observed with an hyperchromicity around 15% at acidic pH and 10% at neutral pH that was assigned to the denaturation of the parallel-stranded haiφin. In Table 3, melting temperatures of the haiφins having 3'<3' linkages are shown.
When the haiφin is formed by natural bases (R-22) (SEQ ID NO: 1, SEQ ID NO: 2), a clear transition is observed at pH 4.6 and pH 6.0 but no transition was observed at pH higher than 6.0. Melting temperatures are pH-dependent, and at lower pH melting temperatures are higher than at pH 7.0. These results are consistent with a Hoogsteen base pairing in which C has to be protonated (i.e., an H-type duplex is supported). This profile of pH dependence cannot be explained for a reverse Watson-Crick parallel duplex, and it is also inconsistent with the existence of short antiparallel duplexes (like a 7-mer duplex d(-AGGAGGA-)-d(-TCCTCCT-), which could be formed with the central part of sequence. To verify the latter point we synthesized and measured the melting temperatures at pH 4.5, 6.0, and 7.0 of two antiparallel duplexes of sequences d(GAAGGAGGAGA) d(TCTCCTCCTTC) (SEQ ID NO: 1, SEQ ID NO: 2) (Dl) and d(GAAGGAGGAGA)»d(TCCTCCT) (SEQ ID NO:l, SEQ ID NO: 9) (D2). The profiles of pH dependence with the temperature found for both antiparallel duplexes are compared in Figure 8 with those found for R-22 (SEQ ID NO: 1, SEQ ID NO: 2) and B- 22 (SEQ ID NO: 1 , SEQ ID NO: 2). It is clear that the profiles strongly support that the antiparallel duplex is not significantly populated.
The substitution of two A's by two 8AAs stabilizes the parallel-stranded structure as seen by the higher melting temperatures at pH 4.6 and 6.0 (ΔTm 16-18°C) and the observation of a transition at pH 6.5. The substitution of two G's by two 8AGs raises the melting temperatures of the haiφins even higher. The differences in melting temperatures with respect to B-22 (SEQ ID NO: 1, SEQ ID NO: 2) are between 21 and 25 °C. It is also possible to observe a transition at about pH 7.0 and 6.5. The substitution of two G's by two 8AIs stabilizes the parallel-stranded structure, but this stabilization is of small intensity (ΔTm 6-9 °C at pH 4.6-6.0). The melting temperatures of haiφins having 8AG and 8AI are not decreasing so quickly at neutral pH. This indicates that these haiφins are not as dependent as the other haiφins to protonation of C probably due to the extra hydrogen bond between the 8-amino group of the 8- aminopurines and the 2-keto group of C.
As noted herein, in addition to the haiφins linked by 3'<3' bonds (R-22 (SEQ ID NO: 1, SEQ ID NO: 2) derivatives) we prepared haiφins linked by 5'<5' bonds (B-22 (SEQ ID NO: 1, SEQ ID NO: 2) derivatives). Table 4 shows the melting temperatures of these haiφins at different pHs.
Table 4. Melting Temperatures3 (°C) for the Parallel-Stranded Haiφins Having 5'-5' Linkages haiφin PH 4.6 pH 5.5 pH 6.0 pH 6.5 pH 70
B-22*l 57 35 25
B-22A*2 61 47 38 23
B-22G*3 65 54 44 30 21
B-22AG*4 72 62 52 43 39 a In 1 M NaCl, 100 mM sodium phosphate/citric acid buffer. *1 SEQ ID NO: 1, SEQ ID NO: 2 *2 SEQ ID NO: 3, SEQ ID NO: 2 *3 SEQ ID NO: 4, SEQ ID NO: 2 *4 SEQ ID NO: 34, SEQ ID NO: 2 Results are similar to that described herein with haiφins having 3'-3' linkages. Substitution of A or G by the corresponding 8-aminopurine derivative induces a strong stabilization of the haiφin seen as a higher Tm at acidic pH and the observation of transitions at neutral pH that are not possible to observe with haiφins having only natural bases. It is important to notice also that the addition of both 8AA and 8AG in the same oligonucleotide (B-22AG) (SEQ ID NO: 34, SEQ ID NO: 2)has additive effects. For example, at pH 6.0, the presence of two 8AAs gives an increase on the Tm of 13 °C, two AGs give an increase of 19 °C and the addition of both two 8AAs and two 8 AGs gives an increase of 27 °C. The low dependence of melting temperatures with the pH found for values close to pH 7.0 for haiφins having 8AG (R-22G) (SEQ ID NO: 4, SEQ ID NO: 2) and 8AI (R-22G (SEQ ID NO: 5, SEQ ID NO: 2) is observed for haiφin B-22AG (SEQ ID NO: 34, SEQ ID NO: 2) but not for haiφin B-22G (SEQ ID NO: 4, SEQ ID NO: 2). Parallel haiφins containing only A-T pairs (B-AT (SEQ ID NO: 6, SEQ ID NO: 7)) had the same melting temperature (rm=42 °C) from about pH=5.5 to 7.0. Control haiφin (B- 22 A control (SEQ ID NO: 3, SEQ ID NO: 8)) had no transition at any pH.
All the melting experiments described in Tables 3 and 4 were performed at about 1 M NaCl, as described under the methods set forth herein. In addition, we have performed melting experiments from about 0 to 1 M NaCl . Melting temperatures remain unchanged within 1 degree error, in agreement with previous results regarding salt effects in Hoogsteen pairing.
There is excellent agreement between MD/TI calculations derived from the assumption of an H-type parallel duplex and experimental measures. The large stabilization found theoretically for the amino groups is also detected experimentally in increases in Tm of almost 10 °C per substitution. Interestingly, the greater stability obtained for the G→ 8AG mutation compared with that obtained by the A → 8AA mutation and the smaller dependence on pH of the stability of duplexes containing 8AG suggest that neutral wobble pairing might play a key role in parallel duplexes containing d(8AG*C) pairs. Finally, the small stabilization obtained for the G→ 8AI mutation is the result of the balance between the stabilization of the H-duplex induced by the I→ 8AI mutation and the destabilization induced by the G→ I change. The 8-amino group destabilizes the Watson-Crick pairing for G and I and is expected then to destabilize the reverse Watson-Crick pairing. Accordingly, the stabilization in the duplex structure found experimentally can be understood only considering that the haiφins studied here have a Hoogsteen and not a reverse Watson- Crick secondary structure. Note also that the change in stability of the duplex induced by the G→ 8AG or A→ 8AA substitutions also argue strongly against the existence of significant amounts of a 7-mer antiparallel duplex. Thus, the changes of two G's (positions 5 and 8) by two 8AGs lead to a decrease of 7 °C in Tm for the two antiparallel duplexes used as controls d(GAAGGAGGAGA) d (TCTCCTCCTTC) (SEQ ID NO: 1, SEQ ID NO: 2) and d(GAAGGAGGAGA) d(TCCTCCT), (SEQ ID NO: 1, SEQ ID NO: 9)while for R-22 (SEQ ID NO: 1, SEQ ID NO: 2) and B-22 (SEQ ID NO: 1, SEQ ID NO: 2) the same changes induced an increase of more than 21 °C in Tm.
Circular Dichroism. To obtain information on the structure of the haiφins, circular dichroism (CD) spectra were measured. Figure 9A shows the CD spectra of haiφins B-22, (SΕQ ID NO: 1, SΕQ ID NO: 2), B-22A (SΕQ ID NO: 3, SΕQ ID NO: 2) and B-22G (SΕQ ID NO: 4, SΕQ ID NO: 2) and the parallel-stranded haiφin with d(A-T) base pairs (B-AT (SΕQ ID NO: 6, SΕQ ID NO: 7)). As an additional control, we introduced a modified B22 haiφin (B-22A control(SΕQ ID NO: 3, SEQ ID NO: 8), where the sequence of the pyrimidine strand is random, to guarantee that no parallel duplex can be formed. This later oligonucleotide was paired with the corresponding 11- mer oligonucleotide complementary to the WC purine strand (SI 1WC) (SEQ ID NO: 16) . As noted in Figure 9B, B-22A control (SEQ ID NO: 3, SEQ ID NO: 8) does not have structure, but it generates an antiparallel duplex if a suitable single-stranded oligonucleotidic strand (SI 1WC) (SEQ ID NO: 16) is added (B-22A control + SI 1WC) (SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 16).
The shapes of the CD spectra (see Figure 9A) of haiφins B-22, (SEQ ID NO: 1, SEQ ID NO: 2) B-22A (SEQ ID NO: 3, SEQ ID NO: 2) and B-22G (SEQ ID NO: 4, SEQ ID NO: 2) are similar, and clearly differ from B-AT (SEQ ID NO: 6, SEQ ID NO: 7) and from the antiparallel duplex (B-22 A control + SI 1WC (SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 16); see also Figure 9B). The CD spectra of the haiφin B-AT (SEQ ID NO: 6, SEQ ID NO: 7) has a strong minimum at 248 nm, a smaller minimum at 206 n , and two maxima at 218 and 280 nm. This spectrum is similar to that known in the art for A-T rich parallel-stranded DNA that is considered a model for reverse Watson- Crick pairing. The CD spectra of B-22, (SEQ ID NO: 1, SEQ ID NO: 2) B-22A (SEQ ID NO: 3, SEQ ID NO: 2) and B-22G (SEQ ID NO:4, SEQ ID NO: 2) have a strong maximum between 270 and 290 nm and two minima: one at 242 nm and a second, more intense minima at around 212 nm. The minimum around 212 and the maximum around 280 are more intense in the haiφins containing 8-aminopurines (B-22A (SEQ ID NO: 3, SEQ ID NO: 2) and B-22G(SEQ ID NO: 4, SEQ ID NO: 2)). This type of spectra is characteristic of DNA triplexes. In summary, CD spectra demonstrate that the haiφins of this invention, which contain a mixture of A(8AA)-T and G(8AG/8AI)-C steps have a Hoogsteen-type structure and are not reverse Watson-Crick parallel or Watson-Crick antiparallel duplexes.
NMR Spectra. The imino region of one-dimensional Η NMR spectra of the DNA haiφin d(3'-AGANGGANGGAAG-5'-(EG)6-5'-CTTCCTCCTCT-3') (SEQ ID NO: 3, SEQ ID NO: 2) at three different pHs is shown in Figure 10. Unfortunately, the broad signals observed (due probably to the formation of Hoogsteen parallel inter-molecular duplexes at the concentration of NMR experiment) prevented the acquisition of high- quality two-dimensional spectra, and, therefore, the sequential assignments could not be done. However, the presence of imino signals between 14.5 and 16.0 ppm clearly indicates that some cytosines are protonated. Also, the signals around 10 ppm correspond to amino protons of cytosines forming Hoogsteen base pairs. Most probably, the resonances around 13 ppm are due to imino protons of Hoogsteen thymines. Since the chemical shifts of the exchangeable protons in reversed Watson-Crick base pairs are very similar to those observed in canonical antiparallel duplexes, this kind of base pairing can be ruled out. Finally, it is worth noting that most of the features of the exchangeable proton spectra can be still observed at neutral pH, suggesting a notable stability of the parallel duplex at neutral pH.
Overall, NMR experiments confirm MD, MD/TI, and CD results, and they demonstrate that the parallel-stranded duplexes studied here are stable and show a Hoogsteen-type hydrogen-bonding pattern similar to that of DNA triplexes. The reverse Watson-Crick model of the parallel-stranded duplex, or the standard antiparallel duplex, is ruled out.
Very extended molecular dynamics simulations fail to provide stable helical structures for sequences containing a similar number of d(A T) and d(G C) pairs arranged in the reverse Watson-Crick structure. On the contrary, stable trajectories are found if a Hoogsteen pairing is assumed. The structures obtained in these trajectories allowed us to describe the structure of an H-type parallel duplex, whose overall conformation is close to that displayed by the Hoogsteen strands of a DNA triplex. CD spectra support this and this also agrees with preliminary NMR experiments.
8-aminopurine derivatives are able to largely increase the stability of DNA haiφins containing almost the same number of d(A-T) and d(G-C) duplexes, which are designed to have a parallel aπangement. This increase in stability is accurately represented by state of the art MD and MD/TI calculations when a Hoogsteen-type secondary structure is assumed for the haiφins.
It will be appreciated by those skilled in the art that the present invention provides a new method for the stabilization of parallel-stranded H-type duplexes. The introduction of at least one 8-aminopurine derivative makes stable H duplexes under pH or temperature conditions where the helices will be otherwise unstable. These structures act as templates for the formation of DNA-DNA-DNA and DNA-RNA-DNA triplexes in physiological conditions, which is helpful for biotechnological puφoses, as well as for antigene and antisense therapies.
EXAMPLES
ALL-PURΓNE HAIRPINS
In addition to triplexes having purine : pyrimidine : pyrimidine (type I) triads, it is possible to observe Purine : Pyrimidine : Purine (type II) triads. By observation of the structure of the type II triads, it is possible to draw an extra hydrogen bond between 8- aminoguanine (Watson-Crick) and 6-keto of guanine (Hoogsteen) (Figure 11). Also in the so-called G-T motif it is possible to draw an extra hydrogen bond between 8- aminoadenine and 2-keto of thymine (Hoogsteen). In this way, 8-aminoguanine shall stabilize Purine : Pyrimidine : Purine (type II) triplex if Hoogsteen strand is formed by G and A and both 8-aminoguanine and 8-aminoadenine may stabilize type II triplex if Hoogsteen strand is formed by G and T. In both cases 8-aminopurine shall occupy the Watson-Crick purine position. The stability of Type II triplexes is independent of pH. For these reasons they are generally used for triplex applications at physiological pH. The following oligonucleotides were prepared:
h26: 5' GAAGGAGGAGA-TTTT-TCTCCTCCTTC 3' (SEQ ID NO: 11) h26-3AG: 5'GAAGGNAGGNAGNA-TTTT-TCTCCTCCTTC 3' (SEQ ID NO: 12) h26-3AA: 5' GAANGGANGGANGA-TTTT-TCTCCTCCTTC 3' (SEQ ID NO: 13) sn-GA : 5' AGAGGAGGAAG 3' (SEQ ID NO: 14) Sπ-GT : 5' TGTGGTGGTTG 3' (SEQ ID NO: 15)
RE-2AG : 5' GAAGGNAGGNAGA-(EG)6-AGAGGAGGAAG 3' (SEQ ID NO: 4, SEQ
ID NO: 14)
WC:-11 mer: 5'TCTCCTCCTTC 3' (SEQ ID NO: 16)
Oligonucleotides sn-GA (SEQ ID NO: 14) and s, ι-GT (SEQ ID NO: 15)were mixed with h26 derivatives (h26, (SEQ ID NO: 11), h26-3AG (SEQ ID NO: 12) and h26- 3AA (SEQ ID NO: 13) in 10 mM sodium cacodilate, 50 mM magnesium chloride and 0.1 mM EDTA pH 7.3. The resulting mixtures were annealed and analyzed on (15%) polyacrylamide gel electrophoresis under native conditions (90 mM Tris-Borate, 50 mM MgCl2, pH 8.0). The presence of triplex was monitored by the appearance of a slower band (Figure 12). Unmodified haiφin (SEQ ID NO: 11) and haiφin carrying 8- aminoguanines (SEQ ID NO: 12) gave triplex with both GA- and GT- Hoogsteen oligonucleotides (sn-GA (SEQ ID NO: 14) and Sn-GT (SEQ ID NO: 15)). Haiφin carrying 8-aminoadenines (SEQ ID NO: 13) gave only triplex with sπ-GT (SEQ ID NO: 15). No triplex was observed with sn-GA (SEQ ID NO: 14) as expected. Melting experiments were also performed in 10 mM sodium cacodilate, 50 mM magnesium chloride and 0.1 mM EDTA. Two transitions were observed: one at 80-85 °C (haiφin to random coil transition) and the other at around 25-30 °C (triplex dissociation). The triplex to duplex transition had a low hyperchromicity and it was difficult to measure with precision. It is known in the art that triplex of type II is accompanied with little or no changes in absorbance.
Furthermore, gel-shift analysis was also performed at the same conditions described above with haiφin RE-2AG (SEQ ID NO: 4, SEQ ID NO: 14) and its polypyrimidine target WC-1 lmer (SEQ ID NO: 16). Also triplex formation was observed by the appearance of a slow moving band (Figure 13).
Melting experiments of haiφin RE-2AG (SEQ ID NO: 4, SEQ ID NO: 14) alone and haiφin RE-2AG (SEQ ID NO: 4, SEQ ID NO: 14) + WC-1 lmer (SEQ ID NO: 16) were also performed at 0.1 M sodium phosphate pH 7.2. In these conditions a clear transition (triplex to random coil) was observed with a melting temperature Tm = 42°C. Haiφin alone did not show any transition. As a control experiment duplex without the Hoogsteen part (5* GAAGGNAGGNAGA3': 3'CTTCCTCCTCT 5') (SEQ ID NO: 4, SEQ ID NO: 16)showed a melting temperature of 31 °C.
Moreover, the triplex stabilization properties of 8-aminoguanine were analyzed using the model system described by Pilch et al. (Pilch, D.S., Levenson, C, Schafer, R.H. (1991) Biochemistry, Vol. 30, pages 6081-6087), incoφorated by reference herein. Triplexes formed by d(C3T4C3).2[d(G3A4G3)] (SEQ ID NO: 17, SEQ ID NO: 18) and d(C3T4C3).2[d(GGNGNA4GNGNG)] (SEQ ID NO: 17, SEQ ID NO: 19) were analyzed by melting experiments. Results are shown in Table 5. The substitution of four guanines for 8-aminoguanines changes ΔG of duplex to random coil transition from -12.6 kcal/mol to -10 kcal/mol (a decrease of 2.6 Kcal/mol). On the contrary, the same substitution changes ΔG of triplex to random coil transition from -26.3 kcal/mol to -28.4 kcal/mol (an increase of 2.1 Kcal/mol). We conclude that 8-aminoguanine destabilizes duplex but stabilizes type II triplex.
Table 5: Thermodynamic parameters of the triplex and the duplex. Data obtained in lOmM sodium cacodylate, 50 mM MgCl2 and 0.1 mM EDTA at pH 7.3.
Figure imgf000032_0001
'natural duplex: d(C3T4C3).d(G3A4G3) (SEQ ID NO: 17, SEQ ID NO: 18); natural triplex d(C3T4C ).2[d(G3A4G3)] (SEQ ID NO: 17, SEQ ID NO: 18
28-aminoG duplex: d(C3T4C3). d(GGNGNA4GNG1 ) (SEQ ID NO: 17, SEQ ID
NO: 19); 8-aminoG triplex d(C3T4C3).2[d(GGNGNA4GNGNG)] (SEQ ID NO: 17, SEQ ID NO: 19)
ΔG25 refers to the standard free energy change at 25 °C.
We conclude that 8-aminoguanine stabilizes purine: pyrimidine: purine triplex. These triplexes are formed at physiological pH. 8-Aminoadenine stabilizes type II triplexes if Hoogsteen strand is made out of G and T bases. Haiφins carrying 8- aminoguanines bind polypyrimidine targets by triplex formation and triplexes are stable at physiological pH.
Preparation of haiφins containing 8-aminopurines
Oligonucleotides were prepared on an automatic Applied Biosystems 392 DNA synthesizer. The parallel-stranded haiφins were prepared using methods known by those skilled in the art. 5'-5' Haiφins (R-22 derivatives) were prepared in three steps. First, the pyrimidine part was prepared using reversed C and T phosphoramidites and reversed C-support (linked to the support through the 5' end). Second, a linker, such as for example but not limited to, a hexaethyleneglycol linker, was added using a commercially available phosphoramidite. Third, the purine part carrying the modified 8-aminopurines was assembled using standard phosphoramidites for the natural bases and the 8- aminopurine phosphoramidites. The phosphoramidites of 8-aminoadenine, 8- aminoguanine and 8-aminohypoxanthine were prepared using methods known by those skilled in the art. For the preparation of 3 '-3' haiφins (B-22 derivatives), a similar approach was used. In this case, the purine part was assembled first, followed by the hexaethyleneglycol. The pyrimidine part was the last to be assembled using reversed phosphoramidites. The phosphoramidite of protected 8-amino-2'-deoxyinosine was dissolved in dry dichloromethane to yield a 0.1 M solution. The remaining phosphoramidites were dissolved in dry acetonitrile (0.1 M solution). Oligonucleotides containing natural bases were prepared using commercially available chemicals and following standard protocols. After the assembly of the sequences, oligonucleotide- supports were treated with 32% aqueous ammonia at 55 °C for 16 h (hour) except for oligonucleotides bearing 8-aminoguanine. In this case, a 0.1 M 2-mercaptoethanol solution in 32% aqueous ammonia was used and the treatment was extended to 24 h at 55 °C. Ammonia solutions were concentrated to dryness and the products were purified by reversed-phase HPLC. Oligonucleotides were synthesized on a 0.2 μmol scale and with the last DMT group at the 5' end (DMT on protocol) to facilitate reversed-phase purification. All purified products presented a major peak, which was collected. Yields (OD units at 260 nm after HPLC purification, 0.2 μmol) were between 5-10 OD. HPLC conditions: HPLC solutions were as follows. Solvent A: 5% ACN in 100 mM triethylammonium acetate pH 6.5 solvent B: 70% ACN in 100 mM triethylammonium acetate pH 6.5. Columns: PRP-1 (Hamilton), 250 x 10 mm. Flow rate: 3ml/min. A 30 min linear gradient from 10-80% B (DMT on) or a 30 min linear gradient from 0-50% B (DMT off).
Binding of haiφins to target sequences by melting experiments.
Melting experiments with triple helices were performed as follows. Solutions of equimolar amounts of haiφins and the target Watson-Crick pyrimidine strand (11-mer) were mixed in 0.1 M sodium phosphate/citric acid buffer of pH ranging from 5.5 to 7.0 with or without NaCl or MgCl2. The DNA concentration was determined by UV absorbance measurements (260 nm) at 90 °C, using for the DNA coil state the following extinction coefficients: 7500, 8500, 12500, 12500, 15000 and, 15000 M"1 cm"1 for C, T, G, 8-amino-G, A and, 8-amino-A, respectively. The solutions were heated to about 90 °C, allowed to cool slowly to room temperature, and stored at about 4°C until UV was measured. UV absoφtion spectra and melting experiments (absorbance vs temperature) were recorded in 1 cm path-length cells using a spectrophotometer, with a temperature controller and a programmed temperature increase rate of 0.5 °C /min. Melts were run on duplex concentration of 4μM at 260 nm. The samples used for the thermodynamic studies were prepared in a similar way, but melting experiments were recorded at 260 nm and using 0.1, 0.5 and 1 cm path-length cells.
Thermodynamic data were analyzed using methods known by those skilled in the art. Melting curves were obtained at concentrations ranging from 0.5 to 25 μM of triplex. The melting temperatures Tm were measured at the maximum of the first derivative of the melting curve. The plot of 1/Tm versus InC was linear. Linear regression of the data gave the slope and the y-intercept, from which ΔH, and ΔS were obtained. The free energy was obtained from the standard equation: ΔG = ΔH -TΔS.
Binding of haiφins to target sequences by gel-shift experiments.
The binding of haiφins to their polypyrimidine targets was analyzed by gel retardation assays. The following targets were studied: WC-1 l mer: TCT CCT CCT TC3' (SEQ ID NO: 16) and T31-PYR: 5' CGA GTC ATT GTC TCC TCC TTC AGT CAT CGA G 3'. (SEQ ID NO: 20).
Either the target oligonucleotides or the haiφins were radioactively labeled at the 5' end by T4 polynucleotide kinase and [γ-32P]-ATP with 35-50 μmol of the oligonucleotide dissolved in 20 μl of kinase buffer. After incubation at 37 °C for 45 min (minutes), the solution was heated to 70 C for 10 min to denature the enzyme and the solution was cooled to room temperature. 60 μl of 50 mM potassium acetate in ethanol was added to the solution and the mixture was left at -20 °C for at least 3 h. The mixture was centrifuged at 4 °C for 45 min (14000 φm) and the supernatant was removed. The pellet was washed with 60 μl of 80% ethanol and centrifuged for 20 min at 4 °C. The supernatant was removed and the pellet was dissolved in 0.2 ml of water.
The radiolabelled target was incubated with the haiφins in 0.1 M sodium phosphate/citric acid buffer of pH ranging from 5.5 to 7.0 at room temperature for 30-60 min. The haiφins were added in increasing amounts from 2 to 200 molar equivalents. After incubation, the mixtures were analysed by 15% polyacrylamide gel electrophoresis at room temperature using the same buffer as for the incubation: 0.1 M sodium phosphate/citric acid buffer of pH ranging from 5.5 to 7.0. The formation of the triplex was monitored by the appearance of a radioactive band with less mobility than the band corresponding to the target alone.
Experiments carried out with radiolabelled haiφins were performed in a similar way. In this case, increasing amounts from 2 to 200 molar equivalents of target oligonucleotide were added to the haiφin. Circular Dichroism
Oligonucleotides were dissolved in 100 mM phosphate buffer pH 6.0, 50 mM sodium chloride and 10 mM magnesium chloride. The equimolar concentration of each strand was 4-5 μM. The solutions were heated to about 90°C, allowed to cool slowly to room temperature and stored at about 4 °C until CD was measured. The CD spectra were recorded on a Jasco J-720 spectropolarimeter attached to a Neslab RP-100 circulating water bath in 1 cm path-length quartz cylindrical cells. Spectra were recorded at room temperature using a 10 nm/min scan speed, a spectral band width of 1 nm and a time constant of 4 s. CD melting curves were recorded at 280 nm using a heating rate of 20°C/h and a scan speed of 100 nm/min. Al the spectra were subtracted with the buffer blank, normalized to facilitate comparisons and noise-reduced using Microcal Origin 5.0 software.
NMR spectroscopy
An equimolar mixture of haiφin d(3'-AG AN GG AN GGA AG-5,-(EG)6-5'-CTT CCT CCT CT-3') (AN=8-amino-A) (SEQ ID NO: 3, SEQ ID NO: 2) and WC-1 lmer: 5TCT CCT CCT TC3' (SEQ ID NO: 16) was prepared in 250 μl of 9:1 H2O/D2O, 25mM sodium phosphate buffer and 100 mM NaCl. The pH was adjusted by adding small amounts of concentrated HC1. The final oligonucleotide concentration was around 1 mM. Spectra were acquired in a Bruker AMX spectrometer operating at 600 MHz and processed with the UXNMR software. Water suppression was performed using a jump- and-return pulse sequence with null excitation in the water signal. All experiments were carried out at 5 °C. Molecular Modeling
Two types of calculations were made to test whether parallel-stranded haiφins behave as a template for triplex formation: i) quantum mechanics, and ii) classical molecular dynamics.
Quantum mechanical calculations. The energy of the Watson-Crick hydrogen bonding of adenine (or 8-aminoadenine) and thymine, and guanine (or 8-aminoguanine) and cytosine was computed at the B3LYP/6-31G(d) level for the isolated purines, and for the preformed Hoogsteen dimer adenine (or 8-aminoadenine)-thymine or guanine (or 8- aminoguanine)-cytosine+ (Fig. 14). The geometries of monomers (A, AN , G, GN, C, T and C+), dimmers (A-T, A.T, AN-T, AN.T, G-C+' GN-C+, G.C and GN C), and trimers (T- A.T, T-AN.T, C+-G.C, and C+-GN.C) were fully optimized at the B3LYP/6-31G(d) level of theory (Watson-Crick base pair is indicated with a dot, Hoogsteen base pair is indicated with a dash). Optimized geometries were subjected to frequency analysis. Basis-set supeφosition errors (BSSE) were corrected following Boys & Bernardi.
Molecular dynamics. Trajectrories for poly d(T-A.T), poly d(T-A) and poly(A.T) were obtained by classical molecular dynamics. Starting structures for our simulations were surrounded by cations to achieve neutrality, hydrated (around 2-3 thousand molecules), optimized, thermalized and equilibrated following standard multistage protocol as known by those skilled in the art. Simulations were carried out for 1.5 ns at constant pressure and temperature (P=l atm., T=298°K) in periodic boundary conditions using the particle mesh Ewald technique (PBC-PME). Only the last 1 ns of the trajectories were considered for the analysis. SHAKE was used to constrain all the bonds at optimum lengths, which allowed us to use a 2 fs. time step for integration of Newton's laws. TIP3P and AMBER-98 force-field, supplemented with specific parameters for protonated cytosine and 8-aminopurines were used to describe molecular interactions. Quantum mechanical calculations were made using the Gaussian-94 computer program. Molecular dynamic simulations were performed using the AMBER-95 suite of programs. Structure of the oligonucleotide derivatives.
The binding properties of haiφins carrying 8-aminoadenine (AN), 8- aminoguanine (G ) and 8-aminohypoxanthine (I ) connected head-to-head to the Hoogsteen pyrimidine strand were studied. The sequences of the oligonucleotides are shown in Figure 15. The target DNA sequence comprises a triplex characterized by Xodo et al.. Here, the polypyrimidine Hoogsteen strand was linked to the Watson-Crick polypurine strand.
The first group of haiφins (R-22 (SEQ ID NO: 1, SEQ ID NO: 2) R-22A (SEQ ID NO: 3, SEQ ID NO: 2) R-22G (SEQ ID NO: 4, SEQ ID NO: 2) R-22I (SEQ ID NO: 5, SEQ ID NO: 2) are parallel-stranded and connected through their 3' ends with a hexaethyleneglycol linker [(EG)6]. They contain 22 bases and two purines replaced by the corresponding 8-aminopurines. In haiφin R-22A (SEQ ID NO: 3, SEQ ID NO: 2) two adenines are replaced by two 8-aminoadenines (A ); in haiφin R-22G (SEQ ID NO: 4, SEQ ID NO: 2)two guanines are replaced by two 8-aminoguanines (G ) and in haiφin R-22I (SEQ ID NO: 5, SEQ ID NO: 2), two guanines are substituted by two 8- aminohypoxanthines (IN). Haiφin R-22 (SEQ ID NO: 1, SEQ ID NO: 2) is a control sequence that contains only the natural bases without modification. The number of modified bases in each haiφin was selected to optimize stability with a minimum number of modified bases, as described elsewhere.
The second group of haiφins B-22 (SEQ ID NO: 1, SEQ ID NO: 2) B-22 A (SEQ ID NO: 3, SEQ ID NO: 2) B-22G (SEQ ID NO: 4, SEQ ID NO: 2) have a similar composition but the polypurine and the polypyrimidine parts are connected through their 5' ends with a hexaethyleneglycol linker [(EG)6]. In addition, a haiφin bearing two 8- aminoguanines and two 8-aminoadenines was prepared (B-22AG (SEQ ID NO: 34, SEQ ID NO: 2) to test whether the stabilizing properties of the two 8-aminopurines are additive. A control oligonucleotide (B-22A control (SEQ ID NO: 3, SEQ ID NO: 8)) with the same sequence in the polypurine part as B-22A (SEQ ID NO: 3, SEQ ID NO: 2) but a random polypyrimidine sequence was prepared. Finally, the oligomers B- 22AMMT (SEQ ID NO: 21, SEQ ID NO: 22), B-22AMMC (SEQ ID NO: 21, SEQ ID NO: 2), B-22AMMG (SEQ ID NO: 21 , SEQ ID NO: 23), B-22AMMA (SEQ ID NO: 21 , SEQ ID NO: 24), B-22AMMpd (SEQ ID NO: 21), B-22AMMCA (SEQ ID NO: 25, SEQ ID NO: 2), B-22AMMTA (SEQ ID NO: 25, SEQ ID NO: 22), B-22AMMGA (SEQ ID NO: 25, SEQ ID NO: 23), B-22AMMAA (SEQ ID NO: 25, SEQ ID NO: 24) and B- 22AMMpdA (SEQ ID NO: 25) were prepared to study the effect of an interruption on the stability of the triple helix. In these haiφins, two adenines are replaced by two 8- aminoadenines. A pyrimidine (C or T) is located in the middle position of the purine part, and each of the natural bases and an abasic site model compound (propanediol, pd) are located in the corresponding position at the Hoogsteen strand.
A third group of oligomers (B-22ALT1 (SEQ ID NO: 3, SEQ ID NO: 26), B- 22ALT2 (SEQ ID NO: 27, SEQ ID NO: 2), B-22ALGA (SEQ ID NO: 28, SEQ ID NO: 2), B-22ALTG (SEQ ID NO: 29, SEQ ID NO: 2) and B-22N) have the same nucleotide sequence as B-22A but the loop between the polypurine and polypyrimidine parts is made out of nucleotides (-TTTT-, -GGAGG-, -CTTTG-) instead of the hexaethyleneglycol bridge.
Thermal stability of the triplex formed by haiφins linked by 3 '-3' bonds.
The relative stability of triple helices formed by R-22 haiφin derivatives and the polypyrimidine target sequence (WC-1 lmer (SEQ ID NO: 16)) was measured spectrophotometrically at various pHs (pH 4.5-7.0). In almost all cases, one single transition was observed with a hyperchromicity around 25% at acidic pH and 20% at neutral pH. The melting curve was assigned to the transition from triple helix to random coil. Exceptionally, the melting curve of the triplex R-22I: WC-1 lmer (SEQ ID NO: 5, SEQ ID NO: 2, SEQ ID NO: 16) at about pH 5.5 and 6 showed two pH-dependent transitions. When A and G were replaced by 8-aminoadenine (AN) and 8-aminoguanine (GN) in the triple helix, this was greatly stabilized (10-18°C in the range from about pH 4.5 to pH 7.0, Table 6). When guanine was replaced by 8-aminohypoxanthine (I ) triple helix stability increased only slightly at acidic pH, but the triplex containing I maintained its stability at neutral pH while the unmodified triplex stability rapidly decreased. To test whether transition was due to triple helix formation, melting curves were obtained with haiφins (R-22 (SEQ ID NO: 1, SEQ ID NO: 2) R-22A (SEQ ID NO: 3, SEQ ID NO: 2) R-22G (SEQ ID NO: 4, SEQ ID NO: 2) R-22G (SEQ ID NO: 5, SEQ ID NO: 2) alone, in the absence of the polypyrimidine target sequence (WC-11 mer) (SEQ ID NO: 16). A single transition was also observed but at lower temperature and with a hyperchromicity around 10-15%, indicating that the transition observed with the WC- 1 lmer (SEQ ID NO: 16) (triple helix) differs from that observed without the WC-1 lmer (SEQ ID NO: 16). The transition observed in the haiφins alone corresponds to the parallel duplex to random coil transition.
Haiφins linked by 3 '-3' bonds versus haiφins with 5'-5' linkages
In addition to the haiφins linked by 3 '-3' bonds (R-22 derivatives), haiφins linked by 5 '-5' bonds (B-22 derivatives) were prepared. The relative stability of triple helices formed by the B-22 oligonucleotide derivatives and the polypyrimidine target sequence (WC-1 lmer) (SEQ ID NO: 16) was measured. As described herein, one single transition was observed with a hyperchromicity around 25%, which was assigned to the melting of the triple helix. Replacement of A by 8-aminoadenine (AN) and guanine by 8- aminoguanine (GN) in triple helix greatly stabilized the triple helix (Table 7). Moreover, when the melting curves of the haiφins were analyzed without the target WC-1 lmer (SEQ ID NO: 16), the parallel structure was stabilized by the presence of 8- aminopurines. At acidic pH triplexes formed by both types of haiφins have similar stability. At neutral pH haiφins linked by 3 '-3' bonds (R-22 derivatives) form more stable triplexes than haiφins linked by 5'-5' bonds (B-22 derivatives). Nevertheless, the increase in stability due to 8-aminopurines was similar in both systems.
Next, we examined whether the stabilization properties of 8-aminoadenine and 8- aminoguanine are additive. A haiφin with two 8-aminoadenines and two 8- aminoguanines substitutions was prepared (B22AG) (SEQ ID NO: 34, SEQ ID NO: 2). Melting curves were obtained with the appropriate haiφin and the target WC-1 lmer at pHs between 4.5-7.0, 0.1 M sodium phosphate, citric acid, 1 M NaCl. We found that the stabilization properties of the 8-aminopurines are additive (Table 7). For example, at pH 6.0 the addition of the two 8-aminoguanines and two 8-aminoadenines raises the melting temperature by 20 °C, whereas two 8-aminoadenines induce an increase of 6 °C, and two 8-aminoguanines a rise of 14 °C.
Role of the Hoogsteen strand on the triplex formation of haiφins
The role of the Hoogsteen strand was further investigated. We prepared a haiφin probe of the same purine sequence, but with two 8-aminoadenine substitutions and a non- complementary pyrimidine strand. This oligonucleotide (named B-22A control (SEQ ID NO: 3, SEQ ID NO: 8)) can only form Watson-Crick interactions with the target sequence (WC-1 lmer (SEQ ID NO: 16)).
When the Hoogsteen strand is replaced by a non-complementary sequence, the structure of the parallel duplex is lost, as revealed by the disappearance of the transition observed when the melting curve is obtained without the target WC-1 lmer (SEQ ID NO: 16) (Table 8).
The transitions observed with the duplexes formed by B22-A control: WC-1 lmer (SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 16) showed lower Tm and hyperchromicity. The hyperchromicity associated with the transition of the duplex formed by B-22A control: WC-1 lmer (SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 16) was 11%, which is indicative of a duplex-to-single-strand transition.
The transitions observed with the complex formed by B-22A: WC-1 lmer (SEQ ID NO: 3, SEQ ID NO: 2, SEQ ID NO: 16) showed a 22% hyperchromicity, indicating a triplex-to-single-strand transition. The difference between the Tm of the B-22A control duplex and B-22A triplex is the gain obtained by the addition of the Hoogsteen strand. At about pH 6.0, this difference is of 11 °C (1.0 °C per base) and at pH 5.5, it is of 16°C (1.4 °C per base).
Salts effects on triplex stability.
Next, we studied the effect of NaCl Mg C12 and spermine on the stability of triplexes at pH 6.0. (Figure 21). We used the triplex formed by the haiφin B-22A (SEQ ID NO: 3, SEQ ID NO: 2) and the WC-1 lmer (SEQ ID NO: 16), as well as the triplex formed by the haiφin B-22G (SEQ ID NO: 4, SEQ ID NO: 2) and WC-1 lmer (SEQ ID NO: 16). For NaCl, the buffer used was 0.1 M sodium phosphate-citric acid pH 6.0. For MgCl2 and spermine, the buffer used was 0.1 M sodium phosphate pH 6.0.
Sodium chloride had a slight stabilization effect (from about 49 °C (without NaCl) to 51 °C (1 M NaCl)). Low concentrations of MgCl2 stabilize the triplex, e.g. the melting temperature of triplexes B-22G: WC-1 lmer (SEQ ID NO: 4, SEQ ID NO: 2, SEQ ID NO: 16) and B-22A: WC-1 lmer increased by 5 degrees from no MgCl2 to 10 mM MgCl2. From lOmM to 50 mM MgCl2, the increase in melting temperature is nil or lower than one degree. In a preferred embodiment of this invention the presence of magnesium is employed for enhancing the stability of the triplex, including wherein the concentration of magnesium is more preferably lOmM. Spermine does not generally affect the stability of triplexes.
Presence of Interruptions in the polypyrimidine target sequence.
We also assessed the effect of an interruption on the polypyrimidine track of the target. To this end, two polypyrimidine targets with a purine in the middle of the sequence were prepared (si ,-MMG: 5TCT CCT GCT TC3' (SEQ ID NO: 30) and s, ,- MMA: 5TCT CCT ACT TC3') (SEQ ID NO: 31). Next, haiφins carrying the four natural bases and an abasic model compound, such as for example but not limited to pd (propanediol), at the Hoogsteen position were prepared (Fig. 15). Moreover, two 8- aminoadenines were introduced in the purine part. These oligomers have the complementary base at the Watson-Crick position opposite to the interruption and a T, C, G, A or pd on the Hoogsteen strand opposite to the interruption. Melting curves were obtained at pH 6.0, 0.1 M sodium phosphate, 1 M NaCl.
The melting temperatures of triplexes carrying a guanine on the polypyrimidine target instead of a cytosine are shown in Table 9. The haiφin with a cytosine in the Hoogsteen pyrimidine part gave the best binding. Haiφin B-22AMMC (SEQ ID NO: 21, SEQ ID NO: 2) bound to its target (si i-MMG) (SEQ ID NO: 30), although the Tm decreased by 4 °C (47 °C B-22AMMC: SM-MMG (SEQ ID NO: 21, SEQ ID NO: 2, SEQ ID NO: 30) compared with 51 °C B-22A: WC-1 lmer (SEQ ID NO: 3, SEQ ID NO: 2, SEQ ID NO: 16). The binding of the new haiφin to its new target is very selective as revealed by the marked decrease in the Tm of the triplex B-22AMMC (SEQ ID NO: 21, SEQ ID NO: 2) with the old target (33 °C B-22AMMC: WC-1 lmer (SEQ ID NO: 21, SEQ ID NO: 2, SEQ ID NO: 16) versus 47 °C B-22AMMC: s, ,-MMG (SEQ ID NO: 21, SEQ ID NO: 2, SEQ ID NO: 30).
A similar result was obtained when an adenine was introduced in the polypyrimidine target (Table 10). In this case, the best base at the Hoogsteen position was G. The preference of G to bind to A.T interruptions and the preference of C to bind G.C interruptions are well known by those skilled in the art. However, the interruptions in parallel haiφins are easier to overcome because of the purine Watson-Crick part. Thus parallel haiφins, especially haiφins carrying 8-aminopurines, can be redesigned to bind efficiently to polypyrimidine targets carrying a short interruption.
Role of the loop on triplex stability.
Finally, the role of the loop on the stability of the triplex was analysed by preparing derivatives of B-22A with various loops. In addition to the hexaethyleneglycol linker, the nucleotide loops -TTTT-, -GGAGG-, and -CTTTG- were studied. Two tetrathymine loops were prepared: one oppositely oriented to the purine strand (B- 22ALT10 (SEQ ID NO: 3, SEQ ID NO: 26) and the second in the same orientation as the purine strand (B-22ALT2 (SEQ ID NO: 27, SEQ ID NO: 2)). The GGAGG and CTTTG loops were in the same orientation as the purine strand (B-22ALGA (SEQ ID NO: 28, SEQ ID NO: 2) and B-22ALTG (SEQ ID NO: 29, SEQ ID NO: 2). The melting curves of triplexes formed by haiφins and target WC-1 lmer (SEQ ID NO: 16) were obtained at pH 6.0, 0.1 M sodium phosphate, 1 M NaCl. Melting temperatures are set forth below.
B-22A 3'AGAN GGAN GGAAG5' -(EG)6- 5'"CTTCCTCCTCT3'- Tm=51 °C
(SEQ ID NO: 3, SEQ ID NO: 2)
B-22ALT1 3AGAN GGAN GGAAG5' -5TTTT-CTTCCTCCTCT3' Tm=57°C
(SEQ ID NO: 3, SEQ ID NO: 26) B-22ALT2 3AGANGGANGGAAG-TTTT5'-5CTTCCTCCTCT3' Tm=55°C
(SEQ ID NO:27, SEQ ID NO: 2)
B-22ALGA 3AGANGGANGGAAG-GGAGG5'-5CTTCCTCCTCT3' Tm=54°C (SEQ ID NO: 28, SEQ ID NO: 2)
B-22ALTG 3AGANGGANGGAAG-CTTTG5'-5'CTTCCTCCTCT3' Tm=54°C
(SEQ ID NO:29, SEQ ID NO: 2)
Use of nucleotide loops is more preferable for the stability of the triplex. Best results were obtained with the reversed TTTT linker (haiφin B-22 ALT 1 (SEQ ID NO: 3, SEQ ID NO: 26), ΔTm 6 °C), followed by the TTTT linker (haiφin B-22ALT2 (SEQ ID NO: 27, SEQ ID NO: 2), ΔTm 4 °C) and the GGAGG and CTTTG linkers (haiφin B- 22ALGA (SEQ ID NO:28, SEQ ID NO: 2), B-22ALTG (SEQ ID NO: 29, SEQ ID NO: 2), ΔTm 3°C). While not wishing to be bound by a particular theory, we suggest that the enhanced stability found with haiφins having nucleotide loops is due to the high salt concentrations used in the melting experiments. When melting experiments were performed at lower salt concentrations, it was found that the differences between haiφins with the hexaethyleneglycol linker and nucleotide linkers were less pronounced.
Molecular modeling
The formation of a triple helix by the binding of a Hoogsteen parallel-stranded duplex to a single-stranded oligonucleotide is guided by the formation of Watson-Cricklike H-bonds. The presence of the complementary Hoogsteen base may alter the magnitude of the Watson-Crick interaction. Results demonstrate that no dramatic changes can be expected in the Watson-Crick interaction by the presence of the Hoogsteen base. Thus, the binding of T to the Hoogsteen A-T (or AN-T) dimer is less than 1 kcal/mol worse than the binding to A and the binding of C to the protonated Hoogsteen dimer G-C (or GN-C) is 2-3 kcal/mol better than the binding to an isolated G. The presence of 8-aminopurines might slightly decrease in the intensity of Watson-Crick interactions, but without affecting the formation of triplexes from Hoogsteen duplexes, as reported elsewhere. Calculations suggest that a pre-organized Hoogsteen duplex gives rise to a triplex. However, the isolated Hoogsteen duplex may not be sufficiently pre-organized. The magnitude of the pre-organization work can be estimated by the mean root mean square deviation (RMSd) between the structures sampled during the trajectories of the isolated duplex and the average structure of the duplex in the triplex structure. Figure 16 displays the RMSd between the trajectories of both Watson-Crick and Hoogsteen duplexes and the average structures of both duplexes when incoφorated inside the triplex (average structure obtained by analysis of the MD trajectory of the triplex). The RMSd between the free Hoogsteen and the triplex-preorganized Hoogsteen duplex is only around 1 A, near the thermal noise of the simulation, as revealed by the fact that the RMSd between the trajectories of the isolated duplexes (Hoogsteen or Watson-Crick) and the corresponding MD-averaged structures is about 0.8 A. In contrast, the RMSd between the free Watson-Crick duplex and the triplex-preorganized Watson-Crick duplex is about 2 A. MD simulations strongly suggest that the free parallel Hoogsteen duplex is better pre-organized to form a triplex than the Watson-Crick antiparallel duplex. This finding agrees with the CD data, which show that the spectra changes more in the transition from a Watson-Crick duplex to triplex than in the transition from a Hoogsteen duplex to the corresponding triplex. Therefore, it will be appreciated by those skilled in the art that the Hoogsteen parallel haiφins of this invention are very efficient templates for the formation of triple helices.
Thermodynamic studies
The dependence of the triplex to random coil transition on DNA concentration was studied on several triplexes (Table 12). In all cases, the melting temperatures of the triplex to random coil transitions decrease with the concentration, as expected for a bimolecular transition. The plot of 1/Tm versus In concentration was linear, giving a slope and a y-intercept from which ΔH, ΔS and ΔG were obtained (Table 12).
The ΔG for the triplex dissociation was -58 kJ/mol for the unmodified triplex, - 76 kJ/mol for the triplexes carrying two AN and -88 kJ/mol for the triplex carrying two GN. Comparison between these values gives a difference in ΔG of approximately 17 kJ/mol for two A→ AN substitutions (7.5 kJ/mol, 2.0 Kcal/mol per substitution). For the triplex carrying GN, the difference in ΔG is 30 kJ/mol (15 kJ/mol, 3.6 Kcal/mol per substitution). Compared with other base analogues, these are among the highest triplex stabilization properties reported for a modified base, although we measured the stability of Hoogsteen and Watson-Crick base pairs jointly. Gel-shift assays
The binding of haiφins to their targets was also analyzed by gel-shift experiments. The target was labeled radioactively with [7- Pj-ATP and polynucleotide kinase and increasing amounts of the haiφins were added. After incubation at room temperature from about 30 min-1 hr in a citric-phosphate buffer pH 6 of 100 mM Na+ ionic strength, the mixtures were analyzed by polyacrylamide gel electrophoresis. The formation of the triplex was monitored by the appearance of a radioactive band with less mobility than the band corresponding to the target alone (Fig. 17).
Figure 17 shows the binding of haiφins (SEQ ID NO: 1, SEQ ID NO: 2) R-22A (SEQ ID NO: 3, SEQ ID NO: 2) and R-22G (SEQ ID NO: 4, SEQ ID NO: 2) to the single-stranded target WC-11 mer (5TCTCCTCCTTC3') (SEQ ID NO: 16). In all cases, a new radioactive band with lower mobility appeared. The relative intensity of this new band is consistent with the melting experiments. For example, the haiφins carrying the modified purines (A and GN) completed the formation of the new band at a lower concentration (0.02-0. lμM, Fig. 17) than the unmodified haiφin (0.5 μM, Fig. 17). The haiφin carrying G also showed better binding properties than the haiφin carrying AN, in agreement with melting experiments. Moreover, binding is more efficient at pH 5.0 than at pH 7.0. We also found that, the binding of haiφin B-22A control, (SEQ ID NO: 3, SEQ ID NO: 8) which had a non-functional Hoogsteen strand, with its target WC-1 lmer (SEQ ID NO: 16) gave a low mobility band, but at concentrations 100 fold higher than haiφin B-22A (SEQ ID NO: 3, SEQ ID NO: 2). All these data indicate that the lower mobility bands detected with haiφins correspond to the triplex.
The binding of haiφin R-22G (SEQ ID NO: 4, SEQ ID NO: 2) to the single- stranded target WC-1 lmer (SEQ ID NO: 16) and a double-stranded target formed by the WC-1 lmer (5TCTCCTCCTTC3) (SEQ ID NO: 16) labeled and its complementary purine strand (3' AGAGGAGGAAG5') (SEQ ID NO: 1) was also examined. (Figure 22). When the labeled oligonucleotide is the target pyrimidine strand (WC-11 mer) (SEQ ID NO: 16) a new radioactive band with lower mobility appear in both single and double- stranded targets, revealing the formation of the triplex. In contrast, when the labeled oligonucleotide is the purine strand, no new band is observed, indicating that haiφins only bind to the target pyrimidine strand.
In addition, the binding of haiφins to a second set of single- and double-stranded DNA targets longer than about 11 bases were studied. The double-stranded DNA target had 31 base pairs containing an 11 base pyrimidine track complementary to the haiφins described in this study at the middle of the molecule:
T31 5' CGAGTCATTGTCTCCTCCTTCAGTCATCGAG 3' (SEQ ID
NO: 32)
T3, compl. 3' GCTCAGTAACAGAGGAGGAAGTCAGTAGCTC 5' (SEQ ID NO: 33) The binding of haiφins to single-stranded targets (T3ι) (SEQ ID NO: 32) was clearly detected (Fig. 18). In contrast, haiφins did not bind to double-stranded DNA. While not wishing to bound by a particular theory, the differences in binding on double- stranded DNA targets may be due to the fact that small duplexes contain a large population of single-stranded molecules in equilibrium with the double-stranded form. The haiφin probably binds the single-stranded form, thus displacing the double-stranded form to the triplex. In longer duplexes, single-stranded forms are scarce, and so the haiφin has to bind and open the duplex to displace the complementary strand. For the haiφins described herein, this phenomenon may be very slow or impracticable.
When the binding experiment was performed by addition of excess of cold target T3ι (SEQ ID NO: 32) to radio-labelled haiφin (R22G) (SEQ ID NO: 4, SEQ ID NO: 2), triplex formation was also observed (Fig. 5). Radiolabelled haiφin (R22G) (SEQ ID NO: 4, SEQ ID NO: 2) alone showed two bands in native gels. The fast running band showed the mobility expected for an oligonucleotide of 22 bases. The slow running band had the mobility of a dimer. It is believed that this second band corresponds to the parallel dimer. Thus parallel haiφins are in equilibrium between the intramolecular haiφin and the intermolecular dimer. When the polypyrimidine target was added, the mobility of the dimer varied enough to show complete formation of the band corresponding to the triplex. Formation of the triplex of the parallel dimer was not observed. Circular Dichroism
To confirm triplex formation and gain more information on the structure of the haiφins, circular dichroism (CD) spectra were obtained. This technique measures the differences in the absoφtion of polarized light. Changes in the conformation of nucleic acids can be detected by CD and comparison of the spectra with the spectra of known structures suggests the presence of a particular conformation. The appearance of an intense negative short- wavelength (210-220 nm) band in the CD spectra indicates the formation of a triple-stranded complex. The CD spectra of the triplex formed between the haiφins B-22 (SEQ ID NO: 1, SEQ ID NO: 2) B-22A (SEQ ID NO:3, SEQ ID NO:
2) and B-22G (SEQ ID NO: 4, SEQ ID NO: 2) and their targets as well as the CD spectra of the haiφins alone are shown in Figure 19. In all cases, we observed an intense negative band (near 215 nm) upon binding of the haiφins with the target molecule. The intensity of the negative band correlates with the strength of the interactions because the negative band is more intense with the triplex formed by modified haiφins (B22-A (SEQ
ID NO:3, SEQ ID NO: 2) and B-22G (SEQ ID NO: 4, SEQ ID NO: 2)) which are more stable by melting experiments.
The melting curves of triplexes formed by haiφins B-22A (SEQ ID NO: 3, SEQ
ID NO: 2) and B-22G with their polypyrimidine target (WC-11 mer (SEQ ID NO: 16)) were also analyzed by CD spectrometry. Melting temperatures obtained by CD experiments were similar to temperatures observed by UV absoφtion (53.0 °C for triplex
B-22A: WC-1 lmer (SEQ ID NO: 3, SEQ ID NO: 2, SEQ ID NO: 16), 56.5°C for triplex
B-22G: WC-1 lmer (SEQ ID NO:4, SEQ ID NO: 2, SEQ ID NO: 16) in 50 mM NaCl, lOmM MgCl2> 0.1 M sodium phosphate pH 6.0). (See Figure 23).
NMR Spectra
The imino region of one-dimensional Η-NMR spectra of the triplex formed by haiφin B-22A (SEQ ID NO:3, SEQ ID NO: 2) and polypyrimidine target WC-1 lmer (SEQ ID NO: 16) at two pHs is shown in Figure 20. Most of the expected imino protons signals are clearly observed between 12 and 16 ppm. The presence of four imino signals between 15 and 16.0 ppm clearly indicates that cytosines are protonated. The spectrum is consistent with a triple helix. Most of the features of the exchangeable proton spectra are observed at about pH 6.6, which points to the high stability of the triplex at neutral pH. The lines of the exchangeable protons in this triplex are much narrower than in the isolated B-22 A haiφin (SEQ ID NO:3, SEQ ID NO: 2). The line-broadening in the parallel Hoogsteen haiφin may be due to a conformational or solvent exchange. This dynamic effect is not observed upon triplex formation.
It will be understood by those persons skilled in the art that the present invention shows that the haiφins of this invention bind specific single-stranded polypyrimidine targets via triplex formation. The binding of these haiφins is stronger when they contain 8-aminopurines. 8-Aminoguanine showed the strongest stabilizing effect, followed by 8- aminoadenine. 8-Aminohypoxanthine is more efficient than unmodified haiφin only at neutral pH. The stability of the triplex of this invention formed by haiφins carrying 8- aminopurines is pH-dependent but the interaction of the modified haiφins with their target is so strong that triplexes are observed even at neutral pH on a short model sequence such as for example having about 11 bases. Both 8-aminoadenine and 8- aminoguanine have an additive effect on the stability of the triplex. The loop that connects the homopurine sequence with the homopyrimidine sequence may also have an additional stabilizing effect if it is made of nucleotides.
The modified haiφins may be redesigned to cope with small interruptions in the polypyrimidine target sequence. This offers great potential for applications in the triplex field, especially for single-stranded targets, e.g. in antisense field and RNA detection. The use of 8-aminopurines is also compatible with most of the developments described in the triplex field so we believe that 8-aminopurines will improve any existing methodology based on triplex formation. Table 6: Melting temperatures* (C) for the triplex formed by R-22 derivatives and WC- Ilmer. SEQIDNO: i6
WC-llmer 5' TCTCCTCCTTC 3' R22: a=A, g=G SEQIDNO I, SEQ ID NO.2
SEQIDNO: 16 R22A: a=A ,N , g=G SEQ ID NO 3. SEQ ID NO. ττ . . - AGagGaσGAAG 5'
Haiφin ( ^
R22G: a=A, g=G SEQ ID NO.4, SEQ ID NO: 2
^ TCTCCTCCTTC 5 ' rN
R22I: a=A, g=I SEQ ID NO: 5, SEQ ID NO: 2
Figure imgf000051_0001
*1 M NaCl, 100 mM sodium phosphate citric aci u er.
2SEQIDNO: l.SEQIDNO: 2 •3SEQIDNO: 3, SEQ ID NO: 2 •4SEQIDNO: 4, SEQ ID NO: 2 •5SEQIDNO: 5, SEQ ID NO: 2 6 SEQ ID NO: 16
iaoie 7J -vieiung temperatures* (°C) tor me tπplex formed by ϋ-zi αeπvatives and WC- llmer. SEQIDNO: i6
WC-1 lmer 5 TCTCCTCCTTC 3' B22: a=A, g=G SEQ ID NO. I , SEQ ID NO: 2
SEQ ID NO: 16
Haiφin AGagGagGAAG-x B22A: a=AN, g=G SEQ ID NO: 3, SEQ ID NO: 2 B22G: a=A, g=GN SEQ ID NO.4, SEQ ID NO: 2
TCTCCTCCTTC^ B22AG: a=AN, g=GN SEQ ID NO: 5, SEQ IDNO: 2
Figure imgf000052_0001
2SEQIDNO: l.SEQIDNO: 2 •3SEQIDNO: 3, SEQ ID NO: 2 4SEQ ID NO: 4, SEQ ID NO: 2 5SEQIDNO: 5, SEQ ID NO: 2 6 SEQ ID NO: 16
Table 8; Effect of the Hoogsteen strand.
WC-1lmer 5' TCT CCT CCTTC 3' WC-1 lmer 5' TCT CCT CCTTC 3'
SEQIDNO: 16 „ „ SEQIDNO: 16
3 AGAKGGAKGGAAG ^ 3 « AGAMGGAHGGAAG.
B-22A SEQIDNO: 3. SEQ ID NO: 2 B-22Acontrol SEQ ID NO: 3, SEQ ID NO β )
3' TCT CCT CCTTC J
3 ' CCCCCCTTTTT — ^
Figure imgf000053_0001
lSEQIDNO: 3, SEQ ID NO: 8
2SEQIDNO: 3, SEQ ID NO: 8
•3SEQ ID NO: 3, SEQ ID NO: 2
4SEQID O: 3, SEQ ID NO: 2 •5 SEQ ID NO: 16
Table 9; Melting temperatures of triplex containing one interruption at the polypurine / polypyrimidine track (at pH 6.0, 0.1 M sodium phosphate and citric acid, 1 M NaCl).
WC-1 lmer 5 ' TCT CCT CCTTC 3 Sn-MMG 5 " TCT CCT GCTTC 3 '
SEQ ID NO: 16
3 ' SEQ ID NO: 30 AGAKGGAHXGAAG ~ 3 " AGANGGANXGAAG ~\
Haiφin Haiφin
3 TCT CCT YCTTC . X 3 ' TCT CCT YCTTC
B-22A: X=G, Y=C B-22AMMC: X=C, Y=C SEQ ID NO: 21. SEQ ID NO. 2
SEQ ID NO: 3. SEQ ID NO: 2 B-22AMMT: X=C, Y=T SEQ ID NO: 21. SEQ ID NO: 22 B-22AMMG: X=C, Y=G SEQ ID NO: 21, SEQ ID NO: 23 B-22AMMA SΈQJDKO: I B-22AMMρd
Figure imgf000054_0001
Figure imgf000054_0002
Watson-Crick base pair is indicated with a dot, oogsteen par s indicated with a dash
•1 SEQ ID NO: 3, SEQ ID NO: 2 2 SEQ ID NO: 21, SEQ tt> NO: 2 *3 SEQ ID NO: 21, SEQ ID NO: 22 *4 SEQ ID NO: 21, SEQ ID NO: 23 »5 SEQ ID NO: 21, SEQ ID NO: 24 6 SEQ ID NO: 21
Table 10 -.Melting temperatures of triplex containing one mterruption at the polypurine / polypyrimidine track (at pH 6.0, 0.1 M sodium phosphate and citric acid, I M NaCl).
WC-l lmer 5 TCT CCT CCTTC 3 s,,-MMA TCT CCT ACTTC 3
SEQ ID NO. 16 SEQ ID NO. 31 AGAHGGANXGAAG ~N 3 ' AGANGGANXGAAG
Haiφin Haiφin
3 ' TCT CCT YCTTC . J 3 ' TCT CCT CTTC , B-22A X=G, Y=C B-22AMMTC: X=T, Y=C SEQ >D NOS: 25.2
SEQ ID NO: 3. SEQ ID NO: 2 B-22AMMTT: X^T, Y=T SEQ ID NOS: 25,22 B-22AMMTG: X^T, Y=G SEQ ID NOS: 25.23 B-22AMMTA X«=T, Y=A SEQ roN0S: 25,2 B-22AMMTpd: X=T, Y= dsεo ID NO= 25
Figure imgf000055_0001
*Watson-Cτick base pair is indicated with a dot, Hoogsteen pair is indicated with a dash
1 SEQ ID NO: 3, SEQ ID NO: 2, 2 SEQ ID NO: 25, SEQ ID NO: 2 3 SEQ ID NO: 25, SEQ ID NO: 22
*4 SEQ ID NO: 25, SEQ ID NO: 23
*5 SEQ ID NO: 25, SEQ ID NO: 24 *6 SEQ ID NO: 25 Table 11; Folding processes and associated energies (in kcal mol) computed in the gas phase at the B3LYP/6-31G(d) level of theory. Watson-Crick base pair is indicated with a dot, Hoogsteen base pair is indicated with a dash
Figure imgf000056_0001
Figure imgf000056_0002
Table 12 : Thermodynamic parameters for triplex to random coil transitions in sodium acetate 100 mM (pH 6.0), 50 mM NaCl, 10 mM MgCl2 from the slope of the plot 1/Tm versus In
Figure imgf000057_0001
assumption that ΔHt and ΔSt do not depend on temperature; analysis has been carried out using melting temperatures obtained from denaturation curves; error on Tm is 0.7°C b) at 4 μM triplex concentration
•1 SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 16 2 SEQ ID NO: 3, SEQ ID NO: 2, SEQ ID NO: 16 *3 SEQ ID NO: 4, SEQ ID NO: 2, SEQ ID NO: 16
Whereas, particular embodiments of this invention have been described for puφoses of illustration, it will be evident to those persons skilled in the art that numerous variations of the details of the present invention may be made without departing from the invention as defined in the appended claims and SEQUENCE LISTING.

Claims

We claim:
1. A triplex comprising: a hairpin comprising at least one first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein at least one of said polypurine sequence is complementary to and parallel to said first polypyrimidine sequence, and said polypurine sequence comprising at least one 8-aminopurine; at least one polypyrimidine target sequence, wherein at least one of said polypyrimidine target sequence is complementary to and antiparallel to said polypurine sequence, wherein said polypyrimidine target sequence and said haiφin are bound to each other.
2. The triplex of Claim 1 wherein said polypyrimidine target sequence comprises at least one purine interruption.
3. The triplex of Claim 1 wherein said polypurine sequence of said haiφin comprises at least one pyrimidine interruption.
4. The triplex of Claim 1 wherein said first polypyrimidine sequence of said haiφin comprises at least one purine interruption or an abasic interruption or an abasic model compound interruption.
5. The triplex of Claim 1 wherein said linker is at least one of a hexaethylene glycol, tetrathymine, CTTTG, or GGAGG.
6. The triplex of Claim 1 wherein said 8-aminopurine comprises 8-aminoguanine.
7. The triplex of Claim 1 wherein said 8-aminopurine comprises 8-aminoadenine.
8. The triplex of Claim 1 wherein said 8-aminopurine comprises 8- aminohypoxanthine.
9. A method for preparing a haiφin containing at least one 8-aminopurine comprising: preparing a pyrimidine strand; binding a linker to the 3' end of said pyrimidine strand; preparing a purine strand comprising at least one 8-aminopurine; and preparing said haiφin by binding the 3' end of said purine strand to said linker.
10. A method for preparing a haiφin containing at least one 8-aminopurine comprising: preparing a purine strand comprising at least one 8-aminopurine; binding a linker to the 5' end of said purine strand; preparing a pyrimidine strand; and preparing said haiφin by binding the 5' end of said pyrimidine strand to said linker.
11. A haiφin comprising at least one first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein at least one of said polypurine sequence comprises at least one 8-aminopurine and wherein said polypurine sequence is complementary to and parallel to said first polypyrimidine sequence.
12. A method for stabilizing a triplex comprising: obtaining a triplex comprising a haiφin comprising at least a first polypyrimidine sequence, at least one linker, and at least one polypurine sequence, wherein said polypurine sequence comprises at least one 8- aminopurine; and contacting said triplex with a sodium chloride solution.
13. The method of Claim 12 wherein said sodium chloride solution has a concentration of about 1 M.
14. A method for stabilizing a triplex comprising: obtaining a triplex comprising a haiφin comprising at least a first polypyrimidine sequence, at least one linker, and at least one polypurine sequence wherein said polypurine sequence comprises at least one 8-aminopurine; and contacting said triplex with a magnesium containing solution.
15. The method of Claim 14 including wherein the concentration of said magnesium is not greater than about 10 mM.
16. A triplex comprising: a haiφin comprising at least one first polypyrimidine sequence, at least one linker, and at least one first polypurine sequence wherein said polypurine sequence is complementary to and antiparallel to said first polypyrimidine sequence, and said first polypurine sequence comprising at least one 8- aminopurine; and a target sequence wherein said target sequence is arranged in Hoogsteen orientation with respect to said haiφin.
17. The triplex of Claim 16 wherein said target sequence comprises G and T bases.
18. The triplex of Claim 16, wherein said target sequence comprises G and A bases.
19. An oligonucleotide duplex comprising two complementary oligonucleotide strands aπanged in an anti-parallel Hoogsteen configuration.
20. A method for stabilizing Hoogsteen duplexes comprising: procuring a Hoogsteen duplex comprising at least one purine; and stabilizing said Hoogsteen duplex by substituting at least one 8- aminopurine for at least one of said purine.
21. A method for targeting a single-stranded oligonucleotide comprising: selecting a region on a single-stranded oligonucleotide, said region having either a first polypurine sequence target or a first polypyrimidine sequence target; preparing a haiφin wherein said haiφin comprises a second polypyrimidine sequence and a second polypurine sequence, wherein said second polypurine sequence comprises at least one 8-aminopurine and is complementary to said second polypyrimidine sequence; and targeting said region on said single- stranded oligonucleotide by contacting said haiφin with said first polypurine sequence target or said first polypyrimidine sequence target.
22. The method of claim 21, wherein said single-stranded oligonucleotide is selected from the group consisting of cDNA, mRNA, tRNA, and rR A.
23. A method for targeting DNA comprising: selecting a region on DNA, said region having either a first polypurine sequence target or a first polypyrimidine sequence target; preparing a haiφin wherein said haiφin comprises a second polypyrimidine sequence and a second polypurine sequence, wherein said second polypurine sequence comprises at least one 8-aminopurine and is complementary to said second polypyrimidine sequence; and targeting the region on said DNA by contacting said haiφin with said first polypurine sequence target or said first polypyrimidine sequence target.
PCT/US2003/016520 2002-05-24 2003-05-23 Parallel stranded duplexes of deoxyribonucleic acid and methods of use WO2003100099A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU2003241620A AU2003241620A1 (en) 2002-05-24 2003-05-23 Parallel stranded duplexes of deoxyribonucleic acid and methods of use
EP03731370A EP1507873A4 (en) 2002-05-24 2003-05-23 Parallel stranded duplexes of deoxyribonucleic acid and methods of use
JP2004507539A JP2005527219A (en) 2002-05-24 2003-05-23 Parallel double strands of deoxyribonucleic acid and methods of use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US38329202P 2002-05-24 2002-05-24
US60/383,292 2002-05-24

Publications (1)

Publication Number Publication Date
WO2003100099A1 true WO2003100099A1 (en) 2003-12-04

Family

ID=29584541

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/016520 WO2003100099A1 (en) 2002-05-24 2003-05-23 Parallel stranded duplexes of deoxyribonucleic acid and methods of use

Country Status (5)

Country Link
US (1) US20040029160A1 (en)
EP (1) EP1507873A4 (en)
JP (1) JP2005527219A (en)
AU (2) AU2003241620A1 (en)
WO (1) WO2003100099A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008507297A (en) * 2004-07-26 2008-03-13 エンゾン ファーマシューティカルズ,インコーポレーテッド Optimized interferon beta gene
EP1995327A1 (en) * 2007-05-21 2008-11-26 Humboldt Universität zu Berlin Probe for detecting a particular nucleic acid sequence
WO2011031520A1 (en) * 2009-08-27 2011-03-17 Idera Pharmaceuticals, Inc. Composition for inhibiting gene expression and uses thereof
US8877722B2 (en) 2011-03-25 2014-11-04 Idera Pharmaceuticals, Inc. Compositions for inhibiting gene expression and uses thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003285916A1 (en) * 2002-10-21 2004-05-13 Cygene Laboratories, Inc. Triplex-forming oligonucleotides containing modified purines and their applications
EP4148143A1 (en) * 2021-09-13 2023-03-15 Consejo Superior De Investigaciones Científicas (CSIC) Polypurine reverse hoogsteen hairpins and parallel clamps and their use as biosensors

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000029624A2 (en) * 1998-11-19 2000-05-25 Cygene, Inc. Methods and compositions for detection of nucleic acid sequences and signal amplification
WO2001032924A1 (en) * 1999-10-29 2001-05-10 Cygene, Inc. Compositions and methods of synthesis and use of novel nucleic acid structures

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5200313A (en) * 1983-08-05 1993-04-06 Miles Inc. Nucleic acid hybridization assay employing detectable anti-hybrid antibodies
AU730633B2 (en) * 1996-05-29 2001-03-08 Phillip Belgrader Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
WO1998035012A2 (en) * 1997-02-12 1998-08-13 Chan Eugene Y Methods and products for analyzing polymers
EP1456409B1 (en) * 2001-11-28 2010-02-24 Bio-Rad Laboratories, Inc. Parallel polymorphism scoring by amplification and error correction
WO2004031408A1 (en) * 2002-09-30 2004-04-15 F.Hoffmann-La Roche Ag Oligonucleotides for genotyping thymidylate synthase gene
US7354706B2 (en) * 2003-09-09 2008-04-08 The Regents Of The University Of Colorado, A Body Corporate Use of photopolymerization for amplification and detection of a molecular recognition event
JP2007512811A (en) * 2003-11-10 2007-05-24 インベスチゲン, インコーポレイテッド Methods for preparing nucleic acids for detection

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000029624A2 (en) * 1998-11-19 2000-05-25 Cygene, Inc. Methods and compositions for detection of nucleic acid sequences and signal amplification
WO2001032924A1 (en) * 1999-10-29 2001-05-10 Cygene, Inc. Compositions and methods of synthesis and use of novel nucleic acid structures

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
AVINO ET AL.: "Properties of triple helices formed by parallel-stranded hairpins containing 8-aminopurines", NUCLEIC ACIDS RESEARCH, vol. 30, no. 12, June 2002 (2002-06-01), pages 2609 - 2619, XP002969114 *
See also references of EP1507873A4 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008507297A (en) * 2004-07-26 2008-03-13 エンゾン ファーマシューティカルズ,インコーポレーテッド Optimized interferon beta gene
EP1995327A1 (en) * 2007-05-21 2008-11-26 Humboldt Universität zu Berlin Probe for detecting a particular nucleic acid sequence
WO2008142571A2 (en) * 2007-05-21 2008-11-27 Humboldt-Universität Zu Berlin Probe for detecting a particular nucleic acid sequence
WO2008142571A3 (en) * 2007-05-21 2009-03-12 Univ Berlin Humboldt Probe for detecting a particular nucleic acid sequence
WO2011031520A1 (en) * 2009-08-27 2011-03-17 Idera Pharmaceuticals, Inc. Composition for inhibiting gene expression and uses thereof
CN102712926A (en) * 2009-08-27 2012-10-03 艾德拉药物股份有限公司 Composition for inhibiting gene expression and uses thereof
CN102712926B (en) * 2009-08-27 2015-04-29 艾德拉药物股份有限公司 Composition for inhibiting gene expression and uses thereof
EP2960333A1 (en) * 2009-08-27 2015-12-30 Idera Pharmaceuticals, Inc. Composition for inhibiting gene expression and uses thereof
US8877722B2 (en) 2011-03-25 2014-11-04 Idera Pharmaceuticals, Inc. Compositions for inhibiting gene expression and uses thereof

Also Published As

Publication number Publication date
US20040029160A1 (en) 2004-02-12
EP1507873A4 (en) 2006-12-27
AU2003241620A1 (en) 2003-12-12
AU2009200593A1 (en) 2009-03-05
JP2005527219A (en) 2005-09-15
EP1507873A1 (en) 2005-02-23

Similar Documents

Publication Publication Date Title
Mergny et al. Intramolecular folding of pyrimidine oligodeoxynucleotides into an i-DNA motif
Antao et al. A thermodynamic study of unusually stable RNA and DNA hairpins
Darlow et al. Secondary structures in d (CGG) and d (CCG) repeat tracts
Batey et al. Tertiary motifs in RNA structure and folding
Szabat et al. Parallel‐stranded DNA and RNA duplexes–structural features and potential applications
JP2005517436A5 (en)
AU2009200593A1 (en) Parallel stranded duplexes of deoxyribonucleic acid and methods of use
AU2002345301B2 (en) Parallel, antiparallel, homologous or complementary binding of nucleic acids
CA2422518A1 (en) Quadruplex dna and duplex probe systems
Coma et al. Strand displacement of double-stranded DNA by triplex-forming antiparallel purine-hairpins
Lacroix et al. Chemical modification of pyrimidine TFOs: effect on i-motif and triple helix formation
AU668886B2 (en) Formation of triple helix complexes of double stranded DNA using nucleoside oligomers which comprise purine base analogs
Rusling et al. Combining nucleoside analogues to achieve recognition of oligopurine tracts by triplex-forming oligonucleotides at physiological pH
Hudson et al. Association of branched nucleic acids: structural and physicochemical analysis of antiparallel T. cntdot. AT triple-helical DNA
Nishikawa et al. Structural studies of an RNA aptamer containing GGA repeats under ionic conditions using microchip electrophoresis, circular dichroism, and 1D-NMR
Guga et al. Unusual thermal stability of RNA/[Rp-PS]-DNA/RNA triplexes containing a homopurine DNA strand
Aviñó et al. Parallel-stranded hairpins containing 8-aminopurines. Novel efficient probes for triple-helix formation
Delarue et al. RNA structure
Petraccone et al. Targeting duplex DNA with DNA‐PNA chimeras? Physico‐chemical characterization of a triplex DNA‐PNA/DNA/DNA
WO2004113564A1 (en) Method for investigating cytosine methylation in dna sequences by means of triplex-forming oligomers
Beban et al. Pyrimidine motif triplexes containing polypurine RNA or DNA with oligo 2′-O-methyl or DNA triplex forming oligonucleotides
Sun et al. FTIR and UV spectroscopy studies of triplex formation between pyrimidine methoxyethylphosphoramidates α-oligodeoxynucleotides and ds DNA targets
Torigoe et al. Triplex formation involving 2′-O, 4′-C-methylene bridged nucleic acid (2′, 4′-BNA) with 2-pyridone base analogue: efficient and selective recognition of C: G interruption
Emehiser Exploring Double-Strand DNA-Targeting Strategies
Timofeev et al. Binding of Nonnatural α, β-Oligocytidylates with DNA Duplexes

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SK SL TJ TM TN TR TT TZ UA UG UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2003241620

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2003731370

Country of ref document: EP

Ref document number: 2004507539

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2003731370

Country of ref document: EP