WO2003070981A2 - Seequences specifically deleted mycobacterium tuberculosis genome and their use in diagnostics and as vaccines - Google Patents

Seequences specifically deleted mycobacterium tuberculosis genome and their use in diagnostics and as vaccines Download PDF

Info

Publication number
WO2003070981A2
WO2003070981A2 PCT/IB2003/000986 IB0300986W WO03070981A2 WO 2003070981 A2 WO2003070981 A2 WO 2003070981A2 IB 0300986 W IB0300986 W IB 0300986W WO 03070981 A2 WO03070981 A2 WO 03070981A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
mycobacterium
nucleic acid
sequence
tuberculosis
Prior art date
Application number
PCT/IB2003/000986
Other languages
French (fr)
Other versions
WO2003070981A8 (en
WO2003070981A3 (en
Inventor
Stewart Cole
Roland Brosch
Stephen Gordon
Karin Eiglmeier
Thierry Garnier
Original Assignee
Institut Pasteur
Veterinary Laboratories Agency
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut Pasteur, Veterinary Laboratories Agency filed Critical Institut Pasteur
Priority to EP03706832A priority Critical patent/EP1478777B1/en
Priority to DE60322674T priority patent/DE60322674D1/en
Priority to AU2003208539A priority patent/AU2003208539B2/en
Priority to US10/505,405 priority patent/US7977047B2/en
Priority to JP2003569872A priority patent/JP4738740B2/en
Priority to CA2477195A priority patent/CA2477195C/en
Publication of WO2003070981A2 publication Critical patent/WO2003070981A2/en
Publication of WO2003070981A3 publication Critical patent/WO2003070981A3/en
Publication of WO2003070981A8 publication Critical patent/WO2003070981A8/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • G01N33/5695—Mycobacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A61P31/06—Antibacterial agents for tuberculosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention pertains to the field of biology, more particularly the subject of the present invention is the identification of a nucleotide sequence which make it possible in particular to distinguish an infection resulting from Mycobacterium tuberculosis from an infection resulting from Mycobacterium africanuvi, Mycobacterium canetti, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG.
  • the subject of the present invention is also a method for detecting the sequences in question by the products of expression of these sequences and the kits for carrying out these methods.
  • the subject ofthe present invention is novel vaccines.
  • tuberculosis is expected to kill 3 million people annually (Snider, 1989 Rev. Inf. Dis. S335) and the number of new people getting infected each year is rising and is estimated at 8.8 million. Although the majority of these are in developing countries, the disease is assuming renewed importance in the western countries due to the increasing number of homeless people, the impact of the AIDS epidemic, the changing global migration, and the travel patterns. Early tuberculosis often goes unrecognized in an otherwise healthy individual.
  • Classical initial methods of diagnosis include examination of a sputum smear under a microscope for acid-fast mycobacteria and an x-ray ofthe lungs.
  • the sputum smear examination is negative for Mycobacteria in the early stages of the disease, and lung changes may not be obvious on an x-ray until several months following infection.
  • Another complicating factor is that acid-fast bacteria in a sputum smear may often be other species of mycobacteria.
  • Antibiotics used for treating tuberculosis have considerable side effects, and must be taken as a combination of three or more drugs for a six to twelve month period.
  • tuberculosis such as the Gen-Probe "Amplified Mycobacterium tuberculosis Direct Test”; this test amplifies M. tuberculosis 16S ribosomal RNA fromrespiratory specimens and uses a chemiluminescent probe to detect the amplified product with a reported sensitivity of about 91%.
  • Gen-Probe “Amplified Mycobacterium tuberculosis Direct Test”
  • Mycobacterium complex (M. tuberculosis, Mbovis, Mbovis-BCG, M. africanum, Mcanettii and M.microti) spawned a whole series of rapid diagnostic strategies (Brisson-Noel et al,
  • tuberculosis is usually caused by infection due to M. tuberculosis, with a few cases being caused by M. bovis, M anettii, and M. africanum.
  • M. bovis M anettii
  • M. africanum M. bovis
  • the present invention provides an isolated or purified nucleic acid from Mycobacterium complex wherein said nucleic acid is selected from the group consisting of: a) SEQ ID N° 1 , named TbD 1 region ; b) Nucleic acid having a sequence fully complementary to SEQ ID N° 1. c) Nucleic acid fragment comprising at least 8, 12, 15, 20, 25, 30, 50, 100, 250,
  • N°l Nucleic acid having at least 90% sequence identity after optimal alignment with a sequence defined in a) or b); e) Nucleic acid that hybridizes under stringent conditions with the nucleic acid defined in a) or b);
  • the te ⁇ ns « isolated » and « purified » according to the invention refer to a level of purity that is achievable using current technology.
  • the molecules of the invention do not need to be absolutely pure (i.e., contain absolutely no molecules of other cellular macromolecules), but should be sufficiently pure so that one of ordinary skill in the art would recognize that they are no longer present in the environment in which they were originally found (i.e., the cellular middle).
  • a purified or isolated molecule according to the present invention is one that have been removed from at least one other macromolecule present in the natural environment in which it was found.
  • the molecules of the invention are essentially purified and/or isolated, which means that the composition in which they are present is almost completely, or even absolutely, free of other macromolecules found in the environment in which the molecules of the invention are originally found. Isolation and purification thus does not occur by addition or removal of salts, solvents, or elements of the periodic table, but must include the removal of at least some macromolecules.
  • the nucleic acids encompassed by the invention are purified and/or isolated by any appropriate technique known to the ordinary artisan. Such techniques are widely known, commonly practiced, and well within the skill ofthe ordinary artisan.
  • nucleic acid refers to a polynucleotide sequence such as a single or double stranded DNA sequence, RNA sequence, cDNA sequence; such a polynucleotide sequence has been isolated, purified or synthesized and may be constituted with natural or non natural nucleotides.
  • the DNA molecule of the invention is a double stranded DNA molecule.
  • nucleic acid refers to a polynucleotide sequence such as a single or double stranded DNA sequence, RNA sequence, cDNA sequence; such a polynucleotide sequence has been isolated, purified or synthesized and may be constituted with natural or non natural nucleotides.
  • the DNA molecule of the invention is a double stranded DNA molecule.
  • nucleic acid oligonucleotide
  • polynucleotide have the same meaning and are used indifferently.
  • Mycobacterium complex as used herein, it is meant the complex of mycobacteria causing tuberculosis which are Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium microti, Mycobacterium canettii and the vaccine strain Mycobacterium bovis BCG.
  • the present invention encompasses not only the entire sequence SEQ ID N°l, its complement, and its double-stranded form, but any fragment of this sequence, its complement, and its double-stranded fo ⁇ n.
  • the fragment of SEQ ID N°l comprises at least approximately 8 nucleotides.
  • the fragment can be between approximately 8 and 30 nucleotides and can be designed as a primer for polynucleotide synthesis.
  • the fragment of SEQ ID N°l comprises between approximately 1,500 and approximately 2,500 nucleotides, and more preferably 2153 nucleotides corresponding to SEQ ID N°4 (see figure 5).
  • nucleotides is used in reference to the number of nucleotides on a single-stranded nucleic acid. However, the term also encompasses double-stranded molecules.
  • a fragment comprising 2,153 nucleotides according to the invention is a single-stranded molecule comprising 2,153 nucleotides, and also a double stranded molecule comprising 2153 base pairs (bp).
  • the nucleic acid fragment ofthe invention is specifically deleted in the genome of Mycobacterium tuberculosis, excepted in Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their, genome and present in the genome of Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG.
  • te ⁇ n "few IS6110 sequences inserted in the genome” it is meant less than ten copies in the genome of M tuberculosis, more preferably less than 5 copies, for example less than two copies.
  • the nucleic acid fragment of the invention is preferably selected from the group consisting of: a) SEQ ID N 0 4; b) Nucleic acid having a sequence fully complementary to SEQ ID N°4. c) Nucleic acid fragment comprising at least 8, 12, 15, 20, 25, 30, 50, 100, 250, 500, 750, 1000, 1500, 2000, 2500, 3000 consecutive nucleotides of SEQ ID N°4; d) Nucleic acid having at least 90% sequence identity after optimal alignment with a sequence defined in a) or b); e) Nucleic acid that hybridizes under stringent conditions with the nucleic acid defined in a) or b).
  • the stringent conditions under which a sequence according to the invention is determined are conditions which are no less stringent than 5X SSPE, 2X Denhardt's solution, and 0.5% (w/v) sodium dodecyl sulfate at 65°C. More stringent conditions can be utilized by the ordinary artisan, and the proper conditions for a given assay can be easily and rapidly determined without undue or excessive experimentation.
  • the stringent hybridization conditions used in order to specifically detect a polynucleotide according to the present invention are advantageously the following: pre-hybridization and hybridization are performed at 65°C in a mixture containing:
  • IX SSPE is 3 M NaCl, 30 mM tri-sodium citrate
  • SDS sodium dodecyl sulfate
  • the washings are performed as follows:
  • the invention also encompasses the isolated or purified nucleic acid of the invention wherein said nucleic acid comprises at least a deletion of a nucleic acid fragment as defined above.
  • nucleic acid of the invention is the SEQ ID N°21 that corresponds to SEQ ID N°l in which SEQ ID N°4 is deleted (absent).
  • Polynucleotides of the invention can be characterized by the percentage of identity they show with the sequences disclosed herein.
  • polynucleotides having at least 90% identity with the polynucleotides of the invention, particularly those sequences of the sequence listing, are encompassed by the invention.
  • the sequences show at least 90% identity with those of the sequence listing. More preferably, they show at least 92% identity, for example 95% or 99% identity.
  • the skilled artisan can identify sequences according to the invention through the use ofthe sequence analysis software BLAST (see for example, Coffin et al., eds., "Retroviruses", Cold Spring Harbor Laboratory Press, pp. 723- 755).
  • Percent identity is calculated using the BLAST sequence analysis program suite, Version 2, available at the NCBI (NIH). All default parameters are used.
  • BLAST Basic Local Alignment Search Tool
  • blastp, blastn, blastx, tblastn and tblastx are the heuristic search algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx, all of which are available through the BLAST analysis software suite at the NCBI. These programs ascribe significance to their findings using the statistical methods of Karlin and Altschul (1990, 1993) with a few enhancements. Using this publicly available sequence analysis program suite, the skilled artisan can easily identify polynucleotides according to the present invention.
  • fragment chosen by the ordinary artisan is the ability of the fragment to be useful for the purpose for which it is chosen. For example, if the ordinary artisan wished to choose a hybridization probe, he would know how to choose one of sufficient length, and of sufficient stability, to give meaningful results.
  • the conditions chosen would be those typically used in hybridization assays developed for nucleic acid fragments ofthe approximate chosen length.
  • the present invention provides short oligonucleotides, such as those useful as probes and primers.
  • the probe and/or primer comprises 8 to 30 consecutive nucleotides of the polynucleotide according to the invention or the polynucleotide complementary thereto.
  • a fragment as defined herein has a length of at least 8 nucleotides, which is approximately the minimal length that has been determined to allow specific hybridization.
  • the nucleic fragment has a length of at least 12 nucleotides and more preferably 20 consecutive nucleotides of any of SEQ ID N°l or SEQ ID N°4.
  • the sequence ofthe oligonucleotide can be any ofthe many possible sequences according to the invention.
  • the sequence is selected from the following group SEQ ID N° 13, SEQ ID N° 14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18. More precisely, the primers SEQ ID N°13, SEQ ID N°14, SEQ ID N°15 and SEQ ID N°16 are contained in the nucleic acid fragment SEQ ID N°4. The primers SEQ ID N°17 and SEQ ID N°18 are contained in the nucleic acid sequence SEQ ID N°l and are flanking the nucleic acid fragment of SEQ ID N°4 (see figure 5).
  • polynucleotides of SEQ ID N°l and SEQ ID N°4, and their fragments can be used to select nucleotide primers, notably for an amplification reaction, such as the amplification reactions further described.
  • PCR is described in US Patent No. 4,683,202, which is incorporated in its entirety herein.
  • the amplified fragments may be identified by agarose or polyacrylamide gel electrophoresis, by a capillary electrophoresis, or alternatively by a chromatography technique (gel filtration, hydrophobic chromatography, or ion exchange chromatography).
  • the specificity of the amplification can be ensured by a molecular hybridization using as nucleic probes the polynucleotides of SEQ ID N°l or SEQ ID N°4, and their fragments, oligonucleotides that are complementary to these polynucleotides or fragments thereof, or their amplification products themselves, and/or even by DNA sequencing.
  • the Strand Displacement Amplification (SDA) technique is an isothermal amplification technique based on the ability of a restriction enzyme to cleave one of the strands at a recognition site (which is under a hemiphosphorothioate form) and on the property of a DNA polymerase to initiate the synthesis of a new strand from the 3'OH end generated by the restriction enzyme and on the property of this DNA polymerase to displace the previously synthesized strand being localized downstream.
  • the SDA amplification technique is more easily performed than PCR (a single thermostatted water bath device is necessary), and is faster than the other amplification methods.
  • the present invention also comprises using the nucleic acid fragments according to the invention (primers) in a method of DNA or RNA amplification according to the SDA technique.
  • RNA for example a mRNA
  • a reverse transcriptase enzyme will be used before the amplification reaction in order to obtain a cDNA from the RNA contained in the biological sample.
  • the generated cDNA is subsequently used as the nucleic acid target for the primers or the probes used in an amplification process or a detection process according to the present invention.
  • the non-labeled polynucleotides or oligonucleotides ofthe invention can be directly used as probes.
  • the polynucleotides or oligonucleotides are generally labeled with a radioactive element ( P, S, H, I) or by a non-isotopic molecule (for example, biotin, acetylaminofluorene, digoxigenin, 5-bromodesoxyuridine, fluorescein) in order to generate probes that are useful for numerous applications.
  • a radioactive element P, S, H, I
  • a non-isotopic molecule for example, biotin, acetylaminofluorene, digoxigenin, 5-bromodesoxyuridine, fluorescein
  • the hybridization step may be performed in different ways. See, for example, Matthews et al, 1988, Anal. Biochem. 169:1-25.
  • a general method comprises immobilizing the nucleic acid that has been extracted from the biological sample on a substrate (for example, nitrocellulose, nylon, polystyrene) and then incubating, in defined conditions, the target nucleic acid with the probe. Subsequent to the hybridization step, the excess amount of the specific probe is discarded and the hybrid molecules formed are detected by an appropriate method (radioactivity, fluorescence or enzyme activity measurement, etc.).
  • Amplified nucleotide fragments are useful, among other things, as probes used in hybridization reactions in order to detect the presence of one polynucleotide according to the present invention or in order to detect mutations.
  • the primers may also be used as oligonucleotide probes to specifically detect a polynucleotide according to the invention.
  • the oligonucleotide probes according to the present invention may also be used in a detection device comprising a matrix library of probes immobilized on a substrate, the sequence of each probe of a given length being localized in a shift of one or several bases, one from the other, each probe of the matrix library thus being complementary to a distinct sequence ofthe target nucleic acid.
  • the substrate ofthe matrix may be a material able to act as an electron donor, the detection of the matrix positions in which an hybridization has occurred being subsequently determined by an electronic device.
  • matrix libraries of probes and methods of specific detection of a target nucleic acid is described in the European patent application N° EP-0 713 016 (Affymax technologies) and also in the US patent N° US-5,202,231 (Drmanac). Since almost the whole length of a mycobacterial chromosome is covered by BAC-based genomic DNA library (i.e.
  • BAC library 1-1945 97% ofthe M tuberculosis chromosome is covered by the BAC library 1-1945
  • these DNA libraries will play an important role in a plurality of post-genomic applications, such as in mycobacterial gene expression studies where the canonical set of BACs could be used as a matrix for hybridization studies.
  • a nucleic acid chips more precisely a DNA chips or a protein chips that respectively comprises a nucleic acid or a polypeptide ofthe invention.
  • the present invention is also providing a vector comprising the isolated DNA molecule ofthe invention.
  • a "vector " is a replicon in which another polynucleotide segment is attached, so as to bring the replication and/or expression to the attached segment.
  • a vector can have one or more restriction endonuclease recognition sites at which the DNA sequences can be cut in a determinable fashion without loss of an essential biological function of the vector, and into which a DNA fragment can be spliced in order to bring about its replication and cloning.
  • Vectors can further provide primer sites (e.g. for PCR), transcriptional and/or translational initiation and/or regulation sites, recombinational signals, replicons, selectable markers, etc.
  • the cloning vector can further contain a selectable marker suitable for use in the identification of cells transformed with the cloning vector.
  • the vector can be any useful vector known to the ordinary artisan, including, but not limited to, a cloning vector, an insertion vector, or an expression vector.
  • vectors examples include plasmids, phages, cosmids, phagemid, yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), human artificial chromosome (HAC), viral vector, such as adenoviral vector, retroviral vector, and other DNA sequences which are able to replicate or to be replicated in vitro or in a host cell, or to convey a desired DNA segment to a desired location within a host cell.
  • YAC yeast artificial chromosome
  • BAC bacterial artificial chromosome
  • HAC human artificial chromosome
  • viral vector such as adenoviral vector, retroviral vector, and other DNA sequences which are able to replicate or to be replicated in vitro or in a host cell, or to convey a desired DNA segment to a desired location within a host cell.
  • the recombinant vector is a BAC pBeloBACl l in which the genomic region of Mycobacterium bovis-BCG 1173P3 that spans the region corresponding to the locus 1,760,753 bp to 1,830,364 bp in the genome of M tuberculosis H37Rv has been inserted into the Hindlll restriction site; this recombinant vector is named X229. In this region, the inventors have demonstrated the deletion of a 2153 bp fragment, corresponding to SEQ ID N°4, in the vast majority of M. tuberculosis strains excepted strains of M.
  • tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome. That's the reason why the inventors named this deletion of 2153 bp TbDl ("M tuberculosis specific deletion 1").
  • TbDl is flanked by the sequence GGC CTG GTC AAA CGC GGC TGG ATG CTG and AGA TCC GTC TTT GAC ACG ATC GAC G.
  • External primers hybridizing with such sequences outside TbDl or the complementary sequences thereof can be used for the amplification of TbDl to check for the presence or the absence of the deletion of the TbDl.
  • the inventors design for example the following primers:
  • a PCR amplification of a fragment comprised in TbDl may be realized by using the plasmid X229 as a matrix.
  • the amplification of a fragment of approximatively 500 bp contained in TbDl can be performed by using the following primers:
  • this invention also concerns a recombinant cell host which contains a polynucleotide or recombinant vector according to the invention.
  • the cell host can be transformed or transfected with a polynucleotide or recombinant vector to provide transient, stable, or controlled expression of the desired polynucleotide.
  • the polynucleotide of interest can be subcloned into an expression plasmid at a cloning site downstream from a promoter in the plasmid and the plasmid can be introduced into a host cell where expression can occur.
  • the recombinant host cell can be any suitable host known to the skilled artisan, such as a eukaryotic cell or a microorganism.
  • the host can be a cell selected from the group consisting of Escherichia coli, Bacillus subtilis, insect cells, and yeasts.
  • the recombinant cell host is a commercially available Escherichia coli DH10B (Gibco) containing the BAC named X229 previously described. This Escherichia coli DH10B (Gibco) containing the BAC named X229 has been deposited with the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, Paris, France, on February 18 th , 2002 under number CNCM 1-2799.
  • CNCM Collection Nationale de Cultures de Microorganismes
  • Another aspect of the invention is the product of expression of all or part of the nucleic acid according to the invention, including the nucleic acid fragment specifically deleted in the genome of Mycobacterium tuberculosis, excepted in Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome as defined previously.
  • the expression "product of expression” is understood to mean any isolated or purified protein, polypeptide or polypeptide fragment resulting from the expression of all or part of the above-mentioned nucleotide sequences.
  • the membrane protein mmpL6 corresponding to SEQ ID N°6 the membrane protein mmpS6 corresponding to SEQ ID N°3 or SEQ ID N°10 (the two sequences SEQ ID N°3 and SEQ ID N°10 are identical), and their truncated or rearranged forms due to the deletion of a nucleic acid fragment according to the invention.
  • SEQ ID N°8 is a truncated form of mmpL6 protein
  • SEQ ID N°12 is a truncated form of mmpS6 protein
  • SEQ ID N°22 is a fusion product [mmpS6-mmpL6] of both rearranged mmpL6 and mmpS6 proteins.
  • polypeptide of the present invention can be produced by insertion of the appropriate polynucleotide into an appropriate expression vector at the appropriate position within the vector. Such manipulation of polynucleotides is well known and widely practiced by the ordinary artisan.
  • the polypeptide can be produced from these recombinant vectors either in vitro or in vivo. All the isolated or purified nucleic acids encoding the polypeptide of the invention are in the scope ofthe invention.
  • the polypeptide ofthe invention is a polypeptide encoded by a polynucleotide which hybridizes to any of SEQ ID N°l or N°4 under stringent conditions, as defined herein.
  • said isolated or purified nucleic acid according the invention is selected among:
  • the present invention also provides a method for the discriminatory detection and identification of:
  • Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome; versus,
  • Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG in a biological sample comprising the following steps: a) isolation of the DNA from the biological sample to be analyzed or production of a cDNA from the RNA ofthe biological sample, b) detection ofthe nucleic acid sequences ofthe mycobacterium present in said biological sample, c) analysis for the presence or the absence of a nucleic acid fragment specifically deleted in the genome of Mycobacterium tuberculosis, excepted in Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, as previously described.
  • a biological sample By a biological sample according to the present invention, it is notably intended a biological fluid, such as sputum, saliva, plasma, blood, urine or sperm, or a tissue, such as a biopsy.
  • a biological fluid such as sputum, saliva, plasma, blood, urine or sperm
  • a tissue such as a biopsy.
  • Analysis of the desired sequences may, for example, be carried out by agarose gel electrophoresis. If the presence of a DNA fragment migrating to the expected site is observed, it can be concluded that the analyzed sample contained mycobacterial DNA.
  • This analysis can also be carried out by the molecular hybridization technique using a nucleic probe.
  • This probe will be advantageously labeled with a nonradioactive (cold probe) or radioactive element.
  • the detection of the mycobacterial DNA sequences will be carried out using nucleotide sequences complementary to said DNA sequences. By way of example, they may include labeled or nonlabeled nucleotide probes; they may also include primers for amplification.
  • the amplification technique used may be PCR but also other alternative techniques such as the SDA (Strand Displacement Amplification) technique, the TAS technique (Transcription-based Amplification System), the NASBA (Nucleic Acid Sequence Based Amplification) technique or the TMA (Transcription Mediated Amplification) technique.
  • SDA Strand Displacement Amplification
  • TAS Transcription-based Amplification System
  • NASBA Nucleic Acid Sequence Based Amplification
  • TMA Transcription Mediated Amplification
  • the primers in accordance witii the invention have a nucleotide sequence chosen from the group comprising SEQ ID N° 13, SEQ ID N° 14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18.
  • the primers SEQ ID N°13, SEQ ID N°14, SEQ ID N°15 and SEQ ID N°16 are contained in the nucleic acid fragment SEQ ID N°4, and the primers SEQ ID N°17 and SEQ ID N°18 are contained in the nucleic acid of the invention SEQ ID N°l but not in the nucleic acid fragment SEQ ID N°4.
  • the subject of the invention is also a method for the discriminatory detection and identification of: - Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome; versus,
  • - Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG in a biological sample comprising the following steps: a) bringing the biological sample to be analyzed into contact with at least one pair of primers as defined above, the DNA contained in the sample having been, where appropriate, made accessible to the hybridization beforehand, b) amplification ofthe DNA ofthe mycobacterium, c) visualization ofthe amplification ofthe DNA fragments.
  • the amplified fragments may be identified by agarose or polyacrylamide gel electrophoresis by capillary electrophoresis or by a chromatographic technique (gel filtration, hydrophobic chromatography or ion-exchange chromatography).
  • the specification of the amplification may be controlled by molecular hybridization using probes, plasmids containing these sequences or their product of amplification.
  • the amplified nucleotide fragments may be used as reagent in hybridization reactions in order to detect the presence, in a biological sample, of a target nucleic acid having sequences complementary to those of said amplified nucleotide fragments.
  • These probes and amplicons may be labeled or otherwise with radioactive elements or with nonradioactive molecules such as enzymes or fluorescent elements.
  • the subject ofthe present invention is also a kit for the discriminatory detection and identification of:
  • Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome; versus,
  • Mycobacterium africanum Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG in a biological sample, in a biological sample comprising the following elements: a) at least one pair of primers as defined previously, b) the reagents necessary to carry out a DNA amplification reaction, c) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
  • primers which are contained in the TbDl deletion such as for example SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, is such that no amplification product is detectable in M.
  • tuberculosis excepted in strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences in their genome, and that amplification product is detectable in Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome.
  • the use of a pair of primers outside the TbDl deletion such as SEQ ID N°17 and SEQ ID N°18 is likely to give rise to an amplicon in Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, of about 2100 bp whereas the use of the pair of primers outside the TbDl deletion will give rise in M. tuberculosis excepted in strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, to an amplicon of about few bp.
  • the invention pertains to the use of at least one pair of primers as defined previously for the amplification of a DNA sequence from Mycobacterium tuberculosis or Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome.
  • the subject of the present invention is also a method for the in vitro discriminatory detection of antibodies directed against Mycobacterium tuberculosis excepted Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome versus antibodies directed against Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few 7S6110 sequences inserted in their genome, in a biological sample, comprising the following steps: a) bringing the biological sample into contact with at least one product of expression of all or part of the nucleic acid fragment specifically deleted in M.
  • tuberculosis excepted in strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, as previously defined, b) detecting the antigen-antibody complex formed.
  • the subject of the present invention is also a method for the in vitro discriminatory detection of a vaccination with Mycobacterium bovis BCG, an infection by M. bovis, M. canettii, M. microti, M. africanum or M. tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, versus an infection by Mycobacterium tuberculosis, excepted by Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome in a mammal, comprising the following steps: a) preparation of a biological sample containing cells, more particularly cells of the immune system of said mammal and more particularly T cells, b) incubation of the biological sample of step a) with at least one product of expression of all or part of the nucleic acid fragment specifically deleted in M.
  • tuberculosis excepted in strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, as previously defined, c) detection of a cellular reaction indicating prior sensitization of the mammal to said product, in particular cell proliferation and/or synthesis of proteins such as gamma- interferon.
  • Cell proliferation may be measured, for example, by incorporating 3 H-Thymidine.
  • the invention also relates to a kit for the in vitro discriminatory diagnosis of a vaccination with M. bovis BCG, an infection by M. bovis, M. canettii, M. microti, M. africanum versus an infection by M. tuberculosis excepted by strains having the sequence
  • a mammal comprising: a) a product of expression of all or part of the nucleic acid fragment specifically deleted in M. tuberculosis excepted in strains of M tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, as previously defined , b) where appropriate, the reagents for the constitution of the medium suitable for the immunological reaction, c) the reagents allowing the detection of the antigen-antibody complexes produced by the immunological reaction, d) where appropriate, a reference biological sample (negative control) free of antibodies recognized by said product, e) where appropriate, a reference biological sample (positive control) containing a predetermined quantity of antibodies recognized by said product.
  • the reagents allowing the detection of the antigen-antibody complexes may carry a marker or may be capable of being recognized
  • the subject of the invention is also mono- or polyclonal antibodies, their chimeric fragments or antibodies, capable of specifically recognizing a product of expression in accordance with the present invention.
  • the present invention therefore also relates to a method for the in vitro discriminatory detection of the presence of an antigen of Mycobacterium tuberculosis excepted of strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, versus the presence of an antigen of Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis-BCG and Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a biological sample comprising the following steps: a) bringing the biological sample into contact with an antibody ofthe invention, b) detecting the antigen-antibody complex formed.
  • the invention also relates to a kit for the discriminatory detection ofthe presence of an antigen of Mycobacterium tuberculosis excepted strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few 7S6110 sequences inserted in their genome versus the presence of an antigen of Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a biological sample comprising the following steps: a) an antibody as previously claimed , b) the reagents for constituting the medium suitable for the immunological reaction, c) the reagents allowing the detection of the antigen-antibody complexes produced by the immunological reaction.
  • the subject of the invention is also an immunogenic composition, characterized in that it comprises at least one product of expression in accordance with the invention.
  • an immunogenic composition will be used to protect animals and humans against infections by M. africanum, M. bovis, M. canettii, M. microti and M. tuberculosis.
  • an immunogenic composition will comprise a product of expression of all or part ofthe nucleic fragment specifically deleted in the genome of Mycobacterium tuberculosis, excepted in Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome.
  • such an immunogenic composition will comprise a product of expression of all or part of TbDl.
  • such an immunogenic composition will be used to protect animals and humans against infections by M. africanum, M. bovis, M. canettii, M. microti and M. tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome.
  • such an immunogenic composition will comprise the fusion product [mmpS6-mmpL6] of SEQ ID N°22.
  • This fusion product is due to the absence of TbDl in M. tuberculosis excepted strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome.
  • An immunogenic composition comprising this fusion product will be used to protect animals and humans specifically against infection by the vast majority of M. tuberculosis strains excepted strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome.
  • the immunogenic composition in accordance with the invention enters into the composition of a vaccine when it is provided in combination with a pharmaceutically acceptable vehicle and optionally with one or more immunity adjuvant(s) such as alum or a representative of the family of muramylpeptides or incomplete Freund's adjuvant.
  • a pharmaceutically acceptable vehicle such as alum or a representative of the family of muramylpeptides or incomplete Freund's adjuvant.
  • the invention also relates to a vaccine comprising at least one product of expression in accordance with the invention in combination with a pharmaceutically compatible vehicle and, where appropriate, one or more appropriate immunity adjuvant(s).
  • the invention also provide an in vitro method for the detection and identification of Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome in a biological sample, comprising the following steps: a) isolation of the DNA from the biological sample to be analyzed or production of a cDNA from the RNA ofthe biological sample, b) detection ofthe nucleic acid sequences ofthe mycobacterium present in said biological sample, c) analysis for the presence or the absence of a nucleic acid fragment of the invention.
  • the invention provides an in vitro method for the detection and identification of Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few
  • IS6110 sequences inserted in their genome in a biological sample comprising the following steps: a) bringing the biological sample to be analyzed into contact with at least one pair of primers selected among nucleic acid fragments of the invention, and more preferably selected among the primers chosen from the group comprising SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18, the DNA contained in the sample having been, where appropriate, made accessible to the hybridization beforehand, b) amplification ofthe DNA ofthe mycobacterium, c) visualization ofthe amplification ofthe DNA fragments.
  • the invention also provides a kit for the detection and identification of
  • Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome in a biological sample comprising the following elements: a) at least one pair of primers selected among nucleic acid fragments of the invention, and more preferably selected among the primers chosen from the group comprising SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18, b) the reagents necessary to carry out a DNA amplification reaction, c) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
  • the invention also relates to a method for the in vitro detection of antibodies directed against Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a biological sample, comprising the following steps: a) bringing the biological sample into contact with at least one product of expression of all or part of the nucleic acid fragment specifically deleted in M. tuberculosis excepted in strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, b) detecting the antigen-antibody complex formed. It is also a goal of the invention to use the TbDl deletion as a genetic marker for the differentiation of Mycobacterium strains of Mycobacterium complex.
  • mmpL6 551 polymorphism as a genetic marker for the differentiation of Mycobacterium strains of Mycobacterium complex.
  • canettii allows the differentiation of Mycobacterium strains of Mycobacterium complex (see example 4).
  • the present invention provides an in vitro method for the detection and identification of Mycobacteria from the Mycobacterium complex in a biological sample, comprising the following steps: a) analysis for the presence or the absence of a nucleic acid fragment specifically deleted in M. tuberculosis excepted in strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, and b) analysis of at least one additional genetic marker selected among RDl, RD2, RD3,
  • two additional markers are used, preferably RD4 and RD9.
  • the analysis is performed by a technique selected among sequence hybridization, nucleic acid amplification, antigen-antibody complex.
  • kits for the detection and identification of Mycobacteria from the Mycobacterium complex in a biological sample comprising the following elements: a) at least one pair of primers selected among nucleic acid fragments of the invention, and more preferably selected among the primers chosen from the group comprising SEQ ID N 0 13, SEQ IDN°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18, b) at least one pair of primers specific of the genetic markers selected among RDl, RD2, RD3, RD4, RD5, RD6, RD7, RD8, RD9, RD10, RD11, RD13, RD14, RvDl, RvD2, RvD3, RvD4, RvD5, katG 463 , gyrA 95 , oxyR' 285 , pncA 57 , the specific insertion element of M. canettii. c) the following elements: a) at least one pair of primers
  • the kit comprises the following elements: a) at least one pair of primers selected among nucleic acid fragments of the invention, and more preferably selected among the primers chosen from the group comprising SEQ ID °13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N 0 18, b) one pair of primers specific ofthe genetic marker RD4, c) one pair of primers specific of the genetic marker RD9, d) the reagents necessary to carry out a DNA amplification reaction, e) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
  • Figure 1 Amplicons obtained from strains that have the indicated genomic region present or deleted. Sizes of amplicons in each group are uniform. Numbers correspond to strain designation used in Kremer et al. (1999, J. Clin Microbiol. 37: 2607-2618) (Ref. 8) and Supply et al (2001, J. Clin. Microbiol. 39: 3563-3571) (ref.9).
  • FIG. 1 Sequences in the TbDl region obtained from strains of various geographic regions.
  • Figure 4 Scheme of the proposed evolutionary pathway of the tubercle bacilli illustrating successive loss of DNA in certain lineages (grey boxes). The scheme is based on presence or absence of conserved deleted regions and on sequence polymorphisms in five selected genes. Note that the distances between certain branches may not correspond to actual phylogenetic differences calculated by other methods. Dark arrows indicate that strains are characterized by katG 0463 CTG (Leu), gyrA c95 ACC (Thr), typical for group 1 organisms. Arrows with white lines indicate that strains belong to group 2 characterized by katG 0463 CGG (Arg), gyrA c95 ACC (Thr).
  • strains belong to group 3, charcterized by katG 0463 CGG (Arg), gyrA 095 AGC (Ser), as defined by Sreevatsan and colleagues (Sreevastan et al., 1997 Proc. Natl. Acad.Sci USA 151: 9869-9874) (Ref. 2).
  • Figure 5 Scheme ofthe TbDl deletion and surrounding region in Mycobacterium complex.
  • A Scheme of TbDl and surrounding region in genome of M. bovis, M. bovis BCG, M. africanum, M. canettii, M. microti and ancestral strains of M. tuberculosis characterized by having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome.
  • the mmpL6 gene, the mmpS6 gene, the different primers, the different nucleic acid fragments and polypeptides coded by them are approximately localized in the region.
  • the 2153 pb deletion named TbDl specifically deleted in M tuberculosis excepted in ancestral strains of M tuberculosis, is delimited by its two end points.
  • FIG. 6 Sequence of the specific insertion element in genome of Mycobacterium canettii strains. The beginning of this insertion element is at position 399 and the end of this insertion element is at position 2378.
  • This insertion element contains the coding sequence of a putative transposase (sequence in bold characters, from position 517 to position 2307) that shows significant homology with a transposase of Mycobacterium smegmatis.
  • This coding sequence is framed by two 20 bp inverted repeats (sequences underlined from position 399 to 418 and from position 2359 to 2378).
  • the 100 M tuberculosis complex strains comprised 46 M. tuberculosis strains isolated in 30 countries, 14 M africanum strains, 28 M. bovis strains originating in 5 countries, 2 M. bovis BCG vaccine strains (Pasteur and Japan), 5 M. microti strains, and 5 M. canettii strains.
  • the strains were isolated from human and animal sources and were selected to represent a wide diversity including 60 strains that have been used in a multi-center study (8).
  • the M. africanum strains were retrieved from the collection of the Wadsworth Center, New York State Department of Health, Albany, New York, whereas the majority of the M.
  • bovis isolates came from the collection of the University of Zaragoza, Spain.
  • M. canettii strains are from the culture collection of the Institut Pasteur, Paris, France. The strains have been extensively characterized by reference typing methods, i.e. IS6U0 restriction fragment length polymorphism (RFLP) typing and spoligotyping.
  • RFLP restriction fragment length polymorphism
  • M. tuberculosis H37Rv, M. tuberculosis H37Ra, M. tuberculosis CDC 1551, M. bovis AF2122/97, M. microti OV254, and M. canettii CIPT 140010059 were included as reference strains. DNA was prepared as previously described (10).
  • Reactions were performed in 96 well plates and contained per reaction 1.25 ⁇ l of 10 x PCR buffer (600mM Tris HC1 pH 8.8, 20 mM MgCl2, 170 mM (NH ⁇ SO ⁇ 100 mM ⁇ - mercaptoethanol), 1.25 ⁇ l 20mM nucleotide mix, 50 nM of each primer, 1-10 ng of template DNA, 10% DMSO, 0.2 units Taq polymerase (Gibco-BRL) and sterile distilled water to 12.5 ⁇ l.
  • Thermal cycling was performed on a PTC- 100 amplifier (MJ Inc.) with an initial denaturation step of 90 seconds at 95°C, followed by 35 cycles of 30 seconds at 95°C, 1 min at 58°C, and 4 min at 72°C.
  • PCR products were obtained as described above, using primers listed in Table 1.
  • 6 ⁇ l PCR product was incubated with 1 unit of Shrimp Alkaline phosphatase (USB), 10 units of exonuclease I (USB), and 2 ⁇ l of 5 x buffer (200mM Tris HC1 pH 8.8, 5mM MgCl 2 ) for 15 min at 37°C and then for 15 min at 80°C.
  • USB Shrimp Alkaline phosphatase
  • exonuclease I USB
  • 5 x buffer 200mM Tris HC1 pH 8.8, 5mM MgCl 2
  • reactions were dissolved in 2 ⁇ l of formamide/EDTA buffer, denatured and loaded onto 48 cm, 4 % polyacrylamide gels and electrophoresis performed on 377 automated DNA sequencers (Applied Biosystems) for 10 to 12 h. Alternatively, reactions were dissolved in 0.3 mM EDTA buffer and subjected to automated sequencing on a 3700 DNA sequencer (Applied Biosystems). Reactions generally gave between 500-700 bp of unambiguous sequence.
  • EXPERIMENTAL DATA The distribution of 20 variable regions resulting from insertion-deletion events in the genomes ofthe tubercle bacilli has been evaluated in a total of 100 strains of Mycobacterium tuberculosis, M. africanum, M. canettii, M. microti and M. bovis. This approach showed that the majority of these polymorphisms did not occur independently in the different strains of the M. tuberculosis complex but, rather, result from ancient, irreversible genetic events in common progenitor strains. Based on the presence or absence of an M. tuberculosis specific deletion (TbDl), M.
  • tuberculosis strains can be divided into ancestral and "modern" strains, the latter comprising representatives of major epidemics like the Beijing, Haarlem and African M. tuberculosis clusters. Furthermore, successive loss of DNA, reflected by RD9 and other subsequent deletions, was identified for an evolutionary lineage represented by M africanum, M. microti and M. bovis that diverged from the progenitor of the present M tuberculosis strains before TbDl occurred. These findings contradict the often-presented hypothesis that M. tuberculosis, the etiological agent of human tuberculosis evolved from M. bovis, the agent of bovine disease. M. canettii and ancestral M.
  • tuberculosis strains lack none of these deleted regions and tiierefore appear to be direct descendants of tubercle bacilli that existed before the M. africanum- > M. bovis lineage separated from the M. tuberculosis lineage. This suggests that the common ancestor of the tubercle bacilli resembled M. tuberculosis or M. canettii and could well have been a human pathogen already.
  • the mycobacteria grouped in the M. tuberculosis complex are characterized by
  • M. tuberculosis Because ofthe unusually high degree of conservation in their housekeeping genes it has been suggested that the members of the M. tuberculosis complex underwent an evolutionary bottleneck at the time of speciation, estimated to have occurred roughly 15,000 - 20,000 years ago (2). It also has been speculated that M. tuberculosis, the most widespread etiological agent of human tuberculosis has evolved from M. bovis, the agent of bovine tuberculosis, by specific adaptation of an animal pathogen to the human host (3). However, both hypotheses were proposed before the whole genome sequence of M. tuberculosis (4) was available and before comparative genomics uncovered several variable genomic regions in the members of the M. tuberculosis complex.
  • Differential hybridization arrays identified 14 regions (RDl -14) ranging in size from 2 to 12.7 kb that were absent from BCG Pasteur relative to M. tuberculosis H37Rv (5, 6).
  • six regions, RvD 1-5, and TbDl, that were absent from the M. tuberculosis H37Rv genome relative to other members of the M. tuberculosis complex were revealed by comparative genomics approaches employing pulsed-field gel electrophoresis (PFGE) techniques (5, 7) and in silico comparisons of the near complete M. bovis AF2122/97 genome sequence and the M. tuberculosis H37Rv sequence.
  • PFGE pulsed-field gel electrophoresis
  • the inventors have analyzed the distribution of these 20 variable regions situated around the genome (Table 1) in a representative and diverse set of 100 strains belonging to the M. tuberculosis complex.
  • the strains were isolated from different hosts, from a broad range of geographic origins, and exhibit a wide spectrum of typing characteristics like 1S6110 and spoligotype hybridization patterns or variable-number tandem repeats of mycobacterial interspersed repetitive units (MIRU-VNTR) (8, 9).
  • the inventors have found striking evidence that deletion of certain variable genomic regions did not occur independently in the different strains of the Mycobacterium complex and, assuming that there is little or no recombination of chromosomal segments between the various lineages of the complex, this allows the inventors to propose a completely new scenario for the evolution ofthe Mycobacterium complex and the origin of human tuberculosis.
  • the PCR screening assay for the 20 variable regions (Table 1) within 46 M tuberculosis, 14 M. africanum, 5 M. canettii, 5 M. microti, 28 M. bovis and 2 BCG strains employed oligonucleotides internal to known RDs and RvDs, as well as oligonucleotides flanking these regions (Table 1).
  • This approach generated a large data set that was robust, highly reliable, and internally controlled since PCR amplicons obtained with the internal primer pair correlated with the absence of an appropriately sized amplicon with the flanking primer-pair, and vice-versa.
  • the first type included mobile genetic elements, like the prophages phiRvl (RD3) and phiRv2 (RD11) and insertion sequences IS1532 (RD6) and IS6110 (RD5), whose distribution in the tubercle bacilli was highly divergent (Table 2).
  • the second type of deletion is mediated by homologous recombination between adjacent 1S6110 insertion elements resulting in the loss of the intervening DNA segment (RvD2, RvD3, RvD4, and RvD5 (7)) and is variable from strain to strain (Table 2).
  • the third type includes deletions whose bordering genomic regions typically do not contain repetitive sequences. Often this type of deletion occurred in coding regions resulting in the truncation of genes that are still intact in other strains ofthe M. tuberculosis complex. The exact mechanism leading to this type of deletion remains obscure, but possibly rare strand slippage errors of DNA polymerase may have contributed to this event.
  • RDl, RD2, RD4, RD7, RD8, RD9, RD10, RD12, RD13, RDM, and TbDl are representatives of this third group whose distribution among the 100 strains allows us to propose an evolutionary scenario for the members of the M. tuberculosis complex, that identified M. tuberculosis and/or M. canettii as most closely related to the common ancestor ofthe tubercle bacilli.
  • tuberculosis strains are highly conserved with respect to RDl, RD2, RD4, RD7, RD8, RD9, RDIO, RD12, RD13, and RD14, and that these RDs represent regions that can differentiate M. tuberculosis strains independent of their geographical origin and their typing characteristics from certain other members ofthe M. tuberculosis complex. Furthermore, this suggests that these regions may be involved in die host specificity of M. tuberculosis.
  • tuberculosis strains (87 %), including representative strains from major epidemics such as the Haarlem, Beijing and Africa clusters (8).
  • TbDl M. tuberculosis specific deletion 1
  • silico sequence comparison of M. tuberculosis H37Rv with the corresponding section in M. bovis AF2122/97 revealed that in M. bovis this locus comprises two genes encoding membrane proteins belonging to a large family, whereas in M. tuberculosis H37Rv one of these genes (mmpS ⁇ ) was absent and the second was truncated (mmpL6).
  • the TbDl region is not flanked by a copy of IS6110 in M. tuberculosis H37Rv, suggesting that insertion elements were not involved in the deletion ofthe 2153 bp fragment.
  • the 40 M. tuberculosis strains lacking the TbDl region had the same genomic organization of this locus as M. tuberculosis H37Rv.
  • strains belonging to group 1 may or may not have deleted region TbDl, whereas all 30 strains belonging to groups 2 and 3 lacked TbDl (Fig. 4). Furthermore, all strains of groups 2 and 3 characteristically lacked spacer sequences 33-36 in the direct repeat (DR) region (Fig. 3). It appears that such spacers may be lost but not gained (14). Therefore, TbDl deleted strains will be referred to hereafter as "modern" M. tuberculosis strains.
  • M. canettii is a very rare smooth variant of M. tuberculosis, isolated usually from patients from, or with connection to, Africa. Although it shares identical 16S rRNA sequences with the other members ofthe Mycobacterium complex, M. canettii strains differ in many respects including polymorphisms in certain house-keeping genes, IS 1081 copy number, colony morphology, and the lipid content of the cell wall (15, 16). Therefore, we were surprised to find that in M. canettii all the RD, RvD, and TbDl regions except the prophages (phiRvl, phiRv2) were present, hi contrast, we identified a region (RD can ) being specifically absent from all five M. canettii strains that partially overlapped RDl 2 (Fig. 4).
  • M. canettii diverged from the common ancestor of the Mycobacterium complex before RD, RvD and TbDl occurred in the lineages of tubercle bacilli (Fig. 4). This hypothesis is supported by the finding that M. canettii was shown to carry 26 unique spacer sequences in the direct repeat region (14), that are no longer present in any other member ofthe Mycobacterium complex.
  • An other specific feature of M. canettii is the presence of an insertion element whose sequence has been searched, by using PCR and hybridization approaches, without sucess in the other member strains of Mycobacterium complex (including M.
  • This insertion element contained an ORF encoding a putative transposase framed by two inverted repeats. The sequence of this insertion element is represented in figure 6 and in SEQ ID N°19 where it begins at position 399 and ends at position 2378. The amino acids sequence of the putative transposase is drawn in SEQ ID N°20. As such, this insertion element can be used to differentiate between M. tuberculosis ancestral strains and M. canettii strains that may show the same TbDl, RD4 and RD9 profiles. Therefore, M. canettii represents a spectacular tubercle bacillus, whose detailed genomic analysis may reveal further insights into the evolution of Mycobacterium complex.
  • M. africanum The isolates designated as M. africanum studied here originate from West and East-
  • M. microti strains were isolated in the 1930's from voles (17) and more recently from immuno-suppressed patients (18). These strains are characterized by an identical, characteristic spoligotype, but differ in their IS6110 profiles. Both, the vole and the human isolates, lacked regions RD7, RD8, RD9, and RDIO as well as a region that is specifically deleted from M. microti (RD m ⁇ c ). RD m ⁇ c was revealed by a detailed comparative genomics study of M. microti isolates (19) using clones from a M. microti Bacterial Artificial Chromosome (BAC) library. RD m ⁇ c partially overlaps RDl from BCG (data not shown). Furthermore, vole isolates missed part ofthe RD5 region, whereas this region was present in the human isolate. As the junction region of RD5 in M. microti was different to that in BCG (data not shown), RD5 was not used as an evolutionary marker.
  • BAC M.
  • M. bovis has a very large host spectrum infecting many mammalian species, including man.
  • the collection of M. bovis strains that was screened for the RD and RvD regions consisted of 2 BCG strains and 18 "classical" M. bovis strains generally characterized by only one or two copies of IS6110 from bovine, llama and human sources in addition to diree goat isolates, three seal isolates, two oryx isolates, and two M. bovis strains from humans that presented a higher number of IS6110 copies.
  • RDs Excluding prophages, the distribution of RDs allowed us to differentiate five main groups among the tested M. bovis strains.
  • the first group was formed by strains that lack RD7, RDS, RD9, and RD10. Representatives of this group are three seal isolates and two human isolates containing between three and five copies of 1S6110 (data not shown).
  • Two oryx isolates harboring between 17 and 20 copies of IS6110 formed the second group that lacked parts of RD5 in addition to RD7-RD10, and very closely resembled the M. microti isolates. However, they did not show RD m ⁇ c , the deletion characteristic of M. microti strains (data not shown).
  • Group three consists of goat isolates that lack regions RD5, RD7, RDS, RD9, RDIO,
  • bovis (21) isolated from cattle from Argentina, the Netherlands, the UK and Spain, as well as from humans (e. g. multi-drug resistant M. bovis from Spain (22)) showed the greatest number of RD deletions and appear to have undergone the greatest loss of DNA relative to other members of the M. tuberculosis complex. These lacked regions RD4, RD5, RD6, RD7, RD8, RD9, RDIO, RD12 and RD13, confirming results obtained with reference strains (5, 6). These strains together with the two BCG strains were the only ones that showed the pncA 51 polymorphism GAC (Asp) in addition to the oxyR 285 mutation (G -> A) characteristic of M. bovis. Analysis of BCG strains indicate that BCG lacked the same RD regions as "classical" M. bovis strains in addition to RDl, RD2 and RDM which apparently occurred during and after the attenuation process (Fig. 4) (6, 23).
  • strains designated as M. bovis showed a single nucleotide polymorphism in the TbDl region at codon 551 (AAG) of the mmpL6 gene, relative to M. canettii, M. africanum and ancestral M. tuberculosis strains, which are characterized by codon AAC.
  • AAG codon 551
  • strains isolated from seals and from oryx with oxyR or pncA loci like those of M. tuberculosis and with fewer deleted regions than the classical M. bovis strains showed the mmpL6 551 AAG polymorphism typical for M. bovis and M. microti (Table 2, Fig. 4).
  • this polymorphism could serve as a very useful genetic marker for the differentiation of strains that lack RD7, RD8, RD9, and RDIO and have been classified as M. bovis or M. africanum, but may differ from other strains ofthe same taxon.
  • M. bovis is the final member of a separate lineage represented by M. africanum (RD9), M. microti (RD7, RDS, RD9, RDIO) and M. bovis (RD4, RD5, RD7, RD8, RD9, RDIO, RD12, RD13) (25) that branched from the progenitor of M. tuberculosis isolates. Successive loss of DNA may have contributed to clonal expansion and the appearance of more successful pathogens in certain new hosts.
  • tuberculosis complex is also a human pathogen. Taken together, this means that those tubercle bacilli, which are thought to most closely resemble the progenitor of M tuberculosis are human and not animal pathogens. It is also interesting that most of these strains were of African or Indian origin (Fig. 3). It is likely that these ancestral strains predominantly originated from endemic foci (15, 26), whereas "modern" M. tuberculosis strains that have lost TbDl may represent epidemic M. tuberculosis strains that were introduced into the same geographical regions more recently as a consequence of the worldwide spread of the tuberculosis epidemic.
  • DNA samples e. g. mycobacterial DNA isolated from a 17,000 year old bison skeleton (31).
  • the mycobacterium whose DNA was amplified showed a spoligotype that was most closely related to patterns of M. africanum and could have been an early representative of the lineage M. africanum — >M bovis.
  • TbDl and RD9 junction sequences that we supply here, PCR analyses of ancient DNAs should enable very focused studies to be undertaken to learn more about the timescale within which the members of the M. tuberculosis complex have evolved.
  • these regions primarily RD9 and TbDl but also RDl, RD2, RD4, RD7, RD8, RD10, RD12 and RD13 represent very interesting candidates for the development of powerful diagnostic tools for the rapid and unambiguous identification of members of the M. tuberculosis complex (32).
  • This genetic approach for differentiation can now be used to replace the often confusing traditional division of the M. tuberculosis complex into rigidly defined subspecies.
  • the members of the M. tuberculosis complex share an unusually high degree of conservation such that the commercially-available nucleic acid probes and amplification assays cannot differentiate these organisms.
  • conventional identification methods are often ambiguous, cumbersome and time consuming because of the slow growth of the organisms.
  • the inventors by a deletion analysis, solve the problem faced by clinical mycobacteriology laboratories for differentiation within the M. tuberculosis complex.
  • This approach allows to perform a diagnostic on a biological fluid by using at least three markers including TbDl.
  • the following table 3 illustrates such a half sufficient to realize the distinction between the members ofthe Mycobacterium complex.
  • Beside TbDl marker preferably at least 2 other markers should be used. Examples of such additional markers available in the literature are listed in the following table 1. Although ancestral sfrains of Mycobacterium tuberculosis represent only 5% of all Mycobacterium tuberculosis strains, persons who would be interested in distinguishing the ancestral strains of Mycobacterium tuberculosis from the srains of Mycobacterium canettii, could consider using the genetic marker RDl 2 in combination with the three markers described in table 3. Because the region RD oan partially overlapped RDl 2 in genome of Mycobacterium canettii, flanking primers as described in table 1 do not hybridize on genomic DNA of Mycobacterium canettii. Therefore, PCR amplification with these flanking primers results in 2.8 kb PCR product in Mycobacterium tuberculosis and no PCR product in Mycobacterium canettii.
  • RDS* Rvl573-Rvl586c 9.2 RD3-Rvl586.int.F RD3-int-REP.F TTA TCT TGG CGT TGA CGA TG CTGACG TCG TTGTCGAGGTA*
  • RDIO Rv0221-Rv0223 1.9 RDlO-intF RDlO-flankF GTA ACC GCT TCA CCG GAA T CTG CAA CCA TCC GGT ACA C
  • RD13mtR RD13-flank R CAC CGG GCT GAT CGA GCG A GGA TCG GCT CAG TGA ATA CC
  • TbDl mmpL6 2.1 TBDlintS.F TBDlflal-F CGT TCAACC CCAAAC AGGTA CTA CCT CAT CTT CCG GTC CA
  • TBDlintS.R TBDlflal-R AAT CGAACT CGTGGAACACC CAT AGA TCC CGG ACA TGG TG katG, gyrA, oxyR',pncA and mmpL6 PCR and sequencing primers katG .'463 * ⁇ /G-2154,225-PCR-F far(G-2154,872-SEQ-R CTA CCA GCA CCG TCA TCT CA ACA AGC TGA TCC ACC GAG AC AGG TCG TAT GGA CGAACA CC gyrA 95 gyn4-7,127-PCR-F gyrA-7,A6W GTT CGT GTG TTG CGT CAA GT CGG GTG CTC TAT GCA ATG TT gyrA- 8,312-PCR-R CAG CTG GGT GTG CTT GTA AA oxyR ;285 oxyR 2725.559F ⁇ Hy ⁇ -2726,024-SEQ-

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Food Science & Technology (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pulmonology (AREA)
  • Oncology (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)

Abstract

The present invention is the identification of a nucleotide sequence which make it possible in particular to distinguish an infection resulting from the vast majority of Mycobacterium tuberculosis strains from an infection resulting from Mycobacterium africanum, Mycobacterium canetti, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG. The subject of the present invention is also a method for detecting the sequences in question by the products of expression of these sequences and the kits for carrying out these methods. Finally, the subject of the present invention is novel vaccines.

Description

DELETED SEQUENCE IN M. TUBERCULOSIS, METHOD FOR DETECTING MYCOBACTERIA USING THESE SEQUENCES AND VACCINES
The present invention pertains to the field of biology, more particularly the subject of the present invention is the identification of a nucleotide sequence which make it possible in particular to distinguish an infection resulting from Mycobacterium tuberculosis from an infection resulting from Mycobacterium africanuvi, Mycobacterium canetti, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG. The subject of the present invention is also a method for detecting the sequences in question by the products of expression of these sequences and the kits for carrying out these methods. Finally, the subject ofthe present invention is novel vaccines.
Despite more than a century of research since the discovery of Mycobacterium tuberculosis, the aetiological agent of tuberculosis, this disease remains one of the major causes of human mortality. M. tuberculosis is expected to kill 3 million people annually (Snider, 1989 Rev. Inf. Dis. S335) and the number of new people getting infected each year is rising and is estimated at 8.8 million. Although the majority of these are in developing countries, the disease is assuming renewed importance in the western countries due to the increasing number of homeless people, the impact of the AIDS epidemic, the changing global migration, and the travel patterns. Early tuberculosis often goes unrecognized in an otherwise healthy individual.
Classical initial methods of diagnosis include examination of a sputum smear under a microscope for acid-fast mycobacteria and an x-ray ofthe lungs. However, in a vast majority of cases the sputum smear examination is negative for Mycobacteria in the early stages of the disease, and lung changes may not be obvious on an x-ray until several months following infection. Another complicating factor is that acid-fast bacteria in a sputum smear may often be other species of mycobacteria. Antibiotics used for treating tuberculosis have considerable side effects, and must be taken as a combination of three or more drugs for a six to twelve month period. In addition, the possibility of inducing the appearance of drug resistant tuberculosis prevents therapy from being administered without solid evidence to support the diagnosis. Currently the only absolutely reliable method of diagnosis is based on culturing M. tuberculosis from the clinical specimen and identifying it morphologically and biochemically. This usually takes anywhere from three to six weeks, during which time a patient may become seriously ill and infect other individuals. Therefore, a rapid test capable of reliably detecting the presence of M. tuberculosis is vital for the early detection and treatment. Several molecular tests have been developed recently for the rapid detection and identification of M. tuberculosis, such as the Gen-Probe "Amplified Mycobacterium tuberculosis Direct Test"; this test amplifies M. tuberculosis 16S ribosomal RNA fromrespiratory specimens and uses a chemiluminescent probe to detect the amplified product with a reported sensitivity of about 91%. The discovery of the IS6110 insertion element (Cave et al., Eisenach et α/.,1990 J. Infectious Diseases 161:977-981; Thierry et al. 1990 J.
Clin. Microbiol. 28: 2668-2673) and the belief that this element may only be present in
Mycobacterium complex (M. tuberculosis, Mbovis, Mbovis-BCG, M. africanum, Mcanettii and M.microti) spawned a whole series of rapid diagnostic strategies (Brisson-Noel et al,
1991 Lancet 338: 364-366; Clarridge et al.1993, J. Clin. Microbiol. 31 :2049-2056 ; Cormican et al. 1992 J. Clin. Pathology 1992, 45 : 601-604 ; Cousins et al., 1992 J. Clin.
Microbiol. 30 : 255-258 ; Del Portillo et al. 1991 J. Clin. Microbiol. 29 : 2163-2168 ;
Folgueira et al., 1994 Neurology 44 :1336-1338 ; Forbes et al. 1993, J.Clin.Microbiol.
31 :1688-1694 ; Hermans et al. 1990 J. Clin. Microbiol. 28 :1204-1213 ; Kaltwasser et al. 1993 Mol. Cell. Probes 7 : 465-470 ; Kocagoz et al. 1993 J. Clin. Microbiol. 31 : 1435-1438 ; Kolk et al. 1992 J.ClinMicrobiol. 30 : 2567-2575 ; Kox et al. 1994 J.Clin.Microbiol.
32 :672-678 ; Liu et al. 1994 Neurology 44 : 1161-1164 ; Miller et al. 1994 J. Clin.Microbiol. 32 : 393-397 ; Reischl et al. 1994 Biotechniques 17 :844-845 ; Schluger et al. 1994 Chest 105 :1116-1121 ; Shawar et al. 1993 J. Clin. Microbiol. 31: 61-65; Wilson et al 1993 J.Clin.Microbiol. 28: 2668-2673). These tests employ various techniques to extract DNA from the sputum. PCR is used to amplify IS6110 DNA sequences from the extracted DNA. The successful amplification of this DNA is considered to be an indicator ofthe presence of MΛuberculosis infection. U.S. Pat. Nos. 5,168,039 and 5,370,998 have been issued to Crawford et al. for the IS6110 based detection of tuberculosis. European patent EP 0,461,045 has been issued to Guesdon for the IS6110 based detection of tuberculosis. Thus, these molecular assays used to detect M. tuberculosis depend on the IS6110 insertion sequence (about 10 copies) or the 16S ribosomal RNA (thousands of copies). However, these methods do not provide any information regarding the sub-type of the mycobacteria. Indeed several dozen species of Mycobacteria are known, and most are non- pathogenic for humans; tuberculosis is usually caused by infection due to M. tuberculosis, with a few cases being caused by M. bovis, M anettii, and M. africanum. In order to choose an appropriate treatment and to conduct epidemiological investigations it is absolutely necessary to be able to rapidly and accurately identify isolates, i.e to distinguish the sub-type of mycobacteria of the Mycobacterium complex, originating from potential tuberculosis patients. That's the problem the present invention intends to solve. The present invention provides an isolated or purified nucleic acid from Mycobacterium complex wherein said nucleic acid is selected from the group consisting of: a) SEQ ID N° 1 , named TbD 1 region ; b) Nucleic acid having a sequence fully complementary to SEQ ID N° 1. c) Nucleic acid fragment comprising at least 8, 12, 15, 20, 25, 30, 50, 100, 250,
500, 750, 1000, 1500, 2000, 2500, 3000 consecutive nucleotides of SEQ ID
N°l; d) Nucleic acid having at least 90% sequence identity after optimal alignment with a sequence defined in a) or b); e) Nucleic acid that hybridizes under stringent conditions with the nucleic acid defined in a) or b);
As used herein, the teπns « isolated » and « purified » according to the invention refer to a level of purity that is achievable using current technology. The molecules of the invention do not need to be absolutely pure (i.e., contain absolutely no molecules of other cellular macromolecules), but should be sufficiently pure so that one of ordinary skill in the art would recognize that they are no longer present in the environment in which they were originally found (i.e., the cellular middle). Thus, a purified or isolated molecule according to the present invention is one that have been removed from at least one other macromolecule present in the natural environment in which it was found. More preferably, the molecules of the invention are essentially purified and/or isolated, which means that the composition in which they are present is almost completely, or even absolutely, free of other macromolecules found in the environment in which the molecules of the invention are originally found. Isolation and purification thus does not occur by addition or removal of salts, solvents, or elements of the periodic table, but must include the removal of at least some macromolecules. The nucleic acids encompassed by the invention are purified and/or isolated by any appropriate technique known to the ordinary artisan. Such techniques are widely known, commonly practiced, and well within the skill ofthe ordinary artisan. As used herein, the term " nucleic acid" refers to a polynucleotide sequence such as a single or double stranded DNA sequence, RNA sequence, cDNA sequence; such a polynucleotide sequence has been isolated, purified or synthesized and may be constituted with natural or non natural nucleotides. In a preferred embodiment the DNA molecule of the invention is a double stranded DNA molecule. As used herein, the terms "nucleic acid", "oligonucleotide",
"polynucleotide" have the same meaning and are used indifferently.
By the term "Mycobacterium complex" as used herein, it is meant the complex of mycobacteria causing tuberculosis which are Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium microti, Mycobacterium canettii and the vaccine strain Mycobacterium bovis BCG.
The present invention encompasses not only the entire sequence SEQ ID N°l, its complement, and its double-stranded form, but any fragment of this sequence, its complement, and its double-stranded foπn.
In embodiments, the fragment of SEQ ID N°l comprises at least approximately 8 nucleotides. For example, the fragment can be between approximately 8 and 30 nucleotides and can be designed as a primer for polynucleotide synthesis. In another preferred embodiment, the fragment of SEQ ID N°l comprises between approximately 1,500 and approximately 2,500 nucleotides, and more preferably 2153 nucleotides corresponding to SEQ ID N°4 (see figure 5). As used herein, "nucleotides" is used in reference to the number of nucleotides on a single-stranded nucleic acid. However, the term also encompasses double-stranded molecules. Thus, a fragment comprising 2,153 nucleotides according to the invention is a single-stranded molecule comprising 2,153 nucleotides, and also a double stranded molecule comprising 2153 base pairs (bp).
In a preferred embodiment, the nucleic acid fragment ofthe invention is specifically deleted in the genome of Mycobacterium tuberculosis, excepted in Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their, genome and present in the genome of Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG. By the teπn "few IS6110 sequences inserted in the genome", it is meant less than ten copies in the genome of M tuberculosis, more preferably less than 5 copies, for example less than two copies.
The nucleic acid fragment of the invention is preferably selected from the group consisting of: a) SEQ ID N04; b) Nucleic acid having a sequence fully complementary to SEQ ID N°4. c) Nucleic acid fragment comprising at least 8, 12, 15, 20, 25, 30, 50, 100, 250, 500, 750, 1000, 1500, 2000, 2500, 3000 consecutive nucleotides of SEQ ID N°4; d) Nucleic acid having at least 90% sequence identity after optimal alignment with a sequence defined in a) or b); e) Nucleic acid that hybridizes under stringent conditions with the nucleic acid defined in a) or b).
In embodiments, the stringent conditions under which a sequence according to the invention is determined are conditions which are no less stringent than 5X SSPE, 2X Denhardt's solution, and 0.5% (w/v) sodium dodecyl sulfate at 65°C. More stringent conditions can be utilized by the ordinary artisan, and the proper conditions for a given assay can be easily and rapidly determined without undue or excessive experimentation. As an illustrative embodiment, the stringent hybridization conditions used in order to specifically detect a polynucleotide according to the present invention are advantageously the following: pre-hybridization and hybridization are performed at 65°C in a mixture containing:
- 5X SSPE (IX SSPE is 3 M NaCl, 30 mM tri-sodium citrate)
- 2X Denhardt's solution
- 0.5% (w/v) sodium dodecyl sulfate (SDS) - 100 μg ml"1 salmon sperm DNA.
The washings are performed as follows:
- two washings at laboratory temperature (approximately 21-25°C) for 10 min. in the presence of 2X SSPE and 0.1% SDS; and
- one washing at 65°C for 15 min. in the presence of IX SSPE and 0.1% SDS.
The invention also encompasses the isolated or purified nucleic acid of the invention wherein said nucleic acid comprises at least a deletion of a nucleic acid fragment as defined above. Preferably, such an isolated or purified nucleic acid of the invention is the SEQ ID N°21 that corresponds to SEQ ID N°l in which SEQ ID N°4 is deleted (absent).
Polynucleotides of the invention can be characterized by the percentage of identity they show with the sequences disclosed herein. For example, polynucleotides having at least 90% identity with the polynucleotides of the invention, particularly those sequences of the sequence listing, are encompassed by the invention. Preferably, the sequences show at least 90% identity with those of the sequence listing. More preferably, they show at least 92% identity, for example 95% or 99% identity. The skilled artisan can identify sequences according to the invention through the use ofthe sequence analysis software BLAST (see for example, Coffin et al., eds., "Retroviruses", Cold Spring Harbor Laboratory Press, pp. 723- 755). Percent identity is calculated using the BLAST sequence analysis program suite, Version 2, available at the NCBI (NIH). All default parameters are used. BLAST (Basic Local Alignment Search Tool) is the heuristic search algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx, all of which are available through the BLAST analysis software suite at the NCBI. These programs ascribe significance to their findings using the statistical methods of Karlin and Altschul (1990, 1993) with a few enhancements. Using this publicly available sequence analysis program suite, the skilled artisan can easily identify polynucleotides according to the present invention.
It is well within the skill ofthe ordinary artisan to identify regions ofthe nucleic acid sequence of the invention, which would be useful as a probe, primer, or other experimental, diagnostic, or therapeutic aid. For example, the ordinary artisan could utilize any of the widely available sequence analysis programs to select regions (fragments) of these sequences that are useful for hybridization assays such as Southern blots, Northern blots, DNA binding assays, and/or in vitro, in situ, or in vivo hybridizations. Additionally, the ordinary artisan, with the sequences of the present invention, can utilize widely available sequence analysis programs to identify regions that can be used as probes and primers, as well as for design of anti-sense molecules. The only practical limitation on the fragment chosen by the ordinary artisan is the ability of the fragment to be useful for the purpose for which it is chosen. For example, if the ordinary artisan wished to choose a hybridization probe, he would know how to choose one of sufficient length, and of sufficient stability, to give meaningful results. The conditions chosen would be those typically used in hybridization assays developed for nucleic acid fragments ofthe approximate chosen length.
Thus, the present invention provides short oligonucleotides, such as those useful as probes and primers. In embodiments, the probe and/or primer comprises 8 to 30 consecutive nucleotides of the polynucleotide according to the invention or the polynucleotide complementary thereto. Advantageously, a fragment as defined herein has a length of at least 8 nucleotides, which is approximately the minimal length that has been determined to allow specific hybridization. Preferably the nucleic fragment has a length of at least 12 nucleotides and more preferably 20 consecutive nucleotides of any of SEQ ID N°l or SEQ ID N°4. The sequence ofthe oligonucleotide can be any ofthe many possible sequences according to the invention. Preferably, the sequence is selected from the following group SEQ ID N° 13, SEQ ID N° 14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18. More precisely, the primers SEQ ID N°13, SEQ ID N°14, SEQ ID N°15 and SEQ ID N°16 are contained in the nucleic acid fragment SEQ ID N°4. The primers SEQ ID N°17 and SEQ ID N°18 are contained in the nucleic acid sequence SEQ ID N°l and are flanking the nucleic acid fragment of SEQ ID N°4 (see figure 5).
Thus, the polynucleotides of SEQ ID N°l and SEQ ID N°4, and their fragments, can be used to select nucleotide primers, notably for an amplification reaction, such as the amplification reactions further described.
PCR is described in US Patent No. 4,683,202, which is incorporated in its entirety herein. The amplified fragments may be identified by agarose or polyacrylamide gel electrophoresis, by a capillary electrophoresis, or alternatively by a chromatography technique (gel filtration, hydrophobic chromatography, or ion exchange chromatography). The specificity of the amplification can be ensured by a molecular hybridization using as nucleic probes the polynucleotides of SEQ ID N°l or SEQ ID N°4, and their fragments, oligonucleotides that are complementary to these polynucleotides or fragments thereof, or their amplification products themselves, and/or even by DNA sequencing.
The following other techniques related to nucleic acid amplification may also be used and are generally preferred to the PCR technique. The Strand Displacement Amplification (SDA) technique is an isothermal amplification technique based on the ability of a restriction enzyme to cleave one of the strands at a recognition site (which is under a hemiphosphorothioate form) and on the property of a DNA polymerase to initiate the synthesis of a new strand from the 3'OH end generated by the restriction enzyme and on the property of this DNA polymerase to displace the previously synthesized strand being localized downstream. The SDA amplification technique is more easily performed than PCR (a single thermostatted water bath device is necessary), and is faster than the other amplification methods. Thus, the present invention also comprises using the nucleic acid fragments according to the invention (primers) in a method of DNA or RNA amplification according to the SDA technique.
When the target polynucleotide to be detected is a RNA, for example a mRNA, a reverse transcriptase enzyme will be used before the amplification reaction in order to obtain a cDNA from the RNA contained in the biological sample. The generated cDNA is subsequently used as the nucleic acid target for the primers or the probes used in an amplification process or a detection process according to the present invention.
The non-labeled polynucleotides or oligonucleotides ofthe invention can be directly used as probes. Nevertlieless, the polynucleotides or oligonucleotides are generally labeled with a radioactive element ( P, S, H, I) or by a non-isotopic molecule (for example, biotin, acetylaminofluorene, digoxigenin, 5-bromodesoxyuridine, fluorescein) in order to generate probes that are useful for numerous applications. Examples of non-radioactive labeling of nucleic acid fragments are described in French patent N° FR 78 10975 and by Urdea et al. (1988, Nucleic Acids Research 11:4937-4957) or Sanchez-Pescador et al. (1988, J. Clin. Microbiol. 26(10):1934-1938), the disclosures of which are hereby incorporated in their entirety. Other labeling techniques can also be used, such as those described in French patents FR 2 422 956 and FR 2 518 755. The hybridization step may be performed in different ways. See, for example, Matthews et al, 1988, Anal. Biochem. 169:1-25. A general method comprises immobilizing the nucleic acid that has been extracted from the biological sample on a substrate (for example, nitrocellulose, nylon, polystyrene) and then incubating, in defined conditions, the target nucleic acid with the probe. Subsequent to the hybridization step, the excess amount of the specific probe is discarded and the hybrid molecules formed are detected by an appropriate method (radioactivity, fluorescence or enzyme activity measurement, etc.).
Amplified nucleotide fragments are useful, among other things, as probes used in hybridization reactions in order to detect the presence of one polynucleotide according to the present invention or in order to detect mutations. The primers may also be used as oligonucleotide probes to specifically detect a polynucleotide according to the invention. The oligonucleotide probes according to the present invention may also be used in a detection device comprising a matrix library of probes immobilized on a substrate, the sequence of each probe of a given length being localized in a shift of one or several bases, one from the other, each probe of the matrix library thus being complementary to a distinct sequence ofthe target nucleic acid. Optionally, the substrate ofthe matrix may be a material able to act as an electron donor, the detection of the matrix positions in which an hybridization has occurred being subsequently determined by an electronic device. Such matrix libraries of probes and methods of specific detection of a target nucleic acid is described in the European patent application N° EP-0 713 016 (Affymax technologies) and also in the US patent N° US-5,202,231 (Drmanac). Since almost the whole length of a mycobacterial chromosome is covered by BAC-based genomic DNA library (i.e. 97% ofthe M tuberculosis chromosome is covered by the BAC library 1-1945), these DNA libraries will play an important role in a plurality of post-genomic applications, such as in mycobacterial gene expression studies where the canonical set of BACs could be used as a matrix for hybridization studies. Thus it is also in the scope of the invention to provide a nucleic acid chips, more precisely a DNA chips or a protein chips that respectively comprises a nucleic acid or a polypeptide ofthe invention.
The present invention is also providing a vector comprising the isolated DNA molecule ofthe invention. A "vector " is a replicon in which another polynucleotide segment is attached, so as to bring the replication and/or expression to the attached segment. A vector can have one or more restriction endonuclease recognition sites at which the DNA sequences can be cut in a determinable fashion without loss of an essential biological function of the vector, and into which a DNA fragment can be spliced in order to bring about its replication and cloning. Vectors can further provide primer sites (e.g. for PCR), transcriptional and/or translational initiation and/or regulation sites, recombinational signals, replicons, selectable markers, etc. Beside the use of homologous recombination or restriction enzymes to insert a desired DNA fragment into the vector, UDG cloning of PCR fragments (US Pat. No. 5,334,575), T:A cloning, and the like can also be applied. The cloning vector can further contain a selectable marker suitable for use in the identification of cells transformed with the cloning vector. The vector can be any useful vector known to the ordinary artisan, including, but not limited to, a cloning vector, an insertion vector, or an expression vector. Examples of vectors include plasmids, phages, cosmids, phagemid, yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), human artificial chromosome (HAC), viral vector, such as adenoviral vector, retroviral vector, and other DNA sequences which are able to replicate or to be replicated in vitro or in a host cell, or to convey a desired DNA segment to a desired location within a host cell.
According to a preferred embodiment of the invention, the recombinant vector is a BAC pBeloBACl l in which the genomic region of Mycobacterium bovis-BCG 1173P3 that spans the region corresponding to the locus 1,760,753 bp to 1,830,364 bp in the genome of M tuberculosis H37Rv has been inserted into the Hindlll restriction site; this recombinant vector is named X229. In this region, the inventors have demonstrated the deletion of a 2153 bp fragment, corresponding to SEQ ID N°4, in the vast majority of M. tuberculosis strains excepted strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome. That's the reason why the inventors named this deletion of 2153 bp TbDl ("M tuberculosis specific deletion 1"). TbDl is flanked by the sequence GGC CTG GTC AAA CGC GGC TGG ATG CTG and AGA TCC GTC TTT GAC ACG ATC GAC G. External primers hybridizing with such sequences outside TbDl or the complementary sequences thereof can be used for the amplification of TbDl to check for the presence or the absence of the deletion of the TbDl. The inventors design for example the following primers:
5'- CTA CCT CAT CTT CCG GTC CA-3' (SEQ ID N°17) 5'- CAT AGA TCC CGG ACA TGG TG-3'(SEQ ID N°18) In order to get a specific 500 pb probe for hybridization experiments, a PCR amplification of a fragment comprised in TbDl may be realized by using the plasmid X229 as a matrix. The amplification of a fragment of approximatively 500 bp contained in TbDl can be performed by using the following primers:
5'- CGT TCA ACC CCA AAC AGG TA-3' (SEQ ID N°13) 5'- AAT CGA ACT CGT GGA ACA CC-3' (SEQ ID N°14) The amplification of a fragment of approximatively 2,000 bp contained in TbDl can be performed by using the following primers: 5'- ATT CAG CGT CTA TCG GTT GC-3' (SEQ ID N°15) 5'- AGC AGC TCG GGA TAT CGT AG-3' (SEQ ID N°16) The PCR conditions are the following: denaturation 95 °C 1 min, then 35 cycles of amplification [95°C during 30 seconds, 58°C during 1 min] , then elongation 72°C during 4 min.
Thus, this invention also concerns a recombinant cell host which contains a polynucleotide or recombinant vector according to the invention. The cell host can be transformed or transfected with a polynucleotide or recombinant vector to provide transient, stable, or controlled expression of the desired polynucleotide. For example, the polynucleotide of interest can be subcloned into an expression plasmid at a cloning site downstream from a promoter in the plasmid and the plasmid can be introduced into a host cell where expression can occur. The recombinant host cell can be any suitable host known to the skilled artisan, such as a eukaryotic cell or a microorganism. For example, the host can be a cell selected from the group consisting of Escherichia coli, Bacillus subtilis, insect cells, and yeasts. According to a preferred embodiment ofthe invention, the recombinant cell host is a commercially available Escherichia coli DH10B (Gibco) containing the BAC named X229 previously described. This Escherichia coli DH10B (Gibco) containing the BAC named X229 has been deposited with the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, Paris, France, on February 18th, 2002 under number CNCM 1-2799.
Another aspect of the invention is the product of expression of all or part of the nucleic acid according to the invention, including the nucleic acid fragment specifically deleted in the genome of Mycobacterium tuberculosis, excepted in Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome as defined previously. The expression "product of expression" is understood to mean any isolated or purified protein, polypeptide or polypeptide fragment resulting from the expression of all or part of the above-mentioned nucleotide sequences. Among those product of expression, one can cite the membrane protein mmpL6 corresponding to SEQ ID N°6, the membrane protein mmpS6 corresponding to SEQ ID N°3 or SEQ ID N°10 (the two sequences SEQ ID N°3 and SEQ ID N°10 are identical), and their truncated or rearranged forms due to the deletion of a nucleic acid fragment according to the invention. For example, SEQ ID N°8 is a truncated form of mmpL6 protein, SEQ ID N°12 is a truncated form of mmpS6 protein and SEQ ID N°22 is a fusion product [mmpS6-mmpL6] of both rearranged mmpL6 and mmpS6 proteins. It is now easy to produce proteins in large amounts by genetic engineering techniques through the use of expression vectors, such as plasmids, phages, and phagemids. The polypeptide of the present invention can be produced by insertion of the appropriate polynucleotide into an appropriate expression vector at the appropriate position within the vector. Such manipulation of polynucleotides is well known and widely practiced by the ordinary artisan. The polypeptide can be produced from these recombinant vectors either in vitro or in vivo. All the isolated or purified nucleic acids encoding the polypeptide of the invention are in the scope ofthe invention. The polypeptide ofthe invention is a polypeptide encoded by a polynucleotide which hybridizes to any of SEQ ID N°l or N°4 under stringent conditions, as defined herein.
More preferably, said isolated or purified nucleic acid according the invention is selected among:
- the mmpL6 gene of sequence SEQ ID N°5 contained in SEQ ID N°l and encoding the mmpL6 protein of sequence SEQ ID N°6; - the truncated form of mmpL6 gene of sequence SEQ ID N°7 contained in TbDl of sequence SEQ ID N°4 and encoding a truncated form of mmpL6 protein of sequence SEQ ID N°8;
- the mmpS6 gene of sequence SEQ ID N°9 contained in SEQ ID N°l and encoding the mmpS6 protein of SEQ ID N°10; - the truncated form of mmpS6 gene of sequence SEQ ID N°l 1 contained in TbDl of sequence SEQ ID N°4 and encoding a truncated form of mmpS6 protein of SEQ ID N°12.
- the chimeric gene of SEQ ID N°21 issued from fusion of both truncated mmpS6 and mmpL6 genes due to the deletion of TbDl in the genome of M. tuberculosis excepted strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome. This chimeric gene encodes the fusion polypeptide [mmpS6-mmpL6] of sequence SEQ ID N°22.
The present invention also provides a method for the discriminatory detection and identification of:
- Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome; versus,
- Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG in a biological sample, comprising the following steps: a) isolation of the DNA from the biological sample to be analyzed or production of a cDNA from the RNA ofthe biological sample, b) detection ofthe nucleic acid sequences ofthe mycobacterium present in said biological sample, c) analysis for the presence or the absence of a nucleic acid fragment specifically deleted in the genome of Mycobacterium tuberculosis, excepted in Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, as previously described.
By a biological sample according to the present invention, it is notably intended a biological fluid, such as sputum, saliva, plasma, blood, urine or sperm, or a tissue, such as a biopsy.
Analysis of the desired sequences may, for example, be carried out by agarose gel electrophoresis. If the presence of a DNA fragment migrating to the expected site is observed, it can be concluded that the analyzed sample contained mycobacterial DNA. This analysis can also be carried out by the molecular hybridization technique using a nucleic probe. This probe will be advantageously labeled with a nonradioactive (cold probe) or radioactive element. Advantageously, the detection of the mycobacterial DNA sequences will be carried out using nucleotide sequences complementary to said DNA sequences. By way of example, they may include labeled or nonlabeled nucleotide probes; they may also include primers for amplification. The amplification technique used may be PCR but also other alternative techniques such as the SDA (Strand Displacement Amplification) technique, the TAS technique (Transcription-based Amplification System), the NASBA (Nucleic Acid Sequence Based Amplification) technique or the TMA (Transcription Mediated Amplification) technique.
The primers in accordance witii the invention have a nucleotide sequence chosen from the group comprising SEQ ID N° 13, SEQ ID N° 14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18. The primers SEQ ID N°13, SEQ ID N°14, SEQ ID N°15 and SEQ ID N°16 are contained in the nucleic acid fragment SEQ ID N°4, and the primers SEQ ID N°17 and SEQ ID N°18 are contained in the nucleic acid of the invention SEQ ID N°l but not in the nucleic acid fragment SEQ ID N°4.
In a variant, the subject of the invention is also a method for the discriminatory detection and identification of: - Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome; versus,
- Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG in a biological sample, comprising the following steps: a) bringing the biological sample to be analyzed into contact with at least one pair of primers as defined above, the DNA contained in the sample having been, where appropriate, made accessible to the hybridization beforehand, b) amplification ofthe DNA ofthe mycobacterium, c) visualization ofthe amplification ofthe DNA fragments.
The amplified fragments may be identified by agarose or polyacrylamide gel electrophoresis by capillary electrophoresis or by a chromatographic technique (gel filtration, hydrophobic chromatography or ion-exchange chromatography). The specification of the amplification may be controlled by molecular hybridization using probes, plasmids containing these sequences or their product of amplification. The amplified nucleotide fragments may be used as reagent in hybridization reactions in order to detect the presence, in a biological sample, of a target nucleic acid having sequences complementary to those of said amplified nucleotide fragments. These probes and amplicons may be labeled or otherwise with radioactive elements or with nonradioactive molecules such as enzymes or fluorescent elements.
The subject ofthe present invention is also a kit for the discriminatory detection and identification of:
- Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome; versus,
- Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG in a biological sample, in a biological sample comprising the following elements: a) at least one pair of primers as defined previously, b) the reagents necessary to carry out a DNA amplification reaction, c) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
Indeed, in the context of the present invention, depending on the pair of primers used, it is possible to obtain very different results. Thus, the use of primers which are contained in the TbDl deletion, such as for example SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, is such that no amplification product is detectable in M. tuberculosis excepted in strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences in their genome, and that amplification product is detectable in Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome. The use of a pair of primers outside the TbDl deletion such as SEQ ID N°17 and SEQ ID N°18 is likely to give rise to an amplicon in Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, of about 2100 bp whereas the use of the pair of primers outside the TbDl deletion will give rise in M. tuberculosis excepted in strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, to an amplicon of about few bp.
More generally, the invention pertains to the use of at least one pair of primers as defined previously for the amplification of a DNA sequence from Mycobacterium tuberculosis or Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome.
Indeed, the subject of the present invention is also a method for the in vitro discriminatory detection of antibodies directed against Mycobacterium tuberculosis excepted Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome versus antibodies directed against Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few 7S6110 sequences inserted in their genome, in a biological sample, comprising the following steps: a) bringing the biological sample into contact with at least one product of expression of all or part of the nucleic acid fragment specifically deleted in M. tuberculosis excepted in strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, as previously defined, b) detecting the antigen-antibody complex formed.
The subject of the present invention is also a method for the in vitro discriminatory detection of a vaccination with Mycobacterium bovis BCG, an infection by M. bovis, M. canettii, M. microti, M. africanum or M. tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, versus an infection by Mycobacterium tuberculosis, excepted by Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome in a mammal, comprising the following steps: a) preparation of a biological sample containing cells, more particularly cells of the immune system of said mammal and more particularly T cells, b) incubation of the biological sample of step a) with at least one product of expression of all or part of the nucleic acid fragment specifically deleted in M. tuberculosis excepted in strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, as previously defined, c) detection of a cellular reaction indicating prior sensitization of the mammal to said product, in particular cell proliferation and/or synthesis of proteins such as gamma- interferon. Cell proliferation may be measured, for example, by incorporating 3H-Thymidine.
The invention also relates to a kit for the in vitro discriminatory diagnosis of a vaccination with M. bovis BCG, an infection by M. bovis, M. canettii, M. microti, M. africanum versus an infection by M. tuberculosis excepted by strains having the sequence
CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a mammal comprising: a) a product of expression of all or part of the nucleic acid fragment specifically deleted in M. tuberculosis excepted in strains of M tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, as previously defined , b) where appropriate, the reagents for the constitution of the medium suitable for the immunological reaction, c) the reagents allowing the detection of the antigen-antibody complexes produced by the immunological reaction, d) where appropriate, a reference biological sample (negative control) free of antibodies recognized by said product, e) where appropriate, a reference biological sample (positive control) containing a predetermined quantity of antibodies recognized by said product. The reagents allowing the detection of the antigen-antibody complexes may carry a marker or may be capable of being recognized in turn by a labeled reagent, more particularly in the case where the antibody used is not labeled.
The subject of the invention is also mono- or polyclonal antibodies, their chimeric fragments or antibodies, capable of specifically recognizing a product of expression in accordance with the present invention.
The present invention therefore also relates to a method for the in vitro discriminatory detection of the presence of an antigen of Mycobacterium tuberculosis excepted of strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, versus the presence of an antigen of Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis-BCG and Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a biological sample comprising the following steps: a) bringing the biological sample into contact with an antibody ofthe invention, b) detecting the antigen-antibody complex formed. The invention also relates to a kit for the discriminatory detection ofthe presence of an antigen of Mycobacterium tuberculosis excepted strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few 7S6110 sequences inserted in their genome versus the presence of an antigen of Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a biological sample comprising the following steps: a) an antibody as previously claimed , b) the reagents for constituting the medium suitable for the immunological reaction, c) the reagents allowing the detection of the antigen-antibody complexes produced by the immunological reaction.
The above-mentioned reagents are well known to a person skilled in the art who will have no difficulty adapting them to the context ofthe present invention.
The subject of the invention is also an immunogenic composition, characterized in that it comprises at least one product of expression in accordance with the invention. Such an immunogenic composition will be used to protect animals and humans against infections by M. africanum, M. bovis, M. canettii, M. microti and M. tuberculosis. In a particular embodiment, such an immunogenic composition will comprise a product of expression of all or part ofthe nucleic fragment specifically deleted in the genome of Mycobacterium tuberculosis, excepted in Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome. And in a preferable embodiement, such an immunogenic composition will comprise a product of expression of all or part of TbDl. In this case, such an immunogenic composition will be used to protect animals and humans against infections by M. africanum, M. bovis, M. canettii, M. microti and M. tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome.
In an other particular embodiment, such an immunogenic composition will comprise the fusion product [mmpS6-mmpL6] of SEQ ID N°22. This fusion product is due to the absence of TbDl in M. tuberculosis excepted strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome. An immunogenic composition comprising this fusion product will be used to protect animals and humans specifically against infection by the vast majority of M. tuberculosis strains excepted strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome.
Advantageously, the immunogenic composition in accordance with the invention enters into the composition of a vaccine when it is provided in combination with a pharmaceutically acceptable vehicle and optionally with one or more immunity adjuvant(s) such as alum or a representative of the family of muramylpeptides or incomplete Freund's adjuvant.
The invention also relates to a vaccine comprising at least one product of expression in accordance with the invention in combination with a pharmaceutically compatible vehicle and, where appropriate, one or more appropriate immunity adjuvant(s).
The invention also provide an in vitro method for the detection and identification of Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome in a biological sample, comprising the following steps: a) isolation of the DNA from the biological sample to be analyzed or production of a cDNA from the RNA ofthe biological sample, b) detection ofthe nucleic acid sequences ofthe mycobacterium present in said biological sample, c) analysis for the presence or the absence of a nucleic acid fragment of the invention.
In another embodiment, the invention provides an in vitro method for the detection and identification of Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few
IS6110 sequences inserted in their genome in a biological sample, comprising the following steps: a) bringing the biological sample to be analyzed into contact with at least one pair of primers selected among nucleic acid fragments of the invention, and more preferably selected among the primers chosen from the group comprising SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18, the DNA contained in the sample having been, where appropriate, made accessible to the hybridization beforehand, b) amplification ofthe DNA ofthe mycobacterium, c) visualization ofthe amplification ofthe DNA fragments. The invention also provides a kit for the detection and identification of
Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome in a biological sample, comprising the following elements: a) at least one pair of primers selected among nucleic acid fragments of the invention, and more preferably selected among the primers chosen from the group comprising SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18, b) the reagents necessary to carry out a DNA amplification reaction, c) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
The invention also relates to a method for the in vitro detection of antibodies directed against Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a biological sample, comprising the following steps: a) bringing the biological sample into contact with at least one product of expression of all or part of the nucleic acid fragment specifically deleted in M. tuberculosis excepted in strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, b) detecting the antigen-antibody complex formed. It is also a goal of the invention to use the TbDl deletion as a genetic marker for the differentiation of Mycobacterium strains of Mycobacterium complex.
It is also a goal ofthe invention to use mmpL6551 polymorphism as a genetic marker for the differentiation of Mycobacterium strains of Mycobacterium complex. The use of such genetic marker(s) in association with at least one genetic marker selected among RD1, RD2, RD3, RD4, RD5, RD6, RD7, RD8, RD9, RD10, RD11, RD13, RD14, RvDl, RvD2, RvD3, RvD4, RvD5, katG463, gyrA95, oxyR'285, pncA57 and the specific insertion element of M. canettii (IS canettii) allows the differentiation of Mycobacterium strains of Mycobacterium complex (see example 4). The present invention provides an in vitro method for the detection and identification of Mycobacteria from the Mycobacterium complex in a biological sample, comprising the following steps: a) analysis for the presence or the absence of a nucleic acid fragment specifically deleted in M. tuberculosis excepted in strains of M. tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, and b) analysis of at least one additional genetic marker selected among RDl, RD2, RD3,
RD4, RD5, RD6, RD7, RD8, RD9, RD10, RD11, RD13, RD14, RvDl, RvD2, RvD3, RvD4, RvD5, katG463, gyrA95, oxyR'285, pncA57, the specific insertion element of M. canettii.
In a preferred embodiment, two additional markers are used, preferably RD4 and RD9. The analysis is performed by a technique selected among sequence hybridization, nucleic acid amplification, antigen-antibody complex.
It is also a goal of the present invention to provide a kit for the detection and identification of Mycobacteria from the Mycobacterium complex in a biological sample comprising the following elements: a) at least one pair of primers selected among nucleic acid fragments of the invention, and more preferably selected among the primers chosen from the group comprising SEQ ID N013, SEQ IDN°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18, b) at least one pair of primers specific of the genetic markers selected among RDl, RD2, RD3, RD4, RD5, RD6, RD7, RD8, RD9, RD10, RD11, RD13, RD14, RvDl, RvD2, RvD3, RvD4, RvD5, katG463, gyrA95, oxyR'285, pncA57, the specific insertion element of M. canettii. c) the reagents necessary to carry out a DNA amplification reaction, d) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
In a preferred embodiment, the kit comprises the following elements: a) at least one pair of primers selected among nucleic acid fragments of the invention, and more preferably selected among the primers chosen from the group comprising SEQ ID °13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N018, b) one pair of primers specific ofthe genetic marker RD4, c) one pair of primers specific of the genetic marker RD9, d) the reagents necessary to carry out a DNA amplification reaction, e) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
The figures and examples presented below are provided as further guide to the practitioner of ordinary skill in the art and are not to be construed as limiting the invention in anyway.
FIGURES
Figure 1 : Amplicons obtained from strains that have the indicated genomic region present or deleted. Sizes of amplicons in each group are uniform. Numbers correspond to strain designation used in Kremer et al. (1999, J. Clin Microbiol. 37: 2607-2618) (Ref. 8) and Supply et al (2001, J. Clin. Microbiol. 39: 3563-3571) (ref.9).
Figure 2 : Sequences in the TbDl region obtained from strains of various geographic regions.
* refers to groups based on katG^^/gyrA095 sequence polymorphism defined by Sreevatsan and colleagues (Ref. 2). Numbers correspond to strain designation used in Kremer et al. (1999, J. Clin Microbiol. 37: 2607-2618) (Ref. 8) and Supply et al (2001, J. Clin. Microbiol. 39: 3563-3571) (ref.9). Figure 3 : Spoligotypes of selected M. tuberculosis and M. bovis strains. Numbers correspond to strain designation used in Kremer et al. (1999, J. Clin Microbiol. 37: 2607- 2618) (Ref. 8) and Supply et al (2001, J. Clin. Microbiol. 39: 3563-3571) (ref.9).
Figure 4 : Scheme of the proposed evolutionary pathway of the tubercle bacilli illustrating successive loss of DNA in certain lineages (grey boxes). The scheme is based on presence or absence of conserved deleted regions and on sequence polymorphisms in five selected genes. Note that the distances between certain branches may not correspond to actual phylogenetic differences calculated by other methods. Dark arrows indicate that strains are characterized by katG0463 CTG (Leu), gyrAc95 ACC (Thr), typical for group 1 organisms. Arrows with white lines indicate that strains belong to group 2 characterized by katG0463 CGG (Arg), gyrAc95 ACC (Thr). The arrow with white boxes indicates that strains belong to group 3, charcterized by katG0463 CGG (Arg), gyrA095 AGC (Ser), as defined by Sreevatsan and colleagues (Sreevastan et al., 1997 Proc. Natl. Acad.Sci USA 151: 9869-9874) (Ref. 2).
Figure 5 : Scheme ofthe TbDl deletion and surrounding region in Mycobacterium complex. A : Scheme of TbDl and surrounding region in genome of M. bovis, M. bovis BCG, M. africanum, M. canettii, M. microti and ancestral strains of M. tuberculosis characterized by having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome. The mmpL6 gene, the mmpS6 gene, the different primers, the different nucleic acid fragments and polypeptides coded by them are approximately localized in the region. The 2153 pb deletion named TbDl, specifically deleted in M tuberculosis excepted in ancestral strains of M tuberculosis, is delimited by its two end points.
B : Scheme of TbDl and surrounding region in genome of M. tuberculosis excepted ancestral strains of M. tuberculosis. Positions ofthe TbDl deletion and ofthe nucleic acid of sequence SEQ ID N°l in the genome of M tuberculosis strain H37Rv are marked below the scheme. An chimeric ORF [mmpS6-mmpL6 resulting from the absence of TbDl is drawn, the sequence of this chimeric ORF, SEQ ID N°21 and the sequence of the encoded polypeptide, SEQ ID N°22, are approximately localized above the scheme.
Figure 6 : Sequence of the specific insertion element in genome of Mycobacterium canettii strains. The beginning of this insertion element is at position 399 and the end of this insertion element is at position 2378. This insertion element contains the coding sequence of a putative transposase (sequence in bold characters, from position 517 to position 2307) that shows significant homology with a transposase of Mycobacterium smegmatis. This coding sequence is framed by two 20 bp inverted repeats (sequences underlined from position 399 to 418 and from position 2359 to 2378).
EXAMPLES
1. MATERIAL AND METHODS:
1.1. Bacterial Strains: The 100 M tuberculosis complex strains comprised 46 M. tuberculosis strains isolated in 30 countries, 14 M africanum strains, 28 M. bovis strains originating in 5 countries, 2 M. bovis BCG vaccine strains (Pasteur and Japan), 5 M. microti strains, and 5 M. canettii strains. The strains were isolated from human and animal sources and were selected to represent a wide diversity including 60 strains that have been used in a multi-center study (8). The M. africanum strains were retrieved from the collection of the Wadsworth Center, New York State Department of Health, Albany, New York, whereas the majority of the M. bovis isolates came from the collection of the University of Zaragoza, Spain. Four M. canettii strains are from the culture collection of the Institut Pasteur, Paris, France. The strains have been extensively characterized by reference typing methods, i.e. IS6U0 restriction fragment length polymorphism (RFLP) typing and spoligotyping. M. tuberculosis H37Rv, M. tuberculosis H37Ra, M. tuberculosis CDC 1551, M. bovis AF2122/97, M. microti OV254, and M. canettii CIPT 140010059 were included as reference strains. DNA was prepared as previously described (10).
1.2. Genome comparisons and primer design
For preliminary genome comparisons between M. tuberculosis and M. bovis websites http://genolist.pasteur.fr/TubercuList/ and http://www.sanger.ac.uk Proiects/M_bovis/ as well as inhouse databases were used. For primer design, sequences inside or flanking RD and RvD regions were obtained from the same websites. Primers were designed using the primer 3 website http://www-genome.wi.mit.edu/cgi-bin/primer/primer3 www.cgi that would amplify ca. 500 base pair fragments in the reference strains (Table 1). 1.3. RD-PCR analysis
Reactions were performed in 96 well plates and contained per reaction 1.25 μl of 10 x PCR buffer (600mM Tris HC1 pH 8.8, 20 mM MgCl2, 170 mM (NH^SO^ 100 mM β- mercaptoethanol), 1.25 μl 20mM nucleotide mix, 50 nM of each primer, 1-10 ng of template DNA, 10% DMSO, 0.2 units Taq polymerase (Gibco-BRL) and sterile distilled water to 12.5 μl. Thermal cycling was performed on a PTC- 100 amplifier (MJ Inc.) with an initial denaturation step of 90 seconds at 95°C, followed by 35 cycles of 30 seconds at 95°C, 1 min at 58°C, and 4 min at 72°C.
1.4. Sequencing of junction regions (KDs, TbDl,) katG, gyrA, oxyR and pncA genes
PCR products were obtained as described above, using primers listed in Table 1. For primer elimination, 6 μl PCR product was incubated with 1 unit of Shrimp Alkaline phosphatase (USB), 10 units of exonuclease I (USB), and 2 μl of 5 x buffer (200mM Tris HC1 pH 8.8, 5mM MgCl2) for 15 min at 37°C and then for 15 min at 80°C. To this reaction mixture 2 μl of Big Dye sequencing mix (Applied Biosystems), 2 μl (2μM) of primer and 3 μl of 5 x buffer (5mM MgCl2, 200mM Tris HC1 pH 8.8) were added and 35 cycles (96°C for 30 sec; 56°C for 15 sec; 60°C for 4 min) performed in a thermocycler (MJ- research Inc., Watertown, MA). DNA was precipitated using 80 μl of 76% ethanol, centrifuged, rinsed with 70% ethanol, and dried. Reactions were dissolved in 2 μl of formamide/EDTA buffer, denatured and loaded onto 48 cm, 4 % polyacrylamide gels and electrophoresis performed on 377 automated DNA sequencers (Applied Biosystems) for 10 to 12 h. Alternatively, reactions were dissolved in 0.3 mM EDTA buffer and subjected to automated sequencing on a 3700 DNA sequencer (Applied Biosystems). Reactions generally gave between 500-700 bp of unambiguous sequence.
1.5. Accession Numbers
The sequence of the TbDl region from the ancestral M. tuberculosis strain No. 74
(Ref. 8) containing genes mmpS6 and mmpL6 was deposited in the EMBL database under accession No. AJ426486. Sequences bordering RD4, RD7, RD8, RD9 and RD10 in BCG are available under accession numbers AJ003103, AJ007301, AJ131210, Y18604, and
AJ132559, respectively.
2. EXPERIMENTAL DATA: The distribution of 20 variable regions resulting from insertion-deletion events in the genomes ofthe tubercle bacilli has been evaluated in a total of 100 strains of Mycobacterium tuberculosis, M. africanum, M. canettii, M. microti and M. bovis. This approach showed that the majority of these polymorphisms did not occur independently in the different strains of the M. tuberculosis complex but, rather, result from ancient, irreversible genetic events in common progenitor strains. Based on the presence or absence of an M. tuberculosis specific deletion (TbDl), M. tuberculosis strains can be divided into ancestral and "modern" strains, the latter comprising representatives of major epidemics like the Beijing, Haarlem and African M. tuberculosis clusters. Furthermore, successive loss of DNA, reflected by RD9 and other subsequent deletions, was identified for an evolutionary lineage represented by M africanum, M. microti and M. bovis that diverged from the progenitor of the present M tuberculosis strains before TbDl occurred. These findings contradict the often-presented hypothesis that M. tuberculosis, the etiological agent of human tuberculosis evolved from M. bovis, the agent of bovine disease. M. canettii and ancestral M. tuberculosis strains lack none of these deleted regions and tiierefore appear to be direct descendants of tubercle bacilli that existed before the M. africanum- > M. bovis lineage separated from the M. tuberculosis lineage. This suggests that the common ancestor of the tubercle bacilli resembled M. tuberculosis or M. canettii and could well have been a human pathogen already. The mycobacteria grouped in the M. tuberculosis complex are characterized by
99.9% similarity at the nucleotide level and identical 16S rRNA sequences (1, 2) but differ widely in terms of their host tropisms, phenotypes and pathogenicity. Assuming that they are all derived from a common ancestor, it is intriguing that some are exclusive human (M. tuberculosis, M. africanum, M. canettii) or rodent pathogens (M. microti) whereas others have a wide host spectrum (M. bovis). What was the genetic organization ofthe last common ancestor ofthe tubercle bacilli and in which host did it live? Which genetic events may have contributed to the fact that the host spectrum is so different and often specific? Where and when did M. tuberculosis evolve? Answers to these questions are important for a better understanding of the pathogenicity and the global epidemiology of tuberculosis and may help to anticipate future trends in the spread ofthe disease.
Because ofthe unusually high degree of conservation in their housekeeping genes it has been suggested that the members of the M. tuberculosis complex underwent an evolutionary bottleneck at the time of speciation, estimated to have occurred roughly 15,000 - 20,000 years ago (2). It also has been speculated that M. tuberculosis, the most widespread etiological agent of human tuberculosis has evolved from M. bovis, the agent of bovine tuberculosis, by specific adaptation of an animal pathogen to the human host (3). However, both hypotheses were proposed before the whole genome sequence of M. tuberculosis (4) was available and before comparative genomics uncovered several variable genomic regions in the members of the M. tuberculosis complex. Differential hybridization arrays identified 14 regions (RDl -14) ranging in size from 2 to 12.7 kb that were absent from BCG Pasteur relative to M. tuberculosis H37Rv (5, 6). In parallel, six regions, RvD 1-5, and TbDl, that were absent from the M. tuberculosis H37Rv genome relative to other members of the M. tuberculosis complex were revealed by comparative genomics approaches employing pulsed-field gel electrophoresis (PFGE) techniques (5, 7) and in silico comparisons of the near complete M. bovis AF2122/97 genome sequence and the M. tuberculosis H37Rv sequence.
In the present study the inventors have analyzed the distribution of these 20 variable regions situated around the genome (Table 1) in a representative and diverse set of 100 strains belonging to the M. tuberculosis complex. The strains were isolated from different hosts, from a broad range of geographic origins, and exhibit a wide spectrum of typing characteristics like 1S6110 and spoligotype hybridization patterns or variable-number tandem repeats of mycobacterial interspersed repetitive units (MIRU-VNTR) (8, 9). The inventors have found striking evidence that deletion of certain variable genomic regions did not occur independently in the different strains of the Mycobacterium complex and, assuming that there is little or no recombination of chromosomal segments between the various lineages of the complex, this allows the inventors to propose a completely new scenario for the evolution ofthe Mycobacterium complex and the origin of human tuberculosis.
Variable genomic regions and their occurrence in the members of the M. tuberculosis complex.
The PCR screening assay for the 20 variable regions (Table 1) within 46 M tuberculosis, 14 M. africanum, 5 M. canettii, 5 M. microti, 28 M. bovis and 2 BCG strains employed oligonucleotides internal to known RDs and RvDs, as well as oligonucleotides flanking these regions (Table 1). This approach generated a large data set that was robust, highly reliable, and internally controlled since PCR amplicons obtained with the internal primer pair correlated with the absence of an appropriately sized amplicon with the flanking primer-pair, and vice-versa.
According to the conservation of junction sequences flanking the variable regions three types of regions were distinguished, each having different importance as an evolutionary marker. The first type included mobile genetic elements, like the prophages phiRvl (RD3) and phiRv2 (RD11) and insertion sequences IS1532 (RD6) and IS6110 (RD5), whose distribution in the tubercle bacilli was highly divergent (Table 2). The second type of deletion is mediated by homologous recombination between adjacent 1S6110 insertion elements resulting in the loss of the intervening DNA segment (RvD2, RvD3, RvD4, and RvD5 (7)) and is variable from strain to strain (Table 2).
The third type includes deletions whose bordering genomic regions typically do not contain repetitive sequences. Often this type of deletion occurred in coding regions resulting in the truncation of genes that are still intact in other strains ofthe M. tuberculosis complex. The exact mechanism leading to this type of deletion remains obscure, but possibly rare strand slippage errors of DNA polymerase may have contributed to this event. As shown in detail below, RDl, RD2, RD4, RD7, RD8, RD9, RD10, RD12, RD13, RDM, and TbDl are representatives of this third group whose distribution among the 100 strains allows us to propose an evolutionary scenario for the members of the M. tuberculosis complex, that identified M. tuberculosis and/or M. canettii as most closely related to the common ancestor ofthe tubercle bacilli.
2.1. M. tuberculosis strains:
Investigation of the 46 M. tuberculosis strains by deletion analysis revealed that most RD regions were present in all M. tuberculosis strains tested (Table 2). Only regions RD3 and RD11, corresponding to the two prophages phiRvl and phiRv2 of M. tuberculosis H37Rv (4), RD6 containing the insertion sequence IS1532, and RD5 that is flanked by a copy of 1S6110 (5) were absent in some strains. This is an important observation as it implies that M. tuberculosis strains are highly conserved with respect to RDl, RD2, RD4, RD7, RD8, RD9, RDIO, RD12, RD13, and RD14, and that these RDs represent regions that can differentiate M. tuberculosis strains independent of their geographical origin and their typing characteristics from certain other members ofthe M. tuberculosis complex. Furthermore, this suggests that these regions may be involved in die host specificity of M. tuberculosis.
In contrast, the presence or absence of RvD regions in M. tuberculosis strains was variable. The region which showed the greatest variability was RvD2, since 18 from 46 tested M. tuberculosis strains did not carry the RvD2 region. Strains with a high copy number of IS6110 (>14) missed regions RvD2 to RvD5 more often than strains with only a few copies. As an example, all six tested strains belonging to the Beijing cluster (8) lacked regions RvD2 and RvD3. This is in agreement with the proposed involvement of recombination of two adjacent copies of IS6110 in this deletion event (7). However, the most surprising finding concerning the RvD regions was that TbDl was absent from 40 of the tested M. tuberculosis strains (87 %), including representative strains from major epidemics such as the Haarlem, Beijing and Africa clusters (8). To accentuate this result we named this region "M. tuberculosis specific deletion 1" (TbDl). In silico sequence comparison of M. tuberculosis H37Rv with the corresponding section in M. bovis AF2122/97 revealed that in M. bovis this locus comprises two genes encoding membrane proteins belonging to a large family, whereas in M. tuberculosis H37Rv one of these genes (mmpSβ) was absent and the second was truncated (mmpL6). Unlike the RvD2-RvD5 deletions, the TbDl region is not flanked by a copy of IS6110 in M. tuberculosis H37Rv, suggesting that insertion elements were not involved in the deletion ofthe 2153 bp fragment. To further investigate whether the 40 M. tuberculosis strains lacking the TbDl region had the same genomic organization of this locus as M. tuberculosis H37Rv, we amplified the TbDl -junction regions of the various strains by PCR using primers flanking the deleted region (Table 1). This approach showed that the size of the amplicons obtained from multiple strains was uniform (Fig. 1) and subsequent sequence analysis ofthe PCR products revealed that in all tested TbDl -deleted strains the sequence of the junction regions was identical to that of M tuberculosis H37Rv (Fig.2). The perfect conservation of the junction sequences in TbDl -deleted strains of wide geographical diversity suggests that the genetic event which resulted in the deletion occurred in a common progenitor. However, six M tuberculosis strains, all characterized by very few or no copies of 1S6110 and spoligotypes that resembled each other (Fig. 3) still had the TbDl region present. Interestingly, these six strains were also clustered together by MIRU-VNTR analysis (9).
Analysis of partial gene sequences of oxyR, pncA, katG, and gyrA which have been described as variable between different tubercle bacilli (2, 11, 12, 13) revealed that all tested M. tuberculosis strains showed oxyR and pncA partial sequences typical for M. tuberculosis (oxyR - nucleotide 285 (oxy^f.G, pncA — codon 57 (pncA51: CAC ). Based on the katG codon 463 (katG463) and gyrA codon 95 (gyrA95) sequence polymorphism, Sreevatsan and colleagues (2) defined three groups among the tubercle bacilli, group 1 showing katG463 CTG (Leu), gyrA95 ACC (Thr), group 2 exhibiting katG463 CGG (Arg), gyrA95 ACC (Thr), and group 3 showing katG463 CGG (Arg), gyrA95 AGC (Ser). According to this scheme, in our study 16 ofthe 46 tested M. tuberculosis strains belonged to group 1, whereas 27 strains belonged to group 2 and only 3 isolates to group 3. From the 40 strains that were deleted for region TbDl, 9 showed characteristics of group 1, including the strains belonging to the Beijing cluster, 28 of group 2, including the strains from the Haarlem and Africa clusters and 3 of group 3, including H37Rv and H37Ra. Most interestingly, all six M. tuberculosis strains where the TbDl region was not deleted, contained a leucine (CTG) at katG463, which was described as characteristic for ancestral M. tuberculosis strains (group 1) (2). As shown in Figure 4, this suggests that during the evolution of M. tuberculosis the katG mutation at codon 463 CTG (Leu) -> CGG (Arg) occurred in a progenitor strain that had region TbDl deleted. This proposal is supported by the finding that strains belonging to group 1 may or may not have deleted region TbDl, whereas all 30 strains belonging to groups 2 and 3 lacked TbDl (Fig. 4). Furthermore, all strains of groups 2 and 3 characteristically lacked spacer sequences 33-36 in the direct repeat (DR) region (Fig. 3). It appears that such spacers may be lost but not gained (14). Therefore, TbDl deleted strains will be referred to hereafter as "modern" M. tuberculosis strains.
2.2. M. canettii:
M. canettii is a very rare smooth variant of M. tuberculosis, isolated usually from patients from, or with connection to, Africa. Although it shares identical 16S rRNA sequences with the other members ofthe Mycobacterium complex, M. canettii strains differ in many respects including polymorphisms in certain house-keeping genes, IS 1081 copy number, colony morphology, and the lipid content of the cell wall (15, 16). Therefore, we were surprised to find that in M. canettii all the RD, RvD, and TbDl regions except the prophages (phiRvl, phiRv2) were present, hi contrast, we identified a region (RDcan) being specifically absent from all five M. canettii strains that partially overlapped RDl 2 (Fig. 4).
The conservation of the RD, RvD, and TbDl regions in the genome of M. canettii in conjunction with the many described and observed differences suggest that M. canettii diverged from the common ancestor of the Mycobacterium complex before RD, RvD and TbDl occurred in the lineages of tubercle bacilli (Fig. 4). This hypothesis is supported by the finding that M. canettii was shown to carry 26 unique spacer sequences in the direct repeat region (14), that are no longer present in any other member ofthe Mycobacterium complex. An other specific feature of M. canettii is the presence of an insertion element whose sequence has been searched, by using PCR and hybridization approaches, without sucess in the other member strains of Mycobacterium complex (including M. tuberculosis, M. bovis, M. africanum and M. microti). This insertion element contained an ORF encoding a putative transposase framed by two inverted repeats. The sequence of this insertion element is represented in figure 6 and in SEQ ID N°19 where it begins at position 399 and ends at position 2378. The amino acids sequence of the putative transposase is drawn in SEQ ID N°20. As such, this insertion element can be used to differentiate between M. tuberculosis ancestral strains and M. canettii strains that may show the same TbDl, RD4 and RD9 profiles. Therefore, M. canettii represents a fascinating tubercle bacillus, whose detailed genomic analysis may reveal further insights into the evolution of Mycobacterium complex.
2.3. M. africanum: The isolates designated as M. africanum studied here originate from West and East-
African sources. 11 strains were isolated in Sierra Leone, Nigeria and Guinea and 2 strains in Uganda. One strain comes from the Netherlands.
For the 11 West African isolates, RD analysis indicated that these strains all lack the RD9 region containing cobL. Sequence analysis of the RD9 junction region showed that the genetic organization of this locus in West African strains was identical to that of M. bovis and M. microti in that the 5' part of cobL as well as the genes Rv2073c and Rv2074c were absent. In addition, six strains (2 from Sierra Leone, 4 from Guinea) also lacked RD7, RD8 and RDIO (Table 2). The junction sequences bordering RD7, RD8 and RDIO, like those for RD9, were identical to those of M. bovis and M. microti strains. As regards the two prophages phiRvl and phiRv2, the West African strains all contained phiRv2, whereas phiRvl was absent. No variability was seen for the RvD regions. RvDl-RvD5 and TbDl were present in all tested West African strains. This shows that M. africanum prevalent in West Africa can be differentiated from "modern" M. tuberculosis by at least two variable genetic markers, namely the absence of region RD9 and the presence of region TbDl. In contrast, for East African M. africanum and for the isolate from the Netherlands, no genetic marker was found which could differentiate them from M. tuberculosis strains. With the exception of prophage phiRvl (RD3) the 3 strains from Uganda and the Netherlands did not exhibit any of the RD deletions, but lacked the TbDl region, as do "modern" M. tuberculosis strains. The absence of the TbDl region was also confirmed by sequence analysis of the TbDl junction region, which was found to be identical to that of TbDl deleted M. tuberculosis strains. These results indicate a very close genetic relationship of these strains to M. tuberculosis and suggest that they should be regarded as M. tuberculosis rather than M. africanum strains.
2.4. M. microti:
M. microti strains were isolated in the 1930's from voles (17) and more recently from immuno-suppressed patients (18). These strains are characterized by an identical, characteristic spoligotype, but differ in their IS6110 profiles. Both, the vole and the human isolates, lacked regions RD7, RD8, RD9, and RDIO as well as a region that is specifically deleted from M. microti (RDmιc). RDmιc was revealed by a detailed comparative genomics study of M. microti isolates (19) using clones from a M. microti Bacterial Artificial Chromosome (BAC) library. RDmιc partially overlaps RDl from BCG (data not shown). Furthermore, vole isolates missed part ofthe RD5 region, whereas this region was present in the human isolate. As the junction region of RD5 in M. microti was different to that in BCG (data not shown), RD5 was not used as an evolutionary marker.
2.5. M. bovis and bovis BCG:
M. bovis has a very large host spectrum infecting many mammalian species, including man. The collection of M. bovis strains that was screened for the RD and RvD regions consisted of 2 BCG strains and 18 "classical" M. bovis strains generally characterized by only one or two copies of IS6110 from bovine, llama and human sources in addition to diree goat isolates, three seal isolates, two oryx isolates, and two M. bovis strains from humans that presented a higher number of IS6110 copies.
Excluding prophages, the distribution of RDs allowed us to differentiate five main groups among the tested M. bovis strains. The first group was formed by strains that lack RD7, RDS, RD9, and RD10. Representatives of this group are three seal isolates and two human isolates containing between three and five copies of 1S6110 (data not shown). Two oryx isolates harboring between 17 and 20 copies of IS6110 formed the second group that lacked parts of RD5 in addition to RD7-RD10, and very closely resembled the M. microti isolates. However, they did not show RDmιc, the deletion characteristic of M. microti strains (data not shown). Analysis of partial oxyR and pncA sequences from strains belonging to groups one and two, showed sequence polymorphisms characteristic of M. tuberculosis strains (oxyR2S5: G,pncA51: CAC, Ref. 12, 13).
Group three consists of goat isolates that lack regions RD5, RD7, RDS, RD9, RDIO,
RD12, and RD13. As previously described by Aranaz and colleagues, these strains exhibited an adenosine at position 285 ofthe oxyR pseudogene that is specific for "classical" M. bovis strains whereas the sequence of the pncA57 polymorphism was identical to that in M. tuberculosis (20). This is in good agreement with our results from sequence analysis (Table 2) and the finding that except for RD4, the goat isolates displayed the same deletions as "classical" M. bovis strains. Taken together, this suggests that the oxyR285 mutation (G ->• A) occurred in M. bovis strains before RD4 was lost. Interestingly, the most common M. bovis strains ("classical" M. bovis (21)), isolated from cattle from Argentina, the Netherlands, the UK and Spain, as well as from humans (e. g. multi-drug resistant M. bovis from Spain (22)) showed the greatest number of RD deletions and appear to have undergone the greatest loss of DNA relative to other members of the M. tuberculosis complex. These lacked regions RD4, RD5, RD6, RD7, RD8, RD9, RDIO, RD12 and RD13, confirming results obtained with reference strains (5, 6). These strains together with the two BCG strains were the only ones that showed the pncA51 polymorphism GAC (Asp) in addition to the oxyR285 mutation (G -> A) characteristic of M. bovis. Analysis of BCG strains indicate that BCG lacked the same RD regions as "classical" M. bovis strains in addition to RDl, RD2 and RDM which apparently occurred during and after the attenuation process (Fig. 4) (6, 23).
In contrast to RDs, the RvD regions were highly conserved in the M. bovis strains. With the exception ofthe two IS<57 iO-rich oryx isolates, that lacked RvD2, RvD3 and RvD4, all other strains had the five RvD regions present. It is particularly noteworthy that TbDl was present in all M. bovis strains.
However, except for the two human isolates, containing between three and five copies of IS6110 from group 1, strains designated as M. bovis showed a single nucleotide polymorphism in the TbDl region at codon 551 (AAG) of the mmpL6 gene, relative to M. canettii, M. africanum and ancestral M. tuberculosis strains, which are characterized by codon AAC. Even the strains isolated from seals and from oryx with oxyR or pncA loci like those of M. tuberculosis and with fewer deleted regions than the classical M. bovis strains, showed the mmpL6551 AAG polymorphism typical for M. bovis and M. microti (Table 2, Fig. 4). As such, this polymorphism could serve as a very useful genetic marker for the differentiation of strains that lack RD7, RD8, RD9, and RDIO and have been classified as M. bovis or M. africanum, but may differ from other strains ofthe same taxon.
3. DISCUSSION
3.1. Origin of human tuberculosis
For many years, it was thought that human tuberculosis evolved from the bovine disease by adaptation of an animal pathogen to the human host (3). This hypothesis is based on the property of M tuberculosis to be almost exclusively a human pathogen, whereas M bovis has a much broader host range. However, the results from this study unambiguously show that M. bovis has undergone numerous deletions relative to M. tuberculosis. This is confirmed by the preliminary analysis of the near complete genome sequence of M. bovis AF2122/97, a "classical" M. bovis strain isolated from cattle, which revealed no new gene clusters that were confined specifically to M. bovis. This indicates that the genome of M. bovis is smaller than that of M. tuberculosis (24). It seems plausible that M. bovis is the final member of a separate lineage represented by M. africanum (RD9), M. microti (RD7, RDS, RD9, RDIO) and M. bovis (RD4, RD5, RD7, RD8, RD9, RDIO, RD12, RD13) (25) that branched from the progenitor of M. tuberculosis isolates. Successive loss of DNA may have contributed to clonal expansion and the appearance of more successful pathogens in certain new hosts.
Whether the progenitor of extant M. tuberculosis sfrains was already a human pathogen when the M. africanum ->• M. bovis lineage separated from the M. tuberculosis lineage is a subject for speculation. However, we have two reasons to believe that this was the case. Firstly, the six ancestral M. tuberculosis strains (TbDl+, RD9+) (Fig.3) that resemble the last common ancestor before the separation of M. tuberculosis and M. africanum are all human pathogens. Secondly, M. canettii, which probably diverged from the common ancestor of today's M. tuberculosis sfrains prior to any other known member ofthe M. tuberculosis complex is also a human pathogen. Taken together, this means that those tubercle bacilli, which are thought to most closely resemble the progenitor of M tuberculosis are human and not animal pathogens. It is also intriguing that most of these strains were of African or Indian origin (Fig. 3). It is likely that these ancestral strains predominantly originated from endemic foci (15, 26), whereas "modern" M. tuberculosis strains that have lost TbDl may represent epidemic M. tuberculosis strains that were introduced into the same geographical regions more recently as a consequence of the worldwide spread of the tuberculosis epidemic.
3.2. The evolutionary timescale of the M. tuberculosis complex
Because of the high sequence conservation in housekeeping genes, Sreevatsan et al. previously hypothesized that the tubercle bacilli encountered a major bottleneck 15,000 - 20,000 years ago (2). As the conservation ofthe TbDl junction sequence in all tested TbDl deleted strains suggests descendance from a single clone, the TbDl deletion is a perfect indicator that "modern" M. tuberculosis sfrains that account for the vast majority of today's tuberculosis cases definitely underwent such a bottleneck and then spread around the world.
As described in detail in the results section, our analysis showed that the katG463 CTG→CGG and the subsequent gyrA95 ACC ->AGC mutations, that were used by Sreevatsan and colleagues to designate groups 2 and 3 of their proposed evolutionary pathway of the tubercle bacilli (2), occurred in a lineage of M. tuberculosis strains that had already lost TbDl (Fig.4). Although deletions are more stable markers than point mutations, which may be subject to reversion, a perfect correlation of deletion and point mutation data was found for the tested strains. This information, together with results from a recent study by Fletcher and colleagues (27), who have shown that M. tuberculosis DNAs amplified from naturally mummified Hungarian villagers from the 18th and 19th century belonged to katG4631 gyrA95 groups 2 and 3, suggests that the TbDl deletion occurred in the lineage of M. tuberculosis before the 18* century. This could mean that the dramatic increase of tuberculosis cases later in the 18th century in Europe mainly involved "modern" M. tuberculosis strains. In addition, it shows that tuberculosis was caused by M. tuberculosis and not by M. bovis, a fact which is also described for cases in rural medieval England (28).
There is good evidence that mycobacterial infections occurred in man several thousand years ago. We know that tuberculosis occurred in Egypt during the reign of the pharaohs because spinal and rib lesions pathognomonic of tuberculosis have been identified in mummies from that period (29). Identification of acid fast bacilli as well as PCR amplification of IS6110 from Peruvian mummies (30) also suggest that tuberculosis existed in pre-Columbian societies of Central and South America. To estimate when the TbDl bottleneck occurred, it would now be very interesting to know whether the Egyptian and South American mummies carried M. tuberculosis DNA that had TbDl deleted or not.
The other major bottleneck, which seems to have occurred for members of the M. africanum -» M. microti - M. bovis lineage is reflected by RD9 and the subsequent RD7, RD8 and RDIO deletions (Fig. 4). These deletions seem to have occurred in the progenitor of tubercle bacilli that - today - show natural host spectra as diverse as humans in Africa, voles on the Orkney Isles (UK), seals in Argentina, goats in Spain, and badgers in the UK. For this reason it is difficult to imagine that spread and adaptation of RD9-deleted bacteria to their specific hosts could have appeared within the postulated 15,000 - 20,000 years of speciation ofthe M. tuberculosis complex. However, more insight into this matter could be gained by RD analysis of ancient
DNA samples, e. g. mycobacterial DNA isolated from a 17,000 year old bison skeleton (31). The mycobacterium whose DNA was amplified showed a spoligotype that was most closely related to patterns of M. africanum and could have been an early representative of the lineage M. africanum — >M bovis. With the TbDl and RD9 junction sequences that we supply here, PCR analyses of ancient DNAs should enable very focused studies to be undertaken to learn more about the timescale within which the members of the M. tuberculosis complex have evolved.
3.3. Concluding comments Our study provides an overview ofthe diversity and conservation of variable regions in a broad range of tubercle bacilli. Deletion analysis of 100 strains from various hosts and countries has identified some evolutionarily "old" M. canettii, M. tuberculosis and M africanum strains, most of them of African origin, as well as "modern" M. tuberculosis sfrains, the latter including representatives from major epidemic clusters like Beijing, Haarlem and Africa. The use of deletion analysis in conjunction with molecular typing and analysis of specific mutations was shown to represent a very powerful approach for the study ofthe evolution ofthe tubercle bacilli and for the identification of evolutionary markers. In a more practical perspective, these regions, primarily RD9 and TbDl but also RDl, RD2, RD4, RD7, RD8, RD10, RD12 and RD13 represent very interesting candidates for the development of powerful diagnostic tools for the rapid and unambiguous identification of members of the M. tuberculosis complex (32). This genetic approach for differentiation can now be used to replace the often confusing traditional division of the M. tuberculosis complex into rigidly defined subspecies.
Moreover, functional analyses will show whether the TbDl deletion confers some selective advantage to "modern" M. tuberculosis, or whether other circumstances contributed to the pandemic ofthe TbDl deleted M. tuberculosis strains.
EXAMPLE 4
The members of the M. tuberculosis complex share an unusually high degree of conservation such that the commercially-available nucleic acid probes and amplification assays cannot differentiate these organisms. In addition conventional identification methods are often ambiguous, cumbersome and time consuming because of the slow growth of the organisms.
In the present invention the inventors, by a deletion analysis, solve the problem faced by clinical mycobacteriology laboratories for differentiation within the M. tuberculosis complex.
This approach allows to perform a diagnostic on a biological fluid by using at least three markers including TbDl. The following table 3 illustrates such a combinaison sufficient to realize the distinction between the members ofthe Mycobacterium complex.
Figure imgf000036_0001
Table 3
Beside TbDl marker, preferably at least 2 other markers should be used. Examples of such additional markers available in the literature are listed in the following table 1. Although ancestral sfrains of Mycobacterium tuberculosis represent only 5% of all Mycobacterium tuberculosis strains, persons who would be interested in distinguishing the ancestral strains of Mycobacterium tuberculosis from the srains of Mycobacterium canettii, could consider using the genetic marker RDl 2 in combination with the three markers described in table 3. Because the region RDoan partially overlapped RDl 2 in genome of Mycobacterium canettii, flanking primers as described in table 1 do not hybridize on genomic DNA of Mycobacterium canettii. Therefore, PCR amplification with these flanking primers results in 2.8 kb PCR product in Mycobacterium tuberculosis and no PCR product in Mycobacterium canettii.
An other way to distinguish ancestral strains of Mycobacterium tuberculosis from Mycobacterium canettii would be the detection of the insertion element specific for M 5 canettii sfrains and corresponding to SEQ ID N° 19.
Supplemental data:
10
Table 1: RD, RvD and TbDl regions and selected primers
Region Gene Size Internal Flanking primers or absent from (kb) Primerpair 2n internal * primerpair
BCG
RDl Rv3871-Rv3879c 9.5 RDlin-Rv3878F RDl-flank.left GTC AGC CAA GTC AGG CTA CC GAA ACA GTC CCC AGC AGG T
RDlin-Rv3878R RDl-flank.right CAA CGT TGT GGT TGT TGA GG TTC AAC GGG TTA CTG CGA AT
RD2 Rvl978-Rvl988 10.8 RD2-Rvl979.int.F RD2-flank.F TAT AGC TCT CGG CAG GTT CC CTC GAC CGC GAC GAT GTG C
RD2-Rvl979-int.R RD2-flank.R ATC GGC ATC TAT GTC GGT GT CCT CGT TGT CAC CGC GTA TG
RDS* Rvl573-Rvl586c 9.2 RD3-Rvl586.int.F RD3-int-REP.F TTA TCT TGG CGT TGA CGA TG CTGACG TCG TTGTCGAGGTA*
RD3-Rvl586.int.R RD3-int-REP.R CAT ATA AGG GTG CCC GCT AC GTA CCC CCA GGC GAT CTT*
RD4 Rvl505c-Rvl516c 12.7 RD -Rvl516.int.F RD -flank.F CAA GGG GTA TGA GGT TCA CG CTC GTC GAA GGC CAC TAA AG
RD -Rvl516.int.R RD -flank.R CGG TGA TTC GTG ATT GAA CA AAG GCG AAC AGA TTC AGC AT Table 1 (continued)
RD5A-Rv2348 ιnt F RD5B-plcA mt F
RD5=> Rv2346c-Rv2353c 9.0
AAT CAC GCT GCT GCT ACT CC CAA GTT GGG TCT GGT CGA AT
RD5A-Rv2348 mt R RD5B-plcA int R
GTG CTT TTG CCT CTT GGT C GCT ACC CAA GGT CTC CTG GT
RD6* Rv3425-Rv3428c 4.9 RD6-IS1532F D
CAGCTGGTGAGTTCAAATGC
RD6-IS1532R ND
CTC CCG ACA CCT GTT CGT
RD7 Rvl964-Rvl977 12.7 RD7-Rvl976 int F RD7-flank F
TGG ATT GTC GAC GGT ATG AA GGT AAT CGT GGC CGA CAA G
RD7-Rvl976 ιnt R RD7-flank R
GGT CGA TAA GGT CAC GGA AC CAG CTC TTC CCC TCT CGA C
RD8 ephA-lpqG 5.9 RD8-ephA F RD8-flank F
GGT GTG ATT TGG TGA GAC GAT G CAA TCA GGG CTG TGC TAA CC
RD8-ephA R RD8-flank R
AGT TCC TCC TGA CTA ATC CAG GC CGA CAG TTG TGC GTA CTG GT
RD9 cobL-Rv2075 2.0 RD9-ιntF RD9-flankF CGA TGG TCA ACA CCA CTA CG GTG TAG GTC AGC CCC ATC C
RD9-ιntR RD9-flankR CTG GAC CTC GAT GAC CAC TC GCC CAA CAG CTC GAC ATC
RDIO Rv0221-Rv0223 1.9 RDlO-intF RDlO-flankF GTA ACC GCT TCA CCG GAA T CTG CAA CCA TCC GGT ACA C
RDlO-mtR RDlO-flankR
GTCAAC TCCACGGAAAGACC GTC ATG AAC GCC GGA CAG
RD11 Rv2645-Rv2695c 11.0 RDll-Rv2646F RDll-fla-F
CGGCAGCTAGAC GAC CTC TCA CAT AGG GGC TGC GAT AG
RDll-Rv2646R RDll-fla-R
AAC GTG CTG CGA TAG GTT TT AGA GGA ACC TTT CGG TGG TT
RD12 ^eC-Rv3121 2.8 RD12-Rv3120 mt F RD12-flank F
GAAATACGAGTGCGCTGACC GCC ATC AAC GTC AAG AAC CT
RD12-Rv3120 ιnt R RD12-flank R
CTC TGA ACC ATC GGT GTC G CGG CCA GGT AAC AAG GAG T
RD13 Rvl255c-Rvl257c 3.0 RD13ιntF RD13-flank F
GGA TGT CAC TCG GAA CGG CA CGA TGG TGT TTC TTG GTG AG
RD13mtR RD13-flank R CAC CGG GCT GAT CGA GCG A GGA TCG GCT CAG TGA ATA CC
RDM Rvl765c-Rvl773c 9.0 RD14-Rvl769 int F RD14-flankF GTG GAG CAC CTT GAC CTG AT TTG ATT CGC CAA CAA CTG AA
RD14-Rvl769 ιnt R RD14-flankR CGT CGA ATA CGA GTC GAA CA GGG CTG GTT AGT GTC GAT TC Table 1 (continued)
Region missing from M. tuberculosis H37Rv
RvDl* 5.0 RvDl-intlF RvDl-int2.F
AGC GCG TCG AAC ACC GGC GAG CCA CTC CGA TGT TGA CT
RvDl-intlR RvDl-int2.R
CCT GAA TCC GCG CAA TTC CAT CAC GCG AAC CCT ACC TAC AT
RvD2* plcD 5.1 RvD2-intlF RvD2-int2F GTT CTC CTG TCG AAC CTC CA GGA CGG TGA CGG TAT TTG TC
RvD2-intlR RvD2-int2R ACT TCA CCG GTT TCA TCT CG TCG CCA ACT TCT ATG GAC CT
RvD3 1.0 RvD3-intF RvD3-flank.F
ATC GAT CAG GTC GTC AAT GC AAA CCA TGC AGC GTC TGC CA
RvD3-intR RvD3-f!ankR
ACGCCACCATCAAGATCC GCG TTT CTG CGT CTG GTT GA
RvD4* PPE gene 0.8 RvD4-intF-PPE ND
GGT TGC CAA CGT TAG CGATGC
RvD4-intR-PPE ND
CCG GTG GTG GTG GCG GCT
RvD5 mo a 4.0 RvD5intF RvD5-flankF
GGG TTC ACG TTC ATT ACT GTT C CCC ATC GTG GTC GTT CAC C
RvD5intR RvD5-flankR
CCT GCG CTT ATC TCT AGC GG GTA CCC GCA CCA CCT GCT G
TbDl mmpL6 2.1 TBDlintS.F TBDlflal-F CGT TCAACC CCAAAC AGGTA CTA CCT CAT CTT CCG GTC CA
TBDlintS.R TBDlflal-R AAT CGAACT CGTGGAACACC CAT AGA TCC CGG ACA TGG TG katG, gyrA, oxyR',pncA and mmpL6 PCR and sequencing primers katG .'463 *α/G-2154,225-PCR-F far(G-2154,872-SEQ-R CTA CCA GCA CCG TCA TCT CA ACA AGC TGA TCC ACC GAG AC
Figure imgf000039_0001
AGG TCG TAT GGA CGAACA CC gyrA 95 gyn4-7,127-PCR-F gyrA-7,A6W GTT CGT GTG TTG CGT CAA GT CGG GTG CTC TAT GCA ATG TT gyrA- 8,312-PCR-R CAG CTG GGT GTG CTT GTA AA oxyR ;285 oxyR 2725.559F <HyΛ-2726,024-SEQ-R TAT GCG ATC AGG CGT ACT TG CAA AGC AGT GGT TCA GCA GT ωyΛ-2726,024-PCR-R CAA AGC AGT GGT TCA GCA GT Table 1 (continued)
/OTC -2288.678-PCR-F pncA- 2289,319-SEQ-R
Pn°A ATC AGG AGC TGC AAA CCA AC GGC GTC ATG GAC CCT ATA TC pncA- 2289,319-PCR-R GGC GTC ATG GAC CCT ATA TC inmpLό^^^ mmpL-seqS mmpL-seq5F
GTA TCA GAG GGA CCG AGC AG GTA TCA GAG GGA CCG AGC AG
TBDlflal-R CAT AGA TCC CGG ACA TGG TG
The RD nomenclature used in this table is based on that used by Brosch et al. (2000), (Ref. 25) and differs from that proposed by Behr and coworkers (1999), (Ref. 6). Primer sequences are shown in 5' -»3' direction.
* Regions where a second pair of internal primers was used rather than flanking primers, due to 5 flanking repetitive regions, and/or mobile genetic elements.
REFERENCES
1. Boddinghaus, B., Rogall, T., Flohr, T., Blocker, H. & Bottger, E. C. (1990) J Clin0 Microbiol 28, 1751-9.
2. Sreevatsan, S., Pan, X., Stockbauer, K. E., Connell, N. D., Kreiswirth, B. N., Whittam, T. S. & Musser, J. M. (1997) Proc NatlAcadSci USA 94, 9869-74.
3. Stead, W. W., Eisenach, K. D., Cave, M. D., Beggs, M. L., Templeton, G. L., Thoen, C. O. & Bates, J. H. (1995) Am JRespir Crit Care Med 151, 1267-8. 5 4. Cole, S. T., Brosch, R., Parkhill, J., Gamier, T., Churcher, C, Harris, D., Gordon, S.
V., Eiglmeier, K., Gas, S., Barry, C. E., 3rd, Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth, T., Connor, R., Davies, R., Devlin, K., Feltwell, T., Gentles, S., Hamlin, N., Holroyd, S., Hornsby, T., Jagels, K., Barrell, B. G. & et al. (1998) Nature 393, 537-44.
5. Gordon, S. V., Brosch, R., Billault, A., Gamier, T., Eiglmeier, K. & Cole, S. T.0 (1999) Mol Microbiol 32, 643-55.
6. Behr, M. A., Wilson, M. A., Gill, W. P., Salamon, H., Schoolnik, G. K., Rane, S. & Small, P. M. (1999) Science 284, 1520-3.
7. Brosch, R., Philipp, W. J., Stavropoulos, E., Colston, M. J., Cole, S. T. & Gordon, S. V. (1999) Infect Immun 67, 5768-74. 8. Kremer, K., van Soolingen, D., Frothingham, R., Haas, W. H., Hermans, P. W., Martin, C, Palittapongarnpim, P., Plikaytis, B. B., Riley, L. W., Yakrus, M. A., Musser, J. M. & van Embden, J. D. (1999) JClin Microbiol 37, 2607-18.
9. Supply, P., Lesjean, S., Savine, E., Kremer, K., van Soolingen, D., & Locht, C. (2001) JClin Microbiol 39, 3563-71.
10. Van Soolingen, D., de Haas, P. E. W., Hermans, P. W. M. & van Embden, J. D. A. (1994) Methods Enzymol 235, 196-205.
11. Heym, B., Honore, N., Truffot-Pernot, C, Banerjee, A., Schurra, C, Jacobs, W. R., Jr., van Embden, J. D., Grosset, J. H. & Cole, S. T. (1994) Lancet 344, 293-8. 12. Scorpio, A., Collins, D., Whipple, D., Cave, D., Bates, J. & Zhang, Y. (1997) J Clin
Microbiol 35, 106-10.
13. Sreevatsan, S., Escalante, P., Pan, X., Gillies, D. A., 2nd, Siddiqui, S., Khalaf, C. N.,
Kreiswirth, B. N., Bifani, P., Adams, L. G., Ficht, T., Perumaalla, V. S., Cave, M. D., van
Embden, J. D. & Musser, J. M. (1996) JClin Microbiol 34, 2007-10. 14. Van Embden, J. D., van Gorkom, T., Kremer, K., Jansen, R., van Der Zeijst, B. A. &
Schouls, L. M. (2000) J Bacterial 182, 2393-401.
15. Van Soolingen, D., Hoogenboezem, T., de Haas, P. E., Hermans, P. W., Koedam, M.
A., Teppema, K. S., Brennan, P. J., Besra, G. S., Portaels, F., Top, J., Schouls, L. M. & Van
Embden, J. D. (1997) Int J Syst Bacteriol 47 ', 1236-45. 16. Papa, F., Laszlo, A., David, H. L. & Daffe, M. (1989) Acta Leprol 7 ( Suppl.) 98-
101.
17. Wells, A. Q., (1937) Lancet 1221.
18. Van Soolingen, D., Van der Zanden, A. G., de Haas, P. E., Noordhoek, G. T., Kiers, A., Foudraine, N. A., Portaels, F., Kolk, A. H., Kremer, K. & Van Embden, J. D. (1998) J Clin Microbiol 36, 1840-5.
19. Brodin, P., et al. (2002) in preparation
20. Aranaz, A., Liebana, E., Gomez-Mampaso, E., Galan, J. C, Cousins, D., Ortega, A., Blazquez, J., Baquero, F., Mateos, A., Suarez, G. & Dominguez, L. (1999) Int J Syst Bacteriol 49, 1263-73. 21. Van Soolingen, D., P.E.W. de Haas, J. Haagsma, T. Eger, P.W.M. Hermans, V. Ritacco, A. Alito, & J.D.A van Embden. (1994) J. Clin. Microbiol. 32, 2425-33.
22. Samper, S., Martin, C, Pinedo, A., Rivero, A., Blazquez, J., Baquero, F., van Soolingen, D. & Van Embden, J. (1997) Aids 11, 1237-42.
23. Mahairas, G. G., Sabo, P. J., Hickey, M. J., Singh, D. C. & Stover, C. K. (1996) J Bacteriol 178, 1274-82. 24. Gordon, S. V., Eiglmeier, K., Gamier, T., Brosch, R., Parkhill, J., Barrell, B., Cole, S. T. & Hewinson, R. G. (2001) Tuberculosis 81, 157-63.
25. Brosch, R., S. V. Gordon, K. Eiglmeier, T. Gamier, F. Tekaia, E. Yeramanian,& S. T. Cole. (1999) in Molecular genetics of mycobacteria, eds. Hatful G. F. & Jacobs, W. R. Jr. (American Society for Microbiology, Washington, D.C.), pp. 19-36.
26. Radhakrishnan, I., K, M. Y., Kumar, R. A. & Mundayoor, S. (2001) J Clin Microbiol 39, 1683.
27. Fletcher, H. A., Donoghue, H. D., Holton, J., Pap, I. & Spigelman, M. (2002) Am. J. Phys. Anthropol, in press. 28. Mays, S., Taylor, G. M., Legge, A. J., Young, D. B. & Turner-Walker, G. (2001) Am JPhys Anthropol 114, 298-311.
29. Nerlich, A. G., Haas, C. J., Zink, A., Szeimies, U. & Hagedom, H. G. (1997) Lancet 350, 1404.
30. Salo, W. L., Aufderheide, A. C, Buikstra, J. & Holcomb, T. A. (1994) Proc Natl AcadSci USA 91, 2091-4.
31. Rothschild, B. M., Martin, L. D., Lev, G., Bercovier, H., Bar-Gal, G. K., Greenblatt, C, Donoghue, H., Spigelman, M. & Brittain, D. (2001) Clin Infect Dis 33, 305-11.
32. Parsons, L.M., Brosch, R., Cole, S. T., Somoskovi, A., Loder, A., Britzel, G., van Soolingen, D., Hale, Y., & Salfϊnger, M. (2001) in preparation

Claims

An isolated or purified nucleic acid wherein said nucleic acid is selected from the group consisting of: a. SEQ ID N°1; b. Nucleic acid having a sequence fully complementary to SEQ ID N°l; c. Nucleic acid having at least 90% sequence identity after optimal alignment with a sequence defined in a) or b); d. Nucleic acid that hybridizes under stringent conditions with the nucleic acid defined in a) or b).
2. A nucleic acid fragment comprising at least 8 to 2000 consecutive nucleotides comprised in at least one nucleic acid according to claim 1.
3. The nucleic acid fragment according to claim 2, characterized in that it is susceptible to be used as a probe or a primer specific of SEQ ED N°l .
4. The nucleic acid fragment according to claim 2, selected from the group consisting of : SEQ ID N°l 7, SEQ ID N°l 8.
5. The nucleic acid fragment according to claim 2, characterized in that it is obtained by specific amplification of SEQ ID N°l with the pair of primers SEQ ID N°17 and SEQ ID N°18.
6. The nucleic acid fragment according to claim 2 wherein said nucleic acid fragment is: specifically deleted from the genome of Mycobacterium tuberculosis, excepted in Mycobacterium tuberculosis sfrains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome; and, present in the genome of Mycobacterium africanum, Mycobacterium canetti, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG.
7. The nucleic acid fragment according to claim 2 or 6 selected from the group consisting of : a) SEQ ID N°4; b) Nucleic acid having a sequence fully complementary to SEQ ID N°4; c) Nucleic acid having at least 90% sequence identity after optimal alignment with a sequence defined in a) or b); d) Nucleic acid that hybridizes under stringent conditions with the nucleic acid defined in a) or b).
8. A nucleic acid fragment comprising at least 8 to 2000 consecutive nucleotides of at least one nucleic acid according to claim 7.
9. The nucleic acid fragment according to claim 2 or 8, characterized in that it is susceptible to be used as a probe or a primer specific of SEQ ID N°l and SEQ ID N°4.
10. The nucleic acid fragment according to claim 9, selected from the group consisting of : SEQ ID N°13, SEQ ID N°14, SEQ ID N015, SEQ ID °16.
11. A nucleic acid fragment according to claim 9, characterized in that is obtained by specific amplification of SEQ ID N°l or SEQ ID N°4 with one pair of primers choosed in the group consisting of SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ
ID N°16.
12. The nucleic acid fragment according to claim 9, characterized in that it is obtained by specific amplification of SEQ ID N°l or SEQ ID N°4 with the pair of primers SEQ ID N013 and SEQ ID N014.
13. The nucleic acid fragment according to claim 9, characterized in that it is obtained by specific amplification of SEQ ID N°l or SEQ ID N°4 with the pair of primers SEQ ID N°15 and SEQ ID N°16.
14. The isolated or purified nucleic acid according to claim 1 wherein said nucleic acid comprises at least a deletion of a nucleic acid fragment according to any of claims 6, 7 and 8.
15. An isolated or purified polypeptide encoded by the nucleic acid according to any of claims 1, 2, 6, 7, 8 and 14.
16. The polypeptide according to claim 15 selected among polypeptides with sequence SEQ ID N°6, SEQ ID N°8, SEQ ID N°10, SEQ ID N°12, SEQ ID N°22 and fragments thereof.
17. An isolated or purified nucleic acid encoding a polypeptide according to claim 16.
18. The isolated or purified nucleic acid according to claim 17, wherein said nucleic acid is selected among :
- SEQ ID N°5 encoding the polypeptide of SEQ ID N°6;
- SEQ ID N°7 encoding the polypeptide of SEQ ID N°8;
- SEQ ID N°9 encoding the polypeptide of SEQ ID N°10; - SEQ ID N° 11 encoding the polypeptide of SEQ ID N° 12;
- SEQ ID N°21 encoding the polypeptide of SEQ ID N°22; and fragments thereof.
19. A recombinant vector comprising a nucleic acid sequence selected among nucleic acids according to any of claims 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13 and 14.
20. The recombinant vector of claim 19 consisting of vector named X229 introduced iinnttoo tthhee rreeccoommbbiinnaanntt Escherichia coli deposited at the CNCM on February 18th, 2002 under N° 1-2799.
21. A recombinant cell comprising a nucleic acid sequence selected among nucleic acids according to any of claims 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13 and 14 or a vector according to claim 19 or 20.
22. The recombinant cell according to claim 21 consisting of the Escherichia coli deposited at the CNCM on February 18th, 2002 under N° 1-2799.
23. A method for the discriminatory detection and identification of : - Mycobacterium tuberculosis excepted Mycobacterium tuberculosis sfrains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome; versus,
Mycobacterium africanum, Mycobacterium canetti, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG in a biological sample, comprising the following steps: a) isolation of the DNA from the biological sample to be analyzed or production of a cDNA from the RNA ofthe biological sample, b) detection ofthe nucleic acid sequences ofthe mycobacterium present in said biological sample, c) analysis for the presence or the absence of a nucleic acid fragment according to any of claims 6, 7 and 8.
24. The method as claimed in claim 23, wherein the detection ofthe mycobacterial DNA sequences is carried out using nucleotide sequences complementary to said DNA sequences.
25. The method as claimed in claim 23 or 24, wherein the detection ofthe mycobacterial DNA sequences is carried out by amplification of these sequences using primers.
26. The method as claimed in claim 25, wherein the primers have a nucleotide sequence chosen from the group comprising SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N017, SEQ ID N°18.
27. A method for the discriminatory detection and identification of :
- Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome; versus,
- Mycobacterium africanum, Mycobacterium canetti, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG in a biological sample, comprising the following steps: a) bringing the biological sample to be analyzed into contact with at least one pair of primers as defined in claim 25 or 26, the DNA contained in the sample having been, where appropriate, made accessible to the hybridization beforehand, b) amplification ofthe DNA ofthe mycobacterium, c) visualization ofthe amplification ofthe DNA fragments.
28. A kit for the discriminatory detection and identification of :
- Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome; versus,
- Mycobacterium africanum, Mycobacterium canetti, Mycobacterium microti,
Mycobacterium bovis, Mycobacterium bovis BCG in a biological sample, comprising the following elements: a) at least one pair of primers as defined in claim 25 or 26, b) the reagents necessary to carry out a DNA amplification reaction, c) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
29. The use of at least one pair of primers as defined in claim 25 or 26 for the amplification of a DNA sequence from Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis or Mycobacterium bovis BCG.
30. The use of at least one pair of primers or at least one nucleic acid fragment according to any of claims 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 and 14 for the detection of a DNA sequence from Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium canettii, Mycobacterium microti, Mycobacterium bovis or Mycobacterium bovis BCG.
31. A product of expression of all or part ofthe nucleic acid fragment as claimed in any of claims 6, 7 and 8.
32. A method for the in vitro discriminatory detection of antibodies directed against Mycobacterium tuberculosis excepted Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, versus antibodies directed against Mycobacterium africanum, Mycobacterium canetti, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, in a biological sample, comprising the following steps: a) bringing the biological sample into contact with at least one product as defined in claim 31, b) detecting the antigen-antibody complex formed.
33. A method for the in vitro discriminatory detection of a vaccination with
Mycobacterium bovis BCG, an infection by M. bovis, M. canettii, M. microti, M. africanum or M. tuberculosis sfrains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome versus an infection by Mycobacterium tuberculosis, excepted Mycobacterium Tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome in a mammal, comprising the following steps : a) preparation of a biological sample containing cells, more particularly cells ofthe immune system of said mammal and more particularly T cells, b) incubation ofthe biological sample of step a) with at least one product as defined in claim 31, c) detection of a cellular reaction indicating prior sensitization of the mammal to said product, in particular cell proliferation and/or synthesis of proteins such as gamma-interferon.
34. A kit for the in vitro discriminatory diagnosis of a vaccination with M. bovis BCG, an infection by M. bovis, M. canettii, M. microti, M. africanum versus an infection by M. tuberculosis excepted by strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a mammal comprising : a) a product as defined in claim 31, b) where appropriate, the reagents for the constitution of the medium suitable for the immunological reaction, c) the reagents allowing the detection of the antigen-antibody complexes produced by the immunological reaction, d) where appropriate, a reference biological sample (negative control) free of antibodies recognized by said product, e) where appropriate, a reference biological sample (positive control) containing a predetermined quantity of antibodies recognized by said product. A mono- or polyclonal antibody, a chimeric fragment or a chimeric antibody thereof, characterized in that it is capable of specifically recognizing a product as defined in claim 31.
A method for the in vitro discriminatory detection of the presence of an antigen of Mycobacterium tuberculosis excepted of sfrains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome versus an antigen of Mycobacterium africanum, Mycobacterium canetti, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG or
Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome in a biological sample comprising the following steps : a) bringing the biological sample into contact with an antibody as claimed in claim 35, b) detecting the antigen-antibody complex formed.
A kit for the in vitro discriminatory detection of the presence of an antigen of Mycobacterium tuberculosis excepted of sfrains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome versus an antigen of Mycobacterium africanum, Mycobacterium canetti, Mycobacterium microti, Mycobacterium bovis, Mycobacterium bovis BCG, or Mycobacterium tuberculosis having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a biological sample comprising the following steps : a) an antibody as claimed in claim 35, b) the reagents for constituting the medium suitable for the immunological reaction, c) the reagents allowing the detection of the antigen-antibody complexes produced by the immunological reaction.
An immunogenic composition, characterized in that it comprises at least one product as defined in claim 31.
39. A vaccine, characterized in that it comprises at least one product as defined in claim 31 in combination with a pharmaceutically compatible vehicle and, where appropriate, one or more appropriate immunity adjuvants.
40. An in vitro method for the detection and identification of Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome in a biological sample, comprising the following steps : a) isolation ofthe DNA from the biological sample to be analyzed or production of a cDNA from the RNA ofthe biological sample, b) detection of the nucleic acid sequences of the mycobacterium present in said biological sample, c) analysis for the presence or the absence of a nucleic acid fragment according to any of claims 6, 7 and 8.
41. An in vitro method for the detection and identification of Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome in a biological sample, comprising the following steps: a) bringing the biological sample to be analyzed into contact with at least one pair of primers selected among nucleic acids according to any of claims 1 to 14, 17 and 18, and more preferably selected among the primers chosen from the group comprising SEQ JD N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18, the DNA contained in the sample having been, where appropriate, made accessible to the hybridization beforehand, b) amplification ofthe DNA ofthe mycobacterium, c) visualization ofthe amplification ofthe DNA fragments. 2. A kit for the detection and identification of Mycobacterium tuberculosis excepted Mycobacterium tuberculosis strains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a biological sample, comprising the following elements : a) at least one pair of primers selected among nucleic acids according to any of claims 1 to 14, 17 and 18, and more preferably selected among the primers chosen from the group comprising SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18, b) the reagents necessary to carry out a DNA amplification reaction, c) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
43. A method for the in vitro detection of antibodies directed against Mycobacterium tuberculosis excepted Mycobacterium tuberculosis sfrains having the sequence CTG at codon 463 of gene katG and having no or very few IS6110 sequences inserted in their genome, in a biological sample, comprising the following steps : a) bringing the biological sample into contact with at least one product as defined in claim 31, b) detecting the antigen-antibody complex formed.
44. Use of TbDl deletion as a genetic marker for the differentiation of Mycobacterium strains of Mycobacterium complex.
45. Use of mmpL6551 polymorphism as a genetic marker for the differentiation of Mycobacterium sfrains of Mycobacterium complex.
46. Use of the genetic marker according to claim 44 in association with at least one genetic markers selected among RDl, RD2, RD3, RD4, RL>5, RD6, RD7, RD8, RD9, RD10, RD11, RD13, RD14, RvDl, RvD2, RvD3, RvD4, RvD5, katG463, gyrA95, oxyR'285, pncA57, mmpL6551, the specific insertion element of M canettii for the differentiation of Mycobacterium sfrains of Mycobacterium complex.
47. An in vitro method for the detection and identification of Mycobacteria from the Mycobacterium complex in a biological sample, comprising the following steps : c) analysis for the presence or the absence of a nucleic acid fragment of a sequence according to claim 6, 7 or 8, and d) analysis of at least one additional genetic marker selected among RDl, RD2, RD3, RD4, RD5, RD6, RD7, RDS, RD9, RD10, RD11, RD13, RD14, RvDl, RvD2, RvD3, RvD4, RvD5, katG463, gyrA95, oxyR'285, pncA57, mmpL6551, the specific insertion element of M canettii.
48. The in vitro method of claim 47 wherein two additional markers are used, preferably RD4 and RD9.
49. The in vitro method of claim 47 wherein three additional markers are used, preferably RD4, RD9 and RD12.
50. The method according to claim 47 wherein the analysis is performed by a technique selected among sequence hybridization, nucleic acid amplification, antigen-antibody complex.
51. A kit for the detection and identification of Mycobacteria from the Mycobacterium complex in a biological sample comprising the following elements : a) at least one pair of primers selected among nucleic acids according to any of claims 1 to 14, 17 and 18, and more preferably selected among the primers chosen from the group comprising SEQ ID N°13, SEQ ID N°14, SEQ ID N°15,
SEQ ID N016, SEQ ID °17, SEQ ID N°18, b) at least one pair of primers specific ofthe genetic markers selected among RDl, RD2, RD3, RD4, RD5, RD6, RD7, RD8, RD9, RD10, RD11, RD13, RD14, RvDl, RvD2, RvD3, RvD4, RvD5, katG463, gyrA95, oxyR'285, pncA57, mmpL6551, the specific insertion element of M. canettii c) the reagents necessary to carry out a DNA amplification reaction, d) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
52. A kit according to claim 51 comprising the following elements : a) at least one pair of primers selected among nucleic acids according to any of claims 1 to 14, 17 and 18, and more preferably selected among the primers chosen from the group comprising SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N016, SEQ ID N017, SEQ ID N°18, b) one pair of primers specific ofthe genetic marker RD4, c) one pair of primers specific ofthe genetic marker RD9, d) the reagents necessary to carry out a DNA amplification reaction, e) optionally, the necessary components which make it possible to verify or compare the sequence and/or the size ofthe amplified fragment.
53. An immunogenic composition, characterized in that it comprises the polypeptide of sequence SEQ ID N°22.
54. A vaccine, characterized in that it comprises the polypeptide of sequence SEQ ID N°22 in combination with a pharmaceutically compatible vehicle and, where appropriate, one or more appropriate immunity adjuvants.
55. Use of the genetic marker according to claim 45 in association with at least one genetic markers selected among RDl, RD2, RD3, RD4, RD5, RD6, RD7, RD8, RD9, RDIO, RD11, RD13, RDM, RvDl, RvD2, RvD3, RvD4, RvD5, TbDl, katG463, gyrA95, oxyR'285, pncA57, the specific insertion element of M. canettii for the differentiation of Mycobacterium sfrains of Mycobacterium complex.
56. A nucleic acid specifically present in strains of M canettii and absent from all other members ofthe Mycobacterium complex and having the sequence from position 399 to position 2378 of SEQ ID N° 19.
57. Use of the nucleic acid according to claim 53 as a genetic marker for the differentiation of Mycobacterium strains of Mycobacterium complex.
58. A reagent for the identification of a Mycobacterium infection comprising at least polynucleotide sequences capable to hybridize under stringent conditions with at least 8 to 20 nucleotides ofthe RDl, RD4, RD9 and TbDl genetic markers.
59. A reagent for the identification of a Mycobacterium infection comprising at least one polypeptide encoded by each of the RDl, RD4, RD9 and TbDl genetic markers capable to react with an antibody or an immune serum raised against the same immunogenic molecules or fragments thereof.
PCT/IB2003/000986 2002-02-25 2003-02-25 Seequences specifically deleted mycobacterium tuberculosis genome and their use in diagnostics and as vaccines WO2003070981A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP03706832A EP1478777B1 (en) 2002-02-25 2003-02-25 Genetic marker for diffentiating mycobacteria
DE60322674T DE60322674D1 (en) 2002-02-25 2003-02-25 Genetic marker for the differentiation of mycobacteria
AU2003208539A AU2003208539B2 (en) 2002-02-25 2003-02-25 Seequences specifically deleted mycobacterium tuberculosis genome and their use in diagnostics and as vaccines
US10/505,405 US7977047B2 (en) 2002-02-25 2003-02-25 Delete sequence in M. tuberculosis, method for detecting mycobacteria using these sequences and vaccines
JP2003569872A JP4738740B2 (en) 2002-02-25 2003-02-25 M.M. TUBERCULOSIS deletion sequences, methods for detecting mycobacteria using these sequences, and vaccines
CA2477195A CA2477195C (en) 2002-02-25 2003-02-25 Deleted sequence in m. tuberculosis, method for detecting mycobacteria using these sequences and vaccines

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP02290458A EP1338657B9 (en) 2002-02-25 2002-02-25 Sequences specifcally deleted from Mycobacterium tuberculosis genome and their use in diagnosistics and as vaccines
EP02290458.5 2002-02-25

Publications (3)

Publication Number Publication Date
WO2003070981A2 true WO2003070981A2 (en) 2003-08-28
WO2003070981A3 WO2003070981A3 (en) 2003-12-04
WO2003070981A8 WO2003070981A8 (en) 2004-10-07

Family

ID=27635905

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2003/000986 WO2003070981A2 (en) 2002-02-25 2003-02-25 Seequences specifically deleted mycobacterium tuberculosis genome and their use in diagnostics and as vaccines

Country Status (12)

Country Link
US (1) US7977047B2 (en)
EP (2) EP1338657B9 (en)
JP (1) JP4738740B2 (en)
AT (2) ATE360097T1 (en)
AU (1) AU2003208539B2 (en)
CA (1) CA2477195C (en)
CY (1) CY1106584T1 (en)
DE (2) DE60219589T2 (en)
DK (1) DK1338657T3 (en)
ES (1) ES2286212T3 (en)
PT (1) PT1338657E (en)
WO (1) WO2003070981A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005090988A2 (en) * 2004-03-19 2005-09-29 Isis Innovation Limited Mycobacterium tuberculosis infection diagnostic test
EP1746156A1 (en) * 2004-04-26 2007-01-24 Wako Pure Chemical Industries, Ltd. Probe and primer for tubercle bacillus detection, and method of detecting human tubercle bacillus therewith
WO2017156436A1 (en) * 2016-03-11 2017-09-14 S&R Pharmaceuticals, Llc Assays and methods for detecting mycobacterial infections
RU2697502C2 (en) * 2014-07-24 2019-08-14 Эбботт Молекьюлар Инк. Compositions and methods for detecting and analyzing micobacterium tuberculosis

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE60236573D1 (en) 2002-04-05 2010-07-15 Pasteur Institut Identification of the virulence-associated regions RD1 and RD5, which allows the development of improved vaccines with M. bovis BCG and M. microti
WO2005118884A1 (en) * 2004-05-28 2005-12-15 The United States Of America As Represented By The Secretary Of The Navy A method for the rapid diagnosis of infectious disease by detection and quantitation of microorganism induced cytokines
EP1922415B1 (en) * 2005-09-05 2013-12-25 Bio-Rad Innovations Use of both rd9 and is6110 as nucleic acid targets for the diagnosis of tuberculosis, and provision of multiplex-compliant is6110 and rd9 targets
BRPI0604958B1 (en) * 2006-11-23 2022-05-17 Fundação Oswaldo Cruz Kit for distinguishing mycobacterium tuberculosis, m. bovis, m. bovis bcg in a sample, and method to distinguish mycobacterium tuberculosis, m. bovis, m. bovis bcg
WO2010132112A2 (en) * 2009-05-14 2010-11-18 Wisconsin Alumni Research Foundation Immunogenic compositions against tuberculosis
KR101498705B1 (en) * 2010-07-02 2015-03-06 (주)바이오니아 Primer and probe for diagnosing tuberculosis, a kit comprising the same and a tu-berculosis-diagnosing method using the kit
JP2013055947A (en) * 2012-10-26 2013-03-28 Bio-Rad Innovations Use of both rd9 and is6110 as nucleic acid targets for diagnosis of tuberculosis, and provision of multiplex-compliant is6110 and rd9 targets
CN106868113A (en) * 2017-01-24 2017-06-20 中国疾病预防控制中心传染病预防控制所 SNP marker and its application for identifying mycobacterium bovis
WO2022235518A1 (en) * 2021-05-03 2022-11-10 The Board Of Trustees Of The Leland Stanford Junior University Method for diagnosing active tuberculosis and progression to active tuberculosis
KR20220164261A (en) 2021-06-04 2022-12-13 (주)아모레퍼시픽 Composition for enhancing proteolytic enzyme stability, freeze-dried composition containing the same, cosmetic kit containing the freeze-dried composition, and method for manufacturing the freeze-dried composition

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000055362A1 (en) * 1999-03-16 2000-09-21 Institut Pasteur Deleted sequences in m. bovis bcg/m. bovis or m. tuberculosis, method for detecting mycobacteria using said sequences and vaccines
US6291190B1 (en) * 1998-08-25 2001-09-18 The Board Of Trustees Of The Leland Stanford Junior University Molecular differences between species of the M. tuberculosis complex

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6582908B2 (en) * 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
US5714593A (en) * 1995-02-01 1998-02-03 Institut Pasteur DNA from mycobacterium tuberculosis which codes for a 45/47 kilodalton protein
AU5559300A (en) * 1999-07-06 2001-01-22 Institut Pasteur Method of making and identifying attenuated microorganisms, compositions utilizing the sequences responsible for attenuation, and preparations containing attenuated microorganisms

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6291190B1 (en) * 1998-08-25 2001-09-18 The Board Of Trustees Of The Leland Stanford Junior University Molecular differences between species of the M. tuberculosis complex
WO2000055362A1 (en) * 1999-03-16 2000-09-21 Institut Pasteur Deleted sequences in m. bovis bcg/m. bovis or m. tuberculosis, method for detecting mycobacteria using said sequences and vaccines

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BROSCH R ET AL: "A new evolutionary scenario for the Mycobacterium tuberculosis complex." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 99, no. 6, 19 March 2002 (2002-03-19), pages 3684-3689, XP002206251 http://www.pnas.org March 19, 2002 ISSN: 0027-8424 -& DATABASE GENBANK [Online] NCBI; 16 March 2002 (2002-03-16) BROSCH R ET AL.: "Mycobacterium tuberculosis mmpS6 gene and mmpL6 gene" retrieved from HTTP://WWW.NCBI.NLM.NIH.GOV, accession no. AJ426486 XP002251350 *
COLE S T ET AL: "Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence" NATURE, MACMILLAN JOURNALS LTD. LONDON, GB, vol. 393, 11 June 1998 (1998-06-11), pages 537-544, XP002087941 ISSN: 0028-0836 & DATABASE GENBANK [Online] NCBI; 7 September 2001 (2001-09-07) COLE S.T. ET AL.: "Mycobacterium tuberculosis H37Rv complete genome." retrieved from HTTP://WWW.NCBI.NLM.NIH.GOV Database accession no. NC_000962 *
DATABASE GENBANK [Online] NCBI; 3 August 2001 (2001-08-03) COLE S.T. ET AL.: "Mycobacterium tuberculosis H37Rv complete genome; segment 69/162" retrieved from HTTP://WWW.NCBI.NLM.NIH.GOV Database accession no. Z74020 XP002206252 *
DATABASE TAXONOMY BROWSER [Online] NCBI; Host: http://www.ncbi.nih.gov, "Mycobacterium tuberculosis complex" XP002206354 *
GORDON S V ET AL: "IDENTIFICATION OF VARIABLE REGIONS IN THE GENOMES OF TUBERCLE BACILI USING BACTERIAL ARTIFICIAL CHROMOSOME ARRAYS" MOLECULAR MICROBIOLOGY, BLACKWELL SCIENTIFIC, OXFORD, GB, vol. 32, no. 3, May 1999 (1999-05), pages 643-655, XP000933429 ISSN: 0950-382X cited in the application *
MAHAIRAS G G ET AL: "MOLECULAR ANALYSIS OF GENETIC DIFFERENCES BETWEEN MYCOBACTERIUM BOVIS BCG AND VIRULENT M. BOVIS" JOURNAL OF BACTERIOLOGY, WASHINGTON, DC, US, vol. 178, no. 5, 1 March 1996 (1996-03-01), pages 1274-1282, XP000647583 ISSN: 0021-9193 cited in the application *
SREEVATSAN SRINAND ET AL: "Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 94, no. 18, 1997, pages 9869-9874, XP002206250 1997 ISSN: 0027-8424 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005090988A2 (en) * 2004-03-19 2005-09-29 Isis Innovation Limited Mycobacterium tuberculosis infection diagnostic test
WO2005090988A3 (en) * 2004-03-19 2006-02-02 Isis Innovation Mycobacterium tuberculosis infection diagnostic test
US8105797B2 (en) 2004-03-19 2012-01-31 Ajit Lalvani Diagnostic test
EP1746156A1 (en) * 2004-04-26 2007-01-24 Wako Pure Chemical Industries, Ltd. Probe and primer for tubercle bacillus detection, and method of detecting human tubercle bacillus therewith
EP1746156A4 (en) * 2004-04-26 2008-08-20 Wako Pure Chem Ind Ltd Probe and primer for tubercle bacillus detection, and method of detecting human tubercle bacillus therewith
EP2256218A1 (en) * 2004-04-26 2010-12-01 Wako Pure Chemical Industries, Ltd. Probe and primer for tubercle bacillus detection, and method of detecting human tubercle bacillus therewith
US8044184B2 (en) 2004-04-26 2011-10-25 Wako Pure Chemical Industries, Ltd. Probe and primer for tubercle bacillus detection, and method of detecting human tubercle bacillus therewith
US8628926B2 (en) 2004-04-26 2014-01-14 Wako Pure Chemical Industries, Ltd. Probe and primer for tubercle bacillus detection, and method of detecting human tubercle bacillus therewith
RU2697502C2 (en) * 2014-07-24 2019-08-14 Эбботт Молекьюлар Инк. Compositions and methods for detecting and analyzing micobacterium tuberculosis
WO2017156436A1 (en) * 2016-03-11 2017-09-14 S&R Pharmaceuticals, Llc Assays and methods for detecting mycobacterial infections
US10677797B2 (en) 2016-03-11 2020-06-09 S&R Pharmaceuticals, Llc Assays and methods for detecting mycobacterial infections

Also Published As

Publication number Publication date
AU2003208539A1 (en) 2003-09-09
EP1338657B9 (en) 2007-10-10
ATE403752T1 (en) 2008-08-15
US20060127897A1 (en) 2006-06-15
PT1338657E (en) 2007-06-21
DE60219589T2 (en) 2008-02-14
CA2477195A1 (en) 2003-08-28
EP1338657A1 (en) 2003-08-27
DE60322674D1 (en) 2008-09-18
EP1478777A2 (en) 2004-11-24
EP1338657B1 (en) 2007-04-18
CA2477195C (en) 2015-01-06
AU2003208539B2 (en) 2008-11-20
WO2003070981A8 (en) 2004-10-07
JP4738740B2 (en) 2011-08-03
WO2003070981A3 (en) 2003-12-04
DK1338657T3 (en) 2007-07-30
DE60219589D1 (en) 2007-05-31
CY1106584T1 (en) 2012-01-25
EP1478777B1 (en) 2008-08-06
JP2005518203A (en) 2005-06-23
ES2286212T3 (en) 2007-12-01
US7977047B2 (en) 2011-07-12
ATE360097T1 (en) 2007-05-15

Similar Documents

Publication Publication Date Title
Hance et al. Detection and identification of mycobacteria by amplification of mycobacterial DNA
Blazquez et al. Genetic characterization of multidrug-resistant Mycobacterium bovis strains from a hospital outbreak involving human immunodeficiency virus-positive patients
EP1478777B1 (en) Genetic marker for diffentiating mycobacteria
PT1108060E (en) Molecular differences between species of the m. tuberculosis complex
JP2003501023A (en) Oligonucleotides for identification of mycobacterial species
WO2003031654A1 (en) Microarray comprising probes for mycobacteria species genotyping, m. tuberculosis strain differenciation, and antibiotic-resistant strain detection
Thoreson et al. Development of a PCR-based technique for detection of Helicobacter pylori
US20080014588A1 (en) Compositions and methods for detecting multidrug resistant strains of M. tuberculosis having mutations in genes of the mutT family
US9011878B2 (en) Vaccine strains of Brachyspira hyodysenteriae
JPH0343087A (en) Hybridization probe of dna for identification of genus mycobacterium
US20040110129A1 (en) Multiplex hybridization system for identification of pathogenic mycobacterium and method of use
AU623236B2 (en) Probes, kits and methods for the detection and differentiation of mycobacteria
US7601822B2 (en) Molecular identification of bacteria of genus Streptococcus and related genera
US5851761A (en) Probes, kits and methods for the detection and differentiation of mycobacteria
JP2005198657A (en) Probe hp-34 for detecting helicobactoer pylori
US5776692A (en) Mycobacterial genus-specific DNA probe and its expressed product
Koivula et al. Genetic diversity in clinical isolates of Mycobacterium avium complex from Guinea-Bissau, West Africa
Clarke et al. Identification and Characterisation of Nontuberculous Mycobacteria that may Impede the Diagnosis of Bovine Tuberculosis in African Buffaloes (Syncerus caffer), South Africa
Fonteyne et al. Characterization of Mycobacterium avium complex related mycobacteria isolated from an African environment and patients with AIDS
ZHANG et al. One dose of MenC-T conjugate vaccine in infancy produces higher mucosal IgG and IgA responses than 2 or 3 doses and optimal mucosal booster responses following polysaccharide vaccine at 13 months
Hirawati further: I lepr Vol. reuse) 2007
Woolford Use of Polymerase Chain Reaction for Detection of Mycobacteria
JP2005192571A (en) Probe hp-60 for detecting helicobacter pylori
JP2005211073A (en) Probe hp-66 for detection of helicobacter pylori

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2477195

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2003208539

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2003569872

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2003706832

Country of ref document: EP

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: IN PCT GAZETTE 35/2003 UNDER (72, 75) THE ADDRESS OF "COLE, STEWARD AND GARNIER, THIERRY" SHOULD READ "C/O INSTITUT PASTEUR, UNITé DE GéNéTIQUE MOLéCULAIRE BACTéRIENNE, 25-28, RUE DU DOCTEUR ROUX, 75724 PARIS CEDEX 15 (FR)"

WWP Wipo information: published in national office

Ref document number: 2003706832

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2006127897

Country of ref document: US

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 10505405

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10505405

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 2003706832

Country of ref document: EP